Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
SECRETED AND TRANSMEMBRANE POLYPEPTIDES AND NUCLEIC ACIDS ENCODING THE
SAME
FIELD OF THE INVENTION
The present invention relates generally to the identification and isolation of
novel DNA and to the
recombinant production of novel polypeptides.
BACKGROUND OF THE INVENTION
Extracellular proteins play important roles in, among other things, the
formation, differentiation and
maintenance of multicelIular organisms. The fate of many individual cells,
e.g., proliferation, migration,
differentiation, or interaction with other cells, is typically governed by
information received from other cells
and/or the immediate environment. This information is often transmitted by
secreted polypeptides (for instance,
mitogenic factors, survival factors, cytotoxic factors,
differentiationfactors, neuropeptides, and hormones) which
are, in turn, received and interpreted by diverse cell receptors or membrane-
bound proteins. These secreted
polypeptides or signaling molecules normally pass through the cellular
secretory pathway to reach their site of
action in the extracellular environment.
Secreted proteins have various industrial applications, including as
pharmaceuticals, diagnostics,
biosensors and bioreactors. Most protein drugs available at present, such as
thrombolytic agents, interferons,
interleukins, erythropoietins, colony stimulating factors, and various other
cytokines, are secretory proteins.
Their receptors, which are membrane proteins, also have potential as
therapeutic or diagnostic agents. Efforts
are being undertaken by both industry and academia to identify new, native
secreted proteins. Many efforts are
focused on the screening of mammalian recombinant DNA libraries to identify
the coding sequences for novel
secreted proteins. Examples of screening methods and techniques are described
in the literature [see, for
example, Klein et al., Proc. Natl. Acad. Sci. 93:710$-7113 (1996); U.S. Patent
No. 5,536,637)].
Membrane-bound proteins and receptors can play important roles in, among other
things, the formation,
differentiation and maintenance of multicellular organisms. The fate of many
individual cells, e.g. , proliferation,
migration, differentiation, or interaction with other cells, is typically
governed by information received from
other cells and/or the immediate environment. This information is often
transmitted by secreted polypeptides
(for instance, mitogenic factors, survival factors, cytotoxic factors,
differentiation factors, neuropeptides, and
hormones) which are, in turn, received and interpreted by diverse cell
receptors or membrane-bound proteins.
Such membrane-bound proteins and cell receptors include, but are not limited
to, cytokine receptors, receptor
kinases, receptor phosphatases, receptors involved in cell-cell interactions,
and cellular adhesin molecules like
selectins and integrins. For instance, transduction of signals that regulate
cell growth and differentiation is
regulated in part by phosphorylation of various cellular proteins. Protein
tyrosine kinases, enzymes that catalyze
that process, can also act as growth factor receptors. Examples include
fibroblast growth factor receptor and
nerve growth factor receptor.
1
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Membrane-bound proteins and receptor molecules have various industrial
applications, including as
pharmaceutical and diagnostic agents. Receptor immunoadhesins, for instance,
can be employed as therapeutic
agents to block receptor-ligand interactions. The membrane-bound proteins can
also be employed for screening
of potential peptide or small molecule inhibitors of the relevant
receptor/ligand interaction.
Efforts are being undertaken by both industry and academia to identify new,
native receptor or
membrane-bound proteins. Many efforts are focused on the screening of
mammalian recombinant DNA libraries
to identify the coding sequences for novel receptor or membrane-bound
proteins.
1. PR0211 and PR0217
Epidermal growth factor (EGF) is a conventional mitogenic factor that
stimulates the proliferation of
various types of cells including epithelial cells and fibroblasts. EGF binds
to and activates the EGF receptor
(EGFR), which initiates intracellular signaling and subsequent effects. The
EGFR is expressed in neurons of
the cerebral cortex, cerebellum, and hippocampus in addition to other regions
of the central nervous system
(CNS). In addition, EGF is also expressed in various regions of the CNS.
Therefore, EGF acts not only on
mitotic cells, but also on postmitotic neurons. In fact, many studies have
indicated that EGF has neurotrophic
or neuromodulatory effects on various types of neurons in the CNS. For
example, EGF acts directly on cultured
cerebral cortical and cerebellar neurons, enhancing neurite outgrowth and
survival. On the other hand, EGF
also acts on other cell types, including septal cholinergic and mesencephalic
dopaminergic neurons, indirectly
through glial cells. Evidence of the effects of EGF on neurons in the CNS is
accumulating, but the mechanisms
of action remain essentially unknown. EGF-induced signaling in mitotic cells
is better understood than in
postmitotic neurons. Studies of cloned pheochromocytoma PC 12 cells and
cultured cerebral cortical neurons
have suggested that the EGF-induced neurotrophic actions are mediated by
sustained activation of the EGFR and
mitogen-activated protein kinase (MAPK) in response to EGF. The sustained
intracellular signaling correlates
with the decreased rate of EGFR down-regulation, which might determine the
response of neuronal cells to EGF.
It is likely that EGF is a multi-potent growth factor that acts upon various
types of cells including mitotic cells
and postmitotic neurons.
EGF is produced by the salivary and Brunner's glands of the gastrointestinal
system, kidney, pancreas,
thyroid gland, pituitary gland, and the nervous system, and is found in body
fluids such as saliva, blood,
cerebrospinal fluid (CSF), urine, amniotic fluid, prostatic fluid, pancreatic
juice, and breast milk, Plata-Salaman,
Peptides 12: 653-663 ( 1991 ).
EGF is mediated by its membrane specific receptor, which contains an intrinsic
tyrosine kinase.
Stoscheck et al., J. Cell Biochem. 31: 135-152 (1986). EGF is believed to
function by binding to the
extracellular portion of its receptor which induces a transmembrane signal
that activates the intrinsic tyrosine
kinase.
Purification and sequence analysis of the EGF-like domain has revealed the
presence of six conserved
cysteine residues which cross-bind to create three peptide loops, Savage et
al., J. Biol. Chem. 248: 7669-7672
(1979). It is now generally known that several other peptides can react with
the EGF receptor which share the
same generalized motif X~CX~CX4,SCX,oCXCXSGX,CX~, where X represents any non-
cysteine amino acid, and
2
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
n is a variable repeat number. Non isolated peptides having this motif include
TGF-a, amphiregulin,
schwannoma-derived growth factor (SDGF), heparin-binding EGF-like growth
factors and certain virally
encoded peptides (e.g., Vaccinia virus, Reisner, Nature 313: 801-803 (1985),
Shope fbroma virus, Chang et
al., Mol Cell Biol. 7: 535-540 (1987), Molluscum contagiosum, Porter and
Archard, J. Gen. Virol. 68: 673-682
(1987), and Myxoma virus, Upton et al., J. Virol. 61: 1271-1275 (1987),
Prigent and- L.emoine, Prog. Growth
Factor Res. 4: 1-24 (1992).
EGF-like domains are not confined to growth factors but have been observed in
a variety of cell-surface
and extracellular proteins which have interesting properties in cell adhesion,
protein-protein interaction and
development, Laurence and Gusterson, Tumor Biol. 11: 229-261 (1990). These
proteins include blood
coagulation factors (factors VI, IX, X, XII, protein C, protein S, protein Z,
tissue plasminogen activator,
urokinase), extracellular matrix components (laminin, cytotactin, entactin),
cell surface receptors (LDL receptor,
thrombomodulin receptor) and immunity-related proteins (complement Clr,
uromodulin).
Even more interesting, the general structure pattern of EGF-like precursors is
preserved through lower
organisms as well as in mammalian cells. A number of genes with developmental
significance have been
identified in invertebrates with EGF-like repeats. For example, the notch gene
of Drosophila encodes 36
tandemly arranged 40 amino acid repeats which show homology to EGF, Wharton et
al., Cell 43: 557-581
( 1985). Hydropathy plots indicate a putative membrane spanning domain, with
the EGF-related sequences being
located on the extracellular side of the membrane. Other homeotic genes with
EGF-like repeats include Delta,
95F and SZD which were identified using probes based on Notch, and the
nematode gene Lin-12 which encodes
a putative receptor for a developmental signal transmitted between two
specified cells.
Specifically, EGF has been shown to have potential in the preservation and
maintenance of
gastrointestinal mucosa and the repair of acute and chronic mucosal lesions,
Konturek et al., Eur. J.
Gastroenterol Hepatol. 7 (10), 933-37 (1995), including the treatment of
necrotizing enterocolitis, Zollinger-
Ellison syndrome, gastrointestinal ulceration gastrointestinal ulcerations and
congenital microvillus atrophy,
Guglietta and Sullivan, Eur. J. Gastroenterol Hepatol, 7(10), 945-50 (1995).
Additionally, EGF has been
implicated in hair follicle differentiation; du Cros, J. Invest. Dermatol. 101
(1 Suppl.), 106S-113S (1993),
Hillier, Clin. Endocrinol. 33(4), 427-28 (1990); kidney function, Hamm et al.,
Semin. Nephrol. 13 (1): 109-15
(1993), Harris, Am. J. Kidney Dis. 17(6): 627-30 (1991); tear fluid, van
Setten et al., Int. Ophthalmol 15(6);
359-62 (1991); vitamin K mediated blood coagulation, Stenflo et al., Blood
78(7): 1637-51 (1991). EGF is also
implicated various skin disease characterized by abnormal keratinocyte
differentiation, e.g., psoriasis, epithelial
cancers such as squamous cell carcinomas of the lung, epidermoid carcinoma of
the vulva and gliomas. King
et al., Am. J. Med. Sci. 296: 154-158 (1988).
Of great interest is mounting evidence that genetic alterations in growth
factors signaling pathways are
closely linked to developmental abnormalities and to chronic diseases
including cancer. Aaronson, Science 254:
1146-1153 (1991). For example, c-erb-2 (also known as HER-2), a proto-oncogene
with close structural
similarity to EGF receptor protein, is overexpressed in human breast cancer.
King et al. , Science 229: 974-976
(1985); Gullick, Hormones and their actions, Cooke et al., eds, Amsterdam,
Elsevier, pp 349-360 (1986}.
3
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
We herein describe the identification and characterization of novel
polypeptides having homology to
EGF, wherein those polypeptides are herein designated PR0211 and PR0217.
2. PR0230
Nephritis is a condition characterized by inflammation of the kidney affecting
the structure and normal
function of the kidney. This condition can be chronic or acute and is
generally caused by infection, degenerative
process or vascular disease. In all cases, early detection is desirable so
that the patient with nephritis can begin
treatment of the condition.
An approach to detecting nephritis is to determine the antigens associated
with nephritis and antibodies
thereto. In rabbit, a tubulointerstitial nephritis antigen (TIN-ag) has been
reported in Nelson, T. R., et al., J_
Biol. Chem., 270(27):16265-70 (July 1995) (GENBANK/U24270). This study reports
that the rabbit TIN-ag
is a basement membrane glycoprotein having a predicted amino acid sequence
which has a carboxyl-terminal
region exhibiting 30% homology with human preprocathepsin B, a member of the
cystein proteinase family of
proteins. It is also reported that the rabbit TIN-ag has a domain in the amino-
terminal region containing an
epidermal growth factor-like motif that shares homology with laminin A and S
chains, alpha 1 chain of type I
collagen, von Willebrand's factor and mucin, indicating structural and
functional similarities. Studies have also
been conducted in mice. However, it is desirable to identify
tubulointerstitial nephritis antigens in humans to
aid in the development of early detection methods and treatment of nephritis.
Proteins which have homology to tubulointerstitial nephritis antigens are of
particular interest to the
medical and industrial communities. Often, proteins having homology to each
other have similar function. It
is also of interest when proteins having homology do not have similar
functions, indicating that certain structural
motifs identify information other than function, such as locality of function.
We herein describe the identification
and characterization of a novel polypeptide, designated hgerein as PR0230,
which has homology to
tubulointerstitial nephritis antigens.
3. PR0232
Stem cells are undifferentiated cells capable of (a) proliferation, (b) self
maintenance, (c) the production
of a large number of differentiated functional progeny, (d) regeneration of
tissue after injury and/or (e) a
flexibility in the use of these options. Stem cells often express cell surface
antigens which are capable of serving
as cell specific markers that can be exploited to identify stem cells, thereby
providing a means for identifying
and isolating specific stem cell populations.
Having possession of different stem cell populations will allow for a number
of important applications.
For example, possessing a specific stem cell population will allow for the
identification of growth factors and
other proteins which are involved in their proliferation and differentiation.
In addition, there may be as yet
undiscovered proteins which are associated with (1) the early steps of
dedication of the stem cell to a particular
lineage, (2) prevention of such dedication, and (3) negative control of stem
cell proliferation, all of which may
be identified if one has possession of the stem cell population. Moreover,
stem cells are important and ideal
targets for gene therapy where the inserted genes promote the health of the
individual into whom the stem cells
4
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
are transplanted. Finally, stem cells may play important roles in
transplantation of organs or tissues, for
example liver regeneration and skin grafting.
Given the importance of stem cells in various different applications, efforts
are currently being
undertaken by both industry and academia to identify new, native stem cell
antigen proteins so as to provide
specific cell surface markers for identifying stem cell populations as well as
for providing insight into the
functional roles played by stem cell antigens in cell proliferation and
differentiation. We herein describe the
identification and characterization of novel polypeptides having homology to a
stem cell antigen, wherein those
polypeptides are herein designated as PR0232 polypeptides..
4. PR0187
Growth factors are molecular signals or mediators that enhance cell growth or
proliferation, alone or
in concert, by binding to specific cell surface receptors. However, there are
other cellular reactions than only
growth upon expression to growth factors. As a result, growth factors are
better characterized as multifunctional
and potent cellular regulators. Their biological effects include
proliferation, chemotaxis and stimulation of
extracellular matrix production. Growth factors can have both stimulatory and
inhibitory effects. For example,
transforming growth factor (TGF-(3) is highly pleiotropic and can stimulate
proliferation in some cells, especially
connective tissue, while being a potent inhibitor of proliferation in others,
such as lymphocytes and epithelial
cells.
The physiological effect of growth stimulation or inhibition by growth factors
depends upon the state
of development and differentiation of the target tissue. The mechanism of
local cellular regulation by classical
endocrine molecules involves comprehends autocrine (same cell), juxtacrine
(neighbor cell), and paracrine
(adjacent cells) pathways. Peptide growth factors are elements of a complex
biological language, providing the
basis for intercellular communication. They permit cells to convey information
between each other, mediate
interaction between cells and change gene expression. The effect of these
multifunctional and pluripotent factors
is dependent on the presence or absence of other peptides.
FGF-8 is a member of the fibroblast growth factors (FGFs) which are a family
of heparin-binding,
potent mitogens for both normal diploid fibroblasts and established cell
lines, Gospodarowicz et al. ( 1984), Proc.
Narl. Acad. Sci. USA 81:6963. The FGF family comprises acidic FGF (FGF-1),
basic FGF (FGF-2), INT-2
(FGF-3), K-FGF/HST (FGF-4), FGF-5, FGF-6, KGF (FGF-7), AIGF (FGF-8) among
others. All FGFs have
two conserved cysteine residues and share 30-50% sequence homology at the
amino acid level. These factors
are mitogenic for a wide variety of normal diploid mesoderm-derived and neural
crest-derived cells, including
granulosa cells, adrenal cortical cells, chondrocytes, myoblasts, corneal and
vascular endothelial cells (bovine
or human), vascular smooth muscle cells, lens, retina and prostatic epithelial
cells, oligodendrocytes, astrocytes,
chrondocytes, myoblasts and osteoblasts.
Fibroblast growth factors can also stimulate a large number of cell types in a
non-mitogenic manner.
These activities include promotion of cell migration into wound area
(chemotaxis), initiation of new blood vessel
formulation (angiogenesis), modulation of nerve regeneration and survival
(neurotrophism), modulation of
endocrine functions, and stimulation or suppression of specific cellular
protein expression, extracellular matrix
5
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
production and cell survival. Baird & Bohlen, Handbook of Exp. Pharmacol.
95(1): 369-418, Springer, (1990).
These properties provide a basis for using fibroblast growth factors in
therapeutic approaches to accelerate
wound healing, nerve repair, collateral blood vessel formation, and the like.
For example, fibroblast growth
factors have been suggested to minimize myocardium damage in heart disease and
surgery (U.S.P. 4,378,347).
FGF-8, also known as androgen-induced growth factor (AIGF), is a 215 amino
acid protein which
S shares 30-40% sequence homology with the other members of the FGF family.
FGF-8 has been proposed to
be under androgenic regulation and induction in the mouse mammary carcinoma
cell line SC3. Tanaka et al.,
Proc. Natl. Acad. Sci. USA 89: 8928-8932 (1992); Sato et al., J. Steroid
Biochern. Molec. Biol. 47: 91-98
(1993). As a result, FGF-8 may have a local role in the prostate, which is
known to be an androgen-responsive
organ. FGF-8 can also be oncogenic, as it displays transforming activity when
transfected into NIH-3T3
fibroblasts. Kouhara et al., Oncogene 9 455-462 ('1994). While FGF-8 has been
detected in heart, brain, lung,
kidney, testis, prostate and ovary, expression was also detected in the
absence of exogenous androgens. Schmitt
et al., J. Steroid Biochem. Mol. Biol. 57 (3-4): 173-78 (1996).
FGF-8 shares the property with several other FGFs of being expressed at a
variety of stages of marine
embryogenesis, which supports the theory that the various FGFs have multiple
and perhaps coordinated roles
in differentiation and embryogenesis. Moreover, FGF-8 has also been identified
as a protooncogene that
cooperates with Wnt-1 in the process of mammary tumorigenesis (Shackleford et
al., Proc. Natl. Acad. Sci. USA
90, 740-744 (1993); Heikinheimo et al., Mech. Dev. 48: 129-138 (1994)).
In contrast to the other FGFs, FGF-8 exists as three protein isoforms, as a
result of alternative splicing
of the primary transcript. Tanaka et al., supra. Normal adult expression of
FGF-8 is weak and confined to
gonadal tissue, however northern blot analysis has indicated that FGF-8 mRNA
is present from day 10 through
day 12 or marine gestation, which suggests that FGF-8 is important to normal
development. Heikinheimo et
al., Mech Dev. 48(2): 129-38 (1994). Further in situ hybridization assays
between day 8 and 16 of gestation
indicated initial expression in the surface ectoderm of the first bronchial
arches, the frontonasal process, the
forebrain and the midbrain-hindbrain junction. At days 10-12, FGF-8 was
expressed in the surface ectoderm
of the forelimb and hindlimb buds, the nasal its and nasopharynx, the
infundibulum and in the telencephalon,
diencephalon and metencephalon. Expression continues in the developing
hindlimbs through day 13 of gestation,
but is undetectable thereafter. The results suggest that FGF-8 has a unique
temporal and spatial pattern in
embryogenesis and suggests a role for this growth factor in multiple regions
of ectodermal differentiation in the
post-gastrulation embryo.
We herein describe the identification of novel poypeptides having homology to
FGF-8, wherein those
polypeptides are heein designated PR0187 polypeptides.
5. PR0265
Protein-protein interactionsinclude receptor and antigen complexes and
signaling mechanisms. As more
is known about the structural and functional mechanisms underlying protein-
protein interactions, protein-protein
interactions can be more easily manipulated to regulate the particular result
of the protein-protein interaction.
Thus, the underlying mechanisms of protein-protein interactions are of
interest to the scientific and medical
6
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
community.
All proteins containing leucine-rich repeats are thought to be involved in
protein-protein interactions.
Leucine-rich repeats are short sequence motifs present in a number of proteins
with diverse functions and cellular
locations. The crystal structure of ribonuclease inhibitor protein has
revealed that leucine-rich repeats
correspond to beta-alpha structural units. These units are arranged so that
they form a parallel beta-sheet with
one surface exposed to solvent, so that the protein acquires an unusual,
nonglubular shape. These two features
have been indicated as responsible for the protein-binding functions of
proteins containing leucine-rich repeats.
See, Kobe and Deisenhofer, Trends Biochem. Sci. 19(10):415-421 (Oct. 1994).
A study has been reported on leucine-rich proteoglycans which serve as tissue
organizers, orienting and
ordering collagen fibrils during ontogeny and are involved in pathological
processes such as wound healing,
tissue repair, and tumor stroma formation. Iozzo, R. V., Crit. Rev. Biochem.
Mol Biol., 32(2):141-174
(1997). Others studies implicating leucine rich proteins in wound healing and
tissue repair are De La Salle, C.,
et al., Vouv. Rev. Fr. Hematol. (Germany), 37(4):215-222 (1995), reporting
mutations in the leucine rich motif
in a complex associated with the bleeding disorder Bernard-Soulier syndrome
and Chlemetson, K. J., Thromb.
Haemost. (Germany), 74(1):111-116 (July 1995), reporting that platelets have
leucine rich repeats. Another
protein of particular interest which has been reported to have leucine-rich
repeats is the SLIT protein which has
been reported to be useful in treating neuro-degenerative diseases such as
Alzheimer's disease, nerve damage
such as in Parkinson's disease, and for diagnosis of cancer, see,
Artavanistsakonas, S. and Rothberg, J. M.,
W09210518-A1 by Yale University. Other studies reporting on the biological
functions of proteins having
leucine-rich repeats include: Tayar, N., et al., Mol. Cell Endocrinol.,
(Ireland), 125(1-2):65-70 (Dec. 1996)
(gonadotropin receptor involvement); Miura, Y., et al., Nippon Rinsho (Japan),
54(7):1784-1789 (July 1996)
(apoptosis involvement); Harris, P. C., et al., J. Am. Soc. Neahrol.,
6(4):1125-1133 (Oct. 1995) (kidney
disease involvement); and Ruoslahti, E. L, et al., W09110727-A by La Jolla
Cancer Research Foundation
(decorin binding to transforming growth factor-~3 involvement for treatment
for cancer, wound healing and
scarring). Also of particular interest is fibromodulin and its use to prevent
or reduce dermal scarring. A study
of fibromodulin is found in U.S. Patent No. 5,654,270 to Ruoslahti, et al.
Efforts are therefore being undertaken by both industry and academia to
identify new proteins having
leucine rich repeats to better understand protein-protein interactions. Of
particular interest are those proteins
having leucine rich repeats and homology to known proteins having leucine rich
repeats such as fibromodulin,
the SLIT protein and platelet glycoprotein V. Many efforts are focused on the
screening of mammalian
recombinant DNA libraries to identify the coding sequences for novel secreted
and membrane-bound proteins
having leucine rich repeats. We herein describe the identification and
characterization of novel polypeptides
having homology to fibromodulin, herein designated as PR0265 polypeptides.
6. PR0219
Human matrilin-2 polypeptide is a member of the von Willebrand factor type A-
like module
superfamily. von Willebrand factor is a protein which plays an important role
in the maintenence of hemostasis.
More specifically, von Willebrand factor is a protein which is known to
participate in platelet-vessel wall
7
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
interactions at the site of vascular injury via its ability to interact and
form a complex with Factor VIII. The
absence of von Willebrand factor in the blood causes an abnormality with the
blood platelets that prevents platelet
adhesion to the vascular wall at the site of the vascular injury. The result
is the propensity for brusing, nose
bleeds, intestinal bleeding, and the like comprising von Willebrand's disease.
Given the physiological importance of the blood clotting factors, efforts are
currently being undertaken
by both industry and academia to identify new, native proteins which may be
involved in the coagulation process.
We herein describe the identification of a novel full-length polypeptide which
possesses homology to the human
matrilin-2 precursor polypeptide.
7. PR0246
The cell surface protein HCAR is a membrane-bound protein that acts as a
receptor for subgroup C of
the adenoviruses and subgroup B of the coxsackieviruses. Thus, HCAR may
provide a means for mediating
viral infection of cells in that the presence of the HCAR receptor on the
cellular surface provides a binding site
for viral particles, thereby facilitating viral infection.
In light of the physiological importance of membrane-bound proteins and
specficially those which serve
a cell surface receptor for viruses, efforts are currently being undertaken by
both industry and academia to
identify new, native membrane-bound receptor proteins. Many of these efforts
are focused on the screening of
mammalian recombinant DNA libraries to identify the coding sequences for novel
receptor proteins. We herein
describe a novel membrane-bound polypeptide (designated herein as PR0246)
having homology to the cell
surface protein HCAR and to various tumor antigens including A33 and
carcinoembryonic antigen, wherein this
polypeptide may be a novel cell surface virus receptor or tumor antigen.
8. PR0228
There are a number of known seven transmembrane proteins and within this
family is a group which
includes CD97 and EMR1. CD97 is a seven-span transmembrane receptor which has
a cellular ligand, CD55,
DAF. Hamann, et al., J. Exp. Med. (U.S.), 184(3):1189 (1996). Additionally,
CD97 has been reported as
being a dedifferentiation marker in human thyroid carcinomas and as associated
with inflammation. Aust, et al. ,
Cancer Res. (U.S.), 57(9):1798 (1997); Gray, et al., J. Immunol. (U.S.),
157(12):5438 (1996). CD97 has also
been reported as being related to the secretin receptor superfamily, but
unlike known members of that family,
CD97 and EMR1 have extended extracellular regions that possess several EGF
domains at the N-terminus.
Hamann, et al., Genomics, 32(1):144 (1996); Harmann, et al., J. Immunol.,
155(4):1942 (1995). EMR1 is
further described in Lin, et al., Genomics, 41(3):301 (1997) and Baud, et al.,
Genomics, 26(2):334 (1995).
While CD97 and EMR1 appear to be related to the secretin receptors, a known
member of the secretin family
of G protein-coupled receptors includes the alpha-latroxin receptor,
latrophilin, which has been described as
calcium independent and abundant among neuronal tissues. Lelianova, et al., J.
Biol. Chem., 272(34), 21504
(1997); Davletov, et al., J. Biol. Chem. (U.S.), 271(38):23239 (1996). Both
members of the secretin receptor
superfamily and non-members which are related to the secretin receptor
superfamiIy, or CRF and calcitonin
receptors are of interest. In particular, new members of these families,
identified by their homology to known
8
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
proteins, are of interest.
Efforts are being undertaken by both industry and academia to identify new
membrane-bound receptor
proteins, particularly transmembrane proteins with EGF repeats and large N-
terminuses which may belong to
the family of seven-transmembrane proteins of which CD97 and EMRI are members.
We herein describe the
identification and charactization of novel polypeptides having homology to
CD97 and EMRI, designated herein
as PR0228 polypeptides.
9. PR0533
Growth factors are molecular signals or mediators that enhance cell growth or
proliferation, alone or
in concert, by binding to specific cell surface receptors. however, there are
other cellular reactions than only
growth upon expression to growth factors. As a result, growth factors are
better characterized as multifunctional
and potent cellular regulators. Their biological effects include
proliferation, chemotaxis and stimulation of
extracellular matrix production. Growth factors can have both stimulatory and
inhibitory effects. For example,
transforming growth factors (TGF-p) is highly pleiotropic and can stimulate
proliferation in some cells,
especially connective tissues, while being a potent inhibitor of proliferation
in others, such as lymphocytes and
epithelial cells.
The physiological effect of growth stimulation or inhibition by growth factors
depends upon the state
of development and differentiation of the target tissue. The mechanism of
local cellular regulation by classical
endocrine molecules comprehends autocrine (same cell), juxtacrine (neighbor
cell), and paracrine (adjacent cell)
pathways. Peptide growth factors are elements of a complex biological
language, providing the basis for
intercellular communication. They permit cells to convey information between
each other, mediate interaction
between cells and change gene expression. the effect of these multifunctional
and pluripotent factors is
dependent on the presence or absence of other peptides.
Fibroblast growth factors (FGFs) are a family of heparin-binding, potent
mitogens for both normal
diploid fibroblasts and established cell lines, Godpodarowicz, D. et al.
(1984), Proc. Natl. Acad. Sci. USA 81:
6983. the FGF family comprises acidic FGF (FGF-1), basic FGF (FGF-2), INT-2
(FGF-3), K-FGF/HST (FGF-
4), FGF-5, FGF-6, KGF (FGF-7), AIGF (FGF-8) among others. All FGFs have two
conserved cysteine
residues and share 30-SO% sequence homology at the amino acid level. These
factors are mitogenic for a wide
variety of normal diploid mesoderm-derived and neural crest-derived cells,
inducing granulosa cells, adrenal
cortical cells, chrondocytes, myoblasts, corneal and vascular endothelial
cells (bovine or human), vascular
smooth muscle cells, lens, retina and prostatic epithelial cells,
oligodendrocytes, astrocytes, chrondocytes,
myoblasts and osteoblasts.
Fibroblast growth factors can also stimulate a large number of cell types in a
non-mitogenic manner.
These activities include promotion of cell migration into a wound area
(chemotaxis), initiation of new blood
vessel formulation (angiogenesis), modulation of nerve regeneration and
survival (neurotrophism), modulation
of endocrine functions, and stimulation or suppression of specific cellular
protein expression, extracellular matrix
production and cell survival. Baird, A. & Bohlen, P., Handbook of Exp.
Phrmacol. 95(1): 369-418 (1990).
These properties provide a basis for using fibroblast growth factors in
therapeutic approaches to accelerate
9
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
wound healing, nerve repair, collateral blood vessel formation, and the like.
For example, fibroblast growth
factors, have been suggested to minimize myocardium damage in heart disease
and surgery (U.S.P. 4,378,437).
We herein describe the identification and characterization of novel
polypeptides having homology to
FGF, herein designated PR0533 polypeptides.
10. PR0245
Some of the most important proteins involved in the above described regulation
and modulation of
cellular processes are the enzymes which regulate levels of protein
phosphorylation in the cell. For example,
it is known that the transduction of signals that regulate cell growth and
differentiation is regulated at least in part
by phosphorylation and dephosphorylation of various cellular proteins. The
enzymes that catalyze these
processes include the protein kinases, which function to phosphorylate various
cellular proteins, and the protein
phosphatases, which function to remove phosphate residues from various
cellular proteins. The balance of the
level of protein phosphorylation in the cell is thus mediated by the relative
activities of these two types of
enzymes.
Although many protein kinase enzymes have been identified, the physiological
role played by many of
these catalytic proteins has yet to be elucidated. It is well known, however,
that a number of the known protein
kinases function to phosphorylate tyrosine residues in proteins, thereby
leading to a variety of different effects.
Perhaps most importantly, there has been a great deal of interest in the
protein tyrosine kinases since the
discovery that many oncogene products and growth factors possess intrinsic
protein tyrosine kinase activity.
There is, therefore, a desire to identify new members of the protein tyrosine
kinase family.
Given the physiological importance of the protein kinases, efforts are being
undertaken by both industry
and academia to identify new, native kinase proteins. Many of these efforts
are focused on the screening of
mammalian recombinant DNA libraries to identify the coding sequences for novel
kinase proteins. We herein
describe the identification and characterization of novel polypeptides having
homology to tyrosine kinase
proteins, designated herein as PR0245 polypeptides.
11. PR0220. PR0221 and PR0227
Protein-protein interactions include receptor and antigen complexesand
signaling mechanisms. As more
is known about the structural and functional mechanisms underlying protein-
protein interactions, protein-protein
interactions can be more easily manipulated to regulate the particular result
of the protein-protein interaction.
Thus, the underlying mechanisms of protein-protein interactions are of
interest to the scientific and medical
community.
All proteins containing leucine-rich repeats are thought to be involved in
protein-protein interactions.
Leucine-rich repeats are short sequence motifs present in a number of proteins
with diverse functions and cellular
locations. The crystal structure of ribonuclease inhibitor protein has
revealed that leucine-rich repeats
correspond to beta-alpha structural units. These units are arranged so that
they form a parallel beta-sheet with
one surface exposed to solvent, so that the protein acquires an unusual,
nonglubular shape. These two features
have been indicated as responsible for the protein-binding functions of
proteins containing leucine-rich repeats.
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
See, Kobe and Deisenhofer, Trends Biochem. Sci.. 19(10):415-421 (Oct. 1994).
A study has been reported on leucine-rich proteoglycans which serve as tissue
organizers, orienting and
ordering collagen fibrils during ontogeny and are involved in pathological
processes such as wound healing,
tissue repair, and tumor stroma formation. Iozzo, R. V., Crit. Rev. Biochem.
Mol. Biol., 32(2):141-174
(1997). Others studies implicating leucine rich proteins in wound healing and
tissue repair are De La Salle, C.,
et al., Vouv. Rev. Fr. Hematol. (Germany), 37(4):215-222 (1995), reporting
mutations in the leucine rich motif
in a complex associated with the bleeding disorder Bernard-Soulier syndrome
and Chlemetson, K. J., Thromb.
Haemost. (Germany), 74(1):111-116 (July 1995), reporting that platelets have
leucine rich repeats. Another
protein of particular interest which has been reported to have leucine-rich
repeats is the SLIT protein which has
been reported to be useful in treating neuro-degenerative diseases such as
Alzheimer's disease, nerve damage
such as in Parkinson's disease, and for diagnosis'of cancer, see,
Artavanistsakonas, S. and Rothberg, J. M.,
W09210518-A1 by Yale University. Other studies reporting on the biological
functions of proteins having
leucine-rich repeats include: Tayar, N., et al., Mol. Cell Endocrinol.,
(Ireland), 125(1-2):65-70 (Dec. 1996)
(gonadotropin receptor involvement); Miura, Y., et al., Nip~on Rinsho (Japan),
54(7):1784-1789 (July 1996)
(agoptosis involvement); Harris, P. C., et al., J. Am. Soc. Nephrol.,
6(4):1125-1133 (Oct. 1995) (kidney
disease involvement); and Ruoslahti, E. L, et al., W09110727-A by La Jolla
Cancer Research Foundation
(decorin binding to transforming growth factorp involvement for treatment for
cancer, wound healing and
scarring).
Efforts are therefore being undertaken by both industry and academia to
identify new proteins having
leucine rich repeats to better understand protein-protein interactions. Of
particular interest are those proteins
having leucine rich repeats and homology to known proteins having leucine rich
repeats such as the SLIT protein
and platelet glycoprotein V.
12. PR0258
Immunoglobulins are antibody molecules, the proteins that function both as
receptors for antigen on the
B-cell membrane and as the secreted products of the plasma cell. Like all
antibody molecules, immunoglobulins
perform two major functions: they bind specifically to an antigen and they
participate in a limited number of
biological effector functions. Therefore, new members of the Ig superfamily
are always of interest. Molecules
which act as receptors by various viruses and those which act to regulate
immune function are of particular
interest. Also of particular interest are those molecules which have homology
to known Ig family members
which act as virus receptors or regulate immune function. Thus, molecules
having homology to poliovirus
receptors, CRTAM and CD 166 (a ligand for lymphocyte antigen CD6) are of
particular interest.
Extracellular and membrane-bound proteins play important roles in the
formation, differentiation and
maintenance of multicellular organisms. The fate of many individual cells,
e.g., proliferation, migration,
differentiation, or interaction with other cells, is typically governed by
information received from other cells
and/or the immediate environment. This information is often transmitted by
secreted polypeptides (for instance,
mitogenic factors, survival factors, cytotoxic factors,
differentiationfactors, neuropeptides, and hormones) which
are, in turn, received and interpreted by diverse cell receptors or membrane-
bound proteins. These secreted
11
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
polypeptides or signaling molecules normally pass through the cellular
secretory pathway to reach their site of
action in the extracellular environment, usually at a membrane-bound receptor
protein.
We herein describe the identification and characterization of novel
polypeptides having homology to
CRTAM, designated herein as PR0258 polypeptides.
13. PR0266
Protein-protein interactions include receptorand antigencomplexes and
signaling mechanisms. As more
is known about the structural and functional mechanisms underlying protein-
protein interactions, protein-protein
interactions can be more easily manipulated to regulate the particular result
of the protein-protein interaction.
Thus, the underlying mechanisms of protein-protein interactions are of
interest to the scientific and medical
community.
All proteins containing leucine-rich repeats are thought to be involved in
protein-protein interactions.
Leucine-rich repeats are short sequence motifs present in a number of proteins
with diverse functions and cellular
locations. The crystal structure of ribonuclease inhibitor protein has
revealed that leucine-rich repeats
correspond to beta-alpha structural units. These units are arranged so that
they form a parallel beta-sheet with
one surface exposed to solvent, so that the protein acquires an unusual,
nonglobular shape. These two features
have been indicated as responsible for the protein-binding functions of
proteins containing leucine-rich repeats.
See, Kobe and Deisenhofer, Trends Biochem. Sci. 19(10):415-421 (Oct. 1994).
A study has been reported on leucine-rich proteoglycans which serve as tissue
organizers, orienting and
ordering collagen fibrils during ontogeny and are involved in pathological
processes such as wound healing,
tissue repair, and tumor stroma formation. Iozzo, R. V., Crit. Rev. Biochem.
Mol. Biol., 32(2):141-174
(1997). Others studies implicating leucine rich proteins in wound healing and
tissue repair are De La Salle, C.,
et al., Vouv. Rev. Fr. Hematol. (Germany), 37(4):215-222 (1995), reporting
mutations in the leucine rich motif
in a complex associated with the bleeding disorder Bernard-Soulier syndrome
and Chlemetson, K. J., Thromb.
Haemost. (Germany), 74(1):111-116 (July 1995), reporting that platelets have
leucine rich repeats. Another
protein of particular interest which has been reported to have leucine-rich
repeats is the SLIT protein which has
been reported to be useful in treating neuro-degenerative diseases such as
Alzheimer's disease, nerve damage
such as in Parkinson's disease, and for diagnosis of cancer, see,
Artavanistsakonas, S. and Rothberg, J. M.,
W09210518-A1 by Yale University. Other studies reporting on the biological
functions of proteins having
leucine-rich repeats include: Tayar, N., et al., Mol. CeII Endocrinol.,
(Ireland), 125(1-2):65-70 (Dec. 1996)
(gonadotropin receptor involvement); Miura, Y., et al., Nippon Rinsho (Japan),
54(7):1784-1789 (July 1996)
(apoptosis involvement); Harris, P. C., et al., J. Am. Soc. Nephrol.,
6(4):1125-1133 (Oct. 1995) (kidney
disease involvement); and Ruoslahti, E. L, et al., W09110727-A by La Jolla
Cancer Research Foundation
(decorin binding to transforming growth factor(3 involvement for treatment for
cancer, wound healing and
scarring).
Efforts are therefore being undertaken by both industry and academia to
identify new proteins having
leucine rich repeats to better understand protein-protein interactions,
neuronal development and adhesin
molecules. Of particular interest are those proteins having leucine rich
repeats and homology to known proteins
12
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
having leucine rich repeats such as the SLIT protein. We herein describe novel
polypeptides having homology
to SLIT, designated herein as PR0266 polypeptides.
14. PR0269
Thrombomodulin binds to and regulates the activity of thrombin. It is
important in the control of blood
coagulation. Thrombomodulin functions as a natural anticoagulant by
accelerating the activation of protein C by
thrombin. Soluble thrombomodulin may have therapeutic use as an antithrombotic
agent with reduced risk for
hemorrhage as compared with heparin. Thrombomodulin is a cell surface traps-
membrane glycoprotein, present
on endothelial cells and platelets. A smaller, functionally active form of
thrombomodulin circulates in the plasma
and is also found in urine. (In Haeberli, A., Human Protein Data, VCH Oub.,
N.Y., 1992). Peptides having
homology to thrombomodulin are particularly desirable.
We herein describe the identification and characterization of novel
polypeptides having homology to
thrombomodulin, designated herein as PR0269 polypeptides.
15. PR0287
Procollagen C-proteinase enhancer protein binds to and enhances the activity
of bone morphogenic
protein "BMP1 "/procollagen C-proteinase (PCP). It plays a role in
extracellular matrix deposition. BMPI
proteins may be used to induce bone and/or cartilage formation and in wound
healing and tissue repair.
Therefore, procollagen C-proteinase enhancer protein, BMP1 and proteins having
homology thereto, are of
interest to the scientific and medical communities.
We herein describe the identification and characterization of novel
polypeptides having homology to
procollagen C-proteinase enhancer protein precursor and procollagen C-
proteinase enhancer protein, designated
herein as PR0287 polypeptides.
16. PR0214
Growth factors are molecular signals or mediators that enhances cell growth or
proliferation, alone or
in concert, by binding to specific cell surface receptors. However, there are
other cellular reactions than only
growth upon expression to growth factors. As a result, growth factors are
better characterized as multifunctional
and potent cellular regulators. Their biological effects include
proliferation, chemotaxis and stimulation of
extracellular matrix production. Growth factors can have both stimulatory and
inhibitory effects. For example,
transforming growth factor ~i (TGF-(3) is highly pleiotropic and can stimulate
proliferation in some cells,
especially connective tissue, while being a potent inhibitor of proliferation
in others, such as lymphocytes and
epithelial cells.
The physiological effect of growth stimulation or inhibition by growth factors
depends upon the state
of development and differentiation of the target tissue. The mechanism of
local cellular regulation by classical
endocrine molecules involves comprehends autocrine (same cell), juxtacrine
(neighbor cell), and paracrine
(adjacent cells) pathways. Peptide growth factors are elements of a complex
biological language, providing the
basis for intercellular communication. They permit cells to convey information
between each other, mediate
13
CA 02343577 2001-03-16
WO 00115796 PCT/US99/21090
interaction between cells and change gene expression. The effect of these
multifunctional and pluripotent factors
is dependent on the presence or absence of other peptides.
Epidermal growth factor (EGF) is a conventional mitogenic factor that
stimulates the proliferation of
various types of cells including epithelial cells and fibroblasts. EGF binds
to and activates the EGF receptor
(EGFR), which initiates intracellular signaling and subsequent effects. The
EGFR is expressed in neurons of
the cerebral cortex, cerebellum, and hippocampus in addition to other regions
of the central nervous system
(CNS). In addition, EGF is also expressed in various regions of the CNS.
Therefore, EGF acts not only on
mitotic cells, but also on postmitotic neurons. In fact, many studies have
indicated that EGF has neurotrophic
or neuromodulatory effects on various types of neurons in the CNS. For
example, EGF acts directly on cultured
cerebral cortical and cerebellar neurons, enhancing neurite outgrowth and
survival. On the other hand, EGF
IO also acts on other cell types, including septal cholinergic and
mesencephalic dopaminergic neurons, indirectly
through glial cells. Evidence of the effects of EGF on neurons in the CNS is
accumulating, but the mechanisms
of action remain essentially unknown. EGF-induced signaling in mitotic cells
is better understood than in
postmitotic neurons. Studies of cloned pheochromocytoma PC 12 cells and
cultured cerebral cortical neurons
have suggested that the EGF-induced neurotrophic actions are mediated by
sustained activation of the EGFR and
mitogen-activated protein kinase (MAPK) in response to EGF. The sustained
intracellular signaling correlates
with the decreased rate of EGFR down-regulation, which might determine the
response of neuronal cells to EGF.
It is likely that EGF is a mufti-potent growth factor that acts upon various
types of cells including mitotic cells
and postmitotic neurons.
EGF is produced by the salivary and Brunner's glands of the gastrointestinal
system, kidney, pancreas,
thyroid gland, pituitary gland, and the nervous system, and is found in body
fluids such as saliva, blood,
cerebrospinal fluid (CSF), urine, amniotic fluid, prostatic fluid, pancreatic
juice, and breast milk, Plata-Salaman,
CR Peptides 12: 653-663 (1991).
EGF is mediated by its membrane specific receptor, which contains an intrinsic
tyrosine kinase.
Stoscheck CM et al., J. Cell Biochem. 31: 135-152 (1986). EGF is believed to
function by binding to the
extracellular portion of its receptor which induces a transmembrane signal
that activates the intrinsic tyrosine
kinase.
Purification and sequence analysis of the EGF-like domain has revealed the
presence of six conserved
cysteine residues which cross-bind to create three peptide loops, Savage CR et
al., J. Biol. Chem. 248: 7669-
7672 (1979). It is now generally known that several other peptides can react
with the EGF receptor which share
the same generalized motif X~CX~CXd,SCX,aCXCX5GX2CX~, where X represents any
non-cysteine amino acid,
and n is a variable repeat number. Non isolated peptides having this motif
include TGF-a, amphiregulin,
schwannoma-derived growth factor (SDGF), heparin-binding EGF-like growth
factors and certain virally
encoded peptides (e.g., Vaccinia virus, Reisner AH, Nature 313: 801-803
(1985), Shope fibroma virus, Chang
W., et al., Mol Cell Biol. 7: 535-540 (1987), Molluscum contagiosum, Porter CD
& Archard LC, J. Gen. Virol.
68: 673-682 {1987), and Myxoma virus, Upton C et al., J. Virol., 6I: 1271-1275
(1987). Prigent SA &- C,emoine
N.R., Prog. Growth FactorRes. 4: 1-24 (1992).
14
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/Z1090
EGF-like domains are not confined to growth factors but have been observed in
a variety of cell-surface
and extracellular proteins which have interesting properties in cell adhesion,
protein-protein interaction and
development, Lawrence DJR & Gusterson BA, Tumor Biol. 11: 229-261 ( 1990).
These proteins include blood
coagulation factors (factors VI, IX, X, XII, protein C, protein S, protein Z,
tissue plasminogen activator,
urokinase), extracellular matrix components (laminin, cytotactin, entactin),
cell surface receptors (LDL receptor,
thrombomodulin receptor) and immunity-related proteins (complement Clr,
uromodulin).
Even more interesting, the general structure pattern of EGF-like precursors is
preserved through lower
organisms as well as in mammalian cells. A number of genes with developmental
significance have been
identified in invertebrates with EGF-like repeats. For example, the notch gene
of Drosophila encodes 36
tandemly arranged 40 amino acid repeats which show homology to EGF, Wharton W
et al., Cell 43: 557-581
( 1985). Hydropathy plots indicate a putative membrane spanning domain, with
the EGF-related sequences being
located on the extracellular side of the membrane. Other homeotic genes with
EGF-like repeats include Delta,
95F and 5ZD which were identified using probes based on Notch, and the
nematode gene Lin-12 which encodes
a putative receptor for a developmental signal transmitted between two
specified cells.
Specifically, EGF has been shown to have potential in the preservation and
maintenance of
gastrointestinal mucosa and the repair of acute and chronic mucosal lesions,
Konturek, PC et al., Eur. J.
Gastroenterol Hepatol. 7 (10), 933-37 (1995), including the treatment of
necrotizing enterocolitis, Zollinger-
Ellison syndrome, gastrointestinal ulceration gastrointestinal ulcerations and
congenital microvillus atrophy, A.
Guglietta & PB Sullivan, Eur. J. Gastroenterol Hepatol, 7(10), 945-50 (1995).
Additionally, EGF has been
implicated in hair follicle differentiation; C.L. du Cros, J. Invest.
Dermatol. 101 (1 Suppl.), 1065-113S (1993),
SG Hillier, Clin. Endocrinol. 33(4), 427-28 (1990); kidney function, L.L. Hamm
et al., Semin. Nephrol. 13 (1):
109-15 (1993), RC Harris, Am. J. Kidney Dis. 17(6): 627-30 (1991); tear fluid,
GB van Setten et al., Int.
Ophthalmol 15(6); 359-62 ( 1991 ); vitamin K mediated blood coagulation, J.
Stenflo et al., Blood 78(7): 1637-51
( 1991). EGF is also implicated various skin disease characterized by abnormal
keratinocyte differentiation, e.g. ,
psoriasis, epithelial cancers such as squamous cell carcinomas of the lung,
epidermoid carcinoma of the wlva
and gliomas. King, LE et al., Am. J. Med. Sci. 296: 154-158 (1988).
Of great interest is mounting evidence that genetic alterations in growth
factors signaling pathways are
closely linked to developmental abnormalities and to chronic diseases
including cancer. Aaronson SA, Science
254: 1146-1153 (1991). For example, c-erb-2 (also known as HER-2), a proto-
oncogene with close structural
similarity to EGF receptor protein, is overexpressed in human breast cancer.
King et al. , Science 229: 974-976
(1985); Gullick, WJ, Hormones and their actions, Cooke BA et al., eds,
Amsterdam, Elsevier, pp 349-360
( 1986).
17. PR0317
The TGF-(i supergene family, or simply TGF-(i superfamily, a group of secreted
proteins, includes
a large number of related growth and differentiation factors expressed in
virtually all phyla. Superfamily
members bind to specific cell surface receptors that activate signal
transduction mechanisms to elicit their
multifunctional cytokine effects. Kolodziejczyk and Hall, Biochem. Cell.
Biol., 74: 299-314 (1996); Attisano
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
and Wrana, Cvtokine Growth Factor Rev., 7: 327-339 (1996); and Hill, Cellular
Si n_g alinP,, 8: 533-544 (1996).
Members of this family include five distinct forms of TGF-~i (Sporn and
Roberts, in Peptide Growth
Factors and Their Receptors. Sporn and Roberts, eds. (Springer-Verlag: Berlin,
1990) pp. 419-472), as well as
the differentiation factors vgl (Weeks and Melton, Cell, 51: 861-867 (1987))
and DPP-C polypeptide (Padgett
et al. , Nature, 325: 81-84 ( 1987)), the hormones activin and inhibin (Mason
et al. , Nature, 318: 659-663 ( i985);
Mason et al., Growth Factors. 1: 7?-88 (1987)), the Mullerian-inhibiting
substance (MIS) (Cate et al., Cell, 45:
685-698 (1986)), the bone morphogenetic proteins (BMPs) (Wozney et al.,
Science, 242: 1528-1534 (1988);
PCT WO 88100205 published January 14, 1988; U.S. 4,877,864 issued October 31,
1989), the developmentally
regulated proteins Vgr-1 (Lyons et al., Proc. Natl. Acad. Sci. USA. 86: 4554-
4558 (1989)) and Vgr-2 (Jones
et al. , Molec. Endocrinol. , 6: 1961-1968 ( 1992)), the mouse growth
differentiation factor (GDF), such as GDF-
3 and GDF-9 (Kingsley, Genes Dev., 8: 133-146(1994); McPherron and Lee, J.
Biol. Chem., 268: 3444-3449
(1993)), the mouselefty/Stral (Meno etal., Nature, 381: 151-155 (1996);
Bouillet etal., Dev. Biol., 170:420-
433 (1995)), glial cell line-derived neurotrophic factor (GDNF) (Lin et al.,
Science, 260: 1130-1132 (1993),
neurturin (Kotzbauer et al. , Nature, 384: 467-470 ( 1996)), and endometrial
bleeding-associated factor (EBAF)
(Kothapalli et al., J. Clin. Invest., 99: 2342-2350 (1997)). The subset BMP-2A
and BMP-2B is approximately
75 % homologous in sequence to DPP-C and may represent the mammalian
equivalent of that protein.
The proteins of the TGF-(i superfamily are disulfide-linked homo- or
heterodimers encoded by larger
precursor polypeptide chains containing a hydrophobic signal sequence, a long
and relatively poorly conserved
N-terminal pro region of several hundred amino acids, a cleavage site (usually
polybasic), and a shorter and
more highly conserved C-terminal region. This C-terminal region corresponds to
the processed mature protein
and contains approximately I00 amino acids with a characteristic cysteine
motif, i.e., the conservation of seven
of the nine cysteine residues of TGF-(3 among all known family members.
Although the position of the cleavage
site between the mature and pro regions varies among the family members, the C-
terminus of all of the proteins
is in the identical position, ending in the sequence Cys-X-Cys-X, but
differing in every case from the TGF-~i
consensus C-terminus of Cys-Lys-Cys-Ser. Sporn and Roberts, 1990, supra.
There are at least five forms of TGF-(i currently identified, TGF-(i1, TGF-
X32, TGF-(33, TGF-/34, and
TGF-X35. The activated form of TGF-(31 is a homodimer formed by dimerization
of the carboxy-terminal 112
amino acids of a 390 amino acid precursor. Recombinant TGF-(31 has been cloned
(Derynck et al., Nature,
316:701-705 (1985)) and expressed in Chinese hamster ovary cells (Gentry et
al., Mol. Cell. Biol., 7: 3418-3427
(1987)). Additionally, recombinant human TGF-(32 (deMartin et al., EMBO J., 6:
3673 (1987)), as well as
human and porcine TGF-(33 (Derynck et al. , EMB J. , 7: 3737-3743 ( 1988); ten
Dijke er al. , Proc. Natl. Acad.
Sci. USA, 85: 4715 (1988)) have been cloned. TGF-p2 has a precursor form of
414 amino acids and is also
processed to a homodimer from the carboxy-terminal 112 amino acids that shares
approximately 70% homology
with the active form of TGF-(31 (Marquardt et al., J. Biol. Chem., 262: 12127
(1987)). See also EP 200,341;
169,016; 268,561; and 267,463; U.S. Pat. No. 4,774,322; Cheifetz et al., Cell,
48: 409-415 (1987); Jakowlew
et al. , Molecular Endocrin.. 2: 747-755 ( 1988); Derynck et al. , J. Biol.
Chem. , 261: 4377-4379 (1986);
Sharpies et al., DNA, 6: 239-244 (1987); Derynck et al., Nucl. Acids. Res.,
15: 3188-3189 (1987); Derynck
et al., Nucl. Acids. Res.. 15: 3187 (1987); Seyedin et al., J. Biol. Chem:,
261: 5693-5695 (1986); Madisen et
16
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
al., DNA, 7: 1-8 (1988); and Hanks et al., Proc. Natl. Acad. Sci. (U.S.A.),
85: 79-82 (1988).
TGF-X34 and TGF-~i5 were cloned from a chicken chondrocyte cDNA library
(Jakowlew et al. , Molec.
Endocrinol., 2: 1186-1195 (1988)) and from a frog oocyte cDNA library,
respectively.
The pro region of TGF-p associates non-covalently with the mature TGF-~i dimer
(Wakefield et al. ,
J. Biol. Chem. , 263: 7646-7654 ( 1988); Wakefield et al. , Growth Factors, 1:
203-218 ( 1989)), and the pro
regions are found to be necessary for proper folding and secretion of the
active mature dimers of both TGF-(3
and activin (Gray and Mason, Science. 247: 1328-1330 (1990)). The association
between the mature and pro
regions of TGF-~i masks the biological activity of the mature dimer, resulting
in formation of an inactive latent
form. Latency is not a constant of the TGF-~i superfamily, since the presence
of the pro region has no effect
on activin or inhibin biological activity.
A unifying feature of the biology of the proteins from the TGF-~i superfamily
is their ability to regulate
developmental processes. TGF-p has been shown to have numerous regulatory
actions on a wide variety of both
normal and neoplastic cells. TGF-~i is multifunctional, as it can either
stimulate or inhibit cell proliferation,
differentiation, and other critical processes in cell function (Sporn and
Roberts, supra).
One member of the TGF-p superfamily, EBAF, is expressed in endometrium only in
the late secretory
phase and during abnormal endometrial bleeding. Kothapalli et al., J. Clin.
Invest., 99: 2342-2350 (1997).
Human endometrium is unique in that it is the only tissue in the body that
bleeds at regular intervals. In
addition, abnormal endometriaI bleeding is one of the most common
manifestations of gynecological diseases,
and is a prime indication for hysterectomy. In situ hybridization showed that
the mRNA of EBAF was expressed
in the stroma without any significant mRNA expression in the endometrial
glands or endothelial cells.
The predicted protein sequence of EBAF showed a strong homology to the protein
encoded by mouse
leftylstra3 of the TGF-~ superfamily. A motif search revealed that the
predicted EBAF protein contains most
of the cysteine residues which are conserved among the TGF-~i-related proteins
and which are necessary for the
formation of the cysteine knot structure. The EBAF sequence contains an
additional cysteine residue, 12 amino
acids upstream from the first conserved cysteine residue. The only other
family members known to contain an
additional cysteine residue are TGF-ps, inhibins, and GDF-3. EBAF, similar to
LEFTY, GDF-3/Vgr2, and
GDF-9, lacks the cysteine residue that is known to form the intermolecular
disulfide bond. Therefore, EBAF
appears to be an additional member of the TGF-p superfamily with an unpaired
cysteine residue that may not
exist as a dimer. However, hydrophobic contacts between the two monomer
subunits may promote dimer
formation. Fluorescence in situ hybridization showed that the ebaf gene is
located on human chromosome 1 at
band q42.1.
Additional members of the TGF-(3 superfamily, such as those related to EBAF,
are being searched for
by industry and academics. We herein describe the identification and
characterization of novel polypeptides
having homology to EBAF, designated herein as PR0317 polypeptides.
18. PR0301
The widespread occurrence of cancer has prompted the devotion of considerable
resources and
discovering new treatments of treatment. One particular method involves the
creation of tumor or cancer specific
17
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
monoclonal antibodies (mAbs) which are specific to tumor antigens. Such mAbs,
which can distinguish between
normal and cancerous cells are useful in the diagnosis, prognosis and
treatment of the disease. Particular
antigens are known to be associated with neoplastic diseases, such as
colorectal cancer.
One particular antigen, the A33 antigen is expressed in more than 90 % of
primary or metastatic colon
cancers as well as normal colon epithelium. Since colon cancer is a widespread
disease, early diagnosis and
treatment is an important medical goal. Diagnosis and treatment of colon
cancer can be implemented using
monoclonal antibodies (mAbs) specific therefore having fluorescent, nuclear
magnetic or radioactive tags.
Radioactive gene, toxins and/or drug tagged mAbs can be used for treatment in
situ with minimal patient
description. mAbs can also be used to diagnose during the diagnosis and
treatment of colon cancers. For
example, when the serum levels of the A33 antigen are elevated in a patient, a
drop of the levels after surgery
would indicate the tumor resection was successful. On the other hand, a
subsequent rise in serum A33 antigen
levels after surgery would indicate that metastases of the original tumor may
have formed or that new primary
tumors may have appeared. Such monoclonal antibodies can be used in Iieu of,
or in conjunction with surgery
and/or other chemotherapies. For example, U.S.P. 4,579,827 and U.S.S.N.
424,991 (E.P. 199,141) are
directed to therapeutic administration of monoclonal antibodies, the latter of
which relates to the application of
anti-A33 mAb.
Many cancers of epithelial origin have adenovirus receptors. In fact,
adenovirus-derived vectors have
been proposed as a means of inserting antisense nucleic acids into tumors
(U.S.P. 5,518,885). Thus, the
association of viral receptors with neoplastic tumors is not unexpected.
We herein describe the identification and characterization of novel
polypeptides having homology to
certain cancer-associated antigens, designated herein as PR0301 polypeptides.
19. PR0224
Cholesterol uptake can have serious implications on one's health. Cholesterol
uptake provides cells with
most of the cholesterol they require for membrane synthesis. If this uptake is
blocked, cholesterol accumulates
in the blood and can contribute to the formation of atherosclerotic plaques in
blood vessel walls. Most
cholesterol is transported in the blood bound to protein in the form of
complexes known as low-density
lipoproteins (LDLs). LDLs are endocytosed into cells via LDL receptor
proteins. Therefore, LDL receptor
proteins, and proteins having homology thereto, are of interest to the
scientific and medical communities.
Membrane-bound proteins and receptors can play an important role in the
formation, differentiation and
maintenance of multicellular organisms. The LDL receptors are an example of
membrane-bound proteins which
are involved in the synthesis and formation of cell membranes, wherein the
health of an individual is affected
directly and indirectly by its function. Many membrane-bound proteins act as
receptors such as the LDL
receptor. These receptors can function to endocytose substrates or they can
function as a receptor for a channel.
Other membrane-bound proteins function as signals or antigens.
Membrane-bound proteins and receptor molecules have various industrial
applications, including as
pharmaceutical and diagnostic agents. The membrane-bound proteins can also be
employed for screening of
potential peptide or small molecule regulators of the relevant receptor/ligand
interaction. In the case of the LDL
18
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
receptor, it is desirable to fmd molecules which enhance endocytosis so as to
lower blood cholesterol levels and
plaque formation. It is also desirable to identify molecules which inhibit
endocytosis so that these molecules can
be avoided or regulated by individuals having high blood cholesterol.
Polypeptides which are homologous to
lipoprotein receptors but which do not function as lipoprotein receptors are
also of interest in the determination
of the function of the fragments which show homology.
The following studies report on previously known low density lipoprotein
receptors and related proteins
including apolipoproteins: Sawamura, et al. , Nippon Chemiphar Co, Japan
patent application J09098787; Novak,
S., et al., J. Biol. Chem., 271:(20)11732-6 (1996); Blaas, D., J. Virol.,
69(11)7244-7 (Nov. 1995); Scott, J.,
J. Inherit. Metab. Dis. (UK), 9/Supp. 1 (3-16) (1986); Yamamoto, et al., Cell,
39:27-38 (1984); Rebece, et al.,
Neurobiol. Aeine, 15:5117 (1994); Novak, S., et al., J. Biol. Chemistrv,
271:11732-11736 (1996); and Sestavel
and Fruchart, Cell MoI. Biol., 40(4):461-81 (June 1994). These publications
and others published prior to the
filing of this application provide further background to peptides already
known in the art.
Efforts are being undertaken by both industry and academia to identify new,
native membrane-bound
receptor proteins, particularly those having homology to lipoprotein
receptors. We herein describe the
identification and characterization of novel polypeptides having homology to
lipoprotein receptors, designated
herein as PR0224 polypeptides.
20. PR0222
Complement is a group of proteins found in the blood that are important in
humoral immunity and
inflammation. Complement proteins are sequentially activated by antigen-
antibody complexes or by proteolytic
enzymes. When activated, complement proteins kill bacteria and other
microorganisms, affect vascular
permeability, release histamine and attract white blood cells. Complement also
enhances phagocytosis when
bound to target cells. In order to prevent harm to autologous cells, the
complement activation pathway is tightly
regulated.
Deficiencies in the regulation of complement activation or in the complement
proteins themselves may
lead to immune-complex diseases, such as systemic lupus erythematosus, and may
result in increased
susceptibility to bacterial infection. In all cases, early detection of
complement deficiency is desirable so that
the patient can begin treatment. Thus, research efforts are currently directed
toward identification of soluble and
membrane proteins that regulate complement activation.
Proteins known to be important in regulating complement activation in humans
include Factor H and
Complement receptor type 1 (CR1). Factor H is a 150 kD soluble serum protein
that interacts with complement
protein C3b to accelerate the decay of C3 convertase and acts as a cofactor
for Factor I-mediated cleavage of
complement protein C4b. Complement receptor type 1 is a 190-280 kD membrane
bound protein found in mast
cells and most blood cells. CR1 interacts with complement proteins C3b, C4b,
and iC3b to accelerate
dissociation of C3 convertases, acts as a cofactor for Factor I-mediated
cleavage of C3b and C4b, and binds
immune complexes and promotes their dissolution and phagocytosis.
Proteins which have homology to complement proteins are of particular interest
to the medical and
industrial communities. Often, proteins having homology to each other have
similar function. It is also of
19
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
interest when proteins having homology do not have similar functions,
indicating that certain structural motifs
identify information other than function, such as locality of function.
Efforts are being undertaken by both industry and academia to identify new,
native secreted and
membrane-bound proteins, particularly those having homology to known proteins
involved in the complement
pathway. Proteins involved in the complement pathway were reviewed in
Birmingham DJ ( 1995), Critical
S Reviews in Immunoloev, 15(2):133-154 and in Abbas AK, et al. (1994) Cellular
and Molecular Immunology,
2nd Ed. W.B. Saunders Company, Philadelphia, pp 295-315.
We herein describe the identification and characterization of novel
polypeptides having homology to
complement receptors, designated herein as PR0222 polypeptides.
21. PR0234
The successful function of many systems within multicellular organisms is
dependent on cell-cell
interactions. Such interactions are affected by the alignment of particular
ligands with particular receptors in
a manner which allows for ligand-receptor binding and thus a cell-cell
adhesion. While protein-protein
interactions in cell recognition have been recognized for some time, only
recently has the role of carbohydrates
in physiologically relevant recognition been widely considered (see B.K.
Brandley et al., J. Leuk. Biol. 40: 97
(1986) and N. Sharon et al., Science 246: 227 (1989). Oligosaccharides are
well positioned to act as recognition
novel lectins due to their cell surface location and structural diversity.
Many oligosaccharide structures can be
created through the differential activities of a smaller number of
glycosyltransferases. The diverse structures
of oligosaccharides can be generated by transcription of relatively few gene
products, which suggests that the
oligosaccharides are a plausible mechanism by which is directed a wide range
of cell-cell interactions. Examples
of differential expression of cell surface carbohydrates and putative
carbohydrate binding proteins (lectins) on
interacting cells have been described (J. Dodd & T.M. Jessel, J. Neurosci. 5:
3278 (1985); L.J. Regan et al.,
Proc: Natl. Acad. Sci. USA 83: 2248 (1986); M. Constantine-Paton et al.,
Nature 324: 459 (1986); and M.
Tiemeyer et al., J. Biol. Chem. 263: 1671 (1989). One interesting member of
the lectin family are selectins.
The migration of leukocytes to sites of acute or chronic inflammation involves
adhesive interactions
between these cells and the endothelium. This specific adhesion is the initial
event in the cascade that is initiated
by inflammatory insults, and it is, therefore, of paramount importance to the
regulated defense of the organism.
The types of cell adhesion molecules that are involved in the interaction
between leukocytes and the
endothelium during an inflammatory response currently stands at four: (1)
selectins; (2) (carbohydrate and
glycoprotein) ligands for selectins; (3) integrins; and (4) integrin ligands,
which are members of the
immunoglobulin gene superfamily.
The selectins are cell adhesion molecules that are unified both structurally
and functionally.
Structurally, selectins are characterized by the inclusion of a domain with
homology to a calcium-dependent
lectin (C-lectins), an epidermal growth factor (egf)-like domain and several
complement binding-like domains,
Bevilacqua, M.P. et al., Science 243: 1160-1165 (1989); Johnston et al., Cell
56: 1033-1044 (1989); Lasky et
al, Cell 56: 1045-1055 (1989); Siegalman> M. et al., Science 243: 1165-1172
(1989); Stoolman, L.M., Cell 56:
907-910 (1989). Functionally, selectins share the common property of their
ability to mediate cell binding
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
through interactions between their lectin domains and cell surface
carbohydrate ligands (Brandley, B, et al. , Cell
63, 861-863 (1990); Springer, T. and Lasky, L.A., Nature 349, 19-197 (1991);
Bevilacqua, M.P. and Nelson,
R.M.; J. Clin. Invest. 91 379-387 (1993) and Tedder et al., J. Exp. Med. 170:
123-133 (1989).
There are three members identified so far in the selectin family of cell
adhesion molecules: L-selectin
(also called peripheral lymph node homing receptor (pnHR), LEC-CAM-1, LAM-1,
gp90 "'EL, gp100MEL,
S gpl lO"'EL, MEL-14 antigen, Leu-8 antigen,TQ-1 antigen, DREG antigen), E-
selectin (LEC-CAM-2, LECAM-2,
ELAM-1) and P-selectin (LEC-CAM-3, LECAM-3, GMP-140, PADGEM).
The identification of the C-lectin domain has led to an intense effort to
define carbohydrate binding
ligands for proteins containing such domains. E-selectin is believed to
recognize the carbohydrate sequence
NeuNAca2-3Ga1(31-4(Fucal-3)GIcNAc (sialyl-Lewis x, or sLe') and related
oligosaccharides, Berg et al., J.
Biol. - -Chem. 265: 14869-14872 (1991); Lowe et al., Cell 63: 475-484 (1990);
Phillips et al., Science 250: 1130-
1132 (1990); Tiemeyer -et al., Proc. Natl. Acad. Sci. USA 88: 1138-1142
(1991).
L-selectin, which comprises a lectin domain, performs its adhesive function by
recognizing
carbohydrate-containing ligands on endothelial cells. L-selectin is expressed
on the surface of leukocytes, such
as lymphocytes, neutrophils, monocytes and eosinophils, and is involved with
the trafficking of lymphocytes to
peripheral lymphoid tissues (Gallatin et al., Nature 303: 30-34 (1983)) and
with acute neutrophil-medicated
inflammatory -responses (Watson, S.R., Nature 349: 164-167(1991)). The amino
acid sequence of L-selectin
and the encoding nucleic acid sequence are, for example, disclosed in U.S.
patent No. 5,098,833 issued 24
March 1992.
L-selectin (LECAM-1 ) is particularly interesting because of its ability to
block neutrophil influx (Watson
et al., Nature 349: 164-167 (1991). It is expressed in chronic lymphocytic
leukemia cells which bind to HEV
(Spertini et al., Nature 349: 691-694 (1991). It is also believed that HEV
structures at sites of chronic
inflammation are associated with the symptoms of diseases such as rheumatoid
arthritis, psoriasis and multiple
sclerosis.
E-selectin (ELAM-1), is particularly interesting because of its transient
expression on endothelial cells
in response to IL-1 or TNF. Bevilacqua et al., Science 243: 1160 (1989). The
time course of this induced
expression (2-8 h) suggests a role for this receptor in initial neutrophil
induced extravasation in response to
infection and injury. It has further been reported that anti-SLAM-1 antibody
blocks the influx of neutrophils
in a primate asthma model and thus is beneficial for preventing airway
obstruction resulting from the
inflammatory response. Gundel et al., J. Clin. Invest. 88: 1407 (1991).
The adhesion of circulating neutrophils to stimulated vascular endothelium is
a primary event of the
inflammatory response. P-selectin has been reported to recognize the Lewis x
structure (Gal(31-4(Fucal-3)
GIcNAc), Larsen et al., Cell 63: 467-474(1990). Others report that an
additional tet~tttinal linked sialic acid is
required for high affinity binding, Moore et al., J. Cell. Biol. 112: 491-499
(1991). P-selectin has been shown
to be significant in acute lung injury. Anti-P-seleetin antibody has been
shown to have strong protective effects
in a rodent lung injury model. M.S. Mulligan et al., J. Clin. Invest. 90: 1600
(1991).
We herein describe the identification and characterization of novel
polypeptides having homology to
lectin proteins, herein designated as PR0234 polypeptides.
21
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
22. PR0231
Some of the most important proteins involved in the above described regulation
and modulation of
cellular processes are the enzymes which regulate levels of protein
phosphorylation in the cell. For example,
it is known that the transduction of signals that regulate cell growth and
differentiation is regulated at least in part
by phosphorylation and dephosphorylation of various cellular proteins. The
enzymes that catalyze these
processes include the protein kinases, which function to phosphorylate various
cellular proteins, and the protein
phosphatases, which function to remove phosphate residues from various
cellular proteins. The balance of the
level of protein phosphorylation in the cell is thus mediated by the relative
activities of these two types of
enzymes.
Protein phosphatases represent a growing family of enzymes that are found in
many diverse forms,
including both membrane-bound and soluble forms. While many protein
phosphatases have been described, the
functions of only a very few are beginning to be understood (Tonks, Semin.
Cell Biol. 4:373-453 (1993) and
Dixon, Recent Prog. Horm. Res. 51:405-414 ( 1996)). However, in general, it
appears that many of the protein
phosphatases function to modulate the positive or negative signals induced by
various protein kinases.
Therefore, it is likely that protein phosphatases play critical roles in
numerous and diverse cellular processes.
Given the physiological importance of the protein phosphatases, efforts are
being undertaken by both
industry and academia to identify new, native phosphatase proteins. Many of
these efforts are focused on the
screening of mammalian recombinant DNA libraries to identify the coding
sequences for novel phosphatase
proteins. Examples of screening methods and techniques are described in the
literature [see, for example, Klein
et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No.
5,536,637)].
We herein describe the identification and characterizationof novel
polypeptides having homology to acid
phosphatases, designated herein as PR0231 polypeptides.
23. PR0229
Scavenger receptors are known to protect IgG molecules from catabolic
degradation. Riechmann and
HolIinger, Nature Biotechnolosy. 15:617 (1997). In particular, studies of the
CH2 and CH3 domains have
shown that specific sequences of these domains are important in determining
the half-lives of antibodies.
Ellerson, et al., J. Immunol., 116: S10 (1976); Yasmeen, et al., J. Immunol.
116: 518 (1976; Pollock, et al.,
Eur. J. Immunol., 20: 2021 (1990). Scavenger receptor proteins and antibodies
thereto are further reported in
U.S. Patent No. 5,510,466 to Krieger, et al. Due to the ability of scavenger
receptors to increase the half life
of polypeptides and their involvement in immune function, molecules having
homology to scavenger receptors
are of importance to the scientific and medical community.
Efforts are being undertaken by both industry and academia to identify new,
native secreted and
membrane-bound receptor proteins, particularly those having homology to
scavenger receptors. Many efforts
are focused on the screening of mammalian recombinant DNA libraries to
identify the coding sequences for
novel secreted and membrane-bound receptor proteins. Examples of screening
methods and techniques are
described in the literature [see, for example, Klein et al., Proc. Natl. Acad.
Sci.. 93:7108-7113 (1996); U.S.
Patent No. 5,536,637)].
22
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
We herein describe the identification and characterization of novel
polypeptides having homology to
scavenger receptors, designated herein as PR0229 polypeptides.
24. PR0238
Oxygen free radicals and antioxidants appear to play an important role in the
central nervous system
after cerebral ischemia and reperfusion. Moreover, cardiac injury, related to
ischaemia and reperfusion has been
reported to be caused by the action of free radicals. Additionally, studies
have reported that the redox state of
the cell is a pivotal determinant of the fate of the cells. Furthermore,
reactive oxygen species have been reported
to be cytotoxic, causing inflammatory disease, including tissue necrosis,
organ failure, atherosclerosis, infertility,
birth defects, premature aging, mutations and malignancy. Thus, the control of
oxidation and reduction is
important for a number of reasons including for control and prevention of
strokes, heart attacks, oxidative stress
and hypertension. In this regard, reductases, and particularly,
oxidoreductases, are of interest. Publications
further describing this subject matter include Kelsey, et al., Br. J. Cancer,
76(7):852-4 (1997); Friedrich and
Weiss, J. Theor. Biol., 187(4):529-40 (1997) and Pieulle, et al., J.
