Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
BONE MORPHOGENIC PROTEIN-INpUCED GENES A 1~1~,
POT YPEPTIDF~_ AND THEM L1~F IN DIAGNO~~TTC'
AND THERAPEiJTIC MET~~IODS
This invention relates to genes induced by bone morphogenic proteins,
polypeptides encoded by those genes, and diagnostic and therapeutic methods
employing these genes and polypeptides.
Bac round of the Invention
Bone is a very dense, specialized form of connective tissue, consisting
of tough fibers (type I collagen fibrils), which resist pulling forces, and
solid
particles (calcium phosphate particles), which resist compression. For all its
rigidity, bone is by no means a permanent and immutable tissue. Throughout
its hard extracellular matrix are channels and cavities occupied by living
cells
that are engaged in an unceasing process of remodeling, which involves a
coupled process of bone resorption and bone formation. Osteoclasts degrade
bone during the resorption phase by attaching to the mineralized bone matrix
and excavating small pits on the bone surface, thereby releasing bone collagen
and minerals into circulation. In the bone formation phase, osteoblasts
replace
the bone collagen removed by osteoclasts by depositing new collagen at the
resorbed areas. In early adulthood, levels of bone resorption and bone
formation generally are balanced. Net bone growth occurs when formation
outpaces resorption, for example, in a child during growth or in the healing
of a
bone fracture, while net bone loss occurs when resorption outpaces formation,
for example, in osteoporosis or Paget's disease.
Control of bone growth and development involves a complex interplay
CA 02345885 2001-04-10
WO 00/21976 PCTNS99l24263
z
of the activities of growth factors, transcription factors, and other
signaling
molecules. For example, a number of bane morphogenic proteins (BMPs) hav;:
been isolated that induce pluripotent stromal cells to differentiate into
osteoblasts. BMPs belong to the TGF-~3 superfamily, and are highly
homologous to proteins involved in pattern formation in lower species. For
example, BMP-2 is 74% identical to decapentaplegic, a drosophila protein that
plays a critical role in dorso-ventral patterning, and is 58% identical to Vg-
l, a
protein postulated to determine mesodermal differentiation in Xenopus oocytes.
BMPs were first isolated because of their ability to induce new bone
formation in ectopic sites in rodents. The development of this new bone is
characterized by differentiation of mesenchymal cells into chondrocytes, and
subsequent replacement of cartilage by bone. This process is identical to that
of endochondral bone formation in the embryo, including the formation of a
functional marrow cavity. BMPs, in fact, are normally synthesized at sites of
new bone formation early in development, suggesting that they play a role in
limb patterning and osteogenesis. In support of their in vivo role in skeletal
development, mutation of BMP-5 and targeted ablation of BMP-7 both result in
a broad range of skeletal defects. These BMPs, therefore, are likely to play
critical roles in the commitment of pluripotent cells to form bone.
Recombinant BMP-2A (BMP-2) has been shown to induce ectopic bone
formation that is histologically indistinguishable from that which is induced
by
BMP purified from bone extracts.
BMPs have also been shown to potentiate the growth of a large number
of tissues, including a variety of connective tissues and organs.
summary of the Invention
The present invention provides substantially pure bone morphogenic
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
3
protein (BMP)-induced polypeptides, such as polypeptides selected from the
group consisting of CAPE, AAP2, and AAP32. The polypeptides can include
amino acid sequences that are substantially identical to the amino acid
sequence of SEQ ID N0:2, an amino acid sequence that is substantially
identical to that encoded by the nucleic acid sequence of SEQ ID N0:3 or the
complement thereof, or an amino acid sequence that is substantially identical
to
that encoded by the nucleic acid sequence of SEQ ID N0:4 or the complement
thereof. The polypeptides can be derived from a mammal such as, for example,
a human.
The invention also provides substantially pure nucleic acid (e.g., DNA)
molecules having sequences encoding BMP-induced polypeptides, for
example, CAPE, AAP2, or AAP32. For example, the nucleic acid molecules
can encode an amino acid sequence selected from the group consisting of SEQ
ID N0:2, an amino acid sequence that is substantially identical to that which
is
encoded by the nucleic acid sequence of SEQ ID NO:3 or the complement
thereof, an amino acid sequence that is substantially identical to that which
is
encoded by the nucleic acid sequence of SEQ ID NO:4 or the complement
thereof, or a fragment thereof. The nucleic acid molecule can have, for
example, at least 55% (e.g., 65%, 75%, 85%, 90%, 95%, or 100%) nucleic acid
sequence identity to a sequence encoding a BMP-induced polypeptide or a
fragment thereof having at least six (e.g., ten, fifteen, twenty, twenty-five,
thirty, forty, or fifty) amino acids. In this case, the nucleic acid molecule
hybridizes under high stringency conditions to at least a portion of a nucleic
acid molecule encoding a bone morphogenic protein-induced polypeptide.
The invention also provides vectors including nucleic acid molecules
encoding BMP-induced polypeptides, cells containing such vectors, non-human
transgenic animals including nucleic acid molecules encoding BMP-induced
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
4
polypeptides, and antibodies that specifically bind bone morphogenic protein-
induced polypeptides.
Also provided by the invention are detection methods. For example, the
invention features a method of detecting a bone morphogenic protein (BMP)-
S induced polypeptide in a sample. In these methods, a sample is contacted
with
an antibody that specifically binds to a BMP-induced polypeptide, and binding
of the antibody to the polypeptide is detected.
In another example, the invention features a method for identifying a
BMP-induced gene, involving culturing cells in tl:e presence of BMP (for
example, BMP-2) and identifying genes induced by the BMP.
Also included in the invention are methods for inducing tissue or organ
formation {for example, connective tissue, such as bone) formation in a
patient,
in which an effective amount of a bone morphogenic-induced polypeptide is
administered to the patient. These methods can also be used to potentiate
growth of other tissues in patients, such as, for example, cartilage, tendon,
ligament, nerve, muscle, and epidermal tissues, as well as to potentiate organ
(e.g., pancreas, heart, liver, lung, and kidney) development. The invention
also
includes use of BMP-induced polypeptides, such as those described above, in
methods for inducing tissue or organ formation, and in the preparation of
medicaments for such uses and others.
By "bone morphogenic protein-induced polypeptide" or "BMP-induced
polypeptide" is meant a polypeptide, or fragment thereof, the expression of
which is induced in cells, such as stromal cells, in response to bone
morphogenic protein (e.g., BMP-2). Preferably, the BMP-induced polypeptide
includes a portion having at least 45%, more preferably at least 55%, more
preferably at least 70%, and most preferably at least 85% amino acid identity
to
the amino acid sequence of SEQ ID N0:2 (CAPE), an amino acid sequence that
CA 02345885 2001-04-10
WO 00121976 PCT/US99/24263
is encoded by the nucleic acid sequence of SEQ ID N0:3 or the complement
thereof, an amino acid sequence that is encoded by the nucleic acid sequence
of
SEQ ID N0:4 or the complement thereof, or a fragment thereof. It is to be
understood that polypeptide products from splice variants of BMP-induced
gene sequences are also included in this definition.
A "BMP-induced gene" or a "nucleic acid molecule encoding a BMP-
induced polypeptide" is a nucleic acid molecule, such as genomic DNA,
cDNA, or mRNA, that encodes a BMP-induced polypeptide (e.g., CAP6,
AAP2, or AAP32) or a portion thereof, as defined above.
The term "identity" is used to indicate that a first polypeptide or nucleic
acid molecule possesses the same amino acid or nucleotide residue at a given
position, compared to a reference polypeptide or nucleic acid molecule to
which the sequence of the first molecule is aligned. Sequence identity can be
measured using sequence analysis software with the default parameters
specified therein, such as the introduction of gaps to achieve an optimal
alignment. For example, the Sequence Analysis Software Package of the
Genetics Computer Group, University of Wisconsin Biotechnology Center,
1710 University Avenue, Madison, WI 53705, can be used.
The term "substantially identical" is used in reference to a polypeptide
or nucleic acid molecule to indicate that the molecule exhibits, over its
entire
length, at least 50%, preferably at least 60% or 65%, and most preferably 75%,
85%, 90%, or 95% identity to a reference amino acid or nucleic acid sequence.
For polypeptides, the length of comparison sequences can be, for example, at
least 16 amino acids, preferably at least 20 amino acids, more preferably at
least 25 amino acids, and most preferably at least 35 amino acids. For nucleic
acid molecules, the length of comparison sequences can be at least 50
nucleotides, preferably at least 60 nucleotides, more preferably at least 75
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
6
nucleotides, and most preferably at least 110 nucleotides.
By "probe" or "primer" is meant a single-stranded DNA or RNA
molecule of defined sequence that can base pair to a second DNA or RNA
molecule that contains a complementary sequence (the "target"). The stability
of the resulting hybrid depends upon the extent of the base pairing that
occurs,
which is affected by parameters such as the degree of complementarity between
the probe and the target molecules and the degree of stringency of the
hybridization conditions. The degree of hybridization stringency is affected
by
parameters such as temperature, salt concentration, and the concentration of
organic molecules, such as formamide, and appropriate conditions can readily
be determined by those skilled in the art. Probes or primers specific for
nucleic
acid molecules encoding BMP-induced polypeptides can have, preferably,
greater than 50% sequence identity, more preferably at least 55-75% sequence
identity, still more preferably at least 75-85% sequence identity, yet more
preferably at least 85-99% sequence identity, and most preferably 100%
sequence identity. Probes can be detestably-labeled, either radioactively, or
non-radioactively, by methods well-known to those skilled in the art. Probes
are used for methods involving nucleic acid hybridization, such as nucleic
acid
amplification by polymerase chain reaction (PCR), single stranded
conformational polymorphism (SSCP) analysis, restriction fragment
polymorphism (RFLP) analysis, Southern hybridization, Northern
hybridization, in situ hybridization, and electrophoretic mobility shift assay
(EMSA).
