Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02347968 2001-04-10
. WO 00/22126 PCT/US99/23179
1
Description
FOLLISTATIN-RELATED PROTEIN ZFSTA2
BACKGROUND OF THE INVENTION
Follistatin is a monomeric, glycosylated protein
originally identified in porcine follicular fluid as a
potent inhibitor of pituitary follicle-stimulating hormone
(FSH) synthesis and secretion, follistatin was later shown
to exert some of its biological effects by specifically
binding the FSH-inducer activin. Other follistatin family
members include follistatin related protein or FRP
(Zwijsen et al., Eur. J. Biochem. 225:937-46, 1994),
SPARC, also known as osteonectin or BM-40 or the human
ortholog of mouse TSC-36 (Lane and Sage, ibid.), agrin
(Patthy and Nikolics, TINS 16:76-81, 1993), hevin (Girard
and Springer, Immunity 2:113-23, 1995), the Flik protein
of chickens (Amthor et al., Dev. Bioloav 178:343-62, 1996)
and the rat brain protein SC1 (Mendis et al., Brain Res.
730:95-106, 1996). Follistatins, however, are thought to
be more than "activin binders" since follistatin deficient
mice prepared by gene targeting have a more complex and
different phenotype than activin gene knock-out animals
(Mazuk et al., Nature 374:360-3, 1995 and Mazuk et al.,
Nature 374:356-9, 1995).
Activins and inhibins are potent activators and
inhibitors, respectively, of pituitary FSH secretion and
are members of the TGF-~3 family of peptide growth factors
(Mather et al., Proc. Soc. Exp. Biol. Med. 215:209-22,
1997). The activin and inhibin family of hormones, while
originally described as gonadally produced regulators of
pituitary FSH secretion, are now known to have a broad
range of effects within and outside of the reproductive
system (Mather et al., ibid.). Inhibins consist of a
common alpha subunit which is covalently linked to one of
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
2
two different beta subunits (inhibin A:a/BA; inhibin
B:a/BH); activins are covalently linked dimers of the two
B-subunits and therefore exist in three different forms
(activin A:BA/BA; activin B:BB/BH; activin AB:BA/BH) .
Activin and inhibin bind to follistatin with high
affinity, and although the structure of the activin
binding site has not been completely defined, preliminary
data (Inouye et al., Biochem. Biophys. Res Commun.
179:352-8, 1991) suggest that residues in the first amino
terminal cysteine-rich follistatin domain are involved in
hormone binding. Activin binding to follistatin is thus
thought to limit its biological effects by sequestration
of the peptide hormone. Thus, the broad range of
biological actions of the activins and inhibins, and
possibly other members of the TGF-(3 family as well, may be
regulated by binding to proteins of the follistatin
family. Different binding proteins may be involved for
each TGF-(3 family member as follistatin binds activin with
high affinity (nM), inhibin with lower affinity, and does
not appear to bind TGF-~i at all (blather et al., ibid.).
Follistatin family members may regulate the activity of
other growth factors as well, for example, SPARC or BM-40
have been shown to bind platelet derived growth factor
(PDGF-AB, PDGF-BB) {Lane and Sage, FASEB J. 8:163-73,
1994) .
This application provides a new member of the
follistatin family, zfsta2, which is likely to play a
major role in regulating the biological activities of the
TGF-(3 growth factors. Like other members of the
follistatin family, zfsta2 may play a broad role in
development and differentiation, pathogenesis of
atherosclerosis, regulation of the gonadal-pituitary-
hypothalamic axis, tooth and bone formation, regulation
of gonadal hormone production, spermatogenesis,
hypothalmic oxytocin secretion, proliferation and
differentiation of erythroid progenitors, hematopoiesis,
host defense and neuron survival.
CA 02347968 2001-04-10
CVO 00/22126 PCT/US99/23179
The present invention provides such polypeptides
for these and other uses that should be apparent to those
skilled in the art from the teachings herein.
SUMMARY OF THE INVENTION
Within one aspect the invention provides an
isolated polypeptide comprising a follistatin homology
domain, wherein the follistatin homology domain comprises
amino acid residues 65 to 133 of the amino acid sequence
of SEQ ID N0:2. Within one embodiment the polypeptide
further comprises an alpha helical linker region that
resides in a carboxyl-terminal position relative to the
follistatin homology domain, wherein the alpha helical
linker region comprises amino acid residues 134 to 174 of
the amino acid sequence of SEQ ID N0:2. Within a related
embodiment the polypeptide further comprises a calmodulin
homology domain that resides in a carboxyl-terminal
position relative to the alpha helical linker region,
wherein the calmodulin homology domain comprises amino
acid residues 175 to 250 of the amino acid sequence of SEQ
ID N0:2. Within another embodiment the polypeptide
further comprises two I-set Ig domains that reside in a
carboxyl-terminal position relative to the calmodulin
homology domain, wherein the I-set Ig domains comprise
amino acid residues 251 to 431 of the amino acid sequence
of SEQ ID N0:2. Within another embodiment the polypeptide
further comprises a carboxy-terminal domain that resides
in a carboxyl-terminal position relative to the I-set Ig
domains, wherein the carboxy-terminal domain comprises
amino acid residues 433 to 847 of the amino acid sequence
of SEQ ID N0:2. Within a yet another embodiment the
polypeptide further comprises a hydrophilic linker region
that resides in an amino-terminal position relative to the
follistatin homology domain, wherein the hydrophobic
linker region comprises amino acid residues 21 to 64 of
the amino acid sequence of SEQ ID N0:2. Within another
embodiment the polypeptide further comprises a secretory
CA 02347968 2001-04-10
WO 00/22126 PCT/US9923179
4
signal sequence that resides in an amino-terminal position
relative to the hydrophobic linker region, wherein the
secretory signal sequence comprises amino acid residues 1
to 20 of the amino acid sequence of SEQ ID N0:2.
Within another aspect the invention provides an
isolated polypeptide having an amino acid sequence that is
at least 70% identical to the amino acid sequence of SEQ
ID N0:2, wherein the isolated polypeptide specifically
binds with an antibody to which a polypeptide having the
amino acid sequence of SEQ ID N0:2 specifically binds.
Within one embodiment the isolated polypeptide has an
amino acid sequence that is at least 80% identical to the
amino acid sequence of SEQ ID N0:2. Within another
embodiment the isolated polypeptide has an amino acid
sequence that is at least 90% identical to the amino acid
sequence of SEQ ID N0:2. Within a further embodiment any
difference between the amino acid sequence and the
corresponding amino acid sequence of SEQ ID N0:2 is due to
one or more conservative amino acid substitutions. Within
another embodiment the amino acid percent identity is
determined using a FASTA program with ktup=1, gap opening
penalty=10, gap extension penalty=1, and substitution
matrix=blosum62, with other parameters set as default.
The invention also provides an isolated
polypeptide comprising the amino acid sequence of SEQ ID
N0:2.
The invention further provides an isolated
polypeptide selected from the group consisting of: a) a
polypeptide consisting of the sequence of amino acid
residues from residue 21 to residue 64 of SEQ ID N0:2; b)
a polypeptide consisting of the sequence of amino acid
residues from residue 65 to residue 133 of SEQ ID N0:2; c)
a polypeptide consisting of the sequence of amino acid
residues from residue 134 to residue 174 of SEQ ID N0:2;
d) a polypeptide consisting of the sequence of amino acid
residues from residue 175 to residue 250 of SEQ ID N0:2;
e) a polypeptide consisting of the sequence of amino acid
CA 02347968 2001-04-10
WO OO/ZZ126 PCT/US99/23179
residues from residue 251 to residue 334 of SEQ ID N0:2;
f) a polypeptide consisting of the sequence of amino acid
residues from residue 335 to residue 432 of SEQ ID N0:2;
g) a polypeptide consisting of the sequence of amino acid
5 residues from residue 433 to residue 847 of SEQ ID N0:2;
h) a polypeptide consisting of the sequence of amino acid
residues from residue 251 to residue 432 of SEQ ID N0:2;
i) a polypeptide consisting of the sequence of amino acid
residues from residue 65 to residue 174 of SEQ ID N0:2; j)
a polypeptide consisting of the sequence of amino acid
residues from residue 65 to residue 250 of SEQ ID N0:2; k)
a polypeptide consisting of the sequence of amino acid
residues from residue 65 to residue 334 of SEQ ID N0:2; 1)
a polypeptide consisting of the sequence of amino acid
residues from residue 65 to residue 847 of SEQ ID N0:2; m)
a polypeptide consisting of the sequence of amino acid
residues from residue 134 to residue 250 of SEQ ID N0:2;
n) a polypeptide consisting of the sequence of amino acid
residues from residue 134 to residue 334 of SEQ ID N0:2;
0) a polypeptide consisting of the sequence of amino acid
residues from residue 134 to residue 432 of SEQ ID N0:2;
p) a polypeptide consisting of the sequence of amino acid
residues from residue 134 to residue 847 of SEQ ID N0:2;
q) a polypeptide consisting of the sequence of amino acid
residues from residue 175 to residue 334 of SEQ ID N0:2;
r) a polypeptide consisting of the sequence of amino acid
residues from residue 175 to residue 432 of SEQ ID N0:2;
and s) a polypeptide consisting of the sequence of amino
acid residues from residue 175 to residue 847 of SEQ ID
N0:2.
The invention also provides an isolated
polypeptide as described above, further comprising an
affinity tag or binding domain.
Within another aspect the invention provides a
fusion protein comprising a secretory signal sequence
having the amino acid sequence of amino acid residues 1-20
CA 02347968 2001-04-10
WO 00/Z2126 PCT/US99/23179
6
of SEQ ID N0:2, wherein the secretory signal sequence is
operably linked to an additional polypeptide.
The invention also provides a fusion protein
consisting essentially of a first portion and a second
portion joined by a peptide bond, the first portion
comprising a polypeptide as described above; and the
second portion comprising another polypeptide.
Within another aspect the invention also
provides an isolated polynucleotide molecule that encodes
a polypeptide as described above. Within one embodiment
the polypeptide further comprises an affinity tag or
binding domain.
The invention also provides an isolated
polynucleotide molecule, wherein the polynucleotide
molecule is a degenerate nucleotide sequence encoding a
polypeptide as described above.
The invention further provides an isolated
polynucleotide encoding a polypeptide having an amino acid
sequence that is at least 70% identical to the amino acid
sequence of SEQ ID N0:2, wherein the isolated polypeptide
specifically binds with an antibody to which a polypeptide
having the amino acid sequence of SEQ ID N0:2 specifically
binds. Within one embodiment the isolated polypeptide has
an amino acid sequence that is at least 80% identical to
the amino acid sequence of SEQ ID N0:2. Within another
embodiment the isolated polypeptide has an amino acid
sequence that is at least 90% identical to the amino acid
sequence of SEQ ID N0:2. Within yet another embodiment
difference between the amino acid sequence and the
corresponding amino acid sequence of SEQ ID N0:2 is due to
one or more conservative amino acid substitutions. Within
still another embodiment the amino acid percent identity
is determined using a FASTA program with ktup=1, gap
opening penalty=10, gap extension penalty=1, and
substitution matrix=blosum62, with other parameters set as
default .
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
7
The invention provides an isolated
polynucleotide molecule comprising the nucleotide sequence
of nucleotides 58 to 3006 of SEQ ID NO:1.
The invention also provides an isolated
polynucleotide molecule of SEQ ID NO:1.
The invention further provides an isolated
polynucleotide selected from the group consisting of: a) a
polynucleotide consisting of nucleotides 58-117 of SEQ ID
NO:1; b) a polynucleotide consisting of nucleotides 118-
249 of SEQ ID NO:1; c) a polynucleotide consisting of
nucleotides 250-456 of SEQ ID NO:1; d) a polynucleotide
consisting of nucleotides 457-579 of SEQ ID NO:1; e) a
polynucleotide consisting of nucleotides 580-810 of SEQ ID
NO:1; f) a polynucleotide consisting of nucleotides 811-
1059 of SEQ ID NO:1; g) a polynucleotide consisting of
nucleotides 1060-1353 of SEQ ID NO:1; h)a polynucleotide
consisting of nucleotides 1354-3006 of SEQ ID NO:1; i) a
polynucleotide consisting of nucleotides 250-579 of SEQ ID
NO:1; j) a polynucleotide consisting of nucleotides 250-
810 of SEQ ID NO:1; k) a polynucleotide consisting of
nucleotides 250-1059 of SEQ ID NO:1; 1) a polynucleotide
consisting of nucleotides 250-1353 of SEQ ID NO:1; m) a
polynucleotide consisting of nucleotides 250-3006 of SEQ
ID N0:1; n) a polynucleotide consisting of nucleotides
457-810 of SEQ ID NO:1; o) a polynucleotide consisting of
nucleotides 457-1059 of SEQ ID NO: l; p) a polynucleotide
consisting of nucleotides 457-1353 of SEQ ID NO:1; q) a
polynucleotide consisting of nucleotides 457-3006 of SEQ
ID NO:1; r) a polynucleotide consisting of nucleotides
580-1059 of SEQ ID NO:1; s) a polynucleotide consisting of
nucleotides 580-1353 of SEQ ID NO: l; t) a polynucleotide
consisting of nucleotides 580-3006 of SEQ ID NO:1; and u)
a polynucleotide consisting of nucleotides 811-1353 of SEQ
ID NO:1.
The invention also provides a polynucleotide
encoding a fusion protein comprising a secretory signal
sequence having the amino acid sequence of amino acid
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
8
residues 1-20 of SEQ ID N0:2, wherein the secretory signal
sequence is operably linked to an additional polypeptide.
Still further, the invention provides a
polynucleotide molecule encoding a fusion protein
consisting essentially of a first portion and a second
portion joined by a peptide bond, the first portion
comprising a polypeptide as described above; and the second
portion comprising another polypeptide.
Within another aspect the invention provides an
expression vector comprising the following operably linked
elements: a transcription promoter; a polynucleotide
molecule that encodes a polypeptide as described above;
and a transcription terminator. Within one embodiment the
expression vector further comprises a secretory signal
sequence operably linked to the DNA segment. Within
another embodiment the polynucleotide encodes a
polypeptide covalently linked amino terminally or carboxy
terminally to an affinity tag.
Within another aspect the invention provides a
cultured cell into which has been introduced an expression
vector comprising the following operably linked elements: a
transcription promoter; a polynucleotide molecule that
encodes a polypeptide as described above; and a
transcription terminator, wherein the cultured cell
expresses the polypeptide encoded by the polynucleotide
segment.
Within still another aspect the invention
provides a method of producing a polypeptide comprising:
culturing a cell into which has been introduced an
expression vector comprising the following operably linked
elements: a transcription promoter; a polynucleotide
molecule that encodes a polypeptide as described above;
and a transcription terminator; whereby the cell expresses
the polypeptide encoded by the polynucleotide segment; and
recovering the expressed polypeptide.
Within another aspect the invention provides an
antibody or antibody fragment that specifically binds to a
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
9
polypeptide as described above. Within one embodiment the
antibody is selected from the group consisting of: a)
polyclonal antibody; b) murine monoclonal antibody; c)
humanized antibody derived from b); and d)human
monoclonal antibody. Within another aspect the antibody
fragment is selected from the group consisting of F(ab'),
F(ab), Fab', Fab, Fv, scFv, and minimal recognition unit.
Within another embodiment is an anti-idiotype antibody
that specifically binds to the antibody described above.
Within another aspect is provided a polypeptide
as described above in combination with a pharmaceutically
acceptable vehicle.
These and other aspects of the invention will
become evident upon reference to the following detailed
description of the invention.
DETAILED DESCRIPTION OF THE INVENTION
Prior to setting forth the invention in detail, it
may be helpful to the understanding thereof to define the
following terms:
The term "affinity tag" is used herein to denote
a polypeptide segment that can be attached to a second
polypeptide to provide for purification or detection of
the second polypeptide or provide sites for attachment of
the second polypeptide to a substrate. In principal, any
peptide or protein for which an antibody or other specific
binding agent is available can be used as an affinity tag.
Affinity tags include a poly-histidine tract, protein A
(Nilsson et al., EMBO J. 4:1075, 1985; Nilsson et al.,
Meth. Enzvmol. 198:3, 1991), glutathione S transferase
(Smith and Johnson, Gene 67:31, 1988), Glu-Glu affinity
tag (Grussenmeyer et al., Proc. Natl. Acad. Sci USA
82:7952-4, 1985), substance P, FlagT"' peptide (Hopp et al.,
Biotechnolomr 6:1204-10, 1988), streptavidin binding
peptide, or other antigenic epitope or binding domain.
See, in general, Ford et al., Protein Expression and
Purification 2: 95-107, 1991. DNAs encoding affinity tags
CA 02347968 2001-04-10
WO 00/22126 PCTlUS99/23179
are available from commercial suppliers (e. g., Pharmacia
Biotech, Piscataway, NJ).
The term "allelic variant" is used herein to
denote any of two or more alternative forms of a gene
5 occupying the same chromosomal locus. Allelic variation
arises naturally through mutation, and may result in
phenotypic polymorphism within populations. Gene
mutations can be silent (no change in the encoded
polypeptide) or may encode polypeptides having altered
10 amino acid sequence. The term allelic variant is also
used herein to denote a protein encoded by an allelic
variant of a gene.
The terms "amino-terminal" and "carboxyl
terminal" are used herein to denote positions within
polypeptides. Where the context allows, these terms are
used with reference to a particular sequence or portion of
a polypeptide to denote proximity or relative position.
For example, a certain sequence positioned carboxyl-
terminal to a reference sequence within a polypeptide is
located proximal to the carboxyl terminus of the reference
sequence, but is not necessarily at the carboxyl terminus
of the complete polypeptide.
The term "complement/anti-complement pair"
denotes non-identical moieties that form a non-covalently
associated, stable pair under appropriate conditions. For
instance, biotin and avidin (or streptavidin) are
prototypical members of a complement/anti-complement pair.
Other exemplary complement/anti-complement pairs include
receptor/ligand pairs, antibody/antigen (or hapten or
epitope) pairs, sense/antisense polynucleotide pairs, and
the like. Where subsequent dissociation of the
complement/anti-complement pair is desirable, the
complement/anti-complement pair preferably has a binding
affinity of <109 M-1.
The term "complements of a polynucleotide
molecule" is a polynucleotide molecule having a
complementary base sequence and reverse orientation as
CA 02347968 2001-04-10
WO 00/Z2126 PCT/US99/Z3179
11
compared to a reference sequence. For example, the
sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT
3'.
The term "contig" denotes a polynucleotide that
has a contiguous stretch of identical or complementary
sequence to another polynucleotide. Contiguous sequences
are said to "overlap" a given stretch of polynucleotide
sequence either in their entirety or along a partial
stretch of the polynucleotide. For example,
representative contigs to the polynucleotide sequence 5'-
ATGGCTTAGCTT-3' are 5'-TAGCTTgagtct-3' and 3'-
gtcgacTACCGA-5'.
The term "degenerate nucleotide sequence"
denotes a sequence of nucleotides that includes one or
more degenerate codons (as compared to a reference
polynucleotide molecule that encodes a polypeptide).
Degenerate codons contain different triplets of
nucleotides, but encode the same amino acid residue (i.e.,
GAU and GAC triplets each encode Asp).
The term "expression vector" is used to denote a
DNA molecule, linear or circular, that comprises a segment
encoding a polypeptide of interest operably linked to
additional segments that provide for its transcription.