Bacteriol., 179(18):5684-92 (1997).
Efforts are being undertaken by both industry and academia to identify new,
native secreted and
membrane-bound receptor proteins, particularly secreted proteins which have
homology to reductase. Many
efforts are focused on the screening of mammalian recombinant DNA libraries to
identify the coding sequences
for novel secreted and membrane-bound receptor proteins. Examples of screening
methods and techniques are
described in the literature [see, for example, Klein et al., Proc. Natl. Acad.
Sci., 93:7108-7113 (1996); U.S.
Patent No. 5,536,637)].
We herein describe the identification and characterization of novel
polypeptides having homology to
reductase, designated herein as PR0238 polypeptides.
25. PR0233
Studies have reported that the redox state of the cell is an important
determinant of the fate of the cell.
Furthermore, reactive oxygen species have been reported to be cytotoxic,
causing inflammatory disease,
including tissue necrosis, organ failure, atherosclerosis, infertility, birth
defects, premature aging, mutations and
malignancy. Thus, the control of oxidation and reduction is important for a
number of reasons, including the
control and prevention of strokes, heart attacks, oxidative stress and
hypertension. Oxygen free radicals and
antioxidants appear to play an important role in the central nervous system
after cerebral ischemia and
reperfusion. Moreover, cardiac injury, related to ischaemia and reperfusion
has been reported to be caused by
the action of free radicals. In this regard, reductases, and particularly,
oxidoreductases, are of- interest. In
addition, the transcription factors, NF-kappa B and AP-1, are known to be
regulated by redox state and to affect
the expression of a large variety of genes thought to be involved in the
pathogenesis of AIDS, cancer,
atherosclerosis and diabetic complications. Publications further describing
this subject matter include Kelsey,
et al., Br. J. Cancer, 76(7):852-4 (1997); Friedrich and Weiss, J. Theor.
Biol., 187(4):529-40 (1997) and
Pieulle, et al., J. Bacteriol., 179(18):5684-92 (1997). Given the
physiological importance of redox reactions
in vivo, efforts are currently being under taken to identify new, native
proteins which are involved in redox
23
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/2I090
reactions. We describe herein the identification of novel polypeptides which
have homology to reductase,
designated herein as PR0233 polypeptides.
26. PR0223
The carboxypeptidase family of exopeptidases constitutes a diverse group of
enzymes that hydrolyze
carboxyl-terminal amide bonds in polypeptides, wherein a large number of
mammalian tissues produce these
enzymes. Many of the carboxypeptidase enzymes that have been identified to
date exhibit rather strong cleavage
specificities for certain amino acids in polypeptides. For example,
carboxypeptidase enzymes have been
identified which prefer lysine, arginine, serine or amino acids with either
aromatic or branched aliphatic side
chains as substrates at the carboxyl terminus of the polypeptide.
IO With regard to the serine carboxypeptidases, such amino acid specific
enzymes have been identified
from a variety of different mammalian and non-mammalian organisms. The
mammalian serine carboxypeptidase
enzymes play important roles in many different biological processes including,
for example, protein digestion,
activation, inactivation, or modulation of peptide hormone activity, and
alteration of the physical properties of
proteins and enzymes.
In light of the physiological importance of the serine carboxypeptidases,
efforts are being undertaken
by both industry and academia to identify new, native secreted and membrane-
bound receptor proteins and
specifically novel carboxypeptidases. Many of these efforts are focused on the
screening of mammalian
recombinant DNA libraries to identify the coding sequences for novel secreted
and membrane-bound receptor
proteins. We describe herein novel polypeptides having homology to one or more
serine carboxypeptidase
polypeptides, designated herein as PR0223 polypeptides.
27. PR0235
Plexin was first identified in Xenopus tadpole nervous system as a membrane
glycoprotein which was
shown to mediate cell adhesion via a homophilic binding mechanism in the
presence of calcium ions. Strong
evolutionary conservation between Xenopus, mouse and human homologs of plexin
has been observed.
[Kaneyama et al., Biochem. And Biophys. Res. Cornm. 226: 524-529 (1996)].
Given the physiological
importance of cell adhesion mechanisms in vivo, efforts are currently being
under taken to identify new, native
proteins which are involved in cell adhesion. We describe herein the
identification of a novel polypeptide which
has homology to plexin, designated herein as PR0235.
28. PR0236 and PR0262
~3-galactosidase is a well known enzymatic protein which functionsto hydrolyze
~i-galactoside molecules.
~i-galactosidase has been employed for a variety of different applications,
both in vitro and in vivo and has proven
to be an extremely useful research tool. As such, there is an interest in
obtaining novel polypeptides which
exhibit homology to the ~i-galactosidase polypeptide.
Given the strong interest in obtaining novel polypeptides having homology to
~i-galactosidase, efforts
are currently being undertaken by both industry and academia to identify new,
native ~3-galactosidase homoiog
24
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
proteins. Many of these efforts are focused on the screening of mammalian
recombinant DNA libraries to
identify the coding sequences for novel ~3-galactosidase-like proteins.
Examples of screening methods and
techniques are described in the literature [see, for example, Klein et al.,
Proc. Natl. Acad. Sci., 93:7108-7113
(1996); U.S. Patent No. 5,536,637)]. We herein describe novel poylpeptides
having siginificant homology to
the (3-galactosidase enzyme, designated herein as PR0236 and PR0262
polypeptides.
S
29. PR0239
Densin is a glycoprotein which has been isolated from the brain which has all
the hallmarks of an
adhesion molecule. It is highly concentrated at synaptic sites in the brain
and is expressed prominently in
dendritic processes in developing neurons. Densin has been characterized as a
member of the O-linked
sialoglycoproteins. Densin has relevance to medically important processes such
as regeneration. Given the
physiological importance of synaptic processes and cell adhesion mechanisms in
vivo, efforts are currently being
under taken to identify new, native proteins which are involved in synaptic
machinery and cell adhesion. We
describe herein the identification of novel polypeptides which have homology
to densin, designated herein as
PR0239 polypeptides.
30. PR0257
Ebnerin is a cell surface protein associated with von Ebner glands in mammals.
Efforts are being
undertaken by both industry and academia to identify new, native cell surface
receptor proteins and specifically
those which possess sequence homology to cell surface proteins such as
ebnerin. Many of these efforts are
focused on the screening of mammalian recombinant DNA libraries to identify
the coding sequences for novel
receptor proteins. We herein describe the identification of novel polypeptides
having significant homology to
the von Ebner's gland-associated protein ebnerin, designated herein as PR0257
polypeptides.
31. PR0260
Fucosidases are enzymes that remove fucose residues from fucose containing
proteoglycans. In some
pathological conditions, such as cancer, rheumatoid arthritis, and diabetes,
there is an abnormal fucosylation of
serum proteins. Therefore, fucosidases, and proteins having homology to
fucosidase, are of importance to the
study and abrogation of these conditions. In particular, proteins having
homology to the alpha-1-fucosidase
precursor are of interest. Fucosidases and fucosidase inhibitors are further
described in U.S. Patent Nos.
5,637,490, 5,382,709, 5,240,707, 5,153,325, 5,100,797, 5,096,909 and
5,017,704. Studies are also reported
in Valk, et al., J. Virol., 71(9):6796 (1997), Aktogu, et al., Monaldi. Arch.
Chest Dis. (Italy), 52(2):118 (1997)
and Focarelli, et al., Biochem. Biophvs. Res. Commun. (U.S.), 234(1):54
(1997).
Efforts are being undertaken by both industry and academia to identify new,
native secreted and
membrane-bound receptor proteins. Of particular interest are proteins having
homology to the alpha-1-fucosidase
precursor. Many efforts are focused on the screening of mammalian recombinant
DNA libraries to identify the
coding sequences for novel secreted and membrane-bound receptor proteins.
Examples of screening methods
and techniques are described in the literature [see, for example, Klein et
al., Proc. Natl. Acad. Sci., 93:7108-
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
7113 (1996); U.S. Patent No. 5,536,637)].
We herein describe the identification and characterization of novel
polypeptides having homology to
fucosidases, designated herein as PR0260 polypeptides.
32. PR0263
CD44 is a cell surface adhesion molecule involved in cell-cell and cell-matrix
interactions. Hyaluronic
acid, a component of the extracellular matrix is a major ligand. Other ligands
include collagen, fibronectin,
laminin, chrondroitin sulfate, mucosal addressin, serglycin and osteoponin.
CD44 is also important in regulating
cell traffic, lymph node homing, transmission of growth signals, and
presentation of chemokines and growth
factors to traveling cells. CD44 surface proteins are associated with
metastatic tumors and CD44 has been used
as a marker for HIV infection. Certain splice vaiiants are associated with
metastasis and poor prognosis of
cancer patients. Therefore, molecules having homology with CD44 are of
particular interest, as their homology
indicates that they may have functions related to those functions of CD44.
CD44 is further described in U.S.
Patent Nos. 5,506,119, 5,504,194 and 5,108,904; Gerberick, et al., Toxicol.
Appl. Pharmacol., 146(1):1
(1997); Wittig, et al., Immunol. Letters (Netherlands), 57(1-3):217 (1997);
and Oliveira and Odell, Oral Oncol.
(England), 33(4):260 (1997).
Efforts are being undertaken by both industry and academia to identify new,
native secreted and
membrane-bound receptor proteins, particularlytransmembrane proteins with
homology to CD44 antigen. Many
efforts are focused on the screening of mammalian recombinant DNA libraries to
identify the coding sequences
for novel secreted and membrane-bound receptor proteins. Examples of screening
methods and techniques are
described in the literature [see, for example, Klein et al., Proc. Natl. Acad.
Sci., 93:7108-7113 (1996); U.S.
Patent No. 5,536,637)].
We herein describe the identification and characterization of novel
polypeptides having homology to
CD44 antigen, designated herein as PR0263 polypeptides.
33. P_R0270
Thioredoxins effect reduction-oxidation (redox) state. Many diseases are
potentially related to redox
state and reactive oxygen species may play a role in many important biological
processes. The transcription
factors, NF-kappa B and AP-l, are regulated by redox state and are known to
affect the expression of a large
variety of genes thought to be involved in the pathogenesis of AIDS, cancer,
atherosclerosis and diabetic
complications. Such proteins may also play a role in cellular antioxidant
defense, and in pathological conditions
involving oxidative stress such as stroke and inflammation in addition to
having a role in apoptosis: Therefore,
thioredoxins, and proteins having homology thereto, are of interest to the
scientific and medical communities.
We herein describe the identification and characterization of novel
polypeptides having homology to
thioredoxin, designated herein as PR0270 polypeptides.
34. PR0271
The proteoglycan link protein is a protein which is intimately associated with
various extracellular
26
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
matrix proteins and more specifically with proteins such as collagen. For
example, one primary component of
collagen is a large proteoglycan called aggrecan. This molecule is retained by
binding to the glycosaminoglycan
hyaluronan through the amino terminal G1 globular domain of the core protein.
This binding is stabilized by
the proteoglycan link protein which is a protein that is also associated with
other tissues containing hyaluronan
binding proteoglycans such as versican.
Link protein has been identified as a potential target for autoimmune
antibodies in individuals who suffer
from juvenile rheumatoid arthritis (see Guerassimov et al. , J. Rheumarology
24(5):959-964 ( 1997)). As such,
there is strong interest in identifying novel proteins having homology to link
protein. We herein describe the
identification and characterization of novel polypeptides having such
homology, designated herein as PR0271
polypeptides.
35. PR0272
Reticulocalbin is an endoplasmic reticular protein which may be involved in
protein transport and
luminal protein processing. Reticulocalbin resides in the lumen of the
endopladsmic rerticulum, is known to bind
calcium, and may be involved in a luminal retention mechanism of the
endoplasmic reticulum. It contains six
domains of the EF-hand motif associated with high affinity calcium binding. We
describe herein the
identification and characterization of a novel polypeptide which has homology
to the reticulocalbin protein,
designated herein as PR0272.
36. PR0294
Collagen, a naturally occurring protein, finds wide application in industry.
Chemically hydrolyzed
natural collagen can be denatured and renatured by heating and cooling to
produce gelatin, which is used in
photographic and medical, among other applications. Collagen has important
properties such as the ability to
form interchain aggregates having a conformation designated as a triple helix.
We herein describe the
identification and characterization of a novel polypeptide which has homology
to portions of the collagen
molecule, designated herein as PR0294.
37. PR0295
The integrins comprise a supergene family of cell-surface glycoprotein
receptors that promote cellular
adhesion. Each cell has numerous receptors that define its cell adhesive
capabilities. Integrins are involved in
a wide variety of interaction between cells and other cells or matrix
components. The integrins are of particular
importance in regulating movement and function of immune system cells The
platelet IIb/IIIA integrin complex
is of particular importance in regulating platelet aggregation. A member of
the integrin family, integrin p-6, is
expressed on epithelial cells and modulates epithelial inflammation. Another
integrin, leucocyte-associated
antigen-1 (LFA-1) is important in the adhesion of lymphocytes during an immune
response. The integrins are
expressed as heterodimers of non-covalently associated alpha and beta
subunits. Given the physiological
importance of cell adhesion mechanisms in vivo, efforts are currently being
under taken to identify new, native
proteins which are involved in cell adhesion. We describe herein the
identification and characterization of a
27
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
novel polypeptide which has homology to integrin, designated herein as PR0295.
38. PR0293
Protein-proteininteractions include receptor and antigen complexes and
signaling mechanisms. As more
is known about the structural and functional mechanisms underlying protein-
protein interactions, protein-protein
interactions can be more easily manipulated to regulate the particular result
of the protein-protein interaction.
Thus, the underlying mechanisms of protein-protein interactions are of
interest to the scientific and medical
community.
All proteins containing leucine-rich repeats are thought to be involved in
protein-protein interactions.
Leucine-rich repeats are short sequence motifs present in a number of proteins
with diverse functions and cellular
locations. The crystal structure of ribonuclease inhibitor protein has
revealed that leucine-rich repeats
correspond to beta-alpha structural units. These units are arranged so that
they form a parallel beta-sheet with
one surface exposed to solvent, so that the protein acquires an unusual,
nonglubular shape. These two features
have been indicated as responsible for the protein-binding functions of
proteins containing leucine-rich repeats.
See, Kobe and Deisenhofer, Trends Biochem. Sci. 19( 10):415-421 (Oct. 1994).
A study has been reported on leucine-rich proteoglycans which serve as tissue
organizers, orienting and
ordering collagen fibrils during ontogeny and are involved in pathological
processes such as wound healing,
tissue repair, and tumor stroma formation. Iozzo, R. V., Crit. Rev. Biochem.
Mol. Biol., 32(2):141-174
(1997). Others studies implicating leucine rich proteins in wound healing and
tissue repair are De La Salle, C.,
et al., Vouv. Rev. Fr. Hematol. (Germany), 37(4):215-222 (1995), reporting
mutations in the leucine rich motif
in a complex associated with the bleeding disorder Bernard-SouIier syndrome
and Chlemetson, K. J., Thromb.
Haemost. (Germany), 74(1):111-116 (July 1995), reporting that platelets have
leucine rich repeats. Another
protein of particular interest which has been reported to have leucine-rich
repeats is the SLIT protein which has
been reported to be useful in treating neuro-degenerative diseases such as
Alzheimer's disease, nerve damage
such as in Parkinson's disease, and for diagnosis of cancer, see,
Artavanistsakonas, S. and Rothberg, J. M.,
W09210518-A1 by Yale University. Other studies reporting on the biological
functions of proteins having
leucine-rich repeats include: Tayar, N., et al., Mol. Cell Endocrinol.,
(Ireland), 125(1-2):65-70 (Dec. 1996)
(gonadotropin receptor involvement); Miura, Y., et al., Nippon Rinsho (Japan),
54(7):1784-1789 (July 1996)
(apoptosis involvement); Harris, P. C., et al., J. Am. Soc. Nephrol.,
6(4):1125-1133 (Oct. 1995) (kidney
disease involvement); and Ruoslahti, E. L, et al., W09110727-A by La Jolla
Cancer Research Foundation
(decorin binding to transforming growth factor~3 involvement for treatment for
cancer, wound healing and
scarring).
Efforts are therefore being undertaken by both industry and academia to
identify new proteins having
leucine rich repeats to better understand protein-protein interactions. Of
particular interest are those proteins
having leucine rich repeats and homology to known neuronal leucine rich repeat
proteins. Many efforts are
focused on the screening of mammalian recombinant DNA libraries to identify
the coding sequences for novel
secreted and membrane-bound proteins having leucuie rich repeats. Examples of
screening methods and
techniques are described in the literature [see, for example, Klein et al.,
Proc. Natl. Acad. Sci., 93:7108-7113
28
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/Z1090
(1996); U.S. Patent No. 5,536,637)].
We describe herein the identification and characterization of a novel
polypeptide which has homology
to leucine rich repeat proteins, designated herein as PR0293.
39. PR0247
S Protein-proteininteractions include receptor and antigen complexes and
signaling mechanisms. As more
is known about the structural and functional mechanisms underlying protein-
protein interactions, protein-protein
interactions can be more easily manipulated to regulate the particular result
of the protein-protein interaction.
Thus, the underlying mechanisms of protein-protein interactions are of
interest to the scientific and medical
community.
All proteins containing leucine-rich repeats are thought to be involved in
protein-protein interactions.
Leucine-rich repeats are short sequence motifs present in a number of proteins
with diverse functions and cellular
locations. The crystal structure of ribonuclease inhibitor protein has
revealed that leucine-rich repeats
correspond to beta-alpha structural units. These units are arranged so that
they form a parallel beta-sheet with
one surface exposed to solvent, so that the protein acquires an unusual,
nonglubular shape. These two features
have been indicated as responsible for the protein-binding functions of
proteins containing leucine-rich repeats.
See, Kobe and Deisenhofer, Trends Biochem. Sci.. 19( 10):415-421 (Oct. 1994).
A study has been reported on leucine-rich proteoglycans which serve as tissue
organizers, orienting and
ordering collagen fibrils during ontogeny and are involved in pathological
processes such as wound healing,
tissue repair, and tumor stroma formation. Iozzo, R. V., Crit. Rev. Biochem.
Mol. Biol., 32(2):141-174
( 1997). Others studies implicating leucine rich proteins in wound healing and
tissue repair are De La Salle, C.,
et al., Vouv. Rev. Fr. Hematol. (Germany), 37(4):215-222 (1995), reporting
mutations in the leucine rich motif
in a complex associated with the bleeding disorder Bernard-Soulier syndrome
and Chlemetson, K. J., Thromb.
Haemost. (Germany), 74(1}:111-116 (July 1995), reporting that platelets have
leucine rich repeats. Another
protein of particular interest which has been reported to have leucine-rich
repeats is the SLIT protein which has
been reported to be useful in treating neuro-degenerative diseases such as
Alzheimer's disease, nerve damage
such as in Parkinson's disease, and for diagnosis of cancer, see,
Artavanistsakonas, S. and Rothberg, J. M.,
W09210518-A1 by Yale University. Other studies reporting on the biological
functions of proteins having
leucine-rich repeats include: Tayar, N., et al., Mol. Cell Endocrinol.,
(Ireland), 125(1-2):65-70 (Dec. 1996)
(gonadotropin receptor involvement); Miura, Y., et al., Nippon Rinsho (Japan),
54(7):1784-1789 (July 1996)
(apoptosis involvement); Harris, P. C., et al., J. Am. Soc. Nephrol.,
6(4):1125-1133 (Oct. 1995) (kidney
disease involvement); and Ruoslahti, E. L, et al., W09110727-A by La Jolla
Cancer Research Foundation
(decorin binding to transforming growth factor ~i involvement for treatment
for cancer, wound healing and
scarring).
Densin is a glycoprotein which has been isolated from the brain which has all
the hallmarks of an
adhesion molecule. It is highly concentrated at synaptic sites in the brain
and is expressed prominently in
dendritic processes in developing neurons. Densin has been characterized as a
member of the O-linked
sialoglycoproteins. Densin has relevance to medically important processes such
as regeneration. Given the
29
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
physiological importance of synaptic processes and cell adhesion mechanisms in
vivo, efforts are currently being
under taken to identify new, native proteins which are involved in synaptic
machinery and cell adhesion. Densin
is further described in Kennedy, M.B, Trends Neurosci. {England), 20(6):264
(1997) and Apperson, et al., J.
Neurosci., 16(21):6839 (1996).
Efforts are therefore being undertaken by both industry and academia to
identify new proteins having
leucine rich repeats to better understand protein-protein interactions. Of
particular interest are those proteins
having leucine rich repeats and homology to known proteins having leucine rich
repeats such as KIAA0231 and
densin. Many efforts are focused on the screening of mammalian recombinant DNA
libraries to identify the
coding sequences for novel secreted and membrane-bound proteins having leucine
rich repeats. Examples of
screening methods and techniques are described in the literature [see, for
example, Klein et al. , Proc. Natl.
Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)].
We describe herein the identification and characterization of a novel
polypeptide which has homology
to leucine rich repeat proteins, designated herein as PR0247.
40. PR0302 PR0303. PR0304. PR0307 and PR0343
1 S Proteases are enzymatic proteins which are involved in a large number of
very important biological
processes in mammalian and non-mammalian organisms. Numerous different
protease enzymes from a variety
of different mammalian and non-mammalian organisms have been both identified
and characterized. The
mammalian protease enzymes play important roles in many different biological
processes including, for example,
protein digestion, activation, inactivation, or modulation of peptide hormone
activity, and alteration of the
physical properties of proteins and enzymes.
In light of the important physiological roles played by protease enzymes,
efforts are currently being
undertaken by both industry and academia to identify new, native protease
homologs. Many of these efforts are
focused on the screening of mammalian recombinant DNA libraries to identify
the coding sequences for novel
secreted and membrane-bound receptor proteins. Examples of screening methods
and techniques are described
in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci.,
93:7108-7113 (1996); U.S. Patent No.
5,536,637)]. We herein describe the identification of novel polypeptides
having homology to various protease
enzymes, designated herein as PR0302, PR0303, PR0304, PR0307 and PR0343
polypeptides.
41. PR0328
The GLIP protein family has been characterized as comprising zinc-forger
proteins which play important
roles in embryogenesis. These proteins may function as transcriptional
regulatory proteins and are known to
be amplified in a subset of human tumors. Glioma pathogenesis protein is
structurally related to a group of plant
pathogenesis-related proteins. It is highly expressed in glioblastoma. See US
Pat. Nos. 5,582,981 (issued Dec.
I0, 1996) and 5,322,801 (issued June 21, 1996), Ellington, A.D. et al.,
Nature, 346:818 (1990), Grindley, J.C.
et al., Dev. Biol., 188(2):337 (1997), Marine, J.C. et al., Mech. Dev.,
63(2):211 (1997), The CRISP or
cysteine rich secretory protein family are a group of proteins which are also
structurally related to a group of
plant pathogenesis proteins. [Schwidetzky, U., Biochem. J., 321:325 (1997),
Pfisterer, P., Mol. Cell Biol.,
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
16 11 :6160 (1996), Kratzschmar, J., Eur. J. Biochem., 23-6(3):827 (1996)]. We
describe herein the
identification of a novel polypeptide which has homology to GLIP and CRISP,
designated herein as PR0328
polypeptides.
42. PR0335. PR0331 and PR0326
Protein-proteininteractions include receptor and antigen complexes and
signaling mechanisms. As more
is known about the structural and functional mechanisms underlying protein-
protein interactions, protein-protein
interactions can be more easily manipulated to regulate the particular result
of the protein-protein interaction.
Thus, the underlying mechanisms of protein-protein interactions are of
interest to the scientific and medical
community.
All proteins containing leucine-rich repeats are thought to be involved in
protein-protein interactions.
Leucine-rich repeats are short sequence motifs present in a number of proteins
with diverse functions and cellular
locations. The crystal structure of ribonuclease inhibitor protein has
revealed that leucine-rich repeats
correspond to beta-alpha structural units. These units are arranged so that
they form a parallel beta-sheet with
one surface exposed to solvent, so that the protein acquires an unusual,
nonglubular shape. These two features
have been indicated as responsible for the protein-binding functions of
proteins containing leucine-rich repeats.
See, Kobe and Deisenhofer, Trends Biochem. Sci.. 19(10):415-421 (Oct. 1994).
A study has been reported on leucine-rich proteoglycans which serve as tissue
organizers, orienting and
ordering collagen fibrils during ontogeny and are involved in pathological
processes such as wound healing,
tissue repair, and tumor stroma formation. Iozzo, R. V., Crit. Rev. Biochem.
Mol. Biol., 32(2):141-174
(1997). Others studies implicating leucine rich proteins in wound healing and
tissue repair are De La Salle, C.,
et al., Vouv. Rev. Fr. Hematol. (Germany), 37(4):215-222 (1995), reporting
mutations in the leucine rich motif
in a complex associated with the bleeding disorder Bernard-Soulier syndrome,
Chlemetson, K. J., Thromb.
Haemost. (Germany), 74( 1):111-116 (July 1995), reporting that platelets have
ieucine rich repeats and Ruoslahti,
E. L, et al., W09110727-A by La Jolla Cancer Research Foundation reporting
that decorin binding to
transforming growth factorp has involvement in a treatment for cancer, wound
healing and scarring. Related by
function to this group of proteins is the insulin like growth factor (IGF), in
that it is useful in wound-healing and
associated therapies concerned with re-growth of tissue, such as connective
tissue, skin and bone; in promoting
body growth in humans and animals; and in stimulating other growth-related
processes. The acid labile subunit
of IGF (ALS) is also of interest in that it increases the half-life of IGF and
is part of the IGF complex in vivo.
Another protein which has been reported to have leucine-rich repeats is the
SLIT protein which has been
reported to be useful in treating neuro-degenerative diseases such as
Alzheimer's disease, nerve damage such
as in Parkinson's disease, and for diagnosis of cancer, see,
Artavanistsakonas, S. and Rothberg, J. M.,
W09210518-A1 by Yale University. Of particular interest is LIG-1, a membrane
glycoprotein that is expressed
specifically in glial cells in the mouse brain, and has leucine rich repeats
and immunoglobulin-like domains.
Suzuki, et al., J. Biol. Chem. (U.S.), 271(37):22522 (1996). Other studies
reporting on the biological functions
of proteins having leucine rich repeats include: Tayar, N., et al., Mol. Cell
Endocrinol., (Ireland), 125(1-2):65-
70 (Dec. 1996) (gonadotropinreceptor involvement); Miura, Y., et al., Nippon
Rinsho (Japan), 54(7):1784-1789
31
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
(July 1996) (apoptosis involvement); Harris, P. C., et al., J. Am. Soc.
Nenhrol., 6(4):1125-1133 (Oct. 1995)
(kidney disease involvement).
Efforts are therefore being undertaken by both industry and academia to
identify new proteins having
leucine rich repeats to better understand protein-protein interactions. Of
particular interest are those proteins
having leucine rich repeats and homology to known proteins having leucine rich
repeats such as LIG-1, ALS and
decorin. Many efforts are focused on the screening of mammalian recombinant
DNA libraries to identify the
coding sequences for novel secreted and membrane-bound proteins having leucine
rich repeats. Examples of
screening methods and techniques are described in the literature [see, for
example, Klein et al., Proc. Natl.
Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)].
We describe herein the identification and characterization of novel
polypeptides which have homology
to proteins of the leucine rich repeat superfamily, designated herein as
PR0335, PR0331 and PR0326
polypeptides.
43. PR0332
Secreted proteins comprising a repeat characterized by an arrangement of
conserved leucine residues
(leucine-rich repeat motif) have diverse biological roles. Certain
proteoglycans, such as biglycan, fibromodulin
and decorin, are, for example, characterized by the presence of a leucine-rich
repeat of about 24 amino acids
[Ruoslahti, Ann. Rev. Cell. Biol. 4 229-255 (1988); Oldberg et al., EMBO J. 8,
2601-2604 (1989)]. In
general, proteoglycans are believed to play a role in regulating extracellular
matrix, cartilage or bone function.
The proteoglycan decorin binds to collagen type I and II and affects the rate
of fibril formation. Fibromodulin
also binds collagen and delays fibril formation. Both fibromodulin and decorin
inhibit the activity of
transforming growth factor beta (TGF-(3) (U.S. Patent No. 5,583,103 issued
December 10, 1996). TGF-~i is
known to play a key role in the induction of extracellular matrix and has been
implicated in the development of
fibrotic diseases, such as cancer and glomerulonephritis. Accordingly,
proteoglycans have been proposed for
the treatment of fibrotic cancer, based upon their ability to inhibit TGF-p's
growth stimulating activity on the
cancer cell. Proteoglycans have also been described as potentially useful in
the treatment of other proliferative
pathologies, including rheumatoid arthritis, arteriosclerosis, adult
respiratory distress syndrome, cirrhosis of the
liver, fibrosis of the lungs, post-myocardial infarction, cardiac fibrosis,
post-angioplasty restenosis, renal
interstitial fibrosis and certain dermal fibrotic conditions, such as keloids
and scarring, which might result from
burn injuries, other invasive skin injuries, or cosmetic or reconstructive
surgery (U.S. Patent No. 5,654,270,
issued August 5, 1997).
We describe herein the identification and characterization of novel
polypeptides which have homology
to proteins of the leucine rich repeat superfamily, designated herein as
PR0332 polypeptides.
44. PR0334
Microfibril bundles and proteins found in association with these bundles,
particularly attachment
molecules, are of interest in the field of dermatology, particularly in the
study of skin which has been damaged
from aging, injuries or the sun. Fibrillin microfibrils define the continuous
elastic network of skin, and are
32
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
present in dermis as microfibril bundles devoid of measurable elastin
extending from the dermal-epithelial
junction and as components of the thick elastic fibres present in the deep
reticular dermis. Moreover, Marfan
syndrome has been linked to mutations which interfere with multimerization of
fibrillin monomers or other
connective tissue elements.
Fibulin-1 is a modular glycoprotein with amino-terminal anaphlatoxin-like
modules followed by nine
epidermal growth factor (EGF)-like modules and, depending on alternative
splicing, four possible carboxyl
termini. Fibulin-2 is a novel extracellular matrix protein frequently found in
close association with microfibrils
containing either fibronectin or fibrillin. Thus, fibrillin, fibulin, and
molecules related thereto are of interest,
particularly for the use of preventing skin from being damaged from aging,
injuries or the sun, or for restoring
skin damaged from same. Moreover, these molecules are generally of interest in
the study of connective tissue
and attachment molecules and related mechanisms: Fibrillin, fibulin and
related molecules are further described
in Adams, et al., J. Mol. Biol., 272(2):226-36 (1997); Kielty and
Shuttleworth, Microsc. Res. Tech., 38(4):413-
27 (1997); and Child. J. Card. Sure.. 12(2Supp.):131-5 (1997).
Currently, efforts are being undertaken by both industry and academia to
identify new, native secreted
and membrane-bound receptor proteins, particularly secreted proteins which
have homology to fibulin and
fibrillin. Many efforts are focused on the screening of mammalian recombinant
DNA libraries to identify the
coding sequences for novel secreted and membrane-bound receptor proteins.
Examples of screening methods
and techniques are described in the literature [see, for example, Klein et
al., Proc. Natl. Acad. Sci., 93:7108-
7113 (1996); U.S. Patent No. 5,536,637)].
We herein describe the identification and characterization of novel
polypeptides having homology to
fibulin and fibrillin, designated herein as PR0334 polypeptides.
45. PRO346
The widespread occurrence of cancer has prompted the devotion of considerable
resources and
discovering new treatments of treatment. One particular method involves the
creation of tumor or cancer specific
monoclonal antibodies (mAbs) which are specific to tumor antigens. Such mAbs,
which can distinguish between
normal and cancerous cells are useful in the diagnosis, prognosis and
treatment of the disease. Particular
antigens are known to be associated with neoplastic diseases, such as
colorectal and breast cancer. Since colon
cancer is a widespread disease, early diagnosis and treatment is an important
medical goal. Diagnosis and
treatment of cancer can be implemented using monoclonal antibodies (mAbs)
specific therefore having
fluorescent, nuclear magnetic or radioactive tags. Radioactive genes, toxins
and/or drug tagged mAbs can be
used for treatment in situ with minimal patient description.
Carcinoembryonic antigen (CEA) is a glycoprotein found in human colon cancer
and the digestive
organs of a 2-6 month human embryos. CEA is a known human tumor marker and is
widely used in the
diagnosis of neoplastic diseases, such as colon cancer. For example, when the
serum levels of CEA are elevated
in a patient, a drop of CEA levels after surgery would indicate the tumor
resection was successful. On the other
hand, a subsequent rise in serum CEA levels after surgery would indicate that
metastases of the original tumor
may have formed or that new primary tumors may have appeared. CEA may also be
a target for mAb, antisense
33
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
nucleotides
46. PR0268
Protein disulfide isomerase is an enzymatic protein which is involved in the
promotion of correct
refolding of proteins through the establishment of correct disulfide bond
formation. Protein disulfide isomerase
S was initially identified based upon its ability to catalyze the renaturation
of reduced denatured RNAse
(Goldberger et al., J. Biol. Chem. 239:1406-1410 (1964) and Epstein et al.,
Cold Spring Harbor Symp. guant.
Biol. 28:439-449 (1963)). Protein disulfide isomerase has been shown to be a
resident enzyme of the
endoplasmic reticulum which is retained in the endoplasmic reticulum via a -
KDEL or -HDEL amino acid
sequence at its C-terminus.
Given the importance of disulfide bond=forming enzymes and their potential
uses in a number of
different applications, for example in increasing the yield of correct
refolding of recombinantly produced
proteins, efforts are currently being undertaken by both industry and academia
to identify new, native proteins
having homology to protein disulfide isomerase. Many of these efforts are
focused on the screening of
mammalian recombinant DNA libraries to identify the coding sequences for novel
protein disulfide isomerase
homologs. We herein describe a novel polypeptide having homology to protein
disulfide isomerase, designated
herein as PR0268.
47. PRO 30
Prolyl 4-hydroxylase is an enzyme which functions to post-translationally
hydroxylate proline residues
at the Y position of the amino acid sequence Gly-X-Y, which is a repeating
three amino acid sequence found in
both collagen and procollagen. Hydroxylation of proline residues at the Y
position of the Gly-X-Y amino acid
triplet to form 4-hydroxyproline residues at those positions is required
before newly synthesized collagen
polypeptide chains may fold into their proper three-dimensional triple-helical
conformation. If hydroxylation
does not occur, synthesized collagen polypeptides remain non-helical, are
poorly secreted by cells and cannot
assemble into stable functional collagen fibrils. Vuorio et al. , Proc. Nail.
Acad. Sci. USA 89:7467-7470 ( 1992).
Prolyl 4-hydroxylase is comprised of at least two different polypeptide
subunits, alpha and beta.
Efforts are being undertaken by both industry and academia to identify new,
native secreted and
membrane-bound receptor proteins. Many efforts are focused on the screening of
mammalian recombinant DNA
libraries to identify the coding sequences for novel secreted and membrane-
bound receptor proteins. Examples
of screening methods and techniques are described in the literature [see, for
example, Klein et al., Proc. Natl.
Acad. Sci., 93:7108-7113 (1996); U.S. Patent No. 5,536,637)]. Based upon these
efforts, Applicants have
herein identified and describe a novel polypeptide having homology to the
alpha subunit of prolyl 4-hydroxylase,
designated herein as PR0330.
48. PR0339 and PR0310
Fringe is a protein which specifically blocks serrate-mediated activation of
notch in the dorsal
compartment of the Drosophila wing imaginal disc. Fleming, et aL, Development,
124(15):2973-81 (1997).
34
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Therefore, fringe is of interest for both its role in development as well as
its ability to regulate serrate,
particularly serrate's signaling abilities. Also of interest are novel
polypeptides which may have a role in
development and/or the regulation of serrate-like molecules. Of particular
interest are novel polypeptides having
homology to fringe as identified and described herein, designated herein as
PR0339 and PR0310 polypeptides.
49. PR0244
Lectins are a class of proteins comprising a region that binds carbohydrates
specifically and non-
covalently. Numerous lectins have been identified in higher animals, both
membrane-bound and soluble, and
have been implicated in a variety of cell-recognition phenomena and tumor
metastasis.
Most lectins can be classified as either C-type (calcium-dependent) or S-type
(thiol-dependent).
Lectins are thought to play a role in regulating cellular events that are
initiated at the level of the plasma
membrane. For example, plasma membrane associated molecules are involved in
the activation of various
subsets of lymphoid cells, e.g. T-lymphocytes, and it is known that cell
surface molecules are responsible for
activation of these cells and consequently their response during an immune
reaction.
A particular group of cell adhesion molecules, selectins, belong in the
superfamily of C-type lectins.
This group includes L-selectin (peripheral lymph node homing receptor (pnHR),
LEC-CAM-1, LAM-1,
gp~MEL~ gpI~MEL' gp110"'E~, MEL-14 antigen, Leu-8 antigen, TQ-1 antigen, DREG
antigen), E-selectin
(LEC-CAM-2, LECAM-2, ELAM-1), and P-selectin (LEC-CAM-3, LECAM-3, GMP-140,
PADGEM). The
structure of selectins consists of a C-type lectin (carbohydrate binding)
domain, an epidermal growth factor-like
(EGF-like) motif, and variable numbers of complement regulatory (CR) motifs.
Selectins are associated with
leukocyte adhesion, e.g. the attachment of neutrophils to venular endothelial
cells adjacent to inflammation (E-
selectin), or with the trafficking of lymphocytes from blood to secondary
lymphoid organs, e.g. lymph nodes
and Peyer's patches (L-selectin).
Another exemplary lectin is the cell-associated macrophage antigen, Mac-2 that
is believed to be
involved in cell adhesion and immune responses. Macrophages also express a
lectin that recognizes Tn Ag, a
human carcinoma-associated epitope.
Another C-type lectin is CD95 (Fas antigen/APO-1) that is an important
mediator of immunologically
relevant regulated or programmed cell death (apoptosis). "Apoptosis" is a non-
necrotic cell death that takes
place in metazoan animal cells following activation of an intrinsic cell
suicide program. The cloning of Fas
antigen is described in PCT publication WO 91/10448, and European patent
application EP510691. The mature
Fas molecule consists of 319 amino acids of which 157 are extracellular, 17
constitute the transmembrane
domain, and 145 are intracellular. Increased levels of Fas expression at T
cell surface have been associated with
tumor cells and HIV-infected cells. Ligation of CD95 triggers apoptosis in the
presence of interleukin-1 (IL-2).
C-type lectins also include receptors for oxidized low-density lipoprotein
(LDL). This suggests a
possible role in the pathogenesis of atherosclerosis.
We herein describe the identification and characterization of novel
polypeptides having homology to C-
type lectins, designated herein as PR0244 polypeptides.
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
SUMMARY OF THE INVENTION
1. PR0211 and PR0217
Applicants have identified cDNA clones that encode novel polypeptides having
homology to EGF,
designated in the present application as "PR0211" and "PR0217" polypeptides.
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
S a PR0211 or PR0217 polypeptide. In one aspect, the isolated nucleic acid
comprises DNA encoding EGF-like
homologue PR0211 and PR0217 polypeptides of Fig. 2 (SEQ ID N0:2) and/or 4 (SEQ
ID N0:4) indicated in
Fig. 1 (SEQ ID NO1) and/or Fig. 3 (SEQ ID N0:3), respectively, or is
complementary to such encoding nucleic
acid sequence, and remains stably bound to it under at least moderate, and
optionally, under high stringency
conditions.
In another embodiment, the invention provides isolated PR0211 and PR0217 EGF-
like homologue
PR0211 and PR0217 polypeptides. In particular, the invention provides isolated
native sequence PR021 l and
PR0217 EGF-like homologue polypeptides, which in one embodiment, includes an
amino acid sequence
comprising residues: 1 to 353 of Fig. 2 (SEQ ID N0:2) or (2) 1 to 379 of Fig.
4 (SEQ ID NO: 4).
1 S 2. PR0230
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0230".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0230 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0230
polypeptide having amino acid residues 1 through 467 of Figure 6 (SEQ ID
N0:12), or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0230 polypeptide. In
particular, the
invention provides isolated native sequence PR0230 polypeptide, which in one
embodiment, includes an amino
2S acid sequence comprising residues 1 through 467 of Figure 6 (SEQ ID N0:12).
In another embodiment, the invention provides an expressed sequence tag (EST)
comprising the
nucleotide sequence of SEQ ID N0:13 (Figure 7) which is herein designated as
DNA20088.
3. PR0232
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0232".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0232 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0232
polypeptide having amino acid residues 1 to 114 of Figure 9 (SEQ ID NO: I8),
or is complementary to such
3S encoding nucleic acid sequence, and remains stably bound to it under at
least moderate, and optionally, under
high stringency conditions.
36
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In another embodiment, the invention provides isolated PR0232 polypeptide. In
particular, the
invention provides isolated native sequence PR0232 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues I to 114 of Figure 9 (SEQ ID N0:18).
4. PR0187
Applicants have identified a cDNA clone that encodes a novel polypeptide,
designated in the present
application as "PR0187".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0187 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0187
polypeptide of Figure 11 (SEQ ID N0:23), or is complementary to such encoding
nucleic acid sequence, and
remains stably bound to it under at least moderate, and optionally, under high
stringency conditions. In another
aspect, the invention provides a nucleic acid comprising the coding sequence
of Figure 10 (SEQ ID N0:22) or
its complement. In another aspect, the invention provides a nucleic acid of
the full length protein of clone
DNA27864-1 I55, deposited with the ATCC under accession number ATCC 209375,
alternatively the coding
sequence of clone DNA27864-1155, deposited under accession number ATCC 209375.
In yet another embodiment, the invention provides isolated PR0187 polypeptide.
In particular, the
invention provides isolated native sequence PROI87 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 205 of Figure 11 (SEQ ID N0:23).
Alternatively, the invention provides
a polypeptide encoded by the nucleic acid deposited under accession number
ATCC 209375.
5. PR0265
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0265".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0265 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0265
polypeptide having amino acid residues 1 to 660 of Figure 13 (SEQ ID N0:28),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0265 polypeptide. In
particular, the
invention provides isolated native sequence PR0265 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 660 of Figure 13 (SEQ ID N0:28). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0265
polypeptide.
6. PR0219
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0219".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0219 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0219
37
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
polypeptide having amino acid residues 1 to 915 of Figure 15 (SEQ ID N0:34),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0219 polypeptide. In
particular, the
invention provides isolated native sequence PR0219 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 915 of Figure 15 (SEQ ID N0:34).
7. PR0246
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0246".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0246 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0246
polypeptide having amino acid residues 1 to 390 of Figure 17 (SEQ ID N0:39),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0246 polypeptide. In
particular, the
invention provides isolated native sequence PR0246 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 390 of Figure 17 (SEQ ID N0:39). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0246
polypeptide.
8. PR0228
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to CD97,
EMR1 and latrophilin, wherein the polypeptide is designated in the present
application as "PR0228".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0228 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0228
polypeptide having amino acid residues 1 to 690 of Figure 19 (SEQ ID N0:49),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0228 polypeptide. In
particular, the
invention provides isolated native sequence PR0228 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 690 of Figure l9 (SEQ ID N0:49). An
additional embodiment of the
present invention is directed to an isolated extraceliular domain of a PR0228
polypeptide.
In another embodiment, the invention provides an expressed sequence tag (EST)
comprising the
nucleotide sequence of SEQ ID N0:50, designated herein as DNA21951.
9. PR0533
Applicants have identified a cDNA clone (DNA49435-1219) that encodes a novel
polypeptide,
designated in the present application as PR0533.
38
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In one embodiment, the invention provides an isolated nucleic acid molecule
having at least about 80%
sequence identity to (a) a DNA molecule encoding a PR0533 polypeptide
comprising the sequence of amino
acids 23 to 216 of Figure 22 (SEQ ID N0:59), or (b) the complement of the DNA
molecule of (a). The
sequence identity preferably is about 85 % , more preferably about 90 % , most
preferably about 95 %a . In one
aspect, the isolated nucleic acid has at least about 80 % , preferably at
least about 85 % , more preferably at least
about 90 % , and most preferably at least about 95 % sequence identity with a
polypeptide having amino acid
residues 23 to 216 of Figure 22 (SEQ ID N0:59). Preferably, the highest degree
of sequence identity occurs
within the secreted portion (amino acids 23 to 216 of Figure 22, SEQ ID
N0:59). In a further embodiment, the
isolated nucleic acid molecule comprises DNA encoding a PR0533 polypeptide
having amino acid residues 1
to 216 of Figure 22 (SEQ ID N0:59), or is complementary to such encoding
nucleic acid sequence, and remains
stably bound to it under at least moderate, and optionally, under high
stringency conditions. In another aspect,
the invention provides a nucleic acid of the full length protein of clone
DNA49435-1219, deposited with the
ATCC under accession number ATCC 209480.
In yet another embodiment, the invention provides isolated PR0533 polypeptide.
In particular, the
invention provides isolated native sequence PR0533 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 23 to 216 of Figure 22 (SEQ ID N0:59).
Native PR0533 polypeptides with
or without the native signal sequence (amino acids 1 to 22 in Figure 22 (SEQ
ID N0:59)), and with or without
the initiating methionine are specifically included. Alternatively, the
invention provides a PR0533 polypeptide
encoded by the nucleic acid deposited under accession number ATCC 209480.
10. PR0245
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0245".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0245 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0245
polypeptide having amino acid residues 1 to 312 of Fig. 24 (SEQ ID N0:64), or
is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0245 polypeptide. In
particular, the
invention provides isolated native sequence PR0245 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 312 of Figure 24 (SEQ ID N0:64).
11. PR0220, PR0221 and PR0227
Applicants have identified cDNA clones that each encode novel polypeptides,
all having leucine rich
repeats. These polypeptides are designated in the present application as
PR0220, PR0221 and PR0227.
In one embodiment, the inventionprovides isolated nucleic acid molecules
comprising DNA respectively
encoding PR0220, PR0221 and PR0227, respectively. In one aspect, provided
herein is an isolated nucleic
acid comprises DNA encoding the PR0220 polypeptide having amino acid residues
1 through 708 of Figure 26
39
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
(SEQ ID N0:69), or is complementary to such encoding nucleic acid sequence,
and remains stably bound to it
under at least moderate, and optionally, under high stringency conditions.
Also provided herein is an isolated
nucleic acid comprises DNA encoding the PR0221 polypeptide having amino acid
residues 1 through 259 of
Figure 28 (SEQ ID N0:71), or is complementary to such encoding nucleic acid
sequence, and remains stably
bound to it under at least moderate, and optionally, under high stringency
conditions. Moreover, also provided
herein is an isolated nucleic acid comprises DNA encoding the PR0227
polypeptide having amino acid residues
1 through 620 of Figure 30 (SEQ ID N0:73), or is complementary to such
encoding nucleic acid sequence, and
remains stably bound to it under at least moderate, and optionally, under high
stringency conditions.
In another embodiment, the invention provides isolated PR0220, PR0221 and
PR0227 polypeptides.
In particular, provided herein is the isolated native sequence for the PR0220
polypeptide, which in one
embodiment, includes an amino acid sequence comprising residues 1 to 708 of
Figure 26 (SEQ ID N0:69).
Additionally provided herein is the isolated native sequence for the PR0221
polypeptide, which in one
embodiment, includes an amino acid sequence comprising residues 1 to 259 of
Figure 28 (SEQ ID N0:71).
Moreover, provided herein is the isolated native sequence for the PR0227
polypeptide, which in one
embodiment, includes an amino acid sequence comprising residues 1 to 620 of
Figure 30 (SEQ ID N0:73}.
12. PR0258
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to CRTAM
and poliovirus receptor precursors, wherein the polypeptide is designated in
the present application as
"PR0258".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0258 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0258
polypeptide having amino acid residues 1 to 398 of Figure 32 (SEQ ID N0:84),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0258 polypeptide. In
particular, the
invention provides isolated native sequence PR0258 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 398 of Figure 32 (SEQ ID N0:84). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0258
polypeptide.
13. PR 266
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0266".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0266 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0266
polypeptide having amino acid residues 1 to 696 of Figure 34 (SEQ ID N0:91),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In another embodiment, the invention provides isolated PR0266 polypeptide. In
particular, the
invention provides isolated native sequence PR0266 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 696 of Figure 34 (SEQ ID N0:91).
14. PR0269
S Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as PR0269.
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0269 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0269
polypeptide having amino acid residues 1 to 490 of Fig. 36 (SEQ ID N0:96), or
is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0269 polypeptide. In
particular, the
invention provides isolated native sequence PR0269 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 490 of Figure 36 (SEQ ID N0:96). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0269
polypeptide.
15. PR0287
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0287".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0287 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0287
polypeptide having amino acid residues 1 to 415 of Fig. 38 (SEQ ID N0:104), or
is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0287 polypeptide. In
particular, the
invention provides isolated native sequence PR0287 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 415 of Figure 38 (SEQ ID N0:104).
16. PR0214
Applicants have identified a cDNA clone that encodes a novel polypeptide,
designated in the present
application as "PR0214".
1n one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0214 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0214
polypeptide of Fig. 40 (SEQ ID N0:109), or is complementary to such encoding
nucleic acid sequence, and
remains stably bound to it under at least moderate, and optionally, under high
stringency conditions. In another
aspect, the invention provides a nucleic acid comprising the coding sequence
of Fig. 39 (SEQ ID N0:108) or
its complement. In another aspect, the invention provides a nucleic acid of
the full length protein of clone
41
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
DNA32286-1191, deposited with ATCC under accession number ATCC 209385.
In yet another embodiment, the invention provides isolated PR0214 polypeptide.
In particular, the
invention provides isolated native sequence PR02I4 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising the residues of Figure 40 (SEQ ID N0:109).
Alternatively, the invention provides
a polypeptide encoded by the nucleic acid deposited under accession number
ATCC 209385.
17. PR0317
Applicants have identified a cDNA clone that encodes a novel polypeptide,
designated in the present
application as "PR03I7".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
PR0317 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
(SEQ ID N0:113) encoding
PR0317 polypeptide having amino acid residues I to 366 of Fig. 42, or is
complementary to such encoding
nucleic acid sequence, and remains stably bound to it under at least moderate,
and optionally, under high
stringency conditions.
In another embodiment, the invention provides isolated PR0317 polypeptide. In
particular, the
invention provides isolated native-sequence PR0317 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 366 of Figure 42 (SEQ ID N0:114).
In yet another embodiment, the invention supplies a method of detecting the
presence of PR0317 in a
sample, the method comprising:
a) contacting a detectable anti-PR0317 antibody with a sample suspected of
containing PR0317; and
b) detecting binding of the antibody to the sample; wherein the sample is
selected from the group
consisting of a body fluid, a tissue sample, a cell extract, and a cell
culture medium.
In a still further embodiment a method is provided for determining the
presence of PR0317 mRNA in
a sample, the method comprising:
a) contacting a sample suspected of containing PR0317 mRNA with a detectable
nucleic acid probe that
hybridizes under moderate to stringent conditions to PR0317 mRNA; and
b) detecting hybridization of the probe to the sample.
Preferably, in this method the sample is a tissue sample and the detecting
step is by in situ hybridization,
or the sample is a cell extract and detection is by Northern analysis.
Further, the invention provides a method for treating a PR0317-associated
disorder comprising
administering to a mammal an effective amount of the PR0317 polypeptide or a
composition thereof containing
a carrier, or with an effective amount of a PR0317 agonist or PR0317
antagonist, such as an antibody which
binds specifically to PR0317.
18. PR0301
Applicants have identified a cDNA clone (DNA40628-1216) that encodes a novel
polypeptide,
designated in the present application as "PR0301".
42
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In one embodiment, the invention provides an isolated nucleic acid molecule
having at least about 80%
sequence identity to (a) a DNA molecule encoding a PR0301 polypeptide
comprising the sequence of amino
acids 28 to 258 of Fig. 44 (SEQ ID N0:119), or (b) the complement of the DNA
molecule of (a). The sequence
identity preferably is about 85 % , more preferably about 90 % , most
preferably about 95 % . In one aspect, the
isolated nucleic acid has at least about 80 % , preferably at least about 85 %
, more preferably at least about 90 % ,
and most preferably at least about 95 % sequence identity with a polypeptide
having amino acid residues 28 to
258 of Fig. 44 (SEQ ID N0:119). Preferably, the highest degree of sequence
identity occurs within the
extracellular domains (amino acids 28 to 258 of Fig. 44, SEQ ID N0:119). In a
further embodiment, the
isolated nucleic acid molecule comprises DNA encoding a PR0301 polypeptide
having amino acid residues 28
to 299 of Fig. 44 (SEQ ID N0:119), or is complementary to such encoding
nucleic acid sequence, and remains
stably bound to it under at least moderate, and optionally, under high
stringency conditions. In another aspect,
the invention provides a nucleic acid of the full length protein of clone
DNA40628-1216, deposited with the
ATCC under accession number ATCC 209432, alternatively the coding sequence of
clone DNA40628-1216,
deposited under accession number ATCC 209432.
In yet another embodiment, the invention provides isolated PR0301 polypeptide.
In particular, the
invention provides isolated native sequence PR0301 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising the extracellular domain residues 28 to 258 of Figure
44 (SEQ ID N0:119). Native
PR0301 polypeptides with or without the native signal sequence (amino acids 1
to 27 in Figure 44 (SEQ ID
N0:119), and with or without the initiating methionine are specifically
included. Additionally, the sequences
of the invention may also comprise the transmembrane domain (residues 236 to
about 258 in Figure 44; SEQ
ID N0:119) and/or the intracellular domain (about residue 259 to 299 in Figure
44; SEQ ID N0:119).
Alternatively, the invention provides a PR0301 polypeptide encoded by the
nucleic acid deposited under
accession number ATCC 209432.
19. PR0224
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0224".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0224 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0224
polypeptide having amino acid residues 1 to 282 of Figure 46 (SEQ ID N0:127),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0224 polypeptide. In
particular, the
invention provides isolated native sequence PR0224 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 282 of Figure 46 (SEQ ID N0:127).
20. PR0222
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
43
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
designated in the present application as "PR0222".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0222 polypeptide. In one aspect, ,the isolated nucleic acid comprises DNA
encoding the PR0222
polypeptide having amino acid residues 1 to 490 of Fig. 48 (SEQ ID N0:132), or
is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0222 polypeptide. In
particular, the
invention provides isolated native sequence PR0222 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 490 of Figure 48 (SEQ ID N0:132).
2I. PR0234
Applicants have identified a cDNA clone that encodes a novel lectin
polypeptide molecule, designated
in the present application as "PR0234".
In one embodiment, the invention provides an isolated nucleic acid encoding a
novel lectin comprising
DNA encoding a PR0234 polypeptide. In one aspect, the isolated nucleic acid
comprises the DNA encoding
PR0234 polypeptides having amino acid residues 1 to 382 of Fig. 50 (SEQ ID
N0:137), or is complementary
to such encoding nucleic acid sequence, and remains stably bound to it under
at least moderate, and optionally,
under high stringency conditions. In another aspect, the invention provides an
isolated nucleic acid molecule
comprising the nucleotide sequence of Fig. 49 (SEQ ID N0:136).
In another embodiment, the invention provides isolated novel PR0234
polypeptides. In particular, the
invention provides isolated native sequence PR0234 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 382 of Figure 50 (SEQ ID N0:137).
In yet another embodiment, the invention provides oligonucleotide probes
useful for isolating genomic
and cDNA nucleotide sequences.
22. PR0231
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to a putative
acid phosphatase, wherein the polypeptide is designated in the present
application as "PR0231 ".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0231 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0231
polypeptide having amino acid residues 1 to 428 of Fig. 52 (SEQ ID N0:142), or
is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0231 polypeptide. In
particular, the
invention provides isolated native sequence PR0231 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 428 of Figure 52 (SEQ ID N0:142).
44
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
23. PR0229
Applicants have identified' a cDNA clone that encodes a novel polypeptide
having homology to
scavenger receptors wherein the polypeptide is designated in the present
application as "PR0229".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0229 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0229
polypeptide having amino acid residues 1 to 347 of Figure S4 (SEQ ID N0:148),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0229 polypeptide. In
particular, the
invention provides isolated native sequence PR0229 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 347 of Figure S4 (SEQ ID N0:148).
24. PR0238
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to
reductase, wherein the polypeptide is designated in the present application as
"PR0238".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0238 poIypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0238
polypeptide having amino acid residues 1 to 310 of Figure 56 (SEQ ID NO:1S3),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0238 polypeptide. In
particular, the
invention provides isolated native sequence PR0238 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 310 of Figure S6 (SEQ ID N0:153).
25. PR0233
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0233".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0233 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0233
polypeptide having amino acid residues 1 to 300 of Figure 58 (SEQ ID NO:1S9),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0233 polypeptide. In
particular, the
invention provides isolated native sequence PR0233 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 300 of Figure S8 (SEQ ID N0:159).
26. PR0223
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to serine
4S
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
carboxypeptidase polypeptides, wherein the polypeptide is designated in the
present application as "PR0223".
in one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0223 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0223
polypeptide having amino acid residues 1 to 476 of Figure 60 (SEQ ID N0:164),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0223 polypeptide. In
particular, the
invention provides isolated native sequence PR0223 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 476 of Figure 60 (SEQ ID N0:164).
27. FR0235
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0235".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0235 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0235
polypeptide having amino acid residues 1 to 552 of Figure 62 (SEQ ID N0:170),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0235 polypeptide. In
particular, the
invention provides isolated native sequence PR0235 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 552 of Figure 62 (SEQ ID N0:170).
28. PR0236 and PR0262
Applicants have identified cDNA clones that encode novel polypeptides having
homology to [3-
galactosidase, wherein those polypeptides are designated in the present
application as "PR0236" and "PR0262".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0236 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0236
polypeptide having amino acid residues 1 to 636 of Figure 64 (SEQ ID N0:175),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides an isolated nucleic acid
molecule comprising DNA
encoding a PR0262 polypeptide. In one aspect, the isolated nucleic acid
comprises DNA encoding the PR0262
polypeptide having amino acid residues 1 to 654 of Figure 66 (SEQ ID N0:177),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0236 polypeptide. In
particular, the
invention provides isolated native sequence PR0236 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 636 of Figure 64 (SEQ ID N0:175).
46
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In another embodiment, the invention provides isolated PR0262 polypeptide. In
particular, the
invention provides isolated native sequence PR0262 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 654 of Figure 66 (SEQ ID N0:177).
29. PR0239
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0239".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0239 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0239
polypeptide having amino acid residues 1 to 501 of Figure 68 (SEQ ID N0:185),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0239 polypeptide. In
particular, the
invention provides isolated native sequence PR0239 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 501 of Figure 68 (SEQ ID N0:185).
30. PR0257
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0257".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0257 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0257
polypeptide having amino acid residues 1 to 607 of Figure 70 (SEQ ID N0:190),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0257 polypeptide. In
particular, the
invention provides isolated native sequence PR0257 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 607 of Figure 70 (SEQ ID N0:190). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0257
polypeptide.
31. PR0260
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0260".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0260 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0260
polypeptide having amino acid residues 1 to 467 of Figure 72 (SEQ ID N0:195),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
47
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In another embodiment, the invention provides isolated PR0260 polypeptide. In
particular, the
invention provides isolated native sequence PR0260 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 467 of Figure 72 (SEQ ID N0:195).
32. PR0263
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to CD44
antigen, wherein the polypeptide is designated in the present application as
"PR0263".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0263 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0263
polypeptide having amino acid residues 1 to 322 of Figure 74 (SEQ ID N0:201),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0263 polypeptide. In
particular, the
invention provides isolated native sequence PR0263 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 322 of Figure 74 (SEQ 1D N0:201). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0263
polypeptide.
33. PR0270
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0270".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0270 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
whivch includes the sequence
encoding the PR0270 polypeptide having amino acid residues 1 to 296 of Fig. 76
(SEQ ID N0:207), or is
complementary to such encoding nucleic acid sequence, and remains stably bound
to it under at least moderate,
and optionally, under high stringency conditions.
In another embodiment, the invention provides isolated PR0270 polypeptide. In
particular, the
invention provides isolated native sequence PR0270 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 296 of Figure 76 (SEQ ID N0:207).
34. PR0271
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to the
proteoglycan link protein, wherein the polypeptide is designated in the
present application as "PR0271 ".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0271 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0271
polypeptide having amino acid residues 1 to 360 of Figure 78 (SEQ ID N0:2I3),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
48
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In another embodiment, the invention provides isolated PR0271 polypeptide. In
particular, the
invention provides isolated native sequence PR0271 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues I to 360 of Figure 78 (SEQ ID N0:213).
35. PR0272
S Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0272".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0272 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0272
polypeptide having amino acid residues 1 to 328 of Figure 80 (SEQ ID N0:221),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0272 polypeptide. In
particular, the
invention provides isolated native sequence PR0272 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 328 of Figure 80 (SEQ ID N0:211 ).
1S
36. PR0294
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0294".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0294 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0294
polypeptide having amino acid residues 1 to S50 of Figure 82 (SEQ ID N0:227),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0294 polypeptide. In
particular, the
2S invention provides isolated native sequence PR0294 polypeptide, which in
one embodiment, includes an amino
acid sequence comprising residues 1 to SSO of Figure 82 (SEQ ID N0:227).
37. PR0295
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0295".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR029S polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0295
polypeptide having amino acid residues 1 to 3S0 of Figure 84 (SEQ 1D N0:236),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
3S high stringency conditions.
In another embodiment, the invention provides isolated PR0295 polypeptide. In
particular, the
invention provides isolated native sequence PR0295 polypeptide, which in one
embodiment, includes an amino
49
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
acid sequence comprising residues 1 to 350 of Figure 84 (SEQ ID N0:236).
38. PR0293
Applicants have identified a cDNA clone that encodes a novel human neuronal
leucine rich repeat
polypeptide, wherein the polypeptide is designated in the present application
as "PR0293".
S In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0293 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0293
polypeptide having amino acid residues 1 to 713 of Figure 86 (SEQ ID N0:245),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention .provides isolated PR0293 polypeptide. In
particular, the
invention provides isolated native sequence PR0293 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 7I3 of Figure 86 (SEQ ID N0:245). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0293
polypeptide.
39. PR0247
Applicants have identified a cDNA clone that encodes a novel polypeptide
having leucine rich repeats
wherein the polypeptide is designated in the present application as "PR0247".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0247 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0247
polypeptide having amino acid residues 1 to 546 of Figure 88 (SEQ ID N0:250),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0247 polypeptide. In
particular, the
invention provides isolated native sequence PR0247 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 546 of Figure 88 (SEQ ID N0:250). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0247
polypeptide.
40. PR0302, PR0303, PR0304, PR0307 and PR0343
Applicants have identified cDNA clones that encode novel polypeptides having
homology to various
proteases, wherein those polypeptide are designated in the present application
as "PR0302", "PR0303",
"PR0304", "PR0307" and "PR0343" polypeptides.
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0302 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0302
polypeptide having amino acid residues 1 to 452 of Figure 90 (SEQ ID N0:255),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In another embodiment, the invention provides an isolated nucleic acid
molecule comprising DNA
encoding a PR0303 polypeptide. In one aspect, the isolated nucleic acid
comprises DNA encoding the PR0303
polypeptide having amino acid residues 1 to 314 of Figure 92 (SEQ ID N0:257),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In yet another embodiment, the invention provides an isolated nucleic acid
molecule comprising DNA
encoding a PR0304 polypeptide. 1n one aspect, the isolated nucleic acid
comprises DNA encoding the PR0304
polypeptide having amino acid residues 1 to 556 of Figure 94 (SEQ ID N0:259),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides an isolated nucleic acid
molecule comprising DNA
encoding a PR0307 polypeptide. In one aspect, the isolated nucleic acid
comprises DNA encoding the PR0307
polypeptide having amino acid residues 1 to 383 of Figure 96 (SEQ ID N0:261),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides an isolated nucleic acid
molecule comprising DNA
encoding a PR0343 polypeptide. In one aspect, the isolated nucleic acid
comprises DNA encoding the PR0343
polypeptide having amino acid residues 1 to 317 of Figure 98 (SEQ ID N0:263),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0302 polypeptide. In
particular, the
invention provides isolated native sequence PR0302 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 452 of Figure 90 (SEQ ID N0:255).
In another embodiment, the invention provides isolated PR0303 polypeptide. In
particular, the
invention provides isolated native sequence PR0303 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 314 of Figure 92 (SEQ ID N0:257).
In another embodiment, the invention provides isolated PR0304 polypeptide. In
particular, the
invention provides isolated native sequence PR0304 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 556 of Figure 94 (SEQ ID N0:259).
In another embodiment, the invention provides isolated PR0307 polypeptide. In
particular, the
invention provides isolated native sequence PR0307 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 383 of Figure 96 (SEQ 1D N0:261).
In another embodiment, the invention provides isolated PR0343 polypeptide. In
particular, the
invention provides isolated native sequence PR0343 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 317 of Figure 98 (SEQ ID N0:263).
51
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
41. PR0328
Applicants have identified a cDNA clone that encodes a novel polypeptide,
wherein the polypeptide is
designated in the present application as "PR0328".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0328 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0328
polypeptide having amino acid residues 1 to 463 of Figure 100 (SEQ ID N0:28S),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0328 polypeptide. In
particular, the
invention provides isolated native sequence PR0328 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 463 of Figure 100 (SEQ ID N0:28S). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0306
polypeptide.
42. PR0335. PR0331 and PR0326
Applicants have identified three cDNA clones that respectively encode three
novel polypeptides, each
having leucine rich repeats and homology to LIG-1 and ALS. These polypeptides
are designated in the present
application as PR0335, PR0331 and PR0326, respectively.
In one embodiment, the invention provides three isolated nucleic acid
molecules comprising DNA
respectively encoding PR0335, PR0331 and PR0326, respectively. In one aspect,
herein is provided an
isolated nucleic acid comprising DNA encoding the PR033S polypeptide having
amino acid residues 1 through
1059 of Figure 102 (SEQ ID N0:290), or is complementary to such encoding
nucleic acid sequence, and remains
stably bound to it under at least moderate, and optionally, under high
stringency conditions. Also provided herein
is an isolated nucleic acid comprises DNA encoding the PR0331 polypeptide
having amino acid residues 1
through 640 of Figure 104 (SEQ ID N0:292), or is complementary to such
encoding nucleic acid sequence, and
remains stably bound to it under at least moderate, and optionally, under high
stringency conditions.
Additionally provided herein is an isolated nucleic acid comprises DNA
encoding the PR0326 polypeptide
having amino acid residues 1 through 1119 of Figure 106 (SEQ ID N0:294), or is
complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR033S, PR0331 and
PR0326 polypeptides
or extracellular domains thereof. In particular, the invention provides
isolated native sequence for the PR033S
polypeptide, which in one embodiment, includes an amino acid sequence
comprising residues 1 through lOS9
of Figure 102 (SEQ ID N0:290). Also provided herein is the isolated native
sequence for the PR0331
polypeptide, which in one embodiment, includes an amino acid sequence
comprising residues 1 through 640 of
Figure 104 (SEQ ID N0:292). Also provided herein is the isolated native
sequence for the PR0326 polypeptide,
which in one embodiment, includes an amino acid sequence comprising residues 1
through 1119 of Figure 106
(SEQ ID N0:294).
52
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
43. PR0332
Applicants have identified a cDNA clone (DNA40982-1235) that encodes a novel
polypeptide,
designated in the present application as "PR0332."
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA having
at least about 80% sequence identity to (a) a DNA molecule encoding a PR0358
polypeptide comprising the
sequence of amino acids 49 to 642 of Fig. 108 (SEQ ID N0:310), or (b) the
complement of the DNA molecule
of (a). The sequence identity preferably is about 85 %, more preferably about
90%, most preferably about 95%.
In one aspect, the isolated nucleic acid has at least about 80%, preferably at
least about 85% , more preferably
at least about 90%, and most preferably at least about 95% sequence identity
with a polypeptide having amino
acid residues 1 to 642 of Fig. 108 (SEQ ID N0:310). Preferably, the highest
degree of sequence identity occurs
within the leucine-rich repeat domains (amino acids 116 to 624 of Fig. 108,
SEQ ID N0:310). In a further
embodiment, the isolated nucleic acid molecule comprises DNA encoding a PR0332
polypeptide having amino
acid residues 49 to 642 of Fig. 108 (SEQ ID N0:310), or is complementary to
such encoding nucleic acid
sequence, and remains stably bound to it under at least moderate, and
optionally, under high stringency
conditions.
In another embodiment, the invention provides isolated PR0332 polypeptides. In
particular, the
invention provides isolated native sequence PR0332 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 49 to 624 of Figure 108 (SEQ ID N0:310).
Native PR0332 polypeptides
with or without the native signal sequence (amino acids 1 to 48 in Figure 108,
SEQ ID N0:310), and with or
without the initiating methionine are specifically inciuded.
44. PR0334
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to fibulin
and fibrillin, wherein the polypeptide is designated in the present
application as "PR0334".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0334 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0334
polypeptide having amino acid residues 1 to 509 of Figure 110 (SEQ ID N0:315),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0334 polypeptide. In
particular, the
invention provides isolated native sequence PR0334 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 509 of Figure 110 (SEQ ID N0:315).
45. PR0346
Applicants have identified a cDNA clone (DNA44167-1243) that encodes a novel
polypeptide,
designated in the present application as "PR0346."
In one embodiment, the invention provides an isolated nucleic acid molecule
having at least about 80%
sequence identity to (a) a DNA molecule encoding a PR0346 polypeptide
comprising the sequence of amino
53
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
acids 19 to 339 of Fig. 112 (SEQ ID NO: 320), or (b) the complement of the DNA
molecule of (a). The
sequence identity preferably is about 85 % , more preferably about 90 % , most
preferably about 95 % . In one
aspect, the isolated nucleic acid has at least about 80% , preferably at least
about 85 %, more preferably at least
about 90%, and most preferably at least about 95% sequence identity with a
polypeptide having amino acid
residues 19 to 339 of Fig. 112 (SEQ ID N0:320). Preferably, the highest degree
of sequence identity occurs
within the extracellular domains (amino acids 19 to 339 of Fig. 112, SEQ ID
N0:320). In alternative
embodiments, the polypeptide by which the homology is measured comprises the
residues 1-339, 19-360 or 19-
450 of Fig. 112, SEQ ID N0:320). In a further embodiment, the isolated nucleic
acid molecule comprises DNA
encoding a PR0346 polypeptide having amino acid residues 19 to 339 of Fig. 112
(SEQ ID N0:320),
alternatively residues 1-339, 19-360 or 19-450 of Fig. I12 (SEQ ID N0:320) or
is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions. In another aspect, the invention provides a
nucleic acid of the full length protein of
clone DNA44I67-1243, deposited with the ATCC under accession number ATCC
209434, alternatively the
coding sequence of clone DNA44167-1243, deposited under accession number ATCC
209434.
In yet another embodiment, the invention provides isolated PR0346 polypeptide.
In particular, the
invention provides isolated native sequence PR0346 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 19 to 339 of Figure 112 (SEQ ID N0:320).
Native PR0346 polypeptides
with or without the native signal sequence (residues 1 to 18 in Figure 112
(SEQ ID N0:320), with or without
the initiating methionine, with or without the transmembrane domain (residues
340 to 360) and with or without
the intracellular domain (residues 361 to 450) are specifically included.
Alternatively, the invention provides
a PR0346 polypeptide encoded by the nucleic acid deposited under accession
number ATCC 209434.
46. PR0268
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to protein
disulfide isomerase, wherein the polypeptide is designated in the present
application as "PR0268".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0268 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0268
polypeptide having amino acid residues 1 to 280 of Figure 114 (SEQ ID N0:325),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0268 polypeptide. In
particular, the
invention provides isolated native sequence PR0268 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 280 of Figure 114 (SEQ ID N0:325). An
additional embodiment of the
present invention is directed to an isolated extracellular domain of a PR0268
polypeptide.
47. PR0330
Applicants have identified a cDNA clone that encodes a novel polypeptide
having homology to the alpha
subunit of prolyl 4-hydroxylase, wherein the polypeptide is designated in the
present application as "PR0330" .
54
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
a PR0330 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding the PR0330
polypeptide having amino acid residues 1 to 533 of Figure 116 (SEQ ID N0:332),
or is complementary to such
encoding nucleic acid sequence, and remains stably bound to it under at least
moderate, and optionally, under
high stringency conditions.
In another embodiment, the invention provides isolated PR0330 polypeptide. In
particular, the
invention provides isolated native sequence PR0330 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 533 of Figure 116 (SEQ ID N0:332).
48. PR0339 and PR0310
Applicants have identified two cDNA clones wherein each clone encodes a novel
polypeptide having
homology to fringe, wherein the polypeptides are designated in the present
application as "PR0339" and
"PR0310" .