The term "detestably-labeled" is used to denote any means for marking
and identifying the presence of a molecule, e.g., an oligonucleotide probe or
primer, a gene or fragment thereof, a cDNA molecule, or an antibody.
Methods for detestably-labeling molecule are well known in the art and
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
7
include, without limitation, radioactive labeling (e.g., with an isotope such
as
32p or ass) and nonradioa~tive labeling (e.g., with a fluorescent label, such
as
fluorescein).
By "substantially pure polypeptide" is meant a polypeptide (or a
fragment thereof) that has been separated from the components that accompany
it in its natural state. Typically, the polypeptide is substantially pure when
it is
at least 60%, by weight, free from the proteins and naturally-occurring
organic
molecules with which it is naturally associated. Preferably, the polypeptide
is a
BMP-induced polypeptide that is at least 75%, more preferably at least 90%,
and most preferably at least 99%, by weight, pure. A substantially pure BMP-
induced polypeptide can be obtained, for example, by extraction from a natural
source, by expression of a recombinant nucleic acid encoding a BMP-induced
polypeptide, or by chemically synthesizing the polypeptide. Purity can be
measured by any appropriate method, e.g., by column chromatography,
polyacrylamide gel electrophoresis, or HPLC analysis.
A protein is substantially free of naturally associated components when
it is separated from those contaminants which accompany it in its natural
state.
Thus, a protein that is chemically synthesized or produced in a cellular
system
different from the cell from which it naturally originates can be considered
substantially free from its naturally associated components. Accordingly,
substantially pure polypeptides not only includes those derived from
eukaryotic
organisms but also those synthesized in E. coli and other prokaryotes.
An antibody is said to "specifically bind" to an antigen, such as a BMP-
induced polypeptide, if it recognizes and binds to the BMP-induced
polypeptide, but does not substantially recognize and bind other molecules
(e.g., other polypeptides) in a sample, e.g., a biological sample, that
naturally
includes the poiypeptide.
CA 02345885 2001-04-10
WO 00/21976 PC'T/US99/24263
8
By "high stringency conditions" is meant a set of conditions that allow
hybridization comparable to hybridization that occurs using a DNA probe of at
least 500 nucleotides in length, in a buffer containing 0.5 M NaHP04, pH 7.2,
7% SDS, 1 mM EDTA, and 1% BSA, at a temperature of 65°C, or a buffer
containing 48% formamide, 4.8 x SSC, 0.2 M Tris-Cl, pH 7.6, 1 x Denhardt's
solution, 10% dextran sulfate, and 0.1 % SDS, at a temperature of 42°C
(these
are typical conditions for high stringency Northern or Southern
hybridizations).
High stringency hybridization is also relied upon for the success of numerous
techniques routinely performed by molecular biologists, such as high
stringency PCR, single strand conformational polymorphism analysis, and in
situ hybridization. In contrast to Northern and Southern hybridizations, these
techniques are usually performed with relatively short probes (e.g., usually
16
nucleotides or longer for PCR or sequencing, and 40 nucleotides or longer for
in situ hybridization). The high stringency conditions used in these
techniques
are well known to those skilled in the art of molecular biology, and can be
found, for example, in Ausubel et al., Curs°ent Protocols in Molecular
Biology,
John Wiley & Sons, New York, NY, 1998, which is hereby incorporated by
reference.
The term "transformation" is used herein to denote any method for
introducing a foreign molecule, such as a nucleic acid molecule, into a cell.
Lipofection, DEAF-dextran-mediated transfection, microinjection, protoplast
fusion, calcium phosphate precipitation, retroviral delivery, electroporation,
and biolistic transformation are just a few of the standard methods known to
those skilled in the art that can be used. For example, biolistic
transformation
is a method for introducing foreign molecules into a cell using velocity
driven
microprojectiles such as tungsten or gold particles. Such velocity-driven
methods originate from pressure bursts which include, but are not limited to,
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
9
helium-driven, air-driven, and gunpowder-driven techniques. Biolistic
transformation can be applied to the transformation or transfection of a wide
variety of cell types and intact tissues including, without limitation,
intracellular organelles (e.g., mitochondria and chloroplasts), bacteria,
yeast,
fungi, algae, animal tissue, and cultured cells.
By "transformed cell," "transfected cell," or "transduced cell," is meant
a cell (or a descendent of a cell) into which a nucleic acid molecule encoding
a
polypeptide of the invention has been introduced, by means of recombinant
techniques.
By "promoter" is meant a sequence sufficient to direct transcription. If
desired, constructs of the invention can include promoter elements that are
sufficient to render promoter-dependent gene expression controllable in a cell
type-specific, tissue-specific, or temporal-specific manner, or inducible by
external signals or agents; such elements can be located in the 5' or 3' or
intron
sequence regions of the native gene.
The term "operably linked" is used herein to indicate that a gene and one
or more regulatory sequences are connected in such a way as to permit gene
expression when the appropriate molecules (e.g., transcriptional activator
proteins) are bound to the regulatory sequences.
By "sample" is meant a specimen containing a tissue biopsy, cell, blood,
serum, urine, stool, or other specimen obtained from a patient or test
subject. A
sample can be analyzed for the presence of a BMP-induced gene, a BMP-
induced polypeptide, or an antibody that binds to a BMP-induced polypeptide
to detect, for example, expression levels of a BMP-induced gene or polypeptide
using methods that are well known in the art. For example, methods involving
nucleic acid hybridization, such as polymerise chain reaction (PCR), reverse
transcriptase/polymerase chain reaction (RT/PCR), and Northern hybridization
CA 02345885 2001-04-10
WO 00/21976 PCTNS99124263
can be used to detect BMP-induced nucleic acid molecules (e.g., mRNA), and
standard immunoassays, such as ELISAs, can be used to measure levels of
BMP-induced polypeptides.
Other features and advantages of invention will be apparent from the
5 following detailed description thereof.
petailed Description of the invention
The invention provides bone morphogenic protein (BMP)-induced
genes, such as CAP6, AAP2, and AAP32, which are expressed in pluripotent
10 stromal cells as they differentiate into osteoblasts in response to bone
morphogenic protein-2 (BMP-2), polypeptides encoded by these genes, and
diagnostic and therapeutic methods employing these genes and polypeptides.
The BMP-induced genes were isolated by differential display PCR
(ddPCR) from a mouse limb bud cell line, MLB 13 MYC clone 17, as genes
that acquired an osteoblastic phenotype in response to rhBMP-2 treatment.
Four true positive ddPCR products were identified, three of which were not
represented in currently available sequence databases and which are designated
herein as CAP6, AAP2, and AAP32. The fourth gene identified was activin
~3A. The induction of activin ~A by rhBMP-2 in the MLB 13 MYC clone 17
cells peaked at 24 hours and was inhibited by cycloheximide, implicating the
need for new protein synthesis. The expression of follistatin, an activin
binding
protein, is also induced by rhBMP-2, with peak levels being observed at 18
hours post-treatment. Unlike the induction of activin (3A, the induction of
follistatin did not require new protein synthesis. To examine the
temperospatial
expression of activin (3A during in vivo endochondral bone formation, in situ
hybridization was performed in developing mouse bones. Activin ~3A message
localized to the site of the future joint space in the developing mouse
phalanges
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
11
at day 14.5.
The full length CAP6 gene was sequenced and its sequence is shown in
the sequence listing, where it is labeled SEQ ID NO:1. The amino acid
sequence includes a glutamine rich region and does not have a high degree of
homology to currently available peptide databases. The protein includes a
putative ATP binding loop (consensus: GXGXXG; AGGGLGGG; amino acids
23-30) and catalytic domain (ALK; amino acids 74-7G). The mRNA encoding
this gene is expressed in several adult mouse tissues, including brain,
calvaria,
diaphragm, and lung, but not liver. Moreover, sequence analysis reveals that
CAP6 is a member of the family of serine-threonine kinases.
The partial sequences of the other two novel nucleic acid molecules
encoding AAP2 and AAP32 are shown in the sequence listing as SEQ ID N0:3
and SEQ ID N0:4, respectively. Full length nucleic acid molecules encoding
AAP2 and AAP32, as well as nucleic acid molecules encoding allelic variants
of CAP6 or a CAP6 polypeptide molecule derived from another source, can be
obtained using standard nucleic acid hybridization methods (see, e.g., Ausubel
et al., supra). For example, a cDNA library can be prepared from a cell line
or
tissue in which the gene is expressed, and the library can be screened using a
probe designed based on the nucleic acid sequences provided herein.
Alternatively, the sequences provided herein can be used to design primers for
use in the polymerase chain reaction (PCR), which can be carried out to obtain
probes suitable for library screening.
BMP-Induced Polvneptides
The BMP-induced polypeptides of the invention can be purified from
cells in which they are naturally expressed, or produced using recombinant
methods, which are described as follows. For example, cell lines can be
CA 02345885 2001-04-10
WO 00/21976 PCf/US99/24263
12
produced that over-express BMP-induced polypeptides, allowing their
purification for biochemical characterization, large-scale broduction,
antibody
production, or patient therapy.
For protein expression, eukaryotic and prokaryotic expression systems
can be generated in which nucleic acid molecules containing BMP-induced
genes are introduced into a plasmid or other vector, which is then used to
transform living cells. Constructs in which BMP-induced cDNAs containing
entire open reading frames inserted in the correct orientation into an
expression
plasmid can be used for protein expression. Alternatively, portions of the
BMP-induced gene sequences can be inserted. Prokaryotic and eukaryotic
expression systems allow various important functional domains of BMP-
induced polypeptides to be recovered, if desired, as fusion proteins, and then
used for binding, structural, and functional studies, and also for the
generation
of appropriate antibodies.