Such additional segments include promoter and terminator
sequences, and may also include one or more origins of
replication, one or more selectable markers, an enhancer,
a polyadenylation signal, etc. Expression vectors are
generally derived from plasmid or viral DNA, or may
contain elements of both.
The term "isolated", when applied to a
polynucleotide, denotes that the polynucleotide has been
removed from its natural genetic milieu and is thus free
of other extraneous or unwanted coding sequences, and is
in a form suitable for use within genetically engineered
protein production systems. Such isolated molecules are
those that are separated from their natural environment
and include cDNA and genomic clones. Isolated DNA
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
12
molecules of the present invention are free of other genes
with which they are ordinarily associated, but may include
naturally occurring 5' and 3' untranslated regions such as
promoters and terminators. The identification of
associated regions will be evident to one of ordinary
skill in the art (see for example, Dynan and Tijan, Nature
316:774-78, 1985).
An "isolated" polypeptide or protein is a
polypeptide or protein that is found in a condition other
than its native environment, such as apart from blood and
animal tissue. In a preferred form, the isolated
polypeptide is substantially free of other polypeptides,
particularly other polypeptides of animal origin. It is
preferred to provide the polypeptides in a highly purified
form, i.e. greater than 95% pure, more preferably greater
than 99% pure. When used in this context, the term
"isolated" does not exclude the presence of the same
polypeptide in alternative physical forms, such as dimers
or alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to
DNA segments, indicates that the segments are arranged so
that they function in concert for their intended purposes,
e.g., transcription initiates in the promoter and proceeds
through the coding segment to the terminator.
The term "ortholog" denotes a polypeptide or
protein obtained from one species that is the functional
counterpart of a polypeptide or protein from a different
species. Sequence differences among orthologs are the
result of speciation.
A "polynucleotide" is a single- or double-
stranded polymer of deoxyribonucleotide or ribonucleotide
bases read from the 5' to the 3' end. Polynucleotides
include RNA and DNA, and may be isolated from natural
sources, synthesized in vitro, or prepared from a
combination of natural and synthetic molecules. Sizes of
polynucleotides are expressed as base pairs (abbreviated
"bp"), nucleotides ("nt"), or kilobases ("kb"). Where the
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
13
context allows, the latter two terms may describe
polynucleotides that are single-stranded or double-
stranded. When the term is applied to double-stranded
molecules it is used to denote overall length and will be
understood to be equivalent to the term "base pairs". It
will be recognized by those skilled in the art that the
two strands of a double-stranded polynucleotide may differ
slightly in length and that the ends thereof may be
staggered as a result of enzymatic cleavage; thus all
nucleotides within a double-stranded polynucleotide
molecule may not be paired. Such unpaired ends will in
general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid
residues joined by peptide bonds, whether produced
naturally or synthetically. Polypeptides of less than
about 10 amino acid residues are commonly referred to as
"peptides".
The term "promoter" is used herein for its art
recognized meaning to denote a portion of a gene
containing DNA sequences that provide for the binding of
RNA polymerise and initiation of transcription. Promoter
sequences are commonly, but not always, found in the 5'
non-coding regions of genes.
A "protein" is a macromolecule comprising one or
more polypeptide chains. A protein may also comprise non
peptidic components, such as carbohydrate groups.
Carbohydrates and other non-peptidic substituents may be
added to a protein by the cell in which the protein is
produced, and will vary with the type of cell. Proteins
are defined herein in terms of their amino acid backbone
structures; substituents such as carbohydrate groups are
generally not specified, but may be present nonetheless.
The term "receptor" denotes a cell-associated
protein that binds to a bioactive molecule (i.e., a
ligand) and mediates the effect of the ligand on the cell.
Membrane-bound receptors are characterized by a multi-
peptide structure comprising an extracellular ligand-
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
14
binding domain and an intracellular effector domain that
is typically involved in signal transduction. Binding of
ligand to receptor results in a conformational change in
the receptor that causes an interaction between the
effector domain and other molecules) in the cell. This
interaction in turn leads to an alteration in the
metabolism of the cell. Metabolic events that are linked
to receptor-ligand interactions include gene
transcription, phosphorylation, dephosphorylation,
increases in cyclic AMP production, mobilization of
cellular calcium, mobilization of membrane lipids, cell
adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids. In general, receptors can be membrane
bound, cytosolic or nuclear; monomeric (e. g., thyroid
stimulating hormone receptor, beta-adrenergic receptor) or
multimeric (e. g., PDGF receptor, growth hormone receptor,
IL-3 receptor, GM-CSF receptor, G-CSF receptor,
erythropoietin receptor and IL-6 receptor).
The term "secretory signal sequence" denotes a
DNA sequence that encodes a polypeptide (a "secretory
peptide") that, as a component of a larger polypeptide,
directs the larger polypeptide through a secretory pathway
of a cell in which it is synthesized. The larger
polypeptide is commonly cleaved to remove the secretory
peptide during transit through the secretory pathway.
The term "splice variant" is used herein to
denote alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed
RNA molecules, and may result in several mRNAs transcribed
from the same gene. Splice variants may encode
polypeptides having altered amino acid sequence. The term
splice variant is also used herein to denote a protein
encoded by a splice variant of an mRNA transcribed from a
gene.
CA 02347968 2001-04-10
CVO 00/22126 PCT/US99/23179
Molecular weights and lengths of polymers
determined by imprecise analytical methods (e.g., gel
electrophoresis) will be understood to be approximate
values. When such a value is expressed as "about" X or
5 "approximately" X, the stated value of X will be
understood to be accurate to t10%.
All references cited herein are incorporated by
reference in their entirety.
A new member of the follistatin family of
10 proteins, zfsta2, has been identified from a human
hypothalamic library. The zfsta2 protein has a predicted
molecular weight of about 86,000 Da and exhibits the
characteristic amino terminal cysteine-rich follistatin
domain (Hohenester et al., EMBO J. 16:3778-86, 1997)
15 found in other follistatin family members such as
follistatin related protein or FRP (Zwijsen et al.,
ibid.), SPARC, also known as osteonectin or BM-40 or the
human ortholog of mouse TSC-36 (Lane and Sage, ibid.),
agrin (Patthy and Nikolics, ibid.), hevin (Girard and
Springer, ibid.), the Flik protein of chickens (Amthor et
al., ibid.) and the rat brain protein SC1 (Mendis et al.,
ibid. ) .
The present invention is based in part upon the
discovery of a novel DNA sequence that encodes a
polypeptide having homology to the family of follistatins.
The zfsta2 polynucleotide sequence is disclosed in SEQ ID
NO:1 and encodes a multi-domain secreted protein of 847
amino acids (SEQ ID N0:2). Sequence analysis of a deduced
amino acid sequence of zfsta2, as represented by SEQ ID
N0:2, indicates the presence of a 20 amino acid residue
signal sequence (amino acid residues 1-20 of SEQ ID N0:2,
nucleotides 58-117 of SEQ ID NO:1), followed by a
predominantly hydrophilic short linker domain that has no
known homology (amino acid residues 21-64 of SEQ ID N0:2,
nucleotides 118-249 of SEQ ID NO:1), a follistatin
homology domain (amino acid residues 65-133 of SEQ ID
N0:2, nucleotides 250-456 of SEQ ID NO:1), an alpha-
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
16
helical linker region (amino acid residues 134-174 of SEQ
ID N0:2, nucleotides 457-579 of SEQ ID NO:1), a calmodulin
domain (amino acid residue 175-250 of SEQ ID N0:2,
nucleotides 580-810 of SEQ ID NO:1), an I-set IG domain #1
(amino acid residues 251-334 of SEQ ID N0:2, nucleotides
811-1059 of SEQ ID N0:1), an I-set IG domain #2 (amino
acid residues 335-432 of SEQ ID N0:2, nucleotides 1060-
1353 of SEQ ID NO:1) and a C-terminal domain with no known
homology (amino acid residues 433-847 of SEQ ID N0:2,
nucleotides 1354-3006 of SEQ ID NO:1). Those skilled in
the art will recognize that predicted domain boundaries
are approximations based on primary sequence content, and
may vary slightly; however, such estimates are generally
accurate to within ~5 amino acid residues.
The follistatin homology domain is predicted to
fold into a structure similar to that determined for the
follistatin homology domain in SPARC (Swiss-Prot
SPRC HUMAN, PDB 1BM0, also known as BM-40 or osteonectin,
Hohenester et al., 1997). This is a beta hairpin
structure, followed by a small hydrophobic core of
alpha/beta structure. Unlike SPARC, which is glycosylated
at Asn99, there is no predicted glycosylation site in
zfsta2. Based on the disulfide bonding pattern in SPARC,
the disulfide pairings in zfsta2 are as follows: Cys65
Cys76, Cys70-Cys87, Cys89-Cys119, Cys93-Cys112, and
Cys101-Cys133, of SEQ ID N0:2. The zfsta2 follistatin
homology domain has 47% identity to the follistatin domain
in human follistatin related protein (Swiss-Prot
FRP HUMAN); the mouse orthologue of this protein is known
as TSC-36 (Swiss-Prot FRP MOUSE).
The follistatin homology domain has substantial
sequence similarity to the Kazal family (Bode and Huber.,
Eur. J. Biochem. 204, 433-51, 1992) of serine proteinase
inhibitors. Serine proteinase inhibitors regulate the
proteolytic activity of target proteinases by occupying
the active site and thereby preventing occupation by
normal substrates. Although serine proteinase inhibitors
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
17
fall into several unrelated structural classes, they all
possess an exposed loop (variously termed an "inhibitor
loop", a "reactive core", a "reactive site", a "binding
loop") which is stabilized by intermolecular interactions
between residues flanking the binding loop and the protein
core (Bode and Huber, ibid.).
Interaction between inhibitor and enzyme
produces a stable complex which disassociates very slowly,
producing either a virgin or a modified inhibitor which is
cleaved at the scissile bond of the binding loop. Based
on analogy with the crystal structures for the proteinase
inhibitors PEC-60 (PDB 1PCE), and ovomucoid (PDB lOVO),
the putative proteinase binding site in the follistatin
homology domain of zfsta2 comprises the amino acid
residues Cys93 (P3), Lys94 (P2), Arg95 (P1), His96 (P1'),
and Tyr97 (P2') of SEQ ID N0:2. The scissile bond of the
binding loop will therefore reside between the P1 and Pl'
residues Arg95 and His96 of SEQ ID N0:2.
The calmodulin homology domain is predicted to
fold into a structure similar to that determined for the
EC (EF-hand calcium binding; calmodulin-like) domain in
SPARC (Hohenester et al., EMBO J. 16:3778-86, 1997).
Calmodulin (Swiss-Prot CALM_HUMAN, PDB 1CLI) is an alpha
helical protein which binds calcium ions through the loops
of helix-loop-helix substructures known as EF hands.
Calmodulin has two structurally similar regions, each
containing two EF hands, linked by a connecting helical
segment. As is used herein "calmodulin homology domain"
is meant to describe one of these two regions. The
calmodulin homology domain of zfsta2 is predicted to
contain two EF hand motifs, and hence two suspected
calcium ion binding sites. Based on motif analysis, the
loops of these two EF hands are predicted to reside
between Asp amino acid residue 188 and Leu, amino acid
residue, 200 of SEQ ID N0:2, and between Asp, amino acid
residue 226 and Phe, amino acid residue 238 of SEQ ID
N0:2. The last residue of the EF hand loop is always
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
18
hydrophobic: in zfsta2 these residues are Leu, amino acid
residue 200 and Phe, amino acid residue 238 of SEQ ID
N0:2. In terms of sequence homology, the calmodulin
homology domain of zfsta2 has 24% identity at the amino
acid level, to the double EF hand segment of human protein
phosphatase PPEF-2 (GenBank accession AF023456). The
zfsta2 calmodulin homology domain has no detectable
sequence homology to the calmodulin domain of SPARC.
The second EF hand of the calmodulin domain of
SPARC is stabilized by a disulfide bond spanning the EF
hand loop. When the two Cys residues in this EF hand were
mutated to Leu residues, a 100-fold decrease in calcium
ion affinity was noted (Hohenester et al., Nat. Struct.
Biol., 3:67-73, 1996). The present application also
provides a mutated form of zfsta2 where the second EF hand
is stabilized by replacing Asp, amino acid residue 225 and
Ala, amino acid residue 241 of SEQ ID N0:2, with cysteine
residues. This mutated form may have higher calcium
binding affinity.
Between the follistatin and calmodulin homology
domains is a short segment, called the alpha-helical
linker which may form a short linker peptide between the
two segments. This linker is predicted to have an alpha
helical structure from Glu, amino acid residue 144 through
Glu, amino acid residue 166 of SEQ ID N0;2. At the C
terminus of this linker are three basic residues which
could be the location of a proteolysis site. Processing
at this site of the secreted protein would release domains
B and C, containing the follistatin homology domain, from
the rest of the protein.
Amino acid residue 140 (Cys, SEQ ID N0:2) of the
alpha-helical linker peptide may form a disulfide bond
with amino acid residue 216 (Cys, SEQ ID N0:2), which
precedes the second EF hand in the calmodulin homology
domain of zfsta2.
The I-set IG domains #1 and #2 of zfsta2 are
predicted to fold into a structure similar to that
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
19
determined for the telokin peptide (Swiss-Prot KMLS HUMAN,
PDB 1TLK). The telokin peptide falls into the class of
immunoglobulins (Bork et al., J. Mol. Biol. 242:309-20,
1994) which are all beta proteins folding into a beta
s sandwich like structure. These have two beta sheets
comprising 3+4 beta strands. Furthermore, the telokin
peptide has been sub-classified as an "I" set
immunoglobulin (IG) domain. Other proteins with I set
immunoglobulin domains include titin, vascular and neural
cell adhesion molecules, and twitchin. In zfsta2 domains
I-set IG #1 and #2 there may be two intra-domain disulfide
bonds, one between cysteine residues 270 and 321 of SEQ ID
N0:2 in I-set IG domain #1 and cysteine residues 362 and
413 of SEQ ID N0:2 in I-set IG domain #2.
The C-terminal domain of zfsta2 shows no
recognizable sequence or structural similarity to any
known protein. This segment may serve to anchor the
protein to the extracellular matrix, or to the cell
surface membrane.
Northern blot analysis of various human tissues
resulted in a transcript of approximately 5 kb seen in
brain, placenta and spinal cord. RNA Dot Blot analysis
indicated expression in the cerebellum, occipital lobe and
pituitary gland.
The results of chromosomal localization showed
that zfsta2 maps 2.84 cR-3000 from the framework marker
WI-5113 on the chromosome 4 WICGR radiation hybrid map.
Proximal and distal framework markers were WI-5113 and
CHLC.GATA4C05.17, respectively. The use of surrounding
markers positions zfsta2 in the 4q28.3 region on the
integrated LDB chromosome 4 map.
The present invention further provides
polynucleotide molecules, including DNA and RNA molecules,
encoding zfsta2 proteins. The polynucleotides of the
present invention include the sense strand; the anti-sense
strand; and the DNA as double-stranded, having both the
sense and anti-sense strand annealed together by their
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
respective hydrogen bonds. A representative DNA sequence
encoding a zfsta2 protein is set forth in SEQ ID NO:1.
DNA sequences encoding other zfsta2 proteins can be
readily generated by those of ordinary skill in the art
5 based on the genetic code. Counterpart RNA sequences can
be generated by substitution of U for T.
Those skilled in the art will readily recognize
that, in view of the degeneracy of the genetic code,
considerable sequence variation is possible among these
10 polynucleotide molecules. SEQ ID N0:3 is a degenerate DNA
sequence that encompasses all DNAs that encode the zfsta2
polypeptide of SEQ ID N0:2. Those skilled in the art will
recognize that the degenerate sequence of SEQ ID N0:3 also
provides all RNA sequences encoding SEQ ID N0:2 by
15 substituting U for T. Thus, zfsta2 polypeptide-encoding
polynucleotides comprising nucleotide 1 to nucleotide 2949
of SEQ ID N0:3 and their RNA equivalents are contemplated
by the present invention. Table 1 sets forth the one-
letter codes used within SEQ ID N0:3 to denote degenerate
20 nucleotide positions. "Resolutions" are the nucleotides
denoted by a code letter. "Complement" indicates the code
for the complementary nucleotide(s). For example, the
code Y denotes either C or T, and its complement R denotes
A or G, A being complementary to T, and G being
complementary to C.
CA 02347968 2001-04-10
WO 00/22126 PC1'/US99/23179
21
TABLE 1
Nucleotide Resolution Complement Resolution
A A T T
C C G G
G G C C
T T A A
R AjG Y CjT
Y CjT R A(G
M ABC K GET
K GjT M AjC
S CjG S C(G
W A(T W A(T
H A(C(T D A~G(T
B C~GjT U A(C~G
V AjC(G B C(G~T
D A(G(T H A(C(T
N A~C(G(T N A~C~G(T
5 The degenerate codons used in SEQ ID N0:3,
encompassing all possible codons for a given amino acid,
are set forth in Table 2.
CA 02347968 2001-04-10
WO 00/22126 PCTNS99/23179
22
TABLE 2
One
Amino Letter Codons Degenerate
Acid Code Codon
Cys C TGC TGY
TGT
Ser S AGC TCA TCC TCG TCT WSN
AGT
Thr T ACA ACG ACT ACN
ACC
Pro P CCA CCG CCT CCN
CCC
Ala A GCA GCG GCT GCN
GCC
Gly G GGA GGG GGT GGN
GGC
As n N AAC q,qY
AAT
Asp D GAC GAY
GAT
Glu E GAA GAR
GAG
Gln Q CAA CAR
CAG
His H CAC CAY
CAT
Arg R AGA CGA CGC CGG CGT MGN
AGG
Lys K AAA AAR
AAG
Met M ATG ATG
Ile I ATA ATT ATH
ATC
Leu L CTA CTG CTT TTA TTG YTN
CTC
Val V GTA GTG GTT GTN
GTC
Phe F TTC TTY
TTT
Tyr Y TAC TAY
TAT
Trp W TGG TGG
Ter . TAA TGA TRR
TAG
Asn ~ Asp B ~Y
Glu~Gln Z SAR
Any X NNN
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
23
One of ordinary skill in the art will appreciate
that some ambiguity is introduced in determining a
degenerate codon, representative of all possible codons
encoding each amino acid. For example, the degenerate
codon for serine (WSN} can, in some circumstances, encode
arginine (AGR), and the degenerate codon for arginine
(MGN) can, in some circumstances, encode serine (AGY). A
similar relationship exists between codons encoding
phenylalanine and leucine. Thus, some polynucleotides
encompassed by the degenerate sequence may encode variant
amino acid sequences, but one of ordinary skill in the art
can easily identify such variant sequences by reference to
the amino acid sequence of SEQ ID N0:2. Variant sequences
can be readily tested for functionality as described
herein.
One of ordinary skill in the art will also
appreciate that different species can exhibit
"preferential codon usage." In general, see, Grantham, et
al., Nuc. Acids Res. 8:1893-912, 1980; Haas, et al. Curr.
Biol. 6:315-24, 1996; Wain-Hobson, et al., Gene 13:355-64,
1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm,
Nuc. Acids Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol.