In one embodiment, the invention provides isolated nucleic acid molecules
comprising DNA encoding
a PR0339 and/or a PR0310 polypeptide. In one aspect, the isolated nucleic acid
comprises DNA encoding the
PR0339 polypeptide having amino acid residues 1 to 772 of Figure 118 (SEQ ID
N0:339), or is complementary
to such encoding nucleic acid sequence, and remains stably bound to it under
at least moderate, and optionally,
under high stringency conditions. In another aspect, the isolated nucleic acid
comprises DNA encoding the
PR0310 polypeptide having amino acid residues 1 to 318 of Figure 120 (SEQ ID
N0:341 ), or is complementary
to such encoding nucleic acid sequence, and remains stably bound to it under
at least moderate, and optionally,
under high stringency conditions.
In another embodiment, the invention provides isolated PR0339 as well as
isolated PR0310
polypeptides. In particular, the invention provides isolated native sequence
PR0339 polypeptide, which in one
embodiment, includes an amino acid sequence comprising residues 1 to 772 of
Figure 118 (SEQ ID N0:339).
The invention further provides isolated native sequence PR0310 polypeptide,
which in one embodiment, includes
an amino acid sequence comprising residues 1 to 318 of Figure 120 (SEQ ID
N0:341).
49. PR0244
Applicants have identified a cDNA clone that encodes a novel polypeptide,
designated in the present
application as "PR0244".
In one embodiment, the invention provides an isolated nucleic acid molecule
comprising DNA encoding
PR0244 polypeptide. In one aspect, the isolated nucleic acid comprises DNA
encoding PR0244-polypeptide
having amino acid residues 1 to 219 of Fig. 122 (SEQ ID N0:377), or is
complementary to such encoding
nucleic acid sequence, and remains stably bound to it under at least moderate,
and optionally, under high
stringency conditions.
In another embodiment, the invention provides isolated PR0244 polypeptide. In
particular, the
invention provides isolated native sequence PR0244 polypeptide, which in one
embodiment, includes an amino
acid sequence comprising residues 1 to 219 of Figure 122 (SEQ ID N0:377).
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
50. Additional Embodiments
In other embodiments of the present invention, the invention provides vectors
comprising DNA
encoding any of the herein described polypeptides. Host cell comprising any
such vector are also provided. By
way of example, the host cells may be CHO cells, E. coli, or yeast. A process
for producing any of the herein
described polypeptides is further provided and comprises culturing host cells
under conditions suitable for
expression of the desired polypeptide and recovering the desired polypeptide
from the cell culture.
In other embodiments, the invention provides chimeric molecules comprising any
of the herein described
polypeptides fused to a heterologous polypeptide or amino acid sequence.
Example of such chimeric molecules
comprise any of the herein described polypeptides fused to an epitope tag
sequence or a Fc region of an
immunoglobulin.
In another embodiment, the invention provides an antibody which specifically
binds to any of the above
or below described polypeptides. Optionally, the antibody is a monoclonal
antibody, humanized antibody,
antibody fragment or single-chain antibody.
In yet other embodiments, the invention provides oligonucleotide probes useful
for isolating genomic
and cDNA nucleotide sequences, wherein those probes may be derived from any of
the above or below described
nucleotide sequences.
In other embodiments, the invention provides an isolated nucleic acid molecule
comprising a nucleotide
sequence that encodes a PRO polypeptide.
In one aspect, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least about
80% sequence identity, preferably at least about 81% sequence identity, more
preferably at least about 82%
sequence identity, yet more preferably at least about 83 % sequence identity,
yet more preferably at least about
84% sequence identity, yet more preferably at least about 85%a sequence
identity, yet more preferably at least
about 86%a sequence identity, yet more preferably at least about 87% sequence
identity, yet more preferably at
least about 88 % sequence identity, yet more preferably at least about 89 %
sequence identity, yet more preferably
at least about 90% sequence identity, yet more preferably at least about 91 %
sequence identity, yet more
preferably at least about 92% sequence identity, yet more preferably at least
about 93% sequence identity, yet
more preferably at least about 94 % sequence identity, yet more preferably at
least about 95 % sequence identity,
yet more preferably at least about 96% sequence identity, yet more preferably
at least about 97% sequence
identity, yet more preferably at least about 98% sequence identity and yet
more preferably at least about 99%
sequence identity to (a) a DNA molecule encoding a PRO polypeptide having a
full-length amino acid sequence
as disclosed herein, an amino acid sequence lacking the signal peptide as
disclosed herein or an extracellular
domain of a transmembrane protein, with or without the signal peptide, as
disclosed herein, or (b) the
complement of the DNA molecule of (a).
In other aspects, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least about
80% sequence identity, preferably at least about 81 % sequence identity, more
preferably at least about 82%
sequence identity, yet more preferably at least about 83% sequence identity,
yet more preferably at least about
84 % sequence identity, yet more preferably at least about 85 % sequence
identity, yet more preferably at least
about 86% sequence identity, yet more preferably at least about 87% sequence
identity, yet more preferably at
56
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
least about 88 % sequence identity, yet more preferably at least about 89 %
sequence identity, yet more preferably
at least about 90% sequence identity, yet more preferably at least about 91 %
sequence identity, yet more
preferably at least about 92 % sequence identity, yet more preferably at least
about 93 % sequence identity, yet
more preferably at least about 94 % sequence identity, yet more preferably at
least about 95 % sequence identity,
yet more preferably at least about 96 % sequence identity, yet more preferably
at least about 97 % sequence
identity, yet more preferably at least about 98% sequence identity and yet
more preferably at least about 99%
sequence identity to (a) a DNA molecule comprising the coding sequence of a
full-length PRO polypeptide cDNA
as disclosed herein, the coding sequence of a PRO polypeptide lacking the
signal peptide as disclosed herein or
the coding sequence of an extracellular domain of a transmembrane PRO
polypeptide, with or without the signal
peptide, as disclosed herein, or (b) the complement of the DNA molecule of
(a).
In a further aspect, the invention concerns an isolated nucleic acid molecule
comprising a nucleotide
sequence having at least about 80 % sequence identity, preferably at least
about 81 % sequence identity, more
preferably at least about 82 % sequence identity, yet more preferably at least
about 83 % sequence identity, yet
more preferably at least about 84 % sequence identity, yet more preferably at
least about 85 % sequence identity,
yet more preferably at least about 86% sequence identity, yet more preferably
at least about 87% sequence
identity, yet more preferably at least about 88% sequence identity, yet more
preferably at least about 89%
sequence identity, yet more preferably at least about 90% sequence identity,
yet more preferably at least about
91 % sequence identity, yet more preferably at least about 92 % sequence
identity, yet more preferably at least
about 93 % sequence identity, yet more preferably at least about 94 % sequence
identity, yet more preferably at
least about 95 % sequence identity, yet more preferably at least about 96%
sequence identity, yet more preferably
at least about 97 % sequence identity, yet more preferably at least about 98 %
sequence identity and yet more
preferably at least about 99% sequence identity to (a) a DNA molecule that
encodes the same mature polypeptide
encoded by any of the human protein cDNAs deposited with the ATCC as disclosed
herein, or (b) the
complement of the DNA molecule of (a).
Another aspect the invention provides an isolated nucleic acid molecule
comprising a nucleotide
sequence encoding a PRO polypeptide which is either transmembrane domain-
deleted or transmembrane domain-
inactivated, or is complementary to such encoding nucleotide sequence, wherein
the transmembrane domains)
of such polypeptide are disclosed herein. Therefore, soluble extracellular
domains of the herein described PRO
polypeptides are contemplated.
Another embodiment is directed to fragments of a PRO polypeptide coding
sequence, or the complement
thereof, that may find use as, for example, hybridization probes or for
encoding fragments of a PRO polypeptide
that may optionally encode a polypeptide comprising a binding site for an anti-
PRO antibody. Such-nucleic acid
fragments are usually at least about 20 nucleotides in length, preferably at
least about 30 nucleotides in length,
more preferably at least about 40 nucleotides in length, yet more preferably
at least about 50 nucleotides in
length, yet more preferably at least about 60 nucleotides in length, yet more
preferably at least about 70
nucleotides in length, yet more preferably at least about 80 nucleotides in
length, yet more preferably at least
about 90 nucleotides in length, yet more preferably at least about 100
nucleotides in length, yet more preferably
at least about 110 nucleotides in length, yet more preferably at least about
120 nucleotides in length, yet more
57
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
preferably at least about 130 nucleotides in length, yet more preferably at
least about 140 nucleotides in length,
yet more preferably at least about 150 nucleotides in length, yet more
preferably at least about 160 nucleotides
in length, yet more preferably at least about 170 nucleotides in length, yet
more preferably at least about 180
nucleotides in length, yet more preferably at least about 190 nucleotides in
length, yet more preferably at least
about 200 nucleotides in length, yet more preferably at least about 250
nucleotides in length, yet more preferably
at least about 300 nucleotides in length, yet more preferably at least about
350 nucleotides in length, yet more
preferably at least about 400 nucleotides in length, yet more preferably at
least about 450 nucleotides in length,
yet more preferably at least about 500 nucleotides in length, yet more
preferably at least about 600 nucleotides
in length, yet more preferably at least about 700 nucleotides in length, yet
more preferably at least about 800
nucleotides in length, yet more preferably at least about 900 nucleotides in
length and yet more preferably at least
about 1000 nucleotides in length, wherein in this context the term "about"
means the referenced nucleotide
sequence length plus or minus 10% of that referenced length. It is noted that
novel fragments of a PRO
polypeptide-encoding nucleotide sequence may be determined in a routine manner
by aligning the PRO
polypeptide-encoding nucleotide sequence with other known nucleotide sequences
using any of a number of well
known sequence alignment programs and determining which PRO polypeptide-
encoding nucleotide sequence
fragments) are novel_ All of such PRO poiypeptide-encoding nucleotide
sequences are contemplated herein.
Also contemplated are the PRO polypeptide fragments encoded by these
nucleotide molecule fragments,
preferably those PRO polypeptide fragments that comprise a binding site for an
anti-PRO antibody.
In another embodiment, the invention provides isolated PRO polypeptide encoded
by any of the isolated
nucleic acid sequences hereinabove identified.
In a certain aspect, the invention concerns an isolated PRO polypeptide,
comprising an amino acid
sequence having at least about 80% sequence identity, preferably at least
about 81 % sequence identity, more
preferably at least about 82 % sequence identity, yet more preferably at least
about 83 % sequence identity, yet
more preferably at least about 84 % sequence identity, yet more preferably at
least about 85 % sequence identity,
yet more preferably at least about 86% sequence identity, yet more preferably
at least about 87% sequence
identity, yet more preferably at least about 88% sequence identity, yet more
preferably at least about 89%
sequence identity, yet more preferably at least about 90% sequence identity,
yet more preferably at least about
9I % sequence identity, yet more preferably at least about 92% sequence
identity, yet more preferably at least
about 93% sequence identity, yet more preferably at least about 94% sequence
identity, yet more preferably at
least about 95 % sequence identity, yet more preferably at least about 96 %
sequence identity, yet more preferably
at least about 97 % sequence identity, yet more preferably at least about 98 %
sequence identity and yet more
preferably at least about 99% sequence identity to a PRO polypeptide having a
full-length amino acid sequence
as disclosed herein, an amino acid sequence lacking the signal peptide as
disclosed herein or an extracellular
domain of a transmembrane protein, with or without the signal peptide, as
disclosed herein.
In a further aspect, the invention concerns an isolated PRO polypeptide
comprising an amino acid
sequence having at least about 80% sequence identity, preferably at least
about 81 % sequence identity, more
preferably at least about 82% sequence identity, yet more preferably at least
about 83% sequence identity, yet
more preferably at least about 84 % sequence identity, yet more preferably at
least about 85 % sequence identity,
58
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
yet more preferably at least about 86% sequence identity, yet more preferably
at least about 87%a sequence
identity, yet more preferably at least about 88% sequence identity, yet more
preferably at least about 89%
sequence identity, yet more preferably at least about 90% sequence identity,
yet more preferably at least about
91 % sequence identity, yet more preferably at least about 92% sequence
identity, yet more preferably at least
about 93 % sequence identity, yet more preferably at least about 94 % sequence
identity, yet more preferably at
least about 95 % sequence identity, yet more preferably at least about 96 %
sequence identity, yet more preferably
at least about 97 % sequence identity, yet more preferably at least about 98 %
sequence identity and yet more
preferably at least about 99% sequence identity to an amino acid sequence
encoded by any of the human protein
cDNAs deposited with the ATCC as disclosed herein.
In a further aspect, the invention concerns an isolated PRO polypeptide
comprising an amino acid
sequence scoring at least about 80% positives, preferably at least about 81 %
positives, more preferably at least
about 82% positives, yet more preferably at least about 83% positives, yet
more preferably at least about 84%
positives, yet more preferably at least about 85% positives, yet more
preferably at least about 86% positives,
yet more preferably at least about 87% positives, yet more preferably at least
about 88% positives, yet more
preferably at least about 89% positives, yet more preferably at least about
90% positives, yet more preferably
at least about 91 % positives, yet more preferably at least about 92 %
positives, yet more preferably at least about
93 % positives, yet more preferably at least about 94 % positives, yet more
preferably at least about 95 %
positives, yet more preferably at least about 96% positives, yet more
preferably at least about 97% positives,
yet more preferably at least about 98% positives and yet more preferably at
least about 99% positives when
compared with the amino acid sequence of a PRO polypeptide having a full-
length amino acid sequence as
disclosed herein, an amino acid sequence lacking the signal peptide as
disclosed herein or an extracellular domain
of a transmembrane protein, with or without the signal peptide, as disclosed
herein.
In a specific aspect, the invention provides an isolated PRO polypeptide
without the N-terminal signal
sequence and/or the initiating methionine and is encoded by a nucleotide
sequence that encodes such an amino
acid sequence as hereinbefore described. Processes for producing the same are
also herein described, wherein
those processes comprise culturing a host cell comprising a vector which
comprises the appropriate encoding
nucleic acid molecule under conditions suitable for expression of the PRO
polypeptide and recovering the PRO
polypeptide from the cell culture.
Another aspect the invention provides an isolated PRO polypeptide which is
either transmembrane
domain-deleted or transmembrane domain-inactivated. Processes for producing
the same are also herein
described, wherein those processes comprise culturing a host cell comprising a
vector which comprises the
appropriate encoding nucleic acid molecule under conditions suitable for
expression of the PRO polypeptide and
recovering the PRO polypeptide from the cell culture.
In yet another embodiment, the invention concerns agonists and antagonists of
a native PRO polypeptide
as defined herein. In a particular embodiment, the agonist or antagonist is an
anti-PRO antibody or a small
molecule.
In a further embodiment, the invention concerns a method of identifying
agonists or antagonists to a
PRO polypeptide which comprise contacting the PRO polypeptide with a candidate
molecule and monitoring a
59
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
biological activity mediated by said PRO polypeptide. Preferably, the PRO
polypeptide is a native PRO
polypeptide.
In a still further embodiment, the invention concerns a composition of matter
comprising a PRO
polypeptide, or an agonist or antagonist of a PRO polypeptide as herein
described, or an anti-PRO antibody, in
combination with a carrier. Optionally, the carrier is a pharmaceutically
acceptable carrier.
S Another embodiment of the present invention is directed to the use of a PRO
polypeptide, or an agonist
or antagonist thereof as hereinbefore described, or an anti-PRO antibody, for
the preparation of a medicament
useful in the treatment of a condition which is responsive to the PRO
polypeptide, an agonist or antagonist
thereof or an anti-PRO antibody.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows a nucleotide sequence (SEQ ID NO: l ) of a native sequence
PR0211 cDNA, wherein
SEQ ID NO:1 is a clone designated herein as "DNA32292-1131 ".
Figure 2 shows the amino acid sequence (SEQ ID N0:2) derived from the coding
sequence of SEQ ID
NO:1 shown in Figure 1.
Figure 3 shows a nucleotide sequence (SEQ ID N0:3) of a native sequence PR0217
cDNA, wherein
SEQ ID N0:3 is a clone designated herein as "DNA33094-1131 ".
Figure 4 shows the amino acid sequence (SEQ ID N0:4) derived from the coding
sequence of SEQ ID
N0:3 shown in Figure 3.
Figure 5 shows a nucleotide sequence (SEQ ID NO:11) of a native sequence
PR0230 cDNA, wherein
SEQ ID NO:11 is a clone designated herein as "DNA33223-1136".
Figure 6 shows the amino acid sequence (SEQ ID N0:12) derived from the coding
sequence of SEQ
ID NO:11 shown in Figure 5.
Figure 7 shows a nucleotide sequence designated herein as DNA20088 (SEQ ID
N0:13).
Figure 8 shows a nucleotide sequence (SEQ ID N0:17) of a native sequence
PR0232 cDNA, wherein
SEQ ID N0:17 is a clone designated herein as "DNA34435-1140".
Figure 9 shows the amino acid sequence (SEQ ID N0:18) derived from the coding
sequence of SEQ
ID N0:17 shown in Figure 8.
Figure 10 shows a nucleotide sequence (SEQ ID N0:22) of a native sequence
PR0187 cDNA, wherein
SEQ ID N0:22 is a clone designated herein as "DNA27864-1155".
Figure 11 shows the amino acid sequence (SEQ ID N0:23) derived from the coding
sequence of SEQ
ID N0:22 shown in Figure 10.
Figure 12 shows a nucleotide sequence (SEQ ID N0:27) of a native sequence
PR0265 cDNA, wherein
SEQ ID N0:27 is a clone designated herein as "DNA36350-1158".
Figure 13 shows the amino acid sequence (SEQ ID N0:28) derived from the coding
sequence of SEQ
ID N0:27 shown in Figure 12.
Figure 14 shows a nucleotide sequence (SEQ ID N0:33) of a native sequence
PR0219 cDNA, wherein
SEQ ID N0:33 is a clone designated herein as "DNA32290-1164".
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Figure 15 shows the amino acid sequence (SEQ ID N0:34) derived from the coding
sequence of SEQ
ID N0:33 shown in Figure 14.
Figure 16 shows a nucleotide sequence (SEQ ID N0:38) of a native sequence
PR0246 cDNA, wherein
SEQ ID N0:38 is a clone designated herein as "DNA35639-1172".
Figure 17 shows the amino acid sequence (SEQ ID N0:39) derived from the coding
sequence of SEQ
ID N0:38 shown in Figure 16.
Figure 18 shows a nucleotide sequence (SEQ ID N0:48) of a native sequence
PR0228 cDNA, wherein
SEQ ID N0:48 is a clone designated herein as "DNA33092-1202".
Figure 19 shows the amino acid sequence (SEQ ID N0:49) derived from the coding
sequence of SEQ
ID N0:48 shown in Figure 18.
Figure 20 shows a nucleotide sequence designated herein as DNA21951 (SEQ ID
N0:50).
Figure 21 shows a nucleotide sequence (SEQ ID N0:58) of a native sequence
PR0533 cDNA, wherein
SEQ ID N0:58 is a clone designated herein as "DNA49435-1219".
Figure 22 shows the amino acid sequence (SEQ ID N0:59) derived from the coding
sequence of SEQ
ID N0:58 shown in Figure 21.
Figure 23 shows a nucleotide sequence (SEQ ID N0:63) of a native sequence
PR0245 cDNA, wherein
SEQ ID N0:63 is a clone designated herein as "DNA35638-1141 ".
Figure 24 shows the amino acid sequence (SEQ ID N0:64) derived from the coding
sequence of SEQ
ID N0:63 shown in Figure 23.
Figure 25 shows a nucleotide sequence (SEQ ID N0:68) of a native sequence
PR0220 cDNA, wherein
SEQ ID N0:68 is a clone designated herein as "DNA32298-1132".
Figure 26 shows the amino acid sequence (SEQ ID N0:69) derived from the coding
sequence of SEQ
ID N0:68 shown in Figure 25.
Figure 27 shows a nucleotide sequence (SEQ ID N0:70) of a native sequence
PR0221 cDNA, wherein
SEQ ID N0:70 is a clone designated herein as "DNA33089-1132".
Figure 28 shows the amino acid sequence (SEQ ID N0:71) derived from the coding
sequence of SEQ
ID N0:70 shown in Figure 27.
Figure 29 shows a nucleotide sequence (SEQ ID N0:72) of a native sequence
PR0227 cDNA, wherein
SEQ ID N0:72 is a clone designated herein as "DNA33786-1132".
Figure 30 shows the amino acid sequence (SEQ ID N0:73) derived from the coding
sequence of SEQ
ID N0:72 shown in Figure 29.
Figure 31 shows a nucleotide sequence (SEQ ID N0:83) of a native sequence
PR0258 cDNA, wherein
SEQ ID N0:83 is a clone designated herein as "DNA35918-1174".
Figure 32 shows the amino acid sequence (SEQ ID N0:84) derived from the coding
sequence of SEQ
ID N0:83 shown in Figure 31.
Figure 33 shows a nucleotide sequence (SEQ ID N0:90) of a native sequence
PR0266 cDNA, wherein
SEQ ID N0:90 is a clone designated herein as "DNA37150-1178".
61
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Figure 34 shows the amino acid sequence (SEQ ID N0:91) derived from the coding
sequence of SEQ
ID N0:90 shown in Figure 33.
Figure 35 shows a nucleotide sequence (SEQ ID N0:95) of a native sequence
PR0269 cDNA, wherein
SEQ ID N0:95 is a clone designated,herein as "DNA38260-1180".
Figure 36 shows the amino acid sequence (SEQ ID N0:96) derived from the coding
sequence of SEQ
ID N0:95 shown in Figure 35.
Figure 37 shows a nucleotide sequence (SEQ ID N0:103) of a native sequence
PR0287 cDNA, wherein
SEQ ID N0:103 is a clone designated herein as "DNA39969-1185".
Figure 38 shows the amino acid sequence (SEQ ID N0:104) derived from the
coding sequence of SEQ
ID N0:103 shown in Figure 37.
Figure 39 shows a nucleotide sequence (SEQ ID N0:108) of a native sequence
PR0214 cDNA, wherein
SEQ ID N0:108 is a clone designated herein as "DNA32286-1191".
Figure 40 shows the amino acid sequence (SEQ ID N0:109) derived from the
coding sequence of SEQ
ID NO:108 shown in Figure 39.
Figure 41 shows a nucleotide sequence (SEQ ID N0:113) of a native sequence
PR0317 cDNA, wherein
1 S SEQ ID N0:113 is a clone designated herein as "DNA33461-1199".
Figure 42 shows the amino acid sequence (SEQ ID N0:114) derived from the
coding sequence of SEQ
ID N0:113 shown in Figure 41.
Figure 43 shows a nucleotide sequence (SEQ ID N0:118) of a native sequence
PR0301 cDNA, wherein
SEQ ID N0:118 is a clone designated herein as "DNA40628-1216".
Figure 44 shows the amino acid sequence (SEQ ID N0:119) derived from the
coding sequence of SEQ
ID N0:118 shown in Figure 43.
Figure 45 shows a nucleotide sequence (SEQ ID N0:126) of a native sequence
PR0224 cDNA, wherein
SEQ ID N0:126 is a clone designated herein as "DNA33221-1133".
Figure 46 shows the amino acid sequence (SEQ ID N0:127) derived from the
coding sequence of SEQ
ID N0:126 shown in Figure 45.
Figure 47 shows a nucleotide sequence (SEQ ID N0:131 ) of a native sequence
PR0222 cDNA, wherein
SEQ ID N0:131 is a clone designated herein as "DNA33107-I 135".
Figure 48 shows the amino acid sequence (SEQ ID N0:132) derived from the
coding sequence of SEQ
ID N0:131 shown in Figure 47.
Figure 49 shows a nucleotide sequence (SEQ ID N0:136) of a native sequence
PR0234 cDNA, wherein
SEQ ID N0:136 is a clone designated herein as "DNA35557-1137".
Figure 50 shows the amino acid sequence (SEQ ID N0:137) derived from the
coding sequence of SEQ
ID N0:136 shown in Figure 49.
Figure 51 shows a nucleotide sequence (SEQ ID N0:141) of a native sequence
PR0231 cDNA, wherein
SEQ ID N0:141 is a clone designated herein as "DNA34434-1139".
Figure 52 shows the amino acid sequence (SEQ ID N0:142) derived from the
coding sequence of SEQ
ID N0:141 shown in Figure 51.
62
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Figure 53 shows a nucleotide sequence (SEQ ID NO: I47) of a native sequence
PR0229 cDNA, wherein
SEQ ID N0:147 is a clone designated herein as "DNA33100-1159".
Figure 54 shows the amino acid sequence (SEQ ID N0:148) derived from the
coding sequence of SEQ
ID N0:147 shown in Figure 53.
Figure 55 shows a nucleotide sequence (SEQ ID N0:152) of a native sequence
PR0238 cDNA, wherein
SEQ ID N0:152 is a clone designated herein as "DNA35600-1162".
Figure S6 shows the amino acid sequence (SEQ 1D N0:153) derived from the
coding sequence of SEQ
ID N0:152 shown in Figure 55.
Figure 57 shows a nucleotide sequence (SEQ ID NO: IS8) of a native sequence
PR0233 cDNA, wherein
SEQ ID N0:158 is a clone designated herein as "DNA34436-1238".
Figure 58 shows the amino acid sequence (SEQ ID NO: IS9) derived from the
coding sequence of SEQ
ID N0:158 shown in Figure 57.
Figure 59 shows a nucleotide sequence (SEQ ID N0:163) of a native sequence
PR0223 cDNA, wherein
SEQ ID N0:163 is a clone designated herein as "DNA33206-1165".
Figure 60 shows the amino acid sequence (SEQ ID N0:164) derived from the
coding sequence of SEQ
ID N0:163 shown in Figure 59.
Figure 61 shows a nucleotide sequence (SEQ ID N0:169) of a native sequence
PR023S cDNA, wherein
SEQ ID N0:169 is a clone designated herein as "DNA35558-1167".
Figure 62 shows the amino acid sequence (SEQ ID N0:170) derived from the
coding sequence of SEQ
ID N0:169 shown in Figure 61.
Figure 63 shows a nucleotide sequence (SEQ ID N0:174) of a native sequence
PR0236 cDNA, wherein
SEQ ID N0:174 is a clone designated herein as "DNA35599-1168".
Figure 64 shows the amino acid sequence (SEQ ID N0:175) derived from the
coding sequence of SEQ
ID N0:174 shown in Figure 63.
Figure 65 shows a nucleotide sequence (SEQ ID N0:176) of a native sequence
PR0262 cDNA, wherein
SEQ ID N0:176 is a clone designated herein as "DNA36992-1168".
Figure 66 shows the amino acid sequence (SEQ ID N0:177) derived from the
coding sequence of SEQ
ID N0:176 shown in Figure 65.
Figure 67 shows a nucleotide sequence (SEQ ID N0:184) of a native sequence
PR0239 cDNA, wherein
SEQ ID N0:184 is a clone designated herein as "DNA34407-I 169".
Figure 68 shows the amino acid sequence (SEQ ID N0:185) derived from the
coding sequence of SEQ
ID N0:184 shown in Figure 67. .
Figure 69 shows a nucleotide sequence (SEQ ID N0:189) of a native sequence
PR0257 cDNA, wherein
SEQ ID N0:189 is a clone designated herein as "DNA35841-1173".
Figure 70 shows the amino acid sequence (SEQ ID N0:190) derived from the
coding sequence of SEQ
ID N0:189 shown in Figure 69.
Figure 71 shows a nucleotide sequence (SEQ ID N0:194) of a native sequence
PR0260 cDNA, wherein
SEQ ID N0:194 is a clone designated herein as "DNA33470-1175".
63
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Figure 72 shows the amino acid sequence (SEQ ID N0:195) derived from the
coding sequence of SEQ
ID N0:194 shown in Figure 71.
Figure 73 shows a nucleotide sequence (SEQ ID N0:200) of a native sequence
PR0263 cDNA, wherein
SEQ 1D N0:200 is a clone designated herein as "DNA34431-1177".
Figure 74 shows the amino acid sequence (SEQ ID N0:201) derived from the
coding sequence of SEQ
S ID NO:Z00 shown in Figure 73.
Figure 75 shows a nucleotide sequence (SEQ ID N0:206) of a native sequence
PR0270 cDNA, wherein
SEQ ID N0:206 is a clone designated herein as "DNA39510-1181 ".
Figure 76 shows the amino acid sequence (SEQ ID N0:207) derived from the
coding sequence of SEQ
ID N0:206 shown in Figure 75.
Figure 77 shows a nucleotide sequence (SEQ ID N0:212) of a native sequence
PR0271 cDNA, wherein
SEQ ID N0:212 is a clone designated herein as "DNA39423-1182".
Figure 78 shows the amino acid sequence (SEQ ID N0:213) derived from the
coding sequence of SEQ
ID N0:212 shown in Figure 77.
Figure 79 shows a nucleotide sequence (SEQ ID N0:220) of a native sequence
PR0272 cDNA, wherein
SEQ ID N0:220 is a clone designated herein as "DNA40620-1183".
Figure 80 shows the amino acid sequence (SEQ ID N0:221) derived from the
coding sequence of SEQ
ID N0:220 shown in Figure 79.
Figure 81 shows a nucleotide sequence (SEQ ID N0:226) of a native sequence
PR0294 cDNA, wherein
SEQ ID N0:226 is a clone designated herein as "DNA40604-1187".
Figure 82 shows the amino acid sequence (SEQ ID N0:227) derived from the
coding sequence of SEQ
ID N0:226 shown in Figure 81.
Figure 83 shows a nucleotide sequence (SEQ ID N0:235) of a native sequence
PR0295 cDNA, wherein
SEQ ID N0:235 is a clone designated herein as "DNA38268-1188".
Figure 84 shows the amino acid sequence (SEQ ID N0:236) derived from the
coding sequence of SEQ
ID N0:235 shown in Figure 83.
Figure 85 shows a nucleotide sequence (SEQ ID N0:244) of a native sequence
PR0293 cDNA, wherein
SEQ ID N0:244 is a clone designated herein as "DNA37151-i 193".
Figure 86 shows the amino acid sequence (SEQ ID N0:245) derived from the
coding sequence of SEQ
ID N0:244 shown in Figure 85.
Figure 87 shows a nucleotide sequence (SEQ ID N0:249) of a native sequence
PR0247 cDNA, wherein
SEQ ID N0:249 is a clone designated herein as "DNA35673-1201".
Figure 88 shows the amino acid sequence (SEQ ID N0:250) derived from the
coding sequence of SEQ
ID N0:249 shown in Figure 87.
Figure 89 shows a nucleotide sequence (SEQ ID N0:254) of a native sequence
PR0302 cDNA, wherein
SEQ ID N0:254 is a clone designated herein as "DNA40370-1217".
Figure 90 shows the amino acid sequence (SEQ ID N0:255) derived from the
coding sequence of SEQ
ID N0:254 shown in Figure 89.
64
CA 02343577 2001-03-16
WO 00/15796 PC1'/US99/21090
Figure 91 shows a nucleotide sequence (SEQ ID N0:256) of a native sequence
PR0303 cDNA, wherein
SEQ ID N0:256 is a clone designated herein as "DNA42551-1217".
Figure 92 shows the amino acid sequence (SEQ ID N0:257) derived from the
coding sequence of SEQ
ID N0:256 shown in Figure 91.
Figure 93 shows a nucleotide sequence (SEQ ID N0:258) of a native sequence
PR0304 cDNA, wherein
SEQ ID NO:258 is a clone designated herein as "DNA39520-1217".
Figure 94 shows the amino acid sequence (SEQ ID N0:259) derived from the
coding sequence of SEQ
ID N0:258 shown in Figure 93.
Figure 95 shows a nucleotide sequence (SEQ ID N0:260) of a native sequence
PR0307 cDNA, wherein
SEQ ID N0:260 is a clone designated herein as "DNA41225-1217".
Figure 96 shows the amino acid sequence (SEQ ID N0:261) derived from the
coding sequence of SEQ
ID N0:260 shown in Figure 95.
Figure 97 shows a nucleotide sequence (SEQ ID N0:262) of a native sequence
PR0343 cDNA, wherein
SEQ ID N0:262 is a clone designated herein as "DNA43318-1217".
Figure 98 shows the amino acid sequence (SEQ ID N0:263) derived from the
coding sequence of SEQ
ID N0:262 shown in Figure 97.
Figure 99 shows a nucleotide sequence (SEQ ID N0:284) of a native sequence
PR0328 cDNA, wherein
SEQ ID N0:284 is a clone designated herein as "DNA40587-1231".
Figure 100 shows the amino acid sequence (SEQ ID N0:285) derived from the
coding sequence of SEQ
ID N0:284 shown in Figure 99.
Figure 101 shows a nucleotide sequence (SEQ ID N0:289) of a native sequence
PR0335 cDNA,
wherein SEQ ID N0:289 is a clone designated herein as "DNA41388-1234".
Figure 102 shows the amino acid sequence (SEQ ID N0:290) derived from the
coding sequence of SEQ
ID N0:289 shown in Figure 101.
Figure 103 shows a nucleotide sequence (SEQ ID N0:291) of a native sequence
PR0331 cDNA,
wherein SEQ ID N0:291 is a clone designated herein as "DNA40981-1234".
Figure 104 shows the amino acid sequence (SEQ ID N0:292) derived from the
coding sequence of SEQ
ID N0:291 shown in Figure 103.
Figure 105 shows a nucleotide sequence (SEQ ID N0:293) of a native sequence
PR0326 cDNA,
wherein SEQ ID N0:293 is a clone designated herein as "DNA37140-1234".
Figure 106 shows the amino acid sequence (SEQ ID N0:294) derived from the
coding sequence of SEQ
ID N0:293 shown in Figure 105.
Figure 107 shows a nucleotide sequence (SEQ ID N0:309) of a native sequence
PR0332 cDNA,
wherein SEQ ID N0:309 is a clone designated herein as "DNA40982-1235".
Figure 108 shows the amino acid sequence (SEQ ID N0:310) derived from the
coding sequence of SEQ
ID N0:309 shown in Figure 107.
Figure 109 shows a nucleotide sequence (SEQ ID N0:314) of a native sequence
PR0334 cDNA,
wherein SEQ ID N0:314 is a clone designated herein as "DNA41379-1236".
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Figure 110 shows the amino acid sequence (SEQ ID N0:3I5) derived from the
coding sequence of SEQ
ID N0:314 shown in Figure 109.
Figure 111 shows a nucleotide sequence (SEQ ID N0:319) of a native sequence
PR0346 cDNA,
wherein SEQ ID N0:319 is a clone designated herein as "DNA44167-1243".
Figure 112 shows the amino acid sequence (SEQ ID N0:320) derived from the
coding sequence of SEQ
ID N0:319 shown in Figure I11.
Figure 113 shows a nucleotide sequence (SEQ ID N0:324) of a native sequence
PR0268 cDNA,
wherein SEQ ID N0:324 is a clone designated herein as "DNA39427-1179".
Figure 114 shows the amino acid sequence (SEQ ID N0:325) derived from the
coding sequence of SEQ
ID N0:324 shown in Figure 113.
Figure I15 shows a nucleotide sequence.(SEQ ID N0:331) of a native sequence
PR0330 cDNA,
wherein SEQ ID N0:331 is a clone designated herein as "DNA40603-1232".
Figure 116 shows the amino acid sequence (SEQ ID N0:332) derived from the
coding sequence of SEQ
ID N0:331 shown in Figure 115.
Figure 117 shows a nucleotide sequence (SEQ ID N0:338) of a native sequence
PR0339 cDNA,
IS wherein SEQ ID N0:338 is a clone designated herein as "DNA43466-1225".
Figure 118 shows the amino acid sequence (SEQ ID N0:339) derived from the
coding sequence of SEQ
ID N0:338 shown in Figure 117.
Figure 119 shows a nucleotide sequence (SEQ ID N0:340) of a native sequence
PR0310 cDNA,
wherein SEQ ID N0:340 is a clone designated herein as "DNA43046-1225".
Figure 120 shows the amino acid sequence (SEQ ID N0:341 ) derived from the
coding sequence of SEQ
ID N0:340 shown in Figure 119.
Figure 121 shows a nucleotide sequence (SEQ ID N0:376) of a native sequence
PR0244 cDNA,
wherein SEQ ID N0:376 is a clone designated herein as "DNA35668-l I71".
Figure 122 shows the amino acid sequence (SEQ ID N0:377) derived from the
coding sequence of SEQ
ID N0:376 shown in Figure I21.
66
CA 02343577 2001-03-16
WO 00/I5796 PCT/US99/21090
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Definitions
The terms "PRO polypeptide" and "PRO" as used herein and when immediately
followed by a
numerical designation refer to various polypeptides, wherein the complete
designation (i.e., PRO/number) refers
to specific polypeptide sequences as described herein. The terms "PRO/number
polypeptide" and
"PRO/number" wherein the term "number" is provided as an actual numerical
designation as used herein
encompass native sequence polypeptides and polypeptide variants (which are
further defined herein). The PRO
polypeptides described herein may be isolated from a variety of sources, such
as from human tissue types or
from another source, or prepared by recombinant or synthetic methods.
A "native sequence PRO polypeptide" comprises a polypeptide having the same
amino acid sequence
as the corresponding PRO polypeptide derived from nature. Such native sequence
PRO polypeptides can be
isolated from nature or can be produced by recombinant or synthetic means. The
term "native sequence PRO
polypeptide" specifically encompasses naturally-occurring truncated or
secreted forms of the specific PRO
polypeptide (e.g., an extracellular domain sequence), naturally-occurring
variant forms (e.g., alternatively
spliced forms) and naturally-occurring allelic variants of the polypeptide. In
various embodiments of the
invention, the native sequence PRO polypeptides disclosed herein are mature or
full-length native sequence
polypeptides comprising the full-length amino acids sequences shown in the
accompanying figures. Start and
stop codons are shown in bold font and underlined in the figures. However,
while the PRO polypeptide
disclosed in the accompanying figures are shown to begin with methionine
residues designated herein as amino
acid position 1 in the figures, it is conceivable and possible that other
methionine residues located either upstream
or downstream from the amino acid position 1 in the figures may be employed as
the starting amino acid residue
for the PRO polypeptides.
The PRO polypeptide "extracellular domain" or "ECD" refers to a form of the
PRO polypeptide which
is essentially free of the transmembrane and cytoplasmic domains. Ordinarily,
a PRO polypeptide ECD will have
less than 1 % of such transmembrane and/or cytoplasmic domains and preferably,
will have less than 0.5 % of
such domains. It will be understood that any transmembrane domains identified
for the PRO polypeptides of
the present invention are identified pursuant to criteria routinely employed
in the art for identifying that type of
hydrophobic domain. The exact boundaries of a transmembrane domain may vary
but most likely by no more
than about 5 amino acids at either end of the domain as initially identified
herein. Optionally, therefore, an
extracellular domain of a PRO polypeptide may contain from about 5 or fewer
amino acids on either side of the
transmembrane domain/extracellular domain boundary as identified in the
Examples or specification and such
polypeptides, with or without the associated signal peptide, and nucleic acid
encoding them, are comtemplated
by the present invention.
The approximate location of the "signal peptides" of the various PRO
polypeptides disclosed herein are
shown in the accompanying figures. It is noted, however, that the C-terminal
boundary of a signal peptide may
vary, but most likely by no more than about 5 amino acids on either side of
the signal peptide C-terminal
boundary as initially identified herein, wherein the C-terminal boundary of
the signal peptide may be identified
pursuant to criteria routinely employed in the art for identifying that type
of amino acid sequence element (e.g.,
67
CA 02343577 2001-03-16
WO 00/1579b
PCT/US99/21090
Nielsen et al., Prot. Ena. 10:1-6 (1997) and von Heinje et al., Nucl. Acids.
Res. 14:4683-4690 (1986)).
Moreover, it is also recognized that, in some cases, cleavage of a signal
sequence from a secreted polypeptide
is not entirely uniform, resulting in more than one secreted species. These
mature polypeptides, where the signal
peptide is cleaved within no more than about 5 amino acids on either side of
the C-terminal boundary of the
signal peptide as identified herein, and the polynucleotides encoding them,
are contemplated by the present
invention.
"PRO polypeptide variant" means an active PRO polypeptide as defined above or
below having at least
about 80% amino acid sequence identity with a full-length native sequence PRO
polypeptide sequence as
disclosed herein, a PRO polypeptide sequence lacking the signal peptide as
disclosed herein, an extracellular
domain of a PRO polypeptide, with or without the signal peptide, as disclosed
herein or any other fragment of
a full-length PRO polypeptide sequence as disclosed herein. Such PRO
polypeptide variants include, for
instance, PRO polypeptides wherein one or more amino acid residues are added,
or deleted, at the N- or C-
terminus of the full-length native amino acid sequence. Ordinarily, a PRO
polypeptide variant will have at least
about 80% amino acid sequence identity, preferably at least about 81 % amino
acid sequence identity, more
preferably at least about 82% amino acid sequence identity, more preferably at
least about 83% amino acid
sequence identity, more preferably at least about 84% amino acid sequence
identity, more preferably at least
about 85 % amino acid sequence identity, more preferably at least about 86 %
amino acid sequence identity, more
preferably at least about 87% amino acid sequence identity, more preferably at
least about 88% amino acid
sequence identity, more preferably at least about 89% amino acid sequence
identity, more preferably at least
about 90 % amino acid sequence identity, more preferably at least about 91 %
amino acid sequence identity, more
preferably at least about 92% amino acid sequence identity, more preferably at
least about 93% amino acid
sequence identity, more preferably at least about 94 % amino acid sequence
identity, more preferably at least
about 95 % amino acid sequence identity, more preferably at least about 96 %
amino acid sequence identity, more
preferably at least about 97% amino acid sequence identity, more preferably at
least about 98% amino acid
sequence identity and most preferably at least about 99% amino acid sequence
identity with a full-length native
sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide
sequence lacking the signal peptide
as disclosed herein, an extracellular domain of a PRO polypeptide, with or
without the signal peptide, as
disclosed herein or any other fragment of a full-length PRO polypeptide
sequence as disclosed herein.
Ordinarily, PRO variant polypeptides are at least about 10 amino acids in
length, often at least about 20 amino
acids in length, more often at least about 30 amino acids in length, more
often at least about 40 amino acids in
length, more often at least about 50 amino acids in length, more often at
least about 60 amino acids in length,
more often at least about 70 amino acids in length, more often at least about
80 amino acids in length, more often
at least about 90 amino acids in length, more often at least about 100 amino
acids in length, more often at least
about 150 amino acids in length, more often at least about 200 amino acids in
length, more often at least about
300 amino acids in length, or more.
"Percent (%) amino acid sequence identity" with respect to the PRO polypeptide
sequences identified
herein is defined as the percentage of amino acid residues in a candidate
sequence that are identical with the
amino acid residues in the specific PRO polypeptide sequence, after aligning
the sequences and introducing gaps,
68
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
if necessary, to achieve the maximum percent sequence identity, and not
considering any conservative
substitutions as part of the sequence identity. Alignment for purposes of
determining percent amino acid
sequence identity can be achieved in various ways that are within the skill in
the art, for instance, using publicly
available computer software such as BLAST, BLAST-2, ALIGN or Megalign
(DNASTAR) software. Those
skilled in the art can determine appropriate parameters for measuring
alignment, including any algorithms needed
to achieve maximal alignment over the full length of the sequences being
compared. For purposes herein,
however, % amino acid sequence identity values are generated using the
sequence comparison computer program
ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided
in Table 10 below. The
ALIGN-2 sequence comparison computer program was authored by Genentech, Inc.
and the source code shown
in Table 10 below has been filed with user documentation in the U.S. Copyright
Office, Washington D.C.,
20559, where it is registered under U.S. Copyright Registration No. TXU510087.
The ALIGN-2 program is
publicly available through Genentech, lnc. , South San Francisco, California
or may be compiled from the source
code provided in Table 10 below. The ALIGN-2 program should be compiled for
use on a UNIX operating
system, preferably digital UNIX V4.OD. All sequence comparison parameters are
set by the ALIGN-2 program
and do not vary.
In situations where ALIGN-2 is employed for amino acid sequence comparisons,
the % amino acid
sequence identity of a given amino acid sequence A to, with, or against a
given amino acid sequence B (which
can alternatively be phrased as a given amino acid sequence A that has or
comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence B) is
calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
ALIGN-2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues in
B. It will be appreciated that where the length of amino acid sequence A is
not equal to the length of amino acid
sequence B, the % amino acid sequence identity of A to B will not equal the %
amino acid sequence identity of
B to A. As examples of % amino acid sequence identity calculations using this
method, Tables 1 l and 12 below
demonstrate how to calculate the % amino acid sequence identity of the amino
acid sequence designated
"Comparison Protein" to the amino acid sequence designated "PRO".
Unless specifically stated otherwise, all % amino acid sequence identity
values used herein are obtained
as described in the immediately preceding paragraph using the ALIGN-2 computer
program. However, % amino
acid sequence identity values may also be obtained as described below by using
the WU-BLAST-2 computer
program (Altschul et al., Methods in Enzvmolosy_266:460-480 (1996)). Most of
the WU-BLAST-2 search
parameters are set to the default values. Those not set to default values,
i.e., the adjustable parameters, are set
with the following values: overlap span = 1, overlap fraction = 0.125, word
threshold (T) = 11, and scoring
matrix = BLOSUM62. When WU-BLAST-2 is employed, a % amino acid sequence
identity value is
determined by dividing (a) the number of matching identical amino acid
residues between the amino acid
sequence of the PRO polypeptide of interest having a sequence derived from the
native PRO polypeptide and the
69
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
comparison amino acid sequence of interest (i.e., the sequence against which
the PRO polypeptide of interest
is being compared which may be a PRO variant polypeptide) as determined by WU-
BLAST-2 by (b) the total
number of amino acid residues of the PRO polypeptide of interest. For example,
in the statement "a polypeptide
comprising an the amino acid sequence A which has or having at least 80% amino
acid sequence identity to the
amino acid sequence B", the amino acid sequence A is the comparison amino acid
sequence of interest and the
amino acid sequence B is the amino acid sequence of the PRO polypeptide of
interest.
Percent amino acid sequence identity may also be determined using the sequence
comparison program
NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)). The
NCBI-BLAST2 sequence
comparison program may be downloaded from http://www.ncbi.nlm.nih.gov. NCBI-
BLAST2 uses several
search parameters, wherein all of those search parameters are set to default
values including, for example,
unmask = yes, strand = all, expected occurrences = 10, minimum low complexity
length = 15/5, multi-pass
e-value = 0.01, constant for mufti-pass = 25, dropoff for final gapped
alignment = 25 and scoring matrix =
BLOSUM62.
In situations where NCBI-BLAST2 is employed for amino acid sequence
comparisons, the % amino
acid sequence identity of a given amino acid sequence A to, with, or against a
given amino acid sequence B
(which can alternatively be phrased as a given amino acid sequence A that has
or comprises a certain % amino
acid sequence identity to, with, or against a given amino acid sequence B) is
calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
NCBI-BLAST2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues
in B. It will be appreciated that where the length of amino acid sequence A is
not equal to the length of amino
acid sequence B, the % amino acid sequence identity of A to B will not equal
the % amino acid sequence identity
ofBtoA.
"PRO variant polynucleotide" or "PRO variant nucleic acid sequence" means a
nucleic acid molecule
which encodes an active PRO polypeptide as defined below and which has at
least about 80% nucleic acid
sequence identity with a nucleotide acid sequence encoding a full-length
native sequence PRO polypeptide
sequence as disclosed herein, a full-length native sequence PRO polypeptide
sequence lacking the signal peptide
as disclosed herein, an extracellular domain of a PRO polypeptide, with or
without the signal peptide, as
disclosed herein or any other fragment of a full-length PRO polypeptide
sequence as disclosed herein.
Ordinarily, a PRO variant polynucleotide will have at least about 80% nucleic
acid sequence- identity, more
preferably at least about 81 % nucleic acid sequence identity, more preferably
at least about 82% nucleic acid
sequence identity, more preferably at least about 83 % nucleic acid sequence
identity, more preferably at least
about 84 % nucleic acid sequence identity, more preferably at least about 85 %
nucleic acid sequence identity,
more preferably at least about 86 % nucleic acid sequence identity, more
preferably at least about 87 % nucleic
acid sequence identity, more preferably at least about 88% nucleic acid
sequence identity, more preferably at
least about 89% nucleic acid sequence identity, more preferably at least about
90% nucleic acid sequence
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
identity, more preferably at least about 91 % nucleic acid sequence identity,
more preferably at least about 92
nucleic acid sequence identity, more preferably at least about 93 % nucleic
acid sequence identity, more
preferably at least about 94% nucleic acid sequence identity, more preferably
at least about 95% nucleic acid
sequence identity, more preferably at least about 96% nucleic acid sequence
identity, more preferably at least
about 97 % nucleic acid sequence identity, more preferably at least about 98 %
nucleic acid sequence identity and
yet more preferably at least about 99% nucleic acid sequence identity with the
nucleic acid sequence encoding
a full-length native sequence PRO polypeptide sequence as disclosed herein, a
full-length native sequence PRO
polypeptide sequence lacking the signal peptide as disclosed herein, an
extracellular domain of a PRO
polypeptide, with or without the signal sequence, as disclosed herein or any
other fragment of a full-length PRO
polypeptide sequence as disclosed herein. Variants do not encompass the native
nucleotide sequence.
Ordinarily, PRO variant polynucleotides are at least about 30 nucleotides in
length, often at least about
60 nucleotides in length, more often at least about 90 nucleotides in length,
more often at least about 120
nucleotides in length, more often at least about 150 nucleotides in length,
more often at least about 180
nucleotides in length, more often at least about 210 nucleotides in length,
more often at least about 240
nucleotides in length, more often at least about 270 nucleotides in length,
more often at least about 300
nucleotides in length, more often at least about 450 nucleotides in length,
more often at least about 600
nucleotides in length, more often at least about 900 nucleotides in length, or
more.
"Percent (%) nucleic acid sequence identity" with respect to PRO-encoding
nucleic acid sequences
identified herein is defined as the percentage of nucleotides in a candidate
sequence that are identical with the
nucleotides in the PRO nucleic acid sequence of interest, after aligning the
sequences and introducing gaps, if
necessary, to achieve the maximum percent sequence identity. Alignment for
purposes of determining percent
nucleic acid sequence identity can be achieved in various ways that are within
the skill in the art, for instance,
using publicly available computer software such as BLAST, BLAST-2, ALIGN or
Megalign (DNASTAR)
software. For purposes herein, however, % nucleic acid sequence identity
values are generated using the
sequence comparison computer program ALIGN-2, wherein the complete source code
for the ALIGN-2 program
is provided in Table 10 below. The ALIGN-2 sequence comparison computer
program was authored by
Genentech, Inc. and the source code shown in Table 10 below has been filed
with user documentation in the U.S.
Copyright Office, Washington D.C., 20559, where it is registered under U.S.
Copyright Registration No.
TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc.,
South San Francisco,
California or may be compiled from the source code provided in Table 10 below.
The ALIGN-2 program should
be compiled for use on a UNIX operating system, preferably digital UNIX V4.OD.
All sequence comparison
parameters are set by the ALIGN-2 program and do not vary.
In situations where ALIGN-2 is employed for nucleic acid sequence comparisons,
the % nucleic acid
sequence identity of a given nucleic acid sequence C to, with, or against a
given nucleic acid sequence D (which
can alternatively be phrased as a given nucleic acid sequence C that has or
comprises a certain % nucleic acid
sequence identity to, with, or against a given nucleic acid sequence D) is
calculated as follows:
100 times the fraction W/Z
71
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
where W is the number of nucleotides scored as identical matches by the
sequence alignment program ALIGN-2
in that program's alignment of C and D, and where Z is the total number of
nucleotides in D. It will be
appreciated that where the length of nucleic acid sequence C is not equal to
the length of nucleic acid sequence
D, the % nucleic acid sequence identity of C to D wilt not equal the % nucleic
acid sequence identity of D to
C. As examples of % nucleic acid sequence identity calculations, Tables 13 and
14 below demonstrate how to
calculate the % nucleic acid sequence identity of the nucleic acid sequence
designated "Comparison DNA" to
the nucleic acid sequence designated "PRO-DNA".
Unless specifically stated otherwise, all % nucleic acid sequence identity
values used herein are obtained
as described in the immediately preceding paragraph using the ALIGN-2 computer
program. However,
nucleic acid sequence identity values may also be obtained as described below
by using the WU-BLAST-2
computer program (Altschul et al., Methods in Enzymoloev 266:460-480 (1996)).
Most of the WU-BLAST-2
search parameters are set to the default values. Those not set to default
values, i.e., the adjustable parameters,
are set with the following values: overlap span = 1, overlap fraction = 0.125,
word threshold (T) = 11, and
scoring matrix = BLOSUM62. When WU-BLAST-2 is employed, a % nucleic acid
sequence identity value is
determined by dividing (a) the number of matching identical nucleotides
between the nucleic acid sequence of
the PRO polypeptide-encoding nucleic acid molecule of interest having a
sequence derived from the native
sequence PRO polypeptide-encoding nucleic acid and the comparison nucleic acid
molecule of interest (i.e., the
sequence against which the PRO polypeptide-encoding nucleic acid molecule of
interest is being compared which
may be a variant PRO polynucleotide) as determined by WU-BLAST-2 by (b) the
total number of nucleotides
of the PRO polypeptide-encoding nucleic acid molecule of interest. For
example, in the statement "an isolated
nucleic acid molecule comprising a nucleic acid sequence A which has or having
at least 80% nucleic acid
sequence identity to the nucleic acid sequence B", the nucleic acid sequence A
is the comparison nucleic acid
molecule of interest and the nucleic acid sequence B is the nucleic acid
sequence of the PRO polypeptide-
encoding nucleic acid molecule of interest.
Percent nucleic acid sequence identity may also be determined using the
sequence comparison program
NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)). The
NCBI-BLAST2 sequence
comparison program may be downloaded from http://www.ncbi.nlm.nih.gov. NCBI-
BLAST2 uses several
search parameters, wherein all of those search parameters axe set to default
values including, for example,
unmask = yes, strand = all, expected occurrences = 10, minimum low complexity
length = 15/5, mufti-pass
e-value = 0.01, constant for mufti-pass = 25, dropoff for final gapped
alignment = 25 and scoring matrix =
BLOSUM62.
In situations where NCBI-BLAST2 is employed for sequence comparisons, the %
nucleic acid sequence
identity of a given nucleic acid sequence C to, with, or against a given
nucleic acid sequence D (which can
alternatively be phrased as a given nucleic acid sequence C that has or
comprises a certain % nucleic acid
sequence identity to, with, or against a given nucleic acid sequence D) is
calculated as follows:
100 times the fraction W/Z
72
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
where W is the number of nucleotides scored as identical matches by the
sequence alignment program NCBI-
BLAST2 in that program's alignment of C and D, and where Z is the total number
of nucleotides in D. It will
be appreciated that where the length of nucleic acid sequence C is not equal
to the length of nucleic acid sequence
D, the % nucleic acid sequence identity of C to D will not equal the % nucleic
acid sequence identity of D to
C.
In other embodiments, PRO variant polynucleotides are nucleic acid molecules
that encode an active
PRO polypeptide and which are capable of hybridizing, preferably under
stringent hybridization and wash
conditions, to nucleotide sequences encoding a full-length PRO polypeptide as
disclosed herein. PRO variant
polypeptides may be those that are encoded by a PRO variant polynucleotide.
The term "positives", in the context of sequence comparison performed as
described above, includes
residues in the sequences compared that are not identical but have similar
properties (e.g. as a result of
conservative substitutions, see Table I below). For purposes herein, the %
value of positives is determined by
dividing (a) the number of amino acid residues scoring a positive value
between the PRO polypeptide amino acid
sequence of interest having a sequence derived from the native PRO polypeptide
sequence and the comparison
amino acid sequence of interest (i.e., the amino acid sequence against which
the PRO polypeptide sequence is
being compared) as determined in the BLOSUM62 matrix of WU-BLAST-2 by (b) the
total number of amino
acid residues of the PRO polypeptide of interest.
Unless specifically stated otherwise, the % value of positives is calculated
as described in the
immediately preceding paragraph. However, in the context of the amino acid
sequence identity comparisons
performed as described for ALIGN-2 and NCBI-BLAST2 above, includes amino acid
residues in the sequences
compared that are not only identical, but also those that have similar
properties. Amino acid residues that score
a positive value to an amino acid residue of interest are those that are
either identical to the amino acid residue
of interest or are a preferred substitution (as defined in Table 1 below) of
the amino acid residue of interest.
For amino acid sequence comparisons using ALIGN-2 or NCBI-BLAST2, the % value
of positives of
a given amino acid sequence A to, with, or against a given amino acid sequence
B (which can alternatively be
phrased as a given amino acid sequence A that has or comprises a certain %
positives to, with, or against a given
amino acid sequence B) is calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scoring a positive value as
defined above by the sequence
alignment program ALIGN-2 or NCBI-BLAST2 in that program's alignment of A and
B, and where Y is the
total number of amino acid residues in B. It will be appreciated that where
the length of amino acid sequence
A is not equal to the length of amino acid sequence B, the % positives of A to
B will not equal the % positives
ofBtoA.
"Isolated, " when used to describe the various polypeptides disclosed herein,
means polypeptide that has
been identified and separated and/or recovered from a component of its natural
environment. Contaminant
components of its natural environment are materials that would typically
interfere with diagnostic or therapeutic
73
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
uses for the polypeptide, and may include enzymes, hormones, and other
proteinaceous or non-proteinaceous
solutes. In preferred embodiments, the polypeptide will be purified ( 1 ) to a
degree sufficient to obtain at least
15 residues of N-terminal or internal amino acid sequence by use of a spinning
cup sequenator, or (2} to
homogeneity by SDS-PAGE under non-reducing or reducing conditions using
Coomassie blue or, preferably,
silver stain. Isolated polypeptide includes polypeptide in situ within
recombinant cells, since at least one
component of the PRO polypeptide natural environment will not be present.
Ordinarily, however, isolated
polypeptide will be prepared by at least one purification step.
An "isolated" PRO polypeptide-encoding nucleic acid is a nucleic acid molecule
that is identified and
separated from at least one contaminant nucleic acid molecule with which it is
ordinarily associated in the natural
source of the PRO polypeptide nucleic acid. An isolated PRO polypeptide
nucleic acid molecule is other than
in the form or setting in which it is found in nature. Isolated PRO
polypeptide nucleic acid molecules therefore
are distinguished from the specific PRO polypeptide nucleic acid molecule as
it exists in natural cells. However,
an isolated PRO polypeptide nucleic acid molecule includes PRO polypeptide
nucleic acid molecules contained
in cells that ordinarily express the PRO polypeptide where, for example, the
nucleic acid molecule is in a
chromosomal location different from that of natural cells.
The term "control sequences" refers to DNA sequences necessary for the
expression of an operably
linked coding sequence in a particular host organism. The control sequences
that are suitable for prokaryotes,
for example, include a promoter, optionally an operator sequence, and a
ribosome binding site. Eukaryotic cells
are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional
relationship with another nucleic
acid sequence. For example, DNA for a presequence or secretory leader is
operably linked to DNA for a
polypeptide if it is expressed as a preprotein that participates in the
secretion of the polypeptide; a promoter or
enhancer is operably linked to a coding sequence if it affects the
transcription of the sequence; or a ribosome
binding site is operably linked to a coding sequence if it is positioned so as
to facilitate translation. Generally,
"operably linked" means that the DNA sequences being linked are contiguous,
and, in the case of a secretory
leader, contiguous and in reading phase. However, enhancers do not have to be
contiguous. Linking is
accomplished by ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide
adaptors or linkers are used in accordance with conventional practice.
The term "antibody" is used in the broadest sense and specifically covers, for
example, single anti-PRO
monoclonal antibodies (including agonist, antagonist, and neutralizing
antibodies), anti-PRO antibody
compositions with polyepitopic specificity, single chain anti-PRO antibodies,
and fragments of anti-PRO
antibodies (see below). The term "monoclonal antibody" as used herein refers
to an antibody obtained from a
population of substantially homogeneous antibodies, i.e., the individual
antibodies comprising the population are
identical except for possible naturally-occurring mutations that may be
present in minor amounts.
"Stringency" of hybridization reactions is readiiy determinable by one of
ordinary skill in the art, and
generally is an empirical calculation dependent upon probe length, washing
temperature, and salt concentration.
In general, longer probes require higher temperatures for proper annealing,
while shorter probes need lower
temperatures. Hybridization generally depends on the ability of denatured DNA
to reanneal when
74
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
complementary strands are present in an environment below their melting
temperature. The higher the degree
of desired homology between the probe and hybridizable sequence, the higher
the relative temperature which
can be used. As a result, it follows that higher relative temperatures would
tend to make the reaction conditions
more stringent, while lower temperatures less so. For additional details and
explanation of stringency of
hybridization reactions, see Ausubel et al., Current Protocols in Molecular
Biolo ~ Wiley Interscience
Publishers, (1995).
"Stringent conditions" or "high stringency conditions", as defined herein, may
be identified by those
that: (1) employ low ionic strength and high temperature for washing, for
example 0.015 M sodium
chloride/0.0015 M sodium citrate/0.1 % sodium dodecyl sulfate at 50°C;
(2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1
% bovine serum
albumin/0.1 % Ficoll/0.1 % polyvinylpyrrolidone/50mM sodium phosphate buffer
at pH 6.5 with 750 mM sodium
chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5
x SSC (0.75 M NaCI, 0.075 M
sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1 % sodium pyrophosphate,
5 x Denhardt's solution,
sonicated salmon sperm DNA (54 ~,g/ml), 0.1 % SDS, and 10% dextran sulfate at
42°C, with washes at 42°C
in 0.2 x SSC (sodium chloride/sodium citrate) and SO% formamide at
55°C, followed by a high-stringency wash
consisting of 0.1 x SSC containing EDTA at 55°C.
"Moderately stringent conditions" may be identified as described by Sambrook
et al., Molecular
Cloning: A Laboratory Manual New York: Cold Spring Harbor Press, 1989, and
include the use of washing
solution and hybridization conditions (e.g., temperature, ionic strength and
%SDS) less stringent that those
described above. An example of moderately stringent conditions is overnight
incubation at 37°C in a solution
comprising: 20 % formamide, 5 x SSC ( 150 mM NaCI, 15 mM trisodium citrate),
50 mM sodium phosphate (pH
7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured
sheared salmon sperm DNA,
followed by washing the filters in 1 x SSC at about 37-50°C. The
skilled artisan will recognize how to adjust
the temperature, ionic strength, etc. as necessary to accommodate factors such
as probe length and the like.
The term "epitope tagged" when used herein refers to a chimcric polypeptide
comprising a PRO
polypeptide fused to a "tag polypeptide". The tag polypeptide has enough
residues to provide an epitope against
which an antibody can be made, yet is short enough such that it does not
interfere with activity of the polypeptide
to which it is fused. The tag polypeptide preferably also is fairly unique so
that the antibody does not
substantially cross-react with other epitopes. Suitable tag polypeptides
generally have at least six amino acid
residues and usually between about 8 and SO amino acid residues (preferably,
between about 10 and 20 amino
acid residues).
As used herein, the term "immunoadhesin" designates antibody-like molecules
which combine the
binding specificity of a heterologous protein (an "adhesin") with the effector
functions of immunoglobulin
constant domains. Structurally, the immunoadhesins comprise a fusion of an
amino acid sequence with the
desired binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is
"heterologous"), and an immunoglobulin constant domain sequence. The adhesin
part of an immunoadhesin
molecule typically is a contiguous amino acid sequence comprising at least the
binding site of a receptor or a
ligand. The immunoglobulin constant domain sequence in the immunoadhesin may
be obtained from any
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
immunoglobulin, such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including
IgA-1 and IgA-2), IgE, IgD
or IgM.
"Active" or "activity" for the purposes herein refers to forms) of a PRO
polypeptide which retain a
biological and/or an immunological activity of native or naturally-occurring
PRO, wherein "biological" activity
refers to a biological function (either inhibitory or stimulatory) caused by a
native or naturally-occurring PRO
S other than the ability to induce the production of an antibody against an
antigenic epitope possessed by a native
or naturally-occurring PRO and an "immunological" activity refers to the
ability to induce the production of an
antibody against an antigenic epitope possessed by a native or naturally-
occurring PRO.
The term "antagonist" is used in the broadest sense, and includes any molecule
that partially or fully
blocks, inhibits, or neutralizes a biological activity of a native PRO
polypeptide disclosed herein. In a similar
manner, the term "agonist" is used in the broadest sense and includes any
molecule that mimics a biological
activity of a native PRO polypeptide disclosed herein. Suitable agonist or
antagonist molecules specifically
include agonist or antagonist antibodies or antibody fragments, fragments or
amino acid sequence variants of
native PRO polypeptides, peptides, antisense oligonucleotides, small organic
molecules, etc. Methods for
identifying agonists or antagonists of a PRO polypeptide may comprise
contacting a PRO polypeptide with a
candidate agonist or antagonist molecule and measuring a detectable change in
one or more biological activities
normally associated with the PRO polypeptide.
"Treatment" refers to both therapeutic treatment and prophylactic or
preventative measures, wherein
the object is to prevent or slow down (lessen) the targeted pathologic
condition or disorder. Those in need of
treatment include those already with the disorder as well as those prone to
have the disorder or those in whom
the disorder is to be prevented.
"Chronic" administration refers to administration of the agents) in a
continuous mode as opposed to
an acute mode, so as to maintain the initial therapeutic effect (activity) for
an extended period of time.
"Intermittent" administration is treatment that is not consecutively done
without interruption, but rather is cyclic
in nature.
"Mammal" for purposes of treatment refers to any animal classified as a
mammal, including humans,
domestic and farm animals, and zoo, sports, or pet animals, such as dogs,
cats, cattle, horses, sheep, pigs, goats,
rabbits, etc. Preferably, the mammal is human.
Administration "in combination with" one or more further therapeutic agents
includes simultaneous
(concurrent) and consecutive administration in any order.
"Carriers" as used herein include pharmaceutically acceptable carriers,
excipients, or stabilizers which
are nontoxic to the cell or mammal being exposed thereto at the dosages and
concentrations employed. Often
the physiologically acceptable carrier is an aqueous pH buffered solution.
Examples of physiologically
acceptable carriers include buffers such as phosphate, citrate, and other
organic acids; antioxidants including
ascorbic acid; low molecular weight (less than about 10 residues) polypeptide;
proteins, such as serum albumin,
gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine,
glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including
glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols
such as mannitol or sorbitol; salt-
76
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
forming counterions such as sodium; and/or nonionic surfactants such as
TWEENT", polyethylene glycol (PEG),
and PLURONICS~".
"Antibody fragments" comprise a portion of an intact antibody, preferably the
antigen binding or
variable region of the intact antibody. Examples of antibody fragments include
Fab, Fab', F(ab'),, and Fv
fragments; diabodies; linear antibodies (Zapata et al., Protein Ene. 8(10):
1057-1062 [1995]); single-chain
antibody molecules; and multispecific antibodies formed from antibody
fragments.
Papain digestion of antibodies produces two identical antigen-binding
fragments, called "Fab"
fragments, each with a single antigen-binding site, and a residual "Fc"
fragment, a designation reflecting the
ability to crystallize readily. Pepsin treatment yields an F(ab'), fragment
that has two antigen-combining sites
and is still capable of cross-linking antigen.
"Fv" is the minimum antibody fragment which contains a complete antigen-
recognition and -binding
site. This region consists of a dimer of one heavy- and one light-chain
variable domain in tight, non-covalent
association. It is in this configuration that the three CDRs of each variable
domain interact to define an antigen-
binding site on the surface of the VH-VL dimer. Collectively, the six CDRs
confer antigen-binding specificity
to the antibody. However, even a single variable domain (or half of an Fv
comprising only three CDRs specific
for an antigen) has the ability to recognize and bind antigen, although at a
lower affinity than the entire binding
site.
The Fab fragment also contains the constant domain of the light chain and the
first constant domain
(CH1) of the heavy chain. Fab fragments differ from Fab' fragments by the
addition of a few residues at the
carboxy terminus of the heavy chain CH1 domain including one or more cysteines
from the antibody hinge
region. Fab'-SH is the designation herein for Fab' in which the cysteine
residues) of the constant domains bear
a free thiol group. F(ab'), antibody fragments originally were produced as
pairs of Fab' fragments which have
hinge cysteines between them. Other chemical couplings of antibody fragments
are also known.
The "light chains" of antibodies (immunoglobulins) from any vertebrate species
can be assigned to one
of two clearly distinct types, called kappa and lambda, based on the amino
acid sequences of their constant
domains.
Depending on the amino acid sequence of the constant domain of their heavy
chains, immunoglobulins
can be assigned to different classes. There are five major classes of
immunoglobulins: IgA, IgD, IgE, IgG, and
IgM, and several of these may be further divided into subclasses (isotypes),
e.g., IgGl, IgG2, IgG3, IgG4, IgA,
and IgA2.
"Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains
of antibody, wherein
these domains are present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a
polypeptide linker between the VH and VL domains which enables the sFv to form
the desired structure for
antigen binding. For a review of sFv, see Pluckthun in The Pharmacoloey of
Monoclonal Antibodies vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994).
The term "diabodies" refers to small antibody fragments with two antigen-
binding sites, which
fragments comprise a heavy-chain variable domain (VH) connected to a light-
chain variable domain (VL) in the
same polypeptide chain (VH - VL). By using a linker that is too short to allow
pairing between the two domains
77
CA 02343577 2001-03-16
WO 00/I5796 PCT/US99/21090
on the same chain, the domains are forced to pair with the complementary
domains of another chain and create
two antigen-binding sites. Diabodies are described more fully in, for example,
EP 404,097; WO 93/11161; and
Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993).
An "isolated" antibody is one which has been identified and separated and/or
recovered from a
component of its natural environment. Contaminant components of its natural
environment are materials which
would interfere with diagnostic or therapeutic uses for the antibody, and may
include enzymes, hormones, and
other proteinaceous or nonproteinaceous solutes. In preferred embodiments, the
antibody will be purified (1)
to greater than 95 % by weight of antibody as determined by the Lowry method,
and most preferably more than
99 % by weight, (2) to a degree sufficient to obtain at least 15 residues of N-
terminal or internal amino acid
sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-
PAGE under reducing or
nonreducing conditions using Coomassie blue or, preferably, silver stain.
Isolated antibody includes the antibody
in situ within recombinant cells since at least one component of the
antibody's natural environment will not be
present. Ordinarily, however, isolated antibody will be prepared by at least
one purification step.
The word "label " when used herein refers to a detectable compound or
composition which is conjugated
directly or indirectly to the antibody so as to generate a "labeled" antibody.
The label may be detectable by itself
(e.g. radioisotope labels or fluorescent labels) or, in the case of an
enzymatic label, may catalyze chemical
alteration of a substrate compound or composition which is detectable.
By "solid phase" is meant a non-aqueous matrix to which the antibody of the
present invention can
adhere. Examples of solid phases encompassed herein include those formed
partially or entirely of glass (e.g.,
controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides,
polystyrene, polyvinyl alcohol and
silicones. In certain embodiments, depending on the context, the solid phase
can comprise the well of an assay
plate; in others it is a purification column (e.g., an affinity chromatography
column). This term also includes
a discontinuous solid phase of discrete particles, such as those described in
U.S. Patent No. 4,275,149.
A "liposome" is a small vesicle composed of various types of lipids,
phospholipids and/or surfactant
which is useful for delivery of a drug (such as a PRO polypeptide or antibody
thereto) to a mammal. The
components of the liposome are commonly arranged in a bilayer formation,
similar to the lipid arrangement of
biological membranes.
A "small molecule" is defined herein to have a molecular weight below about
500 Daltons.
"PR0317-associated disorder" refers to a pathological condition or disease
wherein PR0317 is over-
or underexpressed. Such disorders include diseases of the female genital tract
or of the endometrium of a
mammal, including hyperplasia, endometritis, endometriosis, wherein the
patient is at risk for infenility due to
endometrialfactor, endometrioma, and endometrial cancer, especially those
diseases involvingabnormal bleeding
such as a gynecological disease. They also include diseases involving
angiogenesis, wherein the angiogenesis
results in a pathological condition, such as cancer involving solid tumors
(the therapy for the disorder would
result in decreased vascularization and a decline in growth and metastasis of
a variety of tumors). Alternatively,
the angiogenesis may be beneficial, such as for ischemia, especially coronary
ischemia. Hence, these disorders
include those found in patients whose hearts are functioning but who have a
blocked blood supply due to
atherosclerotic coronary artery disease, and those with a functioning but
underperfused heart, including patients
78
CA 02343577 2001-03-16
WO 00/15796 PCT/US99l21090
with coronary arterial disease who are not optimal candidates for angioplasty
and coronary artery by-pass
surgery. The disorders also include diseases involving the kidney or
originating from the kidney tissue, such as
poIycystic kidney disease and chronic and acute renal failure.
II. Compositions and Methods of the Invention
A. Full-Leneth PRO Polvneatides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PRO polypeptides. In particular,
cDNAs encoding various PRO
polypeptides have been identified and isolated, as disclosed in further detail
in the Examples below. It is noted
that proteins produced in separate expression rounds may be given different
PRO numbers but the UNQ number
is unique for any given DNA and the encoded .protein, and will not be changed.
However, for sake of
simplicity, in the present specification the protein encoded by the full
length native nucleic acid molecules
disclosed herein as well as all further native homologues and variants
included in the foregoing definition of
PRO, will be referred to as "PRO/number", regardless of their origin or mode
of preparation.