Typical expression vectors contain promoters that direct the synthesis of
large amounts of mRNA corresponding to the inserted BMP-induced nucleic
acid molecule in the plasmid-bearing cells. They can also include eukaryotic
or
prokaryotic origin of replication sequences allowing for their autonomous
replication within the host organism, sequences that encode genetic traits
that
allow vector-containing cells to be selected for in the presence of otherwise
toxic drugs, and sequences that increase the efficiency with which the
synthesized mRNA is translated. Stable long-term vectors can be maintained
as freely replicating entities by using regulatory elements of, for example,
viruses (e.g., the OriP sequences from the Epstein Barr Virus genome). Cell
lines can also be produced that have integrated the vector into the genomic
DNA, and in this manner the gene product is produced in the cell lines on a
continuous basis.
WO 00/21976 PCT/US99/242
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
13.
Expression of foreign sequences in bacteria, such as Escherichia coli,
can be accomplished by the insertion of a BMP-induced nucleic acid molecule
into a bacterial expression vector. Such plasmid vectors contain several
elements required for the propagation of the plasmid in bacteria, and for
expression of the DNA inserted into the plasmid. Propagation of only plasmid-
bearing bacteria can be achieved by introducing into the plasmid selectable
marker-encoding sequences that allow plasmid-bearing bacteria to grow in the
presence of otherwise toxic drugs. The plasmid also contains a transcriptional
promoter capable of producing large amounts of mRNA from the cloned gene.
Such promoters can be, but are not necessarily, inducible promoters that
initiate
transcription upon induction with a particular compound. The plasmid also
preferably contains a polylinker to simplify insertion of the gene in the
correct
orientation within the vector.
Once the appropriate expression vectors containing a BMP-induced
gene, fragment, fusion, or mutant thereof are constructed, they are introduced
into appropriate host cells by a transformation technique, such as, for
example,
calcium phosphate transfection, DEAE-dextran transfection, electroporation,
microinjection, protoplast fusion, or liposome-mediated transfection. The host
cells that are transfected with the vectors of the invention can include, but
are
not limited to, E. coli or other bacteria, yeast, fungi, insect cells (using,
for
example, baculoviral vectors for expression), or cells derived from mice,
humans, or other animals. Mammalian cells can also be used to express the
BMP-induced protein using a vaccinia virus expression system described, for
example, by Ausubel et al., supra.
In vitro expression of BMP-induced polypeptides, fusions, or fragments
encoded by cloned DNA is also possible using the T7 late promoter expression
system. This system depends on the regulated expression of T7 RNA
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
14
polymerise, an enzyme encoded in the DNA of bacteriophage T7. The T7
RI~IA polymerise initiates transcripxion at a specific 23 basepair promoter
sequence called the T7 late promoter. Copies of the T7 late promoter are
located at several sites on the T7 genome, but none is present in E. coli
chromosomal DNA. As a result, in T7-infected cells, T7 RNA polymerise
catalyzes transcription of viral genes, but not of E. coli genes. In this
expression system, recombinant E. coli cells are first engineered to carry the
gene encoding T7 RNA polymerise next to the lac promoter. In the presence
of IPTG, these cells transcribe the T7 polymerise gene at a high rate and
synthesize abundant amounts of T7 RNA polymerise. These cells are then
transformed with plasmid vectors that carry a copy of the T7 late promoter
protein. When IPTG is added to the culture medium containing these
transformed E. coli cells, large amounts of T7 RNA polymerise are produced.
The polymerise then binds to the T7 late promoter on the plasmid expression
vectors, catalyzing transcription of the inserted cDNA at a high rate. Since
each E. coli cell contains many copies of the expression vector, large amounts
of mRNA corresponding to the cloned cDNA can be produced in this system
and the resulting protein can be radioactively labeled. Plasmid vectors
containing late promoters and the corresponding RNA polymerises from
related bacteriophages such as T3, T5, and SP6 can also be used for in vitro
production of proteins from cloned DNA. E. coli can also be used for
expression using an M 13 phage, such as mGPI-2. Furthermore, vectors that
contain phage lambda regulatory sequences, or vectors that direct the
expression of fusion proteins, for example, a maltose-binding protein fusion
protein or a glutathione-S-transferase fusion protein, also can be used for
expression in E. coli.
Eukaryotic expression systems are also useful for expressing BMP-
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
induced polypeptides, particularly for obtaining appropriate post-
translational
modification of expressed proteins. Transient transfection of a eukaryotic
expression piasmid allows the transient production of BMP-induced
polypeptides by a transfected host cell. BMP-induced polypeptides can also be
5 produced by a stably-transfected mammalian cell line. A number of vectors
suitable for stable transfection of mammalian cells are available to the
public
(see, e.g., Pouwels et al., Cloning vectors: A Laboratory Manual, 1985, Supp.
1987), as are methods for constructing such cell lines (see, e.g., Ausubel et
al.,
supra). In one example, cDNA encoding a BMP-induced polypeptide, fusion,
10 or fragment is cloned into an expression vector that includes the
dihydrofolate
reductase (DHFR) gene. Integration of the plasmid and, therefore, integration
of the BMP-induced polypeptide-encoding gene into the host cell chromosome,
is selected for by inclusion of 0.01-300 ~.M methotrexate in the cell culture
medium (as is described, for example, by Ausubel et al., supra). This dominant
15 selection can be accomplished in most cell types. Recombinant protein
expression can be increased by DHFR-mediated amplification of the
transfected gene. Methods for selecting cell lines bearing gene amplifications
are described by Ausubel et al., supra. These methods generally involve
extended culture in medium containing gradually increasing levels of
methotrexate. The most commonly used DHFR-containing expression vectors
are pCVSEII-DHFR and pAdD2GSV(A) (described, for example, in Ausubel et
al., supra). The host cells described above or, preferably, a DHFR-deficient
CHO cell line (e.g., CHO DHFR- cells, ATCC Accession No. CRL 9096) are
among those most preferred for DHFR selection of a stably-transfected cell
line
or DHFR-mediated gene amplification.
Eukaryotic cell expression of BMP-induced polypeptides facilitates
studies of BMP-induced genes and gene products, including determination of
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
16
proper expression and post-translational modifications for biological
activity,
identifying regulatory elements located in the 5', 3', and intron regions of
BMP-
induced genes, and determining their roles in tissue regulation of BMP-induced
polypeptide expression. It also permits the production of large amounts of
these polypeptides for isolation and purification, and the use of cells
expressing
BMP-induced polypeptides as a functional assay system for antibodies
generated against the proteins. Eukaryotic cells expressing BMP-induced
polypeptides can be used to test the effectiveness of pharmacological agents
on
BMP-induced polypeptide associated diseases or as means by which to study
BMP-induced polypeptides as components of a transcriptional activation
system. Expression of BMP-induced polypeptides, fusions, and polypeptide
fragments in eukaryotic cells also enables the study of the function of the
normal complete protein, specific portions of the protein, or of naturally
occurring polymorphisms and artificially-produced mutated proteins. The
BMP-induced DNA sequences can be altered using procedures known in the
art, such as restriction endonuclease digestion, DNA polymerise fill-in,
exonuclease deletion, terminal deoxynucleotide transferase extension, ligation
of synthetic or cloned DNA sequences, and site-directed sequence alteration
using specific oligonucleotides, together with PCR.
Another preferred eukaryotic expression system is the baculovirus
system using, for example, the vector pBacPAK9, which is available from
Clontech (Palo Alto, CA). If desired, this system can be used in conjunction
with other protein expression techniques, for example, the myc tag approach
described by Evan et al. (Mol. Cell Biol. 5:3610-3616, 1985).
Once the recombinant protein is expressed, it can be isolated from the
expressing cells by cell lysis followed by protein purification techniques,
such
as affinity chromatography. In this example, an anti-BMP-induced polypeptide
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
17
antibody, which can be produced by the methods described herein, can be
attached to a column and used to isolate the recombinant BMP-induced
polypeptides. Lysis and fractionation of BMP-induced polypeptide-harboring
cells prior to affinity chromatography can be performed by standard methods
(see, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley
& Sons, New York, NY, 1998). Once isolated, the recombinant protein can, if
desired, be purified further by, e.g., high performance liquid chromatography
(HPLC; e.g., see Fisher, Laboratory Techniques In Biochemistry And
Molecular Biology, Work and Burdon, Eds., Elsevier, 1980).
Polypeptides of the invention, particularly short BMP-induced
polypeptide fragments and longer fragments of the N-terminus and C-terminus
of the BMP-induced polypeptide, can also be produced by chemical synthesis
(e.g., by the methods described in Solid Phase Peptide Synthesis, 2"d ed.,
1984,
The Pierce Chemical Co., Rockford, IL). These general techniques of
polypeptide expression and purification can also be used to produce and
isolate
useful BMP-induced polypeptide fragments or analogs, as described herein.
Those skilled in the art of molecular biology will understand that a wide
variety of expression systems can be used to produce the recombinant BMP-
induced polypeptides. The precise host cell used is not critical to the
invention.
The BMP-induced polypeptides can be produced in a prokaryotic host (e.g., E.
toll) or in a eukaryotic host (e.g., S. cerevisiae, insect cells, such as S~
cells, or
mammalian cells, such as COS-1, NIH 3T3, or HeLa cells). These cells are
commercially available from, for example, the American Type Culture
Collection, Rockville, Maryland (see also Ausubel et al., supra). The method
of transformation and the choice of expression vehicle (e.g., expression
vector)
will depend on the host system selected. Transformation and transfection
methods are described, e.g., in Ausubel et al., supra, and expression vehicles
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/242G3
18
can be chosen from those provided, e.g., in Pouwels et al., Cloning Vectors:
A Laboratory Manual, 1985, Supp. 1987. Polypeptides of the invention can be
tested for bone inducing activity using any of the assays described, for
example, in U.S. Patent No. 5,728,679.