158:573-97, 1982. As used herein, the term "preferential
codon usage" or "preferential codons" is a term of art
referring to protein translation codons that are most
frequently used in cells of a certain species, thus
favoring one or a few representatives of the possible
codons encoding each amino acid (See Table 2). For
example, the amino acid threonine (Thr} may be encoded by
ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the
most commonly used codon; in other species, for example,
insect cells, yeast, viruses or bacteria, different Thr
codons may be preferential. Preferential codons for a
particular species can be introduced into the
polynucleotides of the present invention by a variety of
methods known in the art. Introduction of preferential
codon sequences into recombinant DNA can, for example,
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
24
enhance production of the protein by making protein
translation more efficient within a particular cell type
or species. Therefore, the degenerate codon sequence
disclosed in SEQ ID N0:3 serves as a template for
optimizing expression of polynucleotides in various cell
types and species commonly used in the art and disclosed
herein. Sequences containing preferential codons can be
tested and optimized for expression in various species,
and tested for functionality as disclosed herein.
Within preferred embodiments of the invention
the isolated polynucleotides will hybridize to similar
sized regions of SEQ ID NO:1, other polynucleotide probes,
primers, fragments and sequences recited herein or
sequences complementary thereto. Polynucleotide
hybridization is well known in the art and widely used for
many applications, see for example, Sambrook et al.,
Molecular Cloning: A Laboratory Manual, Second Edition,
Cold Spring Harbor, NY, 1989; Ausubel et al., eds.,
Current Protocols in Molecular Bioloctv, John Wiley and
Sons, Inc., NY, 1987; Berger and Kimmel, eds., Guide to
Molecular Cloning Techniques, Methods in Enzymoloqy,
volume 152, 1987 and Wetmur, Crit. Rev. Biochem. Mol
Biol. 26:227-59, 1990. Polynucleotide hybridization
exploits the ability of single stranded complementary
sequences to form a double helix hybrid. Such hybrids
include DNA-DNA, RNA-RNA and DNA-RNA.
Hybridization will occur between sequences which
contain some degree of complementarity. Hybrids can
tolerate mismatched base pairs in the double helix, but
the stability of the hybrid is influenced by the degree of
mismatch. The Tm of the mismatched hybrid decreases by loC
for every 1-1.5% base pair mismatch. Varying the
stringency of the hybridization conditions allows control
over the degree of mismatch that will be present in the
hybrid. The degree of stringency increases as the
hybridization temperature increases and the ionic strength
of the hybridization buffer decreases. Hybridization
CA 02347968 2001-04-10
WO 00/22126 PCT/US99123179
buffers generally contain blocking agents such as
Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.),
denatured salmon sperm DNA, milk powders (BLOTTO), heparin
or SDS, and a Na" source, such as SSC (1X SSC: 0.15 M NaCl,
5 15 mM sodium citrate) or SSPE (1X SSPE: 1.8 M NaCl, 10 mM
NaH2P04, 1 mM EDTA, pH 7.7) . By decreasing the ionic
concentration of the buffer, the stability of the hybrid
is increased. Typically, hybridization buffers contain
from between 10 mM-1 M Na'. Premixed hybridization
10 solutions are also available from commercial sources such
as Clontech Laboratories (Palo Alto, CA) and Promega
Corporation (Madison, WI) for use according to
manufacturer's instruction. Addition of destabilizing or
denaturing agents such as formamide, tetralkylammonium
15 salts, guanidinium cations or thiocyanate cations to the
hybridization solution will alter the Tm of a hybrid.
Typically, formamide is used at a concentration of up to
50% to allow incubations to be carried out at more
convenient and lower temperatures. Formamide also acts to
20 reduce non-specific background when using RNA probes.
Stringent hybridization conditions encompass
temperatures of about 5-25oC below the thermal melting
point (Tm) of the hybrid and a hybridization buffer having
up to 1 M Na'. Higher degrees of stringency at lower
25 temperatures can be achieved with the addition of
formamide which reduces the Tm of the hybrid about 1oC for
each 1% formamide in the buffer solution. Generally, such
stringent conditions include temperatures of 20-70oC and a
hybridization buffer containing up to 6X SSC and 0-50%
formamide. A higher degree of stringency can be achieved
at temperatures of from 40-70oC with a hybridization
buffer having up to 4X SSC and from 0-50% formamide.
Highly stringent conditions typically encompass
temperatures of 42-70oC with a hybridization buffer having
up to 1X SSC and 0-50% formamide. Different degrees of
stringency can be used during hybridization and washing to
CA 02347968 2001-04-10
WO 00/22126 PCTlUS99/23179
26
achieve maximum specific binding to the target sequence.
Typically, the washes following hybridization are
performed at increasing degrees of stringency to remove
non-hybridized polynucleotide probes from hybridized
complexes.
The above conditions are meant to serve as a
guide and it is well within the abilities of one skilled
in the art to adapt these conditions for use with a
particular polypeptide hybrid. The Tm for a specific
target sequence is the temperature (under defined
conditions) at which 50% of the target sequence will
hybridize to a perfectly matched probe sequence. Those
conditions that influence the Tm include, the size and base
pair content of the polynucleotide probe, the ionic
I5 strength of the hybridization solution, and the presence
of destabilizing agents in the hybridization solution.
Numerous equations for calculating Tm are known in the
art, see for example (Sambrook et al., ibid.; Ausubel et
al., ibid.; Berger and Kimmel, ibid. and Wetmur, ibid.)
and are specific for DNA, RNA and DNA-RNA hybrids and
polynucleotide probe sequences of varying length.
Sequence analysis software such as Oligo 4.0 and Primer
Premier, as well as sites on the Internet, are available
tools for analyzing a given sequence and calculating Tm
based on user defined criteria. Such programs can also
analyze a given sequence under defined conditions and
suggest suitable probe sequences. Typically,
hybridization of longer polynucleotide sequences, >50 bp,
is done at temperatures of about 20-25oC below the
calculated Tm. For smaller probes, <50 bp, hybridization
is typically carried out at the Tm or 5-lOoC below. This
allows for the maximum rate of hybridization for DNA-DNA
and DNA-RNA hybrids.
As previously noted, the isolated
polynucleotides of the present invention include DNA and
RNA. Methods for preparing DNA and RNA are well known in
the art. In general, RNA is isolated from a tissue or
CA 02347968 2001-04-10
WO 00122126 PCT/US99/23179
27
cell that produces large amounts of zfsta2 RNA. Such
tissues and cells are identified by Northern blotting
(Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980), and
include brain and spinal cord. Total RNA can be prepared
using guanidinium isothiocyanate extraction followed by
isolation by centrifugation in a CsCl gradient (Chirgwin
et al., Biochemistry 18:52-94, 1979). Poly (A)+ RNA is
prepared from total RNA using the method of Aviv and Leder
(Proc. Natl. Acad. Sci. USA 69:1408-12, 1972).
Complementary DNA (cDNA) is prepared from poly(A)+ RNA
using known methods. In the alternative, genomic DNA can
be isolated. Polynucleotides encoding zfsta2 polypeptides
are then identified and isolated by, for example,
hybridization or PCR.
A full-length clone encoding a zfsta2
polypeptide can be obtained by conventional cloning
procedures. Complementary DNA (cDNA) clones are
preferred, although for some applications (e. g.,
expression in transgenic animals) it may be preferable to
use a genomic clone, or to modify a cDNA clone to include
at least one genomic intron. Methods for preparing cDNA
and genomic clones are well known and within the level of
ordinary skill in the art, and include the use of the
sequence disclosed herein, or parts thereof, for probing
or priming a library. Expression libraries can be probed
with antibodies to zfsta2, receptor fragments, or other
specific binding partners.
The polynucleotides of the present invention can
also be synthesized using automated equipment. The
current method of choice is the phosphoramidite method.
If chemically synthesized double stranded DNA is required
for an application such as the synthesis of a gene or a
gene fragment, then each complementary strand is made
separately. The production of short genes (60 to 80 bp)
is technically straightforward and can be accomplished by
synthesizing the complementary strands and then annealing
them. For the production of longer genes (>300 bp),
CA 02347968 2001-04-10
WO 00/22126 PGT/US99/23179
28
however, special strategies must be invoked, because the
coupling efficiency of each cycle during chemical DNA
synthesis is seldom 100%. To overcome this problem,
synthetic genes (double-stranded) are assembled in modular
form from single-stranded fragments that are from 20 to
100 nucleotides in length. Gene synthesis methods are
well known in the art. See, for example, Glick and
Pasternak, Molecular BiotechnoloQV Principles &
Applications of Recombinant DNA, ASM Press, Washington,
D.C., 1994; Itakura et al., Annu. Rev. Biochem. 53: 323-
56, 1984; and Climie et al., Proc. Natl. Acad. Sci USA
87:633-7, 1990.
The present invention further provides
counterpart polypeptides and polynucleotides from other
species (orthologs). These species include, but are not
limited to mammalian, avian, amphibian, reptile, fish,
insect and other vertebrate and invertebrate species. Of
particular interest are zfsta2 polypeptides from other
mammalian species, including murine, porcine, ovine,
bovine, canine, feline, equine, and other primate
polypeptides. Orthologs of human zfsta2 can be cloned
using information and compositions provided by the present
invention in combination with conventional cloning
techniques. For example, a cDNA can be cloned using mRNA
obtained from a tissue or cell type that expresses zfsta2
as disclosed herein. Suitable sources of mRNA can be
identified by probing Northern blots with probes designed
from the sequences disclosed herein. A library is then
prepared from mRNA of a positive tissue or cell line. A
zfsta2-encoding cDNA can then be isolated by a variety of
methods, such as by probing with a complete or partial
human cDNA or with one or more sets of degenerate probes
based on the disclosed sequences. A cDNA can also be
cloned using the polymerase chain reaction, or PCR
(Mullis, U.S. Patent No. 4,683,202), using primers
designed from the representative human zfsta2 sequence
disclosed herein. Within an additional method, the cDNA
CA 02347968 2001-04-10
WO 00/22126 PGT/US99/23179
29
library can be used to transform or transfect host cells,
and expression of the cDNA of interest can be detected
with an antibody to zfsta2 polypeptide. Similar
techniques can also be applied to the isolation of genomic
clones.
Those skilled in the art will recognize that the
sequence disclosed in SEQ ID NO:l represents a single
allele of human zfsta2 and that allelic variation and
alternative splicing are expected to occur. Allelic
variants of this sequence can be cloned by probing cDNA or
genomic libraries from different individuals according to
standard procedures. Allelic variants of the DNA sequence
shown in SEQ ID NO:1, including those containing silent
mutations and those in which mutations result in amino
acid sequence changes, are within the scope of the present
invention, as are proteins which are allelic variants of
SEQ ID N0:2. cDNAs generated from alternatively spliced
mRNAs, which retain the properties of the zfsta2
polypeptide are included within the scope of the present
invention, as are polypeptides encoded by such cDNAs and
mRNAs. Splice variants are known in the follistatin
family, follistatin exists in at least three forms
(32,000, 35,000 and 39,000 Da) due to alternative
splicing. Allelic variants and splice variants of these
sequences can be cloned by probing cDNA or genomic
libraries from different individuals or tissues according
to standard procedures known in the art.
The present invention also provides isolated
zfsta2 polypeptides that are substantially homologous to
the polypeptides of SEQ ID N0:2 and their orthologs. The
term "substantially homologous" is used herein to denote
polypeptides having 50%, preferably 60%, more preferably
at least 80%, sequence identity to the sequences shown in
SEQ ID N0:2 or their orthologs. Such polypeptides will
more preferably be at least 90o identical, and most
preferably 95°s or more identical to SEQ ID N0:2 or its
orthologs. Percent sequence identity is determined by
CA 02347968 2001-04-10
WO 00/22126 PCT/US99l23179
conventional methods. See, for example, Altschul et al.,
Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and
Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-9, 1992.
Briefly, two amino acid sequences are aligned to optimize
5 the alignment scores using a gap opening penalty of 10, a
gap extension penalty of 1, and the "blosum 62" scoring
matrix of Henikoff and Henikoff (ibid.) as shown in Table
3 (amino acids are indicated by the standard one-letter
codes). The percent identity is then calculated as:
10 Total number of identical matches
x 100
[length of the longer sequence plus the
number of gaps introduced into the longer
sequence in order to align the two sequences]
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/Z3I79
31
~ N M
I
H Il1N N O
I
dl ~-1M N N
I I I
I~r-i~ d' t'~1N
I I I I
dlN N rl M ri
I i I
tIlO N W -irl v-Ir-I
I I I I I
tf1rlM v-1O r-IM N N
I I i I I I I
M a 'dlN N O M N rlN v-it-I
I I I I I I
d~ N M ~-1O M N rlM r-1M
I I 1 1 ~ I
x o0M M rl N rl N r-IN N N M
I I s I I I I I I I
U ~ N d~ d~N M M N O N N M M
I I I 1 1 I I 1 1 I I
w l~1N O M M ~ N M rlO riM N N
I I I I I I I I I I
LflN N O M N rl O M rlO r-IN ~-1N
I I I I I I I I I
U d1M d~M M r-I~-1M riN M v-IrlN N ~-1
I I I I I I I I I I I I I 1 1
A l0M O N r-Ir-1M dlr1 ('~M r-IO rldl M M
i I I i I I I I I I I I I
z l0 riM O O O rlM M O N M N r-IO d~ N M
I I I I I I I I I
f?i InO N M ~-IO N O M N N r-IM N r-1rlM N M
I I I I I I I I I I I I I
IQ,'~ rlN N O ri riO N ri rlri r-IN wlri O M N O
I I I I I I I t I I I I I I
~ x z A U a w ~ x H a x ~ w w cn H ~ ~ a
W n o
W -1 N
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
32
Sequence identity of polynucleotide molecules is
determined by similar methods using a ratio as disclosed
above.
Those skilled in the art appreciate that there
are many established algorithms available to align two
amino acid sequences. The "FASTA" similarity search
algorithm of Pearson and Lipman is a suitable protein
alignment method for examining the level of identity
shared by an amino acid sequence disclosed herein and the
amino acid sequence of a putative variant zfsta2. The
FASTA algorithm is described by Pearson and Lipman, Proc.
Nat. Acad. Sci. USA 85:2444, 1988, and by Pearson, Meth.
Enzymol. 183:63, 1990.
Briefly, FASTA first characterizes sequence
similarity by identifying regions shared by the query
sequence (e. g., SEQ ID N0:2) and a test sequence that have
either the highest density of identities (if the ktup
variable is 1) or pairs of identities (if ktup=2), without
considering conservative amino acid substitutions,
insertions, or deletions. The ten regions with the
highest density of identities are then re-scored by
comparing the similarity of all paired amino acids using
an amino acid substitution matrix, and the ends of the
regions are "trimmed" to include only those residues that
contribute to the highest score. If there are several
regions with scores greater than the "cutoff" value
(calculated by a predetermined formula based upon the
length of the sequence and the ktup value), then the
trimmed initial regions are examined to determine whether
the regions can be joined to form an approximate alignment
with gaps. Finally, the highest scoring regions of the
two amino acid sequences are aligned using a modification
of the Needleman-Wunsch-Sellers algorithm (Needleman and
Wunsch, J. Mol. Biol. 48:444, 1970; Sellers, SIAM J. Appl.
Math. 26:787, 1974), which allows for amino acid
insertions and deletions. Illustrative parameters for
FASTA analysis are: ktup=1, gap opening penalty=10, gap
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
33
extension penalty=1, and substitution matrix=BLOSUM62.
These parameters can be introduced into a FASTA program by
modifying the scoring matrix file ("SMATRIX"), as
explained in Appendix 2 of Pearson, Meth. Enzvmol. 183:63,
1990.
FASTA can also be used to determine the sequence
identity of nucleic acid molecules using a ratio as
disclosed above. For nucleotide sequence comparisons, the
ktup value can range between one to six, preferably from
four to six.
The BLOSUM62 table is an amino acid substitution
matrix derived from about 2,000 local multiple alignments
of protein sequence segments, representing highly
conserved regions of more than 500 groups of related
proteins (Henikoff and Henikoff, Proc. Natl. Acad. Sci.
USA 89:10915, 1992). Accordingly, the BLOSUM62
substitution frequencies can be used to define
conservative amino acid substitutions that may be
introduced into the amino acid sequences of the present
invention. Although it is possible to design amino acid
substitutions based solely upon chemical properties (as
discussed above), the language "conservative amino acid
substitution" preferably refers to a substitution
represented by a BLOSUM62 value of greater than -1. For
example, an amino acid substitution is conservative if the
substitution is characterized by a BLOSUM62 value of 0,
1, 2, or 3. According to this system, preferred
conservative amino acid substitutions are characterized by
a BLOSUM62 value of at least 1 (e. g., 1, 2 or 3), while
more preferred conservative amino acid substitutions are
characterized by a BLOSUM62 value of at least 2 (e.g., 2
or 3 ) .
Conservative amino acid changes in a zfsta2 gene
can be introduced by substituting nucleotides for the
nucleotides recited in SEQ ID N0:1. Such "conservative
amino acid" variants can be obtained, for example, by
oligonucleotide-directed mutagenesis, linker-scanning
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/Z3179
34
mutagenesis, mutagenesis using the polymerase chain
reaction, and the like (see Ausubel (1995) at pages 8-10
to 8-22; and McPherson (ed.), Directed Mutagenesis: A
Practical Approach (IRL Press 1991)). To select for
variants having the properties of the wild-type protein
can be done using standard methods, such as the assays
described herein. Alternatively, a variant zfsta2
polypeptide can be identified by the ability to
specifically bind anti-zfsta2 antibodies.
Variant zfsta2 polypeptides or substantially
homologous zfsta2 polypeptides are characterized as having
one or more amino acid substitutions, deletions or
additions. These changes are preferably of a minor
nature, that is conservative amino acid substitutions (see
Table 4) and other substitutions that do not significantly
affect the folding or activity of the polypeptide; small
deletions, typically of one to about 30 amino acids; and
small amino- or carboxyl-terminal extensions, such as an
amino-terminal methionine residue, a small linker peptide
of up to about 20-25 residues, or an affinity tag.
Polypeptides comprising affinity tags can further comprise
a proteolytic cleavage site between the zfsta2 polypeptide
and the affinity tag. Preferred such sites include
thrombin cleavage sites and factor Xa cleavage sites.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
Table 4
Conservative amino acid substitutions
5
Basic: arginine
lysine
histidine
Acidic: glutamic acid
10 aspartic acid
Polar: glutamine
asparagine
Hydrophobic: leucine
isoleucine
15 valine
Aromatic: phenylalanine
tryptophan
tyrosine
Small: glycine
20 alanine
aerine
threonine
methionine
25 The present invention further provides a variety
of other polypeptide fusions. For example, a zfstat
polypeptide can be prepared as a fusion to a dimerizing
protein as disclosed in U.S. Patents Nos. 5,155,027 and
5,567,584. Preferred dimerizing proteins in this regard
30 include immunoglobulin constant region domains.
Immunoglobulin-zfsta2 polypeptide fusions can be expressed
in genetically engineered cells to produce a variety of
multimeric zfsta2 analogs. Auxiliary domains can be fused
to zfsta2 polypeptides to target them to specific cells,
35 tissues, or macromolecules. For example, a zfsta2
polypeptide or protein could be targeted to a
predetermined cell type by fusing a zfsta2 polypeptide to
CA 02347968 2001-04-10
WO OO/Z2126 PCT/US99/23179
36
a ligand that specifically binds to a receptor on the
surface of the target cell. In this way, polypeptides and
proteins can be targeted for therapeutic or diagnostic
purposes. A zfsta2 polypeptide can be fused to two or
more moieties, such as an affinity tag for purification
and a targeting domain. Polypeptide fusions can also
comprise one or more cleavage sites, particularly between
domains. See, Tuan et al., Conn. Tiss. Res. 34:1-9, 1996.