As disclosed in the Examples below, various cDNA clones have been deposited
with the ATCC. The
actual nucleotide sequences of those clones can readily be determined by the
skilled artisan by sequencing of the
deposited clone using routine methods in the art. The predicted amino acid
sequence can be determined from
the nucleotide sequence using routine skill. For the PRO polypeptides and
encoding nucleic acids described
herein, Applicants have identified what is believed to be the reading frame
best identifiable with the sequence
information available at the time.
1. Full-IenQth PR0211 and PR0217 Polyuentides
The present invention provides newly identified and isolated nucleotide
sequencesencodingpolypeptides
referred to in the present application as PR0211 and PR0217. In particular,
Applicants have identified and
isolated cDNA encoding PR0211 and PR0217 polypeptides, as disclosed in further
detail in the Examples
below. Using BLAST (FastA format) sequence alignment computer programs,
Applicants found that cDNA
sequences encoding full-length native sequence PR0211 and PR0217 have
homologies to known proteins having
EGF-like domains. Specifically, the cDNA sequence DNA32292-1131 (Figure 1, SEQ
ID NO: l) has certain
identify and a Blast score of 209 with PACE RAT and certain identify and a
Blast score of 206 with Fibulin-1,
isoform c precursor. The cDNA sequence DNA33094-1131 (Figure 3, SEQ ID N0:3)
has 36% identity and
a Blast score of 336 with eastern newt tenascin, and 37 % identity and a Blast
score of 331 with human tenascin
X precursor. Accordingly, it is presently believed that PR0211 and PR0217
polypeptides disclosed in the
present application are newly identified members of the EGF-like family and
possesses properties typical of the
EGF-like protein family.
2. Full-leneth PR0230 Polvneptides
The present invention provides newly identifiedand isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0230. In particular, Applicants
have identified and isolated cDNA
79
CA 02343577 2001-03-16
WO 00/15796 PCTlUS99/21090
encoding a PR0230 polypeptide, as disclosed in further detail in the Examples
below. Using known programs
such as BLAST and FastA sequence alignment computer programs, Applicants found
that a cDNA sequence
encoding full-length native sequence PR0230 has 48% amino acid identity with
the rabbit tubulointerstitial
nephritis antigen precursor. Accordingly, it is presently believed that PR0230
polypeptide disclosed in the
present application is a newly identified member of the tubulointerstitial
nephritis antigen family and possesses
the ability to be recognized by human autoantibodies in certain forms of
tubulointerstitial nephritis.
3. Full-length PR0232 Polvpentides
The present inventionprovidesnewly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0232. In particular, Applicants
have identified and isolated cDNA
encoding a PR0232 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a portion of the
full-length native sequence
PR0232 (shown in Figure 9 and SEQ ID N0:18) has 35 % sequence identity with a
stem cell surface antigen
from Gallus gallus. Accordingly, it is presently believed that the PR0232
polypeptide disclosed in the present
application may be a newly identified stem cell antigen.
IS
4. Full-length PR0187 Polvueotides
The present invention provides newly identifiedand isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0187. In particular, Applicants
have identified and isolated cDNA
encoding a PR0187 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a full-length
native sequence PRO 187 (shown in
Figure 15) has 74% amino acid sequence identity and BLAST score of 310 with
various androgen-induced
growth factors and FGF-8. Accordingly, it is presently believed that PR0187
polypeptide disclosed in the
present application is a newly identified member of the FGF-8 protein family
and may possess identify activity
or property typical of the FGF-8-like protein family.
5. Full-length PR0265 Polvpeptides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0265. In particular, Applicants
have identified and isolated cDNA
encoding a PR0265 polypeptide, as disclosed in further detail in the Examples
below. Using programs such as
BLAST and FastA sequence alignment computer programs, Applicants found that
various portions of the
PR0265 polypeptide have significant homology with the fibromodulin protein and
fibromodulin precursor
protein. Applicants have also found that the DNA encoding the PR0265
polypeptide has significant homology
with platelet glycoprotein V, a member of the leucine rich related protein
family involved in skin and wound
repair. Accordingly, it is presently believed that PR0265 polypeptide
disclosed in the present application is a
newly identified member of the leucine rich repeat family and possesses
protein protein binding capabilities, as
well as be involved in skin and wound repair as typical of this family.
$0.
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
6. Full-length PR0219 Polyoeptides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0219. In particular, Appiicants
have identified and isolated cDNA
encoding a PR0219 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0219 polypeptide have
significant homology with the mouse and human matrilin-2 precursor
polypeptides. Accordingly, it is presently
believed that PR0219 polypeptide disclosed in the present application is
related to the matrilin-2 precursor
polypeptide.
7. Full-length PR0246 Polvnentides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0246. In particular, Applicants
have identified and isolated cDNA
encoding a PR0246 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a portion of the
PR0246 polypeptide has
significant homology with the human cell surface protein HCAR. Accordingly, it
is presently believed that
PR0246 polypeptide disclosed in the present application may be a newly
identified membrane-bound virus
receptor or tumor cell-specific antigen.
8. Full-length PR0228 Polyneptides
The present invention provides newly identifiedand isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0228. In particular, Applicants
have identified and isolated cDNA
encoding a PR0228 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0228 polypeptide have
significant homology with the EMR1 protein. Applicants have also found that
the DNA encoding the PR0228
polypeptide has significant homology with latrophilin, macrophage-restricted
cell surface glycoprotein, B0457.1
and leucocyte antigen CD97 precursor. Accordingly, it is presently believed
that PR0228 poiypeptide disclosed
in the present application is a newly identified member of the seven
transmembrane superfamily and possesses
characteristics and functional properties typical of this family. In
particular, it is believed that PR0228 is a new
member of the subgroup within this family to which CD97 and EMR1 belong.
9. Full-length PR0533 Polvpeptides
The presentinventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0533. In particular, Applicants
have identified and isolated cDNA
encoding a PR0533 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST-2 and
FastA sequence alignment computer programs, Applicants found that a full-
length native sequence PR0533
(shown in Figure 22 and SEQ ID N0:59) has a Blast score of 509 and 53 % amino
acid sequence identity with
fibroblast growth factor (FGF). Accordingly, it is presently believed that
PR0533 disclosed in the present
application is a newly identified member of the 6broblast growth factor family
and may possess activity typical
81
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
of such polypeptides.
10. Full-length PR0245 Polvpeutides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0245. In particular, Applicants
have identified and isolated cDNA
encoding a PR0245 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a portion of the
amino acid sequence of the
PR0245 polypeptide has 60% amino acid identity with the human c-myb protein.
Accordingly, it is presently
believed that the PR0245 polypeptide disclosed in the present application may
be a newly identified member of
the transmembrane protein tyrosine kinase family.
11. Full-length PR0220, PR0221 and PR0227 Polvpeptides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0220, PR0221 and PR0227. In
particular, Applicants have identified
and isolated cDNAs encoding a PR0220, PR0221 and PR022? polypeptide,
respectively, as disclosed in further
detail in the Examples below. Using BLAST and FastA sequence alignment
computer programs, PR0220 has
amino acid identity with the amino acid sequence of a leucine rich protein
wherein the identity is 87 % . PR0220
additionally has amino acid identity with the neuronal leucine rich protein
wherein the identity is 55 % . The
neuronal leucine rich protein is further described in Taguchi, et al., Mol.
Brain Res.. 35:31-40 (1996).
PR0221 has amino acid identity with the SLIT protein precursor, wherein
different portions of these
two proteins have the respective percent identities of 39%, 38%, 34%, 31 %,
and 30%.
PR0227 has amino acid identity with the amino acid sequence of platelet
glycoprotein V precursor.
The same results were obtained for human glycoprotein V. Different portions of
these two proteins show the
following percent identities of 30 % , 28 % , 28 % , 31 % , 35 % , 39 % and 27
% .
Accordingly, it is presently believed that PR0220, PR0221 and PR0227
polypeptides disclosed in the
present application are newly identified members of the leucine rich repeat
protein superfamily and that each
possesses protein-protein binding capabilities typical of the leucine rich
repeat protein superfamily. It is also
believed that they have capabilities similar to those of SLIT, the leucine
rich repeat protein and human
glycoprotein V.
12. Full-leneth PR0258 Polv~eotides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0258. In particular, Applicants
have identified and isolated cDNA
encoding a PR0258 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0258 polypeptide have
significant homology with the CRTAM and poliovirus receptors. Accordingly, it
is presently believed that
PR0258 polypeptide disclosed in the present application is a newly identified
member of the Ig superfamily and
possesses virus receptor capabilities or regulates immune function as typical
of this family.
82
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
13. Full-leneth PR0266 Polveeptides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0266. In particular, Applicants
have identified and isolated cDNA
encoding a PR0266 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0266 polypeptide have
significant homology with the SLIT protein from Drosophilia. Accordingly, it
is presently believed that PR0266
polypeptide disclosed in the present application is a newly identified member
of the leucine rich repeat family
and possesses ligand-ligand binding activity and neuronal development typical
of this family. SLIT has been
shown to be useful in the study and treatment of Alzheimer's disease, supra,
and thus, PR0266 may have
involvement in the study and cure of this disease.
14. Full-IenEth PR0269 Polyneutides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0269. In particular, Applicants
have identified and isolated cDNA
encoding a PR0269 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST, FastA
and sequence alignment computer programs, Applicants found that the amino acid
sequence encoded by
nucleotides 314 to 1783 of the full-length native sequence PR0269 (shown in
Figure 35 and SEQ ID N0:95)
has significanthomologyto human urinary thrombomodulin and various
thrombomodulin analogues respectively,
to which it was aligned. Accordingly, it is presently believed that PR0269
polypeptide disclosed in the present
application is a newly identified member of the thrombomoduiin family.
15. Full-IenEth PR0287 Polvpeptides
The present invention provides newly identified and isolated nucleotide
sequencesencodingpolypeptides
referred to in the present application as PR0287. In particular, Applicants
have identified and isolated cDNA
encoding a PR0287 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0287 polypeptide have
significant homology with the type 1 procollagen C-proteinase enhancer protein
precursor and type 1 procollagen
C-proteinase enhancer protein. Accordingly, it is presently believed that
PR0287 polypeptide disclosed in the
present application is a newly identified member of the C-proteinase enhancer
protein family.
16. Full-IenQth PR0214 Polvnentides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding.polypeptides
referred to in the present application as PR0214. In particular, Applicants
have identified and isolated cDNA
encoding a PR0214 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a full-length
native sequence PR0214 polypeptide
(shown in Figure 40 and SEQ ID N0:109) has 49% amino acid sequence identity
with HT protein, a known
member of the EGF-family. The comparison resulted in a BLAST score of 920,
with 150 matching nucleotides.
Accordingly, it is presently believed that the PR0214 polypeptide disclosed in
the present application is a newly
83
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
identified member of the family comprising EGF domains and may possess
activities or properties typical of the
EGF-domain containing family.
17. Full-lenEth PR0317 Polvpe~tides
The present invention provides newly identifiedand isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0317. In particular, cDNA encoding
a PR0317 polypeptide has been
identified and isolated, as disclosed in further detail in the Examples below.
Using BLAST T"' and FastAT"'
sequence alignment computer programs, it was found that a full-length native-
sequence PR0317 (shown in
Figure 42 and SEQ ID N0:114) has 92% amino acid sequence identity with EBAF-1.
Further, it is closely
aligned with many other members of the TGF- superfamily.
Accordingly, it is presently believed that PR0317 disclosed in the present
application is a newly
identified member of the TGF- superfamily and may possess properties that are
therapeutically useful in
conditions of uterine bleeding, etc. Hence, PR0317 may be useful in diagnosing
or treating abnormal bleeding
involved in gynecological diseases, for example, to avoid or lessen the need
for a hysterectomy. PR0317 may
also be useful as an agent that affects angiogenesis in general, so PR0317 may
be useful in anti-tumor
IS indications, or conversely, in treating coronary ischemic conditions.
Library sources reveal that ESTs used to obtain the consensus DNA for
generating PR0317 primers
and probes were found in normal tissues (uterus, prostate, colon, and
pancreas), in several tumors (colon, brain
(twice), pancreas, and mullerian cell), and in a heart with ischemia. PR0317
has shown up in several tissues
as well, but it does look to have a greater concentration in uterus. Hence,
PR0317 may have a broader use by
the body than EBAF-1. It is contemplated that, at least for some indications,
PR03I7 may have opposite effects
from EBAF-1.
18. Full-IenQth PR0301 Polyp_eptides
The present invention provides newly identified and isolated nucleotide
sequencesencodingpolypeptides
referred to in the present application as PR0301. In particular, Applicants
have identified and isolated cDNA
encoding a PR0301 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a full-length
native sequence PR0301 (shown in
Figure 44 and SEQ ID N0:119) has a Blast score of 246 corresponding to 30%
amino acid sequence identity
with human A33 antigen precursor. Accordingly, it is presently believed that
PR0301 disclosed in the present
application is a newly identified member of the A33 antigen protein family and
may be expressed in human
neoplastic diseases such as colorectal cancer. .
19. Full-length PR0224 Polvpentides
The present invention provides newly identifiedand isolatednucleotide
sequences encoding polypeptides
referred to in the present application as PR0224. In particular, Applicants
have identified and isolated cDNA
encoding a PR0224 polypeptide, as disclosed in further detail in the Examples
below. Using known programs
such as BLAST and FastA sequence alignment computer programs, Applicants found
that full-length native
84
CA 02343577 2001-03-16
WO 00/15796
PCTNS99/21090
PR0224 (Figure 46, SEQ ID N0:127) has amino acid identity with apolipoprotein
E receptor 2906 from homo
sapiens. The alignments of different portions of these two polypeptides show
amino acid identities of 37 % , 36 % ,
30 % , 44 % , 44 % and 28 % respectively. Full-length native PR0224 (Figure
46, SEQ ID N0:127) also has
amino acid identity with very low-density lipoprotein receptor precursor from
gall. The alignments of different
portions of these two polypeptides show amino acid identities of 38 % , 37 % ,
42 % , 33 % , and 37 % respectively.
Additionally, full-length native PR0224 (Figure 46, SEQ ID N0:127) has amino
acid identity with the chicken
oocyte receptor P95 from Gallus gallus. The alignments of different portions
of these two polypeptides show
amino acid identities of 38 % , 37 % , 42 % , 33 % , and 37 % respectively.
Moreover, full-length native PR0224
(Figure 46, SEQ ID N0:127) has amino acid identity with very low density
lipoprotein receptor short form
precursor from humans. The alignments of different portions of these two
polypeptides show amino acid
identities of 32 % , 38 % , 34 % , 45 % , and 31 % , respectively.
Accordingly, it is presently believed that PR0224
polypeptide disclosed in the present application is a newly identified member
of the low density lipoprotein
receptor family and possesses the structural characteristics required to have
the functional ability to recognize
and endocytose low density lipoproteins typical of the low density lipoprotein
receptor family. (The alignments
described above used the following scoring parameters: T=7, S+65, S2=36,
Matrix: BLOSUM62.)
20. Full-length PR0222 Polvpeptides
The present invention provides newly identifiedand isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0222. In particular, Applicants
have identified and isolated cDNA
encoding a PR0222 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a sequence
encoding full-length native sequence
PR0222 (shown in Figure 48 and SEQ ID N0:132) has 25-26% amino acid identity
with mouse complement
factor h precursor, has 27-29% amino acid identity with complement receptor,
has 25-47% amino acid identity
with mouse complement C3b receptor type 2 long form precursor, has 40% amino
acid identity with human
hypothetical protein kiaa0247. Accordingly, it is presently believed that
PR0222 polypeptide disclosed in the
present application is a newly identified member of the complement receptor
family and possesses activity typical
of the complement receptor family.
21. Futl-length PR0234 Polvne tides
The presentinventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0234. In particular, Applicants
have identified and isolated cDNA
encoding a PR0234 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST (FastA
format) sequence alignment computer programs, Applicants found that a cDNA
sequence encoding full-length
native sequence PR0234 has 31 % identity and Blast score of 134 with E-
selectin precursor. Accordingly, it is
presently believed that the PR0234 polypeptides disclosed in the present
application are newly identified
members of the lectin/selectin family and possess activity typical of the
lectinlselectin family.
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
22. Full-length PR023I Pol aentides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0231. In particular, Applicants
have identified and isolated cDNA
encoding a PR0231 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that the full-length
native sequence PR0231
polypeptide (shown in Figure 52 and SEQ ID N0:142) has 30 % and 31 % amino
acid identity with human and
rat prostatic acid phosphatase precursor proteins, respectively. Accordingly,
it is presently believed that the
PR0231 polypeptide disclosed in the present application may be a newly
identified member of the acid
phosphatase protein family.
23. Full-IenQth PR0229 Polypeptides
The present invention provides newly identified and isolated
nucleotidesequences encoding polypeptides
referred to in the present application as PR0229. In particular, Applicants
have identified and isolated cDNA
encoding a PR0229 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0229 polypeptide have
significant homology with antigen wcl.l, M130 antigen, T cell surface
glycoprotein CD6 and CD6. It also is
related to Sp-alpha. Accordingly, it is presently believed that PR0229
polypeptide disclosed in the present
application is a newly identified member of the family containing scavenger
receptor homology, a sequence motif
found in a number of proteins involved in immune function and thus possesses
immune function and /or
segments which resist degradation, typical of this family.
24. Full-IenQth PR0238 Polvaeptides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0238. In particular, Applicants
have identified and isolated cDNA
encoding a PR0238 poIypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0238 polypeptide have
significant homology with reductases, including oxidoreductase and fatty acyl-
CoA reductase. Accordingly, it
is presently believed that PR0238 polypeptide disclosed in the present
application is a newly identified member
of the reductase family and possesses reducing activity typical of the
reductase family.
25. Full-leneth PR0233 Polvpeptides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0233. In particular, Applicants
have identified and isolated cDNA
encoding a PR0233 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0233 polypeptide have
significant homology with the reductase protein. Applicants have also found
that the DNA encoding the PR0233
polypeptide has significant homology with proteins from Caenorhabditis
elegans. Accordingly, it is presently
believed that PR0233 polypeptide disclosed in the present application is a
newly identified member of the
86
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
reductase family and possesses the ability to effect the redox state of the
cell typical of the reductase family.
26. Full-length PR0223 Polyneptides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0223. In particular, Applicants
have identified and isolated cDNA
encoding a PR0223 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that the PR0223
polypeptide has significant homology
with various serine carboxypeptidase polypeptides. Accordingly, it is
presently believed that PR0223
polypeptide disclosed in the present application is a newly identified serine
carboxypeptidase.
27. Full-length PR0235 Polvnentides
The present invention provides newly identified and isolated
nucleotidesequences encoding polypeptides
referred to in the present application as PR0235. In particular, Applicants
have identified and isolated cDNA
encoding a PR0235 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0235 polypeptide have
significant homology with the various plexin proteins. Accordingly, it is
presently believed that PR0235
polypeptide disclosed in the present application is a newly identified member
of the plexin family and possesses
cell adhesion properties typical of the plexin family.
28. Full-IenQth PR0236 and PR0262 Polvpeptides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0236 and PR0262. In particular,
Applicants have identified and
isolated cDNA encoding PR0236 and PR0262 polypeptides, as disclosed in further
detail in the Examples
below. Using BLAST and FastA sequence alignment computer programs, Applicants
found that various portions
of the PR0236 and PR0262 polypeptides have significant homology with various
(3-galactosidase and X3-
galactosidase precursor polypeptides. Accordingly, it is presently believed
that the PR0236 and PR0262
polypeptides disclosed in the present application are newly identified (3-
galactosidase homologs.
29. Full-length PR0239 Polvneptides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0239. In particular, Applicants
have identified and isolated cDNA
encoding a PR0239 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0239 polypeptide have
significant homology with densin proteins. Accordingly, it is presently
believed that PR0239 polypeptide
disclosed in the present application is a newly identified member of the
densin family and possesses cell adhesion
and the ability to effect synaptic processes as is typical of the densin
family.
87
CA 02343577 2001-03-16
wo oon s796
PCT/US99/21090
30. Full-length PR0257 Polvpeptides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0257. In particular, Applicants
have identified and isolated cDNA
encoding a PR0257 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0257 polypeptide have
significant homology with the ebnerin precursor and ebnerin protein.
Accordingly, it is presently believed that
PR0257 polypeptide disclosed in the present application is a newly identified
protein member which is related
to the ebnerin protein.
31. Full-IenQth PR0260 Polypeptides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0260. In particular, Applicants
have identified and isolated cDNA
encoding a PR0260 polypeptide, as disclosed in further detail in the Examples
below. Using programs such as
BLAST and FastA sequence alignment computer programs, Applicants found that
various portions of the
PR0260 polypeptide have significant homology with the alpha-1-fucosidase
precursor. Accordingly, it is
presently believed that PR0260 polypeptide disclosed in the present
application is a newly identified member
of the fucosidase family and possesses enzymatic activity related to fucose
residues typical of the fucosidase
family.
32. Full-length PR0263 Polvueptides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0263. In particular, Applicants
have identified and isolated eDNA
encoding a PR0263 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0263 polypeptide have
significant homology with the CD44 antigen and related proteins. Accordingly,
it is presently believed that
PR0263 polypeptide disclosed in the present application is a newly identified
member of the CD44 antigen
family and possesses at least one of the properties associated with these
antigens, i.e., cancer and HIV marker,
cell-cell or cell-matrix interactions, regulating cell traffic, lymph node
homing, transmission of growth signals,
and presentation of chemokines and growth facors to traveling cells.
33. Full-length PR0270 Polvpeptides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0270. In particular, Applicants
have identified and isolated cDNA
encoding a PR0270 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST, FastA and
sequence alignment computer programs, Applicants found that that various
portions of the PR0270 polypeptide
have significant homology with various thioredoxin proteins. Accordingly, it
is presently believed that PR0270
polypeptide disclosed in the present application is a newly identified member
of the thioredoxin family and
possesses the ability to effect reduction-oxidation (redox) state typical of
the thioredoxin family.
8'8
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
34. Full-length PR0271 Polypeptides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0271. In particular, Applicants
have identified and isolated cDNA
encoding a PR0271 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that the PR0271
polypeptide has significant homology
with various link proteins and precursors thereof. Accordingly, it is
presently believed that PR0271 polypeptide
disclosed in the present application is a newly identified link protein
homolog.
35. Full-leneth PR0272 Polvpeptides
The present invention provides newly identified and isolated
nucleotidesequencesencoding polypeptides
referred to in the present application as PR0272. In particular, Applicants
have identified and isolated cDNA
encoding a PR0272 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0272 polypeptide have
significant homology with the human reticulocalbin protein and its precursors.
Applicants have also found that
the DNA encoding the PR0272 polypeptide has significant homology with the
mouse reticulocalbin precursor
protein. Accordingly, it is presently believed that PR0272 polypeptide
disclosed in the present application is
a newly identified member of the reticulocalbin family and possesses the
ability to bind calcium typical of the
reticulocalbin family.
36. Full-leneth PR0294 Polyuentides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0294. In particular, Applicants
have identified and isolated cDNA
encoding a PR0294 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0294 polypeptide have
significant homology with the various portions of a number of collagen
proteins. Accordingly, it is presently
believed that PR0294 polypeptide disclosed in the present application is a
newly identified member of the
collagen family.
37. Full-length PR0295 Polypeptides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0295. In particular, Applicants
have identified and isolated cDNA
encoding a PR0295 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST~and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0295 polypeptide have
significant homology with integrin proteins. Accordingly, it is presently
believed that PR0295 polypeptide
disclosed in the present application is a newly identified member of the
integrin family and possesses cell
adhesion typical of the integrin family.
89
CA 02343577 2001-03-16
WO 00/I5796 PCT/US99/21090
38. Full-length PR0293 Polvpeotides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0293. In particular, Applicants
have identified and isolated cDNA
encoding a PR0293 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that portions of the
PR0293 poiypeptide have
significant homology with the neuronal Ieucine rich repeat proteins 1 and 2,
(NLRR-1 and NLRR-2), particularly
NLRB-2. Accordingly, it is presently believed that PR0293 polypeptide
disclosed in the present application is
a newly identified member of the neuronal leucine rich repeat protein family
and possesses ligand-ligand binding
activity typical of the NRLL protein family.
39. Full-length PR0247 Polvneptides
The present invention provides newly identified and isolated
nucleotidesequences encoding polypeptides
referred to in the present application as PR0247. In particular, Applicants
have identified and isolated cDNA
encoding a PR0247 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0247 polypeptide have
significant homology with densin. Applicants have also found that the DNA
encoding the PR0247 polypeptide
has significant homology with a number of other proteins, including KIAA0231.
Accordingly, it is presently
believed that PR0247 polypeptide disclosed in the present application is a
newly identified member of the leucine
rich repeat family and possesses ligand binding abilities typical of this
family.
40. FuII-length PR0302 PR0303 PR0304 PR0307 and PR0343 Polvpeptides
The present invention providesnewly identifiedand isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0302, PR0303, PR0304, PR0307 and
PR0343. In particular,
Applicants have identified and isolated cDNA encoding PR0302, PR0303, PR0304,
PR0307 and PR0343
polypeptides, as disclosed in further detail in the Examples below. Using
BLAST and FastA sequence alignment
computer programs, Applicants found that various portions of the PR0302,
PR0303, PR0304, PR0307 and
PR0343 polypeptides have significant homology with various protease proteins.
Accordingly, it is presently
believed that the PR0302, PR0303, PR0304, PR0307 and PR0343 polypeptides
disclosed in the present
application are newly identified protease proteins.
41. Full-leneth PR0328 Polypeptides
The presentinvention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0328. In particular, Applicants
have identified and isolated cDNA
encoding a PR0328 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0328 polypeptide have
significant homology with the human glioblastoma protein ("GLIP"). Further,
Applicants found that various
portions of the PR0328 polypeptide have significant homology with the cysteine
rich secretory protein
("CRISP") as identified by BLAST homology [ECCRISP3-1, 568683, and CRS3
HUMAN]. Accordingly, it
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
is presently believed that PR0328 polypeptide disclosed in the present
application is a newly identified member
of the GLIP or CRISP families and possesses transcriptional regulatory
activity typical of the GLIP or CRISP
families.
42. Full-length PR0335, PR0331 and PR0326 Polvpe~tides
The present invention provides newly identified and isolated nucleotide
sequencesencodingpolypeptides
referred to in the present application as PR0335, PR0331 or PR0326. In
particular, Applicants have identified
and isolated cDNA encoding a PR0335, PR0331 or PR0326 polypeptide, as
disclosed in further detail in the
Examples below. Using BLAST and FastA sequence alignment computer programs,
Applicants found that
various portions of the PR0335, PR0331 or PR0326 polypeptide have significant
homology with LIG-1, ALS
and in the case of PR0331, additionally, decorili. Accordingly, it is
presently believed that the PR0335,
PR0331 and PR0326 polypeptides disclosed in the present application are newly
identified members of the
leucine rich repeat superfamily, and particularly, are related to LIG-1 and
possess the biological functions of this
family as discussed and referenced herein.
43. Full-length PR0332 Pohepeptides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0332. In particular, Applicants
have identified and isolated cDNA
encoding PR0332 polypeptides, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a full-length
native sequence PR0332 (shown in
Figure 108 and SEQ ID N0:310) has about 30-40% amino acid sequence identity
with a series of known
proteoglycan sequences, including, for example, fibromodulin and fibromodulin
precursor sequences of various
species (FMOD BOV1N, FMOD CHICK, FMOD RAT, FMOD MOUSE, FMOD IiUMAN, P 836773),
osteomodulin sequences (AB000114 _1, AB007848_1), decorin sequences (CFU83141
_1, OCU03394_1, P
842266, P 842267, P 842260, P 889439), keratan sulfate proteoglycans (BTU48360
_l, AF022890-1), corneal
proteoglycan (AF022256_1), and bone/cartilage proteoglycans and proteoglycane
precursors (PGS1 BOVIN,
PGS2_ MOUSE, PGS2 HUMAN). Accordingly, it is presently believed that PR0332
disclosed in the present
application is a new proteoglycan-type molecule, and may play a role in
regulating extracellular matrix, cartilage,
and/or bone function.
44. Full-length PR0334 Polypeptides
The present invention provides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0334. In particular, Applicants
have identified and isolated cDNA
encoding a PR0334 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0334 polypeptide have
significant homology with fibulin and fibrillin. Accordingly, it is presently
believed that PR0334 polypeptide
disclosed in the present application is a newly identified member of the
epidermal growth factor family and
possesses properties and activities typical of this family.
91
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
45. Full-length PR0346 Polyt~eptides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0346. In particular, Applicants
have identified and isolated cDNA
encoding a PR0346 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that a full-length
native sequence PR0346 (shown in
Figure 112 and SEQ ID N0:320) has 28 % amino acid sequence identity with
carcinoembryonic antigen.
Accordingly, it is presently believed that PR0346 disclosed in the present
application is a newly identified
member of the carcinoembryonic protein family and may be expressed in
association with neoplastic tissue
disorders.
46. Full-length PR0268 Polypeetides
The present invention provides newly identified and isolated
nucleotidesequences encoding polypeptides
referred to in the present application as PR0268. In particular, Applicants
have identified and isolated cDNA
encoding a PR0268 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that portions of the
PR0268 polypeptide have
I S significant homology with the various protein disulfide isomerase
proteins. Accordingly, it is presently believed
that PR0268 polypeptide disclosed in the present application is a homolog of
the protein disulfide isomerase p5
protein.
47. Full-length PR0330 Polvoeutides
The present invention provides newly identified and isolated nucleotide
sequences encodingpolypeptides
referred to in the present application as PR0330. In particular, Applicants
have identified and isolated cDNA
encoding a PR0330 polypeptide, as disclosed in further detail in the Examples
below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that various portions
of the PR0330 polypeptide have
significant homology with the marine prolyl 4-hydroxylase alpha-II subunit
protein. Accordingly, it is presently
believed that PR0330 polypeptide disclosed in the present application is a
novel prolyl 4-hydroxylase subunit
polypeptide.
48. Full-length PR0339 and PR0310 Polyneutides
The present inventionprovides newly identified and isolated nucleotide
sequences encoding polypeptides
referred to in the present application as PR0339 and PR0310. In particular,
Applicants have identified and
isolated cDNA encoding a PR0339 polypeptide, as disclosed in further detail in
the Examples below: Applicants
have also identified and isolated cDNA encoding a PR0310 polypeptide, as
disclosed in further detail in the
Examples below. Using BLAST and FastA sequence alignment computer programs,
Applicants found that
various portions of the PR0339 and PR0310 polypeptides have significant
homology with small secreted
proteins from C. elegans and are distantly related to fringe. PR0339 also
shows homology to collagen-like
polymers. Sequences which were used to identify PR0310, designated herein as
DNA40533 and DNA42267,
also show homology to proteins from C. eleganS. Accordingly, it is presently
believed that the PR0339 and
92
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
PR0310 polypeptides disclosed in the present application are newly identified
member of the family of proteins
involved in development, and which may have regulatory abilities similar to
the capability of fringe to regulate
senate.
49. Full Lens=th PR0244 Polvpeptides
S The present invention provides newly identified and isolated nucleotide
sequences encoding C-type
lectins referred to in the present application as PR0244. In particular,
applicants have identified and isolated
eDNA encoding PR0244 polypeptides, as disclosed in further detail in the
Examples below. Using BLAST and
FastA sequence alignment computer programs, Applicants found that a full-
length native sequence PR0244
(shown in Figure 122 and SEQ ID N0:377) has 43 % amino acid sequence identity
with the hepatic lectin gallus
gallus (LECH-CHICK), and 42% amino acid sequence identity with an HIV gp120
binding C-type lectin
(A46274). Accordingly, it is presently believed that PR0244 disclosed in the
present application is a newly
identified member of the C-lectin superfamily and may play a role in immune
function, apoptosis, or in the
pathogenesis of atherosclerosis. In addition, PR0244 may be useful in
identifying tumor-associated epitopes.
B. PRO Polypentide Variants
In addition to the full-length native sequence PRO polypeptides described
herein, it is contemplated that
PRO variants can be prepared. PRO variants can be prepared by introducing
appropriate nucleotide changes into
the PRO DNA, and/or by synthesis of the desired PRO polypeptide. Those skilled
in the art will appreciate that
amino acid changes may alter post-translational processes of the PRO, such as
changing the number or position
of glycosylation sites or altering the membrane anchoring characteristics.
Variations in the native full-length sequence PRO or in various domains of the
PRO described herein,
can be made, for example, using any of the techniques and guidelines for
conservative and non-conservative
mutations set forth, for instance, in U.S. Patent No. 5,364,934. Variations
may be a substitution, deletion or
insertion of one or more codons encoding the PRO that results in a change in
the amino acid sequence of the
2S PRO as compared with the native sequence PRO. Optionally the variation is
by substitution of at least one amino
acid with any other amino acid in one or more of the domains of the PRO.
Guidance in determining which
amino acid residue may be inserted, substituted or deleted without adversely
affecting the desired activity may
be found by comparing the sequence of the PRO with that of homologous known
protein molecules and
minimizing the number of amino acid sequence changes made in regions of high
homology. Amino acid
substitutions can be the result of replacing one amino acid with another amino
acid having similar structural
and/or chemical properties, such as the replacement of a leucine with a
serine, i.e., conservative amino acid
replacements. Insertions or deletions may optionally be in the range of about
1 to 5 amino acids. The variation
allowed may be determined by systematically making insertions, deletions or
substitutions of amino acids in the
sequence and testing the resulting variants for activity exhibited by the full-
length or mature native sequence.
3S PRO polypeptide fragments are provided herein. Such fragments may be
truncated at the N-terminus
or C-terminus, or may lack internal residues, for example, when compared with
a full length native protein.
Certain fragments lack amino acid residues that are not essential for a
desired biological activity of the PRO
93
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
polypeptide.
PRO fragments may be prepared by any of a number of conventional techniques.
Desired peptide
fragments may be chemically synthesized. An alternative approach involves
generating PRO fragments by
enzymatic digestion, e.g., by treating the protein with an enzyme known to
cleave proteins at sites defined by
particular amino acid residues, or by digesting the DNA with suitable
restriction enzymes and isolating the
desired fragment. Yet another suitable technique involves isolating and
amplifying a DNA fragment encoding
a desired polypeptide fragment, by polymerase chain reaction (PCR).
Oligonucleotides that define the desired
termini of the DNA fragment are employed at the 5' and 3' primers in the PCR.
Preferably, PRO polypeptide
fragments share at least one biological and/or immunological activity with the
native PRO polypeptide disclosed
herein.
In particular embodiments, conservative substitutions of interest are shown in
Table 1 under the heading
of preferred substitutions. If such substitutions result in a change in
biological activity, then more substantial
changes, denominated exemplary substitutions in Table 1, or as further
described below in reference to amino
acid classes, are introduced and the products screened.
94
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 1
Original Exemplary Preferred
Residue Substitutions Substitutions
S Ala (A) val; leu; ile val
Arg (R) lys; gln; asp lys
Asn (N) gln; his; lys; arg gln
Asp (D) glu glu
Cys (C) ser ser
Gln (Q) asp
asp
Glu (E) asp asp
Gly (G) pro; ala ala
His (H) asp; gln; lys; arg arg
Ile (I) leu; val; met; ala;
phe;
norleucine leu
Leu (L) norleucine; ile; val;
met; ala; phe ile
Lys (K) arg; gln; asp arg
Met (M) leu; phe; ile leu
Phe (F) leu; val; ile; ala; leu
tyr
Pro (P) ala ala
Ser (S) thr ~r
Thr (T) ser ser
Trp (W) tyr; phe tyr
Tyr (Y) trp; phe; thr; ser phe
Val (V) ile; leu; met; phe;
aia; norleucine leu
Substantial modifications in functionor immunologicalidentity of the PRO
polypeptide are accomplished
by selecting substitutions that differ significantly in their effect on
maintaining (a) the structure of the polypeptide
backbone in the area of the substitution, for example, as a sheet or helical
conformation, (b) the charge or
hydrophobicity of the molecule at the target site, or (c) the bulk of the side
chain. Naturally occurring residues
are divided into groups based on common side-chain properties:
(1) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophilic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asp, gln, his, lys, arg;
(5) residues that influence chain orientation: gly, pro; and
(6) aromatic: trp, tyr, phe.
Non-conservative substitutions will entail exchanging a member of one of these
classes for another class.
Such substituted residues also may be introduced into the conservative
substitution sites or, more preferably, into
the remaining (non-conserved) sites.
The variations can be made using methods known in the art such as
oligonucleotide-mediated (site-
directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed
mutagenesis [Carter et al., Nucl.
4S Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res., 10:6487
(1987)], cassette mutagenesis [Wells et
ai., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells et al.,
Philos. Traps. R. Soc. London SerA
317:415 (1986)] or other known techniques can be performed on the cloned DNA
to produce the PRO variant
9S
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
DNA.
Scanning amino acid analysis can also be employed to identify one or more
amino acids along a
contiguous sequence. Among the preferred scanning amino acids are relatively
small, neutral amino acids. Such
amino acids include alanine, glycine, serine, and cysteine. Alanine is
typically a preferred scanning amino acid
among this group because it eliminates the side-chain beyond the beta-carbon
and is less likely to alter the main-
s chain conformation of the variant [Cunningham and Wells, Science. 244: 1081-
1085 (1989)]. Alanine is also
typically preferred because it is the most common amino acid. Further, it is
frequently found in both buried and
exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.);
Chothia, J. Mol. Biol., 150:1
(1976)]. If alanine substitution does not yield adequate amounts of variant,
an isoteric amino acid can be used.
C. Modifications of PRO
Covalent modifications of PRO are included within the scope of this invention.
One type of covalent
modification includes reacting targeted amino acid residues of a PRO
polypeptide with an organic derivatizing
agent that is capable of reacting with selected side chains or the N- or C-
terminal residues of the PRO.
Derivatization with bifunctional agents is useful, for instance, for
crosslinking PRO to a water-insoluble support
matrix or surface for use in the method for purifying anti-PRO antibodies, and
vice-versa. Commonly used
crosslinking agents include, e.g., 1,1-bis(diazoacetyl)-2-phenylethane,
glutaraldehyde, N-hydroxysuccinimide
esters, for example, esters with 4-azidosalicylic acid, homobifunctional
imidoesters, including disuccinimidyl
esters such as 3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides
such as bis-N-maleimido-1,8-
octane and agents such as methyl-3-[(p-azidophenyl)dithio]propioimidate.
Other modifications include deamidation of glutaminyl and asparaginyl residues
to the corresponding
glutamyl and aspartyl residues, respectively, hydroxylation of proline and
lysine, phosphorylation of hydroxyl
groups of seryl or threonyl residues, methylation of the a-amino groups of
lysine, arginine, and histidine side
chains [T.E. Creighton, Proteins: Structure and Molecular Properties, W.H.
Freeman & Co., San Francisco,
pp. 79-86 (1983)], acetylation of the N-terminal amine, and amidation of any C-
terminal carboxyl group.
Another type of covalent modification of the PRO polypeptide included within
the scope of this
invention comprises altering the native glycosylation pattern of the
polypeptide. "Altering the native
glycosylation pattern" is intended for purposes herein to mean deleting one or
more carbohydrate moieties found
in native sequence PRO (either by removing the underlying glycosylation site
or by deleting the glycosylation
by chemical and/or enzymatic means), and/or adding one or more glycosylation
sites that are not present in the
native sequence PRO. In addition, the phrase includes qualitative changes in
the glycosylation of the native
proteins, involving a change in the nature and proportions of the various
carbohydrate moieties present.
Addition of glycosylation sites to the PRO polypeptide may be accomplished by
altering the amino acid
sequence. The alteration may be made, for example, by the addition of, or
substitution by, one or more serine
or threonine residues to the native sequence PRO (for O-linked glycosylation
sites). The PRO amino acid
sequence may optionally be altered through changes at the DNA level,
particularly by mutating the DNA
encoding the PRO polypeptide at preselected bases such that codons are
generated that will translate into the
desired amino acids.
96
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Another means of increasing the number of carbohydrate moieties on the PRO
polypeptide is by
chemical or enzymatic coupling of glycosides to the polypeptide. Such methods
are described in the art, e.g.,
in WO 87/05330 published 11 September 1987, and in Aplin and Wriston, CRC
Crit. Rev. Biochem. , pp. 259-
306 (1981).
Removal of carbohydrate moieties present on the PRO polypeptide may be
accomplished chemically
S or enzymatically or by mutational substitution of codons encoding for amino
acid residues that serve as targets
for glycosylation. Chemical deglycosylation techniques are known in the art
and described, for instance, by
Hakimuddin, et al., Arch. Biochem. Bio",phys.. 259:52 (1987) and by Edge et
al., Anal. Biochem., 118:131
( 1981 ). Enzymatic cleavage of carbohydrate moieties on polypeptides can be
achieved by the use of a variety
of endo- and exo-glycosidases as described by Thotakura et al., Meth.
Enzvmol., 138:350 (1987).
Another type of covalent modification of PRO comprises linking the PRO
polypeptide to one of a variety
of nonproteinaceous polymers, e.g., polyethylene glycol (PEG), polypropylene
glycol, or polyoxyalkylenes, in
the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144;
4,670,417; 4,791,192 or 4,179,337.
The PRO of the present invention may also be modified in a way to form a
chimeric molecule
comprising PRO fused to another, heterologous polypeptide or amino acid
sequence.
1S In one embodiment, such a chimeric molecule comprises a fusion of the PRO
with a tag polypeptide
which provides an epitope to which an anti-tag antibody can selectively bind.
The epitope tag is generally placed
at the amino- or carboxyl- terminus of the PRO. The presence of such epitope-
tagged forms of the PRO can be
detected using an antibody against the tag polypeptide. Also, provision of the
epitope tag enables the PRO to
be readily purified by affinity purification using an anti-tag antibody or
another type of affinity matrix that binds
to the epitope tag. Various tag polypeptides and their respective antibodies
are well known in the art. Examples
include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly)
tags; the flu HA tag polypeptide and its
antibody 12CA5 [Field et al., Mol. Cell. BioL, 8:2159-2165 (1988)]; the c-myc
tag and the 8F9, 3C7, 6E10,
G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular
Biolosv 5:3610-3616 (1985)]; and the
Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et
al., Protein En. ineering, 3(6):547-
553 (1990)). Other tag polypeptides include the Flag-peptide [Hope et aL,
BioTechnolosv. 6:1204-1210
(1988)]; the KT3 epitope peptide [Martin et al., Science, 255:192-194 (1992)];
an a-tubulin epitope peptide
[Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10
protein peptide tag [Lutz-
Freyermuth et al., Proc. Natl. Acad. Sci. USA 87:6393-6397 (1990)].
In an alternative embodiment, the chimeric molecule may comprise a fusion of
the PRO with an
immunoglobulin or a particular region of an immunoglobulin. For a bivalent
form of the chimeric molecule (also
referred to as an "immunoadhesin"), such a fusion could be to the Fc region of
an IgG molecule. The Ig fusions
preferably include the substitution of a soluble (transmembrane domain deleted
or inactivated) form of a PRO
polypeptide in place of at least one variable region within an Ig molecule. In
a particularly preferred
embodiment, the immunoglobulin fusion includes the hinge, CH2 and CH3, or the
hinge, CH1, CH2 and CH3
3S regions of an IgG 1 molecule. For the production of immunoglobulin fusions
see also US Patent No. 5,428,130
issued June 27, 1995.
97
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
D. Preparation of PRO
The description below relates primarily to production of PRO by culturing
cells transformed or
transfected with a vector containing PRO nucleic acid. It is, of course,
contemplated that alternative methods,
which are well known in the art, may be employed to prepare PRO. For instance,
the PRO sequence, or
portions thereof, may be produced by direct peptide synthesis using solid-
phase techniques (see, e.g., Stewart
et al., Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA
(1969); Merrifield, J. Am. Chem.
Soc., 85:2149-2154 (1963)]. In vitro protein synthesis may be performed using
manual techniques or by
automation. Automated synthesis may be accomplished, for instance, using an
Applied Biosystems Peptide
Synthesizer (Foster City, CA) using manufacturer's instructions. Various
portions of the PRO may be
chemically synthesized separately and combined using chemical or enzymatic
methods to produce the full-length
PRO.
Isolation of DNA Encoding PRO
DNA encoding PRO may be obtained from a cDNA library prepared from tissue
believed to possess
the PRO mRNA and to express it at a detectable level. Accordingly, human PRO
DNA can be conveniently
obtained from a cDNA library prepared from human tissue, such as described in
the Examples. The PRO-
encoding gene may also be obtained from a genomic library or by known
synthetic procedures (e.g., automated
nucleic acid synthesis).
Libraries can be screened with probes (such as antibodies to the PRO or
oligonucleotides of at least
about 20-80 bases) designed to identify the gene of interest or the protein
encoded by it. Screening the cDNA
or genomic library with the selected probe may be conducted using standard
procedures, such as described in
Sambrook et al., Molecular Clonine: A Laboratory Manual (New York: Cold Spring
Harbor Laboratory Press,
1989). An alternative means to isolate the gene encoding PRO is to use PCR
methodology [Sambrook et al.,
supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, 1995)].
The Examples below describe techniques for screening a cDNA library. The
oligonucleotide sequences
selected as probes should be of sufficient length and sufficiently unambiguous
that false positives are minimized.
The oligonucleotide is preferably labeled such that it can be detected upon
hybridization to DNA in the library
being screened. Methods of labeling are well known in the art, and include the
use of radiolabels like 3zP-labeled
ATP, biotinylation or enzyme labeling. Hybridization conditions, including
moderate stringency and high
stringency, are provided in Sambrook et al., supra.
Sequences identified in such library screening methods can be compared and
aligned to other known
sequences deposited and available in public databases such as GenBank or other
private sequence databases.
Sequence identity (at either the amino acid or nucleotide level) within
defined regions of the molecule or across
the full-length sequence can be determined using methods known in the art and
as described herein.
Nucleic acid having protein coding sequence may be obtained by screening
selected cDNA or genomic
libraries using the deduced amino acid sequence disclosed herein for the first
time, and, if necessary, using
conventional primer extension procedures as described in Sambrook et al.,
supra, to detect precursors and
processing intermediates of mRNA that may not have been reverse-transcribed
into cDNA.
98
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
2. Selection and Transformation of Host Cells
Host cells are transfected or transformed with expression or cloning vectors
described herein for PRO
production and cultured in conventional nutrient media modified as appropriate
for inducing promoters, selecting
transformants, or amplifying the genes encoding the desired sequences. The
culture conditions, such as media,
temperature, pH and the like, can be selected by the skilled artisan without
undue experimentation. In general,
principles, protocols, and practical techniques for maximizing the
productivity of cell cultures can be found in
Mammalian Cell Biotechnologw a Practical Approach M. Butler, ed. (IRL Press,
1991) and Sambrook et al.,
su ra.
Methods of eukaryotic cell transfection and prokaryotic cell transformation
are known to the ordinarily
skilled artisan, for example, CaCI,, CaP04, liposome-mediated and
electroporation. Depending on the host cell
IO used, transformation is performed using standard techniques appropriate to
such cells. The calcium treatment
employing calcium chloride, as described in Sambrook et al., supra, or
electroporation is generally used for
prokaryotes. Infection with Agro6acterium tumefaciens is used for
transformation of certain plant cells, as
described by Shaw et al. , Gene, 23:3 I S ( 1983) and WO 89/05859 published 29
June 1989. For mammalian cells
without such cell walls, the calcium phosphate precipitation method of Graham
and van der Eb, Virolosy,
52:456-457 (1978) can be employed. General aspects of mammalian cell host
system transfections have been
described in U.S. Patent No. 4,399,216. Transformations into yeast are
typically carried out according to the
method of Van Solingen et al., J. Bact., 130:946 (1977) and Hsiao et al.,
Proc. Natl. Acad Sci (USA), 76:3829
(1979). However, other methods for introducing DNA into cells, such as by
nuclear microinjection,
electroporation, bacterial protoplast fusion with intact cells, or
polycations, e.g., polybrene, polyornithine, may
also be used. For various techniques for transforming mammalian cells, see
Keown et al., Methods in
Enzymoloev. 185:527-537 (1990) and Mansour et- al., Nature. 336:348-352
(1988).
Suitable host cells for cloning or expressing the DNA in the vectors herein
include prokaryote, yeast,
or higher eukaryote cells. Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative
or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli.
Various E. coli strains are
publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli
X1776 (ATCC 31,537); E. coli
strain W3110 (ATCC 27,325) and KS 772 (ATCC 53,635). Other suitable
prokaryotic host cells include
Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia,
Klebsiella, Proteus, Salmonella,
e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and
Shigella, as well as Bacilli such as B.
subtilis and B. licheniformis (e.g., B. licheniformis 41P disclosed in DD
266,710 published 12 April 1989),
Pseudomonas such as P. aeruginosa, and Streptomyces. These examples are
illustrative rather than limiting.
Strain W3110 is one particularly preferred host or parent host because it is a
common host strain for recombinant
DNA product fermentations. Preferably, the host cell secretes minimal amounts
of proteolytic enzymes. For
example, strain W3110 may be modified to effect a genetic mutation in the
genes encoding proteins endogenous
to the host, with examples of such hosts including E. coli W3110 strain 1A2,
which has the complete genotype
tonA ; E. coli W3110 strain 9E4, which has the complete genotype tonA ptr3; E.
coli W3110 strain 27C7
(ATCC 55,244), which has the complete genotype tonA ptr3 phoA E15 (argF
lac)169 degP ompT kan~; E. coli
W3110 strain 37D6, which has the complete genotype tonA ptr3 phoA E75 (argF-
lac~169 degP ompT rbs7
99
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
ilvG kan ; E. coli W3110 strain 40B4, which is strain 37D6 with a non-
kanamycin resistant degP deletion
mutation; and an E. coli strain having mutant periplasmic protease disclosed
in U.S. Patent No. 4,946,783 issued
7 August 1990. Alternatively, in vitro methods of cloning, e.g. , PCR or other
nucleic acid polymerase reactions,
are suitable.
In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or
yeast are suitable cloning
or expression hosts for PRO-encoding vectors. Saccharomyces cerevisiae is a
commonly used lower eukaryotic
host microorganism. Others include Schizosaccharomyces pombe (Beach and Nurse,
Nature, 290: 140 [1981];
EP 139,383 published 2 May 1985); Kluyveromyces hosts (U.S. Patent No.
4,943,529; Fleer et al.,
Bio/TechnoloQV. 9:968-975 (1991)) such as, e.g., K. lactis (MW98-8C, CBS683,
CBS4574; Louvencourt et al.,
J. Bacteriol., 737 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC
16,045), K. wickeramii (ATCC
24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906; Van den Berg
et al., Bio/Technolosy.
8:135 (1990)), K. thermotolerans, and K. marxianus; yarrowia (EP 402,226);
Pichia pastoris (EP 183,070;
Sreekrishna et al., J. Basic Microbiol.. 28:265-278 [1988]); Candida;
Trichoderma reesia (EP 244,234);
Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA, 76:5259-5263
[1979]); Schwanniomyces such as
Schwanniomyces occidentalis (EP 394,538 published 31 October 1990); and
filamentous fungi such as, e.g.,
Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January
1991), and Aspergillus hosts such
as A. nidulans (Ballance et al., B_iochem. Biophys. Res. Commun. 112:284-289
[1983]; Tilburn et al., Gene,
26:205-221 [1983]; Yelton et al., Proc. Natl. Acad. Sci. USA, 81: 1470-1474
[1984]) and A. niger (Kelly and
Hynes, EMBO J., 4:475-479 (1985]). Methylotropic yeasts are suitable herein
and include, but are not limited
to, yeast capable of growth on methanol selected from the genera consisting of
Hansenula, Candida, Kloeckera,
Pichia, Saccharomyces, Torulopsis, and Rhodotorula. A list of specific species
that are exemplary of this class
of yeasts may be found in C. Anthony, The Biochemistry of Methvlotrophs 269
(1982).
Suitable host cells for the expression of glycosylated PRO are derived from
multicellular organisms.
Examples of invertebrate cells include insect cells such as Drosophila S2 and
Spodoptera Sf9, as well as plant
cells. Examples of useful mammalian host cell lines include Chinese hamster
ovary (CHO) and COS cells.
More specific examples include monkey kidney CV1 line transformed by SV40 (COS-
7, ATCC CRL 1651);
human embryonic kidney line (293 or 293 cells subcloned for growth in
suspension culture, Graham et al., J_
Gen Virol., 36:59 (1977)); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and
Chasin, Proc. Natl. Acad.
Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod.,
23:243-251 (1980)); human lung
cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse
mammary tumor (MMT
060562, ATCC CCL51). The selection of the appropriate host cell is deemed to
be within the skill in the art.
3. Selection and Use of a Replicable Vector
The nucleic acid (e.g., cDNA or genomic DNA) encoding PRO may be inserted into
a replicable vector
for cloning (amplification of the DNA) or for expression. Various vectors are
publicly available. The vector
may, for example, be in the form of a plasmid, cosmid, viral particle, or
phage. The appropriate nucleic acid
sequence may be inserted into the vector by a variety of procedures. In
general, DNA is inserted into an
appropriate restriction endonuclease sites) using techniques known in the art.
Vector components generally
100
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
include, but are not limited to, one or more of a signal sequence, an origin
of replication, one or more marker
genes, an enhancer element, a promoter, and a transcription termination
sequence. Construction of suitable
vectors containing one or more of these components employs standard Iigation
techniques which are known to
the skilled artisan.
The PRO may be produced recombinantly not only directly, but also as a fusion
polypeptide with a
S heterologous polypeptide, which may be a signal sequence or other
polypeptide having a specific cleavage site
at the N-terminus of the mature protein or polypeptide. In general, the signal
sequence may be a component of
the vector, or it may be a part of the PRO-encoding DNA that is inserted into
the vector. The signal sequence
may be a prokaryotic signal sequence selected, for example, from the group of
the alkaline phosphatase,
penicillinase, lpp, or heat-stable enterotoxin II leaders. For yeast secretion
the signal sequence may be, e.g.,
the yeast invertase leader, alpha factor leader (including Saccharomyces and
Kluyveromyces a-factor leaders,
the latter described in U.S. Patent No. 5,010,182), or acid phosphatase
leader, the C. albicans glucoamylase
leader (EP 362,179 published 4 April 1990), or the signal described in WO
90/13646 published 15 November
1990. In mammalian cell expression, mammalian signal sequences may be used to
direct secretion of the
protein, such as signal sequences from secreted polypeptides of the same or
related species, as well as viral
secretory leaders.
Both expression and cloning vectors contain a nucleic acid sequence that
enables the vector to replicate
in one or more selected host cells. Such sequences are well known for a
variety of bacteria, yeast, and viruses.
The origin of replication from the plasmid pBR322 is suitable for most Gram-
negative bacteria, the 2~ plasmid
origin is suitable for yeast, and various viral origins (SV40, polyoma,
adenovirus, VSV or BPV) are useful for
cloning vectors in mammalian cells.
Expression and cloning vectors will typically contain a selection gene, also
termed a selectable marker.
Typical selection genes encode proteins that (a) confer resistance to
antibiotics or other toxins, e.g., ampicillin,
neomycin, methotrexate, or tetracycline, (b) complement auxotrophic
deficiencies, or (c) supply critical nutrients
not available from complex media, e.g., the gene encoding D-alanine racemase
for Bacilli.
An example of suitable selectable markers for mammalian cells are those that
enable the identification
of cells competent to take up the PRO-encoding nucleic acid, such as DHFR or
thymidine kinase. An
appropriate host cell when wild-type DHFR is employed is the CHO cell line
deficient in DHFR activity,
prepared and propagated as described by Urlaub et al. , Proc. Natl. Acad. Sci.
USA, 77:4216 ( 1980). A suitable
selection gene for use in yeast is the trill gene present in the yeast plasmid
YRp7 [Stinchcomb et al., Nature,
282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene,
10:157 (1980)]. The trill gene
provides a selection marker for a mutant strain of yeast lacking the ability
to grow in tryptophan, for example,
ATCC No. 44076 or PEP4-1 [Jones, Genetics. 85:12 (1977)].
Expression and cloning vectors usually contain a promoter operably linked to
the PRO-encoding nucleic
acid sequence to direct mRNA synthesis. Promoters recognized by a variety of
potential host cells are well
known. Promoters suitable for use with prokaryotic hosts include the (3-
lactamase and lactose promoter systems
[Chang et aL, Nature, 275:615 (1978); Goeddel et al., Nature, 281:544 (1979)],
alkaline phosphatase, a
tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8:4057 (1980);
EP 36,776], and hybrid
101
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA,
80:21-25 (1983)]. Promoters
for use in bacterial systems also will contain a Shine-Dalgarno (S.D.)
sequence operably linked to the DNA
encoding PRO.
Examples of suitable promoting sequences for use with yeast hosts include the
promoters for 3-
phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255:2073 (1980)] or
other glycolytic enzymes [Hess
et al., J. Adv. Enzyme Reg~ 7:149 (1968); Holland, Biochemistry, 17:4900
(1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-
6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase,
triosephosphateisomerase, phosphoglucose
isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having the additional
advantage of transcription
controlled by growth conditions, are the promoter regions for alcohol
dehydrogenase 2, isocytochrome C, acid
phosphatase, degradative enzymes associated with nitrogen metabolism,
metallothionein, glyceraldehyde-3-
phosphate dehydrogenase, and enzymes responsible for maltose and galactose
utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP 73,657.
PRO transcription from vectors in mammalian host cells is controlled, for
example, by promoters
obtained from the genomes of viruses such as polyorna virus, fowipox virus (UK
2,211,504 published 5 July
1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian
sarcoma virus, cytomegalovirus, a
retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous
mammalian promoters, e.g., the
actin promoter or an immunoglobulin promoter, and from heat-shock promoters,
provided such promoters are
compatible with the host cell systems.
Transcription of a DNA encoding the PRO by higher eukaryotes may be increased
by inserting an
enhancer sequence into the vector. Enhancers are cis-acting elements of DNA,
usually about from 10 to 300
bp, that act on a promoter to increase its transcription. Many enhancer
sequences are now known from
mammalian genes (globin, elastase, albumin, a-fetoprotein, and insulin).
Typically, however, one will use an
enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on
the late side of the replication
origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma
enhancer on the late side of the
replication origin, and adenovirus enhancers. The enhancer may be spliced into
the vector at a position S' or
3' to the PRO coding sequence, but is preferably located at a site 5' from the
promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant,
animal, human, or nucleated
cells from other multicellular organisms) will alsc contain sequences
necessary for the termination of
transcription and for stabilizing the mRNA. Such sequences are commonly
available from the S' and,
occasionally 3' , untranslated regions of eukaryotic or viral DNAs or cDNAs.
These regions contain nucleotide
segments transcribed as polyadenylated fragments in the untranslated portion
of the mRNA encoding PRO.
Still other methods, vectors, and host cells suitable for adaptation to the
synthesis of PRO in
recombinant vertebrate cell culture are described in Gething et al., Nature,
293:620-625 (1981); Mantei et al.,
Nature, 281:40-46 (1979); EP 117,060; and EP 117,058.
102
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
4. Detecting Gene Amplification/Expression
Gene amplification and/or expression may be measured in a sample directly, for
example, by
conventional Southern blotting, Northern blotting to quantitate the
transcription of mRNA [Thomas, Proc. Natl.
Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA analysis), or in situ
hybridization, using an
appropriately labeled probe, based on the sequences provided herein.
Alternatively, antibodies may be employed
that can recognize specific duplexes, including DNA duplexes, RNA duplexes,
and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and the assay
may be carried out where the
duplex is bound to a surface, so that upon the formation of duplex on the
surface, the presence of antibody bound
to the duplex can be detected.
Gene expression, alternatively, may be measured by immunological methods, such
as
immunohistochemical staining of cells or tissue sections and assay of cell
culture or body fluids, to quantitate
directly the expression of gene product. Antibodies useful for
immunohistochemical staining and/or assay of
sample fluids may be either monoclonal or polyclonal, and may be prepared in
any mammal. Conveniently, the
antibodies may be prepared against a native sequence PRO polypeptide or
against a synthetic peptide based on
the DNA sequences provided herein or against exogenous sequence fused to PRO
DNA and encoding a specific
antibody epitope.
5. Purification of Pol3rpeptide
Forms of PRO may be recovered from culture medium or from host cell lysates.
If membrane-bound,
it can be released from the membrane using a suitable detergent solution (e.g.
Triton-X 100) or by enzymatic
cleavage. Cells employed in expression of PRO can be disrupted by various
physical or chemical means, such
as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing
agents.
It may be desired to purify PRO from recombinant cell proteins or
polypeptides. The following
procedures are exemplary of suitable purification procedures: by fractionation
on an ion-exchange column;
ethanol precipitation; reverse phase HPLC; chromatography on silica or on a
cation-exchange resin such as
DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel
filtration using, for example,
Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG;
and metal chelating columns
to bind epitope-tagged forms of the PRO. Various methods of protein
purification may be employed and such
methods are known in the art and described for example in Deutscher, Methods
in Enzvmology_. 182 (1990);
Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New
York (1982). The purification
steps) selected will depend, for example, on the nature of the production
process used and the particular PRO
produced.
E. Uses for PRO
Nucleotide sequences (or their complement) encoding PRO have various
applications in the ait of
molecular biology, including uses as hybridization probes, in chromosome and
gene mapping and in the
generation of anti-sense RNA and DNA. PRO nucleic acid will also be useful for
the preparation of PRO
polypeptides by the recombinant techniques described herein.
103
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
The full-length native sequence PRO gene, or portions thereof, may be used as
hybridization probes
for a cDNA library to isolate the full-length PRO cDNA or to isolate still
other cDNAs (for instance, those
encoding naturally-occurring variants of PRO or PRO from other species) which
have a desired sequence identity
to the native PRO sequence disclosed herein. Optionally, the length of the
probes will be about 20 to about 50
bases. The hybridization probes may be derived from at least partially novel
regions of the full length native
nucleotide sequence wherein those regions may be determined without undue
experimentation or from genomic
sequences including promoters, enhancer elements and introns of native
sequence PRO. By way of example,
a screening method will comprise isolating the coding region of the PRO gene
using the known DNA sequence
to synthesize a selected probe of about 40 bases. Hybridization probes may be
labeled by a variety of labels,
including radionucleotides such as 'ZP or'SS, or enzymatic labels such as
alkaline phosphatase coupled to the
probe via avidin/biotin coupling systems. Labeled probes having a sequence
complementary to that of the PRO
gene of the present invention can be used to screen libraries of human cDNA,
genomic DNA or mRNA to
determine which members of such libraries the probe hybridizes to.
Hybridization techniques are described in
further detail in the Examples below.
Any EST sequences disclosed in the present application may similarly be
employed as probes, using
the methods disclosed herein.
Other useful fragments of the PRO nucleic acids include antisense or sense
oligonucleotides comprising
a singe-stranded nucleic acid sequence (either RNA or DNA) capable of binding
to target PRO mRNA (sense)
or PRO DNA (antisense) sequences. Antisense or sense oligonucleotides,
according to the present invention,
comprise a fragment of the coding region of PRO DNA. Such a fragment generally
comprises at least about 14
nucleotides, preferably from about 14 to 30 nucleotides. The ability to derive
an antisense or a sense
oligonucleotide, based upon a cDNA sequence encoding a given protein is
described in, for example, Stein and
Cohen (Cancer Res. 48:2659, 1988) and van der Krol et al. (BioTechniques
6:958, 1988).
Binding of antisense or sense oligonucleotides to target nucleic acid
sequences results in the formation
of duplexes that block transcription or translation of the target sequence by
one of several means, including
enhanced degradation of the duplexes, premature termination of transcription
or translation, or by other means.
The antisense oligonucleotides thus may be used to block expression of PRO
proteins. Antisense or sense
oligonucleotides further comprise oligonucleotides having modified sugar-
phosphodiester backbones (or other
sugar linkages, such as those described in WO 91/06629) and wherein such sugar
linkages are resistant to
endogenous nucleases. Such oligonucleotides with resistant sugar linkages are
stable in vivo (i.e., capable of
resisting enzymatic degradation) but retain sequence specificity to be able to
bind to target nucleotide sequences.
Other examples of sense or antisense oligonucleotides include those
oligonucleotides which are
covalently linked to organic moieties, such as those described in WO 90/10048,
and other moieties that increases
affinity of the oligonucleotide for a target nucleic acid sequence, such as
poly-(L-lysine). Further still,
intercalating agents, such as ellipticine, and alkylating agents or metal
complexes may be attached to sense or
antisense oligonucleotides to modify binding specificities of the antisense or
sense oligonucleotide for the target
nucleotide sequence.
Antisense or sense oligonucleotides may be introduced into a cell containing
the target nucleic acid
104
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
sequence by any gene transfer method, including, for example, CaPO,-mediated
DNA transfection,
electroporation, or by using gene transfer vectors such as Epstein-Barr virus.
In a preferred procedure, an
antisense or sense oligonucleotide is inserted into a suitable retroviral
vector. A cell containing the target nucleic
acid sequence is contacted with the recombinant retroviral vector, either in
vivo or ex vivo. Suitable retroviral
vectors include, but are not limited to, those derived from the murine
retrovirus M-MuLV, N2 (a retrovirus
derived from M-MuLV), or the double copy vectors designated DCTSA, DCTSB and
DCTSC (see WO
90/13641).
Sense or antisense oligonucleotides also may be introduced into a cell
containing the target nucleotide
sequence by formation of a conjugate with a ligand binding molecule, as
described in WO 91/04753. Suitable
ligand binding molecules include, but are not limited to, cell surface
receptors, growth factors, other cytokines,
IO or other ligands that bind to cell surface receptors. Preferably,
conjugation of the ligand binding molecule does
not substantially interfere with the ability of the ligand binding molecule to
bind to its corresponding molecule
or receptor, or block entry of the sense or antisense oligonucleotide or its
conjugated version into the cell.
Alternatively, a sense or an antisense oligonucleotide may be introduced into
a cell containing the target
nucleic acid sequence by formation of an oligonucleotide-lipid complex, as
described in WO 90/10448. The
sense or antisense oligonucleotide-lipid complex is preferably dissociated
within the cell by an endogenous lipase.
Antisense RNA or DNA molecules are generally at Ieast about 5 bases in length,
about 10 bases in
length, about 15 bases in length, about 20 bases in length, about 25 bases in
length, about 30 bases in length,
about 35 bases in length, about 40 bases in length, about 45 bases in length,
about 50 bases in length, about 55
bases in length, about 60 bases in length, about 65 bases in length, about 70
bases in length, about 75 bases in
length, about 80 bases in length, about 85 bases in length, about 90 bases in
length, about 95 bases in length,
about 100 bases in length, or more.
The probes may also be employed in PCR techniques to generate a pool of
sequences for identification
of closely related PRO coding sequences.
Nucleotide sequences encoding a PRO can also be used to construct
hybridization probes for mapping
the gene which encodes that PRO and for the genetic analysis of individuals
with genetic disorders. The
nucleotide sequences provided herein may be mapped to a chromosome and
specific regions of a chromosome
using known techniques, such as in situ hybridization, linkage analysis
against known chromosomal markers,
and hybridization screening with libraries.
When the coding sequences for PRO encode a protein which binds to another
protein (example, where
the PRO is a receptor), the PRO can be used in assays to identify the other
proteins or molecules involved in the
binding interaction. By such methods, inhibitors of the receptor/ligand
binding interaction can be identified.
Proteins involved in such binding interactions can also be used to screen for
peptide or small molecule inhibitors
or agonists of the binding interaction. Also, the receptor PRO can be used to
isolate correlative ligand(s).
Screening assays can be designed to find lead compounds that mimic the
biological activity of a native PRO or
a receptor for PRO. Such screening assays will include assays amenable to high-
throughput screening of
chemical libraries, making them particularly suitable for identifying small
molecule drug candidates. Small
molecules contemplated include synthetic organic or inorganic compounds. The
assays can be performed in a
105
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
variety of formats, including protein-protein binding assays, biochemical
screening assays, immunoassays and
cell based assays, which are well characterized in the art.
Nucleic acids which encode PRO or its modified forms can also be used to
generate either transgenic
animals or "knock out" animals which, in turn, are useful in the development
and screening of therapeutically
useful reagents. A transgenic animal (e.g., a mouse or rat) is an animal
having cells that contain a transgene,
which transgene was introduced into the animal or an ancestor of the animal at
a prenatal, e.g., an embryonic
stage. A transgene is a DNA which is integrated into the genome of a cell from
which a transgenic animal
develops. In one embodiment, cDNA encoding PRO can be used to clone genomic
DNA encoding PRO in
accordance with established techniques and the genomic sequences used to
generate transgenic animals that
contain cells which express DNA encoding PRO. Methods for generating
transgenic animals, particularly
animals such as mice or rats, have become conventional in the art and are
described, for example, in U.S. Patent
Nos. 4,736,866 and 4,870,009. Typically, particular cells would be targeted
for PRO transgene incorporation
with tissue-specific enhancers. Transgenic animals that include a copy of a
transgene encoding PRO introduced
into the germ line of the animal at an embryonic stage can be used to examine
the effect of increased expression
of DNA encoding PRO. Such animals can be used as tester animals for reagents
thought to confer protection
from, for example, pathological conditions associated with its overexpression.
In accordance with this facet of
the invention, an animal is treated with the reagent and a reduced incidence
of the pathological condition,
compared to untreated animals bearing the transgene, would indicate a
potential therapeutic intervention for the
pathological condition.
Alternatively, non-human homologues of PRO can be used to construct a PRO
"knock out" animal
which has a defective or altered gene encoding PRO as a result of homologous
recombination between the
endogenous gene encoding PRO and altered genomic DNA encoding PRO introduced
into an embryonic stem
cell of the animal. For example, cDNA encoding PRO can be used to clone
genomic DNA encoding PRO in
accordance with established techniques. A portion of the genomic DNA encoding
PRO can be deleted or
replaced with another gene, such as a gene encoding a selectable marker which
can be used to monitor
integration. Typically, several kilobases of unaltered flanking DNA (both at
the 5' and 3' ends) are included
in the vector (see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for a
description of homologous
recombination vectors]. The vector is introduced into an embryonic stem cell
line (e.g., by electroporation) and
cells in which the introduced DNA has homologously recombined with the
endogenous DNA are selected [see
e.g., Li et al., Cell, 69:915 (1992)]. The selected cells are then injected
into a blastocyst of an animal (e.g.,
a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in
TeratocarcinomaS and Embryonic Stem
Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-
152]. A chimeric embryo can
then be implanted into a suitable pseudopregnant female foster animal and the
embryo brought to term to create
a "knock out" animal. Progeny harboring the homologously recombined DNA in
their germ cells can be
identif ed by standard techniques and used to breed animals in which all cells
of the animal contain the
homologously recombined DNA. Knockout animals can be characterized for
instance, for their ability to defend
against certain pathological conditions and for their development of
pathological conditions due to absence of
the PRO polypeptide.
106
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Nucleic acid encoding the PRO polypeptides may also be used in gene therapy.
In gene therapy
applications, genes are introduced into cells in order to achieve in vivo
synthesis of a therapeutically effective
genetic product, for example for replacement of a defective gene. "Gene
therapy" includes both conventional
gene therapy where a lasting effect is achieved by a single treatment, and the
administration of gene therapeutic
agents, which involves the one time or repeated administration of a
therapeutically effective DNA or mRNA.
Antisense RNAs and DNAs can be used as therapeutic agents for blocking the
expression of certain genes in
vivo. It has already been shown that short antisense oligonucleotides can be
imported into cells where they act
as inhibitors, despite their low intracellular concentrations caused by their
restricted uptake by the cell
membrane. (Zamecnik et al., Proc. Natl. Acad. Sci. USA 83:4143-4146 [1986]).
The oligonucleotides can be
modified to enhance their uptake, e.g. by substituting their negatively
charged phosphodiester groups by
uncharged groups.
There are a variety of techniques available for introducing nucleic acids into
viable cells. The
techniques vary depending upon whether the nucleic acid is transferred into
cultured cells in vitro, or in vivo in
the cells of the intended host. Techniques suitable for the transfer of
nucleic acid into mammalian cells in vitro
include the use of liposomes, electroporation, microinjection, cell fusion,
DEAE-dextran, the calcium phosphate
IS precipitation method, etc. The currently preferred in vivo gene transfer
techniques include transfection with viral
(typically retroviral) vectors and viral coat protein-liposome mediated
transfection (Dzau et al., Trends in
BiotechnoloQV 11, 205-210 [1993]). In some situations it is desirable to
provide the nucleic acid source with
an agent that targets the target cells, such as an antibody specific for a
cell surface membrane protein or the
target cell, a ligand for a receptor on the target cell, etc. Where liposomes
are employed, proteins which bind
to a cell surface membrane protein associated with endocytosis may be used for
targeting and/or to facilitate
uptake, e.g. capsid proteins or fragments thereof tropic for a particular cell
type, antibodies for proteins which
undergo internalization in cycling, proteins that target
intracellularlocalization and enhance intracellular half life.
The technique of receptor-mediated endocytosis is described, for example, by
Wu et al., J. Biol. Chem. 262,
4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414
(1990). For review of gene
marking and gene therapy protocols see Anderson et al., Science 256, 808-813
(1992).
The PRO polypeptides described herein may also be employed as molecular weight
markers for protein
electrophoresis purposes and the isolated nucleic acid sequences may be used
for recombinantly expressing those
markers.