Polypeptide fragments that incorporate various portions of BMP-
induced polypeptides are useful in identifying the domains important for the
biological activities of BMP-induced polypeptides. Methods for generating
such fragments are well known in the art (see, for example, Ausubel et al.,
supra) using the nucleotide sequences provided herein. For example, a BMP-
induced polypeptide fragment can be generated by PCR amplifying the desired
fragment using oligonucleotide primers designed based upon the BMP-induced
nucleic acid sequences provided herein. Preferably the oligonucleotide primers
include unique restriction enzyme sites that facilitate insertion of the
fragment
into the cloning site of a mammalian expression vector. This vector can then
be introduced into a mammalian cell by artifice by various techniques known in
the art, for example, those described herein, resulting in the production of a
BMP-induced gene fragment.
BMP-induced polypeptide fragments can be used in evaluating portions
of the protein involved in important biological activities, such as protein-
protein interactions. These fragments can be used alone or as chimeric fusion
proteins. BMP-induced polypeptide fragments can also be used to raise
antibodies specific for various regions of BMP-induced polypeptides.
BMP-Induced Poly~_eptide Antibodies
To prepare polyclonal antibodies, BMP-induced polypeptides, fragments
of BMP-induced polypeptides, or fusion proteins containing defined portions of
BMP-induced polypeptide can be synthesized in bacteria by expression of
CA 02345885 2001-04-10
WO 00/21976 PCTNS99/24263
19
corresponding DNA sequences in a suitable cloning vehicle. Fusion proteins
are commonly used as a source ~f antigen for producing antibodies. Two
widely used expression systems for E. coli are IacZ fusions using the pUR
series of vectors and trpE fusions using the pATH vectors. The proteins can be
purified, coupled to a carrier protein and mixed with Freund's adjuvant, to
enhance stimulation of the antigenic response in an innoculated animal, and
injected into rabbits or other laboratory animals. Alternatively, protein can
be
isolated from BMP-induced polypeptide-expressing cultured cells. Following
booster injections at bi-weekly intervals, the rabbits or other laboratory
animals
are bled and sera isolated. The sera can be used directly or can be purified
prior to use by various methods, including affinity chromatography employing
reagents such as Protein A-Sepharose, antigen-Sepharose, or anti-mouse-Ig-
Sepharose. The sera can then be used to probe protein extracts from BMP-
induced polypeptide-expressing tissue electrophoretically fractionated on a
polyacrylamide gel to identify BMP-induced polypeptides. Alternatively,
synthetic peptides can be made that correspond to the antigenic portions of
the
protein and used to innoculate the animals.
To generate peptide or full-length proteins for use in making, for
example, BMP-induced polypeptide-specific antibodies, a BMP-induced
polypeptide coding sequence can be expressed as a C-terminal fusion with
glutathione S-transferase (GST; Smith et al., Gene (i7:31-40, 1988). The
fusion
protein can be purified on glutathione-Sepharose beads, eluted with
glutathione, cleaved with Thrombin (at the engineered cleavage site), and
purified to the degree required to successfully immunize rabbits. Primary
immunizations can be carried out with Freund's complete adjuvant and
subsequent immunizations performed with Freund's incomplete adjuvant.
Antibody titers are monitored by Western blot and immunoprecipitation
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
analyses using the thrombin-cleaved BMP-induced palypeptide fragment of the
GST-BMP-induced polypeptide fusion protein. Immune sera are affinity
purified using CNBr-Sepharose-coupled BMP-induced polypeptide. Antiserum
specificity can be determined using a panel of unrelated GST fusion proteins.
Alternatively, monoclonal BMP-induced polypeptide antibodies can be
produced by using, as an antigen, a BMP-induced polypeptide isolated from
BMP-induced polypeptide-expressing cultured cells or BMP-induced
polypeptide isolated from tissues. The cell extracts, or recombinant protein
extracts containing BMP-induced polypeptide, can, for example, be injected
10 with Freund's adjuvant into mice. Several days after being injected, the
mouse
spleens are removed, the tissues are disaggregated, and the spleen cells are
suspended in phosphate-buffered saline (PBS). The spleen cells serve as a
source of lymphocytes, some of which are producing antibody of the
appropriate specificity. These are then fused with permanently growing
15 myeloma partner cells, and the products of the fusion are plated into a
number
of tissue culture wells in the presence of a selective agent such as
hypoxanthine, aminopterine, and thymidine (HAT). The wells are then
screened by ELISA to identify those containing cells making antibody capable
of binding a BMP-induced polypeptide or polypeptide fragment or mutant
20 thereof. These are then replated and after a period of growth, these wells
are
again screened to identify antibody-producing cells. Several cloning
procedures are carried out until over 90% of the wells contain single clones
that
are positive for antibody production. From this procedure a stable line of
clones that produce the antibody is established. The monoclonal antibody can
then be purified by affinity chromatography using Protein A Sepharose, ion-
exchange chromatography, as well as variations and combinations of these
techniques. Truncated versions of monoclonal antibodies can also be produced
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
21
by recombinant methods in which plasmids are generated that express the
desired monoclonal antibody fragments) in a suitable host.
As an alternate or adjunct immunogen to GST fusion proteins, peptides
corresponding to relatively unique hydrophilic regions of BMP-induced
polypeptide can be generated and coupled to keyhole limpet hemocyanin
(KLH) through an introduced C-terminal lysine. Antiserum to each of these
peptides is similarly affinity-purified on peptides conjugated to BSA, and
specificity is tested by ELISA and Western blotting using peptide conjugates,
and by Western blotting and immunoprecipitation using a BMP-induced
polypeptide, for example, expressed as a GST fusion protein.
Alternatively, monoclonal antibodies can be prepared using the BMP-
induced polypeptides described above and standard hybridoma technology (see,
e.g., Kohler et al., Nature 256:495, 1975; Kohler et ul., Eur. J. Immunol.
6:511,
1976; Kohler et al., Eur. J. Immunol. 6:292, 1976; Hammerling et al., In
1 S Monoclonal Antibodies and T Cell Hybridomas, Elsevier, New York, NY,
1981; Ausubel et al., supra). Once produced, monoclonal antibodies are also
tested for specific BMP-induced polypeptide recognition by Western blot or
immunoprecipitation analysis (for example, by the methods described in
Ausubel et al., supra). Monoclonal and polyclonal antibodies that specifically
recognize a BMP-induced polypeptide (or a fragment thereof) are considered
useful in the invention.
Antibodies of the invention can be produced using BMP-induced
polypeptide amino acid sequences that do not reside within highly conserved
regions, and that appear likely to be antigenic, as analyzed by criteria such
as
those provided by the Peptide Structure Program (Genetics Computer Group
Sequence Analysis Package, Program Manual for the GCG Package, Version 7,
1991) using the algorithm of Jameson and Wolf (CABIOS 4:181, 1988). These
CA 02345885 2001-04-10
WO 00121976 PCT/US99/24263
22
fragments can be generated by standard techniques, e.g., by PCR, and cloned
into the pGEX expression vector l Ausubel et al., supra). GST fusion proteins
are expressed in E. coli and purified using a glutathione-agarose affinity
matrix
as described in Ausubel et al., supra. To generate rabbit polyclonal
antibodies,
and to minimize the potential for obtaining antisera that are non-specific, or
exhibit low-affinity binding to a BMP-induced polypeptide, two or three
fusions are generated for each protein, and each fusion is injected into at
least
two rabbits. Antisera are raised by injections in series, preferably including
at
least three booster injections.
In addition to intact monoclonal and polyclonal anti-BMP-induced
polypeptide antibodies, the invention features various genetically engineered
antibodies, humanized antibodies, and antibody fragments, including F(ab')2,
Fab', Fab, Fv, and sFv fragments. Antibodies can be humanized by methods
known in the art, e.g., monoclonal antibodies with a desired binding
specificity
can be commercially humanized (Scotgene, Scotland; Oxford Molecular, Palo
Alto, CA). Fully human antibodies, such as those expressed in transgenic
animals, are also features of the invention (Green et al., Nature Genetics
7:13-
21, 1994).
Ladner (U.S. Patent Nos. 4,946,778 and 4,704,692) describes methods
for preparing single polypeptide chain antibodies. Ward et al. (Nature
341:544-546, 1989) describe the preparation of heavy chain variable domains,
which they term "single domain antibodies," and which have high antigen-
binding affinities. McCafferty et al. (Nature 348:552-554, 1990) show that
complete antibody V domains can be displayed on the surface of fd
bacteriophage, that the phage bind specifically to antigen, and that rare
phage
(one in a million) can be isolated after affinity chromatography. Boss et al.
(U.S. Patent No. 4,816,397) describe various methods for producing
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
23
immunoglobulins, and immunologically functional fragments thereof, which
include at least the variable domains of the heavy and light chain in a single
host cell. Cabilly et al. (U.S. Patent No. 4,816,567) describe methods for
preparing chimeric antibodies.
Antibodies to BMP-induced polypeptide can be used, as noted above, to
detect BMP-induced polypeptides or to inhibit the biological activities of BMP-
induced polypeptides. For example, a nucleic acid molecule encoding an
antibody or a portion of an antibody can be expressed within a cell to inhibit
BMP-induced polypeptide function. In addition, the antibodies can be coupled
to compounds for diagnostic and/or therapeutic uses, such as radionuclides and
liposomes carrying therapeutic compounds.
Use of BMP-Induced Gensand Polypeptides
Consistent with the role of BMPs in the potentiation of a number of
different tissues, BMP-induced genes and polypeptides also find use in
therapeutic and diagnostic applications involving growth potentiation in
diverse
tissues, including, for example, cartilage, tendon, ligament, nerve, muscle,
and
epidermal tissues, as well as organs such as pancreas, heart, liver, lung, and
kidney.
For example, therapies can be designed to circumvent or overcome
inadequate or excessive expression of BMP-induced genes. Inadequate
expression of such genes may be a characteristic of conditions associated with
bone loss, such as osteoporosis, Paget's disease, and osteogenesis imperfecta,
which can thereby be treated by administration of BMP-induced polypeptides
or genes that encode them.