The proteins of the present invention can also
comprise non-naturally occurring amino acid residues.
Non-naturally occurring amino acids include, without
limitation, traps-3-methylproline, 2,4-methanoproline,
cis-4-hydroxyproline, traps-4-hydroxyproline, N-methyl
glycine, allo-threonine, methylthreonine, hydroxyethyl
cysteine, hydroxyethylhomocysteine, nitroglutamine, homo-
glutamine, pipecolic acid, thiazolidine carboxylic acid,
dehydroproline, 3- and 4-methylproline, 3,3-dimethyl-
proline, tert-leucine, norvaline, 2-azaphenylalanine, 3-
azaphenylalanine, 4-azaphenylalanine, and 4-fluoro-
phenylalanine. Several methods are known in the art for
incorporating non-naturally occurring amino acid residues
into proteins. For example, an in vitro system can be
employed wherein nonsense mutations are suppressed using
chemically aminoacylated suppressor tRNAs. Methods for
synthesizing amino acids and aminoacylating tRNA are known
in the art. Transcription and translation of plasmids
containing nonsense mutations is carried out in a cell-
free system comprising an E. coli S30 extract and
commercially available enzymes and other reagents.
Proteins are purified by chromatography. See, for
example, Robertson et al., J. Am. Chem. Soc. 113:2722,
1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung
et al., Science 259:806-9, 1993; and Chung et al., Proc.
Natl. Acad. Sci. USA 90:10145-9, 1993). In a second
method, translation is carried out in Xenopus oocytes by
microinjection of mutated mRNA and chemically
CA 02347968 2001-04-10
WO 00/22126 PCT/US99IZ3179
37
aminoacylated suppressor tRNAs (Turcatti et al., J. Biol.
Chem. 271:19991-8, 1996). Within a third method, E. coli
cells are cultured in the absence of a natural amino acid
that is to be replaced (e.g., phenylalanine) and in the
presence of the desired non-naturally occurring amino
acids) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-
azaphenylalanine, or 4-fluorophenylalanine). The non-
naturally occurring amino acid is incorporated into the
protein in place of its natural counterpart. See, Koide
et al., Biochem. 33:7470-6, 1994. Naturally occurring
amino acid residues can be converted to non-naturally
occurring species by in vitro chemical modification.
Chemical modification can be combined with site-directed
mutagenesis to further expand the range of substitutions
(Wynn and Richards, Protein Sci. 2:395-403, 1993).
A limited number of non-conservative amino
acids, amino acids that are not encoded by the genetic
code, non-naturally occurring amino acids, and unnatural
amino acids may be substituted for zfsta2 amino acid
residues.
Essential amino acids in the polypeptides of the
present invention can be identified according to
procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis (Cunningham
and Wells, Science 244: 1081-5, 1989; Bass et al., Proc.
Natl. Acad. Sci. USA 88:4498-502, 1991). In the latter
technique, single alanine mutations are introduced at
every residue in the molecule, and the resultant mutant
molecules are tested for biological activity as disclosed
below to identify amino acid residues that are critical to
the activity of the molecule. See also, Hilton et al., J.
Biol. Chem. 271:4699-708, 1996. Sites of ligand-receptor
interaction can also be determined by physical analysis of
structure, as determined by such techniques as nuclear
magnetic resonance, crystallography, electron diffraction
or photoaffinity labeling, in conjunction with mutation of
putative contact site amino acids. See, for example, de
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
38
Vos et al., Science 255:306-12, 1992; Smith et al., J.
Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett.
309:59-64, 1992. The identities of essential amino acids
can also be inferred from analysis of homologies with
related follistatins.
Multiple amino acid substitutions can be made
and tested using known methods of mutagenesis and
screening, such as those disclosed by Reidhaar-Olson and
Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc.
Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these
authors disclose methods for simultaneously randomizing
two or more positions in a polypeptide, selecting for
functional polypeptide, and then sequencing the
mutagenized polypeptides to determine the spectrum of
allowable substitutions at each position. Other methods
that can be used include phage display (e.g., Lowman et
al., Biochem. 30:10832-7, 1991; Ladner et al., U.S. Patent
No. 5,223,409; Huse, WIPO Publication WO 92/06204) and
region-directed mutagenesis (Derbyshire et al., Gene
46:145, 1986; Ner et al., DNA 7:127, 1988).
Variants of the disclosed zfsta2 DNA and
polypeptide sequences can be generated through DNA
shuffling as disclosed by Stemmer, Nature 370:389-91,
1994, Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-51,
1994 and WIPO Publication WO 97/20078. Briefly, variant
DNAs are generated by in vitro homologous recombination by
random fragmentation of a parent DNA followed by
reassembly using PCR, resulting in randomly introduced
point mutations. This technique can be modified by using
a family of parent DNAs, such as allelic variants or DNAs
from different species, to introduce additional
variability into the process. Selection or screening for
the desired activity, followed by additional iterations of
mutagenesis and assay provides for rapid "evolution" of
sequences by selecting for desirable mutations while
simultaneously selecting against detrimental changes.
CA 02347968 2001-04-10
WO 00/Z2126 PCT/US99/23179
39
Mutagenesis methods as disclosed herein can be
combined with high-throughput, automated screening methods
to detect activity of cloned, mutagenized polypeptides in
host cells. Mutagenized DNA molecules that encode active
polypeptides can be recovered from the host cells and
rapidly sequenced using modern equipment. These methods
allow the rapid determination of the importance of
individual amino acid residues in a polypeptide of
interest, and can be applied to polypeptides of unknown
structure.
Using the methods discussed herein, one of
ordinary skill in the art can identify and/or prepare a
variety of polypeptide fragments or variants of SEQ ID
N0:2 that retain the properties of the wild-type zfsta2
protein. Such polypeptide fragments may include the N-
terminal region, the follistatin and/or calmodulin
homology domains, I-set IG domains #1 and/or #2, the
alpha-helical linker and the C-terminal region. Amino
acid truncations or additions can also occur.
For any zfsta2 polypeptide, including variants
and fusion proteins, one of ordinary skill in the art can
readily generate a fully degenerate polynucleotide
sequence encoding that variant using the information set
forth in Tables 1 and 2 above.
The zfsta2 polypeptides of the present
invention, including full-length polypeptides,
biologically active fragments, and fusion~polypeptides,
can be produced in genetically engineered host cells
according to conventional techniques. Suitable host cells
are those cell types that can be transformed or
transfected with exogenous DNA and grown in culture, and
include bacteria, fungal cells, and cultured higher
eukaryotic cells. Eukaryotic cells, particularly cultured
cells of multicellular organisms, are preferred.
Techniques for manipulating cloned DNA molecules and
introducing exogenous DNA into a variety of host cells are
disclosed by Sambrook et al., Molecular Cloning: A
CA 02347968 2001-04-10
WO 00/Z2126 PCT/US99/23179
Laboratorv Manual, 2nd ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY, 1989, and Ausubel et al.,
eds., Current Protocols in Molecular Bioloctv, John Wiley
and Sons, Inc., NY, 1987.
5 In general, a DNA sequence encoding a zfsta2
polypeptide is operably linked to other genetic elements
required for its expression, generally including a
transcription promoter and terminator, within an
expression vector. The vector will also commonly contain
10 one or more selectable markers and one or more origins of
replication, although those skilled in the art will
recognize that within certain systems selectable markers
may be provided on separate vectors, and replication of
the exogenous DNA may be provided by integration into the
15 host cell genome. Selection of promoters, terminators,
selectable markers, vectors and other elements is a matter
of routine design within the level of ordinary skill in
the art. Many such elements are described in the
literature and are available through commercial suppliers.
20 To direct a zfsta2 polypeptide into the
secretory pathway of a host cell, a secretory signal
sequence (also known as a leader sequence, prepro sequence
or pre sequence) is provided in the expression vector.
The secretory signal sequence may be that of zfsta2, or
25 may be derived from another secreted protein (e.g., t-PA)
or synthesized de novo. The secretory signal sequence is
operably linked to the zfsta2 DNA sequence, i . a . , the two
sequences are joined in the correct reading frame and
positioned to direct the newly synthesized polypeptide
30 into the secretory pathway of the host cell. Secretory
signal sequences are commonly positioned 5' to the DNA
sequence encoding the polypeptide of interest, although
certain secretory signal sequences may be positioned
elsewhere in the DNA sequence of interest (see, e.g.,
35 Welch et al., U.S. Patent No. 5,037,743; Holland et al.,
U.S. Patent No. 5,143,830).
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
41
Alternatively, the secretory signal sequence
contained in the polypeptides of the present invention is
used to direct other polypeptides into the secretory
pathway. The present invention provides for such fusion
polypeptides. A signal fusion polypeptide can be made
wherein a secretory signal sequence derived from amino
acid residues 1-20 of SEQ ID N0:2 is be operably linked to
another polypeptide using methods known in the art and
disclosed herein. The secretory signal sequence contained
in the fusion polypeptides of the present invention is
preferably fused amino-terminally to an additional peptide
to direct the additional peptide into the secretory
pathway. Such constructs have numerous applications known
in the art. For example, these novel secretory signal
sequence fusion constructs can direct the secretion of an
active component of a normally non-secreted protein. Such
fusions may be used in vivo or in vitro to direct peptides
through the secretory pathway.
Cultured mammalian cells are suitable hosts
within the present invention. Methods for introducing
exogenous DNA into mammalian host cells include calcium
phosphate-mediated transfection (Wigler et al., Cell
14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics
7:603, 1981: Graham and Van der Eb, Viroloctv 52:456,
1973), electroporation (Neumann et al., EMBO J. 1:841-5,
1982), DEAF-dextran mediated transfection (Ausubel et al.,
ibid.), and liposome-mediated transfection (Hawley-Nelson
et al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80,
1993, and viral vectors (Miller and Rosman, BioTechniques
7:980-90, 1989; Wang and Finer, Nature Med. 2:714-6,
1996). The production of recombinant polypeptides in
cultured mammalian cells is disclosed, for example, by
Levinson et al., U.S. Patent No. 4,713,339; Hagen et al.,
U.S. Patent No. 4,784,950; Palmiter et al., U.S. Patent
No. 4,579,821; and Ringold, U.S. Patent No. 4,656,134.
Suitable cultured mammalian cells include the COS-1 (ATCC
No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
42
CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and
Chinese hamster ovary (e. g. CHO-K1; ATCC No. CCL 61) cell
lines. Additional suitable cell lines are known in the
art and available from public depositories such as the
American Type Culture Collection, Manassas, VA. In
general, strong transcription promoters are preferred,
such as promoters from SV-40 or cytomegalovirus. See,
e.g., U.S. Patent No. 4,956,288. Other suitable promoters
include those from metallothionein genes (U. S. Patent Nos.
4,579,821 and 4,601,978} and the adenovirus major late
promoter.
Drug selection is generally used to select for
cultured mammalian cells into which foreign DNA has been
inserted. Such cells are commonly referred to as
"transfectants". Cells that have been cultured in the
presence of the selective agent and are able to pass the
gene of interest to their progeny are referred to as
"stable transfectants." A preferred selectable marker is
a gene encoding resistance to the antibiotic neomycin.
Selection is carried out in the presence of a neomycin-
type drug, such as G-418 or the like. Selection systems
can also be used to increase the expression level of the
gene of interest, a process referred to as
"amplification." Amplification is carried out by
culturing transfectants in the presence of a low level of
the selective agent and then increasing the amount of
selective agent to select for cells that produce high
levels of the products of the introduced genes. A
preferred amplifiable selectable marker is dihydrofolate
reductase, which confers resistance to rnethotrexate.
Other drug resistance genes (e. g. hygromycin resistance,
multi-drug resistance, puromycin acetyltransferase) can
also be used. Alternative markers that introduce an
altered phenotype, such as green fluorescent protein, or
cell surface proteins such as CD4, CD8, Class I MHC,
placental alkaline phosphatase may be used to sort
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
43
transfected cells from untransfected cells by such means
as FRCS sorting or magnetic bead separation technology.
Other higher eukaryotic cells can also be used
as hosts, including plant cells, insect cells and avian
cells. The use of Agrolaacterium rhizogenes as a vector
for expressing genes in plant cells has been reviewed by
Sinkar et al., J. Biosci. (Banaalore) 11:47-58, 1987.
Transformation of insect cells and production of foreign
polypeptides therein is disclosed by Guarino et al., U.S.
Patent No. 5,162,222 and WIPO publication WO 94/06463.
Insect cells can be infected with recombinant baculovirus,
commonly derived from Autographa californica nuclear
polyhedrosis virus (AcNPV). DNA encoding the zfsta2
polypeptide is inserted into the baculoviral genome in
place of the AcNPV polyhedrin gene coding sequence by one
of two methods. The first is the traditional method of
homologous DNA recombination between wild-type AcNPV and a
transfer vector containing the zfsta2 flanked by AcNPV
sequences. Suitable insect cells, e.g. SF9 cells, are
infected with wild-type AcNPV and transfected with a
transfer vector comprising a zfsta2 polynucleotide
operably linked to an AcNPV polyhedrin gene promoter,
terminator, and flanking sequences. See, King and Possee,
The Baculovirus Expression System A Laboratory Guide,
London, Chapman & Hall; O~Reilly et al., Baculovirus
Expression Vectors: A Laboratory Manual, New York, Oxford
University Press., 1994; and, Richardson, Ed., Baculovirus
Expression Protocols. Methods in Molecular Bioloctv,
Totowa, NJ, Humana Press, 1995. Natural recombination
within an insect cell will result in a recombinant
baculovirus which contains zfsta2 driven by the polyhedrin
promoter. Recombinant viral stocks are made by methods
commonly used in the art.
The second method of making recombinant
baculovirus utilizes a transposon-based system described
by Luckow (Luckow et al., J. Virol. 67:4566-79, 1993).
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
44
This system is sold in the Bac-to-Bac kit (Life
Technologies, Rockville, MD). This system utilizes a
transfer vector, pFastBaclT"" (Life Technologies) containing
a Tn7 transposon to move the DNA encoding the zfsta2
polypeptide into a baculovirus genome maintained in E.
coli as a large plasmid called a "bacmid." The pFastBaclT""
transfer vector utilizes the AcNPV polyhedrin promoter to
drive the expression of the gene of interest, in this case
zfsta2. However, pFastBaclT"" can be modified to a
considerable degree. The polyhedrin promoter can be
removed and substituted with the baculovirus basic protein
promoter (also known as Pcor, p6.9 or MP promoter) which
is expressed earlier in the baculovirus infection, and has
been shown to be advantageous for expressing secreted
proteins. See, Hill-Perkins and Possee, J. Gen. Virol.
71:971-6, 1990; Bonning et al., J. Gen. Virol. 75:1551-6,
1994; and, Chazenbalk, G.D., and Rapoport, J. Biol. Chem.
270:1543-9, 1995. In such transfer vector constructs, a
short or long version of the basic protein promoter can be
used. Moreover, transfer vectors can be constructed which
replace the native zfsta2 secretory signal sequences with
secretory signal sequences derived from insect proteins.
For example, a secretory signal sequence from Ecdysteroid
Glucosyltransferase (EGT), honey bee Melittin (Invitrogen,
Carlsbad, CA), or baculovirus gp67 (PharMingen, San Diego,
CA) can be used in constructs to replace the native
secretory signal sequence. In addition, transfer vectors
can include an in-frame fusion with DNA encoding an
epitope tag at the C- or N-terminus of the expressed
zfsta2 polypeptide, for example, a Glu-Glu epitope tag
(Grussenmeyer et al., ibid.). Using a technique known in
the art, a transfer vector containing zfsta2 is
transformed into E. coli, and screened for bacmids which
contain an interrupted lacZ gene indicative of recombinant
baculovirus. The bacmid DNA containing the recombinant
baculovirus genome is isolated, using common techniques,
CA 02347968 2001-04-10
WO 0(1/22126 PCT/US99/23179
and used to transfect Spodoptera frugiperda cells, e.g.
Sf9 cells. Recombinant virus that expresses zfsta2 is
subsequently produced. Recombinant viral stocks are made
by methods commonly used the art.
5 The recombinant virus is used to infect host
cells, typically a cell line derived from the fall
armyworm, Spodoptera frugiperda. See, in general, Glick
and Pasternak, Molecular Biotechnolocxy: Principles and
Applications of Recombinant DNA, ASM Press, Washington,
10 D.C., 1994. Another suitable cell line is the High FiveOT""
cell line (Invitrogen) derived from Trichoplusia ni (U. S.
Patent #5,300,435). Commercially available serum-free
media are used to grow and maintain the cells. Suitable
media are Sf900 IIT"" (Life Technologies) or ESF 921T""
15 (Expression Systems) for the Sf9 cells; and Ex-ce11O405T""
(JRH Biosciences, Lenexa, KS) or Express FiveOT"" (Life
Technologies) for the T. ni cells. The cells are grown up
from an inoculation density of approximately 2-5 x 105
cells to a density of 1-2 x 106 cells at which time a
20 recombinant viral stock is added at a multiplicity of
infection (MOI) of 0.1 to 10, more typically near 3. The
recombinant virus-infected cells typically produce the
recombinant zfsta2 polypeptide at 12-72 hours post-
infection and secrete it with varying efficiency into the
25 medium. The culture is usually harvested 48 hours post-
infection. Centrifugation is used to separate the cells
from the medium (supernatant). The supernatant containing
the zfsta2 polypeptide is filtered through micropore
filters, usually 0.45 ~.m pore size. Procedures used are
30 generally described in available laboratory manuals (King
and Possee, ibid.; O~Reilly et al., ibid.; Richardson, C.
D., ibid.). Subsequent purification of the zfsta2
polypeptide from the supernatant can be achieved using
methods described herein.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
46
Fungal cells, including yeast cells, can also be
used within the present invention. Yeast species of
particular interest in this regard include Saccharomyces
cerevisiae, Pichia pastoris, and Pichia methanolica.
Methods for transforming S. cerevisiae cells with
exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S.
Patent No. 4,599,311; Kawasaki et al., U.S. Patent No.
4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al.,
U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent
No. 4,845,075. Transformed cells are selected by
phenotype determined by the selectable marker, commonly
drug resistance or the ability to grow in the absence of a
particular nutrient (e. g., leucine). A preferred vector
system for use in Saccharomyces cerevisiae is the POTI
vector system disclosed by Kawasaki et al. (U. S. Patent
No. 4,931,373), which allows transformed cells to be
selected by growth in glucose-containing media. Suitable
promoters and terminators for use in yeast include those
from glycolytic enzyme genes (see, e.g., Kawasaki, U.S.
Patent No. 4,599,311; Kingsman et al., U.S. Patent No.
4,615,974; and Bitter, U.S. Patent No. 4,977,092) and
alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446; 5,063,154; 5,139,936 and 4,661,454.
Transformation systems for other yeasts, including
Hansenula polymorpha, Schizosaccharomyces pombe,
Kluyveromyces lactis, Kluyveromyces fragilis, Ustilago
maydis, Pichia pastoris, Pichia methanolica, Pichia
guillermondii and Candida maltosa are known in the art.