The nucleic acid molecules encoding the PRO polypeptides or fragments thereof
described herein are
useful for chromosome identification. In this regard, there exists an ongoing
need to identify new chromosome
markers, since relatively few chromosome marking reagents, based upon actual
sequence data are presently
available. Each PRO nucleic acid molecule of the present invention can be used
as a chromosome marker.
The PRO polypeptides and nucleic acid molecules of the present invention may
also be used for tissue
typing, wherein the PRO polypeptides of the present invention may be
differentially expressed in one tissue as
compared to another. PRO nucleic acid molecules will fmd use for generating
probes for PCR, Northern
analysis, Southern analysis and Western analysis.
107
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
The PRO polypeptides described herein may also be employed as therapeutic
agents. The PRO
polypeptides of the present invention can be formulated according to known
methods to prepare pharmaceutically
useful compositions, whereby the PRO product hereof is combined in admixture
with a pharmaceutically
acceptable carrier vehicle. Therapeutic formulations are prepared for storage
by mixing the active ingredient
having the desired degree of purity with optional physiologically acceptable
carriers, excipients or stabilizers
(Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in
the form of lyophilized
formulations or aqueous solutions. Acceptable carriers, excipients or
stabilizers are nontoxic to recipients at the
dosages and concentrations employed, and include buffers such as phosphate,
citrate and other organic acids;
antioxidants including ascorbic acid; low molecular weight (less than about 10
residues) polypeptides; proteins,
such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such
as polyvinylpyrrolidone, amino
acids such as glycine, glutamine, asparagine, arginine or lysine;
monosaccharides, disaccharides and other
carbohydrates including glucose, mannose, or dextrins; chelating agents such
as EDTA; sugar alcohols such as
mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as TWEENT"',
PLURONICSTM or PEG.
The formulations to be used for in vivo administration must be sterile. This
is readily accomplished by
filtration through sterile filtration membranes, prior to or following
lyophilization and reconstitution.
Therapeutic compositions herein generally are placed into a container having a
sterile access port, for
example, an intravenous solution bag or vial having a stopper pierceable by a
hypodermic injection needle.
The route of administration is in accord with known methods, e.g. injection or
infusion by intravenous,
intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or
intralesional routes, topical
administration, or by sustained release systems.
Dosages and desired drug concentrations of pharmaceutical compositions of the
present invention may
vary depending on the particular use envisioned. The determination of the
appropriate dosage or route of
administration is well within the skill of an ordinary physician. Animal
experiments provide reliable guidance
for the determination of effective doses for human therapy. Interspecies
scaling of effective doses can be
performed following the principles laid down by Mordenti, J. and Chappell, W.
"The use of interspecies scaling
in toxicokinetics" In Toxicokinetics and New Drug Development, Yacobi et al.,
Eds., Pergamon Press, New
York 1989, pp. 42-96.
When in vivo administration of a PRO polypeptide or agonist or antagonist
thereof is employed, normal
dosage amounts may vary from about 10 ng/kg to up to 100 mg/kg of mammal body
weight or more per day,
preferably about 1 ~.g/kg/day to 10 mg/kg/day, depending upon the route of
administration. Guidance as to
particular dosages and methods of delivery is provided in the literature; see,
for example, U.S. Pat. Nos.
4,657,760; 5,206,344; or 5,225,212. It is anticipated that different
formulations will be effective for different
treatment compounds and different disorders, that administration targeting one
organ or tissue, for example, may
necessitate delivery in a manner different from that to another organ or
tissue.
Where sustained-release administration of a PRO polypegtide is desired in a
formulation with release
characteristics suitable for the treatment of any disease or disorder
requiring administration of the PRO
polypeptide, microencapsulation of the PRO polypeptide is contemplated.
Microencapsulation of recombinant
I08
CA 02343577 2001-03-16
WO 00/15796 PCTlUS99/21090
proteins for sustained release has been successfully performed with human
growth hormone (rhGH), interferon-
(rhlFN- ), interleukin-2, and MN rgp120. Johnson et al., Nat. Med., 2:795-799
(1996); Yasuda, Biomed.
Ther., 27:1221-1223 (1993); Hora et al., Bio/Technoloey. 8:755-758 (1990);
Cleland, "Design and Production
of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere
Systems," in Vaccine Design-
The Subunit and Adjuvant Approach. Powell and Newman, eds, (Plenum Press: New
York, 1995), pp. 439-462;
WO 97/03692, WO 96/40072, WO 96/07399; and U.S. Pat. No. 5,654,010.
The sustained-release formulations of these proteins were developed using poly-
lactic-coglycolic acid
(PLGA) polymer due to its biocompatibiliry and wide range of biodegradable
properties. The degradation
products of PLGA, lactic and glycolic acids, can be cleared quickly within the
human body. Moreover, the
degradability of this polymer can be adjusted from months to years depending
on its molecular weight and
composition. Lewis, "Controlled release of bioacfive agents from
lactide/glycolide polymer, " in: M. Chasin and
R. Langer (Eds.), Biodegradable Polymers as Drug Deliver~Svstems (Marcel
Dekker: New York, 1990), pp.
1-41.
This invention encompasses methods of screening compounds to identify those
that mimic the PRO
polypeptide (agonists) or prevent the effect of the PRO polypeptide
(antagonists). Screening assays for
antagonist drug candidates are designed to identify compounds that bind or
complex with the PRO polypeptides
encoded by the genes identified herein, or otherwise interfere with the
interaction of the encoded polypeptides
with other cellular proteins. Such screening assays will include assays
amenable to high-throughput screening
of chemical libraries, making them particularly suitable for identifying small
molecule drug candidates.
The assays can be performed in a variety of formats, including protein-protein
binding assays,
biochemical screening assays, immunoassays, and cell-based assays, which are
well characterized in the art.
All assays for antagonists are common in that they call for contacting the
drug candidate with a PRO
polypeptide encoded by a nucleic acid identified herein under conditions and
for a time sufficient to allow these
two components to interact.
In binding assays, the interaction is binding and the complex formed can be
isolated or detected in the
reaction mixture. In a particular embodiment, the PRO polypeptide encoded by
the gene identified herein or the
drug candidate is immobilized on a solid phase, e.g., on a microtiter plate,
by covalent or non-covalent
attachments. Non-covalent attachment generally is accomplished by coating the
solid surface with a solution of
the PRO polypeptide and drying. Alternatively, an immobilized antibody, e.g.,
a monoclonal antibody, specific
for the PRO polypeptide to be immobilized can be used to anchor it to a solid
surface. The assay is performed
by adding the non-immobilized component, which may be labeled by a detectable
label, to the immobilized
component, e.g., the coated surface containing the anchored component. When
the reaction is complete, the
non-reacted components are removed, e.g., by washing, and complexes anchored
on the solid surface are
detected. When the originally non-immobilized component carries a detectable
label, the detection of label
immobilized on the surface indicates that complexing occurred. Where the
originally non-immobilized
component does not carry a label, complexing can be detected, for example, by
using a labeled antibody
specifically binding the immobilized complex.
109
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
If the candidate compound interacts with but does not bind to a particular PRO
polypeptide encoded by
a gene identified herein, its interaction with that polypeptide can be assayed
by methods well known for detecting
protein-protein interactions. Such assays include traditional approaches, such
as, e.g., cross-linking, co-
immunoprecipitation, and co-purification through gradients or chromatographic
columns. In addition, protein-
protein interactions can be monitored by using a yeast-based genetic system
described by Fields and co-workers
(Fields and Song, Nature (London). 340:245-246 (1989); Chien et al., Proc.
Natl. Acad. Sci. USA, 88:9578-
9582 (1991)) as disclosed by Chevray and Nathans, Proc. Natl. Acad. Sci. USA,
89: 5789-5793 (1991). Many
transcriptional activators, such as yeast GALA, consist of two physically
discrete modular domains, one acting
as the DNA-binding domain, the other one functioning as the transcription-
activation domain. The yeast
expression system described in the foregoing publications (generally referred
to as the "two-hybrid system")
takes advantage of this property, and employs two hybrid proteins, one in
which the target protein is fused to
the DNA-binding domain of GALA, and another, in which candidate activating
proteins are fused to the
activation domain. The expression of a GALL-lacZ reporter gene under control
of a GALA-activated promoter
depends on reconstitution of GALA activity via protein-protein interaction.
Colonies containing interacting
polypeptides are detected with a chromogenic substrate for p-galactosidase. A
complete kit
(MATCHMAKERT"') for identifying protein-protein interactions between two
specific proteins using the two-
hybrid technique is commercially available from Clontech. This system can also
be extended to map protein
domains involved in specific protein interactions as well as to pinpoint amino
acid residues that are crucial for
these interactions.
Compounds that interfere with the interaction of a gene encoding a PRO
polypeptide identified herein
and other intra- or extracellular components can be tested as follows: usually
a reaction mixture is prepared
containing the product of the gene and the infra- or extracellular component
under conditions and for a time
allowing for the interaction and binding of the two products. To test the
ability of a candidate compound to
inhibit binding, the reaction is run in the absence and in the presence of the
test compound. In addition, a
placebo may be added to a third reaction mixture, to serve as positive
control. The binding (complex formation)
between the test compound and the infra- or extracellular component present in
the mixture is monitored as
described hereinabove. The formation of a complex in the control reactions)
but not in the reaction mixture
containing the test compound indicates that the test compound interferes with
the interaction of the test compound
and its reaction partner.
To assay for antagonists, the PRO polypeptide may be added to a cell along
with the compound to be
screened for a particular activity and the ability of the compound to inhibit
the activity of interest in the presence
of the PRO polypeptide indicates that the compound is an antagonist to the PRO
polypeptide. Alternatively,
antagonists may be detected by combining the PRO polypeptide and a potential
antagonist with membrane-bound
PRO polypeptide receptors or recombinant receptors under appropriate
conditions for a competitive inhibition
assay. The PRO polypeptide can be labeled, such as by radioactivity, such that
the number of PRO polypeptide
molecules bound to the receptor can be used to determine the effectiveness of
the potential antagonist. The gene
encoding the receptor can be identified by numerous methods known to those of
skill in the art, for example,
ligand panning and FACS sorting. Coligan et al., Current Protocols in Immun.
1(2): Chapter S (1991).
110
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Preferably, expression cloning is employed wherein polyadenylated RNA is
prepared from a cell responsive to
the PRO polypeptide and a cDNA library created from this RNA is divided into
pools and used to transfect COS
cells or other cells that are not responsive to the PRO polypeptide.
Transfected cells that are grown on glass
slides are exposed to labeled PRO poIypeptide. The PRO polypeptide can be
labeled by a variety of means
including iodination or inclusion of a recognition site for a site-specific
protein kinase. Following fixation and
incubation, the slides are subjected to autoradiographic analysis. Positive
pools are identified and sub-pools are
prepared and re-transfected using an interactive sub-pooling and re-screening
process, eventually yielding a
single clone that encodes the putative receptor.
As an alternative approach for receptor identification, labeled PRO
polypeptide can be photoaffinity
linked with cell membrane or extract preparations that express the receptor
molecule. Cross-linked material is
resolved by PAGE and exposed to X-ray film. The labeled complex containing the
receptor can be excised,
resolved into peptide fragments, and subjected to protein micro-sequencing.
The amino acid sequence obtained
from micro- sequencing would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA
library to identify the gene encoding the putative receptor.
In another assay for antagonists, mammalian cells or a membrane preparation
expressing the receptor
would be incubated with labeled PRO polypeptide in the presence of the
candidate compound. The ability of
the compound to enhance or block this interaction could then be measured.
More specific examples of potential antagonists include an oligonucleotide
that binds to the fusions of
immunoglobulin with PRO polypeptide, and, in particular, antibodies including,
without limitation, poly- and
monoclonal antibodies and antibody fragments, single-chain antibodies, anti-
idiotypic antibodies, and chimeric
or humanized versions of such antibodies or fragments, as well as human
antibodies and antibody fragments.
Alternatively, a potential antagonist may be a closely related protein, for
example, a mutated form of the PRO
polypeptide that recognizes the receptor but imparts no effect, thereby
competitively inhibiting the action of the
PRO polypeptide.
Another potential PRO polypeptide antagonist is an antisense RNA or DNA
construct prepared using
antisense technology, where, e.g., an antisense RNA or DNA molecule acts to
block directly the translation of
mRNA by hybridizing to targeted mRNA and preventing protein translation.
Antisense technology can be used
to control gene expression through triple-helix formation or antisense DNA or
RNA, both of which methods are
based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding
portion of the polynucleotide
sequence, which encodes the mature PRO polypeptides herein, is used to design
an antisense RNA
oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is designed to be
complementary to a region of the gene involved in transcription (triple helix -
see Lee et al., Nucl: Acids Res.
6:3073 (1979); Cooney et al., Science, 241: 456 (1988); Dervan et al.,
Science, 251:1360 (1991)), thereby
preventing transcription and the production of the PRO polypeptide. The
antisense RNA oligonucleotide
hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule
into the PRO polypeptide
(antisense - Okano, Neurochem., 56:560 (1991); OliQOdeoxvnucteotides as
Antisense Inhibitors of Gene
E~ression (CRC Press: Boca Raton, FL, 1988). The oligonucleotides described
above can also be delivered
to cells such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of the PRO
111
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
polypeptide. When antisense DNA is used, oligodeoxyribonucleotidesderived from
the translation-initiation site,
e.g., between about -10 and +10 positions of the target gene nucleotide
sequence, are preferred.
Potential antagonists include small molecules that bind to the active site,
the receptor binding site, or
growth factor or other relevant binding site of the PRO polypeptide, thereby
blocking the normal biological
activity of the PRO polypeptide. Examples of small molecules include, but are
not limited to, small peptides
or peptide-like molecules, preferably soluble peptides, and synthetic non-
peptidyl organic or inorganic
compounds.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage of RNA.
Ribozymes act by sequence-specific hybridization to the complementary target
RNA, followed by endonucleolytic
cleavage. Specific ribozyme cleavage sites within a potential RNA target can
be identified by known techniques.
For further details see, e.g., Rossi, Current Bioloev. 4:469-471 (1994), and
PCT publication No. WO 97/33551
(published September 18, 1997).
Nucleic acid molecules in triple-helix formation used to inhibit transcription
should be single-stranded
and composed of deoxynucleotides. The base composition of these
oligonucleotides is designed such that it
promotes triple-helix formation via Hoogsteen base-pairing rules, which
generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further details see,
e.g., PCT publication No. WO
97/33551, supra.
These small molecules can be identified by any one or more of the screening
assays discussed
hereinabove and/or by any other screening techniques well known for those
skilled in the art.
With regard to the PR0211 and PR0217 polypeptide, therapeutic indications
include disorders
associated with the preservation and maintenance of gastrointestinal mucosa
and the repair of acute and chronic
mucosal lesions (e.g., enterocolitis, Zollinger-Ellison syndrome,
gastrointestinal ulceration and congenital
microvillus atrophy), skin diseases associated with abnormal. keratinocyte
differentiation (e.g., psoriasis,
epithelial cancers such as lung squamous cell carcinoma, epidermoid carcinoma
of the vulva and gliomas.
Since the PR0232 polypeptide and nucleic acid encoding it possess sequence
homology to a cell surface
stem cell antigen and its encoding nucleic acid, probes based upon the PR0232
nucleotide sequence may be
employed to identify other novel stem cell surface antigen proteins. Soluble
forms of the PR0232 polypeptide
may be employed as antagonists of membrane bound PR0232 activity both in vitro
and in vivo. PR0232
polypeptides may be employed in screening assays designed to identify agonists
or antagonists of the native
PR0232 polypeptide, wherein such assays may take the form of any conventional
cell-type or biochemical
binding assay. Moreover, the PR0232 polypeptide may serve as a molecular
marker for the tissues in which
the polypeptide is specifically expressed.
With regard to the PR0187 polypeptides disclosed herein, FGF-8 has been
implicated in cellular
differentiation and embryogenesis, including the patterning which appears
during limb formation. FGF-8 and
the PR0187 molecules of the invention therefore are likely to have potent
effects on cell growth and
development. Diseases which relate to cellular growth and differentiation are
therefore suitable targets for
therapeutics based on functionality similar to FGF-8. For example, diseases
related to growth or survival of
nerve cells including Parkinson's disease, Alzheimer's disease, ALS,
neuropathies. Additionally, disease related
112
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
to uncontrolled cell growth, e.g., cancer, would also be expected therapeutic
targets.
With regard to the PR0265 polypeptides disclosed herein, other methods for use
with PR0265 are
described in U.S. Patent 5,654,270 to Ruoslahti et al. In particular, PR0265
can be used in comparison with
the fibromodulin disclosed therein to compare its effects on reducing dermal
scarring and other properties of the
fibromodulin described therein including where it is located and with what it
binds and does not.
The PR0219 polypeptides of the present invention which play a regulatory role
in the blood coagulation
cascade may be employed in vivo for therapeutic purposes as well as for in
vitro purposes. Those of ordinary
skill in the art will well know how to employ PR0219 polypeptides for such
uses.
The PR0246 polypeptides of the present invention which serve as cell surface
receptors for one or more
viruses will find other uses. For example, extracellular domains derived from
these PR0246 polypeptides may
be employed therapeutically in vivo for lessening the effects of viral
infection. Those PR0246 polypeptides
which serves as tumor specific antigens may be exploited as therapeutic
targets for anti-tumor drugs, and the
like. Those of ordinary skill in the art will well know how to employ PR0246
polypeptides for such uses.
Assays in which connective growth factor and other growth factors are usually
used should be
performed with PR0261. An assay to determine whether TGF beta induces PR0261,
indicating a role in cancer
is performed as known in the art. Wound repair and tissue growth assays are
also performed with PR0261.
The results are applied accordingly.
PR0228 polypeptides should be used in assays in which EMR1, CD97 and
latrophilin would be used
in to determine their relative activities. The results can be applied
accordingly. For example, a competitive
binding assay with PR0228 and CD97 can be performed with the ligand for CD97,
CD55.
Native PR0533 is a 216 amino acid polypeptide of which residues 1-22 are the
signal sequence.
Residues 3 to 216 have a Blast score of 509, corresponding to 53 % homology to
fibroblast growth factor. At
the nucleotide level, DNA47412, the EST from which PCR oligos were generated
to isolate the full length
DNA49435-I219, has been observed to map to 11p15. Sequence homology to the
11p15 locus would indicate
that PR0533 may have utility in the treatment of Usher Syndrome or Atrophic
areata.
As mentioned previously, fibroblast growth factors can act upon cells in both
a mitogenic and non-
mitogenic manner. These factors are mitogenic for a wide variety of normal
diploid mesoderm-derived and
neural crest-derived cells, inducing granulosa cells, adrenal cortical cells,
chrondrocytes, myoblasts, corneal and
vascular endothelial cells (bovine or human), vascular smooth muscle cells,
lens, retina and prostatic epithelial
cells, oligodendrocytes, astrocytes, chrondocytes, myoblasts and osteoblasts.
Non-mitogenic actions of fibroblast growth factors include promotion of cell
migration into a wound
area (chemotaxis}, initiation of new blood vessel formulation (angiogenesis),
modulation of nerve regeneration
and survival (neurotrophism), modulation of endocrine functions, and
stimulation or suppression of specific
cellular protein expression, extracellular matrix production and cell
survival. Baird, A. & Bohlen, P., Handbook
ofExp. Phrmacol. 95(1): 369-418 (1990). These properties provide a basis for
using fibroblast growth factors
in therapeutic approaches to accelerate wound healing, nerve repair,
collateral blood vessel formation, and the
like. For example, ftbroblast growth factors, have been suggested to minimize
myocardium damage in heart
disease and surgery (U.S.P. 4,378,437).
113
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Since the PR0245 polypeptide and nucleic acid encoding it possess sequence
homology to a
transmembrane protein tyrosine kinase protein and its encoding nucleic acid,
probes based upon the PR0245
nucleotide sequence may be employed to identify other novel transmembrane
tyrosine kinase proteins. Soluble
forms of the PR0245 polypeptide may be employed as antagonists of membrane
bound PR0245 activity both
in vitro and in vivo. PR0245 polypeptides may be employed in screening assays
designed to identify agonists
or antagonists of the native PR0245 polypeptide, wherein such assays may take
the form of any conventional
cell-type or biochemical binding assay. Moreover, the PR0245 polypeptide may
serve as a molecular marker
for the tissues in which the polypeptide is specifically expressed.
PR0220, PR0221 and PR0227 all have leucine rich repeats. Additionally, PR0220
and PR0221 have
homology to SLIT and leucine rich repeat protein. Therefore, these proteins
are useful in assays described in
the literature, supra, wherein the SLIT and leucine rich repeat protein are
used. Regarding the SLIT protein,
PR0227 can be used in an assay to determine the affect of PR0227 on
neurodegenerative disease. Additionally,
PR0227 has homology to human glycoprotein V. In the case of PR0227, this
polypeptide is used in an assay
to determine its affect on bleeding, clotting, tissue repair and scarring.
The PR0266 polypeptide can be used in assays to determine if it has a role in
neurodegenerative
diseases or their reversal.
PR0269 polypeptides and portions thereof which effect the activity of thrombin
may also be useful for
in vivo therapeutic purposes, as well as for various in vitro applications. In
addition, PR0269 polypeptides and
portions thereof may have therapeutic use as an antithrombotic agent with
reduced risk for hemorrhage as
compared with heparin. Peptides having homology to thrombomodulin are
particularly desirable.
PR0287 polypeptides and portions thereof which effect the activity of bone
morphogenic protein
"BMP1"/procollagen C-proteinase (PCP) may also be useful for in vivo
therapeutic purposes, as well as for
various in vitro applications. In addition, PR0287 polypeptides and portions
thereof may have therapeutic
applications in wound healing and tissue repair. Peptides having homology to
procollagen C-proteinase enhancer
protein and its precursor may also be used to induce bone and/or cartilage
formation and are therefore of
particular interest to the scientific and medical communities.
Therapeutic indications for PR0214 polypeptides include disorders associated
with the preservation and
maintenance of gastrointestinal mucosa and the repair of acute and chronic
mucosal lesions (e.g., enterocolitis,
Zollinger-Ellison syndrome, gastrointestinal ulceration and congenital
microvillus atrophy), skin diseases
associated with abnormal keratinocyte differentiation (e.g., psoriasis,
epithelial cancers such as lung squamous
cell carcinoma, epidermoid carcinoma of the vulva and gliomas.
Studies on the generation and analysis of mice deficient in members of the TGF-
superfamily are
reported in Matzuk, Trends in Endocrinol. and Metabol., 6: 120-127 (1995).
The PR0317 polypeptide, as well as PR0317-specificantibodies, inhibitors,
agonists, receptors, or their
analogs, herein are useful in treating PR0317-associated disorders. Hence, for
example, they may be employed
in modulating endometrial bleeding angiogenesis, and may also have an effect
on kidney tissue. Endometrial
bleeding can occur in gynecological diseases such as endometrial cancer as
abnormal bleeding. Thus, the
compositions herein may fmd use in diagnosing and treating abnormal bleeding
conditions in the endometrium,
114
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
as by reducing or eliminating the need for a hysterectomy. The molecules
herein may also find use in
angiogenesis applications such as anti-tumor indications for which the
antibody against vascular endothelial
growth factor is used, or, conversely, ischemic indications for which vascular
endothelial growth factor is
employed.
Bioactive compositions comprising PR0317 or agonists or antagonists thereof
may be administered in
S a suitable therapeutic dose determined by any of several methodologies
including clinical studies on mammalian
species to determine maximal tolerable dose and on normal human subjects to
determine safe dose. Additionally,
the bioactive agent may be complexed with a variety of well established
compounds or compositions which
enhance stability or pharmacological properties such as half-life. It is
contemplated that the therapeutic, bioactive
composition may be delivered by intravenous infusion into the bloodstream or
any other effective means which
could be used for treating problems of the kidney, uterus, endometrium, blood
vessels, or related tissue, e.g.,
in the heart or genital tract.
Dosages and administration of PR0317, PR0317 agonist, or PR0317 antagonist in
a pharmaceutical
composition may be determined by one of ordinary skill in the art of clinical
pharmacology or pharmacokinetics.
See, for example, Mordenti and Rescigno, Pharmaceutical Research. 9:17-25
(1992); Morenti et al.,
Pharmaceutical Research. 8:1351-1359 (1991); and Mordenti and Chappell, "The
use of interspecies scaling in
toxicokinetics" in Toxicokinetics and New Drug Development Yacobi et al. (eds)
(Pergamon Press: NY, 1989),
pp. 42-96. An effective amount of PR0317, PR0317 agonist, or PR03I7 antagonist
to be employed
therapeutically will depend, for example, upon the therapeutic objectives, the
route of administration, and the
condition of the mammal. Accordingly, it will be necessary for the therapist
to titer the dosage and modify the
route of administration as required to obtain the optimal therapeutic effect.
A typical daily dosage might range
from about 10 nglkg to up to 100 mg/kg of the mammal's body weight or more per
day, preferably about 1
ug/kg/day to 10 mg/kg/day. Typically, the clinician will administer PR0317,
PR0317 agonist, or PR0317
antagonist, until a dosage is reached that achieves the desired effect for
treatment of the above mentioned
disorders.
2S PR0317 or an PR0317 agonist or PR0317 antagonist may be administered alone
or in combination with
another to achieve the desired pharmacological effect. PR0317 itself, or
agonists or antagonists of PR0317 can
provide different effects when administered therapeutically. Such compounds
for treatment will be formulated
in a nontoxic, inert, pharmaceutically acceptable aqueous carrier medium
preferably at a pH of about 5 to 8,
more preferably 6 to 8, although the pH may vary according to the
characteristics of the PR0317, agonist, or
antagonist being formulated and the condition to be treated. Characteristics
of the treatment compounds include
solubility of the molecule, half life, and antigenicity/immunogenicity; these
and other characteristics may aid
in defining an effective carrier.
PR0317 or PR0317 agonists or PR0317 antagonists may be delivered by known
routes of
administration including but not limited to topical creams and gels;
transmucosal spray and aerosol, transdermal
3S patch and bandage; injectable, intravenous, and lavage formulations; and
orally administered liquids and pills,
particularly fot~ttulated to resist stomach acid and enzymes. The particular
formulation, exact dosage, and route
of administration will be determined by the attending physician and will vary
according to each specific situation.
115
CA 02343577 2001-03-16
WO 00115796 PCT/US99/21090
Such determinations of administration are made by considering multiple
variables such as the condition
to be treated, the type of mammal to be treated, the compound to be
administered, and the pharmacokinetic
profile of the particular treatment compound. Additional factors which may be
taken into account include disease
state (e.g. severity) of the patient, age, weight, gender, diet, time of
administration, drug combination, reaction
sensitivities, and tolerance/response to therapy. Long-acting treatment
compound formulations (such as
S liposomally encapsulated PR0317 or PEGylated PR0317 or PR0317 polymeric
microspheres, such as polylactic
acid-based microspheres) might be administered every 3 to 4 days, every week,
or once every two weeks
depending on half-life and clearance rate of the particular treatment
compound.
Normal dosage amounts may vary from about 10 ng/kg to up to 100 mg/kg of
mammal body weight
or more per day, preferably about 1 ~,g/kg/day to 10 mg/kg/day, depending upon
the route of administration.
Guidance as to particular dosages and methods of delivery is provided in the
literature; see, for example, U.S.
Pat. Nos. 4,657,760; 5,206,344; or S,22S,212. It is anticipated that different
formulations will be effective for
different treatment compounds and different disorders, that administration
targeting the uterus, for example, may
necessitate delivery in a manner different from that to another organ or
tissue, such as cardiac tissue.
Where sustained-release administration of PR0317 is desired in a formulation
with release
characteristics suitable for the treatment of any disease or disorder
requiring administration of PR0317,
microencapsulation of PR0317 is contemplated. Microencapsulation of
recombinant proteins for sustained
release has been successfully performed with human growth hormone (rhGH),
interferon- (rhIFN- ),
interleukin-2, and MN rgp120. Johnson et al., Nat. Med., 2: 79S-799 (1996);
Yasuda. Biomed. Ther., 27:
1221-1223 (1993); Hora etal., Bio/Technolo~v, 8: 7SS-758 (1990); Cleland,
"Design and Production of Single
Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems," in
Vaccine Desi;en: The Subunit
and Adiuvant Approach , Powell and Newman, eds, (Plenum Press: New York,
1995), pp. 439-462; WO
97/03692, WO 96/40072, WO 96/07399; and U.S Pat. No. 5,654,010.
It is contemplated that conditions or diseases of the uterus, endometrial
tissue, or other genital tissues
or cardiac tissues may precipitate damage that is treatable with PR0317 or
PR0317 agonist where PR0317
expression is reduced in the diseased state; or with antibodies to PR0317 or
other PR0317 antagonists where
the expression of PR0317 is increased in the diseased state. These conditions
or diseases may be specifically
diagnosed by the probing tests discussed above for physiologic and pathologic
problems which affect the function
of the organ.
The PR0317, PR0317 agonist, or PR0317 antagonist may be administered to a
mammal with another
biologically active agent, either separately or in the same formulation to
treat a common indication for which
they are appropriate. For example, it is contemplated that PR0317 can be
administered together with EBAF-1
for those indications on which they demonstrate the same qualitative
biological effects. Alternatively, where they
have opposite effects, EBAF-1 may be administered together with an antagonist
to PR0317, such as an anti-
PR0317 antibody. Further, PR0317 may be administered together with VEGF for
coronary ischemia where
such indication is warranted, or with an anti-VEGF for cancer as warranted,
or, conversely, an antagonist to
PR0317 may be administered with VEGF for coronary ischemia or with anti-VEGF
to treat cancer as warranted.
These administrations would be in effective amounts for treating such
disorders.
116
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Native PR0301 (SEQ ID N0:119) has a Blast score of 246 and 30% homology at
residues 24 to 282
of Figure 44 with A33 HUMAN, an A33 antigen precursor. A33 antigen precursor,
as explained in the
Background is a tumor-specific antigen, and as such, is a recognized marker
and therapeutic target for the
diagnosis and treatment of colon cancer. The expression of tumor-specific
antigens is often associated with the
progression of neoplastic tissue disorders. Native PR0301 (SEQ ID N0:119) and
A33 HUMAN also show a
Blast score of 245 and 30% homology at residues 21 to 282 of Fig. 44 with A33
HUMAN, the variation
dependent upon how spaces are inserted into the compared sequences. Native
PR0301 (SEQ ID N0:119) also
has a Blast score of 165 and 29% homology at residues 60 to 255 of Fig. 44
with HS46KDA 1, a human
coxsackie and adenovirus receptor protein, also known as cell surface protein
HCAR. This region of PR0301
also shows a similar Blast score and homology with HSU90716 1. Expression of
such proteins is usually
associated with viral infection and therapeutics for the prevention of such
infection may be accordingly
conceived. As mentioned in the Background, the expression of viral receptors
is often associated with neoplastic
tumors.
Therapeutic uses for the PR0234 polypeptides of the invention includes
treatments associated with
leukocyte homing or the interaction between leukocytes and the endothelium
during an inflammatory response.
Examples include asthma, rheumatoid arthritis, psoriasis and multiple
sclerosis.
Since the PR0231 polypeptide and nucleic acid encoding it possess sequence
homology to a putative
acid phosphatase and its encoding nucleic acid, probes based upon the PR0231
nucleotide sequence may be
employed to identify other novel phosphatase proteins. Soluble forms of the
PR0231 polypeptide may be
employed as antagonists of membrane bound PR0231 activity both in vitro and in
vivo. PR0231 polypeptides
may be employed in screening assays designed to identify agonists or
antagonists of the native PR0231
polypeptide, wherein such assays may take the form of any conventional cell-
type or biochemical binding assay.
Moreover, the PR0231 polypeptide may serve as a molecular marker for the
tissues in which the polypeptide
is specifically expressed.
PR0229 polypeptides can be fused with peptides of interest to determine
whether the fusion peptide has
an increased half-life over the peptide of interest. The PR0229 poiypeptides
can be used accordingly to increase
the half-life of polypeptides of interest. Portions of PR0229 which cause the
increase in half life are an
embodiment of the invention herein.
PR0238 can be used in assays which measure its ability to reduce substrates,
including oxygen and
Aceyl-CoA, and particularly, measure PR0238's ability to produce oxygen free
radicals. This is done by using
assays which have been previously described. PR0238 can further be used to
assay for candidates which
block, reduce or reverse its reducing abilities. This is done by performing
side by side assays where candidates
are added in one assay having PR0238 and a substrate to reduce, and not added
in another assay, being the same
but for the lack of the presence of the candidate.
PR0233 polypeptides and portions thereof which have homology to reductase may
also be useful for
in vivo therapeutic purposes, as well as for various other applications. The
identification of novel reductase
proteins and related molecules may be relevant to a number of human disorders
such as inflammatory disease,
organ failure, atherosclerosis, cardiac injury, infertility, birth defects,
premature aging, AIDS, cancer, diabetic
117
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
complications and mutations in general. Given that oxygen free radicals and
antioxidants appear to play
important roles in a number of disease processes, the identification of new
reductase proteins and reductase-like
molecules is of special importance in that such proteins may serve as
potential therapeutics for a variety of
different human disorders. Such polypeptides may also play important roles in
biotechnological and medical
research, as well as various industrial applications. As a result, there is
particular scientific and medical interest
in new molecules, such as PR0233.
The PR0223 polypeptides of the present invention which exhibit serine
carboxypeptidease activity may
be employed in vivo for therapeutic purposes as well as for in vitro purposes.
Those of ordinary skill in the art
will well know how to employ PR0223 polypeptides for such uses.
PR0235 polypeptides and portions thereof which may be involved in cell
adhesion are also useful for
in vivo therapeutic purposes, as well as for various in vitro applications. In
addition, PR0235 polypeptides and
portions thereof may have therapeutic applications in disease states which
involve cell adhesion. Given the
physiological importance of cell adhesion mechanisms in vivo, efforts are
currently being under taken to identify
new, native proteins which are involved in cell adhesion. Therefore, peptides
having homology to plexin are
of particular interest to the scientific and medical communities.
Because the PR0236 and PR0262 polypeptides disclosed herein are homologous to
various known ~i-
galactosidase proteins, the PR0236 and PR0262 polypeptides disclosed herein
will fmd use in conjugates of
monoclonal antibodies and the polypeptide for specific killing of tumor cells
by generation of active drug from
a galactosylated prodrug (e.g., the generation of 5-fluorouridine from the
prodrug (3-D-galactosyl-5-
fluorouridine). The PR0236 and PR0262 polypeptides disclosed herein may also
find various uses both in vivo
and in vitro, wherein those uses will be similar or identical to uses for
which p-galactosidase proteins are now
employed. Those of ordinary skill in the art will well know how to employ
PR0236 and PR0262 polypeptides
for such uses.
PR0239 polypeptides and portions thereof which have homology to densin may
also be useful for in
vivo therapeutic purposes, as well as for various in vitro applications. In
addition, PR0239 polypeptides and
portions thereof may have therapeutic applications in disease states which
involve synaptic mechanisms,
regeneration or cell adhesion. Given the physiological importance of synaptic
processes, regeneration and cell
adhesion mechanisms in vivo, efforts are currently being under taken to
identify new, native proteins which are
involved in synaptic machinery and cell adhesion. Therefare, peptides having
homology to densin are of
particular interest to the scientific and medical communities.
The PR0260 polypeptides described herein can be used in assays to determine
their relation to
fucosidase. In particular, the PR0260 polypeptides can be used in assays in
determining their ability to remove
fucose or other sugar residues from proteoglycans. The PR0260 polypeptides can
be assayed to determine if
they have any functional or locational similarities as fucosidase. The PR0260
polypeptides can then be used to
regulate the systems in which they are integral.
PR0263 can be used in assays wherein CD44 antigen is generally used to
determine PR0263 activity
relative to that of CD44. The results can be used accordingly.
PR0270 polypeptides and portions thereof which effect reduction-oxidation
(redox) state may also be
118
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
useful for in vivo therapeutic purposes, as well as for various in vitro
applications. More specifically, PR0270
polypeptides may affect the expression of a large variety of genes thought to
be involved in the pathogenesis of
AIDS, cancer, atherosclerosis, diabetic complications and in pathological
conditions involving oxidative stress
such as stroke and inflammation. In addition, PR0270 polypeptides and portions
thereof may affect the
expression of a genes which have a role in apoptosis. Therefore, peptides
having homology to thioredoxin are
particularly desirable to the scientific and medical communities.
PR0272 polypeptides and portions thereof which possess the ability to bind
calcium may also have
numerous in vivo therapeutic uses, as well as various in vitro applications.
Therefore, peptides having homology
to reticulocalbin are particularly desirable. Those with ordinary skill in the
art will know how to employ
PR0272 polypeptides and portions thereof for such purposes.
PR0294 polypeptides and portions thereof which have homology to collagen may
also be useful for in
vivo therapeutic purposes, as well as for various other applications. The
identification of novel collagens and
collage-like molecules may have relevance to a number of human disorders.
Thus, the identification of new
collagens and collage-like molecules is of special importance in that such
proteins may serve as potential
therapeutics for a variety of different human disorders. Such polypeptides may
also play important roles in
biotechnological and medical research as well as various industrial
applications. Given the large number of uses
for collagen, there is substantial interest in polypeptides with homology to
the collagen molecule.
PR0295 polypeptides and portions thereof which have homology to integrin may
also be useful for in
vivo therapeutic purposes, as well as for various other applications. The
identification of novel integrins and
integrin-like molecules may have relevance to a number of human disorders such
as modulating the binding or
activity of cells of the immune system. Thus, the identification of new
integrins and integrin-like molecules is
of special importance in that such proteins may serve as potential
therapeutics for a variety of different human
disorders. Such polypeptides may also play important roles in biotechnological
and medical research as well as
various industrial applications. As a result, there is particular scientific
and medical interest in new molecules,
such as PR0295.
As the PR0293 polypeptide is clearly a leucine rich repeat polypeptide
homologue, the peptide can be
used in all applications that the known NLRR-1 and NLRR-2 polypeptides are
used. The activity can be
compared between these peptides and thus applied accordingly.
The PR0247 polypeptides described herein can be used in assays in which densin
is used to determine
the activity of PR0247 relative to densin or these other proteins. The results
can be used accordingly in
diagnostics and/or therapeutic applications with PR0247.
PR0302, PR0303, PR0304, PR0307 and PR0343 polypeptides of the present
invention which possess
protease activity may be employed both in vivo for therapeutic purposes and in
vitro. Those of ordinary skill
in the art will well know how to employ the PR0302, PR0303, PR0304, PR0307 and
PR0343 polypeptides
of the present invention for such purposes.
PR0328 polypeptides and portions thereof which have homology to GLIP and CRISP
may also be useful
for in vivo therapeutic purposes, as well as for various other applications.
The identification of novel GLIP and
CRISP-like molecules may have relevance to a number of human disorders which
involve transcriptional
119
CA 02343577 2001-03-16
WO 00/15796 PCT1US99/21090
regulation or are over expressed in human tumors. Thus, the identification of
new GLIP and CRISP-like
molecules is of special importance in that such proteins may serve as
potential therapeutics for a variety of
different human disorders. Such polypeptides may also play important roles in
biotechnological and medical
research as well as in various industrial applications. As a result, there is
particular scientific and medical
interest in new molecules, such as PR0328.
Uses for PR0335, PR0331 or PR0326 including uses in competitive assays with
LIG-1, ALS and
decorin to determine their relative activities. The results can be used
accordingly. PR0335, PR0331 or
PR0326 can also be used in assays where LIG-1 would be used to determine if
the same effects are incurred.
PR0332 contains GAG repeat (GKEK) at amino acid positions 625-628 in Fig. 108
(SEQ ID N0:310).
Slippage in such repeats can be associated with human disease. Accordingly,
PR0332 can use useful for the
treatment of such disease conditions by gene therapy, i.e. by introduction of
a gene containing the correct GKEK
sequence motif.
Other uses of PR0334 include use in assays in which fibrillin or fibulin would
be used to determine the
relative activity of PR0334 to fibrillin or fibulin. In particular, PR0334 can
be used in assays which require
the mechanisms imparted by epidermal growth factor repeats.
Native PR0346 (SEQ 1D N0:320) has a Blast score of 230, corresponding to 27%
homology between
amino acid residues 21 to 343 with residues 35 to 1040 CGM6 HUMAN, a
carcinoembryonic antigen cgm6
precursor. This homology region includes nearly all but 2 N-terminal
extracellular domain residues, including
an immunoglobulin superfamily homology at residues 148 to 339 of PR0346 in
addition to several
transmembrane residues (340-343). Carcinoembryonic antigen precursor, as
explained in the Background is a
tumor-specific antigen, and as such, is a recognized marker and therapeutic
target for the diagnosis and treatment
of colon cancer. The expression of tumor-specific antigens is often associated
with the progression of neoplastic
tissue disorders. Native PR0346 (SEQ ID N0:320) and P W06874, a human
carcinoembryonic antigen CEA-d
have a Blast score of 224 and homology of 28% between residues 2 to 343 and 67
to 342, respectively. This
homology includes the entire extracellular domain residues of native PR0346,
minus the initiator methionine
(residues 2 to 18) as well as several transmembrane residues (340-343).
PR0268 polypeptides which have protein disulfide isomerase activity will be
useful for many
applications where protein disulfide isomerase activity is desirable
including, for example, for use in promoting
proper disulfide bond formation in recombinantly produced proteins so as to
increase the yield of correctly folded
protein. Those of ordinary skill in the art will readily know how to employ
such PR0268 polypeptides for such
purposes.
PR0330 polypeptides of the present invention which possess biological activity
related to that of the
prolyl 4-hydroxylase alpha subunit protein may be employed both in vivo for
therapeutic purposes and in vitro.
Those of ordinary skill in the art will well know how to employ the PR0330
polypeptides of the present
invention for such purposes.
120
CA 02343577 2001-03-16
WO 00/15796 PCT/U599/21090
F. Anti-PRO Antibodies
The present invention further provides anti-PRO antibodies. Exemplary
antibodies include polyclonal,
monoclonal, humanized, bispecific, and heteroconjugate antibodies.
Polvclonal Antibodies
S The anti-PRO antibodies may comprise polyclonal antibodies. Methods of
preparing polyclonal
antibodies are known to the skilled artisan. Polyclonal antibodies can be
raised in a mammal, for example, by
one or more injections of an immunizing agent and, if desired, an adjuvant.
Typically, the immunizing agent
and/or adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. The
immunizing agent may include the PRO polypeptide or a fusion protein thereof.
It may be useful to conjugate
the immunizing agent to a protein known to be immunogenic in the mammal being
immunized. Examples of
such immunogenic proteins include but are not limited to keyhole limpet
hemocyanin, serum albumin, bovine
thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may
be employed include Freund's
complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic
trehalose dicorynomycolate).
The immunization protocol may be selected by one skilled in the art without
undue experimentation.
2. Monoclonal Antibodies
The anti-PRO antibodies may, alternatively, be monoclonal antibodies.
Monoclonal antibodies may be
prepared using hybridoma methods, such as those described by Kohler and
Milstein, Nature, 256:495 (1975).
In a hybridoma method, a mouse, hamster, or other appropriate host animal, is
typically immunized with an
immunizing agent to elicit lymphocytes that produce or are capable of
producing antibodies that will specifically
bind to the immunizing agent. Alternatively, the lymphocytes may be immunized
in vitro.
The immunizing agent will typically include the PRO polypeptide or a fusion
protein thereof.
Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of
human origin are desired, or spleen
cells or lymph node cells are used if non-human mammalian sources are desired.
The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent, such as
polyethylene glycol, to form a
hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice
Academic Press, ( 1986) pp. 59-103].
Immortalized cell lines are usually transformed mammalian cells, particularly
myeloma cells of rodent, bovine
and human origin. Usually, rat or mouse myeloma cell lines are employed. The
hybridoma cells may be
cultured in a suitable culture medium that preferably contains one or more
substances that inhibit the growth or
survival of the unfused, immortalized cells. For example, if the parental
cells lack the enzyme hypoxanthine
guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the
hybridomas typically will
include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which
substances prevent the growth of
HGPRT-deficient cells.
Preferred immortalized cell lines are those that fuse efficiently, support
stable high level expression of
antibody by the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More
preferred immortalized cell lines are murine myeloma lines, which can be
obtained, for instance, from the Salk
Institute Cell Distribution Center, San Diego, California and the American
Type Culture Collection, Manassas,
I2I
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have
been described for the
production of human monoclonal antibodies [Kozbor, J. Immunol. , 133:3001 (
1984); Brodeur et al. , Monoclonal
Antibody Production Techniques and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
The culture medium in which the hybridoma cells are cultured can then be
assayed for the presence of
monoclonal antibodies directed against PRO. Preferably, the binding
specificity of monoclonal antibodies
produced by the hybridoma cells is determined by immunoprecipitation or by an
in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such
techniques and assays are
known in the art. The binding affinity of the monoclonal antibody can, for
example, be determined by the
Scatchard analysis of Munson and Pollard, Anal. Biochem.. 107:220 (1980).
After the desired hybridoma cells are identified, the clones may be subcloned
by limiting dilution
procedures and grown by standard methods [coding, su ra . Suitable culture
media for this purpose include,
for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
Alternatively, the hybridoma cells
may be grown in vivo as ascites in a mammal.
The monoclonal antibodies secreted by the subclones may be isolated or
purified from the culture
medium or ascites fluid by conventional immunoglobulin purification procedures
such as, for example, protein
A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or
affinity chromatography.
The monoclonal antibodies may also be made by recombinant DNA methods, such as
those described
in U. S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the
invention can be readily isolated
and sequenced using conventional procedures (e.g., by using oligonucleotide
probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the
invention serve as a preferred source of such DNA. Once isolated, the DNA may
be placed into expression
vectors, which are then transfected into host cells such as simian COS cells,
Chinese hamster ovary (CHO) cells,
or myeloma cells that do not otherwise produce immunoglobulin protein, to
obtain the synthesis of monoclonal
antibodies in the recombinant host cells. The DNA also may be modified, for
example, by substituting the
coding sequence for human heavy and light chain constant domains in place of
the homologous murine sequences
[U.S. Patent No. 4,816,567; Morrison et al., su ra or by covalently joining to
the immunoglobulin coding
sequence all or part of the coding sequence for a non-immunoglobulin
polypeptide. Such a non-immunoglobulin
polypeptide can be substituted for the constant domains of an antibody of the
invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody of the
invention to create a chimeric bivalent
antibody.
The antibodies may be monovalent antibodies. Methods for preparing monovalent
antibodies are well
known in the art. For example, one method involves recombinant expression of
immunoglobulin light chain and
modified heavy chain. The heavy chain is truncated generally at any point in
the Fc region so as to prevent
heavy chain crosslinking. Alternatively, the relevant cysteine residues are
substituted with another amino acid
residue or are deleted so as to prevent crosslinking.
In vitro methods are also suitable for preparing monovalent antibodies.
Digestion of antibodies to
produce fragments thereof, particularly, Fab fragments, can be accomplished
using routine techniques known
in the art.
122
CA 02343577 2001-03-16
WO 00115796 PCT/US99/21090
3. Human and Humanized Antibodies
The anti-PRO antibodies of the invention may further comprise humanized
antibodies or human
antibodies. Humanized forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or
other antigen-binding
subsequences of antibodies) which contain minimal sequence derived from non-
human immunoglobulin.
Humanized antibodies include human immunoglobulins (recipient antibody) in
which residues from a
complementary determining region (CDR) of the recipient are replaced by
residues from a CDR of a non-human
species (donor antibody) such as mouse, rat or rabbit having the desired
specificity, affinity and capacity. In
some instances, Fv framework residues of the human immunoglobulin are replaced
by corresponding non-human
residues. Humanized antibodies may also comprise residues which are found
neither in the recipient antibody
nor in the imported CDR or framework sequences. In general, the humanized
antibody will comprise
substantially all of at least one, and typically two, variable domains, in
which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all or
substantially all of the FR regions are
those of a human immunoglobulin consensus sequence. The humanized antibody
optimally also will comprise
at least a portion of an immunoglobulin constant region (Fc), typically that
of a human immunoglobulin [Jones
et al. , Nature, 321:522-525 ( 1986); Riechmann et al. , Nature, 332:323-329 (
1988); and Presta, Curr. Op. Struct.
Biol., 2:593-596 (1992)].
Methods for humanizing non-human antibodies are well known in the art.
Generally, a humanized
antibody has one or more amino acid residues introduced into it from a source
which is non-human. These non-
human amino acid residues are often referred to as "import" residues, which
are typically taken from an "import"
variable domain. Humanization can be essentially performed following the
method of Winter and co-workers
[Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-
327 (1988); Verhoeyen et al.,
Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences
for the corresponding
sequences of a human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (U.S. Patent
No. 4,816,567), wherein substantially less than an intact human variable
domain has been substituted by the
corresponding sequence from a non-human species. In practice, humanized
antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues are
substituted by residues from
analogous sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the
art, including phage
display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks
et al., J. Mol. Biol., 222:581
(1991)]. The techniques of Cole et al. and Boerner et al. are also available
for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy,
Alan R. Liss, p.. 77 (1985) and
Boerner et al., J. Immunol., 147(1):86-95 (1991)]. Similarly, human antibodies
can be made by introducing
of human immunoglobulin loci into transgenic animals, e.g., mice in which the
endogenous immunoglobulin
genes have been partially or completely inactivated. Upon challenge, human
antibody production is observed,
which closely resembles that seen in humans in all respects, including gene
rearrangement, assembly, and
antibody repertoire. This approach is described, for example, in U.S. Patent
Nos. 5,545,807; 5,545,806;
5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific
publications: Marks et al.,
123
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Bio/Technolosv 10, 779-783 (1992); Lonberg etal., Nature 368 856-859 (1994);
Morrison, Nature 368, 8I2-13
(1994); Fishwild et al., Nature Biotechnoloey 14, 845-51 (1996); Neuberger,
Nature Biotechnolosv 14, 826
(1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).
4. Bispecific Antibodies
Bispecific antibodies are monoclonal, preferably human or humanized,
antibodies that have binding
specificities for at least two different antigens. In the present case, one of
the binding specificities is for the
PRO, the other one is for any other antigen, and preferably for a cell-surface
protein or receptor or receptor
subunit.
Methods for making bispecific antibodies are known in the art. Traditionally,
the recombinant
production of bispecific antibodies is based on the co-expression of two
immunoglobulin heavy-chain/light-chain
pairs, where the two heavy chains have different speciftcities [Milstein and
Cuello, Nature, 305:537-539 (1983)].
Because of the random assortment of immunoglobulin heavy and Light chains,
these hybridomas (quadromas)
produce a potential mixture of ten different antibody molecules, of which only
one has the correct bispecific
structure. The purification of the correct molecule is usually accomplished by
affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in
Traunecker et al., EMBO
J., 10:3655-3659 (1991).
Antibody variable domains with the desired binding specificities (antibody-
antigen combining sites) can
be fused to immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin
heavy-chain constant domain, comprising at least part of the hinge, CH2, and
CH3 regions. It is preferred to
have the first heavy-chain constant region (CH 1 ) containing the site
necessary for light-chain binding present in
at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain
fusions and, if desired, the
immunoglobulin light chain, are inserted into separate expression vectors, and
are co-transfected into a suitable
host organism. For further details of generating bispecific antibodies see,
for example, Suresh et al., Methods
in Enzvmoloav, 121:210 (1986).
According to another approach described in WO 96!27011, the interface between
a pair of antibody
molecules can be engineered to maximize the percentage of heterodimers which
are recovered from recombinant
cell culture. The preferred interface comprises at least a part of the CH3
region of an antibody constant domain.
In this method, one or more small amino acid side chains from the interface of
the first antibody molecule are
replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory
"cavities" of identical or similar
size to the large side chains) are created on the interface of the second
antibody molecule by replacing large
amino acid side chains with smaller ones (e.g. alanine or threonine). This
provides a mechanism for increasing
the yield of the heterodimer over other unwanted end-products such as
homodimers.
Bispecific antibodies can be prepared as full length antibodies or antibody
fragments (e.g. F(ab')
bispecific antibodies). Techniques for generating bispecific antibodies from
antibody fragments have been
described in the literature. For example, bispecific antibodies can be
prepared can be prepared using chemical
linkage. Brennan et al. , Science 229:81 ( 1985) describe a procedure wherein
intact antibodies are proteoIytically
cleaved to generate F(ab'), fragments. These fragments are reduced in the
presence of the dithiol complexing
I24
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular
disulfide formation. The Fab'
fragments generated are then converted to thionitrobenzoate (TNB) derivatives.
One of the Fab'-TNB
derivatives is then reconverted to the Fab'-thiol by reduction with
mercaptoethylamine and is mixed with an
equimolar amount of the other Fab'-TNB derivative to form the bispecific
antibody. The bispecific antibodies
produced can be used as agents for the selective immobilization of enzymes.
Fab' fragments may be directly recovered from E, coli and chemically coupled
to form bispecific
antibodies. Shalaby et al., J_. Exp. Med. 175:217-225 (1992) describe the
production of a fully humanized
bispecific antibody F(ab'), molecule. Each Fab' fragment was separately
secreted from E. coli and subjected
to directed chemical coupling in vitro to form the bispecific antibody. The
bispecific antibody thus formed was
able to bind to cells overexpressing the ErbB2 receptor and normal human T
cells, as well as trigger the lytic
activity of human cytotoxic lymphocytes against human breast tumor targets.
Various technique for making and isolating bispecific antibody fragments
directly from recombinant cell
culture have also been described. For example, bispeci6c antibodies have been
produced using leucine zippers.
Kostelny et al., J. Immunol. 148(5):1547-1553 (1992). The leucine zipper
peptides from the Fos and Jun
proteins were linked to the Fab' portions of two different antibodies by gene
fusion. The antibody homodimers
were reduced at the hinge region to form monomers and then re-oxidized to form
the antibody heterodimers.
This method can also be utilized for the production of antibody homodimers.
The "diabody" technology
described by Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993)
has provided an alternative
mechanism for making bispecific antibody fragments. The fragments comprise a
heavy-chain variable domain
(V") connected to a light-chain variable domain (V~) by a linker which is too
short to allow pairing between the
two domains on the same chain. Accordingly, the V" and VL domains of one
fragment are forced to pair with
the complementary V~ and V" domains of another fragment, thereby forming two
antigen-binding sites. Another
strategy for making bispecific antibody fragments by the use of single-chain
Fv (sFv) dimers has also been
reported. See, Gruber et al., J. Immunol. 152:5368 (1994).
Antibodies with more than two valencies are contemplated. For example,
trispecific antibodies can be prepared.
Tutt et al. , J. Immunol. 147:60 ( 1991 ).
Exemplary bispecific antibodies may bind to two different epitopes on a given
PRO polypeptide herein.
Alternatively, an anti-PRO polypeptide arm may be combined with an arm which
binds to a triggering molecule
on a leukocyte such as a T-cell receptor molecule (e.g. CD2, CD3, CD28, or
B7), or Fc receptors for IgG
(FcyR), such as FcyRI (CD64), FcyRII (CD32) and FcyRIII (CD16) so as to focus
cellular defense mechanisms
to the cell expressing the particular PRO polypeptide. Bispecific antibodies
may also be used to localize
cytotoxic agents to cells which express a particular PRO polypeptide. These
antibodies possess a PRO-binding
arm and an arm which binds a cytotoxic agent or a radionuclide chelator, such
as EOTUBE, DPTA, DOTA,
or TETA. Another bispecific antibody of interest binds the PRO polypeptide and
further binds tissue factor
(TF).
5. Heteroconiugate Antibodies
Heteroconjugate antibodies are also within the scope of the present invention.
Heteroconjugate
125
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
antibodies are composed of two covalently joined antibodies. Such antibodies
have, for example, been proposed
to target immune system cells to unwanted cells [U.S. Patent No. 4,676,980],
and for treatment of HIV infection
[WO 91/00360; WO 92/200373; EP 03089]. 1t is contemplated that the antibodies
may be prepared in vitro
using known methods in synthetic protein chemistry, including those involving
crosslinking agents. For
example, immunotoxins may be constructed using a disulfide exchange reaction
or by forming a thioether bond.
Examples of suitable reagents for this purpose include iminothiolate and
methyl-4-mercaptobutyrimidate and
those disclosed, for example, in U.S. Patent No. 4,676,980.
6. Effector Function Engineering
It may be desirable to modify the antibody of the invention with respect to
effector function, so as to
enhance, e.g., the effectiveness of the antibody in treating cancer. For
example, cysteine residues) may be
introduced into the Fc region, thereby allowing interchain disulfide bond
formation in this region. The
homodimeric antibody thus generated may have improved internalization
capability and/or increased
complement-mediated cell killing and antibody-dependent cellular cytotoxicity
(ADCC). See Caron et al., J.
Exp Med., 176: 1191-1195 (1992) and Shopes, J. Immunol., 148: 2918-2922
(1992). Homodimeric antibodies
1 S with enhanced anti-tumor activity may also be prepared using
heterobifunctional cross-linkers as described in
Wolff et al. Cancer Research, 53: 2560-2565 ( 1993). Alternatively, an
antibody can be engineered that has dual
Fc regions and may thereby have enhanced complement lysis and ADCC
capabilities. See Stevenson etal., Anti-
Cancer DJg Desi; n~. 3: 219-230 (1989).
7. ImmunoconiuEates
The invention also pertains to immunoconjugates comprising an antibody
conjugated to a cytotoxic agent
such as a chemotherapeutic agent, toxin (e.g. , an enzymatically active toxin
of bacterial, fungal, plant, or animal
origin, or fragments thereof), or a radioactive isotope (i.e., a
radioconjugate).
Chemotherapeutic agents useful in the generation of such immunoconjugates have
been described above.
Enzymatically active toxins and fragments thereof that can be used include
diphtheria A chain, nonbinding active
fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa),
ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins,
Phytolaca americana proteins
(PAPI, PAPA, and PAP-S), momordica charantia inhibitor, curcin, croon,
sapaonaria officinalis inhibitor,
gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the
tricothecenes. A variety of radionuclides are
available for the production of radioconjugated antibodies. Examples include
Z''-Bi, '3'I, '3'In, ~°Y, and '86Re.
Conjugates of the antibody and cytotoxic agent are made using a variety of
bifunctional protein-coupling
agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional
derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters
(such as disuccinimidyl suberate),
aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-
azidobenzoyl} hexanediamine), bis-
diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-
diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-
dinitrobenzene). For example, a ricin
immunotoxin can be prepared as described in Vitetta et al. , Science, 238:
1098 (1987). Carbon-14-labeled 1-
126
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is
an exemplary chelating agent
for conjugation of radionucleotide to the antibody. See W094/11026.
In another embodiment, the antibody may be conjugated to a "receptor" (such
streptavidin) for
utilization in tumor pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed
by removal of unbound conjugate from the circulation using a clearing agent
and then administration of a
"ligand" (e.g., avidin) that is conjugated to a cytotoxic agent (e.g., a
radionucleotide).
8. Immunolinosomes
The antibodies disclosed herein may also be formulated as immunoliposomes.
Liposomes containing
the antibody are prepared by methods known in the art, such as described in
Epstein et al., Proc. Natl. Acad.
Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Natl Acad. Sci. USA, 77: 4030
(1980); and U.S. Pat. Nos.
4,485,045 and 4,544,545. Liposomes with enhanced circulation time are
disclosed in U.S. Patent No.
S,OI3,556.
Particularly useful liposomes can be generated by the reverse-phase
evaporation method with a lipid
compositioncomprising phosphatidylcholine, cholesterol, and PEG-derivatized
phosphatidylethanolamine(PEG-
PE). Liposomes are extruded through filters of defined pore size to yield
liposomes with the desired diameter.
Fab' fragments of the antibody of the present invention can be conjugated to
the liposomes as described in Martin
et al ., J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange
reaction. A chemotherapeutic agent
(such as Doxorubicin) is optionally contained within the liposome. See Gabizon
et al. , J. National Cancer Inst.
81(19): 1484 (1989).
9. Pharmaceutical Compositions of Antibodies
Antibodies specifically binding a PRO polypeptide identifiedherein, as well as
other molecules identified
by the screening assays disclosed hereinbefore, can be administered for the
treatment of various disorders in the
form of pharmaceutical compositions.
If the PRO polypeptide is intracellular and whole antibodies are used as
inhibitors, internalizing
antibodies are preferred. However, lipofections or liposomes can also be used
to deliver the antibody, or an
antibody fragment, into cells. Where antibody fragments are used, the smallest
inhibitory fragment that
specifically binds to the binding domain of the target protein is preferred.
For example, based upon the variable-
region sequences of an antibody, peptide molecules can be designed that retain
the ability to bind the target
protein sequence. Such peptides can be synthesized chemically and/or produced
by recombinant DNA
technology. See, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA 90: 7889-
7893 (1993). The fomntlatiort
herein may also contain more than one active compound as necessary for the
particular indication being treated,
preferably those with complementary activities that do not adversely affect
each other. Alternatively, or in
addition, the composition may comprise an agent that enhances its function,
such as, for example, a cytotoxic
agent, cytokine, chemotherapeutic agent, or growth-inhibitory agent. Such
molecules are suitably present in
combination in amounts that are effective for the purpose intended.
The active ingredients may also be entrapped in microcapsules prepared, for
example, by coacervation
127
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
techniques or by interfacial polymerization, for example,
hydroxymethylcellulose or gelatin-microcapsules and
poly-(methylmethacylate) microcapsules, respectively, in colloidal drug
delivery systems (for example,
liposomes, albumin microspheres, microemulsions, nano-particles, and
nanocapsules) or in macroemulsions.
Such techniques are disclosed in Remington's Pharmaceutical Sciences, supra.
The formulations to be used for in vivo administration must be sterile. This
is readily accomplished by
filtration through sterile filtration membranes.
Sustained-release preparations may be prepared. Suitable examples of sustained-
release preparations
include semipermeable matrices of solid hydrophobic polymers containing the
antibody, which matrices are in
the form of shaped articles, e.g., films, or microcapsules. Examples of
sustained-release matrices include
polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or
poly(vinylalcohol)), polylactides
(U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and y ethyl-L-
glutamate, non-degradable ethylene-
vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the
LUPRON DEPOT T'" (injectable
microspheres composed of lactic acid-glycolic acid copolymer and leuprolide
acetate), and poly-D-(-)-3-
hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic
acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins for shorter
time periods. When encapsulated
antibodies remain in the body for a long time, they may denature or aggregate
as a result of exposure to moisture
at 37°C, resulting in a loss of biological activity and possible
changes in immunogenicity. Rational strategies
can be devised for stabilization depending on the mechanism involved. For
example, if the aggregation
mechanism is discovered to be intermolecular S-S bond formationthroughthio-
disulfide interchange, stabilization
may be achieved by modifying sulfhydryl residues, lyophilizing from acidic
solutions, controlling moisture
content, using appropriate additives, and developing specific polymer matrix
compositions.
G. Uses for anti-PRO Antibodies
The anti-PRO antibodies of the invention have various utilities. For example,
anti-PRO antibodies may
be used in diagnostic assays for PRO, e.g., detecting its expression in
specific cells, tissues, or serum. Various
diagnostic assay techniques known in the art may be used, such as competitive
binding assays, direct or indirect
sandwich assays and immunoprecipitation assays conducted in either
heterogeneous or homogeneous phases
[Zola, Monoclonal Antibodies: A Manual of Techniques CRC Press, Inc. (1987)
pp. 147-158j. The antibodies
used in the diagnostic assays can be labeled with a detectable moiety. The
detectable moiety should be capable
of producing, either directly or indirectly, a detectable signal. For example,
the detectable moiety may be a
radioisotope, such as 3H, '4C,'zP, 3sS, or'zSI, a fluorescent or
chemiluminescent compound, such as fluorescein
isothiocyanate, rhodamine, or luciferin, or an enzyme, such as alkaline
phosphatase, beta-galactosidase or
horseradish peroxidase. Any method known in the art for conjugating the
antibody to the detectable moiety may
be employed, including those methods described by Hunter et al., Nature,
144:945 (1962); David et- al.,
Biochemistrv, 13:1014 (1974); Pain et al., J. Immunol. Meth. 40:219 (1981);
and Nygren, J. Histochem. and
Cytochem., 30:407 (1982).
Anti-PRO antibodies also are useful for the affinity purification of PRO from
recombinant cell culture
or natural sources. In this process, the antibodies against PRO are
immobilized on a suitable support, such a
128
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
Sephadex resin or filter paper, using methods well known in the art. The
immobilized antibody then is contacted
with a sample containing the PRO to be purified, and thereafter the support is
washed with a suitable solvent that
will remove substantially all the material in the sample except the PRO, which
is bound to the immobilized
antibody. Finally, the support is washed with another suitable solvent that
will release the PRO from the
antibody.
The following examples are offered for illustrative purposes only, and are not
intended to limit the scope
of the present invention in any way.
All patent and literature references cited in the present specification are
hereby incorporated by reference
in their entirety.
EXAMPLES
Commercially available reagents referred to in the examples were used
according to manufacturer's
instructions unless otherwise indicated. The source of those cells identified
in the following examples, and
throughout the specification, by ATCC accession numbers is the American Type
Culture Collection, Rockville,
Maryland.
EXAMPLE 1: Extracellular Domain Homoloev Screening to Identify Novel
Polvneptides and cDNA
Encoding Therefor
The extracellular domain (ECD) sequences (including the secretion signal
sequence, if any) from about
950 known secreted proteins from the Swiss-Prot public database were used to
search EST databases. The EST
databases included public databases (e.g., Dayhoff, GenBank), and proprietary
databases (e.g. LIFESEQT"',
Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the
computer program BLAST or
BLAST2 (Altschul, and Gish, Methods in Enzymoloev 266: 460-80 (1996);
http://blast.wustl/edu/blast/README.html) as a comparison of the ECD protein
sequences to a 6 frame
translation of the EST sequences. Those comparisons with a Blast score of 70
(or in some cases 90) or greater
that did not encode known proteins were clustered and assembled into consensus
DNA sequences with the
program "phrap" (Phil Green, University of Washington, Seattle, Washington).
Using this extracellular domain homology screen, consensus DNA sequences were
assembled relative
to the other identified EST sequences. In addition, the consensus DNA
sequences obtained were often (but not
always) extended using repeated cycles of BLAST and phrap to extend the
consensus sequence as far as possible
using the sources of EST sequences discussed above.
Based upon the consensus sequences obtained as described above,
oligonucleotides were then
synthesized and used to identify by PCR a cDNA library that contained the
sequence of interest and for use as
probes to isolate a clone of the full-length coding sequence for a PRO
polypeptide. Forward (.f) and reverse
(.r) PCR primers generally range from 20 to 30 nucleotides and are often
designed to give a PCR product of
about 100-1000 by in length. The probe (.p) sequences are typically 40-55 by
in length. In some cases,
additional oligonucleotides are synthesized when the consensus sequence is
greater than about I-1.Skbp. In order
to screen several libraries for a full-length clone, DNA from the libraries
was screened by PCR amplification,
129
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
as per Ausubel et al., Current Protocols in Molecular Biolo y with the PCR
primer pair. A positive library was
then used to isolate clones encoding the gene of interest using the probe
oligonucleotide and one of the primer
pairs.
The cDNA libraries used to isolate the cDNA clones were constructed by
standard methods using
commercially available reagents such as those from Invitrogen, San Diego, CA.
The cDNA was primed with
oligo dT containing a NotI site, linked with blunt to SaII hemikinased
adaptors, cleaved with NotI, sized
appropriately by gel electrophoresis, and cloned in a defined orientation into
a suitable cloning vector (such as
pRKB or pRKD; pRKSB is a precursor of pRKSD that does not contain the SfiI
site; see, Holmes et al., Science,
253:1278-1280 (1991)) in the unique XhoI and NotI sites.
EXAMPLE 2: Isolationof cDNA Clones Encoding PR0211 and PR0217
Consensus DNA sequences were assembled as described in Example 1 above and
were designated as
DNA28730 and DNA28760, respectively. Based on these consensus sequences,
oligonucleotides were
synthesized and used to identify by PCR a cDNA library that contained the
sequences of interest and for use as
probes to isolate a clone of the full-length coding sequence for the PR0211
and PR0217 polypeptides. The
libraries used to isolate DNA32292-1131 and DNA33094-1131 were fetal lung
libraries.
cDNA clones were sequenced in their entirety. The entire nucleotide sequences
of PR0211
(DNA32292-1131) and PR0217 (UNQ191) are shown in Figure 1 (SEQ ID NO: 1) and
Figure 3 (SEQ ID
N0:3), respectively. The predicted polypeptides are 353 and 379 amino acid in
length, respectively, with
respective molecular weights of approximately 38,190 and 41,520 daltons.
The oligonucleotide sequences used in the above procedures were the following:
28730.p (OLI 516) (SEQ ID N0:5)
5'-AGGGAGCACGGACAGTGTGCAGATGTGGACGAGTGCTCACTAGCA-3'
28730.f (OLI 517) (SEQ ID N0:6)
5'-AGAGTGTATCTCTGGCTACGC-3'
28730.r (OLI 518) (SEQ ID N0:7)
5'-TAAGTCCGGCACATTACAGGTC-3'
28760.p (OLI 617) (SEQ ID N0:8)
5'-CCCACGATGTATGAATGGTGGACTTTGTGTGACTCCTGGTTTCTGCATC-3'
28760.f (OLI 618) (SEQ ID N0:9)
5'-AAAGACGCATCTGCGAGTGTCC-3'
28760.r (OLI 619) (SEQ ID N0:10)
5'-TGCTGATTTCACACTGCTCTCCC-3'
EXAMPLE 3: Isolation of cDNA Clones Encodin Human PR0230
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence is designated herein as
DNA30857. An EST proprietary
to Genentech was employed in the consensus assembly. The EST is designated as
DNA20088 and has the
130
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/Z1090
nucleotide sequence shown in Figure 7 (SEQ ID N0:13).
Based on the DNA30857 consensus sequence, oligonucleotides were synthesized to
identify by PCR
a cDNA library that contained the sequence of interest and for use as probes
to isolate a clone of the full-length
coding sequence for PR0230.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-TTCGAGGCCTCTGAGAAGTGGCCC-3' (SEQ ID N0:14)
reverse PCR primer 5'-GGCGGTATCTCTCTGGCCTCCC-3' (SEQ ID NO:IS)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30857
sequence which had the following nucleotide sequence
hybridization probe
5'-TTCTCCACAGCAGCTGTGGCATCCGATCGTGTCTCAATCCATTCTCTGGG-3' (SEQ ID N0:16)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0230 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue. DNA
sequencing of the clones isolated as described above gave the full-length DNA
sequence for PR0230 (herein
designated as DNA33223-1136 and the derived protein sequence for PR0230.
The entire nucleotide sequence of DNA33223-1136 is shown in Figure 5 (SEQ ID
NO:11). Clone
DNA33223-1136 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 100-103 and ending at the stop codon at nucleotide positions 1501-
1503 (Figure 5; SEQ ID NO:11).
The predicted polypeptide precursor is 467 amino acids long (Figure 6).
EXAMPLE 4: Isolation of cDNA Clones Encoding Human PR0232
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence is designated herein as
DNA30935. Based on the
DNA30935 consensus sequence, oligonucleotides were synthesized to identify by
PCR a cDNA library that
contained the sequence of interest and for use as probes to isolate a clone of
the full-length coding sequence for
PR0232.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-TGCTGTGCTACTCCTGCAAAGCCC-3' (SEQ ID N0:19)
reverse PCR primer S'-TGCACAAGTCGGTGTCACAGCACG-3' (SEQ ID N0:20)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30935
sequence which had the following nucleotide sequence
hybridization probe
5'-AGCAACGAGGACTGCCTGCAGGTGGAGAACTGCACCCAGCTGGG-3' (SEQ ID N0:21)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0232 gene using the probe oligonucleotide and
one of the PCR primers.
131
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0232 [herein designated as DNA34435-1140] and the derived protein sequence
for PR0232.
The entire nucleotide sequence of DNA34435-1140 is shown in Figure 8 (SEQ ID
N0:17). Clone
DNA34435-1140 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 17-19 and ending at the stop codon at nucleotide positions 359-361
(Fig. 8; SEQ ID N0:17). The
predicted polypeptide precursor is 114 amino acids long (Fig. 9). Clone
DNA34435-1140 has been deposited
with ATCC on September 16, 1997 and is assigned ATCC deposit no. ATCC 209250.
Analysis of the amino acid sequence of the full-length PR0232 suggests that it
possesses 35 % sequence
identity with a stem cell surface antigen from Gallus gallus.
EXAMPLE 5: Isolation of cDNA Clones Encoding PR0187
A proprietary expressed sequence tag (EST) DNA database (LIFESEQT'", Incyte
Pharmaceuticals, Palo
Alto, CA) was searched and an EST (#843193) was identified which showed
homology to fibroblast growth
factor (FGF-8) also known as androgen-induced growth factor. mRNA was isolated
from human fetal lung tissue
using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2).
The cDNA libraries used to
isolate the cDNA clones were constructed by standard methods using
commercially available reagents (e.g.,
Invitrogen, San Diego, CA, Life Technologies, Gaithersburg, MD). The cDNA was
primed with oligo dT
containing a NotI site, linked with blunt to SaII hemikinased adaptors,
cleaved with NotI, sized appropriately
by gel electrophoresis, and cloned in a defined orientation into the cloning
vector pRKSD using reagents and
protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid
System). The double-strandedcDNA
was sized to greater than 1000 by and the SaII/NotI tinkered cDNA was cloned
into XhoI/NotI cleaved vector.
pRKSD is a cloning vector that has an sp6 transcription initiation site
followed by an SfiI restriction enzyme site
preceding the XhoI/NotI cDNA cloning sites.