As is noted above, CAPE has been identified as a member of the family
of serine-threonine kinases. Misexpression of these kinases has been
CA 02345885 2001-04-10
WO 00/Z197b PCT/US99/24263
24
associated with malignancy. Thus, compounds that inhibit the activity of
CAPE, which can be identified according to the invention, can be used in
methods to prevent or to treat malignancies, such as cancer. Further, CAP6
includes a long glutamine repeat region, and expansion of such triplet repeats
has been associated with heritable diseases {e.g., Huntington's disease).
Thus,
compounds that inhibit this expansion, which can be identified according to
the
invention, can be used to prevent or to treat such diseases. CAPG, as well as
corresponding peptide fragments and nucleic acid molecules can also be used
to diagnose such conditions.
In considering various therapies, it is to be understood that such
therapies are preferably targeted to the effected or potentially effected
organs.
Reagents that modulate BMP-induced polypeptide biological activity include,
without limitation, full length BMP-induced polypeptides, or fragments
thereof,
BMP-induced polypeptide mRNA or antisense RNA, or any compound that
modulates BMP-induced polypeptide biological activity, expression, or
stability. Multiple active components can be administered together, for
example, molecules of the invention can be administered with each other or
with, e.g., BMPs or related molecules.
Treatment or prevention of diseases that would benefit from BMP-
induced polypeptide expression can be accomplished by replacing a mutant
BMP-induced polypeptide gene with a normal BMP-induced polypeptide gene,
by modulating the function a mutant protein, by delivering normal BMP-
induced polypeptide to the appropriate cells, or by altering the levels of
normal
or mutant protein. It is also possible to modify the pathophysiologic pathway
(e.g., a signal transduction pathway) in which the protein participates to
correct
the physiological defect.
To replace a mutant protein with normal protein, or to add protein to
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
cells that no longer express sufficient BMP-induced polypeptides, it may be
necessary to obtain large amounts of pure BMP-induced polypeptide from
cultured cell systems that can express the protein. Delivery of the protein to
the
effected tissue can then be accomplished using appropriate packaging or
5 administration systems. Alternatively, small molecule analogs that act as
BMP-induced polypeptide agonists or antagonists can be administered to
produce a desired physiological effect.
Gene therapy is another therapeutic approach for preventing or
ameliorating diseases related to BMP-induced polypeptide expression. Nucleic
10 acid molecules encoding BMP-induced polypeptides can be delivered to cells,
where it must be in a form in which it can be taken up and direct expression
of
sufficient protein to provide effective function. Transducing retroviral,
adenoviral, and human immunodeficiency viral (HIV) vectors can be used for
somatic cell gene therapy especially because of their high efficiency of
15 infection and stable integration and expression; see, e.g., Cayouette et
al., Hum.
Gene Therapy, 8:423-430, 1997; Kido et al., Curr. Eye Res., 15:833-844, 1996;
Bloomer et al., J. Virol., 71:6641-6649, 1997; Naldini et al., Science 272:263-
267, 1996; and Miyoshi et al., Proc. Nat. Acad. Sci., U.S:A., 94:10319-1032,
1997. For example, a full length BMP-induced polypeptide gene, or a portion
20 thereof, can be cloned into a retroviral vector and driven from its
endogenous
promoter or from the retroviral long terminal repeat or from a promoter
specific
for the target cell type of interest (such as neurons). Other viral vectors
which
can be used include adenovirus, adeno-associated virus, vaccinia virus, bovine
papilloma virus, or a herpes virus such as Epstein-Barr virus.
25 Gene transfer can also be achieved using non-viral means requiring
infection in vitro. This would include calcium phosphate, DEAE dextran,
electroporation, and protoplast fusion. Liposomes can also be beneficial for
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
26
delivery of DNA into a cell.
Transplantation of normal genes into the affected tissues of a patient can
also be accomplished by transferring a normal BMP-induced polypeptide gene
into a cultivatable cell type ex vivo, after which the cells are injected into
the
targeted tissue(s).
Retroviral vectors, adenoviral vectors, adenovirus-associated viral
vectors, or other viral vectors with the appropriate tropism for cells likely
to be
involved in BMP-induced polypeptide-related diseases can be used as gene
transfer delivery systems for therapeutic BMP-induced polypeptide gene
constructs. Numerous vectors useful for this purpose are generally known (see,
for example, Miller, Human Gene Therapy 15-14, 1990; Friedman, Science
244:1275-1281, 1989; Eglitis and Anderson, BioTechnigues 6:608-614, 1988;
Tolstoshev and Anderson, Curs°. Opin. Biotech. 1:55-61, 1990;
Sharp, The
Lancet 337:1277-1278, 1991; Cornetta et al., Nucl. Acid Res. and Mol. Biol.
36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells
17:407-416, 1991; Miller et al., Biotech. 7:980-990, 1989; Le Gal La Salle et
al., Science 259:988-990, 1993; and Johnson, Chest 107:775-835, 1995).
Retroviral vectors are particularly well developed and have been used in
clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson
et
al., U.S. Patent No. 5,399,346).
Non-viral approaches can also be employed for the introduction of
therapeutic DNA into cells predicted to be subject to diseases involving BMP-
induced polypeptides. For example, a BMP-induced polypeptide nucleic acid
molecule or antisense nucleic acid molecule can be introduced into a cell by
lipofection (Felgner et al., Pr°oc. Natl. Acad. Sci. USA 84:7413, 1987;
Ono
et al., Neurosci. Lett. 117:259, 1990; Brigham et al., Am. J. Med. Sci.
298:278,
1989; Staubinger et al., Meth. Enz. 101:512, 1983), asialoorosomucoid-
CA 02345885 2001-04-10
WO 00/Z1976
PCTNS99/24263
27
polylysine conjugation (Wu et al., .I. Biol. CIZeni. 263:14621, 1988; Wu et
al.,
J. Biol. Chem. 264:16985, 1989), or, less preferably, micro-injection under
surgical conditions (Wolff et al., Science 247:1465, 1990).
In these constructs, BMP-induced polypeptide cDNA expression can be
directed from any suitable promoter (e.g., the human cytomegalovirus (CMV),
simian virus 40 ((SV40), or metallothionein promoters), and regulated by any
appropriate mammalian regulatory element. For example, if desired, enhancers
known to preferentially direct gene expression in specific cell types can be
used
to direct BMP-induced polypeptide expression. The enhancers used include,
without limitation, those that are characterized as tissue- or cell-specific
enhancers. Alternatively, if a BMP-induced polypeptide genomic clone is used
as a therapeutic construct (such clones can be identified by hybridization
with
the BMP-induced polypeptide cDNA described above), regulation can be
mediated by the cognate regulatory sequences or, if desired, by regulatory
sequences derived from a heterologous source, including any of the promoters
or regulatory elements described above.
Antisense-based strategies can be employed to explore BMP-induced
polypeptide gene function and as a basis for therapeutic drug design. The
principle is based on the hypothesis that sequence-specific suppression of
gene
expression (via transcription or translation) can be achieved by intracellular
hybridization between genomic DNA or mRNA and a complementary
antisense species. The formation of a hybrid RNA duplex interferes with
transcription of the target BMP-induced polypeptide-encoding genomic DNA,
or processing, transport, translation, and/or stability of the target BMP-
induced
polypeptide mRNA.
Antisense molecules can be delivered by a variety of approaches. For
example, antisense oligonucleotides or antisense RNA can be directly
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
28
administered (e.g., by intravenous injection) to a subject in a form that
allows
uptake into cells. Alternatively, viral or plasmid vectors that encode
antisense
RNA (or RNA fragments) can be introduced into a cell in vivo or ex vivo.
Antisense effects can be induced by control (sense) sequences; however, the
extent of phenotypic changes are highly variable. Phenotypic effects induced
by antisense effects are based on changes in criteria such as protein levels,
protein activity measurement, and target mRNA levels.
For example, BMP-induced polypeptide gene therapy can also be
accomplished by direct administration of antisense BMP-induced polypeptide
mRNA to a cell that is expected to be adversely affected by the expression of
wild-type or mutant BMP-induced polypeptide. The antisense BMP-induced
polypeptide mRNA can be produced and isolated by any standard technique,
but is most readily produced by iu vitro transcription using an antisense BMP-
induced polypeptide cDNA under the control of a high efficiency promoter
(e.g., the T7 promoter). Administration of antisense BMP-induced polypeptide
mRNA to cells can be carried out by any of the methods for direct nucleic acid
administration described above.
An alternative strategy for inhibiting BMP-induced polypeptide function
using gene therapy involves intracellular expression of an anti-BMP-induced
polypeptide antibody or a portion of an anti-BMP-induced polypeptide
antibody. For example, the gene (or gene fragment) encoding a monoclonal
antibody that specifically binds to BMP-induced polypeptide and inhibits its
biological activity can be placed under the transcriptional control of a
tissue-
specific gene regulatory sequence.
Another therapeutic approach within the invention involves
administration of recombinant BMP-induced polypeptide, either directly to the
site of a potential or actual disease-affected tissue (for example, by
injection) or
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
29
systemically (for example, by any conventional recombinant protein
administration technique). The dosage of BMP-induced polypeptide depends
on a number of factors, including the size and health of the individual
patient,
but, generally, between 0.1 mg and 100 mg inclusive are administered per day
to an adult in any pharmaceutically acceptable formulation.
The methods of the instant invention can be used to diagnose or treat the
disorders described herein in any mammal, for example, humans, domestic
pets, or livestock. Where a non-human mammal is treated or diagnosed, the
BMP-induced polypeptide, nucleic acid, or antibody employed is preferably
specific for that species.