See, for example, Gleeson et al., J. Gen. Microbiol.
132:3459-65, 1986 and Cregg, U.S. Patent No. 4,882,279.
Aspergillus cells may be utilized according to the methods
of McKnight et al., U.S. Patent No. 4,935,349. Methods
for transforming Acremonium chrysogenum are disclosed by
Sumino et al., U.S. Patent No. 5,162,228. Methods for
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
47
transforming Neurospora are disclosed by Lambowitz, U.S.
Patent No. 4,486,533.
For example, the use of Pichia methanolica as
host for the production of recombinant proteins is
disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond,
U.S. Patent No. 5,736,383, Raymond et al., Yeast 14:11-23,
1998, and in WIPO Publication Nos. WO 97/17450, WO
97/17451, WO 98/02536, and WO 98/02565. DNA molecules for
use in transforming P. methanolica will commonly be
prepared as double-stranded, circular plasmids, which are
preferably linearized prior to transformation. For
polypeptide production in P. methanolica, it is preferred
that the promoter and terminator in the plasmid be that of
a P. methanolica gene, such as a P. methanolica alcohol
utilization gene (AUG1 or AUG2). Other useful promoters
include those of the dihydroxyacetone synthase (DHAS),
formate dehydrogenase (FMD), and catalase (CAT) genes. To
facilitate integration of the DNA into the host
chromosome, it is preferred to have the entire expression
segment of the plasmid flanked at both ends by host DNA
sequences. A preferred selectable marker for use in
Pichia methanolica is a P. methanolica ADE2 gene, which
encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC;
EC 4.1.1.21), which allows ade2 host cells to grow in the
absence of adenine. For large-scale, industrial processes
where it is desirable to minimize the use of methanol, it
is preferred to use host cells in which both methanol
utilization genes (AUG1 and AUG2) are deleted. For
production of secreted proteins, host cells deficient in
vacuolar protease genes (PEP4 and PRB1} are preferred.
Electroporation is used to facilitate the introduction of
a plasmid containing DNA encoding a polypeptide of
interest into P. methanolica cells. It is preferred to
transform P. methano~ica cells by electroporation using
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
48
an exponentially decaying, pulsed electric field having a
field strength of from 2.5 to 4.5 kV/cm, preferably about
3.75 kV/cm, and a time constant (i) of from 1 to 40
milliseconds, most preferably about 20 milliseconds.
Prokaryotic host cells, including strains of the
bacteria Escherichia coli, Bacillus and other genera are
also useful host cells within the present invention.
Techniques for transforming these hosts and expressing
foreign DNA sequences cloned therein are well known in the
art (see, e.g., Sambrook et al., ibid.). When expressing
a zfsta2 polypeptide in bacteria such as E. coli, the
polypeptide may be retained in the cytoplasm, typically as
insoluble granules, or may be directed to the periplasmic
space by a bacterial secretion sequence. In the former
case, the cells are lysed, and the granules are recovered
and denatured using, for example, guanidine isothiocyanate
or urea. The denatured polypeptide can then be refolded
and dimerized by diluting the denaturant, such as by
dialysis against a solution of urea and a combination of
reduced and oxidized glutathione, followed by dialysis
against a buffered saline solution. In the latter case,
the polypeptide can be recovered from the periplasmic
space in a soluble and functional form by disrupting the
cells (by, for example, sonication or osmotic shock) to
release the contents of the periplasmic space and
recovering the protein, thereby obviating the need for
denaturation and refolding.
The adenovirus system can also be used for
protein production in vitro. By culturing adenovirus
infected non-293 cells under conditions where the cells
are not rapidly dividing, the cells can produce proteins
for extended periods of time. For instance, BHK cells are
grown to confluence in cell factories, then exposed to the
adenoviral vector encoding the secreted protein of
interest. The cells are then grown under serum-free
conditions, which allows infected cells to survive for
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
49
several weeks without significant cell division.
Alternatively, adenovirus vector infected 293 cells can be
grown as adherent cells or in suspension culture at
relatively high cell density to produce significant
amounts of protein (see Garnier et al., Cytotechnol.
15:145-55, 1994). With either protocol, an expressed,
secreted heterologous protein can be repeatedly isolated
from the cell culture supernatant. Within the infected
293 cell production protocol, non-secreted proteins may
also be effectively obtained.
Transformed or transfected host cells are
cultured according to conventional procedures in a culture
medium containing nutrients and other components required
for the growth of the chosen host cells. A variety of
suitable media, including defined media and complex media,
are known in the art and generally include a carbon
source, a nitrogen source, essential amino acids, vitamins
and minerals. Media may also contain such components as
growth factors or serum, as required. The growth medium
will generally select for cells containing the exogenously
added DNA by, for example, drug selection or deficiency in
an essential nutrient which is complemented by the
selectable marker carried on the expression vector or co-
transfected into the host cell. P. methanolica cells are
cultured in a medium comprising adequate sources of
carbon, nitrogen and trace nutrients at a temperature of
about 25°C to 35°C. Liquid cultures are provided with
sufficient aeration by conventional means, such as shaking
of small flasks or sparging of fermentors. A preferred
culture medium for P. methanolica is YEPD (2% D-glucose,
2% BactoTM Peptone (Difco Laboratories, Detroit, MI), 1%
BactoTM yeast extract (Difco Laboratories), 0.004% adenine
and 0.006% L-leucine).
It is preferred to purify the polypeptides of
the present invention to >_80% purity, more preferably to
>_90% purity, even more preferably __>95% purity, and
CA 02347968 2001-04-10
WO 00/22126 PGT/US99/23179
particularly preferred is a pharmaceutically pure state,
that is greater than 99.9% pure with respect to
contaminating macromolecules, particularly other proteins
and nucleic acids, and free of infectious and pyrogenic
5 agents. Preferably, a purified polypeptide is
substantially free of other polypeptides, particularly
other polypeptides of animal origin.
Expressed recombinant zfsta2 polypeptides (or
chimeric zfsta2 polypeptides) can be purified using
10 fractionation and/or conventional purification methods and
media. Ammonium sulfate precipitation and acid or
chaotrope extraction may be used for fractionation of
samples. Exemplary purification steps may include
hydroxyapatite, size exclusion, FPLC and reverse-phase
15 high performance liquid chromatography. Suitable
chromatographic media include derivatized dextrans,
agarose, cellulose, polyacrylamide, specialty silicas, and
the like. PEI, DEAE, QAE and Q derivatives are preferred.
Exemplary chromatographic media include those media
20 derivatized with phenyl, butyl, or octyl groups, such as
Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toso
Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia)
and the like; or polyacrylic resins, such as Amberchrom CG
71 (Toso Haas) and the like. Suitable solid supports
25 include glass beads, silica-based resins, cellulosic
resins, agarose beads, cross-linked agarose beads,
polystyrene beads, cross-linked polyacrylamide resins and
the like that are insoluble under the conditions in which
they are to be used. These supports may be modified with
30 reactive groups that allow attachment of proteins by amino
groups, carboxyl groups, sulfhydryl groups, hydroxyl
groups and/or carbohydrate moieties. Examples of coupling
chemistries include cyanogen bromide activation, N-
hydroxysuccinimide activation, epoxide activation,
35 sulfhydryl activation, hydrazide activation, and carboxyl
and amino derivatives for carbodiimide coupling
chemistries. These and other solid media are well known
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
51
and widely used in the art, and are available from
commercial suppliers. Methods for binding receptor
polypeptides to support media are well known in the art.
Selection of a particular method is a matter of routine
design and is determined in part by the properties of the
chosen support. See, for example, Affinitv
Chromatoaraphy~ Principles & Methods, Pharmacia LKB
Biotechnology, Uppsala, Sweden, 1988.
The polypeptides of the present invention can be
isolated by exploitation of physical properties of the
zfsta2 sequence or properties of coupled tags or epitopes.
For example, immobilized metal ion adsorption (IMAC)
chromatography can be used to purify histidine-rich
proteins, including those comprising polyhistidine tags.
Briefly, a gel is first charged with divalent metal ions
to form a chelate (Sulkowski, Trends in Biochem. 3:1-7,
1985). Histidine-rich proteins will be adsorbed to this
matrix with differing affinities, depending upon the metal
ion used, and will be eluted by competitive elution,
lowering the pH, or use of strong chelating agents. Other
methods of purification include purification of
glycosylated proteins by lectin affinity chromatography
and ion exchange chromatography (Methods in Enzymol., Vol.
182, "Guide to Protein Purification", M. Deutscher, (ed.),
Acad. Press, San Diego, 1990, pp.529-39). Within
additional embodiments of the invention, a fusion of the
polypeptide of interest and an affinity tag (e. g.,
maltose-binding protein, FLAG tag, Glu-Glu tag, an
immunoglobulin domain) may be constructed to facilitate
purification. An exemplary purification method of protein
constructs having an N-terminal or C-terminal affinity tag
involves using an antibody to the affinity tag epitope to
purify the protein using chromatography methods known in
the art. SDS-PAGE, Western analysis, amino acid analysis
and N-terminal sequencing can be done to confirm the
identity of the purified protein.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
52
Protein refolding (and optionally reoxidation)
procedures may be advantageously used. It is preferred to
purify the protein to >80% purity, more preferably to >90%
purity, even more preferably >95%, and particularly
preferred is a pharmaceutically pure state, that is
greater than 99.9% pure with respect to contaminating
macromolecules, particularly other proteins and nucleic
acids, and free of infectious and pyrogenic agents.
Preferably, a purified protein is substantially free of
other proteins, particularly other proteins of animal
origin.
Proteins/polypeptides which bind zfsta2 (such as
a zfsta2-binding receptor) can also be used for
purification of zfsta2. The zfsta2-binding
protein/polypeptide is immobilized on a solid support,
such as beads of agarose, cross-linked agarose, glass,
cellulosic resins, silica-based resins, polystyrene,
cross-linked polyacrylamide, or like materials that are
stable under the conditions of use. Methods for linking
polypeptides to solid supports are known in the art, and
include amine chemistry, cyanogen bromide activation, N-
hydroxysuccinimide activation, epoxide activation,
sulfhydryl activation, and hydrazide activation. The
resulting medium will generally be conf figured in the form
of a column, and fluids containing zfsta2 polypeptide are
passed through the column one or more times to allow
zfsta2 polypeptide to bind to the ligand-binding or
receptor polypeptide. The bound zfsta2 polypeptide is
then eluted using changes in salt concentration, chaotropic
agents (guanidine HC1), or pH to disrupt ligand-receptor
binding.
Moreover, using methods described in the art,
polypeptide fusions, or hybrid zfsta2 proteins, are
constructed using regions or domains of the inventive
zfsta2 in combination with other polypeptides, in
particular, those of other follistatin family proteins
(e. g. FRP, SPARC, agrin or hevin), or heterologous
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
53
proteins (Sambrook et al., ibid., Altschul et al., ibid.,
Picard, Cur. Opin. Bioloav, 5:511-5, 1994, and references
therein). These methods allow the determination of the
biological importance of larger domains or regions in a
polypeptide of interest. Such hybrids may alter reaction
kinetics, binding, constrict or expand the substrate
specificity, or alter tissue and cellular localization of
a polypeptide, and can be applied to polypeptides of
unknown structure.
Fusion proteins can be prepared by methods known
to those skilled in the art by preparing each component of
the fusion protein and chemically conjugating them.
Alternatively, a polynucleotide encoding both components
of the fusion protein in the proper reading frame can be
generated using known techniques and expressed by the
methods described herein. For example, part or all of a
domains) conferring a biological function may be swapped
between zfsta2 of the present invention with the
functionally equivalent domains) from another family
member, such as FRP. Such domains include, but are not
limited to, the secretory signal sequence, follistatin
homology domain, calmodulin homology domain, I-set IG
domains #1 and #2, the N or C-terminal domains and the
alpha helical linker, for example. Such fusion proteins
would be expected to have a biological functional profile
that is the same or similar to polypeptides of the present
invention or other known follistatin family proteins
described herein, depending on the fusion constructed.
Moreover, such fusion proteins may exhibit other
properties as disclosed herein.
zfsta2 polypeptides or fragments thereof may
also be prepared through chemical synthesis. zfsta2
polypeptides may be monomers or multimers; glycosylated or
non-glycosylated; pegylated or non-pegylated; and may or
may not include an initial methionine amino acid residue .
Polypeptides, especially polypeptides of the present
invention, can also be synthesized as described by
CA 02347968 2001-04-10
WO 00/Z2126 PCT/US99/23179
54 -
Merrifield, J. Am. Chem. Soc. 85:2149, 1963, Stewart et
al., "Solid Phase Peptide Synthesis" (2nd Edition?,
(Pierce Chemical Co. , Rockford, IL, 1984) and Bayer & Rapp
Chem. Pept. Prot. 3:3, 1986 and Atherton et al., Solid
Phase Peptide Synthesis: A Practical Ap~~roach, IRL Press,
Oxford, 1989, for example.
As described above, the disclosed polypeptides
can be used to construct zfsta2 variants and functional
fragments of zfsta2. Such variants and extracellular
domain fragments are considered to be zfsta2 agonists.
Another type of zfsta2 agonist is provided by anti-
idiotype antibodies, and fragments thereof, which mimic
the extracellular domain of zfsta2. Moreover, recombinant
antibodies comprising anti-idiotype variable domains that
mimic the zfsta2 extracellular domain can be used as
agonists (see, for example, Monfardini et al., Proc.
Assoc. Am. Physicians 108:420, 1996). zfsta2 agonists can
also be constructed using combinatorial libraries.
Methods for constructing and screening phage display and
other combinatorial libraries are provided, for example,
by Kay et al., Phaae Display of Peptides and Proteins
(Academic Press 1996), Verdine, U.S. Patent No. 5,783,384,
Kay, et. al., U.S. Patent No. 5,747,334, and Kauffman et
al., U.S. Patent No. 5,723,323.
The invention also provides antagonists, which
either bind to zfsta2 polypeptides or, alternatively, to a
receptor to which zfsta2 polypeptides bind, thereby
inhibiting or eliminating the function of zfsta2. Such
zfsta2 antagonists would include antibodies;
oligonucleotides which bind either to the zfsta2
polypeptide or to its receptor; natural or synthetic
analogs of zfsta2 polypeptides which retain the ability to
bind the receptor but do not result in either ligand or
receptor signaling. Such analogs could be peptides or
peptide-like compounds. Natural or synthetic small
molecules which bind to receptors of zfsta2 polypeptides
and prevent signaling are also contemplated as
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/Z3179
antagonists. As such, zfsta2 antagonists would be useful
as therapeutics for treating certain disorders where
blocking signal from either a zfsta2 ligand or receptor
would be beneficial.
5 zfsta2 can also be used to identify inhibitors
(antagonists) of its activity. Test compounds are added
to the assays disclosed herein to identify compounds that
inhibit the activity of zfsta2. In addition to those
assays disclosed herein, samples can be tested for
10 inhibition of zfsta2 activity within a variety of assays
designed to measure receptor binding or the
stimulation/inhibition of zfsta2-dependent cellular
responses. For example, zfsta2-responsive cell lines can
be transfected with a reporter gene construct that is
15 responsive to a zfsta2-stimulated cellular pathway.
Reporter gene constructs of this type are known in the
art, and will generally comprise a zfsta2-DNA response
element operably linked to a gene encoding an assayable
protein, such as luciferase. DNA response elements can
20 include, but are not limited to, cyclic AMP response
elements (CRE}, hormone response elements (HRE} insulin
response element (IRE) (Nasrin et al., Proc. Natl. Acad.
Sci. USA 87:5273-7, 1990) and serum response elements
(SRE) (Shaw et al. Cell, 56: 563-72, 1989). Cyclic AMP
25 response elements are reviewed in Roestler et al., J.
Biol. Chem. 263 (19):9063-6; 1988 and Habener, Molec.
Endocrinol. 4_ (8):1087-94; 1990. Hormone response
elements are reviewed in Beato, Cell 56:335-44; 1989.
Candidate compounds, solutions, mixtures or extracts are
30 tested for the ability to inhibit the activity of zfsta2
on the target cells as evidenced by a decrease in zfsta2
stimulation of reporter gene expression. Assays of this
type will detect compounds that directly block zfsta2
binding to cell-surface receptors, as well as compounds
35 that block processes in the cellular pathway subsequent to
receptor-ligand binding. In the alternative, compounds or
other samples can be tested for direct blocking of zfsta2
CA 02347968 2001-04-10
WO OOI22126 PCT/US99/Z3179
56
binding to receptor using zfsta2 tagged with a detectable
label (e, g,, lzsl, biotin, horseradish peroxidase, FITC,
and the like). Within assays of this type, the ability of
a test sample to inhibit the binding of labeled zfsta2 to
the receptor is indicative of inhibitory activity, which
can be confirmed through secondary assays. Receptors used
within binding assays may be cellular receptors or
isolated, immobilized receptors.
The invention also provides isolated and
purified zfsta2 polynucleotide probes and/or primers. The
probes and/or primers can be RNA or DNA. DNA can be
either cDNA or genomic DNA. Polynucleotide probes and
primers are single or double-stranded DNA or RNA,
generally synthetic oligonucleotides, but may be generated
from cloned cDNA or genomic sequences or its complements .
Analytical probes will generally be at least 20
nucleotides in length, although somewhat shorter probes
(14-17 nucleotides) can be used. PCR primers are at least
5 nucleotides in length, preferably 15 or more nt, more
preferably 20-30 nt. Short polynucleotide probes can be
used when a small region of the gene is targeted for
analysis. For gross analysis of genes, a polynucleotide
probe may comprise an entire exon or more.
Such probes can also be used in hybridizations
to detect the presence or quantify the amount of zfsta2
gene or mRNA transcript in a sample. zfsta2 polynucleotide
probes could be used to hybridize to DNA or RNA targets
for diagnostic purposes, using such techniques such as
fluorescent in situ hybridization (FISH) or
immunohistochemistry. Polynucleotide probes could be used
to identify genes encoding zfsta2-like proteins. Such
probes can also be used to screen libraries for related
zfsta2 sequences. Such screening would be carried out
under conditions of lower stringency which would allow
identification of sequences which are substantially
homologous, but not requiring complete homology to the
probe sequence. Such methods and conditions are well
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/Z3179
57
known in the art, see, for example, Sambrook et al.,
Molecular Clonincr: A Laboratory Manual, Second Edition,
Cold Spring Harbor, NY, 1989. Such stringency conditions
are described herein. Libraries may be made of genomic
DNA or cDNA. Polynucleotide probes are also useful for
Southern, Northern, or slot blots, colony and plaque
hybridization and in situ hybridization. Mixtures of
different zfsta2 polynucleotide probes can be prepared
which would increase sensitivity or the detection of low
copy number targets, in screening systems.
Nucleic acid molecules can be used to detect the
expression of a zfsta2 gene in a biological sample. In a
basic assay, a single-stranded probe molecule is incubated
with RNA, isolated from a biological sample, under
conditions of temperature and ionic strength that promote
base pairing between the probe and target zfsta2 RNA
species. After separating unbound probe from hybridized
molecules, the amount of hybrids is detected.