Several libraries from various tissue sources were screened by PCR
amplification with the following
oligonucleotide probes:
IN843193.f (OLI315) (SEO ID N0~24)
5'-CAGTACGTGAGGGACCAGGGCGCCATGA-3'
IN843193.r (OLI 317) (SEO ID N0~25)
5'-CCGGTGACCTGCACGTGCTTGCCA-3'
A positive library was then used to isolate clones encoding the PR0187 gene
using one of the above
oligonucleotides and the following oligonucleotide probe:
IN843193.p (OLI 316) (SEO ID N0~26)
5'-GCGGATCTGCCGCCTGCTCANCTGGTCGGTCATGGCGCCCT-3'
A cDNA clone was sequenced in entirety. The entire nucleotide sequence of
PR0187 (DNA27864-
1155) is shown in Figure 10 (SEQ ID N0:22). Clone DNA27864-1155 contains a
single open reading frame
with an apparent translational initiation site at nucleotide position 1
(Figure 10; SEQ ID N0:22). The predicted
polypeptide precursor is 205 amino acids long. Clone DNA27864-1155 has been
deposited with the ATCC
132
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
(designation: DNA27864-1155) and is assigned ATCC deposit no. ATCC 209375.
Based on a BLAST and FastA sequence alignment analysis (using the ALIGN
computer program) of
the foil-length sequence, the PR0187 polypeptide shows 74% amino acid sequence
identity (Blast score 310)
to human fibroblast growth factor-8 (androgen-induced growth factor).
EXAMPLE 6: Isolation of cDNA Clones Encoding PR0265
A consensus DNA sequence was assembled relative to other EST sequences as
described in Example
1 above using phrap. This consensus sequence is herein designated DNA33679.
Based on the DNA33679
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0265.
PCR primers (two forward and one reverse) were synthesized:
forward PCR primer A: 5'-CGGTC'TACCTGTATGGCAACC-3' (SEQ ID N0:29);
forward PCR primer B: 5'-GCAGGACAACCAGATAAACCAC-3' (SEQ ID N0:30);
reverse PCR primer 5'-ACGCAGATTTGAGAAGGCTGTC-3' (SEQ ID N0:31)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA33679
sequence which had the following nucleotide sequence
hybridization probe
5'-TTCACGGGCTGCTCTTGCCCAGCTCTTGAAGCTTGAAGAGCTGCAC-3' (SEQ ID N0:32)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with PCR primer pairs identified above. A
positive library was then used to
isolate clones encoding the PR0265 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human a fetal
brain library.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0265 [herein designated as DNA36350-1158] (SEQ ID N0:27) and the derived
protein sequence for
PR0265.
The entire nucleotide sequence of DNA36350-1158 is shown in Figure 12 (SEQ ID
N0:27). Clone
DNA36350-1158 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 352-354 and ending at the stop codon at positions 2332-2334 (Figure
12). The predicted polypeptide
precursor is 660 amino acids long (Figure 13). Clone DNA36350-1158 has been
deposited with ATCC and is
assigned ATCC deposit no. ATCC 209378.
Analysis of the amino acid sequence of the full-length PR0265 poiypeptide
suggests that- portions of
it possess significant homology to the fibromodulin and the fibromodulin
precursor, thereby indicating that
PR0265 may be a novel member of the leucine rich repeat family, particularly
related to fibromodulin.
EXAMPLE 7: Isolation of cDNA Clones Encodine Human PR0219
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA28729.
Based on the DNA28729
133
CA 02343577 2001-03-16
WO 00/I5796 PCT/US99/21090
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0219.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer S'-GTGACCCTGGTTGTGAATACTCC-3' (SEQ ID N0:35)
reverse PCRprimer 5'-ACAGCCATGGTCTATAGCTTGG-3' (SEQ ID N0:36)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA28729
sequence which had the following nucleotide sequence
hybridization probe
5'-GCCTGTCAGTGTCCTGAGGGACACGTGCTCCGCAGCGATGGGAAG-3' (SEQ 1D N0:37)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0219 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0219 [herein designated as DNA32290-1164] (SEQ ID N0:33) and the derived
protein sequence for
PR0219.
The entire nucleotide sequence of DNA32290-1164 is shown in Figure 14 (SEQ ID
N0:33). Clone
DNA32290-1164 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 204-206 and ending at the stop codon at nucleotide positions 2949-
2951 (Figure 14). The predicted
polypeptide precursor is 915 amino acids long (Figure 15). Clone DNA32290-1164
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209384.
Analysis of the amino acid sequence of the full-length PR0219 polypeptide
suggests that portions of
it possess significant homology to the mouse and human matrilin-2 precursor
polypeptides.
EXAMPLE 8: Isolation of cDNA Clones Encodinc Human PR0246
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA30955.
Based on the DNA30955
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0246.
A pair of PCR primers (forward and reverse) were synthesized: '
forward PCR primer 5'-AGGGTCTCCAGGAGAAAGACTC-3' (SEQ ID N0:40)
reverse PCR primer 5'-ATTGTGGGCCTTGCAGACATAGAC-3' (SEQ ID N0:41)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30955
sequence which had the following nucleotide sequence
hybridization probe
5'-GGCCACAGCATCAAAACCTTAGAACTCAATGTACTGGTTCCTCCAGCTCC-3' (SEQ ID N0:42)
134
CA 02343577 2001-03-16
WO 00/I5796 PCT/US99/21090
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0246 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue. DNA
sequencing of the clones isolated as described above gave the full-length DNA
sequence for PR0246 [herein
designated as DNA35639-1172] (SEQ ID N0:38) and the derived protein sequence
for PR0246.
The entire nucleotide sequence of DNA35639-1172 is shown in Figure 16 (SEQ ID
N0:38). Clone
DNA35639-1172 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 126-128 and ending at the stop codon at nucleotide positions 1296-
1298 (Figure 16). The predicted
polypeptide precursor is 390 amino acids long (Figure 17). Clone DNA35639-1172
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC.209396.
Analysis of the amino acid sequence of the full-length PR0246 polypeptide
suggests that it possess
significant homology to the human cell surface protein HCAR, thereby
indicating that PR0246 may be a novel
cell surface virus receptor.
EXAMPLE 9: Isolation of cDNA Clones Encoding Human PR0228
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA28758. An
EST proprietary to
Genentech was employed in the consensus assembly. This EST is shown in Figure
20 (SEQ ID N0:50) and is
herein designated as DNA21951.
Based on the DNA28758 consensus sequence, oligonucleotides were synthesized:
1) to identify by PCR
a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the full-
length coding sequence for PR0228.
PCR primers (forward and reverse) were synthesized:
forward PCR primer5'-GGTAATGAGCTCCATTACAG-3' (SEQ ID N0:51)
forward primer'-GGAGTAGAAAGCGCATGG-3' (SEQ ID N0:52)
PCR
5
_forward primer5'-CACCTGATACCATGAATGGCAG-3' (SEQ ID N0:53)
PCR
reverse PCR rimer5'-CGAGCTCGAATTAATTCG-3' (SEQ ID N0:54)
p
reverse PCR rimer'-GGATCTCCTGAGCTCAGG-3' (SEQ ID N0:55)
p
5
reverse PCR rimer5'-CCTAGTTGAGTGATCCTTGTAAG-3' (SEQ ID N0:56)
p
Additionally,
a synthetic
oligonucleotide
hybridization
probe was
constructed
from the
consensus
DNA28758
sequence which had the following nucleotide sequence
hybridization probe
5'-ATGAGACCCACACCTCATGCCGCTGTAATCACCTGACACATTTTGCAATT-3' (SEQ ID N0:57)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0228 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
135
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0228 (herein designated as DNA33092-1202] (SEQ ID N0:48) and the derived
protein sequence for
PR0228.
The entire nucleotide sequence of DNA33092-1202 is shown in Figure 18 (SEQ ID
N0:48). Clone
DNA33092-1202 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 24-26 of SEQ ID N0:48 and ending at the stop colon after nucleotide
position 2093 of SEQ ID
N0:48. The predicted polypeptide precursor is 690 amino acids long (Figure
19). Clone DNA33092-1202 has
been deposited with ATCC and is assigned ATCC deposit no. ATCC 209420.
Analysis of the amino acid sequence of the full-length PR0228 polypeptide
suggests that portions of
it possess significant homology to the secretin-related proteins CD97 and EMR
1 as well as the secretin member,
latrophilin, thereby indicating that PR0228 may .be a new member of the
secretin related proteins.
EXAMPLE 10: Isolation of cDNA Clones Encodin~~ Human PR0533
The EST sequence accession number AF007268, a murine fibroblast growth factor
(FGF-15) was used
to search various public EST databases (e.g., GenBank, Dayhoff, etc.). The
search was performed using the
computer program BLAST or BLAST2 [Altschul et al., Methods in Enzvmoloev
266:460-480 (1996);
http://blast.wustl/edu/blast/README.html) as a comparison of the ECD protein
sequences to a 6 frame
translation of the EST sequences. The search resulted in a hit with GenBank
EST AA220994, which has been
identified as stratagene NT2 neuronal precursor 937230.
Based on the Genbank EST AA220994 sequence, oligonucleotides were synthesized:
1) to identify by
PCR a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the
full-length coding sequence. Forward and reverse PCR primers may range from 20
to 30 nucleotides (typically
about 24), and are designed to give a PCR product of 100-1000 by in length.
The probe sequences are typically
40-55 by (typically about 50) in length. In order to screen several libraries
for a source of a full-length clone,
DNA from the libraries was screened by PCR amplification, as per Ausubel et
al., Current Protocols in
Molecular Biology, with the PCR primer pair. A positive library was then used
to isolate clones encoding the
gene of interest using the probe oligonucleotide and one of the PCR primers.
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified below. A
positive library was then used to
isolate clones encoding the PR0533 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
retina. The cDNA libraries
used to isolated the eDNA clones were constructed by standard methods using
commercially available reagents
(e.g., Invitrogen, San Diego, CA; Clontech, etc.) The cDNA was primed with
oligo dT containing a NotI site,
linked with blunt to SaII hemikinased adaptors, cleaved with NotI, sized
appropriately by gel electrophoresis,
and cloned in a defined orientation into a suitable cloning vector (such as
pRKB or pRKD; pRKSB is a precursor
of pRKSD that does not contain the SfiI site; see, Holmes et al., Science,
253:1278-1280 (1991)) in the unique
Xhol and NotI sites.
136
CA 02343577 2001-03-16
WD 00/15796 PCT/LTS99/21090
A cDNA clone was sequenced in its entirety. The full length nucleotide
sequence of PR0533 is shown
in Figure 21 (SEQ ID N0:58). Clone DNA49435-1219 contains a single open
reading frame with an apparent
translational initiation site at nucleotide positions 459-461 (Figure 21; SEQ
ID N0:58). The predicted
polypeptide precursor is 216 amino acids long. Clone DNA47412-1219 has been
deposited with ATCC and is
assigned ATCC deposit no. ATCC 209480.
Based on a BLAST-2 and FastA sequence alignment analysis of the full-length
sequence, PR0533 shows
amino acid sequence identity to fibroblast growth factor (53 % ).
The oligonucleotide sequences used in the above procedure were the following:
FGFlS.forward: 5'-ATCCGCCCAGATGGCTACAATGTGTA-3' (SEQ ID N0:60);
FGFlS.probe: 5'-GCCTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGTGTA-3' (SEQ ID N0:61);
FGFlS.reverse: 5'-CCAGTCCGGTGACAAGCCCAAA-3' (SEQ ID N0:62).
EXAMPLE 11: Isolation of cDNA Clones Encoding Human PR0245
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence is designated herein as
DNA30954.
Based on the DNA30954 consensus sequence, oligonucleotides were synthesized to
identify by PCR
a cDNA library that contained the sequence of interest and for use as probes
to isolate a clone of the full-length
coding sequence for PR0245.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-ATCGTTGTGAAGTTAGTGCCCC-3' (SEQ 1D N0:65)
reverse PCR~rimer 5'-ACCTGCGATATCCAACAGAATTG-3' (SEQ ID N0:66)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30954
sequence which had the following nucleotide sequence
hybridization probe
5'-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3' (SEQ ID N0:67)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0245 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue. DNA
sequencing of the clones isolated as described above gave the full-length DNA
sequence for PR0245 [herein
designated as DNA35638-1141] and the derived protein sequence for PR0245.
The entire nucleotide sequence of DNA35638-1141 is shown in Figure 23 (SEQ ID
N0:63). Clone
DNA35638-1141 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 89-91 and ending at the stop codon at nucleotide positions 1025-1027
(Fig. 23; SEQ ID N0:63). The
predicted poiypeptide precursor is 312 amino acids long (Fig. 24). Clone
DNA35638-1141 has been deposited
with ATCC on September 16, 1997 and is assigned ATCC deposit no. ATCC 209265.
Analysis of the amino acid sequence of the full-length PR0245 suggests that a
portion of it possesses
60 % amino acid identity with the human c-myb protein and, therefore, may be a
new member of the
137
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
transmembrane protein receptor tyrosine ltinase family.
EXAMPLE 12: Isolation of cDNA Clones Encoding Human PR0220 PR0221 and PR0227
(a) PR0220
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence is designated herein as
DNA28749. Based on the
DNA28749 consensus sequence, oligonucleotides were synthesized to identify by
PCR a cDNA library that
contained the sequence of interest and for use as probes to isolate a clone of
the full-length coding sequence for
PR0220.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-TCACCTGGAGCCTTTATTGGCC-3' (SEQ ID N0:74)
reverse PCR primer S'-ATACCAGCTATAACCAGGCTGCG-3' (SEQ ID N0:75)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA28749
sequence which had the following nucleotide sequence:
hybridization probe
5'-CAACAGTAAGTGGTTTGATGCTCTTCCAAATCTAGAGATTCTGATGATTGGG-3'(SEQ ID N0:76).
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0220 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue. DNA
sequencing of the clones isolated as described above gave the full-length DNA
sequence for PR0220 (herein
designated as DNA32298-1132 and the derived protein sequence for PR0220.
The entire nucleotide sequence of DNA32298-1132 is shown in Figure 25 (SEQ ID
N0:68). Clone
DNA32298-1132 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 480-482 and ending at the stop codon at nucleotide positions 2604-
2606 (Figure 25). The predicted
polypeptide precursor is 708 amino acids long (Figure 26). Clone DNA32298-1132
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209257.
Analysis of the amino acid sequence of the full-length PR0220 shows it has
homology to member of
the leucine rich repeat protein superfamily, including the leucine rich repeat
protein and the neuronal leucine-rich
repeat protein 1.
(b) PR0221
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence is designated herein as
DNA28756. Based on the
DNA28756 consensus sequence, oligonucleotides were synthesized to identify by
PCR a cDNA library that
contained the sequence of interest and for use as probes to isolate a clone of
the full-length coding sequence for
PR0221.
A pair of PCR primers (forward and reverse) were synthesized:
138
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
forward PCR primer 5'-CCATGTGTCTCCTCCTACAAAG-3' (SEQ ID N0:77)
reverse PCR primer 5'-GGGAATAGATGTGATCTGATTGG-3' (SEQ ID N0:78)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA28756
sequence which had the following nucleotide sequence:
hvbridizatio~robe
5'-CACCTGTAGCAATGCAAATCTCAAGGAAATACCTAGAGATCTTCCTCCTG-3' (SEQ ID N0:79)
In order to screen several Libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0221 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue. DNA
sequencing of the clones isolated as described above gave the full-length DNA
sequence for PR0221 [herein
designated as DNA33089-1132 and the derived protein sequence for PR0221.
The entire nucleotide sequence of DNA33089-1132 is shown in Figure 27 (SEQ ID
N0:70). Clone
DNA33089-1132 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 179-181 and ending at the stop codon at nucleotide positions 956-958
(Figure 27). The predicted
polypeptide precursor is 259 amino acids long (Figure 28). PR0221 is believed
to have a transmembrane region
at amino acids 206-225. Clone DNA33089-1132 has been deposited with ATCC and
is assigned ATCC deposit
no. ATCC 209262.
Analysis of the amino acid sequence of the full-length PR0221 shows it has
homology to member of
the leucine rich repeat protein superfamily, including the SLIT protein.
(c) PR0227
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence is designated herein as
DNA28740. Based on the
DNA28740 consensus sequence, oligonucleotides were synthesized to identify by
PCR a cDNA library that
contained the sequence of interest and for use as probes to isolate a clone of
the full-length coding sequence for
PR0227.
A pair of PCR primers (fotwvard and reverse) were synthesized:
forward PCR primer 5'-AGCAACCGCCTGAAGCTCATCC-3' (SEQ ID N0:80)
reverse PCR primer S'-AAGGCGCGGTGAAAGATGTAGACG-3' (SEQ ID N0:81)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA28740
sequence which had the following nucleotide sequence:
hybridization probe
5'GACTACATGTTTCAGGACCTGTACAACCTCAAGTCACTGGAGGTTGGCGA-3' (SEQ ID N0:82).
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0227 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue. DNA
139
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
sequencing of the clones isolated as described above gave the full-length DNA
sequence for PR0227 [herein
designated as DNA33786-1132 and the derived protein sequence for PR0227.
The entire nucleotide sequence of DNA33786-1132 is shown in Figure 29 (SEQ ID
N0:72). Clone
DNA33786-1132 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 33-35 and ending at the stop codon at nucleotide positions 1893-1895
(Figure 29). The predicted
polypeptide precursor is 620 amino acids long (Figure 30). PR0227 is believed
to have a transmembrane
region. Clone DNA33786-1132 has been deposited with ATCC and is assigned ATCC
deposit no. ATCC
209253.
Analysis of the amino acid sequence of the full-length PR0221 shows it has
homology to member of
the leucine rich repeat protein superfamily, including the platelet
glycoprotein V precursor and the human
glycoprotein V.
EXAMPLE 13: Isolation of cDNA Clones Encoding Human PR0258
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA28746.
Based on the DNA28746 consensus sequence, oligonucleotides were synthesized:
1) to identify by PCR
a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the full-
length coding sequence for PR0258.
PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-GCTAGGAATTCCACAGAAGCCC-3' (SEQ ID N0:85)
reverse PCR primer 5'-AACCTGGAATGTCACCGAGCTG-3' (SEQ ID N0:86)
reverse PCR primer 5'-CCTAGCACAGTGACGAGGGACTTGGC-3' (SEQ ID N0:87)
Additionally, synthetic oligonucleotide hybridization probes were constructed
from the consensus DNA28740
sequence which had the following nucleotide sequence:
hybridization probe
5'-AAGACACAGCCACCCTAAACTGTCAGTCTTCTGGGAGCAAGCCTGCAGCC-3' (SEQ ID N0:88)
5'-GCCCTGGCAGACGAGGGCGAGTACACCTGCTCAATCTTCACTATGCCTGT-3' (SEQ ID N0:89)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0258 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue. DNA
sequencing of the clones isolated as described above gave the full-length DNA
sequence for PR0258 [herein
designated as DNA35918-1174] (SEQ ID N0:83) and the derived protein sequence
for PR0258.
The entire nucleotide sequence of DNA35918-1174 is shown in Figure 31 (SEQ ID
N0:83). Clone
DNA35918-1174 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 147-149 of SEQ ID N0:83 and ending at the stop codon after
nucleotide position 1340 of SEQ ID
N0:83 (Figure 31). The predicted polypeptide precursor is 398 amino acids long
(Figure 32). Clone
DNA35918-1174 has been deposited with ATCC and is assigned ATCC deposit no.
ATCC 209402.
140
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Analysis of the amino acid sequence of the full-length PR0258 polypeptide
suggests that portions of
it possess significant homology to the CRTAM and the poliovirus receptor and
have an Ig domain, thereby
indicating that PR0258 is a new member of the lg superfamily.
EXAMPLE 14: Isolation of cDNA Clones Encodin~e Human PR0266
S An expressed sequence tag database was searched for ESTs having homology to
SLIT, resulting in the
identification of a single EST sequence designated herein as T73996. Based on
the T73996 EST sequence,
oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that
contained the sequence of interest,
and 2) for use as probes to isolate a clone of the full-length coding sequence
for PR0266.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-GTTGGATCTGGGCAACAATAAC-3' (SEQ ID N0:92)
reverse PCR primer 5'-ATTGTTGTGCAGGCTGAGTTTAAG-3' (SEQ ID N0:93)
Additionally, a synthetic oligonucleotide'fiybridization probe was constructed
which had the following nucleotide
sequence
hybridization probe
5'-GGTGGCTATACATGGATAGCAATTACCTGGACACGCTGTCCCGGG-3' (SEQ ID N0:94)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0266 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal brain
tissue. DNA
sequencing of the clones isolated as described above gave the full-length DNA
sequence for PR0266 [herein
designated as DNA37150-1178] (SEQ ID N0:90) and the derived protein sequence
for PR0266.
The entire nucleotide sequence of DNA37150-1178 is shown in Figure 33 (SEQ ID
N0:90). Clone
DNA37150-1178 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 167-169 and ending at the stop codon after nucleotide position 2254
of SEQ ID N0:90. The predicted
polypeptide precursor is 696 amino acids long (Figure 34). Clone DNA37150-1178
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209401.
Analysis of the amino acid sequence of the full-length PR0266 polypeptide
suggests that portions of
it possess significant homology to the SLIT protein, thereby indicating that
PR0266 may be a novel leucine rich
repeat protein.
EXAMPLE 15: Isolation of cDNA Clones Encoding Human PR0269
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA35705.
Based on the DNA35705
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0269.
Forward and reverse PCR primers were synthesized:
141
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
forward PCR primer (.fl) 5'-TGGAAGGAGATGCGATGCCACCTG -3'
(SEQ ID N0:97)
forward PCRprimer (.f2) 5'-TGACCAGTGGGGAAGGACAG-3' (SEQ ID N0:98)
forward PCR primer (.f3) 5'-ACAGAGCAGAGGGTGCCTTG-3' (SEQ ID N0:99)
reverse PCR primer (.rl) 5'-TCAGGGACAAGTGGTGTCTCTCCC-3'
(SEQ ID NO:100)
reverse PCR primer (.r2) 5'-TCAGGGAAGGAGTGTGCAGTTCTG-3'
(SEQ ID NO:101)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35705
sequence which had the following nucleotide sequence:
hybridization probe
5'-ACAGCTCCCGATCTCAGTTACTTGCATCGCGGACGAAATCGGCGCTCGCT-3' (SEQ ID N0:102)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0269 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0269 [herein designated as DNA38260-1180] (SEQ ID N0:95) and the derived
protein sequence for
PR0269.
The entire nucleotide sequence of DNA38260-1180 is shown in Figure 35 (SEQ ID
N0:95). Clone
DNA38260-1180 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 314-316 and ending at the stop codon at nucleotide positions 1784-
1786 (Fig. 35; SEQ ID N0:95).
The predicted polypeptide precursor is 490 amino acids long (Fig. 36). Clone
DNA38260-1180 has been
deposited with ATCC and is assigned ATCC deposit no. ATCC 209397.
Analysis of the amino acid sequence of the full-length PR0269 suggests that
portions of it possess
significant homology to the human thrombomodulin proteins, thereby indicating
that PR0269 may possess one
or more thrombomodulin-like domains.
EXAMPLE 16: Isolation of cDNA Clones Encodine Human PR0287
A consensus DNA sequence encoding PR0287 was assembled relative to the other
identified EST
sequences as described in Example 1 above, wherein the consensus sequence is
designated herein as DNA28728.
Based on the DNA28728 consensus sequence, oligonucleotides were synthesized to
identify by PCR a cDNA
library that contained the sequence of interest and for use as probes to
isolate a clone of the full-length coding
sequence for PR0287.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-CCGATTCATAGACCTCGAGAGT-3' (SEQ ID NO:105)
reverse PCRprimer 5'-GTCAAGGAGTCCTCCACAATAC-3' (SEQ ID N0:106)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA28728
142
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
sequence which had the following nucleotide sequence
hybridization probe
5'-GTGTACAATGGCCATGCCAATGGCCAGCGCATTGGCCGCTTCTGT-3'
(SEQ ID N0:107)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0287 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isalated from human fetal
kidney tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0287 [herein designated as DNA39969-1185, SEQ ID N0:103] and the derived
protein sequence for
PR0287.
The entire nucleotide sequence of DNA39969-1185 is shown in Figure 37 (SEQ ID
N0:103). Clone
DNA39969-1185 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 307-309 and ending at the stop colon at nucleotide positions 1552-
1554 (Fig. 37; SEQ ID N0:103).
The predicted polypeptide precursor is 415 amino acids long (Fig. 38). Clone
DNA39969-1185 has been
deposited with ATCC and is assigned ATCC deposit no. ATCC 209400.
Analysis of the amino acid sequence of the full-length PR0287 suggests that it
may possess one or more
procollagen C-proteinase enhancer protein precursor or procollagen C-
proteinase enhancer protein-like domains.
Based on a BLAST and FastA sequence alignment analysis of the full-length
sequence, PR0287 shows nucleic
acid sequence identity to procollagen C-proteinase enhancer protein precursor
and procollagen C-proteinase
enhancer protein (47 and 54%, respectively).
EXAMPLE 17: Isolation of cDNA Clones Encodin~~ Human PR0214
A consensus DNA sequence was assembled using phrap as described in Example 1
above. This
consensus DNA sequence is designated herein as DNA28744. Based on this
consensus sequence,
oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that
contained the sequence of interest,
and 2) for use as probes to isolate a clone of the full-length coding
sequence.
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified below. A
positive library was then used to
isolate clones encoding the PR0214 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue.
A cDNA clone was sequenced in its entirety. The full length nucleotide
sequence of DNA32286-1191
is shown in Figure 39 (SEQ ID N0:108). DNA32286-1191 contains a single open
reading frame with an
apparent translational initiation site at nucleotide position 103 (Fig. 39;
SEQ ID N0:108). The predicted
polypeptide precursor is 420 amino acids long (SEQ ID N0:109).
Based on a BLAST and FastA sequence alignment analysis of the full-length
sequence, PR0214
polypeptide shows amino acid sequence identity to HT protein and/or Fibulin
(49% and 38%, respectively).
The oligonucleotide sequences used in the above procedure were the following:
143
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
28744.p (OLI555)
5'-CCTGGCTATCAGCAGGTGGGCTCCAAGTGTCTCGATGTGGATGAGTGTGA-3' (SEQ ID NO:110)
28744.f (OLI556)
5'-ATTCTGCGTGAACACTGAGGGC-3' (SEQ ID NO:111)
28744.r (OLI557)
5'-ATCTGCTTGTAGCCCTCGGCAC-3' (SEQ ID N0:112)
EXAMPLE 18: Isolation of cDNA Clones Encoding Human PR0317
A consensus DNA sequence was assembled using phrap as described in Example 1
above, wherein the
consensus sequence is herein designated as DNA28722. Based on this consensus
sequence, oligonucleotides
were synthesized: 1) to identify by PCR a cDNA .library that contained the
sequence of interest, and 2) for use
as probes to isolate a clone of the full-length coding sequence. The forward
and reverse PCR primers,
respectively, synthesized for this purpose were:
5'-AGGACTGCCATAACTTGCCTG (OLI489) (SEQ ID NO:115) and
5'-ATAGGAGTTGAAGCAGCGCTGC (OLI490) (SEQ ID N0:116).
The probe synthesized for this purpose was:
S'-TGTGTGGACATAGACGAGTGCCGCTACCGCTACTGCCAGCACCGC (OLI488) (SEQ ID N0:117)
mRNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification, as per Ausubel et al., Current Protocols in
Molecular Biology ( 1989), with the
PCR primer pair identified above. A positive library was then used to isolate
clones containing the PR0317 gene
using the probe oligonucleotide identified above and one of the PCR primers.
A cDNA clone was sequenced in its entirety. The entire nucleotide sequence of
DNA33461-1199
(encoding PR0317) is shown in Figure 41 (SEQ ID N0:113). Clone DNA33461-1199
contains a single open
reading frame with an apparent translational initiation site at nucleotide
positions 68-70 (Fig. 41; SEQ ID
N0:113). The predicted polypeptide precursor is 366 amino acids long. The
predicted signal sequence is amino
acids 1-18 of Figure 42 (SEQ ID N0:114). There is one predicted N-linked
glycosylation site at amino acid
residue 160. Clone DNA33461-1199 has been deposited with ATCC and is assigned
ATCC deposit no. ATCC
209367.
Based on BLASTT"' and FastATM sequence aligtunent analysis (using the ALIGNT"'
computer program)
of the full-length PR0317sequence, PR0317 shows the most amino acid sequence
identity to EBAF-1 (92%).
The results also demonstrate a significant homology between human PR0317 and
mouse LEFTY protein. The
C-terminal end of the PR0317 protein contains many conserved sequences
consistent with the pattern expected
of a member of the TGF- superfamily.
In situ expression analysis in human tissues performed as described below
evidences that there is
distinctly strong expression of the PR0317 polypeptide in pancreatic tissue.
144
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
EXAMPLE 19: Isolation of cDNA clones Encoding Human PR0301
A consensus DNA sequence designated herein as DNA35936 was assembled using
phrap as described
in Example 1 above. Based on this consensus sequence, oligonucleotides were
synthesized: 1) to identify by
PCR a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the
full-length coding sequence.
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified below. A
positive library was then used to
isolate clones encoding the PR0301 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney.
A cDNA clone was sequenced in its entirety. The full length nucleotide
sequence of native sequence
PR0301 is shown in Figure 43 (SEQ ID N0:118). Clone DNA40628-1216 contains a
single open reading frame
with an apparent translational initiation site at nucleotide positions 52-54
(Fig. 43; SEQ ID N0:118). The
predicted polypeptide precursor is 299 amino acids long with a predicted
molecular weight of 32,583 daltons and
pI of 8.29. Clone DNA40628-1216 has been deposited with ATCC and is assigned
ATCC deposit No. ATCC
209432.
Based on a BLAST and FastA sequence alignment analysis of the full-length
sequence, PR0301 shows
amino acid sequence identity to A33 antigen precursor (30%) and coxsackie and
adenovirus receptor protein
(29% ).
The oligonucleotide sequences used in the above procedure were the following:
OLI2162 (35936.f1) 5'-TCGCGGAGCTGTGTTCTGTTTCCC-3' (SEQ ID N0:120)
OLI2163 (35936.p1)
5'-TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT-3' (SEQ ID N0:121)
OLI2164 (35936.f2)
5'-ACACCTGGTTCAAAGATGGG-3' (SEQ ID N0:122)
OLI2165 (35936.r1)
5'-TAGGAAGAGTTGCTGAAGGCACGG-3' (SEQ ID N0:123)
OLI2166 (35936.f3)
5'-TTGCCTTACTCAGGTGCTAC-3' (SEQ ID N0:124)
OLI2167 (35936.r2)
5'-ACTCAGCAGTGGTAGGAAAG-3' (SEQ ID N0:125)
EXAMPLE 20: Isolation of cDNA Clones Encodin Human PR0224
A consensus DNA sequence assembled relative to the other identified EST
sequences as described in
Example 1, wherein the consensus sequence is designated herein as DNA30845.
Based on the DNA30845
consensus sequence, oligonucleotides were synthesized to identify by PCR a
cDNA library that contained the
sequence of interest and for use as probes to isolate a clone of the full-
length coding sequence for PR0224.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-AAGTTCCAGTGCCGCACCAGTGGC-3' (SEQ ID N0:128)
reverse PCR primer 5'-TTGGTTCCACAGCCGAGCTCGTCG-3' (SEQ ID N0:129)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30845
sequence which had the following nucleotide sequence
hybridization probe
145
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
5'-GAGGAGGAGTGCAGGATTGAGCCATGTACCCAGAAAGGGCAATGCCCACC-3' (SEQ ID N0:130)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0224 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0224 (herein designated as DNA33221-1133] and the derived protein sequence
for PR0224.
The entire nucleotide sequence of DNA33221-1133 is shown in Figure 45 (SEQ ID
N0:126). Clone
DNA33221-1133 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 33-35 and ending at the stop codon at nucleotide positions 879-899
(Figure 45; SEQ ID N0:126). The
start of a transmembrane region begins at nucleotide position 777. The
predicted polypeptide precursor is 282
amino acids long (Figure 46). Clone DNA33221-1133 has been deposited with ATCC
and is assigned ATCC
deposit no. ATCC 209263.
Analysis of the amino acid sequence of the full-length PR0224 suggests that it
has homology to very
low-density lipoprotein receptors, apolipoprotein E receptor and chicken
oocyte receptors P95. Based on a
BLAST and FastA sequence alignment analysis of the full-length sequence,
PR0224 has amino acid identity to
portions of these proteins in the range from 28 % to 45 % , and overall
identity with these proteins in the range
from 33 % to 39 % .
EXAMPLE 21: Isolation of cDNA Clones Encoding Human PR0222
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence is designated herein as
DNA28771. Based on the
DNA28771 consensus sequence, oligonucleotides were synthesized to identify by
PCR a cDNA library that
contained the sequence of interest and for use as probes to isolate a clone of
the full-length coding sequence for
PR0222.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-ATCTCCTATCGCTGCTTTCCCGG-3' (SEQ ID N0:133)
reverse PCR primer 5'-AGCCAGGATCGCAGTAAAACTCC-3' (SEQ ID N0:134)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA28771
sequence which had the following nucleotide sequence:
hybridization probe
5'-ATTTAAACTTGATGGGTCTGCGTATCTTGAGTGCTTACAAAACCTTATCT-3' (SEQ ID N0:135)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0222 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0222 [herein designated as DNA33107-1135] and the derived protein sequence
for PR0222.
146
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
The entire nucleotide sequence of DNA33107-1135 is shown in Figure 47 (SEQ ID
N0:131). Clone
DNA33107-1135 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 159-161 and ending at the stop codon at nucleotide positions 1629-
1631 (Fig. 47; SEQ ID N0:131).
The predicted polypeptide precursor is 490 amino acids long (Fig. 48). Clone
DNA33107-1135 has been
deposited with ATCC and is assigned ATCC deposit no. ATCC 209251.
Based on a BLAST and FastA sequence alignment analysis of the full-length
sequence, PR0222 shows
amino acid sequence identity to mouse complementfactorh precursor (25-26% ),
complement receptor (27-29%),
mouse complement C3b receptor type 2 long form precursor (25-47 %) and human
hypothetical protein kiaa0247
(40% ).
EXAMPLE 22: Isolation of cDNA clones Encoding PR0234
A consensus DNA sequence was assembled (DNA30926) using phrap as described in
Example 1 above.
Based on this consensus sequence, oligonucleotides were synthesized: 1 ) to
identify by PCR a cDNA library that
contained the sequence of interest, and 2) for use as probes to isolate a
clone of the full-length coding sequence.
RNA for the construction of the cDNA libraries was isolated using standard
isolation protocols, e.g.,
1 S Ausubel et al., Current Protocols in Molecular Biology, from tissue or
cell line sources or it was purchased from
commercial sources (e.g., Clontech). The cDNA libraries used to isolate the
cDNA clones were constructed
by standard methods (e.g., Ausubel et al. ) using commercially available
reagents (e.g., Invitrogen). This library
was derived from 22 week old fetal brain tissue.
A cDNA clone was sequenced in its entirety. The entire nucleotide sequence of
PR0234 is shown in
Figure 49 (SEQ ID N0:136). The predicted polypeptide precursor is 382 amino
acids long and has a calculated
molecular weight of approximately 43.1 kDa.
The oligonucleotide sequences used in the above procedure were the following:
30926.p (OLI826) (SEQ ID N0:138): 5'-GTTCATTGAAAACCTCTTGCCATCT
GATGGTGACTTCTGGATTGGGCTCA-3'
30926.f (OLI827) (SEQ ID N0:139): 5'-AAGCCAAAGAAGCCTGCAGGAGGG-3'
30926.r (OLI828) (SEQ ID N0:140): 5'-CAGTCCAAGCATAAAGGTCCTGGC-3'
EXAMPLE 23: Isolation of cDNA Clones Encodine Human PR0231
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence was designated herein as
DNA30933. Based on the
DNA30933 consensus sequence, oligonucleotides were synthesized to identify by
PCR a cDNA library that
contained the sequence of interest and for use as probes to isolate a clone of
the full-length coding sequence for
PR0231.
Three PCR primers (two forward and one reverse) were synthesized:
forward PCR primer 1 5'-CCAACTACCAAAGCTGCTGGAGCC-3' (SEQ ID N0:143)
forward PCR primer 2 5'-GCAGCTCTATTACCACGGGAAGGA-3' (SEQ ID N0:144)
reverse PCR yrimer 5'-TCCTTCCCGTGGTAATAGAGCTGC-3' (SEQ ID N0:145)
147
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30933
sequence which had the following nucleotide sequence
~bridization probe
5'-GGCAGAGAACCAGAGGCCGGAGGAGACTGCCTCTTTACAGCCAGG-3' (SEQ ID N0:146)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0231 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0231 (herein designated as DNA34434-1139] and the derived protein sequence
for PR0231.
The entire nucleotide sequence of DNA34434-1139 is shown in Figure Si (SEQ ID
N0:141). Clone
DNA34434-1139 contains a single open reading frame with an apparent
translationai initiation site at nucleotide
positions 173-175 and ending at the stop codon at nucleotide positions 1457-
1459 (Fig. 51; SEQ ID N0:141).
The predicted polypeptide precursor is 428 amino acids long (Fig. 52). Clone
DNA34434-1139 has been
deposited with ATCC on September 16, 1997 and is assigned ATCC deposit no.
ATCC 209252.
Analysis of the amino acid sequence of the full-length PR0231 suggests that it
possesses 30% and 31 %
amino acid identity with the human and rat prostatic acid phosphatase
precursor proteins, respectively.
EXAMPLE 24: Isolation of cDNA Clones Encoding Human PR0229
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA28762.
Based on the DNA28762
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0229.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer S'-TTCAGCTCATCACCTTCACCTGCC-3' (SEQ ID N0:149)
reverse PCR primer 5'-GGCTCATACAAAATACCACTAGGG-3' (SEQ ID NO:150)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA28762
sequence which had the following nucleotide sequence
hybridization probe
5'-GGGCCTCCACCGCTGTGAAGGGCGGGTGGAGGTGGAACAGAAAGGCCAGT-3' (SEQ ID NO:151)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0229 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0229 [herein designated as DNA33100-1159] (SEQ ID N0:147) and the derived
protein sequence for
PR0229.
148
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
The entire nucleotide sequence of DNA33100-1159 is shown in Figure 53 (SEQ ID
N0:147). Clone
DNA33100-1159 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 98-100 and ending at the stop codon at nucleotide positions 1139-
1141 (Figure 53). The predicted
polypeptide precursor is 347 amino acids long (Figure 54). Clone DNA33100-1159
has been deposited with
ATCC and is assigned ATCC deposit no.ATCC 209377
Analysis of the amino acid sequence of the full-length PR0229 polypeptide
suggests that portions of
it possess significant homology to antigen wcl.l, M130 antigen and CD6.
EXAMPLE 25: Isolation of cDNA Clones Encodin~2 Human PR0238
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
above in Example l . This consensus sequence is herein designated DNA30908.
Based on the DNA30908
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0238.
PCR primers (forward and reverse) were synthesized:
forward PCR primer 1 5'-GGTGCTAAACTGGTGCTCTGTGGC-3' (SEQ ID N0:154)
forward PCR primer 2 5'-CAGGGCAAGATGAGCATTCC-3' (SEQ ID NO:155)
reverse PCR primer 5'-TCATACTGTTCCATCTCGGCACGC-3' (SEQ ID N0:156)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30908
sequence which had the following nucleotide sequence
hvbridization~robe
5'-AATGGTGGGGCCCTAGAAGAGCTCATCAGAGAACTCACCGCTTCTCATGC-3' (SEQ ID N0:157)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0238 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0238 and the derived protein sequence for PR0238.
The entire nucleotide sequence of DNA35600-1162 is shown in Figure 55 (SEQ ID
N0:152). Clone
DNA35600-1162 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 134-136 and ending prior to the stop codon at nucleotide positions
1064-1066 (Figure 55). The
predicted polypeptide precursor is 310 amino acids long (Figure 56). Clone
DNA35600-1162 has-been deposited
with ATCC and is assigned ATCC deposit no. ATCC 209370.
Analysis of the amino acid sequence of the full-length PR0238 polypeptide
suggests that portions of
it possess significant homology to reductase, particularly oxidoreductase,
thereby indicating that PR0238 may
be a novel reductase.
149
CA 02343577 2001-03-16
WO 00115796 PCT/US99/21090
EXAMPLE 26: Isolation of cDNA Clones Encoding Human PR0233
The extracellular domain (ECD) sequences (including the secretion signal, if
any) of from about 950
known secreted proteins from the Swiss-Prot public protein database were used
to search expressed sequence
tag (EST) databases. The EST databases included public EST databases (e.g.,
GenBank) and a proprietary EST
DNA database (LIFESEQT"', Incyte Pharmaceuticals, Palo Alto, CA). The search
was performed using the
computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymoloev
266:460-480 (1996)) as a
comparison of the ECD protein sequences to a 6 frame translation of the EST
sequence. Those comparisons
resulting in a BLAST score of 70 (or in some cases 90) or greater that did not
encode known proteins were
clustered and assembled into consensus DNA sequences with the program "phrap"
(Phil Green, University of
Washington, Seattle, Washington;
http://bozeman.mbt.washington.edu/phrap.docs/phrap.html).
An expressed sequence tag (EST) was identified by the EST database search and
a consensus DNA
sequence was assembled relative to other EST sequences using phrap. This
consensus sequence is herein
designated DNA30945. Based on the DNA30945 consensus sequence,
oligonucleotides were synthesized: 1)
to identify by PCR a cDNA library that contained the sequence of interest, and
2) for use as probes to isolate
a clone of the full-length coding sequence for PR0233.
Forward and reverse PCR primers were synthesized:
forward PCR primer 5'-GGTGAAGGCAGAAATTGGAGATG-3' (SEQ ID N0:160)
reverse PCR primer 5'-ATCCCATGCATCAGCCTGTTTACC-3' (SEQ ID N0:161)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30945
sequence which had the following nucleotide sequence
hybridization probe
5'-GCTGGTGTAGTCTATACATCAGATTTGTTTGCTACACAAGATCCTCAG-3'
(SEQ ID N0:162)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0233 gene using the probe oligonucleotide.
RNA for construction of the cDNA libraries was isolated from human fetal brain
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0233 [herein designated as DNA34436-1238] (SEQ ID N0:158) and the derived
protein sequence for
PR0233.
The entire nucleotide sequence of DNA34436-1238 is shown in Figure 57 (SEQ ID
N0:158). Clone
DNA34436-1238 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 101-103 and ending at the stop codon at nucleotide positions 1001-
1003 (Figure 57). The predicted
polypeptide precursor is 300 amino acids long (Figure 58). The full-length
PR0233 protein shown in Figure
58 has an estimated molecular weight of about 32,964 daltons and a pI of about
9.52. Clone DNA34436-1238
has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209523.
Analysis of the amino acid sequence of the full-length PR0233 polypeptide
suggests that portions of
it possess significant homology to reductase proteins, thereby indicating that
PR0233 may be a novel reductase.
150
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
EXAMPLE 27: Isolation of cDNA Clones Encodin~e Human PR0223
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA30836.
Based on the DNA30836
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0223.
PCR primer pairs (one forward and two reverse) were synthesized:
forward PCR~rimer 5'-TTCCATGCCACCTAAGGGAGACTC-3' (SEQ ID N0:165)
reverse PCR primer 1 5'-TGGATGAGGTGTGCAATGGCTGGC-3' (SEQ ID N0:166)
reverse PCR primer 2 5'-AGCTCTCAGAGGCTGGTCATAGGG-3' (SEQ ID N0:167)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30836
sequence which had the following nucleotide sequence
hybridization probe
5'-GTCGGCCCTTTCCCAGGACTGAACATGAAGAGTTATGCCGGCTTCCTCAC-3' (SEQ ID N0:168)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0223 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0223 [herein designated as DNA33206-1165] (SEQ ID N0:163) and the derived
protein sequence for
PR0223.
The entire nucleotide sequence of DNA33206-1165 is shown in Figure 59 (SEQ ID
N0:163). Clone
DNA33206-1165 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 97-99 and ending at the stop codon at nucleotide positions 1525-1527
(Figure 59). The predicted
polypeptide precursor is 476 amino acids long (Figure 60). Clone DNA33206-1165
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209372.
Analysis of the amino acid sequence of the full-length PR0223 polypeptide
suggests that it possesses
significant homology to various serine carboxypeptidase proteins, thereby
indicating that PR0223 may be a novel
serine carboxypeptidase.
EXAMPLE 28: Isolation of cDNA Clones Encoding Human PR0235
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated "DNA30927".
Based on the DNA30927
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0235.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-TGGAATACCGCCTCCTGCAG-3' (SEQ ID N0:171)
151
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
reverse PCR primer 5'-CTTCTGCCCTTTGGAGAAGATGGC-3' (SEQ ID N0:172)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30927
sequence which had the following nucleotide sequence
hybridization probe
5'-GGACTCACTGGCCCAGGCCTTCAATATCACCAGCCAGGACGAT-3' (SEQ ID N0:173)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0235 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0235 [herein designated as DNA35558-1167] (SEQ ID N0:169) and the derived
protein sequence for
PR0235.
The entire nucleotide sequence of DNA35558-1167 is shown in Figure 61 (SEQ ID
N0:169). Clone
DNA35558-1167 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 667-669 and ending at the stop codon at nucleotide positions 2323-
2325 (Figure 61). The predicted
polypeptide precursor is 552 amino acids long (Figure 62). Clone DNA35558-1167
has been deposited with
ATCC and is assigned ATCC deposit no. 209374.
Analysis of the amino acid sequence of the full-length PR0235 polypeptide
suggests that portions of
it possess significant homology to the human, mouse and Xenopus plexin
protein, thereby indicating that PR0235
may be a novel plexin protein.
EXAMPLE 29: Isolation of cDNA Clones Encodine Human PR0236 and Human PR0262
Consensus DNA sequences were assembled relative to other EST sequences using
phrap as described
in Example 1 above. These consensus sequences are herein designated DNA30901
and DNA30847. Based on
the DNA30901 and DNA30847 consensus sequences, oligonucleotides were
synthesized: 1) to identify by PCR
a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the full-
length coding sequence for PR0236 and PR0262, respectively.
Based upon the DNA30901 consensus sequence, a pair of PCR primers (forward and
reverse) were
synthesized:
forward PCR primer 5'-TGGCTACTCCAAGACCCTGGCATG-3' (SEQ ID N0:178)
reverse PCR primer 5'-TGGACAAATCCCCTTGCTCAGCCC-3' (SEQ ID N0:179)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30901
sequence which had the following nucleotide sequence
hybridization probe
5'-GGGCTTCACCGAAGCAGTGGACCTTTATTTTGACCACCTGATGTCCAGGG-3' (SEQ ID N0:180)
Based upon the DNA30847 consensus sequence, a pair of PCR primers (forward and
reverse) were
synthesized:
forward PCRprimer 5'-CCAGCTATGACTATGATGCACC-3' (SEQ ID N0:181)
152
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
reverse PCR primer 5'-TGGCACCCAGAATGGTGTTGGCTC-3' (SEQ ID N0:182)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30847
sequence which had the following nucleotide sequence
h~rbridization probe
5'-CGAGATGTCATCAGCAAGTTCCAGGAAGTTCCTTTGGGACCTTTACCTCC-3' (SEQ ID N0:183}
In order to screen several libraries for a source of full-length clones, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above.
Positive libraries were then used
to isolate clones encoding the PR0236 and PR0262 genes using the probe
oligonucleotides and one of the PCR
primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue for PR0236 and
human fetal liver tissue for PR0262
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0236 [herein designated as DNA35599-I 168] (SEQ ID N0:174), the derived
protein sequence for PR0236,
the full-length DNA sequence for PR0262 [herein designated as DNA36992-1168]
(SEQ ID N0:176) and the
derived protein sequence for PR0262. ,
The entire nucleotide sequence of DNA35599-1168 is shown in Figure 63 (SEQ ID
N0:174). Clone
DNA35599-1168 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 69-71 and ending at the stop codon at nucleotide positions 1977-1979
(Figure 63). The predicted
polypeptide precursor is 636 amino acids long (Figure 64). Clone DNA35599-1168
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209373.
The entire nucleotide sequence of DNA36992-1168 is shown in Figure 65 (SEQ ID
N0:176). Clone
DNA36992-I 168 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 240-242 and ending at the stop codon at nucleotide positions 2202-
2204 (Figure 65). The predicted
polypeptide precursor is 654 amino acids long (Figure 66). Clone DNA36992-1168
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209382.
Analysis of the amino acid sequence of the full-length PR0236 and PR0262
polypeptides suggests that
portions of those polypeptides possess significant homology to (3-
galactosidase proteins derived from various
sources, thereby indicating that PR0236 and PR0262 may be novel p-
galactosidase homologs.
EXAMPLE 30: Isolation of cDNA Clones Encodins Human PR0239
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA30909.
Based on the DNA30909
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0239.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-CCTCCCTCTATTACCCATGTC-3' (SEQ ID N0:186)
reverse PCR primer 5'-GACCAACTTTCTCTGGGAGTGAGG-3' (SEQ ID N0:187)
153
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30909
sequence which had the following nucleotide sequence
hybridization probe
5'-GTCACTTTATTTCTCTAACAACAAGCTCGAATCCTTACCAGTGGCAG-3'
(SEQ ID N0:188)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0239 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0239 [herein designated as DNA34407-1169] (SEQ ID N0:184) and the derived
protein sequence for
PR0239.
The entire nucleotide sequence of DNA34407-1169 is shown in Figure 67 (SEQ ID
N0:184). Clone
DNA34407-1169 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 72-74 and ending at the stop codon at nucleotide positions 1575-1577
(Figure 67). The predicted
polypeptide precursor is 501 amino acids long (Figure 68). Clone DNA34407-1169
has been deposited with
ATCC and is assigned ATCC deposit no.ATCC 209383.
Analysis of the amino acid sequence of the full-length PR0239 polypeptide
suggests that portions of
it possess significant homology to the densin protein, thereby indicating that
PR0239 may be a novel molecule
in the densin family.
EXAMPLE 31: Isolation of cDNA Clones Encodine Human PR0257
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA28?31.
Based on the DNA28731
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0257.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer S'-TCTCTATTCCAAACTGTGGCG-3' (SEQ ID N0:191)
reverse PCR primer S'-TTTGATGACGATTCGAAGGTGG-3' (SEQ ID N0:192)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA28731
sequence which had the following nucleotide sequence
hybridization probe
5'-GGAAGGATCCTTCACCAGCCCCAATTACCCAAAGCCGCATCCTGAGC-3' (SEQ ID N0:193)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0257 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
154
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0257 [herein designated as DNA35841-1173 (SEQ ID N0:189) and the derived
protein sequence for
PR0257.
The entire nucleotide sequence of DNA35841-1173 is shown in Figure 69 (SEQ ID
N0:189). Clone
DNA35841-1173 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 964-966 and ending at the stop colon at nucleotide positions 2785-
2787 (Figure 69). The predicted
polypeptide precursor is 607 amino acids long (Figure 70). Clone DNA35841-1173
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209403.
Analysis of the amino acid sequence of the full-length PR0257 polypeptide
suggests that portions of
it possess significant homology to the ebnerin protein, thereby indicating
that PR02S7 may be a novel protein
member related to the ebnerin protein.
EXAMPLE 32: Isolation of cDNA Clones Encoding Human PR0260
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA30834.
Based on the DNA30834
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0260.
PCR primers (forward and two reverse) were synthesized:
forward PCR primer: 5'-TGGTTTGACCAGGCCAAGTTCGG-3' (SEQ ID N0:196);
reverse PCR primer A: S'-GGATTCATCCTCAAGGAAGAGCGG-3' (SEQ ID N0:197); and
reverse PCR erimer B: 5'AACTTGCAGCATCAGCCACTCTGC-3' (SEQ ID N0:198)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30834
sequence which had the following nucleotide sequence:
hybridization~robe:
5'-TTCCGTGCCCAGCTTCGGTAGCGAGTGGTTCTGGTGGTATTGGCA-3' (SEQ ID N0:199)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0260 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0260 [herein designated as DNA33470-1175] (SEQ ID N0:194) and the derived
protein. sequence for
PR0260.
The entire nucleotide sequence of DNA33470-1175 is shown in Figure 7I (SEQ ID
N0:194). Clone
DNA33470-1175 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 67-69 and ending at the stop colon 1468-1470 (see Figure 71). The
predicted polypeptide precursor
is 467 amino acids long (Figure 72). Clone DNA33470-1175 has been deposited
with ATCC and is assigned
ATCC deposit no. ATCC 209398.
155
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Analysis of the amino acid sequence of the full-length PR0260 polypeptide
suggests that portions of
it possess significant homology to the alpha-I-fucosidase precursor, thereby
indicating that PR0260 may be a
novel fucosidase.
EXAMPLE 33: Isolation of cDNA Clones Encoding Human PR0263
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA30914.
Based on the DNA30914
consensus sequence, oligonucleotides were synthesized: l) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0263.
PCR primers (tow forward and one reverse) were synthesized:
forward PCR primer 1: 5'-GAGCTTTCCATCCAGGTGTCATGC-3' (SEQ ID N0:202);
forward PCR primer 2: 5'-GTCAGTGACAGTACCTACTCGG-3' (SEQ ID N0:203); reverse
PCR primer:
5'-TGGAGCAGGAGGAGTAGTAGTAGG-3' (SEQ ID N0:204)
Additionally, a synthetic oiigonucleotide hybridization probe was constructed
from the consensus DNA30914
sequence which had the following nucleotide sequence:
hybridization probe:
5'-AGGAGGCCTGTAGGCTGCTGGGACTAAGTTTGGCCGGCAAGGACCAAGTT-3' (SEQ ID N0:205)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0263 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0263 [herein designated as DNA34431-1177] (SEQ ID N0:200) and the derived
protein sequence for
PR0263.
The entire nucleotide sequence of DNA34431-1177 is shown in Figure 73 (SEQ ID
N0:200). Clone
DNA34431-1177 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 160-162 of SEQ ID N0:200 and ending at the stop codon after the
nucleotide at position 1126-1128
of SEQ ID N0:200 (Figure 73). The predicted polypeptide precursor is 322 amino
acids long (Figure 74).
Clone DNA34431-1177 has been deposited with ATCC and is assigned ATCC deposit
no. ATCC 209399.
Analysis of the amino acid sequence of the full-length PR0263 polypeptide
suggests that portions of
it possess significant homology to CD44 antigen, thereby indicating that
PR0263 may be a novel cell surface
adhesion molecule.
EXAMPLE 34: Isolation of cDNA Clones Encoding Human PR0270
A consensus DNA sequence was assembled relative to the other identified EST
sequences as described
in Example 1 above, wherein the consensus sequence was designated herein as
DNA35712. Based on the
DNA35712 consensus sequence, oligonucleotides were synthesized: 1) to identify
by PCR a cDNA library that
156
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
contained the sequence of interest, and 2) for use as probes to isolate a
clone of the full-length coding sequence
for PR0270. Forward and reverse PCR primers were synthesized:
forward PCR primer (.fl) S'-GCTTGGATATTCGCATGGGCCTAC-3' (SEQ ID N0:208)
forward PCR primer (.fZ) 5'-TGGAGACAATATCCCTGAGG-3' (SEQ ID N0:209)
reverse PCR primer (.rl) 5'-AACAGTTGGCCACAGCATGGCAGG-3' (SEQ ID N0:210)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35712
sequence which had the following nucleotide sequence
hybridization probe
5'-CCATTGATGAGGAACTAGAACGGGACAAGAGGGTCACTTGGATTGTGGAG-3'
(SEQ ID N0:211)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0270 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0270 [herein designated as DNA39510-1181] (SEQ ID N0:206) and the derived
protein sequence for
PR0270.
The entire nucleotide sequence of DNA39510-1181 is shown in Figure 75 (SEQ ID
N0:206). Clone
DNA39510-1181 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 3-5 and ending at the stop codon at nucleotide positions 891-893
(Fig. 75; SEQ ID N0:206). The
predicted polypeptide precursor is 296 amino acids long (Fig. 76). Clone
DNA39510-1181 has been deposited
with ATCC and is assigned ATCC deposit no. ATCC 209392.
Analysis of the amino acid sequence of the full-length PR0270 suggests that
portions of it possess
significant homology to the thioredoxin-protein, thereby indicating that the
PR0270 protein may be a novel
member of the thioredoxin family.
EXAMPLE 35: Isolation of cDNA Clones Encodin Human PR0271
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA35737.
Based on the DNA35737
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0271.
Forward and reverse PCR primers were synthesized:
forward PCR primer 1 5'-TGCTTCGCTACTGCCCTC-3'(SEQ ID
N0:214)
forward PCR primer 2 5'-TTCCCTTGTGGGTTGGAG-3'(SEQ ID
N0:215)
forward PCR primer 3 5'-AGGGCTGGAAGCCAGTTC-3'(SEQ ID
N0:216)
reverse PCR primer 1 5'-AGCCAGTGAGGAAATGCG-3'(SEQ ID
N0:217)
reverse PCR-primer 2 5'-TGTCCAAAGTACACACACCTGAGG-3' (SEQ ID N0:218)
157
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35737
sequence which had the following nucleotide sequence
hybridizationprobe
S'-GATGCCACGATCGCCAAGGTGGGACAGCTCTTTGCCGCCTGGAAG-3' (SEQ ID N0:219)
In order to screen several libraries for a source of a full-length clone, ANA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0271 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal brain
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0271 [herein designated as DNA39423-1182] (SEQ ID N0:212) and the derived
protein sequence for
PR0271.
The entire nucleotide sequence of DNA39423-1182 is shown in Figure 77 (SEQ 1D
N0:212). Clone
DNA39423-1182 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 101-103 and ending at the stop codon at nucleotide positions 1181-
1183 (Figure 77). The predicted
polypeptide precursor is 360 amino acids long (Figure 78). Clone DNA39423-1182
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209387.
Analysis of the amino acid sequence of the full-length PR0271 polypeptide
suggests that it possess
significant homology to the proteoglycan link protein, thereby indicating that
PR0271 may be a link protein
homolog.
EXAMPLE 36: Isolation of cDNA Clones Encoding Human PR0272
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA36460.
Based on the DNA36460
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0272.
Forward and reverse PCR primers were synthesized:
forward PCR primer (.fl) 5'-CGCAGGCCCTCATGGCCAGG-3' (SEQ ID N0:222)
forward PCR primer (.f2) 5'-GAAATCCTGGGTAATTGG-3' (SEQ ID N0:223)
reverse PCR primer 5'-GTGCGCGGTGCTCACAGCTCATC-3' (SEQ ID N0:224)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA36460
sequence which had the following nucleotide sequence
hvbridization probe
5'-CCCCCCTGAGCGACGCTCCCCCATGATGACGCCCACGGGAACTTC-3' (SEQ ID N0:225)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0272 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue.
158
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0272 [herein designated as DNA40620-1183] (SEQ ID N0:220) and the derived
protein sequence for
PR0272.
The entire nucleotide sequence of DNA40620-1183 is shown in Figure 79 (SEQ ID
N0:220). Clone
DNA40620-1183 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 35-37 and ending at the stop codon at nucleotide positions 1019-1021
(Figure 79). The predicted
polypeptide precursor is 328 amino acids long (Figure 80). Clone DNA40620-1183
has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209388.
Analysis of the amino acid sequence of the full-length PR0272 polypeptide
suggests that portions of
it possess significant homology to the human and mouse reticulocalbin
proteins, respectively, thereby indicating
that PR0272 may be a novel reticulocalbin protein.
EXAMPLE 37: Isolation of cDNA Clones Encodin~Human PR0294
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA35731.
Based on the DNA35731
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0294.
Forward
and reverse
PCR primers
were synthesized:
forward primer (.fl)S'-TGGTCTCGCACACCGATC-3'
PCR (SEQ ID N0:228)
forward primer (.f2)5'-CTGCTGTCCACAGGGGAG-3'
PCR (SEQ ID N0:229)
forward primer (.f3)5'-CCTTGAAGCATACTGCTC-3'
PCR (SEQ ID N0:230)
forward primer (.f4)5'-GAGATAGCAATTTCCGCC-3'(SEQ ID N0:231)
PCR
reverse rimer (.rl)5'-TTCCTCAAGAGGGCAGCC-3'(SEQ ID N0:232)
PCR p
reverse PCR primer (.r2) 5'-CTTGGCACCAATGTCCGAGATTTC-3'
(SEQ ID N0:233)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35731
sequence which had the following nucleotide sequence
hybridization grobe
5'-GCTCTGAGGAAGGTGACGCGCGGGGCCTCCGAACCCTTGGCCTTG-3'
(SEQ ID N0:234)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0294 gene using the probe oiigonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal brain
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0294 [herein designated as DNA40604-1187] (SEQ ID N0:226) and the derived
protein sequence for
PR0294.
159
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
The entire nucleotide sequence of DNA40604-1187 is shown in Figure 81 (SEQ 1D
N0:226). Clone
DNA40604-1187 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 396-398 and ending at the stop codon at nucleotide positions 2046-
2048 (Figure 81). The predicted
polypeptide precursor is 550 amino acids long (Figure 82). Clone DNA40604-1187
has been deposited with
ATCC and is assigned ATCC deposit no. 209394.
Analysis of the amino acid sequence of the full-length PR0294 poiypeptide
suggests that portions of
it possess significant homology to portions of various collagen proteins,
thereby indicating that PR0294 may
be collagen-like molecule.
EXAMPLE 38: Isolation of cDNA Clones Encoding Human PR0295
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA35814.
Based on the DNA35814
consensus sequence, oligonucleotides were synthesized: I) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0295.
Forward and reverse PCR primers were synthesized:
forward PCR primer (.fl) 5'-GCAGAGCGGAGATGCAGCGGCTTG-3'
(SEQ ID N0:238)
forward PCR primer (.f2) 5'-CCCAGCATGTACTGCCAG-3' (SEQ ID N0:239)
forward PCR primer (.f3) 5'-TTGGCAGCTTCATGGAGG-3' (SEQ ID N0:240)
forward PCR primer (.f4) 5'-CCTGGGCAAAAATGCAAC-3' (SEQ ID N0:241)
reverse PCR primer (.rl) 5'-CTCCAGCTCCTGGCGCACCTCCTC-3' (SEQ ID N0:242)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35814
sequence which had the foilowing nucleotide sequence
hybridization probe
5'-GGCTCTCAGCTACCGCGCAGGAGCGAGGCCACCCTCAATGAGATG-3'
(SEQ ID N0:243)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0295 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0295 [herein designated as DNA38268-1188] (SEQ ID N0:235) and the derived
protein sequence for
PR0295.
The entire nucleotide sequence of DNA38268-1188 is shown in Figure 83 (SEQ ID
N0:235). Clone
DNA38268-I 188 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 153-155 and ending at the stop codon at nucleotide positions 1202-
1204 (Figure 83). The predicted
polypeptide precursor is 350 amino acids long (Figure 84). Clone DNA38268-1188
has been deposited with
160
CA 02343577 2001-03-16
WO 00/15796
ATCC and is assigned ATCC deposit no. 209421.
PCT/US99/21090
Analysis of the amino acid sequence of the full-length PR0295 polypeptide
suggests that portions of
it possess significant homology to the integrin proteins, thereby indicating
that PR0295 may be a novel integrin.
EXAMPLE 39: Isolation of cDNA Clones Encodine Human PR0293
The extracellular domain (ECD) sequences (including the secretion signal, if
any) of from about 950
known secreted proteins from the Swiss-Prot public protein database were used
to search expressed sequence
tag (EST) databases. The EST databases included public EST databases (e.g. ,
GenBank) and a proprietary EST
DNA database (LIFESEQT"', Incyte Pharmaceuticals, Palo Alto, CA). The search
was performed using the
computer program BLAST or BLAST2 (Altshul et aL, Methods in Et>_zvmolOEV
266:460-480 (1996)) as a
comparison of the ECD protein sequences to a 6. frame translation of the EST
sequence. Those comparisons
resulting in a BLAST score of 70 (or in some cases 90) or greater that did not
encode known proteins were
clustered and assembled into consensus DNA sequences with the program "phrap"
(Phil Green, University of
Washington, Seattle, Washington;
http://bozeman.mbt.washington.edu/phrap.docs/phrap.html).
Based on an expression tag sequence designated herein as T08294 identified in
the above analysis,
oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that
contained the sequence of interest,
and 2) for use as probes to isolate a clone of the full-length coding sequence
for PR0293.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR~rimer 5'-AACAAGGTAAGATC'~CCA'rrrTr;_z~ icFn m ,,r~,..,.~,
reverse PCR primer 5'-AAACTTGTCGATGGAGACCAGCTC-3' (SEQ ID N0:247)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the expression sequence tag
which had the following nucleotide sequence
hybridization probe
5'-AGGGGCTGCAAAGCCTGGAGAGCCTCTCCTTCTATGACAACCAGC-3' (SEQ ID N0:248)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0293 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal brain
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0293 [herein designated as DNA37151-1193] (SEQ ID N0:244) and the derived
protein sequence for
PR0293.
The entire nucleotide sequence of DNA37151-1193 is shown in Figure 85 (SEQ ID
N0:244). Clone
DNA37151-1193 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 881-883 and ending at the stop colon after nucleotide position 3019
of SEQ ID N0:244, Figure 85).
The predicted polypeptide precursor is 713 amino acids long (Figure 86). Clone
DNA37151-1193 has been
deposited with ATCC and is assigned ATCC deposit no. ATCC 209393.
Analysis of the amino acid sequence of the full-length PR0293 polypeptide
suggests that portions of
it possess significant homology to the NLRR proteins, thereby indicating that
PR0293 may be a novel NLRR
161
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
protein.
EXAMPLE 40: Isolation of cDNA Clones Encodin~Q Human PR0247
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA33480.
Based on the DNA33480
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0247.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-CAACAATGAGGGCACCAAGC-3' (SEQ ID N0:251)
reverse PCR primer 5'-GATGGCTAGGTTCTGGAGGTTCTG-3' (SEQ ID N0:252)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the DNA33480 expression
sequence tag which had the following nucleotide sequence
hybridization probe
5'-CAACCTGCAGGAGATTGACCTCAAGGACAACAACCTCAAGACCATCG-3' (SEQ ID N0:253)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0247 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal brain
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0247 [herein designated as DNA35673-1201) (SEQ ID N0:249) and the derived
protein sequence for
PR0247.
The entire nucleotide sequence of DNA35673-1201 is shown in Figure 89 (SEQ ID
N0:249). Clone
DNA35673-1201 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 80-82 of SEQ ID N0:249 and ending at the stop codon after nucleotide
position 1717 of SEQ ID
N0:249 (Figure 89). The predicted polypeptide precursor is 546 amino acids
long (Figure 88). Clone
DNA35673-1201 has been deposited with ATCC and is assigned ATCC deposit no.
209418.
Analysis of the amino acid sequence of the full-length PR0247 polypeptide
suggests that portions of
it possess significant homology to the densin molecule and KIAA0231, thereby
indicating that PR0247 may be
a novel leucine rich repeat protein.
EXAMPLE 41: Isolation of cDNA Clones Encoding Human PR0302 PR0303 PR0304
PR0307 and
PR0343
Consensus DNA sequences were assembled relative to other EST sequences using
phrap as described
in Example 1 above. These consensus sequences are herein designated DNA35953,
DNA35955, DNA35958,
DNA37160 and DNA30895. Based on the DNA35953 consensus sequence,
oligonucleotides were synthesized:
1) to identify by PCR a cDNA library that contained the sequence of interest,
and 2) for use as probes to isolate
a clone of the full-length coding sequence for PR0302.
162
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
PCR primers (forward and reverse) were synthesized:
forward PCR primer 1 5'-GTCCGCAAGGATGCCTACATGTTC-3' (SEQ ID N0:264)
forward PCR primer 2 5'-GCAGAGGTGTCTAAGGTTG-3' (SEQ ID N0:265)
reverse PCR primer 5'-AGCTCTAGACCAATGCCAGCTTCC-3' (SEQ ID N0:266)
Also, a synthetic oligonucleotide hybridization probe was constructed from the
consensus DNA35953 sequence
which had the following nucleotide sequence
hybridization probe
5'-GCCACCAACTCCTGCAAGAACTTCTCAGAACTGCCCCTGGTCATG-3' (SEQ ID N0:267)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0302 gene using. the probe oligonucleotide
and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue (LIB228).
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0302 [herein designated as DNA40370-1217] (SEQ ID N0:254) and the derived
protein sequence for
PR0302.
The entire nucleotide sequence of DNA40370-1217 is shown in Figure 89 (SEQ ID
N0:254). Clone
DNA40370-1217 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 34-36 and ending at the stop codon at nucleotide positions 1390-1392
(Figure 89). The predicted
polypeptide precursor is 452 amino acids long (Figure 90). Various unique
aspects of the PR0302 protein are
shown in Figure 90. Clone DNA40370-1217 has been deposited with the ATCC on
November 21, 1997 and
is assigned ATCC deposit no. ATCC 209485.
Based on the DNA35955 consensus sequence, oligonucleotides were synthesized: 1
) to identify by PCR
a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the full-
length coding sequence for PR0303.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-GGGGAATTCACCCTATGACATTGCC-3' (SEQ ID N0:268)
reverse PCR primer 5'-GAATGCCCTGCAAGCATCAACTGG-3' (SEQ ID N0:269)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35955
sequence which had the following nucleotide sequence:
hybridization probe
S'-GCACCTGTCACCTACACTAAACACATCCAGCCCATCTGTCTCCAGGCCTC-3' (SEQ ID N0:270)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0303 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue (LIB25).
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0303 [herein designated as DNA42551-1217] (SEQ ID N0:256) and the derived
protein sequence for
PR0303.
163
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
The entire nucleotide sequence of DNA42551-1217 is shown in Figure 91 (SEQ ID
N0:256). Clone
DNA42551-1217 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 20-22 and ending at the stop codon at nucleotide positions 962-964
(Figure 91). The predicted
polypeptide precursor is 314 amino acids long (Figure 92). Various unique
aspects of the PR0303 protein are
shown in Figure 92. Clone DNA42551-1217 has been deposited on November 21,
1997 with the ATCC and
is assigned ATCC deposit no. ATCC 209483.
Based on the DNA35958 consensus sequence, oligonucleotides were synthesized: 1
) to identify by PCR
a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the full-
length coding sequence for PR0304.
Pairs of PCR primers (forward and reverse) were synthesized:
forward PCR urimer 1 5'-GCGGAAGGGCAGAATGGGACTCCAAG-3' (SEQ ID N0:271)
forward PCR primer 2 5'-CAGCCCTGCCACATGTGC-3' (SEQ ID N0:272)
forward PCR primer 3 5'-TACTGGGTGGTCAGCAAC-3' (SEQ ID N0:273)
reverse PCR~rimer 5'-GGCGAAGAGCAGGGTGAGACCCCG-3' (SEQ ID N0:274)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35958
sequence which had the following nucleotide sequence
hybridization probe
5'-GCCCTCATCCTCTCTGGCAAATGCAGTTACAGCCCGGAGCCCGAC-3' (SEQ ID N0:275)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0304 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from 22 week human
fetal brain tissue
(LIB 153).
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0304 [herein designated as DNA39520-1217] (SEQ ID N0:258) and the derived
protein sequence for
PR0304.
The entire nucleotide sequence of DNA39520-1217 is shown in Figure 93 (SEQ ID
N0:258). Clone
DNA39520-1217 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 34-36 and ending at the stop codon at nucleotide positions 1702-1704
(Figure 93). The predicted
polypeptide precursor is 556 amino acids long (Figure 94). Various unique
aspects of the PR0304 protein are
shown in Figure 94. Clone DNA39520-1217 has been deposited with ATCC on
November 21, 1997 and is
assigned ATCC deposit no. ATCC 209482.
Based on the DNA37160 consensus sequence, oligonucleotides were synthesized: 1
) to identify by PCR
a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the full-
length coding sequence for PR0307.
Pairs of PCR primers (forward and reverse) were synthesized:
forward PCR primer 1 5'-GGGCAGGGATTCCAGGGCTCC-3' (SEQ ID N0:276)
forward PCR primer 2 5'-GGCTATGACAGCAGGTTC-3' (SEQ ID N0:277)
164
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
forward PCR primer 3 5'-TGACAATGACCGACCAGG-3' (SEQ ID N0:278)
reverse PCR primer 5'-GCATCGCATTGCTGGTAGAGCAAG-3' (SEQ ID N0:279)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA37160
sequence which had the following nucleotide sequence
hybridization probe
5'-TTACAGTGCCCCCTGGAAACCCACTTGGCCTGCATACCGCCTCCC-3' (SEQ ID N0:280)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0307 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue (LIB229).
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0307 [herein designated as DNA41225-1217] (SEQ ID N0:260) and the derived
protein sequence for
PR0307.