A BMP-induced polypeptide, gene, or modulator of a BMP-induced
polypeptide can be administered within a pharmaceutically-acceptable diluent,
earner, or excipient, in unit dosage form. Conventional pharmaceutical
practice can be employed to provide suitable formulations or compositions to
administer BMP-induced polypeptides, neutralizing BMP-induced polypeptide
antibodies, or BMP-induced polypeptide-inhibiting compounds (e.g., antisense
molecules) to patients suffering from a BMP-induced polypeptide-related
disease, such as disease characterized by bone resorption, such as
osteoporosis.
Administration can begin before the patient is symptomatic. Any appropriate
route of administration can be employed, for example, administration can be
parenteral, intravenous, intra-arterial, subcutaneous, intramuscular,
intracranial,
intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal,
intracisternal, intraperitoneal, intranasal, aerosol, by suppositories, or
oral.
Therapeutic formulations can be in the form of liquid solutions or
suspensions;
for oral administration, formulations can be in the form of tablets or
capsules;
and for intranasal formulations, in the form of powders, nasal drops, or
aerosols.
CA 02345885 2001-04-10
WO 00/21976 PCTNS99/24263
Methods well known in the art for making formulations are found, for
example, in Remington 's Pharmaceutical Sciences, ~ 18'x' edition), ed. A.
Gennaro, 1990, Mack Publishing Company, Easton, PA. Formulations for
parenteral administration can, for example, contain excipients, sterile water,
or
5 saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable
origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide
polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene
copolymers can be used to control the release of the compounds. Other
potentially useful parenteral delivery systems for BMP-induced polypeptide
10 modulatory compounds include ethylene-vinyl acetate copolymer particles,
osmotic pumps, implantable infusion systems, and liposomes. Formulations for
inhalation can contain excipients, for example, lactose, or can be aqueous
solutions containing, for example, polyoxyethylene-)-lauryl ether,
glycocholate
and deoxycholate, or can be oily solutions for administration in the form of
15 nasal drops, or as a gel.
In addition, BMP-induced genes and polypeptides have a number of
diagnostic uses. For example, as discussed above, maintenance of bone
structure requires a balance between the bone resorbing activity of
osteoclasts
and the bone formation activity of osteoblasts. Throughout life, a dynamic
20 process of bone remodeling takes place through the opposing activities of
these
cells, with the net effect, under normal circumstances, of maintaining bone
structure. Disruption of this balance is a hallmark of bone injury, as well as
several diseases of bones, such as osteoporosis, Paget's disease, and
osteogenesis imperfecta.
25 As noted above, the genes of the invention are induced in the
differentiation of the bone formation cells, osteoblasts. Thus, the genes of
the
invention and, in particular, the gene products they encode, can be used as
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
31
markers of bone formation and resorption, facilitating diagnosis of, for
example, pathological alterations in bone turnover and to measure responses to
therapy. This is of significant medical relevance, as numerous and prevalent
debilitating diseases are associated with loss of the balance between bone
loss
and formation. In particular, osteoporosis and Paget's disease are associated
with net bone loss.
Standard diagnostic methods, such as immunoassays, including enzyme-
linked immunosorbent assays (ELISAs), quantitative PCR, and reverse
transcriptase/polymerase chain reaction (RT/PCR)-based assays can be readily
adapted for use in the diagnostic methods of the invention (see, e.g., Ausubel
et
al., supra; Ehrlich (Ed.) PCR TechiZOlogy: Principles and Applications for
DNA Amplification, Stockton Press, NY; Yap et al., Nucl. Acids. Res. 19:4294,
1991). Materials from which samples may be obtained for use in diagnosis
include, for example, urine, blood samples (e.g., serum) and bone marrow,
which can be obtained using standard methods. Of course, use of samples
obtained by minimally invasive techniques are preferred, provided sufficient
levels of marker are present in the sample for detection.
Standard immunoassays can be used to detect or to monitor BMP-
induced polypeptide expression in a biological sample. BMP-induced
polypeptide-specific polyclonal or monoclonal antibodies (produced as
described above) can be used in any standard immunoassay format (e.g.,
ELISA, Western blot, or RIA) to measure BMP-induced polypeptide levels.
These levels can be compared to wild-type BMP-induced polypeptide levels in
control samples. For example, a decrease in BMP-induced polypeptide
production can indicate a condition or a predisposition to a condition
involving
insufficient BMP-induced polypeptide biological activity. Examples of
immunoassays are described, e.g., in Ausubel et al., supra.
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
32
Immunohistochemical techniques can also be utilized for BMP-induced
polypeptide detection. For example, a tissue sample can be obtained from a
patient, sectioned, and stained for the presence of BMP-induced polypeptides
using an anti-BMP-induced polypeptide antibody and any standard detection
system (e.g., one which includes a secondary antibody conjugated to
horseradish peroxidase). General guidance regarding such techniques can be
found in, e.g., Bancroft and Stevens (Theory and Practice of Histological
Techniques, Churchill Livingstone, 1982) and Ausubel et al., supra.
Alternatively, diagnosis of BMP-related disorders may be evaluated by
an examination of BMP-induced genes and a determination of whether such
genes include mutations characteristic of disease. Moreover, as discussed
above, such BMP-induced genes and polypeptides may be used for diagnostic
purposes for detecting alterations in any of a variety of issues including,
for
example, cartilage, tendon, ligament, nerve, muscle, and epidermal tissues, as
well as organs such as pancreas, heart, liver, lung, and kidney.
Additional uses and applications for the molecules of the invention are
described, for example, in tl.S. Patent Nos. 5,661,007, 5,728,679, 5,703,043,
5,700,911, 5,688,678, 5,658,882, 5,639,638, 5,637,480, 5,635,372, 5,459,047,
and 5,543,394, which, as all other references cited herein, are hereby
incorporated by reference.
What is claimed is:
CA 02345885 2001-04-10
WO 00/21976 PCTNS99/24263
1
SEQUENCE LISTING
<110> The General Hospital Corporation
<120> BONE MORPHOGENIC PROTEIN-INDUCED GENES
AND POLYPEPTIDES, AND THEIR USES IN DIAGNOSTIC AND
THERAPEUTIC METHODS
<130> 00786/367W02
<150> 60/104,416
<151> 1998-10-15
<160> 4
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 7192
<212> DNA
<213> Mus musculus
<220>
<221> misc_feature
<222> (1). .(7192)
<223> n = A,T,C or G
<400>
1
cggtggcggccgctctagaactagtggatcccccgggctgcaggaattcggcacgagccc 60