A method of detecting the presence of zfsta2 RNA
in a biological sample is provided, comprising the steps
of
a) contacting a zfsta2 nucleic acid probe
under stringent hybridizing conditions with either
i) test RNA molecules isolated from the
biological sample, or
ii) nucleic acid molecules synthesized from
the isolated RNA molecules,
wherein the probe has a nucleotide sequence
comprising a portion of the nucleotide sequence of SEQ ID
NOs:l or 3, or their complements, and
b) detecting the formation of hybrids of the
nucleic acid probe and either the test RNA molecules or
the synthesized nucleic acid molecules,
wherein the presence of the hybrids indicates
the presence of zfsta2 RNA is the biological sample.
Well-established hybridization methods of RNA
detection include northern analysis and dot/slot blot
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
58
hybridization (see, for example, Ausubel ibid. at pages 4-
1 to 4-27, and Wu et al. (eds.), "Analysis of Gene
Expression at the RNA Level," in Methods in Gene
Biotechnolocrv, pages 225-39, CRC Press, Inc., 1997).
Nucleic acid probes can be detectably labeled with
radioisotopes such as 'ZP or 35S . Alternatively, zf sta2 RNA
can be detected with a nonradioactive hybridization method
(see, for example, Isaac (ed.), Protocols for Nucleic Acid
Analysis by Nonradioactive Probes, Humana Press, Inc.,
1993). Typically, nonradioactive detection is achieved by
enzymatic conversion of chromogenic or chemiluminescent
substrates. Illustrative non-radioactive moieties include
biotin, fluorescein, and digoxigenin.
zfsta2 oligonucleotide probes are also useful
for in vivo diagnosis. As an illustration, l8F-labeled
oligonucleotides can be administered to a subject and
visualized by positron emission tomography (Tavitian et
al., Nat. Med. 4:467, 1998).
Numerous diagnostic procedures take advantage of
the polymerase chain reaction (PCR) to increase
sensitivity of detection methods. Standard techniques for
performing PCR are well-known (see, generally, Mathew
(ed.), Protocols in Human Molecular Genetics, Humana
Press, Inc., 1991; White (ed.), PCR Protocols: Current
Methods and Applications, Humana Press, Inc., 1993; Cotter
(ed.), Molecular Diagnosis of Cancer, Humana Press, Inc.,
1996; Hanausek and Walaszek (eds.), Tumor Marker
Protocols, Humana Press, Inc., 1998; Lo (ed.), Clinical
Applications of PCR, Humana Press, Inc., 1998 and Meltzer
(ed.), PCR in Bioanalysis, Humana Press, Inc., 1998).
PCR primers can be designed to amplify a sequence encoding
a particular zfsta2 region, such as the follistatin
homology domain, encoded by about nucleotide 250 to
nucleotide 456 of SEQ ID NO:1, and the calmodulin domain,
encoded by about nucleotide 580 to nucleotide 810 of SEQ
ID NO:1.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
59
One variation of PCR for diagnostic assays is
reverse transcriptase-PCR (RT-PCR). In the RT-PCR
technique, RNA is isolated from a biological sample,
reverse transcribed to cDNA, and the cDNA is incubated
with zfsta2 primers (see, for example, Wu et al. (eds.),
"Rapid Isolation of Specific cDNAs or Genes by PCR," in
. Methods in Gene Biotechnology, pages 15-28, CRC Press,
Inc. 1997). PCR is then performed and the products are
analyzed using standard techniques.
As an illustration, RNA is isolated from a
biological sample using, for example, the guanidinium-
thiocyanate cell lysis procedure described above.
Alternatively, a solid-phase technique can be used to
isolate mRNA from a cell lysate. A reverse transcription
reaction can be primed with the isolated RNA using random
oligonucleotides, short homopolymers of dT, or zfsta2
anti-sense oligomers. Oligo-dT primers offer the
advantage that various mRNA nucleotide sequences are
amplified that can provide control target sequences.
zfsta2 sequences are amplified by the polymerase chain
reaction using two flanking oligonucleotide primers that
are typically 20 bases in length.
PCR amplification products can be detected using
a variety of approaches. For example, PCR products can be
fractionated by gel electrophoresis, and visualized by
ethidium bromide staining. Alternatively, fractionated
PCR products can be transferred to a membrane, hybridized
with a detectably-labeled zfsta2 probe, and examined by
autoradiography. Additional alternative approaches
include the use of digoxigenin-labeled deoxyribonucleic
acid triphosphates to provide chemiluminescence detection,
and the C-TRAK colorimetric assay.
Another approach is real time quantitative PCR
(Perkin-Elmer Cetus, Norwalk, CT). A fluorogenic probe,
consisting of an oligonucleotide with both a reporter and
a quencher dye attached, anneals specifically between the
forward and reverse primers. Using the 5' endonuclease
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
activity of Taq DNA polymerise, the reporter dye is
separated from the quencher dye and a sequence-specific
signal is generated and increases as amplification
increases. The fluorescence intensity can be continuously
5 monitored and quantified during the PCR reaction.
Another approach for detection of zfsta2
expression is cycling probe technology (CPT), in which a
single-stranded DNA target binds with an excess of DNA-
RNA-DNA chimeric probe to form a complex, the RNA portion
10 is cleaved with RNase H, and the presence of cleaved
chimeric probe is detected (see, for example, Beggs et
al., J. Clin. Microbiol. 34:2985, 1996 and Bekkaoui et
al., Biotechniques 20:240, 1996). Alternative methods for
detection of zfsta2 sequences can utilize approaches such
15 as nucleic acid sequence-based amplification (NASBA),
cooperative amplification of templates by cross-
hybridization (CATCH), and the ligase chain reaction (LCR)
(see, for example, Marshall et al., U.S. Patent No.
5,686,272 (1997), Dyer et al., J. Virol. Methods 60:161,
20 1996; Ehricht et al . , Eur. J. Biochem. 243 :358, 1997; and
Chadwick et al., J. Virol. Methods 70:59, 1998). Other
standard methods are known to those of skill in the art.
Zfsta2 probes and primers can also be used to
detect and to localize zfsta2 gene expression in tissue
25 samples. Methods for such in situ hybridization are well
known to those of skill in the art (see, for example, Choo
(ed.), In Situ Hvbridization Protocols, Humana Press,
Inc., 1994; Wu et al. (eds.), "Analysis of Cellular DNA or
Abundance of mRNA by Radioactive In Situ Hybridization
30 IRISH)," in Methods in Gene Biotechnology, pages 259-278,
CRC Press, Inc., 1997; and Wu et a1. (eds.), "Localization
of DNA or Abundance of mRNA by Fluorescence In Situ
Hybridization IRISH)," in Methods in Gene BiotechnoloQV,
pages 279-289, CRC Press, Inc., 1997).
35 Various additional diagnostic approaches are
well-known to those of skill in the art (see, for example,
Mathew (ed.), Protocols in Human Molecular Genetics,
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/Z3I79
61
Humana Press, Inc., 1991; Coleman and Tsongalis, Molecular
Diacrnostics, Humana Press, Inc., 1996; and Elles,
Molecular Diacxnosis of Genetic Diseases, Humana Press,
Inc., 1996).
An assay system that uses a ligand-binding
receptor (or an antibody, one member of a complement/
anti-complement pair) or a binding fragment thereof, and a
commercially available biosensor instrument (BIAcore,
Pharmacia Biosensor, Piscataway, NJ) may be advantageously
employed. Such receptor, antibody, member of a
complement/anti-complement pair or fragment is immobilized
onto the surface of a receptor chip. Use of this
instrument is disclosed by Karlsson, J. Immunol. Methods
145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol.
234:554-63, 1993. A receptor, antibody, member or
fragment is covalently attached, using amine or sulfhydryl
chemistry, to dextran fibers that are attached to gold
film within the flow cell. A test sample is passed
through the cell. If a ligand, epitope, or opposite
member of the complement/anti-complement pair is present
in the sample, it will bind to the immobilized receptor,
antibody or member, respectively, causing a change in the
refractive index of the medium, which is detected as a
change in surface plasmon resonance of the gold film.
This system allows the determination of on- and off-rates,
from which binding affinity can be calculated, and
assessment of stoichiometry of binding.
Ligand-binding receptor polypeptides can also be
used within other assay systems known in the art. Such
systems include Scatchard analysis for determination of
binding affinity (see Scatchard, Ann. NY Acad. Sci. 51:
660-72, 1949) and calorimetric assays (Cunningham et al.,
Science 253:545-48, 1991; Cunningham et al., Science
245:821-25, 1991).
Probes and primers generated from the sequences
disclosed herein can be used to map the zfsta2 gene to
human chromosome 4. Radiation hybrid mapping is a somatic
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/Z3179
62
cell genetic technique developed for constructing high-
resolution, contiguous maps of mammalian chromosomes (Cox
et al., Science 250:245-50, 1990). Partial or full
knowledge of a gene's sequence allows one to design PCR
primers suitable for use with chromosomal radiation hybrid
mapping panels. Radiation hybrid mapping panels are
commercially available which cover the entire human
genome, such as the Stanford G3 RH Panel and the
GeneBridge 4 RH Panel (Research Genetics, Inc.,
Huntsville, AL). These panels enable rapid, PCR-based
chromosomal localizations and ordering of genes, sequence-
tagged sites (STSs), and other nonpolymorphic and
polymorphic markers within a region of interest. This
includes establishing directly proportional physical
distances between newly discovered genes of interest and
previously mapped markers. The precise knowledge of a
gene's position can be useful for a number of purposes,
including: 1) determining if a sequence is part of an
existing contig and obtaining additional surrounding
genetic sequences in various forms, such as YACs, BACs or
cDNA clones; 2) providing a possible candidate gene for an
inheritable disease which shows linkage to the same
chromosomal region; and 3) cross-referencing model
organisms, such as mouse, which may aid in determining
what function a particular gene might have.
Sequence tagged sites (STSs) can also be used
independently for chromosomal localization. An STS is a
DNA sequence that is unique in the human genome and can be
used as a reference point for a particular chromosome or
region of a chromosome. An STS is defined by a pair of
oligonucleotide primers that are used in a polymerase
chain reaction to specifically detect this site in the
presence of all other genomic sequences. Since STSs are
based solely on DNA sequence they can be completely
described within an electronic database, for example,
Database of Sequence Tagged Sites (dbSTS), GenBank,
(National Center for Biological Information, National
CA 02347968 2001-04-10
WO OO/Z2126 PCT/US99/23i79
63
Institutes of Health, Bethesda, MD http://www.ncbi.nlm.
nih.gov), and can be searched with a gene sequence of
interest for the mapping data contained within these short
genomic landmark STS sequences.
The present invention also contemplates use of
such chromosomal localization for diagnostic applications.
Briefly, the zfsta2 gene, a probe comprising zfsta2 DNA or
RNA or a subsequence thereof , can be used to determine if
the zfsta2 gene is present on human chromosome 4 or if a
mutation has occurred. Detectable chromosomal aberrations
at the zfsta2 gene locus include, but are not limited to,
aneuploidy, gene copy number changes, insertions,
deletions, restriction site changes and rearrangements.
Such aberrations can be detected using polynucleotides of
the present invention by employing molecular genetic
techniques, such as restriction fragment length
polymorphism (RFLP) analysis, short tandem repeat (STR)
analysis employing PCR techniques, and other genetic
linkage analysis techniques known in the art (Sambrook et
al., ibid.; Ausubel et. al., ibid.; Marian, Chest
108:255-65, 1995).
In general, these diagnostic methods comprise
the steps of (a) obtaining a genetic sample from a
patient; (b) incubating the genetic sample with a
polynucleotide probe or primer as disclosed above, under
conditions wherein the polynucleotide will hybridize to
complementary polynucleotide sequence, to produce a first
reaction product; and (iii) comparing the first reaction
product to a control reaction product. A difference
between the first reaction product and the control
reaction product is indicative of a genetic abnormality in
the patient. Genetic samples for use within the present
invention include genomic DNA, cDNA, and RNA. The
polynucleotide probe or primer can be RNA or DNA, and will
comprise a portion of SEQ ID NO:1, the complement of SEQ
ID NO:1, or an RNA equivalent thereof. Suitable assay
methods in this regard include molecular genetic
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
64
techniques known to those in the art, such as restriction
fragment length polymorphism (RFLP) analysis, short tandem
repeat (STR) analysis employing PCR techniques, ligation
chain reaction (Barany, PCR Methods and Applications 1:5-
16, 1991), ribonuclease protection assays, and other
genetic linkage analysis techniques known in the art
(Sambrook et al., ibid.; Ausubel et. al., ibid.; Marian,
Chest 108:255-65, 1995). Ribonuclease protection assays
(see, e.g., Ausubel et al., ibid., ch. 4) comprise the
hybridization of an RNA probe to a patient RNA sample,
after which the reaction product (RNA-RNA hybrid) is
exposed to RNase. Hybridized regions of the RNA are
protected from digestion. Within PCR assays, a patient's
genetic sample is incubated with a pair of polynucleotide
primers, and the region between the primers is amplified
and recovered. Changes in size or amount of recovered
product are indicative of mutations in the patient.
Another PCR-based technique that can be employed is single
strand conformational polymorphism (SSCP) analysis
(Hayashi, PCR Methods and Applications 1:34-8, 1991).
The invention also provides anti-zfsta2
antibodies. Antibodies to zfsta2 can be obtained, for
example, using as an antigen the product of a zfsta2
expression vector, or zfsta2 isolated from a natural
source. Particularly useful anti-zfsta2 antibodies "bind
specifically" with zfsta2. Antibodies are considered to
be specifically binding if the antibodies bind to a zfsta2
polypeptide, peptide or epitope with a binding affinity
(Ka) of 106 M 1 or greater, preferably 10~ M 1 or greater,
more preferably 108 M 1 or greater, and most preferably
109 M 1 or greater. The binding affinity of an antibody
can be readily determined by one of ordinary skill in the
art, for example, by Scatchard analysis (Scatchard, Ann.
NY Acad. Sci. 51:660, 1949). Suitable antibodies include
antibodies that bind with zfsta2 in particular domains,
such as the zfsta2 follistatin homology domain (amino acid
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
residues 65 to about 133 of SEQ ID N0:2), the calmodulin
homology domain (located at about amino acid residues 175
to 250 of SEQ ID N0:2), or I-set IG domains #1 or #2
(located at about amino acid residues 251 to334 of SEQ ID
5 N0:2 or amino acid residues 335 to 432 of SEQ ID N0:2).
Anti-zfsta2 antibodies can be produced using
antigenic zfsta2 epitope-bearing peptides and
polypeptides. Antigenic epitope-bearing peptides and
polypeptides of the present invention contain a sequence
10 of at least nine, preferably between 15 to about 30 amino
acids contained within SEQ ID N0:2. However, peptides or
polypeptides comprising a larger portion of an amino acid
sequence of the invention, containing from 30 to 50 amino
acids, or any length up to and including the entire amino
15 acid sequence of a polypeptide of the invention, also are
useful for inducing antibodies that bind with zfsta2. It
is desirable that the amino acid sequence of the epitope-
bearing peptide is selected to provide substantial
solubility in aqueous solvents (i.e., the sequence
20 includes relatively hydrophilic residues, while
hydrophobic residues are preferably avoided). Moreover,
amino acid sequences containing proline residues may be
also be desirable for antibody production.
Polyclonal antibodies to recombinant zfsta2
25 protein or to zfsta2 isolated from natural sources can be
prepared using methods well-known to those of skill in the
art. See, for example, Green et al., "Production of
Polyclonal Antisera," in Immunochemical Protocols (Manson,
ed.), pages 1-5 (Humana Press 1992), and Williams et al.,
30 "Expression of foreign proteins in E. col.i using plasmid
vectors and purification of specific polyclonal
antibodies," in DNA Cloning 2: Expression Systems, 2nd
Edition, Glover et al. (eds.), page 15 (Oxford University
Press 1995). The immunogenicity of a zfsta2 polypeptide
35 can be increased through the use of an adjuvant, such as
alum (aluminum hydroxide) or Freund's complete or
incomplete adjuvant. Polypeptides useful for immunization
CA 02347968 2001-04-10
WO 00/22126 PGT/US99/23179
66
also include fusion polypeptides, such as fusions of
zfsta2 or a portion thereof with an immunoglobulin
polypeptide or with maltose binding protein. The
polypeptide immunogen may be a full-length molecule or a
portion thereof. If the polypeptide portion is "hapten-
like," such portion may be advantageously joined or linked
to a macromolecular carrier (such as keyhole limpet
hemocyanin (KLH), bovine serum albumin (BSA) or tetanus
toxoid) for immunization.
Although polyclonal antibodies are typically
raised in animals such as horses, cows, dogs, chicken,
rats, mice, rabbits, hamsters, guinea pigs, goats or
sheep, an anti-zfsta2 antibody of the present invention
may also be derived from a subhuman primate antibody.
General techniques for raising diagnostically and
therapeutically useful antibodies in baboons may be found,
for example, in Goldenberg et al., international patent
publication No. WO 91/11465, and in Losman et al., Int. J.
Cancer 46:310, 1990. Antibodies can also be raised in
transgenic animals such as transgenic sheep, cows, goats
or pigs, and may be expressed in yeast and fungi in
modified forms as will as in mammalian and insect cells.
Alternatively, monoclonal anti-zfsta2
antibodies can be generated. Rodent monoclonal antibodies
to specific antigens may be obtained by methods known to
those skilled in the art (see, for example, Kohler et al.,
Nature 256:495 (1975), Coligan et al. (eds.), Current
Protocols in Immunologv, Vol. 1, pages 2.5.1-2.6.7 (John
Wiley & Sons 1991), Picksley et al., "Production of
monoclonal antibodies against proteins expressed in E.
coli, " in DNA Cloning 2 : Expression Systems, 2nd Edition,
Glover et al. (eds.), page 93 (Oxford University Press
1995) ) .
Briefly, monoclonal antibodies can be obtained
by injecting mice with a composition comprising a zfsta2
gene product, verifying the presence of antibody
production by removing a serum sample, removing the spleen
CA 02347968 2001-04-10
WO 00/22126 PCTlUS99/23179
67
to obtain B-lymphocytes, fusing the B-lymphocytes with
myeloma cells to produce hybridomas, cloning the
hybridomas, selecting positive clones which produce
antibodies to the antigen, culturing the clones that
produce antibodies to the antigen, and isolating the
antibodies from the hybridoma cultures.
In addition, an anti-zfsta2 antibody of the
present invention may be derived from a human monoclonal
antibody. Human monoclonal antibodies are obtained from
transgenic mice that have been engineered to produce
specific human antibodies in response to antigenic
challenge. In this technique, elements of the human heavy
and light chain locus are introduced into strains of mice
derived from embryonic stem cell lines that contain
targeted disruptions of the endogenous heavy chain and
light chain loci. The transgenic mice can synthesize human
antibodies specific for human antigens, and the mice can be
used to produce human antibody-secreting hybridomas.
Methods for obtaining human antibodies from transgenic mice
are described, for example, by Green et al., Nat. Genet.
7:13, 1994, Lonberg et al., Nature 368:856, 1994, and
Taylor et al., Int. Immun. 6:579, 1994.
Monoclonal antibodies can be isolated and
purified from hybridoma cultures by a variety of well
established techniques. Such isolation techniques include
affinity chromatography with Protein-A Sepharose, size-
exclusion chromatography, and ion-exchange chromatography
(see, for example, Coligan at pages 2.7.1-2.7.12 and pages
2.9.1-2.9.3; Baines et al., "Purification of
Immunoglobulin G (IgG)," in Methods in Molecular Biology,
Vol. 10, pages 79-104 (The Humana Press, Inc. 1992)).