The entire nucleotide sequence of DNA41225-1217 is shown in Figure 95 (SEQ ID
N0:260). Clone
DNA41225-1217 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 92-94 and ending at the stop colon at nucleotide positions 1241-1243
(Figure 95). The predicted
polypeptide precursor is 383 amino acids long (Figure 96). Various unique
aspects of the PR0307 protein are
shown in Figure 96. Clone DNA41225-1217 has been deposited with ATCC on
November 21, 1997 and is
assigned ATCC deposit no. ATCC 209491.
Based on the DNA30895 consensus sequence, oligonucleotides were synthesized:
1) to identify by PCR
a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the full
length coding sequence for PR0343.
A pair of PCR primers (forward and reverse) were synthesized:
forward PCR primer 5'-CGTCTCGAGCGCTCCATACAGTTCCCTTGCCCCA-3' (SEQ ID N0:281)
reverse PCR primer
5'-TGGAGGGGGAGCGGGATGCTTGTCTGGGCGACTCCGGGGGCC
CCCTCATGTGCCAGGTGGA-3' (SEQ ID N0:282)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA30895
sequence which had the following nucleotide sequence
hybridization probe
5'-CCCTCAGACCCTGCAGAAGCTGAAGGTTCCTATCATCGAC
TCGGAAGTCTGCAGCCATCTGTACTGGCGGGGAGCAGGACAGGGACCCATCACTGAGGACATGC
TGTGTGCCGGCTACT-3' (SEQ ID N0:283)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0343 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue (LIB26).
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
165
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
PR0343 (herein designated as DNA43318-1217] (SEQ ID N0:262) and the derived
protein sequence for
PR0343.
The entire nucleotide sequence of DNA43318-1217 is shown in Figure 97 (SEQ ID
N0:262). Clone
DNA43318-1217 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 53-55 and ending at the stop codon at nucleotide positions 1004-1006
(Figure 97). The predicted
$ polypeptide precursor is 317 amino acids long (Figure 98). Various unique
aspects of the PR0343 protein are
shown in Figure 98. Clone DNA43318-1217 has been deposited with ATCC on
November 21, 1997 and is
assigned ATCC deposit no. ATCC 209481.
EXAMPLE 42: Isolation of cDNA Clones Encoding Human PR0328
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA35615.
Based on the DNA35615
consensus sequence, oligonucleotides were synthesized: I) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0328.
Forward and reverse PCR primers were synthesized:
forward PCR primer 5'-TCCTGCAGTTTCCTGATGC-3' (SEQ ID N0:286)
reverse PCR primer 5'-CTCATATTGCACACCAGTAATTCG-3' (SEQ ID N0:287)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35615
sequence which had the following nucleotide sequence
hybridization probe
5'-ATGAGGAGAAACGTTTGATGGTGGAGCTGCACAACCTCTACCGGG-3'
(SEQ ID N0:288)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0328 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0328 [herein designated as DNA40587-1231] (SEQ ID N0:284) and the derived
protein sequence for
PR0328.
The entire nucleotide sequence of DNA40587-1231 is shown in Figure 99 (SEQ ID
N0:284). Clone
DNA40587-1231 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 15-17 and ending at the stop codon at nucleotide positions 1404-1406
(Figure 99). The predicted
polypeptide precursor is 463 amino acids long (Figure 100). Clone DNA40587-
1231 has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209438.
Analysis of the amino acid sequence of the full-length PR0328 polypeptide
suggests that portions of
it possess significant homology to the human glioblastoma protein and to the
cysteine rich secretory protein
thereby indicating that PR0328 may be a novel glioblastoma protein or cysteine
rich secretory protein.
166
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
EXAMPLE 43: Isolation of cDNA Clones Encodine Human PR0335 PR0331 or PR0326
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA36685.
Based on the DNA36685
consensus sequence, and Incyte EST sequence no. 2228990, oligonucleotides were
synthesized: 1) to identify
by PCR a cDNA library that contained the sequence of interest, and 2) for use
as probes to isolate a clone of the
full-length coding sequence for PR0335, PR0331 or PR0326.
Forward and reverse PCR primers were synthesized for the determination of
PR0335:
forward PCR primer 5'-GGAACCGAATCTCAGCTA-3' (SEQ ID N0:295)
forward PCR primer5'-CCTAAACTGAACTGGACCA-3' (SEQ ID N0:296)
forward PCR primer5'-GGCTGGAGACACTGAACCT-3' (SEQ ID N0:297)
,
forward PCR 5'-ACAGCTGCACAGCTCAGAACAGTG-3' (SEQ ID
primer N0:298)
reverse PCR primer5'-CATTCCCAGTATAAAAATTTTC-3' (SEQ ID N0:299)
reverse PCR primer 5'-GGGTCTTGGTGAATGAGG-3' (SEQ ID N0:300)
reverse PCR primer 5'-GTGCCTCTCGGTTACCACCAATGG-3' (SEQ ID N0:301)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
for the determination of PR0335
which had the following nucleotide sequence
hybridization probe
5'-GCGGCCACTGTTGGACCGAACTGTAACCAAGGGAGAAACAGCCGTCCTAC-3'
(SEQ ID N0:302)
Forward and reverse PCR primers were synthesized for the determination of
PR0331:
forward PCR primer 5'-GCCTTTGACAACCTTCAGTCACTAGTGG-3' (SEQ ID N0:303)
reverse PCR primer 5'-CCCCATGTGTCCATGACTGTTCCC-3' (SEQ ID N0:304)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
for the determination of PR0331
which had the following nucleotide sequence
hybridization probe
5'-TACTGCCTCATGACCTCTTCACTCCCTTGCATCATCTTAGAGCGG-3'
(SEQ ID N0:305)
Forward and reverse PCR primers were synthesized for the determination of
PR0326:
forward PCR primer 5'-ACTCCAAGGAAATCGGATCCGTTC-3' (SEQ ID N0:306)
reverse PCR primer 5'-TTAGCAGCTGAGGATGGGCACAAC-3' (SEQ ID N0:307)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
for the determination of PR0331
which had the following nucleotide sequence _
hybridization probe
5'-GCCTTCACTGGTTTGGATGCATTGGAGCATCTAGACCTGAGTGACAACGC-3'
(SEQ ID N0:308)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0335, PR0331 or PR0326 gene using the probe
oligonucleotide and one of
167
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal
kidney tissue (PR0335 and
PR0326) and human fetal brain (PR0331).
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0335, PR0331 or PR0326 [herein designated as SEQ ID NOS:289, 291 and 293,
respectively; see Figures
103, 105 and 107, respectivelyJ, and the derived protein sequence for PR0335,
PR0331 or PR0326 (see
Figures 104, 106 and 108, respectively; SEQ ID NOS:290, 292 and 294,
respectively).
The entire nucleotide sequences are shown in Figures 103, 105 and 107,
deposited with the ATCC on
June 2, 1998, November 7, 1997 and November 21, 1997, respectively.
Analysis of the amino acid sequence of the full-length PR0335, PR0331 or
PR0326 polypeptide
suggests that portions of it possess significant homology to the LIG-1
protein, thereby indicating that PR0335,
PR0331 and PR0326 may be a novel LIG-1-related protein.
EXAMPLE 44: Isolation of cDNA clones Encoding Human PR0332
Based upon an ECD homology search performed as described in Example 1 above, a
consensus DNA
sequence designated herein as DNA36688 was assembled. Based on the DNA36688
consensus sequence,
oligonucleotides were synthesized to identify by PCR a cDNA library that
contained the sequence of interest and
for use as probes to isolate a clone of the full-length coding sequence for
PR0332.
A pair of PCR primers (forward and reverse) were synthesized:
5'-GCATTGGCCGCGAGACTTTGCC-3' (SEQ ID N0:311)
5'-GCGGCCACGGTCCTTGGAAATG-3' (SEQ ID N0:312)
A probe was also synthesized:
5'-TGGAGGAGCTCAACCTCAGCTACAACCGCATCACCAGCCCACAGG-3'
(SEQ ID N0:3I3)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0332 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from a human fetal
liver library (LIB229).
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
DNA40982-1235 and the derived protein sequence for PR0332.
The entire nucleotide sequence of DNA40982-1235 is shown in Figure 109 (SEQ ID
N0:309). Clone
DNA40982-1235 contains a single open reading frame (with an apparent
translational initiation site at nucleotide
positions 342-344, as indicated in Figure 109). The predicted polypeptide
precursor is 642 amino acids long,
and has a calculated molecular weight of 72,067 (pI: 6.60). Clone DNA40982-
1235 has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209433.
Based on a BLAST and FastA sequence alignment analysis of the full-length
sequence, PR0332 shows
about 30-40% amino acid sequence identity with a series of known proteoglycan
sequences, including, for
example, fibromodulin and fibromodulin precursor sequences of various species
(FMOD BOVIN, FMOD
168
CA 02343577 2001-03-16
wo oon x796
PCT/US99/2I 090
CHICK, FMOD RAT, FMOD_MOUSE, FMOD HUMAN, P 836773), osteomodulin sequences
(AB000114
1, AB007848_1), decorin sequences (CFU83141 _1, OCU03394-1, P 842266, P
842267, P 842260, P 889439),
keratan sulfate proteoglycans (BTU48360_l, AF022890_1), corneal proteoglycan
(AF022256_1), and
bone/cartilage proteoglycans and proteoglycane precursors (PGS1 BOVIN, PGS2-
MOUSE, PGS2_HUMAN).
EXAMPLE 45: Isolation of cDNA clones Encodin;~ Human PR0334
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. Based on the consensus sequence, oligonucleotides were
synthesized: 1) to identify by PCR
a cDNA library that contained the sequence of interest, and 2) for use as
probes to isolate a clone of the full-
length coding sequence for PR0334.
Forward and reverse PCR primers were synthesized for the determination of
PR0334:
forward PCR primer 5'-GATGGTTCCTGCTCAAGTGCCCTG-3' (SEQ ID N0:316)
reverse PCR primer 5'-TTGCACTTGTAGGACCCACGTACG-3' (SEQ ID N0:317)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
for the determination of PR0334
which had the following nucleotide sequence
hybridization probe
5'-CTGATGGGAGGACCTGTGTAGATGTTGATGAATGTGCTACAGGAAGAGCC-3'
(SEQ ID N0:318)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0334 gene using the probe oligonucleotide and
one of the PCR primers.
Human fetal kidney cDNA libraries used to isolate the cDNA clones were
constructed by standard
methods using commercially available reagents such as those from Invitrogen,
San Diego, CA.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0334 [herein designated as DNA4I379-1236] (SEQ ID N0:314) and the derived
protein sequence for
PR0334.
The entire nucleotide sequence of DNA41379-1236 (also referred to as UNQ295)
is shown in Figure
109 (SEQ ID N0:314). Clone DNA41379-1236 contains a single open reading frame
with an apparent
translational initiation site at nucleotide positions 203-205 and ending at
the stop codon at nucleotide positions
1730-1732 (Figure 109). The predicted polypeptide precursor is 509 amino acids
long (Figure 110). Clone
DNA41379-1236 has been deposited with ATCC and is assigned ATCC deposit no.
ATCC 209488.
Analysis of the amino acid sequence of the full-length FR0334 polypeptide
suggests that portions of
it possess significant homology to the fibulin and fibrillin proteins, thereby
indicating that PR0334 may be a
novel member of the EGF protein family.
EXAMPLE 46: Isolation of cDNA Clones Encodine Human PR0346
A consensus DNA sequence was identified using phrap as described in Example 1
above. Specifically,
this consensus sequence is herein designated DNA38240. Based on the DNA38240
consensus sequence,
169
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
oligonucleotides were synthesized: 1 ) to identify by PCR a cDNA library that
contained the sequence of interest,
and 2) for use as probes to isolate a clone of the full-length PR0346 coding
sequence.
RNA for construction of the cDNA libraries was isolated from human fetal
liver. The cDNA libraries
used to isolated the cDNA clones were constructed by standard methods using
commercially available reagents
(e.g., Invitrogen, San Diego, CA; Clontech, etc.) The cDNA was primed with
oligo dT containing a NotI site,
linked with blunt to SaII hemikinased adaptors, cleaved with Notl, sized
appropriately by gel electrophoresis,
and cloned in a defined orientation into a suitable cloning vector (such as
pRKB or pRKD; pRKSB is a precursor
of pRKSD that does not contain the SfiI site; see, Holmes et al., Science,
253:1278-1280 (1991)) in the unique
XhoI and NotI sites.
A cDNA clone was sequenced in entirety. The entire nucleotide sequence of
DNA44167-1243 is
shown in Figure 111 (SEQ ID N0:319). Clone DNA44167-1243 contains a single
open reading frame with an
apparent translationaI initiation site at nucleotide positions 64-66 (Fig.
113; SEQ ID N0:319). The predicted
polypeptide precursor is 450 amino acids long. Clone DNA44167-1243 has been
deposited with ATCC and is
assigned ATCC deposit no. ATCC 209434 (designation DNA44167-1243).
Based on a BLAST, BLAST-2 and FastA sequence alignment analysis (using the
ALIGN computer
program) of the full-length sequence, PR0346 shows amino acid sequence
identity to carcinoembryonic antigen
(28 % ).
The oligonucleotide sequences used in the above procedure were the following:
OLI2691 (38240.f1)
5'-GATCCTGTCACAAAGCCAGTGGTGC-3' (SEQ ID N0:321)
OLI2693 (38240.r1)
S'-CACTGACAGGGTTCCTCACCCAGG-3' (SEQ ID N0:322)
OLI2692 (38240.p1)
5'-CTCCCTCTGGGCTGTGGAGTATGTGGGGAACATGACCCTGACATG-3' (SEQ ID N0:323)
EXAMPLE 47: Isolation of cDNA Clones Encodine Human PR0268
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA35698.
Based on the DNA35698
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0268.
Forward and reverse PCR primers were synthesized:
forward PCR primer I 5'-TGAGGTGGGCAAGCGGCGAAATG-3' (SEQ ID N0:326)
forward PCR primer 2 5'-TATGTGGATCAGGACGTGCC-3' (SEQ ID N0:327)
forward PCR primer 3 5'-TGCAGGGTTCAGTCTAGATTG-3' (SEQ ID N0:328)
reverse PCR~rimer 5'-TTGAAGGACAAAGGCAATCTGCCAC-3' (SEQ ID N0:329)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus DNA35698
sequence which had the following nucleotide sequence
170
CA 02343577 2001-03-16
WO 00/15796
PCT/US99/21090
hybridization probe
5'-GGAGTCTTGCAGTTCCCCTGGCAGTCCTGGTGCTGTTGCTTTGGG-3' (SEQ ID N0:330)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0268 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung
tissue.
DNA sequencing of the clones isolated, as described above gave the full-length
DNA sequence for
PR0268 [herein designated as DNA39427-1179] (SEQ ID N0:324) and the derived
protein sequence for
PR0268.
The entire nucleotide sequence of DNA39427-l I79 is shown in Figure 113 (SEQ
ID N0:324). Clone
DNA39427-1179 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 13-15 and ending at the stop codon at nucleotide positions 853-855
(Figure 113). The predicted
polypeptide precursor is 280 amino acids long (Figure 114). Clone DNA39427-
1179 has been deposited with
ATCC and is assigned ATCC deposit no. ATCC 209395.
Analysis of the amino acid sequence of the full-length PR0268 polypeptide
suggests that it possess
significant homology to protein disulfide isomerase, thereby indicating that
PR0268 may be a novel protein
disulfide isomerase.
EXAMPLE 48: Isolation of cDNA Clones Encodine Human PR0330
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA35730.
Based on the DNA35730
consensus sequence, oligonucleotides were synthesized: I) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0330.
Forward and reverse PCR primers were synthesized:
forward PCR~rimer 1 5'-CCAGGCACAATTTCCAGA-3' (SEQ ID N0:333)
forward PCR primer 2 S'-GGACCCTTCTGTGTGCCAG-3' (SEQ ID N0:334)
reverse PCR primer 1 5'-GGTCTCAAGAACTCCTGTC-3' (SEQ ID N0:335)
reverse PCRprimer 2 5'-ACACTCAGCATTGCCTGGTACTTG-3' (SEQ ID N0:336)
Additionally, a synthetic oligonucleotide hybridization probe was constructed
from the consensus sequence which
had the following nucleotide sequence
hybridization probe
5'-GGGCACATGACTGACCTGATTTATGCAGAGAAAGAGCTGGTGCAG-3' (SEQ ID N0:337)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0330 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
171
CA 02343577 2001-03-16
WO 00/15796 PCTNS99/21090
PR0330 [herein designated as DNA40603-1232] (SEQ ID N0:331) and the derived
protein sequence for
PR0330.
The entire nucleotide sequence of DNA40603-1232 is shown in Figure 115 (SEQ ID
N0:331). Clone
DNA40603-1232 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 167-169 and ending at the stop codon at nucleotide positions 1766-
1768 (Figure 115). The predicted
polypeptide precursor is 533 amino acids long (Figure 116). Clone DNA40603-
1232 has been deposited with
ATCC and is assigned ATCC deposit no.ATCC 209486 on November 21, 1997.
Analysis of the amino acid sequence of the full-length PR0330 polypeptide
suggests that portions of
it possess significant homology to the mouse prolyl 4-hydroxylase alpha
subunit protein, thereby indicating that
PR0330 may be a navel prolyl 4-hydroxylase alpha subunit polypeptide.
EXAMPLE 49: Isolation of cDNA Clones Encodin~E Human PR0310_
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. This consensus sequence is herein designated DNA40553.
Based on the DNA40553
consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a
cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a clone of the
full-length coding sequence for
PR0310.
Forward and reverse PCR primers were synthesized:
forward PCR~rimer 1 5'-TCCCCAAGCCGTTCTAGACGCGG-3' (SEQ ID N0:342)
forward PCR primer 2 5'-CTGGTTCTTCCTTGCACG-3' (SEQ ID N0:343)
reverse PCR primer 5'-GCCCAAATGCCCTAAGGCGGTATACCCC-3' (SEQ ID N0:344)
Additionally, a syntheticoligonucleotide hybridization probe was constructed
from the consensus sequence which
had the following nucleotide sequence
hybridization probe
5'-GGGTGTGATGCTTGGAAGCATTTTCTGTGCTTTGATCACTATGCTAGGAC-3' (SEQ ID N0:345)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0310 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
PR0310 [herein designated as DNA43046-1225 (SEQ ID N0:340) and the derived
protein sequence for PR0310
(SEQ ID N0:341).
The entire nucleotide sequence of DNA43046-1225 is shown in Figure 119 (SEQ ID
N0:340). Clone
DNA43046-1225 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 81-83 and ending at the stop codon at nucleotide positions 1035-1037
(Figure 119). The predicted
polypeptide precursor is 318 amino acids long (Figure 120) and has a
calculated molecular weight of
approximately 36,382 daltons. Clone DNA43046-1225 has been deposited with ATCC
and is assigned ATCC
deposit no. ATCC 209484.
172
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Analysis of the amino acid sequence of the full-length PR0310 polypeptide
suggests that portions of
it possess homology to C. elegans proteins and to fringe, thereby indicating
that PR0310 may be involved in
development.
EXAMPLE 50: Isolation of cDNA clones Encodine Human PR0339
An expressed sequence tag (EST) DNA database (LIFESEQTM, Incyte
Pharmaceuticals, Palo Alto, CA)
was searched and ESTs were identified. An assembly of Incyte clones and a
consensus sequence was formed
using phrap as described in Example 1 above.
Forward and reverse PCR primers were synthesized based upon the assembly-
created consensus
sequence:
forward PCR primer 1 S'-GGGATGCAGGTGGTGTCTCATGGGG-3' (SEQ ID N0:346)
forward primer5'-CCCTCATGTACCGGCTCC-3'(SEQ ID
PCR 2 N0:347)
forward rimer 5'-GTGTGACACAGCGTGGGC-3'(SEQ ID
PCR~ 3 N0:43)
forward primer5'-GACCGGCAGGCTTCTGCG-3'(SEQ ID
PCR 4 N0:44)
reverse PCR primer 1 5'-CAGCAGCTTCAGCCACCAGGAGTGG-3' (SEQ ID N0:45)
reverse PCR primer 2 5'-CTGAGCCGTGGGCTGCAGTCTCGC-3' (SEQ ID N0:46)
Additional ly, a synthetic oligonucleotide hybridization probe was constructed
from the consensus sequence which
had the following nucleotide sequence
hybridization probe
5'-CCGACTACGACTGGTTCTTCATCATGCAGGATGACACATATGTGC-3' (SEQ ID N0:47)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pairs identified above. A
positive library was then used
to isolate clones encoding the PR0339 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver
tissue.
A cDNA clone was sequenced in entirety. The entire nucleotide sequence of
DNA43466-1225 is shown
in Figure 117 (SEQ ID N0:338). Clone DNA43466-1225 contains a single open
reading frame with an apparent
translational initiation site at nucleotide positions 333-335 and ending at
the stop codon found at nucleotide
positions 2649-2651 (Figure 117; SEQ ID N0:338). The predicted polypeptide
precursor is 772 amino acids
long and has a calculated molecular weight of approximately 86,226 daltons.
Clone DNA43466-1225 has been
deposited with ATCC and is assigned ATCC deposit no. ATCC 209490.
Based on a BLAST and FastA sequence alignment analysis (using the ALIGN
computer program) of
the full-length sequence, PR0339 has homology to C. elegans proteins and
collagen-like polymer sequences as
well as to fringe, thereby indicating that PR0339 may be involved in
development or tissue growth.
EXAMPLE 51: Isolation of cDNA Clones Encoding Human PR0244
A consensus DNA sequence was assembled relative to other EST sequences using
phrap as described
in Example 1 above. Based on this consensus sequence, oligonucleotides were
synthesized to identify by PCR
a cDNA library that contained the sequence of interest and for use as probes
to isolate a clone of the full-length
173
CA 02343577 2001-03-16
16-06-200U US 009921090
.. .. .. .. ..
.. .. .. . . .. . ..
. . . . ... . . ... . . .
. . . .. . . ..
.. . . ..
... .. .. .. . .. ..
coding setluence for PR0244.
A pair of PCR primers (forward and reverse) were synthesized:
5'-TTCAGCTTCTGGGATGTAGGG-3' (30923.f1) (SEQ ID N0:378)
5'-TATTCCTACCATTTCACAAATCCG-3' (30923.r1) (SEQ ID N0:379)
S A probe was also synthesized:
5'-GGAGGACTGTGCCACCATGAGAGACTCTTCAAACCCAAGGCAAAATTGG-3' (30923.p1) (SEQID
N0:237)
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0244 gene using the probe oligonucleotide and
one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from a human fetal
kidney library. DNA
sequencing of the clones isolated as described above gave the full-length DNA
sequence and the derived protein
sequence for PR0244.
The entire nucleotide sequence of PR0244 is shown in Figure 121 (SEQ ID
N0:376). Clone
DNA35668-1171 contains a single open reading frame with an apparent
translational initiation site at nucleotide
positions 106-108 (Fig. 121). The predicted polypeptide precursor is 219 amino
acids long. Clone DNA35668-
1171 has been deposited with ATCC (designated as DNA35663-1171) and is
assigned ATCC deposit no.
ATCC209371. The protein has a cytoplasmic domain (aa 1-20), a transmembrane
domain (aa 21-46), and an
extracellular domain (aa 47-219), with a C-lectin domain at as 55-206.
Based on a BLAST and FastA sequence alignment analysis of the full-length
sequence, PR0244 shows
notable amino acid sequence identity to hepatic lectin gallus gallus (43%),
HIC hp120-binding C-type lectin
(42 % ), macrophage lectin 2 (HUMHML2-1, 41 % ), and sequence PR32188 (44 % ).
EXAMPLE 52: Use of PRO Polvnentide-Encoding Nucleic Aeid as Hybridization
Probes
The following method describes use of a nucleotide sequence encoding a PRO
polypeptide as a
hybridization probe.
DNA comprising the coding sequence of of a PRO polypeptide of interest as
disclosed herein may be
employed as a probe or used as a basis from which to prepare probes to screen
for homologous DNAs (such as
those encoding naturally-occurring variants of the PRO polypeptide} in human
tissue cDNA libraries or human
tissue genomic libraries.
Hybridization and washing of filters containing either library DNAs is
performed under the following
high stringency conditions. Hybridization of radiolabeled PRO polypeptide-
encoding nucleic acid-derived probe
to the filters is performed in a solution of 50% formamide, Sx SSC, 0.1 % SDS,
0.1 % sodium pyrophosphate,
50 mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dexiran
sulfate at 42°C for 20 hours.
Washing of the filters is performed in an aqueous solution of O. lx SSC and
0.1 % SDS at 42°C.
DNAs having a desired sequence identity with the DNA encoding full-length
native sequence PRO
polypeptide can then be identified using standard techniques known in the art.
174
AMENDED SHEET
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
EXAMPLE 53: Expression of PRO Polvpeptides in E coli
This example illustrates preparation of an unglycosylated form of a desired
PRO polypeptide by
recombinant expression in E. coli.
The DNA sequence encoding the desired PRO polypeptide is initially amplified
using selected PCR
primers. The primers should contain restriction enzyme sites which correspond
to the restriction enzyme sites
S on the selected expression vector. A variety of expression vectors may be
employed. An example of a suitable
vector is pBR322 (derived from E. coli; see Bolivar et al., Gene, 2:95 (1977))
which contains genes for
ampicillin and tetracycline resistance. The vector is digested with
restriction enzyme and dephosphorylated.
The PCR amplified sequences are then ligated into the vector. The vector will
preferably include sequences
which encode for an antibiotic resistance gene, a trp promoter, a polyhis
leader (including the first six STII
codons, polyhis sequence, and enterokinase cleavage site), the specific PRO
polypeptide coding region, lambda
transcriptional terminator, and an argU gene.
The ligation mixture is then used to transform a selected E. coli strain using
the methods described in
Sambrook et al., su ra. Transformants are identified by their ability to grow
on LB plates and antibiotic resistant
colonies are then selected. Plasmid DNA can be isolated and confirmed by
restriction analysis and DNA
sequencing.
Selected clones can be grown overnight in liquid culture medium such as LB
broth supplemented with
antibiotics. The overnight culture may subsequently be used to inoculate a
larger scale culture. The cells are
then grown to a desired optical density, during which the expression promoter
is turned on.
After culturing the cells for several more hours, the cells can be harvested
by centrifugation. The cell
pellet obtained by the centrifugation can be solubilized using various agents
known in the art, and the solubilized
PRO polypeptide can then be purified using a metal chelating column under
conditions that allow tight binding
of the protein.
PR0187, PR0317, PR0301, PR0224 and PR0238 were successfully expressed in E.
coli in a poly-His
tagged form, using the following procedure. The DNA encoding PR0187, PR0317,
PR0301, PR0224 or
PR0238 was initially amplified using selected PCR primers. The primers
contained restriction enzyme sites
which correspond to the restriction enzyme sites on the selected expression
vector, and other useful sequences
providing for efficient and reliable translation initiation, rapid
purification on a metal chelation column, and
proteolytic removal with enterokinase. The PCR-amplified, poly-His tagged
sequences were then ligated into
an expression vector, which was used to transform an E. coli host based on
strain 52 (W3110 fuhA(tonA) lop
galE rpoHts(htpRts) clpP(IacIq). Transformants were first grown in LB
containing 50 mg/ml carbenicillin at
30°C with shaking until an O.D.600 of 3-5 was reached. Cultures were
then diluted 50-100 fold into CRAP
media (prepared by mixing 3.57 g (NH4)ZSO,, 0.71 g sodium citrate~2H20, 1.07 g
KCI, 5.36 g Difco yeast
extract, 5.36 g Sheffield hycase SF in S00 mL water, as well as 110 mM MPOS,
pH 7.3, 0.55% (w/v} glucose
and 7 mM MgS04) and grown for approximately 20-30 hours at 30°C with
shaking. Samples were removed
to verify expression by SDS-PAGE analysis, and the bulk culture is centrifuged
to pellet the cells. Cell pellets
were frozen until purification and refolding.
175
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets) was resuspended
in 10 volumes (w/v) in 7
M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium
tetrathionate is added to make final
concentrations of O.1M and 0.02 M, respectively, and the solution was stirred
overnight at 4°C. This step
results in a denatured protein with all cysteine residues blocked by
sulfitolization. The solution was centrifuged
at 40,000 rpm in a Beckman Ultracentifuge for 30 min. The supernatant was
diluted with 3-5 volumes of metal
S chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and filtered
through 0.22 micron filters to clarify.
Depending the clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal
chelate column equilibrated in the
metal chelate column buffer. The column was washed with additional buffer
containing 50 mM imidazole
(Calbiochem, Utrol grade), pH 7.4. The protein was eluted with buffer
containing 250 mM imidazole.
Fractions containing the desired protein were pooled and stored at 4°C.
Protein concentration was estimated
by its absorbance at 280 nm using the calculated extinction coefficient based
on its amino acid sequence.
The proteins were refolded by diluting sample slowly into freshly prepared
refolding buffer consisting
of: 20 mM Tris, pH 8.6, 0.3 M NaCI, 2.5 M urea, 5 mM cysteine, 20 mM glycine
and 1 mM EDTA.
Refolding volumes were chosen so that the final protein concentration was
between 50 to 100 microgramslml.
The refolding solution was stirred gently at 4°C for 12-36 hours. The
refolding reaction was quenched by the
addition of TFA to a final concentration of 0.4% (pH of approximately 3).
Before further purification of the
protein, the solution was filtered through a 0.22 micron filter and
acetonitrile was added to 2-10% final
concentration. The refolded protein was chromatographed on a Poros R1/H
reversed phase column using a
mobile buffer of 0.1 % TFA with elution with a gradient of acetonitrile from
10 to 80%. Aliquots of fractions
with A280 absorbance were analyzed on SDS polyacrylamide gels and fractions
containing homogeneous
refolded protein were pooled. Generally, the properly refolded species of most
proteins are eluted at the lowest
concentrations of acetonitrile since those species are the most compact with
their hydrophobic interiors shielded
from interaction with the reversed phase resin. Aggregated species are usually
eluted at higher acetonitrile
concentrations. In addition to resolving misfolded forms of proteins from the
desired form, the reversed phase
step also removes endotoxin from the samples.
Fractions containing the desired folded PR0187, PR0317, PR0301, PR0224 and
PR0238 proteins,
respectively, were pooled and the acetonitrile removed using a gentle stream
of nitrogen directed at the solution.
Proteins were formulated into 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride
and 4 % mannitol by dialysis
or by gel filtration using G25 Superfine (Pharmacia) resins equilibrated in
the formulation buffer and sterile
filtered.
EXAMPLE 54: Expression of PRO Polvpeptides in Mammalian Cells
This example illustrates preparation of a glycosylated form of a desired PRO
polypeptide by
recombinant expression in mammalian cells.
The vector, pRKS (see EP 307,247, published March 15, 1989), is employed as
the expression vector.
Optionally, the PRO polypeptide-encoding DNA is ligated into pRKS with
selected restriction enzymes to allow
insertion of the PRO polypeptide DNA using ligation methods such as described
in Sambrook et al., su ra. The
resulting vector is called pRKS-PRO polypeptide.
176
CA 02343577 2001-03-16
wo oon x796
PCT/t3S99/21090
In one embodiment, the selected host cells may be 293 cells. Human 293 cells
(ATCC CCL 1573) are
grown to confluence in tissue culture plates in medium such as DMEM
supplemented with fetal calf serum and
optionally, nutrient components andlor antibiotics. About 10 ~g pRKS-PRO
polypeptide DNA is mixed with
about 1 ug DNA encoding the VA RNA gene (Thimmappaya et al., Cell, 31:543
(1982)] and dissolved in 500
~1 of 1 mM Tris-HCI, 0.1 mM EDTA, 0.227 M CaCl2. To this mixture is added,
dropwise, 500 ,ul of SO mM
HEPES (pH 7.35), 280 mM NaCI, 1.5 mM NaP04, and a precipitate is allowed to
form for 10 minutes at 25°C.
The precipitate is suspended and added to the 293 cells and allowed to settle
for about four hours at 37°C. The
culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for
30 seconds. The 293 cells are
then washed with serum free medium, fresh medium is added and the cells are
incubated for about 5 days.
Approximately 24 hours after the transfections, the culture medium is removed
and replaced with culture
medium (alone) or culture medium containing 200 ~Ci/ml'SS-cysteine and 200
~Ci/ml'SS-methionine. After
a 12 hour incubation, the conditioned medium is collected, concentrated on a
spin filter, and loaded onto a 15
SDS gel. The processed gel may be dried and exposed to film for a selected
period of time to reveal the
presence of PRO polypeptide. The cultures containing transfected cells may
undergo further incubation (in
serum free medium) and the medium is tested in selected bioassays.
In an alternative technique, PRO polypeptide may be introduced into 293 cells
transiently using the
dextran sulfate method described by Somparyrac et al., Proc. Natl. Acad. Sci.,
12:7575 (1981). 293 cells are
grown to maximal density in a spinner flask and 700 ~.g pRKS-PRO polypeptide
DNA is added. The cells are
first concentrated from the spinner flask by centrifugation and washed with
PBS. The DNA-dextran precipitate
is incubated on the cell pellet for four hours. The cells are treated with 20%
glycerol for 90 seconds, washed
with tissue culture medium, and re-introduced into the spinner flask
containing tissue culture medium, 5 ~.g/ml
bovine insulin and 0.1 ~.g/ml bovine transferrin. After about four days, the
conditioned media is centrifuged
and filtered to remove cells and debris. The sample containing expressed PRO
polypeptide can then be
concentrated and purified by any selected method, such as dialysis and/or
column chromatography.
In another embodiment, PRO polypeptides can be expressed in CHO cells. The
pRKS-PRO polypeptide
can be transfected into CHO cells using known reagents such as CaP04 or DEAF-
dextran. As described above,
the cell cultures can be incubated, and the medium replaced with culture
medium (alone) or medium containing
a radiolabel such as 'SS-methionine. After determining the presence of PRO
polypeptide, the culture medium
may be replaced with serum free medium. Preferably, the cultures are incubated
for about 6 days, and then the
conditioned medium is harvested. The medium containing the expressed PRO
polypeptide can then be
concentrated and purified by any selected method.
Epitope-tagged PRO polypeptide may also be expressed in host CHO cells. The
PRO polypeptide may
be subcloned out of the pRKS vector. The subclone insert can undergo PCR to
fuse in frame with a selected
epitope tag such as a poly-his tag into a Baculovirus expression vector. The
poly-his tagged PRO polypeptide
insert can then be subcloned into a SV40 driven vector containing a selection
marker such as DHFR for selection
of stable clones. Finally, the CHO cells can be transfected (as described
above) with the SV40 driven vector.
Labeling may be performed, as described above, to verify expression. The
culture medium containing the
expressed poly-His tagged PRO polypeptide can then be concentrated and
purified by any selected method, such
177
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
as by Ni'-+-chelate affinity chromatography.
PR0211, PR0217, PR0230, PR0219, PR0245, PR0221, PR0258, PR0301, PR0224,
PR0222,
PR0234, PR0229, PR0223, PR0328 and PR0332 were successfully expressed in CHO
cells by both a transient
and a stable expression procedure. In addition, PR0232, PR0265, PR0246,
PR0228, PR0227, PR0220,
PR0266, PR0269, PR0287, PR0214, PR0231, PR0233, PR0238, PR0244, PR0235,
PR0236, PR0262,
PR0239, PR0257, PR0260, PR0263, PR0270, PR0271, PR0272, PR0294, PR0295,
PR0293, PR0247,
PR0303 and PR0268 were successfully transiently expressed in CHO cells.
Stable expression in CHO cells was performed using the following procedure.
The proteins were
expressed as an IgG construct (immunoadhesin), in which the coding sequences
for the soluble forms (e.g.
extracellular domains) of the respective proteins were fused to an IgGI
constant region sequence containing the
hinge, CH2 and CH2 domains and/or is a poly-His. tagged form.
Following PCR amplification, the respective DNAs were subcloned in a CHO
expression vector using
standard techniques as described in Ausubel et al., Current Protocols of
Molecular Biology, Unit 3.16, John
Wiley and Sons (1997). CHO expression vectors are constructed to have
compatible restriction sites 5' and 3'
of the DNA of interest to allow the convenient shuttling of cDNA's. The vector
used expression in CHO cells
is as described in Lucas et al., Nucl. Acids Res. 24: 9 (1774-1779 (1996), and
uses the SV40 early
promoter/enhancer to drive expression of the cDNA of interest and
dihydrofolate reductase (DHFR). DHFR
expression permits selection for stable maintenance of the plasmid following
transfection.
Twelve micrograms of the desired plasmid DNA were introduced into
approximately 10 million CHO
cells using commercially available transfection reagents Superfect' (Quiagen),
Dospei or Fugene (Boehringer
Mannheim). The cells were grown and described in Lucas et al. , supra.
Approximately 3 x 10'' cells are frozen
in an ampule for further growth and production as described below.
The ampules containing the plasmid DNA were thawed by placement into water
bath and mixed by
vortexing. The contents were pipetted into a centrifuge tube containing 10 mLs
of media and centrifuged at 1000
rpm for 5 minutes. The supernatant was aspirated and the cells were
resuspended in 10 mL of selective media
(0.2 ~m filtered PS20 with 5 % 0.2 um diafiltered fetal bovine serum). The
cells were then aliquoted into a 100
mL spinner containing 90 mL of selective media. After 1-2 days, the cells were
transferred into a 250 mL
spinner filled with 150 mL selective growth medium and incubated at
37°C. After another 2-3 days, a 250 mL,
500 mL and 2000 mL spinners were seeded with 3 x 105 cells/mL. The cell media
was exchanged with fresh
media by centrifugation and resuspension in production medium. Although any
suitable CHO media may be
employed, a production medium described in US Patent No. 5,122,469, issued
June 16, 1992 was actually used.
3L production spinner is seeded at 1.2 x 106 cells/mL. On day 0, the cell
number pH were determined. On day
1, the spinner was sampled and sparging with filtered air was commenced. On
day 2, the spinner was sampled,
the temperature shifted to 33°C, and 30 mL of 500 g/L glucose and 0.6
mL of 10% antifoam (e.g., 35%
polydimethylsiloxane emulsion, Dow Coming 365 Medical Grade Emulsion).
Throughout the production, pH
was adjusted as necessary to keep at around 7.2. After 10 days, or until
viability dropped below 70%, the cell
culture was harvested by centrifugtion and filtering through a 0.22 p.m
filter. The filtrate was either stored at
4°C or immediately loaded onto columns for purification.
178
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
For the poly-His tagged constructs, the proteins were purified using a Ni-NTA
column (Qiagen).
Before purification, imidazole was added to the conditioned media to a
concentration of S mM. The conditioned
media was pumped onto a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH
7.4, buffer containing 0.3
M NaCI and S mM imidazole at a flow rate of 4-S ml/min. at 4°C. After
loading, the column was washed with
additional equilibration buffer and the protein eluted with equilibration
buffer containing 0.25 M imidazole. The
highly purified protein was subsequently desalted into a storage buffer
containing 10 mM Hepes, 0.14 M NaCI
and 4% mannitol, pH 6.8, with a 2S ml G2S Superfine (Pharmacia) column and
stored at -80°C.
Immunoadhesin (Fc containing) constructs of were purified from the conditioned
media as follows. The
conditioned medium was pumped onto a S ml Protein A column (Pharmacia) which
had been equilibrated in 20
mM Na phosphate buffer, pH 6.8. After loading, the column was washed
extensively with equilibration buffer
before elution with 100 mM citric acid, pH 3.5. The eluted protein was
immediately neutralized by collecting
1 ml fractions into tubes containing 27S ~L of 1 M Tris buffer, pH 9. The
highly purified protein was
subsequently desalted into storage buffer as described above for the poly-His
tagged proteins. The homogeneity
was assessed by SDS polyacrylamide gels and by N-terminal amino acid
sequencing by Edman degradation.
PR0211, PR0217, PR0230, PR0232, PR0187, PR026S, PR0219, PR0246, PR0228,
PROS33,
1S PR024S, PR0221, PR0227, PR0220, PR02S8, PR0266, PR0269, PR0287, PR0214,
PR0317, PR0301,
PR0224, PR0222, PR0234, PR0231, PR0229, PR0233, PR0238, PR0223, PR023S,
PR0236, PR0262,
PR0239, PR02S7, PR0260, PR0263, PR0270, PR0271, PR0272, PR0294, PR029S,
PR0293, PR0247,
PR0304, PR0302, PR0307, PR0303, PR0343, PR0328, PR0326, PR0331, PR0332,
PR0334, PR0346,
PR0268, PR0330, PR0310 and PR0339 were also successfully transiently expressed
in COS cells.
EXAMPLE SS: Expression of PRO Polype~tides in Yeast
The following method describes recombinant expression of a desired PRO
polypeptide in yeast.
First, yeast expression vectors are constructed for intracellular production
or secretion of PRO
polypeptides from the ADH2/GAPDH promoter. DNA encoding a desired PRO
polypeptide, a selected signal
peptide and the promoter is inserted into suitable restriction enzyme sites in
the selected plasmid to direct
intracellular expression of the PRO polypeptide. For secretion, DNA encoding
the PRO polypeptide can be
cloned into the selected plasmid, together with DNA encoding the ADH2/GAPDH
promoter, the yeast alpha-
factor secretory signal/leader sequence, and linker sequences (if needed) for
expression of the PRO polypeptide.
Yeast cells, such as yeast strain AB 110, can then be transformed with the
expression plasmids described
above and cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by
precipitation with 10% trichloroacetic acid and separation by SDS-PAGE,
followed by staining of the gels with
Coomassie Blue stain.
Recombinant PRO polypeptide can subsequently be isolated and purified by
removing the yeast cells
from the fermentation medium by centrifugation and then concentrating the
medium using selected cartridge
filters. The concentrate containing the PRO polypeptide may further be
purified using selected column
chromatography resins.
179
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
EXAMPLE 56: Expression of PRO Polypeptides in Baculovirus-Infected Insect
Cells
The following method describes recombinant expression of PRO polypeptides in
Baculovirus-infected
insect cells.
The desired PRO polypeptide is fused upstream of an epitope tag contained with
a baculovirus
expression vector. Such epitope tags include poly-his tags and immunoglobulin
tags (like Fc regions of IgG).
A variety of plasmids may be employed, including plasmids derived from
commercially available plasmids such
as pVL1393 (Novagen). Briefly, the PRO polypeptide or the desired portion of
the PRO polypeptide (such as
the sequence encoding the extracellular domain of a transmembrane protein) is
amplified by PCR with primers
complementary to the 5' and 3' regions. The 5' primer may incorporate flanking
(selected) restriction enzyme
sites. The product is then digested with those selected restriction enzymes
and subcloned into the expression
vector.
Recombinant baculovirus is generated by co-transfecting the above plasmid and
BaculoGoldr"" virus
DNA (Pharmingen) into Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711 )
using lipofectin (commercially
available from GIBCO-BRL). After 4-5 days of incubation at 28°C, the
released viruses are harvested and used
for further amplifications. Viral infection and protein expression is
performed as described by O'Reilley et al.,
Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford University
Press (1994).
Expressed poly-his tagged PRO polypeptide can then be purified, for example,
by Niz+-chelate affinity
chromatography as follows. Extracts are prepared from recombinant virus-
infected Sf9 cells as described by
Rupert et al., Nature, 32:175-179 (1993). Briefly, Sf9 cells are washed,
resuspended in sonication buffer (25
mL Hepes, pH 7.9; 12.5 mM MgClz; 0.1 mM EDTA; 10% Glycerol; 0.1 % NP-40; 0.4 M
KCI), and sonicated
twice for 20 seconds on ice. The sonicates are cleared by centrifugation, and
the supernatant is diluted 50-fold
in loading buffer (50 mM phosphate, 300 mM NaCI, 10% Glycerol, pH 7.8) and
filtered through a 0.45 ~cm
filter. A Niz+-NTA agarose column (commercially available from Qiagen) is
prepared with a bed volume of 5
mL, washed with 25 mL of water and equilibrated with 25 mL of loading buffer.
The filtered cell extract is
loaded onto the column at 0.5 mL per minute. The column is washed to baseline
Azao with loading buffer, at
which point fraction collection is started. Next, the column is washed with a
secondary wash buffer (50 mM
phosphate; 300 mM NaCI, 10% Glycerol, pH 6.0), which elutes nonspecifically
bound protein. After reaching
Azso baseline again, the column is developed with a 0 to 500 mM Imidazole
gradient in the secondary wash
buffer. One mL fractions are collected and analyzed by SDS-PAGE and silver
staining or western blot with
Niz+-NTA-conjugated to alkaline phosphatase (Qiagen). Fractions containing the
eluted His,o-tagged PRO
polypeptide are pooled and dialyzed against loading buffer.
Alternatively, purification of the IgG tagged (or Fc tagged) PRO polypeptide
can be performed using
known chromatography techniques, including for instance, Protein A or protein
G column chromatography.
PR0211, PR0217, PR0230, PR0187, PR0265, PR0246, PR0228, PR0533, PR0245,
PR0221,
PR0220, PR0258, PR0266, PR0269, PR0287, PR0214, PR0301, PR0224, PR0222,
PR0234, PR0231,
PR0229, PR0235, PR0239, PR0257, PR0272, PR0294, PR0295, PR0328, PR0326,
PR0331, PR0334,
PR0346 and PR0310 were successfully expressed in baculovirus infected Sf9 or
highs insect cells. While the
expression was actually performed in a 0.5-2 L scale, it can be readily scaled
up for larger (e.g. 8 L)
180
CA 02343577 2001-03-16
WO 00/15796 PCTNS99/21090
preparations. The proteins were expressed as an IgG construct (immunoadhesin),
in which the protein
extracellular region was fused to an IgG 1 constant region sequence containing
the hinge, CH2 and CH3 domains
and/or in poly-His tagged forms.
Following PCR amplification, the respective coding sequences were subcloned
into a baculovirus
expression vector (pb.PH.IgG for IgG fusions and pb.PH.His.c for poly-His
tagged proteins), and the vector
S and Baculogold~ baculovirus DNA (Pharmingen) were co-transfected into 105
Spodoptera frugiperda ("Sf9")
cells (ATCC CRL 1711), using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His
are modifications of the
commercially available baculovirus expression vector pVL1393 (Pharmingen),
with modified polylinker regions
to include the His or Fc tag sequences. The cells were grown in Hink's TNM-FH
medium supplemented with
10% FBS (Hyclone). Cells were incubated for 5 days at 28°C. The
supernatant was harvested and subsequently
used for the first viral amplification by infecting Sf9 cells in Hink's TNM-FH
medium supplemented with IO%
FBS at an approximate multiplicity of infection (MOI) of 10. Cells were
incubated for 3 days at 28°C. The
supernatant was harvested and the expression of the constructs in the
baculovirus expression vector was
determined by batch binding of 1 ml of supernatant to 25 mL of Ni-NTA beads
(QIAGEN) for histidine tagged
proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for IgG tagged
proteins followed by SDS-PAGE
analysis comparing to a known concentration of protein standard by Coomassie
blue staining.
The first viral amplification supernatant was used to infect a spinner culture
(500 ml) of Sf9 cells grown
in ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0.1. Cells
were incubated for 3 days
at 28°C. The supernatant was harvested and filtered. Batch binding and
SDS-PAGE analysis was repeated, as
necessary, until expression of the spinner culture was confirmed.
The conditioned medium from the transfected cells (0.5 to 3 L) was harvested
by centrifugation to
remove the cells and filtered through 0.22 micron filters. For the poly-His
tagged constructs, the protein
construct were purified using a Ni-NTA column (Qiagen). Before purification,
imidazole was added to the
conditioned media to a concentration of 5 mM. The conditioned media were
pumped onto a 6 ml Ni-NTA
column equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCI and 5
mM imidazole at a flow rate
of 4-5 ml/min. at 4°C. After loading, the column was washed with
additional equilibration buffer and the
protein eluted with equilibration buffer containing 0.25 M imidazole. The
highly purified protein was
subsequently desalted into a storage buffer containing 10 mM Hepes, 0.14 M
NaCI and 4 % mannitol, pH 6.8,
with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C.
Immunoadhesin (Fc containing) constructs of proteins were purified from the
conditioned media as
follows. The conditioned media were pumped onto a 5 ml Protein A column
(Pharmacia) which had been
equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column
was washed extensively with
equilibration buffer before elution with 100 mM citric acid, pH 3.5. The
eluted protein was immediately
neutralized by collecting 1 ml fractions into tubes containing 275 mL of 1 M
Tris buffer, pH 9. The highly
purified protein was subsequently desalted into storage buffer as described
above for the poly-His tagged
proteins. The homogeneity of the proteins was verified by SDS polyacrylamide
gel (PEG) electrophoresis and
N-terminal amino acid sequencing by Edman degradation.
181
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
EXAMPLE 57: Preparation of Antibodies that Bind to PRO Polypeptides
This example illustrates preparation of monoclonal antibodies which can
specifically bind to a PRO
polypeptide.
Techniques for producing the monoclonal antibodies are known in the art and
are described, for
instance, in Goding, supra. Immunogens that may be employed include purified
PRO polypeptide, fusion
proteins containing the PRO polypeptide, and cells expressing recombinant PRO
polypeptide on the cell surface.
Selection of the immunogen can be made by the skilled artisan without undue
experimentation.
Mice, such as Balb/c, are immunized with the PRO polypeptide immunogen
emulsified in complete
Freund's adjuvant and injected subcutaneously or intraperitoneally in an
amount from 1-100 micrograms.
Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi
Immunochemical Research, Hamilton,
MT) and injected into the animal's hind foot pads. The immunized mice are then
boosted 10 to 12 days later
with additional immunogen emulsified in the selected adjuvant. Thereafter, for
several weeks, the mice may also
be boosted with additional immunization injections. Serum samples may be
periodically obtained from the mice
by retro-orbital bleeding for testing in ELISA assays to detect anti-PRO
polypeptide antibodies.
After a suitable antibody titer has been detected, the animals "positive" for
antibodies can be injected
with a final intravenous injection of PRO polypeptide. Three to four days
later, the mice are sacrificed and the
spleen cells are harvested. The spleen cells are then fused (using 35 %
polyethylene glycol) to a selected murine
myeloma cell line such as P3X63AgU.1, available from ATCC, No. CRL 1597. The
fusions generate
hybridoma cells which can then be plated in 96 well tissue culture plates
containing HAT (hypoxanthine,
aminopterin, and thymidine) medium to inhibit proliferation of non-fused
cells, myeloma hybrids, and spleen
cell hybrids.
The hybridoma cells will be screened in an ELISA for reactivity against the
PRO polypeptide.
Determination of "positive" hybridoma cells secreting the desired monoclonal
antibodies against the PRO
poiypeptide is within the skill in the art.
The positive hybridoma cells can be injected intraperitoneally into syngeneic
Balb/c mice to produce
ascites containing the anti-PRO polypeptide monoclonal antibodies.
Alternatively, the hybridoma cells can be
grown in tissue culture flasks or roller bottles. Purification of the
monoclonal antibodies produced in the ascites
can be accomplished using ammonium sulfate precipitation, followed by gel
exclusion chromatography.
Alternatively, affinity chromatography based upon binding of antibody to
protein A or protein G can be
employed.
EXAMPLE 58: Chimeric PRO Polypeptides
PRO polypeptides may be expressed as chimeric proteins with one or more
additional polypeptide
domains added to facilitate protein purification. Such purification
facilitating domains include, but are not
limited to, metal chelating peptides such as histidine-tryptophan modules that
allow purification on immobilized
metals, protein A domains that allow purification on immobilized
immunoglobulin, and the domain utilized in
the FLAGSTM extension/affinity purification system (Immunex Corp., Seattle
Wash.). The inclusion of a
cleavable linker sequence such as Factor XA or enterokinase (Invitrogen, San
Diego Calif.) between the
182
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
purification domain and the PRO polypeptide sequence may be useful to
facilitate expression of DNA encoding
the PRO polypeptide.
EXAMPLE 59: Purification of PRO Polwentides Using Specific Antibodies
Native or recombinant PRO polypeptides may be purified by a variety of
standard techniques in the art
of protein purification. For example, pro-PRO polypeptide, mature PRO
polypeptide, or pre-PRO polypeptide
is purified by immunoaffinity chromatography using antibodies specific for the
PRO polypeptide of interest. In
general, an immunoaffinity column is constructed by covalently coupling the
anti-PRO polypeptide antibody to
an activated chromatographic resin.
Polyclonal immunoglobulins are prepared from immune sera either by
precipitation with ammonium
sulfate or by purification on immobilized Protein A (Pharmacia LKB
Biotechnology, Piscataway, N.J.).
Likewise, monoclonal antibodies are prepared from mouse ascites fluid by
ammonium sulfate precipitation or
chromatography on immobilized Protein A. Partially purified immunoglobulin is
covalently attached to a
chromatographic resin such as CnBr-activated SEPHAROSET"' (Pharmacia LKB
Biotechnology). The antibody
is coupled to the resin, the resin is blocked, and the derivative resin is
washed according to the manufacturer's
instructions.
Such an immunoaffinity column is utilized in the purification of PRO
polypeptide by preparing a fraction
from cells containing PRO polypeptide in a soluble form. This preparation is
derived by solubilization of the
whole cell or of a subcellular fraction obtained via differential
centrifugation by the addition of detergent or by
other methods well known in the art. Alternatively, soluble PRO polypeptide
containing a signal sequence may
be secreted in useful quantity into the medium in which the cells are grown.
A soluble PRO polypeptide-containing preparation is passed over the
immunoaffinity column, and the
column is washed under conditions that allow the preferential absorbance of
PRO polypeptide (e.g., high ionic
strength buffers in the presence of detergent). Then, the column is eluted
under conditions that disrupt
antibody/PRO polypeptide binding (e. g. , a low pH buffer such as
approximately pH 2-3, or a high concentration
of a chaotrope such as urea or thiocyanate ion), and PRO polypeptide is
collected.
EXAMPLE 60: Drug Screenine
This invention is particularly useful for screening compounds by using PRO
polypeptides or binding
fragment thereof in any of a variety of drug screening techniques. The PRO
polypeptide or fragment employed
in such a test may either be free in solution, affixed to a solid support,
borne on a cell surface, or located
intracellularly. One method of drug screening utilizes eukaryotic or
prokaryotic host cells which are stably
transformed with recombinant nucleic acids expressing the PRO polypeptide or
fragment. Drugs are screened
against such transformed cells in competitive binding assays. Such cells,
either in viable or fixed form, can be
used for standard binding assays. One may measure, for example, the formation
of complexes between PRO
polypeptide or a fragment and the agent being tested. Alternatively, one can
examine the diminution in complex
formation between the PRO polypeptide and its target cell or target receptors
caused by the agent being tested.
183
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Thus, the present invention provides methods of screening for drugs or any
other agents which can
affect a PRO polypeptide-associated disease or disorder. These methods
comprise contacting such an agent with
an PRO polypeptide or fragment thereof and assaying (I) for the presence of a
complex between the agent and
the PRO polypeptide or fragment, or (ii) for the presence of a complex between
the PRO polypeptide or fragment
and the cell, by methods well known in the art. In such competitive binding
assays, the PRO polypeptide or
fragment is typically labeled. After suitable incubation, free PRO polypeptide
or fragment is separated from that
present in bound form, and the amount of free or uncomplexed label is a
measure of the ability of the particular
agent to bind to PRO polypeptide or to interfere with the PRO polypeptide/cell
complex.
Another technique for drug screening provides high throughput screening for
compounds having suitable
binding affinity to a polypeptide and is described in detail in WO 84/03564,
published on September 13, 1984.
Briefly stated, large numbers of different small peptide test compounds are
synthesized on a solid substrate, such
as plastic pins or some other surface. As applied to a PRO polypeptide, the
peptide test compounds are reacted
with PRO polypeptide and washed. Bound PRO polypeptide is detected by methods
well known in the art.
Purified PRO polypeptide can also be coated directly onto plates for use in
the aforementioned drug screening
techniques. In addition, non-neutralizing antibodies can be used to capture
the peptide and immobilize it on the
solid support.
This invention also contemplates the use of competitive drug screening assays
in which neutralizing
antibodies capable of binding PRO polypeptide specifically compete with a test
compound for binding to PRO
polypeptide or fragments thereof. In this manner, the antibodies can be used
to detect the presence of any
peptide which shares one or more antigenic determinants with PRO polypeptide.
EXAMPLE 61: Rational Dru~s_ign
The goal of rational drug design is to produce structural analogs of
biologically active polypeptide of
interest (i. e. , a PRO polypeptide) or of small molecules with which they
interact, e. g. , agonists, antagonists, or
inhibitors. Any of these examples can be used to fashion drugs which are more
active or stable forms of the
PRO polypeptide or which enhance or interfere with the function of the PRO
polypeptide in vivo (c.f., Hodgson,
Bio/Technoloey. 9: 19-21 (1991)).
In one approach, the three-dimensional structure of the PRO polypeptide, or of
an PRO
polypeptide-inhibitor complex, is determined by x-ray crystallography, by
computer modeling or, most typically,
by a combination of the two approaches. Both the shape and charges of the PRO
polypeptide must be ascertained
to elucidate the structure and to determine active sites) of the molecule.
Less often, useful information regarding
the structure of the PRO polypeptide may be gained by modeling based on the
structure of homologous proteins.
In both cases, relevant structural information is used to design analogous PRO
polypeptide-like molecules or to
identify efficient inhibitors. Useful examples of rational drug design may
include molecules which have improved
activity or stability as shown by Braxton and Wells, Biochemistry. 31:7796-
7801 (1992) or which act as
inhibitors, agonists, or antagonists of native peptides as shown by Athauda et
al., J. Biochem., 113:742-746
(1993).
It is also possible to isolate a target-specific antibody, selected by
functional assay, as described above,
184
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
and then to solve its crystal structure. This approach, in principle, yields a
pharmacore upon which subsequent
drug design can be based. It is possible to bypass protein crystallography
altogether by generating anti-idiotypic
antibodies (anti-ids) to a functional, pharmacologically active antibody. As a
mirror image of a mirror image,
the binding site of the anti-ids would be expected to be an analog of the
original receptor. The anti-id could then
be used to identify and isolate peptides from banks of chemically or
biologically produced peptides. The isolated
S peptides would then act as the pharmacore.
By virtue of the present invention, sufficient amounts of the PRO polypeptide
may be made available
to perform such analytical studies as X-ray crystallography. In addition,
knowledge of the PRO polypeptide
amino acid sequence provided herein will provide guidance to those employing
computer modeling techniques
in place of or in addition to x-ray crystallography.
EXAMPLE 62: Diaenostic Test Usine PR0317 Polvpeptide-Specific Antibodies
Particular anti-PR0317 polypeptide antibodies are useful for the diagnosis of
prepathologic conditions,
and chronic or acute diseases such as gynecological diseases or ischemic
diseases which are characterized by
differences in the amount or distribution of PR0317. PR0317 has been found to
be expressed in human kidney
and is thus likely to be associated with abnormalities or pathologies which
affect this organ. Further, since it
is so closely related to EBAF-1, it is likely to affect the endometrium and
other genital tissues. Further, due to
library sources of certain ESTs, it appears that PR0317 may be involved as
well in forming blood vessels and
hence to be a modulator of angiogenesis.
Diagnostic tests for PR0317 include methods utilizing the antibody and a label
to detect PR0317 in
human body fluids, tissues, or extracts of such tissues. The polypeptide and
antibodies of the present invention
may be used with or without modification. Frequently, the polypeptide and
antibodies will be labeled by joining
them, either covalently or noncovalently, with a substance which provides for
a detectable signal. A wide variety
of labels and conjugation techniques are known and have been reported
extensively in both the scientific and
patent literature. Suitable labels include radionuclides, enzymes, substrates,
cofactors, inhibitors, fluorescent
agents, chemiluminescent agents, magnetic particles, and the like. Patents
teaching the use of such labels include
U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350;3,996,345; 4,277,437;
4,275,149; and 4,366,241. Also,
recombinant immunoglobulins may be produced as shown in U.S. Pat. No.
4,816,567.
A variety of protocols for measuring soluble or membrane-bound PRo317, using
either polyclonal or
monoclonal antibodies specific for that PR0317, are known in the art. Examples
include enzyme-linked
immunosorbent assay (ELISA), radioimmunoassay (RIA), radioreceptor assay
(RRA), and fluorescent activated
cell sorting (FACS). A two-site monoclonal-based immunoassay utilizing
monoclonal antibodies reactive to two
non-interfering epitopes on PR0317 is preferred, but a competitive binding
assay may be employed. These
assays are described, among other places, in Maddox et al. J Exp. Med.,
158:1211 (1983).
EXAMPLE 63: Identification of PR0317 Receptors
Purified PR0317 is useful for characterization and purification of specific
cell surface receptors and
other binding molecules. Cells which respond to PR0317 by metabolic changes or
other specific responses are
185
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
likely to express a receptor for PR0317. Such receptors include, but are not
limited to, receptors associated with
and activated by tyrosine and serine/threonine kinases. See Kolodziejczyk and
HaII, supra, for a review on
known receptors for the TGF- superfamily. Candidate receptors for this
superfamily fall into two primary
groups, termed type I and type II receptors. Both types are serine/threonine
kinases. Upon activation by the
appropriate ligand, type I and type II receptors physically interact to form
hetero-oligomers and subsequently
activate intracellular signaling cascades, ultimately regulating gene
transcription and expression. In addition,
TGF- binds to a third receptor class, type III, a membrane-anchored
proteoglycan lacking the kinase activity
typical of signal transducing molecules.
PR0317 receptors or other PR0317-binding molecules may be identified by
interaction with
radiolabeled PR0317. Radioactive labels may be incorporated into PR0317 by
various methods known in the
art. A preferred embodiment is the labeling of primary amino groups in PR0317
with 'ZSI Bolton-Hunter reagent
(Bolton and Hunter, Biochem. J., 133:529 (1973)), which has been used to label
other polypeptides without
concomitant loss of biological activity (Hebert et al., J. Biol. Chem.,
266:18989 (1991); McColl et al., J.
Immunol., 150:4550-4555 (1993}). Receptor-bearing cells are incubated with
labeled PR0317. The cells are
then washed to removed unbound PR0317, and receptor-bound PR0317 is
quantified. The data obtained using
different concentrations of PR0317 are used to calculate values for the number
and affinity of receptors.
Labeled PR0317 is useful as a reagent for purification of its specific
receptor. In one embodiment of
affinity purification, PR0317 is covalently coupled to a chromatography
column. Receptor-bearing cells are
extracted, and the extract is passed over the column. The receptor binds to
the column by virtue of its biological
affinity for PR0317. The receptor is recovered from the column and subjected
to N-terminal protein sequencing.
This amino acid sequence is then used to design degenerate oligonucleotide
probes for cloning the receptor gene.
In an alternative method, mRNA is obtained from receptor-bearing cells and
made into a cDNA library.
The library is transfected into a population of cells, and those cells
expressing the receptor are selected using
fluorescently Labeled PR0317. The receptor is identified by recovering and
sequencing recombinant DNA from
highly labeled cells.
In another alternative method, antibodies are raised against the surface of
receptor bearing cells,
specifically monoclonal antibodies. The monoclonal antibodies are screened to
identify those which inhibit the
binding of labeled PR0317. These monoclonal antibodies are then used in
affmiry purification or expression
cloning of the receptor.
Soluble receptors or other soluble binding molecules are identified in a
similar manner. Labeled
PR0317 is incubated with extracts or other appropriate materials derived from
the uterus. After incubation,
PR0317 complexes larger than the size of purified PR0317 are identified by a
sizing technique such as size-
exclusion chromatography or density gradient centrifugation and are purified
by methods known in the art. The
soluble receptors or binding proteins) are subjected to N-terminal sequencing
to obtain information sufficient
for database identification, if the soluble protein is known, or for cloning,
if the soluble protein is unknown.
EXAMPLE 64: Determination of PR0317-Induced Cellular Response
The biological activity of PR0317 is measured, for example, by binding of an
PR0317 of the invention
186
CA 02343577 2001-03-16
WO 00/15796 PCT/US99I21090
to an PR0317 receptor. A test compound is screened as an antagonist for its
ability to block binding of PR0317
to the receptor. A test compound is screened as an agonist of the PR0317 for
its ability to bind an PR0317
receptor and influence the same physiological events as PR0317 using, for
example, the KIRA-ELISA assay
described by Sadick et al. , Analytical Biochemistryt 235:207-214 ( 1996) in
which activation of a receptor
tyrosine kinase is monitored by immuno-capture of the activated receptor and
quantitation of the level of ligand-
induced phosphorylation. The assay may be adapted to monitor PR0317-induced
receptor activation through
the use of an PR0317 receptor-specific antibody to capture the activated
receptor. These techniques are also
applicable to other PRO polypeptides described herein.
EXAMPLE 65: Use of PR0224 for Screenine Compounds
PR0224 is expressed in a cell stripped of membrane proteins and capable of
expressing PR0224. Low
density lipoproteins having a detectable label are added to the cells and
incubated for a sufficient time for
endocytosis. The cells are washed. The cells are then analysed for label bound
to the membrane and within the
cell after cell lysis. Detection of the low density lipoproteins within the
cell determines that PR0224 is within
the family of low density lipoprotein receptor proteins. Members found within
this family are then used for
screening compounds which affect these receptors, and particularly the uptake
of cholesterol via these receptors.
EXAMPLE 66: Abilitv of PRO Polvnentides to Inhibit Vascular Endothelial Growth
Factor IVEGF) Stimulated
Proliferation of Endothelial Cell Growth
The ability of various PRO polypeptides to inhibit VEGF stimulated
proliferation of endothelial cells
was tested. Specifically, bovine adrenal cortical capillary endothelial (ACE)
cells (from primary culture,
maximum 12-14 passages) were plated on 96-well microtiter plates (Amersham
Life Science) at a density of 500
cells/well per 100 ~,L in low glucose DMEM, 10% calf serum, 2 mM glutamine, lx
pen/strept and fungizone,
supplemented with 3 ng/mL VEGF. Controls were plated the same way but some did
not include VEGF. A
test sample of the PRO polypeptide of interest was added in a 100 ~1 volume
for a 200 ~1 final volume. Cells
were incubated for 6-7 days at 37°C. The media was aspirated and the
cells washed lx with PBS. An acid
phosphatase reaction mixture (100 uL, O.1M sodium acetate, pH 5.5, 0.1% Triton-
100, 10 mM p-nitrophenyl
phosphate) was added. After incubation for 2 hours at 37°C, the
reaction was stopped by addition of 10 ~l 1N
NaOH. OD was measured on microtiter plate reader at 405 nm. Controls were no
cells, cells alone, cells +
FGF (5 nglmL), cells + VEGF (3 nglmL), cells + VEGF (3 ng/ml) + TGF-~i (1
ng/ml), and cells + VEGF
(3ng/mL) + LIF (5 ng/mL). (TGF-(3 at a 1 ng/ml concentration is known to block
70-90% of VEGF stimulated
cell proliferation.)
The results were assessed by calculating the percentage inhibition of VEGF (3
ng/ml) stimulated cells
proliferation, determined by measuring acid phosphatase activity at OD405 nm,
(1) relative to cells without
stimulation, and (2) relative to the reference TGF-~3 inhibition of VEGF
stimulated activity. The results, as
shown in Table 2 below, are indicative of the utility of the PRO polypeptides
in cancer therapy and specifically
in inhibiting tumor angiogenesis. The numerical values (relative inhibition)
shown in Table 2 are determined
by calculating the percent inhibition of VEGF stimulated proliferation by the
PRO polypeptide relative to cells
187
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
without stimulation and then dividing that percentage into the percent
inhibition obtained by TGF-~i at 1 ng/ml
which is known to block 70-90 % of VEGF stimulated cell proliferation.
Table 2
PRO Name PRO Concentration Relative Inhibition
PR0211 0.01 % 99.0
PR0211 0.01 % 1.09
PR0211 0.1 % 0.95
PR0211 0.1 % 67.0
PR0211 1.0 % 0.27
PR0211 1.0 % 20.0
PR0217 0.01 % 1.06
PR0217 0.1 % 0.84
PR0217 1.0 % 0.39
PR0217 2.5 ~.M 0.2
PR0217 25 nM 0.88
PR0217 250 nM 0.58
PRO 187 0.01 % 0.91
PR0187 0.1 % 0.82
PRO 187 1.0 % 0.44
PR0219 5.7 ~cM 0.61
PR0219 57 nM 1.09
PR0219 570 nM 0.97
PR0246 0.01 % 1.04
PR0246 0. I % 1.0
PR0246 1.0 % 0.49
PR0228 0.01 % 0.99
PR0228 0.1 % 0.93
PR0228 1.0 % 0.57
PR0228 0.01 % 0.95
PR0228 0.01 % 0.98
PR0228 0.1 % 0.77
PR0228 0.1 % 0.88
PR0228 1.0 % 0.16
PR0228 I.0% 0.48
PR0245 0.01 % 0.76
PR0245 0.1 % 0.35
PR0245 1.0 % 0.11
PR0245 0.48 nM I .03
PR0245 4.8 ttM 0.95
PR0245 48 nM 0.49
PR0221 0.01 % 1.03
PR0221 0.01 % 1.06
PR0221 0.1 % 0.82
PR0221 0.1 % 0.93
PR0221 1.0 % 0. 31
PR0221 I .0 % 0.43
PR0258 0.01 % 0.98
PR0258 0.01 % 1.06
SO PR0258 0.1 % 0.95
PR0258 0.1 % 1.02
PR0258 1.0 % 0.6
PR0258 1.0 % 0.69
188
CA 02343577 2001-03-16
WO 00/15796 PCT/US99J21090
PAGE INTENTIONALLY LEFT BLANK
189
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 2 cons'
PRO Name PRO Concentration Relative Inhibition
PR0301 7.0 ~cM 1.02
PR0301 70 pM O,gg
PR0301 700 p.M 0.44
PR0301 0.01 % 0.92
PR0301 0.1 % 0.85
PR0301 1.0 % 0.68
PR0224 0.01 % 101.0
PR0224 0.1 % 65.0
PR0224 1.0% 23.0
PR0272 0.01 % 0.95
PR0272 0.1 % 0.57
PR0272 1.0 % 0.18
PR0328 0.01 % 0.98
PR0328 0.1 % 0.96
PR0328 1.0 % 0.6
PR0331 0.01 % 0_gg
PR0331 0.1 % 0.82
PR0331 1.0% 0.56
EXAMPLE 67: Retinal Neuron Survival
This example demonstrates that PR0220 polypeptides have efficacy in enhancing
the survival of retinal
neuron cells.
Sprague Dawley rat pups at postnatal day 7 (mixed population: glia and retinal
neuronal types) are killed
by decapitation following CO, anesthesia and the eyes are removed under
sterile conditions. The neural retina
is dissected away from the pigment epithelium and other ocular tissue and then
dissociated into a single cell
suspension using 0.25% trypsin in Ca'+, Mg'-+-free PBS. The retinas are
incubated at 37°C for 7-10 minutes
after which the trypsin is inactivated by adding 1 ml soybean trypsin
inhibitor. The cells are plated at 100,000
cells per well in 96 well plates in DMEM/F12 supplemented with N2 and with or
without the specific test PRO
polypeptide. Cells for all experiments are grown at 37°C in a water
saturated atmosphere of 5% CO,. After
2-3 days in culture, cells are stained with calcein AM then fixed using 4 %
paraformaldehyde and stained with
DAPI for determination of total cell count. The total cells (fluorescent) are
quantified at 20X objective
magnification using CCD camera and NIH image software for Macintosh. Fields in
the well are chosen at
random.
The effect of various concentration of PR0220 polypeptides are reported in
Table 3 below where
percent survival is calculated by dividing the total number of calcein AM
positive cells at 2-3 days in culture by
the total number of DAPI-labeled cells at 2-3 days in culture. Anything above
30% survival is considered
positive.
190
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 3
PRO Name PRO Concentration Percent Survival
PR0220 0.01 % 2.4
PR0220 0.01 % 4.1
PR0220 0.1 % 3.0 %n
PR0220 0.1 % 3.1
PR0220 1.0% 72.4
PR0220 1.0 % 42.1
EXAMPLE 68: Rod Photoreceptor Survival
This example demonstrates that PR0220 polypeptides have efficacy in enhancing
the survival of rod
photoreceptor cells.
Sprague Dawley rat pups at 7 day postnatal (mixed population: glia and retinal
neuronal cell types) are
killed by decapitation following C02 anesthesis and the eyes are removed under
sterile conditions. The neural
retina is dissected away form the pigment epithelium and other ocular tissue
and then dissociated into a single
cell suspension using 0.25 % trypsin in Ca'-+, Mgz+-free PBS. The retinas are
incubated at 37°C for 7-10
minutes after which the trypsin is inactivated by adding 1 ml soybean trypsin
inhibitor. The cells are plated at
100,000 cells per well in 96 well plates in DMEM/F12 supplemented with N2 and
with or without the specific
test PRO polypeptide. Cells for all experiments are grown at 37°C in a
water saturated atmosphere of 5% C02.
After 2-3 days in culture, cells are fixed using 4 % paraformaldehyde, and
then stained using CellTracker Green
CMFDA. Rho 4D2 (ascites or IgG 1:100), a monoclonal antibody directed towards
the visual pigment rhodopsin
is used to detect rod photoreceptor cells by indirect immunofluorescence. The
results are reported as % survival:
total number of calcein/CellTracker - rhodopsin positive cells at 2-3 days in
culture, divided by the total number
of rhodopsm positive cells at time 2-3 days in culture. The total cells
(fluorescent) are quantified at 20x objective
magnification using a CCD camera and NIH image software for Macintosh. Fields
in the well are chosen at
random.