gctggctctgcgggcgccgggcagctgcagcgggcggccagggctgcgcgctcgggacgc 120
gcggaatgtgaggcgcggcgagccgctgcgcaccgacgctcgcgcgcgcgaagggcggcg 180
acccctcgaagacggtcggccgcgcccggcgctccgctgtgcgacgcgcgggtctgggct 240
ctcgccctcgcgcgccctagtgccctcctggtgccctccagcgcgccggcgggaccatga 300
agaagttctctcggatgcccaagtcggagggcagcggcggcggggcggcggctggcgggg 360
ccgcgggcggcgggctcggcggcggcttcgcaagctcgtccatgggggtccgggtgttcg 420
ccgtcggccgctaccaggtcaccctggaggagtcgctggccgaaggtggattctccactg 480
ttttcctggtgcggactcacagtgggatccgatgtgcactgaagcgaatgtatgtcaata 540
acacacccgacctcaacatttgtaaaagggaaatcacgattatgaaagagttatctggcc 600
acaaaaatattgtcggttatttggactgtgctgtcaattcaattagtgacaatgtgtggg 660
aagtgcttatcttaatggaatattgtcgagctgggcaggttgtgaaccagatgaataaga 720
agctgcagacaggctttaccgagtcagaagtcctacaaatcttctgtgatacctgcgaag 780
ctgtcgcacgattgcatcaatgtaagactcccataatccaccgggatctgaaggtagaaa 840
atattttgctaaatgatgctggaaattatgtgctttgtgactttggcagtgccactaata 900
aatttctcaatcctcaaaaagatggagttaatgtagtagaagaagaaattaaaaaataca 960
cgactctgtcgtatagagcaccagaaatgatcaacctttatggagggaaaccgatcacca 1020
ccaaggctgatatctgggccttgggatgtttactgtataaactttgtttcttcactcttc 1080
cttttggtgagagtcaggttgctatctgtgatggcagcttcaccatcccagacaattctc 1140
gctactcccacaacgtgcattgcttgattaggttcatgcttgaaccagaccccgagtgca 1200
gacctgacatatttcaagtatcctactttgcgtttaaattcgccaaaaaggattgtccgg 1260
tctccaacatcaataattcttttcttccatcaactcttcccgagccgatgactgctactg 1320
aagctgctgctaggaaaagccagatgaaagccagaataacagataccattggaccaacag 1380
aaacctcaattgcaccaagacaaagaccaaaggccaattccactgctgccacttccagtg 1440
tgctgaccattcagagttcagcaacgcctgtcaaagtccctgctcctggggagttcagca 1500
accacaaacccaaaggagcattgagacctggaaatgggtctgaagtcttaatggttcagg 1560
CA 02345885 2001-04-10
WO 00/21976 PCTNS99/24263
2
gaccccctcagcaacccccacagcagcatagagtcctccagcagttgcagcagggagact 1620
ggagattacagcaacttcatttgcatcgtcatccccaccaccaccatcagcaacagcaac 1680
aacagcaacaacaacagcagcaacaacagctgcagcaacaacagcaacagcaacagcaac 1740
tacttcaaaatgcttacttgcagcagtatcagcatgcaatgcaccagcagcatatacttc 1800
agcaacagtttcta~agcactcagtgtatcagccacaaccgcctgcatcccagtatcctg 1860
ccatgatgcagcagtatcagcaggctttcttgcagcagcagatgctagctcgccatcagc 1920
agccagcacagcaggtatcacccgagtatcttacctccccgcaagagttctcaccagcct 1980
tagtttcctacgcctcgtcacttccagctcaggttggaaccatagtggactcttcttacg 2040
gtgccaacaggtcagttgctgagaaagaggcagttgcaaattttacaaatcagaagacca 2100
ttagtcaccctcctgacatgtcaggctggaatccttttggagaagacaatttttccaagt 2160
taacagaagaggaactgttggacagagaatttgaccttctaagatcaaacaggctcgggg 2220
cgagcacaccctcagataagactgtagacctgccccccgctccacatagccgtcctccgg 2280
aggagccttttgcttccgtccctttcatttctcactcaggttctcctgaaaagaaaacga 2340
cggaacattctccaaatcaaaaatctatcactgcaaaccttaccaaaaatggaggctcaa 2400
gtccactatgtaaagatcagcgagccggaaagaaaacctccgagaatcccgtaattaggg 2460
gtcaagtacaaaagggacatgatgattctgaaagtgatttcgaatcagaccccccttctc 2520
ctaagagcagtgaagaagaacaagaggatgaagacgcacagggagaacacggggacttta 2580
atgatgacgacactgagccggagaacctgggtcacaggcctctgctgatggactctgaag 2640
atgaggaagaggacgacaaacacagctctgattcagagtgtgaacaggcaaagaccaaga 2700
gaggagacacgagctccctgcgcagggacaaacctggcgtggccccagacacagccctcc 2760
tgaccccggcccgctcgcctgctgatgcgctgactcccagtcaggagttcgatgtgtttg 2820
gcgctgttcccttctttgcagcgcctgctccgcagagcctgcagcacagaggggatggga 2880
agaacctgtcccagcatgcttttccagagcaggaggacttcgacgtgttcacaaaggcac 2940
ccttcaacaagaaggtcagcgtacaggactggcccgcggtggggccagatgcccggcctc 3000
tgcctgcacggcccagaagtgtagatatatttggctccactcccttccagcccttctccg 3060
tgtcagccagtaaaagtgaaagcaaggaggatgtttttgggctcgtgccctttgaggaaa 3120
taactgggagtcagcagcagcagaaagtcaagcagcgcagcttgcagaaactctcctctc 3180
gccagagacgcacaaagcaggatgtgtccaaaagcaatgggaagcgccatcacggcaccc 3240
ctaccagcgcaaagaagacgctgaagcccccctaccgcacgcccgagagggcccgcagac 3300
acaagaaggtgggccgcagagactcccagagcagcaatgagtttttaaccatttccgatt 3360
ccaaggagaacatcagcgtcgcgctgactgatggcaaagacagggccagtgtcctgccat 3420
ctgacgagagtctgctggacccattcggtgccaagccctttcatcctccagacttgtggc 3480
accagccccatcagggcctaagcgacatctgcgttgatcacaccaccattttgcctggga 3540
ggccgcgacagaattcagtacacgggtccttccacagcgcagagacattgagaatggatg 3600
actttggtgccgtgccctttacagaactcgtggtgcaaagtgtcactccacaacagtccc 3660
aaccggtcgaactagacccctttggtgctgctccatttccttctaaacagtagatacttc 3720
aggtggactcagcaataactcctgtttcaaaaaagtatgaatagttttatgaatctggaa 3780
gaaaaagtatttgtatagttgtttatatcatacactcttcacaggttaatcaggataggt 3840
gatttttaaataaaccaaatggaattgtttgtacagggtagtaagtggatgccttcttca 3900
agcaggaggaggcctaaatcgaaagttccaagggcttttgctactgacagctagctcaga 3960
ggttcccgtgggctccctgggaaagctgctgtgtagccgctgagggacaagaaagcttat 4020
cacttcagatatcacatgtcacctaggtgcacaccccagatgcagcgtttggggctgaat 4080
gaatgcttccaccatgaggaaacagcctcgagtgctcttcatacactgcttcgtaaggtg 4140
gagccagaggaaactgactgttgtgcctaaaaatactgtttcattaaaaaacaaaacaaa 4200
acaagtgccattaataatggactctgcaatgataagtatatgaaataatgtatatattaa 4260
ctcactttagcccttctatggtgtatggctcaaaacatgtatatgataatatatatgcag 4320
tttctaatctgtcaaaaataaatttttacaatgtggaatgcctagaacaaaaatacaaag 4380
agaaatatctggcatttgaaaaaaatgtaaaagaatgatacgtaaaaagaaaagcaacat 4440
ttggtacttcagaaagactttgtctttgaatgggtatttgccaaaacctttatcatcatg 4500
cccctactgaagtacattgatagaagggggggggcaggttatatagaaatttaatttcag 4560
aaacaatgtagctgaaactttaatttttaaagaagtttacaatgtaaaatcatgttgcat 4620
ttactgacctactttctgccagccccaccctcatccagcactggggagtcctgggctgca 4680
gttccttcagggtgctccgacagtgacagactctgcatggacagccagaccctcagtgga 4740
tggaagaactgggtggtgggactaggagcttaattctgctacccgactgcatcagtagtg 4800
aaaagaactaagctaccaaattgccttttaaaaaaatatcaccagtcataataagaaact 4860
CA 02345885 2001-04-10
WO 00/21976 PGT/US99/24263
3
tgaaattttgtagttgtggttagtgatagcagttatacatcagttaatgtgaatgtacta 4920
tccgtgcgtcctgtgtctgtcgtaagttatgattagcttctttacagatgagcatttgaa 4980
gtttctaggtcaacagctattgctattgattgctatattttaagttgcccccagttagtg 5040
taccttaatgagtaatcttattaaaacctcttaactttagtgccccagaaggtaaatcat 5100
ttgcctactttcagagttcagaacttggaaagaagcaaaatacataaccaaggcatggtc 5160
cttttatatttcttgtctcctcctctgcaaactcagtgggggtagtgtggacaggagcag 5220
gccacaccatgccacgcagaaccgggctgcaccacttactgtcctgtgccaaaggcagag 5280
actatgtttgcaccttttttttttctggttctcaggttaattaatctaactaacgcaaat 5340
ggtagtagaccctttaagctacaaaacagattcagtaatgcttgctttttaaagtaatga 5400
tgaactgatgtggtcttctgagttgtgaatatgaaatcagagttccacttgcctttcaat 5460
gcactgaatattttaaggtgattcactgacaacaacccctccagcttactctggacaaat 5520
tcttaggaaacaactctgccacagcttaaaatgtttacattgcctctgacagcccagcag 5580
gtgacactcctcttggaacccgctcattggacagatgatttaattggaggtccaatgggt 5640
agctcctttgcattgctgttagaggcattttctcaagctgaggagactccatttaaattt 5700
cagtgtcagctgccactgtcactctgtacagctgagccttaggtagcgaattccctcaca 5760
agaacttggctcccccacttaccagcacccaacactcactcaacagctggcccagttctg 5820
gcttaaagaatgtcatttgggtgtgccctgtgyttctaagtatgcaaagcagttctaact 5880
aaacccgttagacttgaacatcaaagggaagtcacgtgaggaacccagagttgtcagcta 5940
gaagctttaccagtgctcattaactctgaatcttcttaaaaagtggaccctttgctccac 6000
tttgaacacgtcaataaaaggttagtgtcgccagagaatcttttagggcattgaagaaat 6060
ggatctagtacagcacagcacagaggttgctcagtatgtagctggagaaaaggtctgctc 6120
caagcagggtgagaatggaactggctagaatattaagcactgcagtgctcctcccctggg 6180
ctgtgtgtcctgggcagttaggaaatcacttggctctcagatgtgtgcactttgcagtca 6240
gtgctaccctgtttaacaggaactgactcctctcatcttcctgatggaagatactaaggt 6300
ggtgcccactctggctcctctccattcggccatccaggcctgggtacttcactaaagcat 6360
tgttagaaggtgcacgtgtattaatatcactacttacgggaagtttgggtatatttgctt 6420