For particular uses, it may be desirable to
prepare fragments of anti-zfsta2 antibodies. Such
antibody fragments can be obtained, for example, by
proteolytic hydrolysis of the antibody. Antibody
fragments can be obtained by pepsin or papain digestion of
whole antibodies by conventional methods. As an
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
68
illustration, antibody fragments can be produced by
enzymatic cleavage of antibodies with pepsin to provide a
5S fragment denoted F(ab')2. This fragment can be further
cleaved using a thiol reducing agent to produce 3.55 Fab'
monovalent fragments. Optionally, the cleavage reaction
can be performed using a blocking group for the sulfhydryl
groups that result from cleavage of disulfide linkages.
As an alternative, an enzymatic cleavage using pepsin
produces two monovalent Fab fragments and an Fc fragment
directly. These methods are described, for example, by
Goldenberg, U.S. patent No. 4,331,647, Nisonoff et al.,
Arch Biochem. Biophys. 89:230, 1960, Porter, Biochem. J.
73:119, 1959, Edelman et al., in Methods in Enzvmologv
Vol. 1, page 422 (Academic Press 1967), and by Coligan,
ibid.
Other methods of cleaving antibodies, such as
separation of heavy chains to form monovalent light-heavy
chain fragments, further cleavage of fragments, or other
enzymatic, chemical or genetic techniques may also be
used, so long as the fragments bind to the antigen that is
recognized by the intact antibody.
For example, Fv fragments comprise an
association of VH and vL chains. This association can be
noncovalent, as described by Inbar et al., Proc. Nat'1
Acad. Sci. USA 69:2659, 1972. Alternatively, the variable
chains can be linked by an intermolecular disulfide bond
or cross-linked by chemicals such as gluteraldehyde (see,
for example, Sandhu, Crit. Rev. Biotech. 12:437, 1992).
The Fv fragments may comprise VH and VL chains
which are connected by a peptide linker. These single
chain antigen binding proteins (scFv) are prepared by
constructing a structural gene comprising DNA sequences
encoding the VH and VL domains which are connected by an
oligonucleotide. The structural gene is inserted into an
expression vector which is subsequently introduced into a
host cell, such as E. coli. The recombinant host cells
synthesize a single polypeptide chain with a linker
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
69
peptide bridging the two V domains. Methods for producing
scFvs are described, for example, by Whitlow et al.,
Methods: A Companion to Methods in Enzymoloqy 2:97, 1991,
also see, Bird et al., Science 242:423, 1988, Ladner et
al., U.S. Patent No. 4,946,778, Pack et al.,
Bio/Technology 11:1271, 1993, and Sandhu, supra.
As an illustration, a scFV can be obtained by
exposing lymphocytes to zfsta2 polypeptide in vitro, and
selecting antibody display libraries in phage or similar
vectors (for instance, through use of immobilized or
labeled zfsta2 protein or peptide). Genes encoding
polypeptides having potential zfsta2 polypeptide binding
domains can be obtained by screening random peptide
libraries displayed on phage (phage display) or on
bacteria, such as E. coli. Nucleotide sequences encoding
the polypeptides can be obtained in a number of ways, such
as through random mutagenesis and random polynucleotide
synthesis. These random peptide display libraries can be
used to screen for peptides which interact with a known
target which can be a protein or polypeptide, such as a
ligand or receptor, a biological or synthetic
macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide
display libraries are known in the art (Ladner et al.,
U.S. Patent No. 5,223,409, Ladner et al., U.S. Patent No.
4,946,778, Ladner et al., U.S. Patent No. 5,403,484,
Ladner et al., U.S. Patent No. 5,571,698, and Kay et al.,
PhaQe Display of Peptides and Proteins (Academic Press,
Inc. 1996)) and random peptide display libraries and kits
for screening such libraries are available commercially,
for instance from Clontech (Palo Alto, CA), Invitrogen
Inc. (San Diego, CA), New England Biolabs, Inc. (Beverly,
MA), and Pharmacia LKB Biotechnology Inc. (Piscataway,
NJ). Random peptide display libraries can be screened
using the zfsta2 sequences disclosed herein to identify
proteins which bind to zfsta2.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
Another form of an antibody fragment is a
peptide coding for a single complementarity-determining
region (CDR). CDR peptides ("minimal recognition units")
can be obtained by constructing genes encoding the CDR of
5 an antibody of interest. Such genes are prepared, for
example, by using the polymerase chain reaction to
synthesize the variable region from RNA of antibody-
producing cells (see, for example, Larrick et a.I.,
Methods: A Companion to Methods in Enzymology 2:106,
10 1991), Courtenay-Luck, "Genetic Manipulation of Monoclonal
Antibodies," in Monoclonal Antibodies: Production.
EncrineerinQ and Clinical Application, Ritter et al.
(eds.), page 166 (Cambridge University Press 1995), and
Ward et al., "Genetic Manipulation and Expression of
15 Antibodies," in Monoclonal Antibodies: Principles and
Applications, Birch et al., (eds.), page 137 (Wiley-Liss,
Inc. 1995)).
Alternatively, an anti-zfsta2 antibody may be
derived from a "humanized" monoclonal antibody. Humanized
20 monoclonal antibodies are produced by transferring mouse
complementary determining regions from heavy and light
variable chains of the mouse immunoglobulin into a human
variable domain. Typical residues of human antibodies are
then substituted in the framework regions of the murine
25 counterparts. The use of antibody components derived from
humanized monoclonal antibodies obviates potential
problems associated with the immunogenicity of murine
constant regions. General techniques for cloning murine
immunoglobulin variable domains are described, for
30 example, by Orlandi et al., Proc. Nat'1 Acad. Sci. USA
86:3833, 1989. Techniques for producing humanized
monoclonal antibodies are described, for example, by Jones
et al., Nature 321:522, 1986, Carter et al., Proc. Nat'1
Acad. Sci. USA 89:4285, 1992, Sandhu, Crit. Rev. Biotech.
35 12:437, 1992, Singer et al., J. Immun. 150:2844, 1993,
Sudhir (ed.), Antibody Eng~ineerincr Protocols (Humana
Press, Inc. 1995), Kelley, "Engineering Therapeutic
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
71
Antibodies," in Protein Engineering: Principles and
Practice, Cleland et al. (eds.), pages 399-434 (John Wiley
& Sons, Inc. 1996), and by Queen et al., U.S. Patent No.
5,693,762 (1997).
Polyclonal anti-idiotype antibodies can be
prepared by immunizing animals with anti-zfsta2 antibodies
or antibody fragments, using standard techniques. See,
for example, Green et al., "Production of Polyclonal
Antisera," in Methods In Molecular Biology: Immunochemical
Protocols, Manson (ed.), pages 1-12 (Humana Press 1992).
Also, see Coligan, ibid. at pages 2.4.1-2.4.7.
Alternatively, monoclonal anti-idiotype antibodies can be
prepared using anti-zfsta2 antibodies or antibody
fragments as immunogens with the techniques, described
above. As another alternative, humanized anti-idiotype
antibodies or subhuman primate anti-idiotype antibodies
can be prepared using the above-described techniques.
Methods for producing anti-idiotype antibodies are
described, for example, by Irie, U.S. Patent No.
5,208,146, Greene, et. al., U.S. Patent No. 5,637,677, and
Varthakavi and Minocha, J. Gen. Virol. 77:1875, 1996.
Antibodies or polypeptides herein can also be
directly or indirectly conjugated to drugs, toxins,
radionuclides and the like, and these conjugates used for
in vivo diagnostic or therapeutic applications. For
instance, polypeptides or antibodies of the present
invention can be used to identify or treat tissues or
organs that express a corresponding anti-complementary
molecule (receptor or antigen, respectively, for
instance). More specifically, zfsta2 polypeptides or
anti-zfsta2 antibodies, or bioactive fragments or portions
thereof, can be coupled to detectable or cytotoxic
molecules and delivered to a mammal having cells, tissues
or organs that express the anti-complementary molecule.
Suitable detectable molecules may be directly or
indirectly attached to the polypeptide or antibody, and
CA 02347968 2001-04-10
WO 00122126 PCT/US99/23179
72
include radionuclides, enzymes, substrates, cofactors,
inhibitors, fluorescent markers, chemiluminescent markers,
magnetic particles and the like. Suitable cytotoxic
molecules may be directly or indirectly attached to the
polypeptide or antibody, and include bacterial or plant
toxins (for instance, diphtheria toxin, Pseudomonas
exotoxin, ricin, abrin and the like), as well as
therapeutic radionuclides, such as iodine-131, rhenium-188
or yttrium-90 (either directly attached to the polypeptide
or antibody, or indirectly attached through means of a
chelating moiety, for instance). Polypeptides or
antibodies may also be conjugated to cytotoxic drugs, such
as adriamycin. For indirect attachment of a detectable or
cytotoxic molecule, the detectable or cytotoxic molecule
can be conjugated with a member of a complementary/
anticomplementary pair, where the other member is bound to
the polypeptide or antibody portion. For these purposes,
biotin/streptavidin is an exemplary complementary/
anticomplementary pair.
Expression of zfsta2 mRNA is largely confined to
spinal cord, brain, and placenta with low level expression
seen in a wide variety of other tissues. This is
consistent with the reported distribution of follistatin
gene transcripts and transcripts of a number of other
follistatin family members. This distribution suggests
that zfsta2 may play a role in neuron regeneration and
repair within the CNS. Injury to the adult mammalian
brain or spinal cord generates a cascade of cellular
events leading to inflammation, proliferation of
astrocytes, angiogenesis, and formation of a glial-
mesodermal scar (Logan et al., Brain Res. 587:216-25,
1992; Wang et al., Brain Res. Bull. 36:607-9, 1995 and
Lindholm et al., J. Cell. Biol. 117:395-400, 1992).
Production of scar tissue within the CNS provides a
physical barrier for regeneration of neurons and is
thought to limit the ability of the adult CNS to recover
after injury. Scar tissue formation in the CNS is thought
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
73
to be dependent on the localized TGF-(3 stimulated
production of extracellular matrix components, similar to
what is seen for scar tissue formation in the periphery.
Indeed, TGF-(3 mRNA and protein have been localized to
astrocytes at the site of damage in the CNS (Logan et al.,
ibid., Wang et al., ibid. and Lindholm et al., ibid.)
suggesting that a follistatin family member, such as
zfsta2, facilitates neuron regeneration and establishment
of new synaptic contacts by sequestering TGF-(3. SC1, a
member of the follistatin family, is expressed in brain
astrocytes following injury (Mendis et al., Brain Res.
730:95-106, 1996) and follistatin related protein (FRP) is
secreted by glioma cells in culture (Zwijsen et al., Eur.
J. Biochem. 225:937-46, 1994).
Proteins that can sequester TGF~3 and stimulate
neuron regeneration would be useful in treatment of
peripheral neuropathies by increasing spinal cord and
sensory neurite outgrowth. Such polypeptides, agonists
and antagonists can be included in therapeutic treatment
to regenerate neurite outgrowths following strokes, brain
damage caused by head injuries, and paralysis caused by
spinal injuries. Application may also be made in treating
neurodegenerative diseases such as Alzheimer's disease,
Parkinson's disease and multiple sclerosis by stimulating
neuronal outgrowths. Additional applications would
include repair of transected axons which are common in
lesions of multiple sclerosis.
Zfsta2 polypeptides, agonists or antagonists
thereof may be therapeutically useful for treating brain
and spinal cord injuries. To verify the presence of this
capability in zfsta2 polypeptides, agonists or antagonists
of the present invention, such zfsta2 polypeptides,
agonists or antagonists are evaluated with respect to
their ability to stimulate neuron regeneration and
establish new synaptic contacts according to procedures
known in the art, see for example Mendis et al., Brain
CA 02347968 2001-04-10
WO OO/Z2I26 PCT/US99IZ3179
74
Res. 730:95-106, 1996; Lindholm et al., J. Cell Biol.
117:395-400, 1992 and Logan et al., Brain Res. 587:216-25,
1992. If desired, zfsta2 polypeptide performance in this
regard can be compared to other follistatins such as SC1
and FRP and the like. In addition, zfsta2 polypeptides or
agonists or antagonists thereof may be evaluated in
combination with one or more follistatins to identify
synergistic effects. If desired, zfsta2 performance in
this regard can be compared to other anti-inflammatory
compounds, such as dexamethasone and hydrocortisone and
the like.
In addition to its potential role in treatment
of injuries to the CNS, zfsta2 may also have a role in
host defense. Human marrow stromal cells have been shown
to be reactive with anti-activin A antibodies and the
production of the BA-subunit mRNA is increased in these
cells by a number of pro-inflammatory cytokines/regulators
such as interleukin la, lipopolysaccaride, tumor necrosis
factor-a, or 12-O-tetradecanoylphorbol 13-acetate (Shao et
al., Cytokine 10:227-35, 1998). In contrast to the
stimulatory effects of these agents, the anti-inflammatory
compounds dexamethasone and hydrocortisone inhibited the
constitutive and cytokine-stimulated expression of activin
BA-mRNA (Shao et al., ibid.).
Application of the polypeptides of the present
invention may be made to inhibit inflammatory response,
stimulate a reduction in the number and activity of
inflammatory cells, and diminish edema and inflammation.
Such anti-inflammatory polypeptides would find application
in the treatment of acute inflammation conditions,
bursitis, chronic inflammatory demyelinating
polyneuropathy, various forms of contact dermatitis,
contact vulvovaginitis, myositis, sepsis and ulcerative
colitis. Use as therapeutic agents could also be made for
treating acute renal failure, pancreatitis and neonatal
bronchopulmonary dysplasia. Application can also be made
for ocular injuries, such as corneal injury from burns or
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
penetration of a foreign body or ocular inflammatory
diseases such as uveitis.
Application may also be made to alleviate
chronic itching and inflammation associated with
5 dermatological conditions and skin diseases such as
eczema, neurodermatitis, allergy, psoriasis, xerosis,
insect bites, and burns, such as thermal, chemical and
radiation burns, particularly sunburns.
Symptoms associated with gout, asthma, carpal
10 tunnel syndrome, systemic lupus erythematosus, multiple
sclerosis and myasthenia gravis may also be alleviated
using the compounds of the present invention.
zfsta2 polypeptide, agonist or antagonist
mediated removal of bioactive activin from sites of
15 inflammation would be a useful therapy for treatment of a
wide variety of inflammatory disorders. To verify the
presence of this capability in zfsta2 polypeptides, or
polypeptide fragments thereof, such polypeptides and
polypeptide fragments are evaluated with respect to their
20 ability to inhibit acute inflammation. Such methods are
known in the art, in particular, zfsta2 polypeptides can
be tested for anti-inflammatory activity in the
carrageenan-induced rat footpad edema model (Winter et
al., J. Pharmac. Exp. Ther. 141:369-76, 1963 and Miele et
25 al., Nature 335:726-30, 1988). Other models include the
endotoxin-induced uveitis (EIU) model (Chan et al., Arch.
Ophthalmol. 109:278-81, 1991), Oxazolone-induced
inflammation model (Lloret and Moreno, Biochem. Pharmocol.
44:1437, 1992), croton oil-induced inflammation model,
30 PMA-induced inflammation model (Miele et al., ibid.), and
dextran-induced edema assay for anti-inflammatory agents
(Ialenti et al., Aaents Actions 29:48-9, 1990 and Rosa and
Willoughby, J. Pharm. Pharmac. 23:297-8, 1971). Efficacy
for treating diseases such as rheumatoid arthritis can be
35 evaluated using indicators which would include a reduction
in inflammation and relief of pain or stiffness, and in
animal models indications would be derived from
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/Z3179
76
macroscopic inspection of joints and change in swelling of
hind paws. If desired, zfsta2 polypeptide performance in
this regard can be compared to other anti-inflammatory
agents, in particular, dexamethasone and hydrocortisone.
In addition, zfsta2 polypeptides may be evaluated in
combination with one or more anti-inflammatory agents to
identify synergistic effects.
The recent conformation of the sequence identity
of erythroid differentiation factor (EDF) and BA subunit of
activins and inhibins (Murata et al., Proc. Natl. Acad.
Sci. USA 85:2434, 1988) suggests a role for zfsta2 in
regulating hematopoiesis and differentiation of erythroid
progenitors. EDF exhibits potent differentiation-inducing
activity towards cultured erythroleukemia cells and
enhances the growth of normal erythroid precursor cells in
vitro and in vivo (Yu et al., Nature, 330:765, 1987,
Shiozaki, et al., Biochem. Biophys. Res. Commun. 165:1155,
1989) and activin A/EDF is expressed in activated
macrophages (Eramaa et al., J. Exp. Med. 176:1449-52,
1992). Continuous intraperitoneal administration of
follistatin to normal mice resulted in a decrease of
erythroid progenitors in bone marrow and spleen (Shiozaki
et al., Proc. Natl. Acad. Sci. USA 89:1553-6, 1992)
demonstrating that follistatin modulates murine
erythropoeisis. In humans, moreover, the follistatin
related gene is a target of chromosonal rearrangement in a
B-cell chronic lymphocytic leukemia (Hayette et al.,
Oncog~ene 16:2949-54, 1998).
EDF-binding proteins such as zfsta2
polypeptides, agonists or antagonists would provide a
useful therapeutic for modulating hematopoiesis and
differentiation of erythroid progenitors. To verify the
presence of this capability, zfsta2 polypeptides and
agonists of the present invention are evaluated with
respect to their ability to alter erythropoiesis by
decreasing erythroid progenitors in bone marrow and
spleen, according to procedures known in the art. zfsta2
CA 02347968 2001-04-10
WO 00/22126 PCT/US99lZ3179
77
antagonists can be evaluated with respect to enhancing
hematopoiesis and differentiation of erythroid progenitors
by inactivating follistatin and follistatin-like
molecules. If desired, zfsta2 performance in this regard
can be compared to other follistatins or hematopoietic
factors such as erythropoietin or thrombopoietin and the
like. In addition, zfsta2 polypeptides or agonists or
antagonists thereof may be evaluated in combination with
one or more follistatins to identify synergistic effects.
The pleiotropic actions of activins and inhibins
on the gonadal/hypothalamic/pituitary axis would indicate
that follistatins, such as zfsta2, would be useful in
treatment of fertility disorders such characterized by
abnormalities in hormone production. Activin A, for
example, has been shown to stimulate hypothalamic
oxytocin secretion (Sawchenko et al., Nature 334:615-7;
1988). Oxytocin specifically stimulates uterine
contraction near term. Proteins which bind activin A
would serve as useful therapeutics for delaying birth in
pre-term pregnancies.
Folliculogenesis is a physiological event
characterized by morphological and functional changes of
the follicle. Of these events, antrum formation is
considered the milestone of this pathway, a process that
is governed by the pituitary hormone FSH. Since FSH is
required for normal function of the ovaries, and activin
is required for activation of FSH synthesis and secretion,
it is not surprising that follistatin is an important
regulator of ovarian function. Follistatin mRNA is
present in primordial follicles and its levels are
dramatically increased in granulosa cells of the growing
secondary or tertiary follicles and then decreases in the
pre-ovulatory follicles (Shimasaki et al., Mol.