The effect of various concentration of PR0220 polypeptides are reported in
Table 4 below. Anything
above 10% survival is considered positive..
Table 4
PRO Name PRO Concentration Percent Survival
PR0220 0.01 % 0.0
PR0220 0.1 % 0.0
PR0220 2.0 % 0.0%
PR0220 10% 0.0%
PR0220 20 % 66.9 %
PR0220 1.0 % 56. 9 %
EXAMPLE 69: Induction of Endothelial Cell Apoptosis
The ability of PR0228 polypeptides to induce apoptosis in endothelial cells
was tested in human venous
umbilical vein endothelial cells (HUVEC, Cell Systems), using a 96-well
format, in 0% serum media
supplemented with 100 ng/ml VEGF. (As HUVEC cells are easily dislodged from
the plating surface, all
pipetting in the wells must be done as gently as practicable.)
191
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
The media was aspired and the cells washed once with PBS. 5 ml of 1 x trypsin
was added to the cells
in a T-175 flask, and the cells were allowed to stand until they were released
from the plate (about 5-10 minutes).
Trypsinization was stopped by adding 5 ml of growth media. The cells were spun
at 1000 rpm for 5 minutes
at 4°C. The media was aspirated and the cells were resuspended in 10 ml
of 10% serum complemented medium
(Cell Systems), 1 x pennlstrep.
The cells were plated on 96-well microtiter plates (Amersham Life Science,
cytostar-T scintillating
microplate, RPNQ160, sterile, tissue-culture treated, individually wrapped),
in 10% serum (CSG-medium, Cell
Systems), at a density of 2 x 10" cells per well in a total volume of 100 ~1.
The PR0228 polypeptide was added
in triplicate at dilutions of 1 % , 0.33 % and 0.11 % . Wells without cells
were used as a blank and wells with cells
only as a negative control. As a positive control 1:3 serial dilutions of 50
~l of a 3x stock of staurosporine were
used. The ability of the PR0228 polypeptide to induce apoptosis was determined
using Annexin V, a member
of the calcium and phospholipid binding proteins, to detect apoptosis.
0.2 ml Annexin V - Biotin stock solution (100 ~,g/ml) were diluted in 4.6 ml 2
x Ca=+ binding buffer
and 2.5 % BSA (1:25 dilution). 50 ~ls of the diluted Annexin V - Biotin
solution were added to each well (except
controls) to a final concentration of 1.0 pg/ml. The samples were incubated
for 10-15 minutes with Annexin-
Biotin prior to direct addition of 'SS-Streptavidin. 'SS-Streptavidin was
diluted in 2x Caz+ binding buffer, 2.5
BSA and was added to all wells at a final concentration of 3 x 10°
cpm/well. The plates were then sealed,
centrifuged at 1000 rpm for 15 minutes and placed on orbital shaker for 2
hours. The analysis was performed
on 1450 Microbeta Trilux (Wallac). The results are shown in Table 5 below
where percent above background
represents the percentage amount of counts per minute above the negative
controls. Percents greater than or
equal to 30% above background are considered positive.
Table 5
PRO Name PRO Concentration Percent Above Background
PR0228 0.11 % 0.7
PR0228 0.1 I % 47.6
PR0228 0.33 % 92.2
PR0228 0.33 % 123.7
PR0228 1.0 % 51.4
PR0228 1.0 % 95.3
EXAMPLE 70: PDB12 Cell Inhibition
This example demonstrates that various PRO polypeptides have efficacy in
inhibiting protein production
by PDB12 pancreatic ductal cells.
PDB12 pancreatic ductal cells are plated on fibronectin coated 96 well plates
at 1.5x10' cells per well
in 100 ~L/180 ~cL of growth media. 100 ~.L of growth media with the PRO
polypeptide test sample or negative
control lacking the PRO polypeptide is then added to well, for a final volume
of 200 ~.L. Controls contain growth
medium containing a protein shown to be inactive in this assay. Cells are
incubated for 4 days at 37°C. 20 ~L
of Alamar Blue Dye (AB) is then added to each well and the flourescent reading
is measured at 4 hours post
addition of AB, on a microtiter plate reader at 530 nm excitation and 590 nm
emission. The standard employed
is cells without Bovine Pituitary Extract (BPE) and with various
concentrations of BPE. Buffer or CM controls
192
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
from unknowns are run 2 times on each 96 well plate.
The results from these assays are shown in Table 6 below wherein percent
decrease in protein
production is calculated by comparing the Alamar Blue Dye calculated protein
concentration produced by the
PRO polypeptide-treated cells with the Alamar Blue Dye calculated protein
concentration produced by the
negative control cells. A percent decrease in protein production of greater
than or equal to 25%a as compared
to the negative control cells is considered positive.
Table 6
PRO Name PRO Concentration Percent Decrease in Protein
Production
PR0211 0.1 % 0.0%
PR0211 0.01 % 0. 6 %
PR0211 1.0% 59.7%n
PR0287 2.0 % 22. 3
PR0287 10% 18.2%
PR0287 50 % 67.5
1 S PR0287 2.0 % 45.53
PR0287 10 % 57.3
PR0287 SO % 52.24
PR0301 2.0 % 0.0 %
PR0301 10 % 59. 8 %
PR0301 50 % 65.6
PR0293 2.0 % 0.0
PR0293 10 % 40.4 %
PR0293 50% 56.7%
EXAMPLE 71: Stimulation of Adult Heart Hvnertronhv
This assay is designed to measure the ability of various PRO polypeptides to
stimulate hypertrophy of
adult heart.
Ventricular myocytes freshly isolated from adult (250g) Sprague Dawley rats
are plated at 2000 ccll/well
in 180 ~.1 volume. Cells are isolated and plated on day 1, the PRO polypeptide-
containing test samples or growth
medium only (negative control) (20 ~.1 volume) is added on day 2 and the cells
are then fixed and stained on day
5. After staining, cell size is visualized wherein cells showing no growth
enhancement as compared to control
cells are given a value of 0.0, cells showing small to moderate growth
enhancement as compared to control cells
are given a value of 1.0 and cells showing large growth enhancement as
compared to control cells are given a
value of 2Ø Any degree of growth enhancement as compared to the negative
control cells is considered positive
for the assay. The results are shown in Table 7 below.
Table 7
PRO Name PRO Concentration Growth Enhancement
Score
PR0287 20 % 1.0
PR0287 20% 1.0
PR0301 20 % 1.0
PR0301 20 % 1.0
PR0293 20 % 1.0
PR0293 20 % 1.0
PR0303 20 % 1.0
PR0303 20 % 1.0
193
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
EXAMPLE 72: PDB12 Cell Proliferation
This example demonstrates that various PRO polypeptides have efficacy in
inducing proliferation of
PDB12 pancreatic ductal cells.
PDB12 pancreatic ductal cells are plated on fibronectin coated 96 well plates
at 1.5x10' cells per well
in 100 ~.L/180 /cL of growth media. 100 /eL of growth media with the PRO
polypeptide test sample or negative
control lacking the PRO polypeptide is then added to well, for a final volume
of 200 uL. Controls contain growth
medium containing a protein shown to be inactive in this assay. Cells are
incubated for 4 days at 37°C. 20 PL
of Alamar Blue Dye (AB) is then added to each well and the flourescent reading
is measured at 4 hours post
addition of AB, on a microtiter plate reader at 530 nm excitation and 590 nm
emission. The standard employed
is cells without Bovine Pituitary Extract (BPE) and with various
concentrations of BPE. Buffer or growth
medium only controls from unknowns are run 2 times on each 96 well plate.
The results from these assays are shown in Table 8 below wherein percent
increase in protein production
is calculated by comparing the Alamar Blue Dye calculated protein
concentration produced by the PRO
polypeptide-treated cells with the Alamar Blue Dye calculated protein
concentration produced by the negative
control cells. A percent increase in protein production of greater than or
equal to 25 % as compared to the
negative control cells is considered positive.
Table 8
PRO Name PRO Concentration Percent Increase in Protein
Production
PR0301 2.0 % ~, 0 %
PR0301 10 % 67.4
PR0301 50 % 185.8
PR0303 2.0 % 27. 9 %
PR0303 10 % 174.9
PR0303 SO % 193.1 %
EXAMPLE 73: Enhancement of Neart Neonatal Hypertrophy Induced by PR0224
This assay is designed to measure the ability of PR0224 polypeptides to
stimulate hypertrophy of
neonatal heart.
Cardiac myocytes from I-day old Harlan Sprague Dawley rats were obtained.
Cells (180 /el at 7.5 x
104/ml, serum < 0.1 % , freshly isolated) are added on day 1 to 96-well plates
previously coated with DMEM/F12
+ 4 % FCS. Test samples containing the test PR0224 polypeptide or growth
medium only (hegative control) (20
~,1/well) are added directly to the wells on day 1. PGF (20 ~l/well) is then
added on day 2 at final concentration
of 10-6 M. The cells are then stained on day 4 and visually scored on day 5,
wherein cells showing no increase
in size as compared to negative controls are scored 0.0, cells showing a small
to moderate increase in size as
compared to negative controis are scored 1.0 and cells showing a large
increase in size as compared to negative
controls are scored 2Ø The results are shown in Table 9 below.
194
CA 02343577 2001-03-16
WO 00/15796 PCT1US99/21090
Table 9
PRO Name PRO Concentration Growth Enhancement Score
PR0224 0.01 % 0.0
PR0224 0.1 % 0.0
PR0224 1.0 % 1.0
EXAMPLE 74: In situ Hybridization
In situ hybridization is a powerful and versatile technique for the detection
and localization of nucleic
acid sequences within cell or tissue preparations. It may be useful, for
example, to identify sites of gene
expression, analyze the tissue distribution of transcription, identify and
localize viral infection, follow changes
in specific mRNA synthesis and aid in chromosome mapping.
In situ hybridization was performed following an optimized version of the
protocol by Lu and Gillett,
Cell Vision 1:169-176 (1994), using PCR-generated "P-labeled riboprobes.
Briefly, formalin-fixed, paraffin-
embedded human tissues were sectioned, deparaffinized, deproteinated in
proteinase K (20 g/ml) for 15 minutes
at 37°C, and further processed for in situ hybridization as described
by Lu and Gillett, supra. A ["-P) UTP-
labeled antisense riboprobe was generated from a PCR product and hybridized at
55°C overnight. The slides
were dipped in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks.
"P-Riboprobe synthesis
6.0 ~I ( 125 mCi) of "P-UTP (Amersham BF 1002, SA < 2000 Ci/mmol) were speed
roac dried. To each
tube containing dried "P-UTP, the following ingredients were added:
2.0 ~1 Sx transcription buffer
1.0 ~cl DTT (100 mM)
2.0 wl NTP mix (2.5 mM : 10 P,; each of 10 mM GTP, CTP & ATP + 10 tcl H20)
1.0 p.l UTP (50 ~,M)
1.0 ~1 Rnasin
1.0 td DNA template (leg)
I .0 ~1 H,O
1.0 ~l RNA polymerase (for PCR products T3 = AS, T7 = S, usually)
The tubes were incubated at 37°C for one hour. 1.0 ~.1 RQ1 DNase were
added, followed by incubation
at 37°C for 15 minutes. 90 tcl TE (10 mM Tris pH 7.6/1mM EDTA pH 8.0)
were added, and the mixture was
pipetted onto DE81 paper. The remaining solution was loaded in a Microcon-50
ultrafiltration unit, and spun
using program 10 (6 minutes). The filtration unit was inverted over a second
tube and spun using program 2
(3 minutes). After the final recovery spin, 100 ~1 TE were added. I ~,1 of the
final product was pipetted on
DE81 paper and counted in 6 ml of Biofluor II.
The probe was run on a TBE/urea gel. 1-3 Pl of the probe or 5 ~1 of RNA Mrk
III were added to 3
pl of loading buffer. After heating on a 95°C heat block for three
minutes, the gel was immediately placed on
ice. The wells of gel were flushed, the sample loaded, and run at 180-250
volts for 45 minutes. The gel was
wrapped in saran wrap and exposed to XAR film with an intensifying screen in -
70°C freezer one hour to
overnight.
195
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
"P-Hybridization
A. Pretreatment of frozen sections
The slides were removed from the freezer, placed on aluminium trays and thawed
at room temperature
for 5 minutes. The trays were placed in 55°C incubator for five minutes
to reduce condensation. The slides
were fixed for 10 minutes in 4 % paraformaldehyde on ice in the fume hood, and
washed in 0.5 x SSC for 5
minutes, at room temperature (25 ml 20 x SSC + 975 ml SQ Hz0). After
deproteination in 0.5 ~g/ml proteinase
K for 10 minutes at 37°C (12.5 ~.l of 10 mg/ml stock in 250 ml
prewarmed RNase-free RNAse buffer), the
sections were washed in 0.5 x SSC for 10 minutes at room temperature. The
sections were dehydrated in 70 % ,
95 % , 100 % ethanol, 2 minutes each.
B. Pretreatment of paraffin-embedded sections
The slides were deparaffinized, placed in SQ H,O, and rinsed twice in 2 x SSC
at room temperature,
for 5 minutes each time. The sections were deproteinated in 20 p,g/ml
proteinase K (500 ~l of 10 mg/ml in 250
ml RNase-free RNase buffer; 37°C, 15 minutes) - human embryo, or 8 x
proteinase K (100 pl in 250 ml Rnase
buffer, 37°C, 30 minutes) - formalin tissues. Subsequent rinsing in 0.5
x SSC and dehydration were performed
as described above.
C. Prehybridization
The slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50%
formamide) - saturated
filter paper. The tissue was covered with 50 ~1 of hybridization buffer (3.75g
Dextran Sulfate + 6 ml SQ HZO),
vortexed and heated in the microwave for 2 minutes with the cap loosened.
After cooling on ice, 18.75 ml
formamide, 3.75 ml 20 x SSC and 9 ml SQ HZO were added, the tissue was
vortexed well, and incubated at
42°C for 1-4 hours.
D. Hybridization
1.0 x 106 cpm probe and 1.0 PI tRNA (50 mg/ml stock) per slide were heated at
95°C for 3 minutes.
The slides were cooled on ice, and 48 ~,1 hybridization buffer were added per
slide. After vortexing, 50 ~1 33p
mix were added to 50 ~,l prehybridization on slide. The slides were incubated
overnight at 55°C.
E. Washes
Washing was done 2 x 10 minutes with 2xSSC, EDTA at room temperature (400 ml
20 x SSC + 16
ml 0.25M EDTA, V f=4L), followed by RNaseA treatment at 37 °C for 30
minutes (500 ~.1 of 10 mg/ml in 250
ml Rnase buffer = 20 P,g/ml), The slides were washed 2 x 10 minutes with 2 x
SSC, EDTA at room
temperature. The stringency wash conditions were as follows: 2 hours at
55°C, 0.1 x SSC, EDTA (20 ml 20
x SSC + 16 mI EDTA, V~=4L).
F. Oli~onucleotides
In situ analysis was performed on a variety of DNA sequences disclosed herein.
The oligonucleotides
employed for these analyses are as follows.
(1) DNA33094-1131 (PR0217)
pl 5'-GGATTCTAATACGACTCACTATAGGGCTCAGAAAAGCGCAACAGAGAA-3' (SEQ ID
N0:348)
p2 5'-CTATGAAATTAACCCTCACTAAAGGGATGTCTTCCATGCCAACCTTC-3(SEQIDN0:349)
196
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
(2) DNA33223-1136 (PR0230)
pl S'-GGATTCTAATACGACTCACTATAGGGCGGCGATGTCCACTGGGGCTAC-3' (SEQ ID
N0:3S0)
p2 S'-CTATGAAATTAACCCTCACTAAAGGGACGAGGAAGATGGGCGGATGGT-3' (SEQ ID
N0:3S 1 )
(3) DNA3443S-1140 (PR0232)
pl 5'-GGATTCTAATACGACTCACTATAGGGCACCCACGCGTCCGGCTGCTT-3(SEQ ID N0:352)
p2 S'-CTATGAAATTAACCCTCACTAAAGGGACGGGGGACACCACGGACCAGA-3' (SEQ ID
N0:3S3)
(4) DNA3S639-1172 (PR0246)
pl S'-GGATTCTAATACGACTCACTATAGGGCTTGCTGCGGTTTTTGTTCCTG-3CSEQIDN0:354)
p2 S'-CTATGAAATTAACCCTCACTAAAGGGAGCTGCCGATCCCACTGGTATT-3' (SEQ ID
N0:3SS)
(S) DNA4943S-12191PROS33)
pl S'-GGATTCTAATACGACTCACTATAGGGCGGATCCTGGCCGGCCTCTG-3' (SEQ ID N0:356)
p2 S'-CTATGAAATTAACCCTCACTAAAGGGAGCCCGGGCATGGTCTCAGTTA-3' (SEQ ID
N0:357)
(6) DNA35638-1141 (PR0245)
p 1 S'-GGATTCTAATACGACTCACTATAGGGCGGGAAGATGGCGAGGAGGAG-3'(SEQ ID N0:3S8)
p2 S'-CTATGAAATTAACCCTCACTAAAGGGACCAAGGCCACAAACGGAAATC-3' (SEQ ID
N0:3S9)
(7) DNA33089-1132 (PR0221)
p 1 5'-GGATTCTAATACGACTCACTATAGGGCTGTGCTTTCATTCTGCCAGTA-3(SEQ ID N0:360)
p2 S'-CTATGAAATTAACCCTCACTAAAGGGAGGGTACAATTAAGGGGTGGAT-3' (SEQ ID
N0:361)
(8) DNA35918-1174 (PR0258)
p I 5'-GGATTCTAATACGACTCACTATAGGGCCCGCCTCGCTCCTGCTCCTG-3 CSEQ ID N0:362)
p2 S'-CTATGAAATTAACCCTCACTAAAGGGAGGATTGCCGCGACCCTCACAG-3' (SEQ ID
N0:363)
(9) DNA32286-1191 (PR0214)
pl S'-GGATTCTAATACGACTCACTATAGGGCCCCTCCTGCCTTCCCTGTCC-3'(SEQ 1D N0:364)
197
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
p2 S'-CTATGAAATTAACCCTCACTAAAGGGAGTGGTGGCCGCGATTATCTGC-3' (SEQ ID
N0:365)
(10) DNA33221-1133 (PR0224)
pI 5'-GGATTCTAATACGACTCACTATAGGGCGCAGCGATGGCAGCGATGAGG-3' (SEQ ID
N0:366)
p2 5'-CTATGAAATTAACCCTCACTAAAGGGACAGACGGGGCAGAGGGAGTG-3'(SEQ ID N0:367)
(11) DNA35557-1137 (PR0234)
p 1 5'-GGATTCTAATACGACTCACTATAGGGCCAGGAGGCGTGAGGAGAAAC-3'(SEQ ID N0:368)
p2 5'-CTATGAAATTAACCCTCACTAAAGGGAAAGACATGTCATCGGGAGTGG-3' (SEQ ID
N0:369)
(12) DNA33100-1159 (PR0229)
pl 5'-GGATTCTAATACGACTCACTATAGGGCCGGGTGGAGGTGGAACAGAAA-3' (SEQ ID
N0:370)
p2 5'-CTATGAAATTAACCCTCACTAAAGGGACACAGACAGAGCCCCATACGC-3' (SEQ ID
N0:371)
(13) DNA34431-11771PR0263)
p 1 5'-GGATTCTAATACGACTCACTATAGGGCCAGGGAAATCCGGATGTCTC-3(SEQ ID N0:372)
p2 5'-CTATGAAATTAACCCTCACTAAAGGGAGTAAGGGGATGCCACCGAGTA-3' (SEQ ID
N0:373)
(14) DNA38268-1188 (PR0295)
p 1 S'-GGATTCTAATACGACTCACTATAGGGCCAGCTACCCGCAGGAGGAGG-3'(SEQ ID N0:374)
p2 5'-CTATGAAATTAACCCTCACTAAAGGGATCCCAGGTGATGAGGTCCAGA-3' (SEQ ID
N0:375)
G. Results
In situ analysis was performed on a variety of DNA sequences disclosed herein.
The results from these
analyses are as follows.
(1) DNA33094-1131 (PR0217)
Highly distinctive expression pattern, that does not indicate an obvious
biological function. In the human
embryo it was expressed in outer smooth muscle layer of the GI tract,
respiratiry cartilage, branching respiratory
epithelium, osteoblasts, tendons, gonad, in the optic nerve head and
developing dermis. In the adult expression
was observed in the epidermal pegs of the chimp tongue, the basal
epithelial/myoepithelial cells of the prostate
and urinary bladder. Also expressed in the alveolar lining cells of the adult
lung, mesenchymal cells juxtaposed
198
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
to erectile tissue in the penis and the cerebral cortex (probably glial
cells). In the kidney, expression was only
seen in disease, in cells surrounding thyroidized renal tubules.
Human fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical
cord, liver, kidney, adrenals,
thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine,
spleen, thymus, pancreas, brain, eye,
spinal cord, body wall, pelvis and lower limb.
Adult human tissues examined: Kidney (normal and end-stage), adrenal,
myocardium, aorta, spleen, lymph
node, gall bladder, pancreas, lung, skin, eye (inc. retina), prostate,
bladder, liver (normal, cirrhotic, acute
failure).
Non-human primate tissues examined:
(a) Chimp Tissues: Salivary gland, stomach, thyroid, parathyroid, skin,
thymus, ovary, lymph
node.
(b) Rhesus Monkey Tissues: Cerebral cortex, hippocampus, cerebellum, penis.
(2) DNA33223-1136 (PR0230)
Sections show an intense signal associated with arterial and venous vessels in
the fetus. In arteries the
signal appeared to be confined to smooth-muscle/pericytic cells. The signal is
also seen in capillary vessels and
in glomeruli. 1t is not clear whether or not endothelial cells are expressing
this mRNA. Expression is also
observed in epithelial cells in the fetal lens. Strong expression was also
seen in cells within placental
trophoblastic villi, these cells lie between the trophoblast and the
fibroblast-like cells that express HGF -
uncertain histogenesis. In the adult, there was no evidence of expression and
the wall of the aorta and most
vessels appear to be negative. However, expression was seen over vascular
channels in the normal prostate and
in the epithelium lining the gallbladder. Insurers expression was seen in the
vessels of the soft-tissue sarcoma
and a renal cell carcinoma. In summary, this is a molecule that shows
relatively specific vascular expression
in the fetus as well as in some adult organs. Expression was also observed in
the fetal lens and the adult
gallbladder.
In a secondary screen, vascular expression was observed, similar to that
observed above, seen in fetal
blocks. Expression is on vascular smooth muscle, rather than endothelium.
Expression also seen in smooth
muscle of the developing oesophagus, so as reported previously, this molecule
is not vascular specific.
Expression was examined in 4 lung and 4 breast carcinomas. Substantial
expression was seen in vascular smooth
muscle of at least 3/4 lung cancers and 2/4 breast cancers. In addition, in
one breast carcinoma, expression was
observed in peritumoral stromal cells of uncertain histogenesis (possibly
myofibroblasts). No endothelial cell
expression was observed in this study.
(3) DNA34435-1140 (PR0232)
Strong expression in prostatic epithelium and bladder epithelium, lower level
of expression in bronchial
epithelium. High background / low level expression seen in a number of sites,
including among others, bone,
blood, chondrosarcoma, adult heart and fetal liver. It is felt that this level
of signal represents background, partly
because signal at this level was seen over the blood. All other tissues
negative.
199
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Human fetal tissues examined (E12-E16 weeks) include' Placenta, umbilical
cord, liver, kidney, adrenals,
thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine,
spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis, testis
and lower limb.
Adult human tissues examined: Kidney (normal and end-stage), adrenal, spleen,
lymph node, pancreas, lung,
eye (inc. retina), bladder, liver (normal, cirrhotic, acute failure).
Non-humanprimate tissues examined:
Chimp Tissues: adrenal
Rhesus Monkev Tissues: Cerebral cortex, hippocampus
In a secondary screen, expression was observed in the epithelium of the
prostate, the superficial layers
of the urethelium of the urinary bladder, the urethelium lining the renal
pelvis and the urethelium of the ureter
(1 out of 2 experiments). The urethra of a rhesus.monkey was negative; it is
unclear whether this represents a
true lack of expression by the urethra, or if it is the result of a failure of
the probe to cross react with rhesus
tissue. The findings in the prostate and bladder are similar to those
previously described using an isotopic
detection technique. Expression of the mRNA for this antigen is NOT prostate
epithelial specific. The antigen
may serve as a useful marker for urethelial derived tissues. Expression in the
superficial, post-mitotic cells, of
the urinary tract epithelium also suggest that it is unlikely to represent a
specific stem cell marker, as this would
be expected to be expressed specifically in basal epithelium.
(4) DNA35639-1172 (PR0246)
Strongly expressed in fetal vascular endothelium, including tissues of the
CNS. Lower level of
expression in adult vasculature, including the CNS. Not obviously expressed at
higher levels in tumor vascular
endothelium. Signal also seen over bone matrix and adult spleen, not obviously
cell associated, probably related
to non-specific background at these sites.
Human fetal tissues examined (E12-E16 weeks) include Placenta, umbilical cord,
liver, kidney, adrenals,
thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine,
spleen, thymus, pancreas, brain, eye,
spinal cord, body wall, pelvis, testis and lower limb.
Adult human tissues examined: Kidney (normal and end-stage), adrenal, spleen,
lymph node, pancreas, lung,
eye (inc. retina), bladder, liver (normal, cirrhotic, acute failure).
Non-human primate tissues examined:
Chimp Tissues: adrenal
Rhesus Monkey Tissues: Cerebral cortex, hippocampus
(S) DNA49435-1219 (PR0533)
Moderate expression over cortical neurones in the fetal brain. Expression over
the inner aspect of the
fetal retina, possible expression in the developing lens. Expression over
fetal skin, cartilage, small intestine,
placental villi and umbilical cord. In adult tissues there is an extremely
high level of expression over the
gallbladder epithelium. Moderate expression over the adult kidney, gastric and
colonic epithelia. Low-level
expression was observed over many cell types in many tissues, this may be
related to stickiness of the probe,
200
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
these data should therefore be interpreted with a degree of caution.
Human fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical
cord, liver, kidney, adrenals,
thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine,
spleen, thymus, pancreas, brain, eye,
spinal cord, body wall, pelvis, testis and lower limb.
Adult human tissues examined: Kidney (normal and end-stage), adrenal, spleen,
lymph node, pancreas, lung,
eye (inc. retina), bladder, liver (normal, cirrhotic, acute failure).
Non-human primate tissues examined:
Chimp Tissues: adrenal
Rhesus Monkev Tissues: Cerebral cortex, hippocampus, cerebellum.
(6) DNA35638-1141 (PR0245)
Expression observed in the endothelium lining a subset of fetal and placental
vessels. Endothelial
expression was confined to these tissue blocks. Expression also observed over
intermediate trophoblast cells of
placenta. All other tissues negative.
Fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical cord,
liver, kidney, adrenals, thyroid,
lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen,
thymus, pancreas, brain, eye, spinal
cord, body wall, pelvis and lower limb.
Adult tissues examined: Liver, kidney, adrenal, myocardium, aorta, spleen,
lymph node,
pancreas, lung, skin, cerebral cortex (rm), hippocampus(rm), cerebellum(rm),
penis, eye, bladder, stomach,
gastric carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid
(chimp) ovary (chimp) and
chondrosarcoma. Acetominophen induced liver injury and hepatic
cirrhosis
(7) DNA33089-1132 (PR0221)
Specific expression over fetal cerebral white and grey matter, as well as over
neurones in the spinal
cord. Probe appears to cross react with rat. Low level of expression over
cerebellar neurones in adult rhesus
brain. All other tissues negative.
Fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical cord,
liver, kidney, adrenals, thyroid,
lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen,
thymus, pancreas, brain, eye, spinal
cord, body wall, pelvis and lower limb.
Adult tissues examined: Liver, kidney, adrenal, myocardium, aorta, spleen,
lymph node,
pancreas, lung, skin, cerebral cortex (rm), hippocampus(rm), cerebellum(rm),
penis, eye, bladder, stomach,
gastric carcinoma, colon, colonic carcinoma and chondrosarcoma. Acetominophen
induced liver injury and
hepatic cirrhosis
(8) DNA35918-1174 (PR0258)
Strong expression in the nervous system. In the rhesus monkey brain expression
is observed in cortical,
hippocampal and cerebellar neurones. Expression over spinal neurones in the
fetal spinal cord, the developing
201
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
brain and the inner aspects of the fetal retina. Expression over developing
dorsal root and autonomic ganglia as
well as enteric nerves. Expression observed over ganglion cells in the adult
prostate. In the rat, there is strong
expression over the developing hind brain and spinal cord. Strong expression
over interstitial cells in the
placental villi. All other tissues were negative.
Fetal tissues examined 1E12-E16 weeks) include: Placenta, umbilical cord,
liver, kidney, adrenals, thyroid,
lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen,
thymus, pancreas, brain, eye, spinal
cord, body wall, pelvis and lower limb.
Adult tissues examined: Liver, kidney, renal cell carcinoma, adrenal, aorta,
spleen, lymph
node, pancreas, lung, myocardium, skin, cerebral cortex (rm), hippocampus(rm),
cerebellum(rm), bladder,
prostate, stomach, gastric carcinoma, colon, colonic carcinoma, thyroid
(chimp), parathyroid (chimp) ovary
(chimp) and chondrosarcoma. Acetominophen induced liver injury and hepatic
cirrhosis.
(9) DNA32286-1191 (PR0214)
Fetal tissue: Low level throughout mesenchyme. Moderate expression in
placental stromal cells in
membranous tissues and in thyroid. Low level expression in cortical neurones.
Adult tissue: all negative.
Fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical cord,
liver, kidney, adrenals, thyroid,
lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen,
thymus, pancreas, brain, eye, spinal
cord, body wall, pelvis and lower limb.
Adult tissues examined include: Liver, kidney, adrenal, myocardium, aorta,
spleen, lymph node, pancreas, lung
and skin.
(10) DNA33221-1133 (PR0224)
Expression limited to vascular endothelium in fetal spleen, adult spleen,
fetal liver, adult thyroid and
adult lymph node (chimp). Additional site of expression is the developing
spinal ganglia. All other tissues negative.
Human fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical
cord, liver, kidney, adrenals,
thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine,
spleen, thymus, pancreas, brain, eye,
spinal cord, body wall, pelvis and lower limb.
Adult human tissues examined: Kidney (normal and end-stage), adrenal,
myocardium, aorta, spleen, lymph
node, pancreas, lung, skin, eye (inc. retina), bladder, liver (normal,
cirrhotic, acute failure).
Non-human primate tissues examined:
Chimp Tissues: Salivary gland, stomach, thyroid, parathyroid, skin, thymus,
ovary, lymph node.
Rhesus Monkev Tissues: Cerebral cortex, hippocampus, cerebellum, penis.
(11) DNA35557-1137 (PR0234)
Specific expression over developing motor neurones in ventral aspect of the
fetal spinal cord. (will
develop into ventral horns of spinal cord). All other tissues negative.
Possible role in growth, differentiation
and/or development of spinal motor neurons.
202
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical cord,
liver, kidney, adrenals, thyroid,
lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen,
thymus, pancreas, brain, eye, spinal
cord, body wall, pelvis and lower limb.
Adult tissues examined: Liver, kidney, adrenal, myocardium, aorta, spleen,
lymph node,
pancreas, lung, skin, cerebral cortex (rm), hippocampus(rm), cerebellum(rm),
penis, eye, bladder, stomach,
S gastric carcinoma, colon, colonic carcinoma and chondrosarcoma.
Acetominophen induced liver injury and
hepatic cirrhosis
(12) DNA33100-11591PR0229)
Striking expression in mononuclear phagocytes (macrophages) of fetal and adult
spleen, liver, lymph
node and adult thymus (in tingible body macrophages). The highest expression
is in the spleen. All other tissues
negative. Localisation and homology are entirely consistent with a role as a
scavenger receptor for cells of the
reticuloendothelial system. Expression also observed in placental mononuclear
cells.
Human fetal tissues examined (E12-E16 weeks) include' Placenta, umbilical
cord, liver, kidney, adrenals,
thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine,
1S spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and
lower limb.
Adult human tissues examined : Kidney (normal and end-stage), adrenal,
myocardium, aorta, spleen, lymph
node, gall bladder, pancreas, lung, skin, eye (inc. retina), prostate,
bladder, liver (normal, cirrhotic, acute
failure).
Non-human primate tissues examined:
Chimp Tissues: Salivary gland, stomach, thyroid, parathyroid, skin, thymus,
ovary, lymph node.
Rhesus Monkey Tissues: Cerebral cortex, hippocampus, cerebellum, penis.
(13) DNA34431-1177 (PR0263)
Widepread expression in human fetal tissues and placenta over mononuclear
cells, probably
2S macrophages +/- lymphocytes. The cellular distribution follows a
perivascular pattern in many tissues. Strong
expression also seen in epithelial cells of the fetal adrenal cortex. All
adult tissues were negative.
Fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical cord,
liver, kidney, adrenals, thyroid,
lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen,
thymus, pancreas, brain, eye, spinal
cord, body wall, pelvis and lower limb.
Adult tissues examined: Liver, kidney, adrenal, spleen, lymph node, pancreas,
lung, skin, cerebral cortex (rm),
hippocampus(rm), cerebellum(rm), bladder, stomach, colon and colonic
carcinoma. Acetominophen induced
liver injury and hepatic cirrhosis.
A secondary screen evidenced expression over stromal mononuclear cells
probably histiocytes.
3S (14) DNA38268-1188 (PR0295)
High expression over ganglion cells in human fetal spinal ganglia and over
large neurones in the anterior horns
of the developing spinal cord. In the adult there is expression in the chimp
adrenal medulla (neural), neurones
Zas
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
of the rhesus monkey brain (hippocampus [+++] and cerebral cortex) and
neurones in ganglia in the normal
adult human prostate (the only section that contains ganglion cells, ie
expression in this cell type is presumed
NOT to be confined to the prostate). All other tissues negative.
Human fetal tissues examined (E12-E16 weeks) include' Placenta, umbilical
cord, liver, kidney, adrenals,
thyroid, lungs, great vessels, stomach, small intestine, spleen, thymus,
pancreas, brain, eye, spinal cord, body
wall, pelvis, testis and lower limb.
Adult human tissues examined: Kidney (normal and end-stage), adrenal, spleen,
lymph node, pancreas, lung,
eye (inc. retina), bladder, liver (normal, cirrhotic, acute failure).
Non-human primate tissues examined:
Chimp Tissues: adrenal
Rhesus Monkev Tissues: Cerebral cortex, hippocampus, cerebellum.
204
CA 02343577 2001-03-16
WO 00!15796 PCT/US99/21090
Table 10
/*
* C-C increased from 12 to IS
* Z is average of EQ
$ * B is average of ND
* match with stop is M; stop-stop = 0; J (joker) match = 0
*%
#define M -8 /* value of a match with a stop */
int _day(26](26] _ {
/* A B C D E F G H I J K L M N O P Q R S T U V W X Y Z */
/* { 2, 0,-2, 0, 0,-4, I,-1,-1, 0,-I,-2,-1, 0, M, 1, 0,-2,
A 1, 1, 0, 0,-6, 0,-3, 0},
*/
/* { 0, 3,-4, 3, 2,-5, 0, 1,-2, 0, 0,-3,-Z, 2, M,-1, 1, 0,
B 0, 0, 0,-2,-5, 0,-3, 1},
*/
/* {-2,-4,15,-5,-5,-4,-3,-3,-2, 0,-5,-6,-5,-4, M,-3,-5,-4,
C 0,-2, 0,-2,-8, 0, 0,-5},
*/
1$ /* { 0, 3,-5, 4, 3,-6, 1, I,-2, 0, 0,-4,-3, 2, M,-1, 2,-1,
D 0, 0, 0,-2,-7, 0,-4, 2},
*/
/* { 0, 2,-5, 3, 4,-5, 0, 1,-2, 0, 0,-3,-2, I, M,-1, 2,-1,
E 0, 0, 0,-2,-7, 0,-4, 3},
*/
/* {-4,-5,-4,-6,-5, 9,-5,-2, 1, 0,-5. 2, 0,-4, M,-5,-5,-4,-3,-3,
F 0,-1, 0, 0, 7,-5},
*/
/* { 1, 0,-3, 1, 0,-5, 5,-2,-3, 0,-2,-4,-3, O, M,-1,-I,-3,
G 1, 0, 0,-1,-7, 0,-5, 0},
*/
/* {-1, 1,-3, 1, I,-2,-2, 6,-2, 0, 0,-2,-2, 2, M, 0, 3, 2,-I,-1,
H 0,-2,-3, 0, 0, 2},
*/
/* {-1,-2,-2,-2,-2, I,-3,-2, 5, 0,-2, 2, 2,-2, M,-2,-2,-2,-1,
I 0, 0, 4,-5, 0,-I,-2},
*/
/* { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, O, M, 0, 0, 0,
1 0, 0, 0, 0, 0, 0, 0, 0},
*/
/* {-1, 0,-5, 0, 0,-5,-2, 0,-2, 0, 5,-3, 0, I, M,-1, 1, 3,
K 0, 0, 0,-2,-3, 0,-4, 0},
*/
/* {-2,-3,-6,-4,-3, 2,-4,-2, 2, 0,-3, 6, 4,-3,_M,-3,-2,-3,-3,-1,
L 0, 2,-2, 0,-1,-2},
*/
/* {-1,-2,-5,-3,-2, 0,-3,-2, 2, 0, 0, 4, 6,-2, M,-2,-1, 0,-2,-1,
M 0, 2,-4, 0,-2,-1},
*/
/* { 0, 2,-4, 2, 1,-4, 0, 2,-2, 0, 1,-3,-2, 2, M,-1, 1, 0,
N 1, 0, 0,-2,-4, 0,-2, 1},
*l
/* { M, M,_M,_M, M, M, M, M,_M,_M,_M,_M,_M,_M, O, M, M, M,
O M, M, M, M, M, M, M,
*/ M},
/* _
P { I,-1,-3,-I,-I,-5,-1, 0,-2, 0,-I,-3,-2,-1, M, 6, 0, 0,
*/ 1, 0, 0,-1,-6, 0,-5, 0},
/* { 0, 1,-5, 2, 2,-5,-1, 3,-2, 0, 1,-2,-1, 1, M, 0, 4, 1,-I,-1,
Q 0,-2,-5, 0,-4, 3},
*/
/* {-2, 0,-4,-I,-1,-4,-3, 2,-2, 0, 3,-3, 0, O, M, 0, 1, 6,
R 0,-1, 0,-2, 2, 0,-4, 0},
*/
/* { 1, 0, 0, 0, 0,-3, I,-I,-I, 0, 0,-3,-2, 1, M, l,-1, 0,
S 2, I, 0,-1,-2, 0,-3, 0},
*/
I* { 1, 0,-2, 0, 0,-3, 0,-1, 0, 0, 0,-1,-1, O, M, 0,-I,-1,
T 1, 3, 0, 0,-5, 0,-3, 0},
*/
/* { 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, M, 0, 0, 0,
U 0, 0, 0, 0, 0, 0, 0, 0},
*/
/* { 0,-2,-2,-2,-2,-I,-I,-2, 4, 0,-2, 2, 2,-2, M,-I,-2,-2,-1,
V 0, 0, 4,-6, 0,-2,-2},
*/
/* {-6,-5,-8,-7,-7, 0,-7,-3,-5, 0,-3,-2,-4,-4, M,-6,-5, 2,-2,-5,
W 0,-6,17, 0, 0,-6},
*/
/* { o, o, o, o, o, o, o, o, o, o, o, o, o, o,_M, o, o, o,
x o, o, o, o, o, o, o, o},
*/
/* {-3,-3, 0,-4,-4, 7,-5, 0,-1, 0,-4,-I,-2,-2, M,-5,-4,-4,-3,-3,
Y 0,-2, 0, 0,10,-4},
*/
/* { 0, I,-5, 2, 3,-5, 0, 2,-2, 0, 0,-2,-1, 1, M, 0, 3, 0,
Z 0, 0, 0,-2,-6, 0,-4, 4}
*l _
}
45
55
205
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
/*
*/
#include < stdio.h >
#include < ctype. h >
#define MAXJMP 16 /* max jumps in a diag */
#deflne MAXGAP 24 I* don't continue to penalize gaps larger than this */
#define JMPS 1024 /* max jmps in an path */
#detine MX 4 I* save if there's at least MX-1 bases since last jmp */
#define DMAT 3 /* value of matching
bases */
#define DMIS 0 /* penalty for mismatched
bases */
#define DINSO 8 /* penalty for a gap
*/
#define DINS1 1 /* penalty per base
*/
IS #definePINSO 8 /* penalty for a gap
*/
#define PINS 1 4 /* penalty per residue
*/
struct
jmp {
short n[MAXJMP];
/*
size
of
jmp
(neg
for
dely)
*/
unsigned x[MAXJMP];
short /*
base
no.
of
jmp
in
seq
x
*/
}; /* limits seq to 2"16
-1 */
struct ag {
di
int score;/* score at last jmp
*/
long offset;/* offset of prev block
*l
short ijmp;/* current jmp index
*/
struct jp; /* list of jmps */
}; jmp
struct path {
int spc; /* number of leading
spaces */
shortn[JMPS]; I* size of jmp (gap)
*I
int x(JMPS]; /* loc of jmp (last
elem before gap)
*!
char *ofile; /* output file name
*/
char *namex[2]; /* seq names: getseqsQ
*/
char *prog; 1* prog name for err
msgs */
char *seqx[2]; /* seqs: getseqsQ
*!
int dmax; /* best diag: nwQ
*/
int dmax0; /* final diag *I
int dna; /* set if dna: mainQ
*/
int endgaps; /* set if penalizing
end gaps */
int gapx, gapy;/* total gaps in seqs
*/
int IenO, lenl;/* seq lens */
int ngapx, ngapy;/* total size of gaps
*/
int smax; /* max score: nwQ
*/
int *xbm; /* bitmap for matching
*/
long offset; /* current offset
in jmp file */
$0 structdiag *dx; I* holds diagonals
*/
structpath pp[2]; /* holds path for
seqs */
char *callocQ, , *index(}, *strcpyQ;
*mallocQ
char *getseqQ,
*g callocQ;
206
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
/* Needleman-Wunsch alignment program
* usage: progs filel filet
* where filel and filet are two dna or two protein sequences.
$ * The sequences can be in upper- or lower-case an may contain ambiguity
* Any lines beginning with '; ' > ' or ' < ' are ignored
* Max file length is 65535 (limited by unsigned short x in the jmp struct)
* A sequence with 1/3 or more of its elements ACGTU is assumed to be DNA
* Output is in the file "align.out"
* The program may create a tmp file in /tmp to hold info about traceback.
* Original version developed under BSD 4.3 on a vax 8650
*/
#include "nw.h"
1$ #include "day.h"
static dbval(26) _ {
1,14,2,13,0,0,4,11,0,0,12,0,3,15,0,0,0,5,6,8,8,7,9,0,10,0
}
static _pbval[26] _ {
1, 2~(1 < <('D'-'A'))~(1 < <('N'-'A')), 4, 8. 16, 32, 64,
128, 256, OxFFFFFFF, 1 < < 10, 1 < < 11, 1 < < 12, 1 < < 13, 1 < < 14,
1«15, 1«16, 1«17, 1«18, 1«19, 1«20, 1«21, 1«22,
2$ 1«23, 1«24, 1«25(1«('E'-'A'))~(1«('Q'-'A'))
};
main(ac, av) lrialn
int ac;
char *av[];
{
prog = av[O];
if (ac ! = 3) {
fprintf(stderr,"usage: %s filel filet\n", prog);
3$ fprintf(stderr,"where filel and filet are two dna or two protein
sequences.ln");
fprintf(stderr, "The sequences can be in upper- or lower-case\n");
fprintf(stderr,"Any lines beginning with ';' or ' <' are ignored\n");
fprintf(stderr,"Output is in the 61e \"align.outl"\n"):
exit( 1 );
namex[O] = av[1];
namex[1] = av[2];
seqx[O] = getseq(namex[0], &len0);
seqx(1] = getseq(namex[1], &lenl};
4$ xbm = (dna)? dbvat : -pbval;
endgaps = 0; /* 1 to penalize endgaps */
otile = "align.out"; /* output file */
$0 nwQ; /* fill in the matrix, get the possible jmps */
readjmpsQ; /* get the actual jmps */
printQ; I* print slats, alignment *l
cleanup(0); /* unlink any tmp files */
$$ }
207
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 cont'~
/* do the alignment, return best score: main()
* dna: values in Fitch and Smith, PNAS, 80, 1382-1386, 1983
* pro: PAM 250 values
* When scores are equal, we prefer mismatches to any gap, prefer
$ * a new gap to extending an ongoing gap, and prefer a gap in seqx
* to a gap in seq y.
*I
nwp nW
{
char *px, *py; /* seqs and ptrs */
int *ndely, *dely; l* keep track of dely *I
int ndelx, delx; /* keep track of delx */
int *tmp; /* for swapping row0, cowl */
int mis; /* score for each type */
1$ int ins0, insl; /* insertion penalties */
register id; /* diagonal index */
register ij; /* jmp index */
register *coIO, *coll; /* score for curr, last row */
register xx, yy; 1* index into seqs */
dx = (struct diag *)g calloc("to get diags", len0+lenl+1, sizeof(struct
diag));
ndely = (int *)g calloc("to get ndely", lenl+1, sizeof(int));
dely = (int *)g calloc("to get dely", lenl +1, sizeof(int));
col0 = (int *)g calloc("to get col0", lenl+1, sizeof(int));
toll = (int *)g calloc("to get coil", lenl + I, sizeof(int));
ins0 = (dna)? DINSO : PINSO;
insl = (dna)? DINSI : PINS1;
smax = -10000;
if (endgaps) {
for (col0[0] = dely[0] _ -ins0, yy = 1; yy < = lenl; yy++) {
col0[yy] = dely[yyJ = col0[yy-lJ - insl;
ndely[yy] = yy;
3$
col0[0] = 0; /* Waterman Bull Math Biol 84 *l
else
for (yy = 1; yy < = lenl; yy++)
dely[yy] _ -ins0;
/* fill in match matrix
*/
for (px = seqx[O], xx = 1; xx < = IenO; px++, xx++) {
4$ I* initialize first entry in col
*/
if (endgaps) {
if (xx == 1)
toll[0] = delx = -(ins0+insl);
$0 else
coil[0] = delx = col0[0] - insl;
ndelx = xx;
else {
$$ col l [0] = 0;
delx = -ins0;
ndelx = 0;
208
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (coot')
for (py = seqx[1], yy = 1; yy < = lent; py++,
yy++) {
mis = col0[yy-1];
if (dna)
$ mis + _ (xbm[*px-'A']&xbm(*py-'A'])? DMAT
: DMIS;
else
mis += day(*px-'A'][*py-'A'];
/* update penalty for del in x seq;
] 0 * favor new del over ongong del
* ignore MAXGAP if weighting endgaps
*/
if (endgaps ~ ~ ndely[yy] < MAXGAP) {
if (col0[yy] - ins0 > = dely[yy]) {
1$ dely[yy) = col0[yy] - (ins0+insl);
ndely[yy] = 1;
} else {
dely[yy] -= insl;
ndely[yy] + + ;
20 }
} else {
if (col0[yy] - (ins0+insl) > = dely[yy]) {
dely[yy] = col0[yy] - (ins0+insl);
ndely(yy] = 1;
2$
} else
ndely[yy] + +;
}
/* update penalty for del in y seq;
30 * favor new del over ongong del
*/
if (endgaps ~ ~ ndelx < MAXGAP) {
if (coll[yy-1] - ins0 > = delx) {
delx = coll[yy-1] - (ins0+insl);
3$
ndelx = 1;
} else {
delx -= insl;
ndelx++;
}
40 } else {
if (coll[yy-1) - (ins0+insl) > = delx) {
delx = coll[yy-1] - (ins0+insl);
ndelx = 1;
} else
4$ ndelx++;
}
/* pick the maximum score; we're favoring
* mis over any del and delx over dely
$0 */
$$
...nw
209
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cont'~
id=xx-yy+lenl-1;
if (mis > = delx && mis > = dely[yy))
col l [yy] = mis;
$ else if (delx > = dely[yy]) {
col I [yy] = delx;
ij = dx[id].ijmp;
if (dx[id].jp.n[0] && (!dna ~ ~ (ndelx > = MAXJMP
&& xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx[id].score+DINSO)) {
dx[id].ijmp+ +;
if (++ij > = MAXJMP) {
writejmps(id);
ij = dx[id].ijmp = 0;
dx[id).offset = offset;
1$ offset += sizeof(struct jmp) + sizeof(offset);
}
}
dx[id].jp.n[ij] = ndelx;
dx[id].jp.x[ij] = xx;
dx[id].score = delx;
}
else {
coll[yy] = dely[yy];
ij = dx[id].ijmp:
2$ if (dx[id].jp.n[0) && (!dna ~ ( (ndely(yy] > = MAXJMP
&& xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx[id].score+DINSO)) {
dx[id].ijmp++;
if (++ij > = MAXJMP) {
writejmps(id);
ij = dx[id].ijmp = 0;
dx[idJ.offset = offset;
offset + = sizeof(struct jmp) + sizeof(offset);
}
}
3$ dx[id].jp.n[ij] _ -ndely[yy];
dx[id].jp.x(ij] = xx;
dx(id].score = dely[yy];
}
if (xx == IenO && yy < lent) {
/* last col
*/
if (endgaps)
coll[yy] -= ins0+insl*(lenl-yy);
if (col 1 (yy) > smax) {
4$ smax = coll[yy];
dmax = id;
}
}
$0 f (endgaps && xx < IenO)
coil[yy-1] -= ins0+insl*(len0-xx);
if (col l [yy-1 ] > smax) {
smax = coll[yy-1];
dmax = id;
$$ }
tmp = col0; col0 = coi l ; col t = tmp;
}
(void) free((char *)ndely);
(void) free((char *)dely);
fi0 (void) free((char *)col0);
(void) free((char *)coll);
}
...nw
210
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
/*
* print() -- only routine visible outside this module
$ * static:
* getmatQ -- trace back best path, count matches: print()
* pr alignQ -- print alignment of described in array p(]: print()
* dumpblockQ -- dump a block of lines with numbers, stars: pr align()
* numsp -- put out a number line: dumpblockQ
* putlineQ -- put out a line (name, [num], seq, [num]): dumpblockQ
* stars() - -put a line of stars: dumpblockQ
* stripname() -- strip any path and prefix from a seqname
*/
1$ Afinclude "nw.h"
ildefine SPC 3
ildefine P LINE 256 /* maximum output line */
/!define P SPC 3 /* space between name or num and seq */
-
extern day[26][26];
int oleo; /* set output line length */
FILE *fx; /* output file */
2$ print()
print
{
int lx, ly, firstgap, lastgap; /* overlap *l
if ((fx = fopen(ofile, "w")) _ _ 0) {
fprintf(stderr,"%s: can't write %s\n", prog, oftle);
cleanup(1);
fprintf(fx, " < first sequence: % s (length = % d)\n", namex[0], len0);
fprintf(fx, "<second sequence: %s (length = %d)\n", namex[1], lenl);
3$ oleo = 60;
Ix = len0;
ly = lent;
firstgap = lastgap = 0;
if (dmax < lenl - 1) { /* leading gap in x *1
pp[O].spc = firstgap = lenl - dmax - 1;
ly -= pP[Ol.sPc;
else if (dmax > lenl - 1) { /* leading gap in y */
pp[1].spc = firstgap = dmax - (lenl - 1);
4$ lx -= pp[1].spc;
if (dmax0 < IenO - 1) { /* trailing gap in x */
lastgap = len0 - dmax0 -1;
Ix -= lastgap;
$0
else if (dmax0 > len0 - 1) { /* trailing gap in y */
lastgap = dmax0 - (IenO - 1);
ly -= lastgap;
$$ getmat(Ix, ly, firstgap, lastgap);
pr align();
211
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
/*
* trace back the best path, count matches
*/
static
getmat(lx, ly, firstgap, lastgap) getInat
int lx, ly; /* "core" (minus endgaps) */
int firstgap, lastgap; /* leading trailing overlap */
{
int nm, i0, i 1, siz0, siz I ;
char outx[32];
double pct;
register n0, nl;
register char *p0, *pl;
/* get total matches, score
*/
i0 = il = siz0 = sizl = 0;
p0 = seqx[0] + pp[I].spc;
pl = seqx[1] + pp(0).spc;
n0 = pp[I].spc + 1;
nl = pp(0].spc + l;
nm = 0;
while ( *p0 && *pl ) {
if (siz0) {
pl++;
nl++;
siz0--;
else If (sizl) {
p0++;
n0++;
sizl--;
else {
if (xbm[*p0-'A']&xbm[*pl-'A'])
nm++;
if (n0++ _= pp[O].x[i0])
4o siz0 = pp[0].n[i0++];
if (nl++ _= pp[1].x[il])
sizl = pp[1].n[il++];
p0++;
pl++;
/* pct homology:
* if penalizing endgaps, base is the shorter seq
* else, knock off overhangs and take shorter core
*/
if (endgaps)
lx = (IenO < lenl)? len0 : lenl;
else
lx = (lx < ly)? Ix : ly;
pct = 100. *(double)nm/(double)lx;
fprintf(fx, "\n");
fprintf(fx, "< %d match%s in an overlap of %ad: %.2f percent similarity\n",
nm, (nm == I)~ "" . "es", lx, pct);
212
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
fprintf(fx, " < gaps in first sequence: %d", gapx); ...getInat
if (gapx) {
(void) sprintf(outx, " (%d %s%s)",
$ ngapx, (dna)? "base":"residue", (ngapx = = I)? "':"s");
fprintf(fx,"%s", outx};
fprintf(fx, ", gaps in second sequence: %d", gapy);
if (gapY) {
(void) sprintf(outx, " (%d %s%s)",
ngapy, (dna)? "base":"residue", (ngapy = = 1)? "":"s");
fprintf(fx,"%s", outx);
if (dna)
fprintf(fx,
"\n < score: % d (match = % d, mismatch = % d, gap penalty = % d + % d per
base)\n",
smax, DMAT, DMIS, DINSO, DINS1);
else
fprintf(fx,
"\n < score: %d (Dayhoff PAM 250 matrix, gap penalty = %d + %d per
residue)\n",
smax, PINSO, PINSI);
if (endgaps)
fprintf(fx,
" < endgaps penalized. left endgap: % d % s % s, right endgap: %d % s%s\n",
firstgap, (dna}? "base" : "residue", (firstgap == 1)? "" . "s",
lastgap, (dna)? "base" : "residue", (lastgap == I)? "" . "s");
else
fprintf(fx, " <endgaps not penalized\n");
static nm; /* matches in core -- for checking */
static lmax; /* lengths of stripped ftle names */
static ij(2]; /* jmp index for a path */
static nc[2]; l* number at start of current line */
static ni[2]; /* current elem number -- for gapping */
static siz[2J;
static char *ps[2]; /* ptr to current element */
static char *po(2]; /* ptr to next output char slot */
static char out[2](P LINE]; /* output line */
static char star[P LINE]; /* set by stars() */
/*
* print alignment of described in struct path pp[]
*/
static
pr align() pr align
{
int nn; /* char count */
int more;
register i;
for (i = 0, imax = 0; i < 2: i++) {
nn = stripname(namex[i]);
if (nn > lmax)
Imax = nn;
nc[i] = 1;
ni[i] = l;
siz[i] = ij[iJ = 0;
f)0 ps[i] = seqx[i];
po[iJ = out(i];
213
CA 02343577 2001-03-16
WO 00/15796 PCTNS99/21090
Table 10 (cony)
for (nn = nm = 0, more = 1; more; ) { ...pr align
for (i = more = 0; i < 2; i++) {
/*
* do we have more of this sequence?
*/
if (!*ps[i])
continue;
more++;
if (pp(i].spc) { /* leading space */
*po[i] + + _ ,
PP[i].sPc--;
}
else if (siz[i]) { /* in a gap */
*po[i]++ _ ,
siz[i]__;
}
else { /* we're putting a seq element
*/
*Po[i] _ *PS[~];
if (islower(*ps[i]))
*ps[i] = toupper(*ps[i]);
po[i]++;
ps[i]++;
/*
* are we at next gap for this seq?
*/
if (ni[i] _= pp[i).x[ij(i]]) {
/*
* we need to merge all gaps
* at this location
*/
siz[i] = pp[i].n[ij[i]++];
while (ni[i] _ = pp[i].x[ij(i]p
siz[i] += pp[i].n[ij[i]++];
ni[i]++;
}
}
if (++nn == olen ( ( !more && nn) {
dumpblockQ;
4$ for (i = 0; i < 2; i++)
po[i] = out[i];
nn = 0;
}
}
SO }
/*
* dump a block of lines, including numbers, stars: pr align()
*I
55 static
dumpblockQ dumpblock
{
register i;
60 for (i = 0; i < 2; i++)
*po[i]__ _ '\0' >
214
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
...dumpblock
(void) putc('\n', fx);
for (i = 0; i < 2; i + +) {
$ if (*out[i] && (*out[i) ! _ ' ' I I *(Po(i]) ! _ ' '))
{
if (i == 0)
nums(i);
if (i == 0 && *out[1])
stars();
putline(i);
if (i == 0 && *out(1])
fprintf(fx, star);
if (i == 1)
nums(i);
J*
* put
out
a
number
line:
dumpblockQ
*/
static
nums(ix)nums
int ix; 1* index in out[] holding seq line */
{
char nline[P LINE];
register i, j;
register char *pn, *px, *py;
for (pn = mine, i = 0; i < lmax+P SPC; i++, pn++)
*pn = ' ,
for (i = nc[ix], py = out[ix]; *py; py++, pn++) {
if (*py =- ' I I *PY =_ -')
*Pn = ,
else {
if (i% 10 == 0 I I (i == 1 && nc[ix) != 1)) {
j = (i < 0)? -i : i;
for (px = pn; j; j /= 10, px--)
*px=j%10+'0';
if (i < o)
*Px = ,
else
*Pn = ,
i++;
*Pn = ~\0';
nc[ix] = i;
for (pn = nline; *pn; pn++)
(void) putc(*pn, fx);
(void) putc('\n', fx);
SS 1*
* put
out
a
line
(name,
[num],
seq,
[num)):
dumpblockp
*/
static
putline(ix)
putllrie
int ix;
{
215
CA 02343577 2001-03-16
WO 00/15796 PCTNS99/21090
Table 10 (cony)
...putline
int i;
register char *px;
for (px = namex[ix], i = 0; *px && *px !_ '~'; px++, i++)
(void) putc(*px, fx);
for (; i < Imax+P SPC; i++)
(void) putc(' ', fx);
/* these count from 1:
* ni[] is current element (from 1)
* nc[] is number at start of current line
*1
for (px = out[ix]; *px; px++)
(void) putc(*px&Ox7F, fx);
(void) putc('\n', fx);
}
/*
* put a line of stars (seqs always in out[Oj, out(1]): dumpblockQ
*/
static
stars() Stal'S
{
int j;
register char *p0, *pl, cx, *px;
if (!*out[0] ~ ~ (*out[0] _- ' && *(po(0]) _- ' ') ~ ~
!*out[1] ~ ~ (*out[I] _ _ ' && *(po(1]) _- ' '))
return;
px = star;
for (i = Imax+P SPC; i; i--)
*px++ _ ,
for (p0 = out[Oj, p1 = out[1]; *p0 && *pl; p0++, pl++) {
if (isalpha(*p0) && isalpha(*pl)) {
4~ if (xbm[*p0-'A']&xbm[*pl-'A']) {
cx = '*';
nm++;
}
else if (!dna && day[*p0-'A'](*pl-'A'] > 0)
cx = ,
else
cx = ,
else
cx = ,
*px++ = cx;
}
*px++ _ '\n';
*Px = '\0';
}
216
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
/*
* strip path or prefix from pn, return len: pr align()
*%
static
$ stripname(pn) stripname
char *pn; I* file name (may be path) *I
register char *px, *py;
lO py = 0;
for (px = pn; *px; px++)
if (*px = _ '/')
py=px+I;
if (pY)
1$ (void) strcpy(pn, py);
return(strlen(pn));
2$
3$
4$
$O
$$
217
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
/*
* cleanupQ -- cleanup any tmp file
* getseqQ -- read in seq, set dna, len, maxlen
* g callocQ -- callocQ with error checkin
* readjmps() -- get the good jmps, from tmp file if necessary
* writejmps() -- write a filled array of jmps to a tmp file: nwQ
*/
1/include "nw.h"
ltinclude < sys/file.h >
char *jname = "/tmp/homgXXXXXX"; /* tmp file for jmps */
FILE *fj;
int cleanupQ; I* cleanup tmp file *I
long IseekQ;
/*
* remove any tmp file if we blow
*/
cleanup(i) cleanup
int i;
{
if (fj)
(void) unlink(jname);
exit(i);
/*
* read, return ptr to seq, set dna, len, maxlen
* skip lines starting with '; , ' <', or ' >'
* seq in upper or lower case
*/
char
getseq(file, len) getSe(]
char *file; I * file name *I
int *len; /* seq len */
{
char line[1024], *pseq;
register char *px, *py;
int natgc, tlen;
FILE *fp;
if ((fp = fopen(file, "r")) _ = 0) {
fprintf(stderr,"%s: can't read ~s\n", prog, file);
exit(1);
tlen = natgc = 0;
while (fgets(line, 1024, fp)) {
if (*line = _ ';' ~ ~ *line = _ ' < ' ~ ~ *line = _ ' > ')
continue;
for (px = line; *px !_ '\n'; px++)
if (isupper(*px) ~ ~ islower(*px))
tlen+ +;
if ((pseq = malloc((unsigned)(tlen+6))) _ = 0) {
fprintf(stderr,"%s: mallocQ failed to get %d bytes for %s\n", prog, tlen+6,
file);
exit(1);
pseq(O] = pseq[1] = pseq[2] = pseq[3] _ '\0';
218
CA 02343577 2001-03-16
WO 00/15796 PC'T/US99121090
Table 10 (cont'1
...getseq
py = pseq + 4;
*len = tlen;
rewind(fp);
while (fgets(line, 1024, fp)) {
if (*line = _ ,' ~ ~ *line = _ ' < ' ~ ~ *line = _ ' > ')
continue;
for (px = line; *px !_ '\n'; px++) {
if (isupper(*px))
*py + + _ *px;
else if (islower(*px))
*py++ = toupper(*px);
if (index("ATGCU",*(py-1)))
natgc++;
}
}
*py++ _ '\0';
*PY = ~\0~;
(void) fclose(fp);
dna = natgc > (tlen/3);
return(pseq+4);
}
char
g calloc(msg, nx, sz) g_Ca110C
char *msg; /* program, calling routine */
int nx, sz; /* number and size of elements *l
{
char *px, *calloc();
if ((px = calioc((unsigned)nx, (unsigned)sz)) _ = 0) {
if (*msg) {
fprintf(stderr, "%s: g callocQ failed %s (n=%d, sz=%d)\n", prog, msg, nx, sz);
exit( 1);
}
}
return(px);
}
/*
* get final jmps from dx[] or tmp file, set ppQ, reset dmax: main()
*/
readjmpsQ
readjmps
{
int fd = -1;
int siz, i0, il;
register i, j, xx;
if (fj) {
(void) fclose(fj);
if ((fd = open(jname, O_RDONLY, 0)) < 0) {
fprintf(stderr, "%s: can't open() %s\n", prog, jname);
cleanup(1);
S$ }
}
for (i = i0 = il = 0, dmax0 = dmax, xx = len0; ; i++) {
while (I) {
for (j = dx[dmax].ijmp; j > = 0 && dx[dmax].jp.x[j] > = xx; j--)
,
219
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cont'~
...readjmps
if (j < 0 && dx[dmax].offset && fj) {
(void) Iseek(fd, dx(dmax].offset, 0);
(void) read(fd, (char *)&dx[dmax].jp, sizeof(struct jmp));
$ (void) read(fd, (char *)&dx[dmax].offset, sizeof(dx[dmax].offset));
dx[dmax].ijmp = MAXJMP-1;
else
break;
if (i > = JMPS) {
fprintf(stderr, "%s: too many gaps in alignment\n", prog);
cleanup(1);
ifs >=o){
siz = dx[dmax].jp.n[j];
xx = dx[dmax].jp.x(j];
dmax += siz;
if (siz < 0) { J* gap in second seq */
pp[1].n[il] _ -siz;
xx + = siz;
/*id=xx-yy+lenl-I
*/
pp(1].x[il] = xx - dmax + lenl - 1;
2$ gapy + + ;
ngapy -= siz;
/* ignore MAXGAP when doing endgaps *1
siz = (-siz < MAXGAP ~ ~ endgaps)? -siz : MAXGAP;
il++;
else if (siz > 0) { /* gap in first seq */
pp[0].n[i0] = siz;
pp[0].x[i0] = xx;
gapx + + ;
ngapx + = siz;
/* ignore MAXGAP when doing endgaps */
siz = (siz < MAXGAP ~ ~ endgaps)? siz : MAXGAP;
i0++;
else
break;
/* reverse the order of jmps
*/
for Q = 0, i0--; j < i0; j++, i0--) {
~ = PP[0].n(11; PP(0].n[j] = PP[Ol.n[i0]: pP(0].n(i0] = i:
SO ~ = PP(0).xU]; PP[0].xG] = PP[Ol.x[i0]: PP(0].x(i0] = i;
for (j = 0, il--; j < il; j++, il--) {
i = PP[ll.n~]: PP[1]~nG] = PP(1].n(il]; PP(1].n(il] = i:
~ = PP(ll.x~]; PP(1].x~] = PP[1].x[il]; pP[1].x(il] = i:
$$ if (fd > = 0)
(void) close(fd);
if (fj) {
(void) unlink(jname);
fj = 0;
f>0 offset = 0;
220
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 10 (cony)
i*
* write a filled jmp struct offset of the prev one (if any): nwQ
*~
S writejmps(ix) wi'itejtIIpS
int ix;
{
char *mktemp();
if (!fj) {
if (mktemp(jname) < 0) {
fprintf(stderr, "%s: can't mktemp() %s\n", prog, jname);
cleanup(1 );
1S f ((fj = fopen(jname, "w")) _= 0) {
fprintf(stderr, "%as: can't write %s\n", prog, jname);
exit(I);
(void) fwrite((char *)&dx[ix].jp, sizeof(struct jmp), I, fj);
(void) fwrite((char *)&dxjix].offset, sizeof(dx[ix].offset), 1, fj);
2S
3S
4S
SO
SS
221
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 11
PRO XXXXXXXXXXXXXXX (Length = 15 amino acids)
Comparison Protein XXXXXYYYYYYY (Length = 12 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two
polypeptide sequences as determined
by ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
5 divided by 15 = 33.3 %
222
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 12
PRO XXXXXXXXXX (Length = 10 amino acids)
Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two
polypeptide sequences as determined
by ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
5 divided by 10 = 50%
223
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 13
PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides)
Comparison DNA NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
$ % nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by
ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic
acid sequence) _
6 divided by 14 = 42.9%
224
CA 02343577 2001-03-16
WO 00/15796 PCT/US99/21090
Table 14
PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides)
Comparison DNA NNNNLLLVV (Length = 9 nucleotides)
% nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by
ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic
acid sequence) _
4 divided by 12 = 33.3 %
225
CA 02343577 2001-03-16
16-06-200'J US 009921090
.. .. .. .. ..
.. .. .. . . . . . . .
. . . . ... . . ... . . .
. . . .. . . ..
, . . . . .. . . ..
... .. .. .. . .. ..
Deposit off' Material
The following materials have been deposited with the American Type Culture
Collection, 12301
Parklawn Drive, Rockville, MD, USA (ATCC):
Material ATCC Dep. No. Deposit Date
DNA32292-1131 ATCC 209258 September 16,
1997
DNA33094-1131 ATCC 209256 September 16,
1997
DNA33223-1136 ATCC 209264 September 16,
1997
DNA34435-1140 ATCC 209250 September 16,
1997
DNA27864-1155 ATCC 209375 October 16, 1997
DNA36350-1158 ATCC 209378 October 16, 1997
DNA32290-1164 ATCC 209384 October 16, 1997
DNA35639-1172 ATCC 209396 October 17, 1997
DNA33092-1202 ATCC 209420 October 28, 1997
DNA49435-1219 ATCC 209480 November 21, 1997
DNA35638-1141 ATCC 209265 September 16,
1997
DNA32298-1132 ATCC 209257 September 16,
1997
DNA33089-1132 ATCC 209262 September 16,
1997
DNA33786-1132 ATCC 209253 September 16,
1997
DNA35918-1174 ATCC 209402 October 17, 1997
DNA37150-1178 ATCC 209401 October 17, 1997
DNA38260-1180 ATCC 209397 October 17, 1997
DNA39969-1185 ATCC 209400 October 17, 1997
DNA32286-1191 ATCC 209385 October 16, 1997
DNA33461-1199 ATCC 209367 October 15, 1997
DNA40628-1216 ATCC 209432 November 7, 1997
DNA33221-1133 ATCC 209263 September 16,
1997
DNA33107-1135 ATCC 209251 September 16,
1997
DNA35557-1137 ATCC 209255 September 16,
1997
DNA34434-1139 ATCC 209252 September 16,
1997
DNA33100-1159 ATCC 209377 October 16, 1997
DNA35600-1162 ATCC 209370 October 16, 1997
DNA34436-1238 ATCC 209523 December 10, 1997
DNA33206-1165 ATCC 209372 October 16, 1997
DNA35558-1167 ATCC 209374 October 16, 1997
DNA35599-1168 ATCC 209373 October 16, 1997
DNA36992-1168 ATCC 209382 October 16, 1997
DNA34407-1169 ATCC 209383 October 16, 1997
DNA35841-1173 ATCC 209403 October 17, 1997
DNA33470-1175 ATCC 209398 October 17, 1997
DNA34431-1177 ATCC 209399 October 17, 1997
DNA39510-1181 ATCC 209392 October 17, 1997
DNA39423-1182 ATCC 209387 October 17, 1997
DNA40620-1183 ATCC 209388 October 17, 1997
DNA40604-1187 ATCC 209394 October 17, 1997
DNA38268-1188 ATCC 209421 October 28, 1997
DNA37151-1193 ATCC 209393 October 17, 1997
DNA35673-1201 ATCC 209418 October 28, 1997
DNA40370-1217 ATCC 209485 November 21, 1997
DNA42551-1217 ATCC 209483 ~ November 21,
1997
DNA39520-1217 ATCC 209482 November 21, 1997
DNA41225-1217 ATCC 209491 November 21, 1997
DNA43318-1217 ATCC 209481 November 21, 1997
DNA40587-1231 ATCC 209438 November 7, 1997
DNA41338-1234 ATCC 209927 June 2, 1998
DNA40981-1234 ATCC 209439 November 7, 1997
226
AMENDED SHEET
CA 02343577 2001-03-16
WO 00115796 PCT/US99/21090
DNA37140-1234 ATCC 209489 November 21, 1997
DNA40982-1235 ATCC 209433 November 7, 1997
DNA41379-1236 ATCC 209488 November 21, 1997
DNA44167-1243 ATCC 209434 November 7, 1997
DNA39427-1179 ATCC 209395 October 17, 1997
DNA40603-1232 ATCC 209486 November 21, 1997
DNA43466-1225 ATCC 209490 November 21, 1997
DNA43046-1225 ATCC 209484 November 21, 1997
DNA35668-1171 ATCC 209371 October 16, 1997
These deposit were made under the provisions of the Budapest Treaty on the
International Recognition
of the Deposit of Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest
Treaty). This assures maintenance of a viable culture of the deposit for 30
years from the date of deposit. The
deposits will be made available by ATCC under the terms of the Budapest
Treaty, and subject to an agreement
between Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of
the culture of the deposit to the public upon issuance of the pertinent U.S.
patent or upon laying open to the
public of any U.S. or foreign patent application, whichever comes first, and
assures availability of the progeny
to one determined by the U.S. Commissioner of Patents and Trademarks to be
entitled thereto according to 35
USC ~ 122 and the Commissioner's rules pursuant thereto (including 37 CFR ~
1.14 with particular reference
to 886 OG 638).
The assignee of the present application has agreed that if a culture of the
materials on deposit should
die or be lost or destroyed when cultivated under suitable conditions, the
materials will be promptly replaced on
notification with another of the same. Availability of the deposited material
is not to be construed as a license
to practice the invention in contravention of the rights granted under the
authority of any government in
accordance with its patent laws.
The foregoing written specification is considered to be sufficient to enable
one skilled in the art to
practice the invention. The present invention is not to be limited in scope by
the construct deposited, since the
deposited embodiment is intended as a single illustration of certain aspects
of the invention and any constructs
that are functionally equivalent are within the scope of this invention. The
deposit of material herein does not
constitute an admission that the written description herein contained is
inadequate to enable the practice of any
aspect of the invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the
claims to the specific illustrations that it represents. Indeed, various
modifications of the invention in addition
to those shown and described herein will become apparent to those skilled in
the art from the foregoing
description and fall within the scope of the appended claims.
227