aatacctgtagagtgcacagtgaactctgttatttttttcttttctttttaagcaaaact 6480
agtcatcaaattacatccagtttctgaactgatggtctactgtgagatgatgtatctact 6540
gagagaatagcaaatgactgttgggaaaaaaaaaatctatactcggtgttgttttctact 6600
aagataaaaagatacttgcacaccaaaaaaaaaaaaaaaaaactcgagggggggcccggt 6660
acccaatncnccctatattgattcntattacaattcactggccgtcgttttacaacgtcn 6720
tgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgc 6780
cagctggcgtaataacgaaaaggcccncaccnatcncccttcccaacatttgcncaccct 6840
gaatggcgaatggcaaattgtaaccgttaatattttgttaaaattcccgttaaatttttg 6900
ttaaatcacctcattttttaaccaataggccgaaatcggcaaaatcccttataattcana 6960
agaatagaccgagatagggttgagtgttgttccattttggaacaaaagtcccctattaaa 7020
gaacttgaactccacntcaaagggcnaaaaaccgtctntcagggcnatggcccnctactt 7080
naaccancnccctaatcaatttttttggggtcaaagtgccctaaaccactaaatcggaac 7140
cctaaagggaccccccatttaaaacttaacggggaaaccggccaaatttggc 7192
<210> 2
<211> 1138
<212> PRT
<213> Mus musculus
<400> 2
Met Lys Lys Phe Ser Arg Met Pro Lys Ser Glu Gly Ser Gly Gly Gly
1 5 10 15
Ala Ala Ala Gly Gly Ala Ala Gly Gly Gly Leu Gly Gly Gly Phe Ala
20 25 30
Ser Ser Ser Met Gly Val Arg Val Phe Ala Val Gly Arg Tyr Gln Val
35 40 45
Thr Leu Glu Glu Ser Leu Ala Glu Gly Gly Phe Ser Thr Val Phe Leu
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
4
50 55 60
Val Arg Thr His Ser Gly Ile Arg Cys Ala Leu Lys Arg Met Tyr Val
65 70 75 80
Asn Asn Thr Pro Asp Leu Asn Ile Cys Lys Arg Glu Ile Thr Ile Met
85 90 95
Lys Glu Leu Ser Gly His Lys Asn Ile Val Gly Tyr Leu Asp Cys Ala
100 105 110
Val Asn Ser Ile Ser Asp Asn Val Trp Glu Val Leu Ile Leu Met Glu
115 120 125
Tyr Cys Arg Ala Gly Gln Val Val Asn Gln Met Asn Lys Lys Leu Gln
130 135 140
Thr Gly Phe Thr Glu Ser Glu Val Leu Gln Ile Phe Cys Asp Thr Cys
145 150 155 160
Glu Ala Val Ala Arg Leu His Gln Cys Lys Thr Pro Ile Ile His Arg
165 170 175
Asp Leu Lys Val Glu Asn Ile Leu Leu Asn Asp Ala Gly Asn Tyr Val
180 185 190
Leu Cys Asp Phe Gly Ser Ala Thr Asn Lys Phe Leu Asn Pro Gln Lys
195 200 205
Asp Gly Val Asn Val Val Glu Glu Glu Ile Lys Lys Tyr Thr Thr Leu
210 215 220
Ser Tyr Arg Ala Pro Glu Met Ile Asn Leu Tyr Gly Gly Lys Pro Ile
225 230 235 240
Thr Thr Lys Ala Asp Ile Trp Ala Leu Gly Cys Leu Leu Tyr Lys Leu
245 250 255
Cys Phe Phe Thr Leu Pro Phe Gly Glu Ser Gln Val Ala Ile Cys Asp
260 265 270
Gly Ser Phe Thr Ile Pro Asp Asn Ser Arg Tyr Ser His Asn Val His
275 280 285
Cys Leu Ile Arg Phe Met Leu Glu Pro Asp Pro Glu Cys Arg Pro Asp
290 295 300
Ile Phe Gln Val Ser Tyr Phe Ala Phe Lys Phe Ala Lys Lys Asp Cys
305 310 315 320
Pro Val Ser Asn Ile Asn Asn Ser Phe Leu Pro Ser Thr Leu Pro Glu
325 330 335
Pro Met Thr Ala Thr Glu Ala Ala Ala Arg Lys Ser Gln Met Lys Ala
340 345 350
Arg Ile Thr Asp Thr Ile Gly Pro Thr Glu Thr Ser Ile Ala Pro Arg
355 360 365
Gln Arg Pro Lys Ala Asn Ser Thr Ala Ala Thr Ser Ser Val Leu Thr
370 375 380
Ile Gln Ser Ser Ala Thr Pro Val Lys Val Pro Ala Pro Gly Glu Phe
385 390 395 400
Ser Asn His Lys Pro Lys Gly Ala Leu Arg Pro Gly Asn Gly Ser Glu
405 410 415
Val Leu Met Val Gln Gly Pro Pro Gln Gln Pro Pro Gln Gln His Arg
420 425 430
Val Leu Gln Gln Leu Gln Gln Gly Asp Trp Arg Leu Gln Gln Leu His
435 440 445
Leu His Arg His Pro His His His His Gln Gln Gln Gln Gln Gln Gln
450 455 460
Gln Gln Gln Gln Gln Gln Gln Leu Gln Gln Gln Gln Gln Gln Gln Gln
465 470 475 480
Gln Leu Leu Gln Asn Ala Tyr Leu Gln Gln Tyr Gln His Ala Met His
485 490 495
CA 02345885 2001-04-10
WO 00121976 PCT/US99/24263
Gln Gln His Ile Leu Gln Gln Gln Phe Leu Met His Ser Val Tyr Gln
500 505 510
Pro Gln Pro Pro Ala Ser Gln Tyr Pro Ala Met Met Gln Gln Tyr Gln
515 520 525
Gln Ala Phe Leu Glz Gln Gln Met Leu Ala Arg His Gln Gln Pro Ala
530 535 540
Gln Gln Val Ser Pro Glu Tyr Leu Thr Sex Pro Gln Glu Phe Ser Pro
545 550 555 560
Ala Leu Val Ser Tyr Ala Ser Ser Leu Pro Ala Gln Val Gly Thr Ile
565 570 575
Val Asp Ser Ser Tyr Gly Ala Asn Arg Ser Val Ala Glu Lys Glu Ala
580 585 590
Val Ala Asn Phe Thr Asn Gln Lys Thr Ile Ser His Pro Pro Asp Met
595 600 605
Ser Gly Trp Asn Pro Phe Gly Glu Asp Asn Phe Ser Lys Leu Thr Glu
610 615 620
Glu Glu Leu Leu Aep Arg Glu Phe Asp Leu Leu Arg Ser Asn Arg Leu
625 630 635 640
Gly Ala Ser Thr Pro Ser Asp Lys Thr Val Asp Leu Pro Pro Ala Pro
645 650 655
His Ser Arg Pro Pro Glu Glu Pro Phe Ala Ser Val Pro Phe Ile Ser
660 665 670
His Ser Gly Ser Pro Glu Lys Lys Thr Thr Glu His Ser Pro Asn Gln
675 680 685
Lys Ser Ile Thr Ala Asn Leu Thr Lys Asn Gly Gly Ser Ser Pro Leu
690 695 700
Cys Lys Asp Gln Arg Ala Gly Lys Lys Thr Ser Glu Asn Pro Val Ile
705 710 715 720
Arg Gly Gln Val Gln Lys Gly His Asp Asp Ser Glu Ser Asp Phe Glu
725 730 735
Ser Asp Pro Pro Ser Pro Lys Ser Ser Glu Glu Glu Gln Glu Asp Glu
740 745 750
Asp Ala Gln Gly Glu His Gly Asp Phe Asn Asp Asp Asp Thr Glu Pro
755 760 '765
Glu Asn Leu Gly His Arg Pro Leu Leu Met Asp Ser Glu Asp Glu Glu
770 775 780
Glu Asp Asp Lys His Sex Sex Asp Ser Glu Cys Glu Gln Ala Lys Thr
785 790 795 B00
Lys Arg Gly Asp Thr Ser Ser Leu Arg Arg Asp Lys Pro Gly Val Ala
805 810 815
Pro Asp Thr Ala Leu Leu Thr Pro Ala Arg Ser Pro Ala Asp Ala Leu
820 825 830
Thr Pro Ser Gln Glu Phe Asp Val Phe Gly Ala Val Pro Phe Phe Ala
835 840 845
Ala Pro Ala Pro Gln Ser Leu Gln His Arg Gly Asp Gly Lys Asn Leu
850 855 860
Ser Gln His Ala Phe Pro Glu Gln Glu Asp Phe Asp Val Phe Thr Lys
865 870 875 880
Ala Pro Phe Asn Lys Lys Val Ser Val Gln Asp Trp Pro Ala Val Gly
885 890 895
Pro Asp Ala Arg Pro Leu Pro Ala Arg Pro Arg Ser Val Asp Ile Phe
900 905 910
Gly Ser Thr Pro Phe Gln Pro Phe Ser Val Ser Ala Ser Lys Ser Glu
915 920 925
Ser Lys Glu Asp Val Phe Gly Leu Val Pro Phe Glu Glu Ile Thr Gly
CA 02345885 2001-04-10
WO 00/21976 PCT/US99/24263
6
930 935 940
Ser Gln Gln Gln Gln Lys Val Lys Gln Arg Ser Leu Gln Lys Leu Ser
945 950 955 960
Ser Arg Gln Arg Arg Thr Lys Gln Asp Val Ser Lys Ser Asn Gly Lys
965 970 975
Arg His His Gly Thr Pro Thr Ser Ala Lys Lys Thr Leu Lys Pro Pro
980 985 990
Tyr Arg Thr Pro Glu Arg Ala Arg Arg His Lys Lys Val Gly Arg Arg
995 1000 1005
Asp Ser Gln Ser Ser Asn Glu Phe Leu Thr Ile Ser .Asp Ser Lys Glu
1010 1015 1020
Asn Ile Ser Val Ala Leu Thr Asp Gly Lys Asp Arg Ala Ser Val Leu
1025 1030 1035 1040
Pro Ser Asp Glu Ser Leu Leu Asp Pro Phe Gly Ala Lys Pro Phe His
1045 1050 1055
Pro Pro Asp Leu Trp His Gln Pro His Gln Gly Leu Ser Asp Ile Cys
1060 1065 1070
Val Asp His Thr Thr Ile Leu Pro Gly Arg Pro Arg Gln Asn ser Val
1075 1080 1085
His Gly Ser Phe His Ser Ala Glu Thr Leu Arg Met Asp Asp Phe Gly
1090 1095 1100
Ala Val Pro Phe Thr Glu Leu Val Val Gln Ser Val Thr Pro Gln Gln
1105 1110 1115 1120
Ser Gln Pro Val Glu Leu Asp Pro Phe Gly Ala Ala :Pro Phe Pro Ser
1125 1130 1135
Lys Gln
<210> 3
<211> 106
<212> DNA
<213> Mus musculus
<400> 3
tttttttttt taccaaaggg taaatatgtt gtattaacat gaatcctaat gacaaacaca 60
ctgcagttat aagccacatt gaagatacac agaacagtcg aagctt 106
<210> 4
<211> 317
<212> DNA
<213> Mus musculus
<400>
4
aagctttttttttttacaaagttctgtacataaaataaatatacagaagcaaaccccgtc 60
aactgtgaacatcagtaatcctcactggtgggttcaccatttataaggaagacatcattc 120
aacgcatcccgtcacagagaccatcctgccagcaaggacttctaccccaaagtatcatca 180
ctgggccttctttatgaagtctgctaaacagcaagaagccttcaacctaccaactagcca 240
gcagccataaaagccatggctgtcttgtctagagtgtggcctaatggcaatgtctatatc 300
tcatgctgaccaaagct 317