Endocrinol. 3:651-9, 1989). Recent in vitro assay systems
have also shown that activin is directly folliculogenic in
immature mice but not in adults, the inhibition of
folliculogenesis in adults was, furthermore, reversed by
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
78
follistatin (Yokota et al., Endocrinoloav 138:4572-6,
1997). The balance between activin and follistatin
appears to be critical for normal ovarian function as
overexpression of mouse follistatin in female transgenic
mice had a number of reproductive defects (Guo et al.,
Mol. Endocrinol. 12: 96-106, 1998). Follistatins, such as
zfsta2, play a role in regulating folliculogenesis by
affecting proliferation or differentiation of follicular
cells, affecting cell-cell interactions, modulating
hormones involved in the process, and the like. The role
of sex steroids, such as FSH, on target tissues and
organs, e.g., uterus, breast, adipose, bones and liver,
has made modulators of their activity desirable for
therapeutic applications. Such applications include
treatments for precocious puberty, endometriosis, uterine
leiomyomata, hirsutism, infertility, pre-menstrual
syndrome (PMS), amenorrhea, and as contraceptive agents.
The level and ratio of gonadotropin and steroid
hormones in the blood can be used to assess the existence
of hormonal imbalances associated with diseases, as well
as determine whether normal hormonal balance has been
restored after administration of a therapeutic agent.
Determination of estradiol, progesterone, LH, and FSH
levels, for example, from serum is known by one of skill
in the art. Such assays can be used to monitor the
effects on hormone levels after administration of zfsta2
in vivo, or in a transgenic mouse model where the zfsta2
gene is expressed or the murine ortholog is deleted.
The zfsta2 polypeptides, agonists and
antagonists of the present invention may be used directly
or incorporated into therapies for treating reproductive
disorders. As a hormone-modulating molecule, zfsta2
polypeptides, agonists and antagonists can have
therapeutic application for treating, for example,
breakthrough menopausal bleeding, as part of a therapeutic
regime for pregnancy support, or for treating symptoms
associated with polycystic ovarian syndrome (PCOS), PMS
CA 02347968 2001-04-10
WO 00/Z2126 PCT/US99/23179
79
and menopause. In addition, other in vi vo rodent models
are known in the art to assay effects of zfsta2
polypeptides, agonists and antagonists on, for example,
polycystic ovarian syndrome (PCOS).
Activin, inhibin and follistatin are also found
in the testes. mRNA encoding follistatin is located in
many germ cells including type B spermatogonia, primary
spermatocytes and spermatids at steps 1 to 11 (Meinhardt
et al., J. Reprod. Fertil. 112:233-41, 1998). It is also
found in Sertoli cells and endothelial cells but not in
Leydig cells. Immunohistochemistry with anti-follistatin
antibodies showed that the protein was localized to
spermatids at all stages and it was also localized to
endothelial and Leydig cells. This widespread
localization, together with follistatin's capacity to
neutralize the activity of activin, suggests that
follistatin modulates spermatogenesis and a range of other
testicular functions. The balance between activin and
follistatin plays an important role in normal reproduction
in males was shown in mouse follistatin transgenic mice:
males exhibited variable degrees of Leydig cell
hyperplasia, spermatogenesis was arrested, and
seminiferous tubules degenerated which lead to
infertility. This suggests that reproductive disorders
due to an excess of activin or other TGF-beta family
members would be amenable to treatment with members of the
follistatin family. Additionally, follistatin antagonists
would be useful in treatment regimes to enhance male
fertility.
In vivo assays for evaluating the effect of
zfsta2 polypeptides, agonists and antagonists on testes
are well known in the art. For example, compounds can be
injected intraperitoneally for a specific time duration.
After the treatment period, animals are sacrificed and
testes removed and weighed. Testicles are homogenized and
sperm head counts are made (Meistrich et al., Exp. Cell
Res. 99:72-78, 1976).
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
Other activities, for example, chemotaxic
activity that may be associated with proteins of the
present invention can be analyzed. For example, late
stage factors in spermatogenesis may be involved in egg-
s sperm interactions and sperm motility. Activities, such
as enhancing viability of cryopreserved sperm, stimulating
the acrosome reaction, enhancing sperm motility and
enhancing egg-sperm interactions may be associated with
the proteins of the present invention. Assays evaluating
10 such activities are known (Rosenberger, J. Androl. 11:89-
96, 1990; Fuchs, Zentralbl Gynakol 11:117-120, 1993;
Neurwinger et al., Androlo is 22:335-9, 1990; Harris et
al., Human Reprod. 3:856-60, 1988; and Jockenhovel,
Androloc~ia 22:171-178, 1990; Lessing et al., Fertil.
15 Steril. 44:406-9 (1985); Zaneveld, In Male Infertility
Chapter 11, Comhaire Ed., Chapman & Hall, London 1996).
These activities are expected to result in enhanced
fertility and successful reproduction.
zfsta2 polypeptides, agonists or antagonists
20 would provide a useful therapeutic for modulating
reproductive hormones. To verify the presence of this
capability, zfsta2 polypeptides, agonists and antagonists
of the present invention are evaluated with respect to
their ability to regulate hormones associated with
25 reproduction, according to procedures known in the art.
For example, Guoqetal, Mol, Endocrinol. 12:96-106, 1998
describes RIA measurement of serum LH, FSH, testosterone,
estradiol, activin and follistatin. Zfsta2 polypeptides
and agonists would be useful for treating male and female
30 reproductive disorders. Zfsta2 antagonists would also be
useful as contraceptives. If desired, zfsta2 performance
in this regard can be compared to other follistatins and
the like. In addition, zfsta2 polypeptides or agonists or
antagonists thereof may be evaluated in combination with
35 one or more follistatins. to identify synergistic effects.
Zfsta2 polypeptides, agonists and antagonists of
the present invention may also be used in applications for
CA 02347968 2001-04-10
WO 00/22126 PCTNS99/23179
81
enhancing fertilization during assisted reproduction in
humans and in animals. Such assisted reproduction methods
are known in the art and include artificial insemination,
in vitro fertilization, embryo transfer, and gamete
intrafallopian transfer. Such methods are useful for
assisting those who may have physiological or metabolic
disorders that prevent or impede natural conception. Such
methods are also used in animal breeding programs, e.g.,
for livestock, racehorses, domestic and wild animals, and
could be used as methods for the creation of transgenic
animals. Zfsta2 polypeptides, agonists or antagonists
could be used in the induction of ovulation, either
independently or in conjunction with a regimen of
gonadotropins or agents such as clomiphene citrate or
bromocriptine (Speroff et al., Induction of ovulation,
Clinical Gvnecoloctic Endocrinology and Infertility, 5'n
ed., Baltimore, Williams & Wilkins, 1994). Zfsta2
polypeptides, agonists and antagonists can also be used in
stimulation of spermatogenesis, independently or in
conjunction with other gonadotropins or sex steroids such
as testosterone. As such, proteins of the present
invention can be administered to the recipient prior to
fertilization or combined with the sperm, an egg or an
egg-sperm mixture prior to in vitro or in vivo
fertilization. Such proteins can also be mixed with
oocytes or sperm prior to cryopreservation to enhance
viability of the preserved tissues for use in assisted
reproduction.
The formation of bone and teeth and is a multi
step process that is known to be initiated and promoted by
members of the TGF-(i superfamily, including TGF-his and
bone morphogenic proteins (BMPs). Accumulating evidence
suggests that activin and follistatin play regulatory
roles in both tooth and bone formation. The temporal
spatial expression of activin and follistatin in pre-
odontoblasts suggests that activin is required for
proliferation of these cells, while odontoblast terminal
CA 02347968 2001-04-10
WO OOlZZ126 PCT/US99/23179
82
differentiation is mediated, at least partly, by
follistatin inactivation of these proliferative effects
(Heikinheimo et al., J. Dent. Res. 76:1625-36; 1997,
Heikinheimo et al., Eur. J. Oral Sci. 106:167-73; 1998).
Follistatin is also expressed in bone (moue et al.,
Calcif. Tiss. Int. 55:395-7, 1994) and activin and
follistatin have been detected by immunohistochemistry in
healing fractures in the rat (Nagamine et al., J.
Orthopaed. Res. 16:314-21, 1998). Follistatin has also
been detected in developing bone and the expression of
follistatin and activin A genes during demineralized bone
matrix-induced endochondral bone development suggests a
cooperative interaction between follistatin and activin
during bone formation (Funaba, et al., Endocrinolocty
137:4250-9, 1996).
Such therapeutic agents may be used for repair
of bone defects and deficiencies, such as those occurring
in closed, open and non-union fractures; prophylactic use
in closed and open fracture reduction; promotion of bone
healing in plastic surgery; stimulation of bone ingrowth
into non-cemented prosthetic joints and dental implants;
elevation of peak bone mass in pre-menopausal women;
treatment of growth deficiencies; treatment of periodontal
disease and defects, and other tooth repair processes;
increase in bone formation during distraction
osteogenesis; and treatment of other skeletal disorders,
such as age-related osteoporosis, post-menopausal
osteoporosis, glucocorticoid-induced osteoporosis,
diabetes-associated osteoporosis or disuse osteoporosis
and arthritis. The compounds of the present invention can
also be useful in repair of congenital, trauma-induced or
surgical resection of bone (for instance, for cancer
treatment), and in cosmetic surgery. Further uses include
limiting or treating cartilage defects or disorders and
stimulation of wound healing and tissue repair.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
83
Well established animal models are available to
test in vivo efficacy of modulators of bone formation.
For example, the hypocalcemic rat or mouse model can be
used to determine the effect of test compounds on serum
calcium, and the ovariectomized rat or mouse can be used
as a model system for osteoporosis. Bone changes seen in
these models and in humans during the early stages of
estrogen deficiency are qualitatively similar.
Molecules that are capable of modulating the
effects of members of the TGF-(3 family, such as zfsta2
polypeptides, agonists or antagonists, would provide
molecules useful for tooth and bone formation. To verify
the presence of this capability, zfsta2 polypeptides,
agonists and antagonists of the present invention are
evaluated with respect to their ability to stimulate tooth
or bone formation according to procedures known in the
art. If desired, zfsta2 performance in this regard can be
compared to other follistatins and the like. In addition,
zfsta2 polypeptides or agonists or antagonists thereof may
be evaluated in combination with one or more follistatins.
to identify synergistic effects.
Follistatin and activin also appear likely to
play a role in the pathogenesis of atherosclerosis. In
vascular wall cells, activin-A has been shown to inhibit
endothelial cell growth and promote smooth muscle cell
growth (Kojima et al., Exp. Cell Res. 206:152-6; 1993,
McCarthy and Bicknell, J. Biol. Chem. 268:23066-71; 1993)
and has been shown to produce a modest inhibition of
scavenger receptor, SRB1, expression and foam cell
formation in THP-1 macrophages (Kozaki et al.,
Arterioscler. Thromb. Vasc. Biol. 17:2389-94; 1997).
These effects are antagonized by follistatin. Activin-A,
follistatin and bone morphogenic protein-2, are produced
by human atherosclerotic lesions and expression of the
first two has been localized to the neointima of the
diseased arteries (Inoue et al., Biochem. Biophvs. Res
Commun. 205:441-8; 1994). These data suggest that the
CA 02347968 2001-04-10
'WO 00/22126 PCT/US99/23179
84
relative balance between activin, and its binding protein,
follistatin, may be important in initiation and
progression of atherosclerotic lesions.
Zfsta2 polypeptides, agonists or antagonists
would be useful for neutralizing the activities of TGF-(3
family members. Such molecules would provide a novel
therapy for treatment of restenosis after angioplasty.
Additionally, TGF-(3 neutralizers would be useful for the
treatment of atherosclerosis. Use of such molecules would
also be applicable for treatment of stroke.
Follistatin and activin appear to play important
roles in development: Two classes of TGF-~i family members
are believed to determine the dorsal/ventral pattern of
the mesoderm in early development in Xenopus laevi. The
first are related to activin and induce the formation of
the dorsal mesoderm, which gives rise to muscle and the
notocord (Asashima et al., Roux's Arch. Dev. Biol.
19,$:330-5, 1990) and the second are related to the bone
morphogenic proteins (BMPs) which inhibit dorsal mesoderm
formation and induce cells to take on ventral fates, such
as blood cells (Maeno et al., Dev. Biol. 161: 522-9,
1994). Follistatin can block the activities of activin
(Fukui et al., Dev. Biol. 159:131-9, 1993) and BMPs
(Iemura et al., Proc. Natl. Acad. Sci. USA 95:9337-42,
1998) in these systems. Taken together, these findings
suggest that zfsta2, as a member of the follistatin family
of TGF-beta binding proteins, may useful as a therapy for
a wide range of developmental disorders.
The effects of zfsta2 can be measured in vitro
using cultured cells or in vivo by administering molecules
of the claimed invention to the appropriate animal model.
For instance, zfsta2 transfected or co-transfected
expression host cells may be embedded in an alginate
environment and injected (implanted) into recipient
animals. Alginate-poly-L-lysine microencapsulation,
permselective membrane encapsulation and diffusion
chambers have been described as a means to entrap
CA 02347968 2001-04-10
WO 00/22126 PCTNS99/23179
transfected mammalian cells or primary mammalian cells.
These types of non-immunogenic "encapsulations" or
microenvironments permit the transfer of nutrients into
the microenvironment, and also permit the diffusion of
5 proteins and other macromolecules secreted or released by
the captured cells across the environmental barrier to the
recipient animal. Most importantly, the capsules or
microenvironments mask and shield the foreign, embedded
cells from the recipient animal's immune response. Such
10 microenvironments can extend the life of the injected
cells from a few hours or days (naked cells) to several
weeks (embedded cells).
Alginate threads provide a simple and quick
means for generating embedded cells. The materials needed
15 to generate the alginate threads are readily available and
relatively inexpensive. Once made, the alginate threads
are relatively strong and durable, both in vitro and,
based on data obtained using the threads, in vivo. The
alginate threads are easily manipulable and the
20 methodology is scalable for preparation of numerous
threads. In an exemplary procedure, 3% alginate is
prepared in sterile H20, and sterile filtered. Just prior
to preparation of alginate threads, the alginate solution
is again filtered. An approximately 50% cell suspension
25 (containing about 5 x 105 to about 5 x 10~ cells/ml) is
mixed with the 3% alginate solution. One ml of the
alginate/cell suspension is extruded into a 100 mM sterile
filtered CaCl2 solution over a time period of "15 min,
forming a "thread". The extruded thread is then
30 transferred into a solution of 50 mM CaCl2, and then into
a solution of 25 mM CaCl2. The thread is then rinsed with
deionized water before coating the thread by incubating in
a 0.01% solution of poly-L-lysine. Finally, the thread is
rinsed with Lactated Ringer's Solution and drawn from
35 solution into a syringe barrel (without needle attached).
A large bore needle is then attached to the syringe, and
CA 02347968 2001-04-10
WO 08/22126 PCT/US99/23179
86
the thread is intraperitoneally injected into a recipient
in a minimal volume of the Lactated Ringer's Solution.
An alternative in vivo approach for assaying
proteins of the present invention involves viral delivery
systems. Exemplary viruses for this purpose include
adenovirus, herpesvirus, vaccinia virus and adeno-
associated virus (AAV). Adenovirus, a double-stranded DNA
virus, is currently the best studied gene transfer vector
for delivery of heterologous nucleic acid (for a review,
see Becker et al., Meth. Cell Biol. 43:161-89, 1994; and
Douglas and Curiel, Science & Medicine 4:44-53, 1997).
The adenovirus system offers several advantages:
adenovirus can (i) accommodate relatively large DNA
inserts; (ii) be grown to high-titer; (iii) infect a broad
range of mammalian cell types; and (iv) be used with a
large number of available vectors containing different
promoters. Also, because adenoviruses are stable in the
bloodstream, they can be administered by intravenous
injection.
By deleting portions of the adenovirus genome,
larger inserts (up to 7 kb) of heterologous DNA can be
accommodated. These inserts can be incorporated into the
viral DNA by direct ligation or by homologous
recombination with a co-transfected plasmid. In an
exemplary system, the essential E1 gene has been deleted
from the viral vector, and the virus will not replicate
unless the E1 gene is provided by the host cell (the human
293 cell line is exemplary). When intravenously
administered to intact animals, adenovirus primarily
targets the liver. If the adenoviral delivery system has
an E1 gene deletion, the virus cannot replicate in the
host cells. However, the host's tissue (e. g., liver) will
express and process (and, if a secretory signal sequence
is present, secrete) the heterologous protein. Secreted
proteins will enter the circulation in the highly
vascularized liver, and effects on the infected animal can
be determined.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
87
Polynucleotides encoding zfsta2 polypeptides are
useful within gene therapy applications where it is
desired to increase or inhibit zfsta2 activity. If a
mammal has a mutated or absent zfsta2 gene, the zfsta2
gene can be introduced into the cells of the mammal. In
one embodiment, a gene encoding a zfst2 polypeptide is
introduced in vivo in a viral vector. Such vectors
include an attenuated or defective DNA virus, such as, but
not limited to, herpes simplex virus (HSV),
papillomavirus, Epstein Barr virus (EBV), adenovirus,
adeno-associated virus (AAV), arid the like. Defective
viruses, which entirely or almost entirely lack viral
genes, are preferred. A defective virus is not infective
after introduction into a cell. Use of defective viral
vectors allows for administration to cells in a specific,
localized area, without concern that the vector can infect
other cells. Examples of particular vectors include, but
are not limited to, a defective herpes simplex virus 1
(HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci.
2:320-30, 1991); an attenuated adenovirus vector, such as
the vector described by Stratford-Perricaudet et al., J.
Clin. Invest. 90:626-30, 1992; and a defective adeno
associated virus vector (Samulski et al., J. Virol.
61:3096-101, 1987; Samulski et al., J. Virol. 63:3822-8,
1989) .
In another embodiment, a zfsta2 gene can be
introduced in a retroviral vector, e.g., as described in
Anderson et al., U.S. Patent No. 5,399,346; Mann et al.
Cell 33:153, 1983; Temin et al., U.S. Patent No.
4,650,764; Temin et al., U.S. Patent No. 4,980,289;
.. , Markowitz et al., J. Virol. 62:1120, 1988; Temin et al.,
U.S. Patent No. 5,124,263; International Patent
Publication No. WO 95/07358, published March 16, 1995 by
Dougherty et al.; and Kuo et al., Blood 82:845, 1993.
Alternatively, the vector can be introduced by lipofection
in vivo using liposomes. Synthetic cationic lipids can be
CA 02347968 2001-04-10
WO 00/22126 PCT/US99123179
88
used to prepare liposomes for in vivo transfection of a
gene encoding a marker (Felgner et al., Proc. Natl. Acad.
Sci. USA 84:7413-7, 1987; Mackey et al., Proc. Natl. Acad.
Sci. USA 85:8027-31, 1988). The use of lipofection to
introduce exogenous genes into specific organs in vivo has
certain practical advantages. Molecular targeting of
liposomes to specific cells represents one area of
benefit. More particularly, directing transfection to
particular cells represents one area of benefit. For
instance, directing transfection to particular cell types
would be particularly advantageous in a tissue with
cellular heterogeneity, such as the pancreas, liver,
kidney, and brain. Lipids may be chemically coupled to
other molecules for the purpose of targeting. Targeted
peptides (e: g., hormones or neurotransmitters), proteins
such as antibodies, or non-peptide molecules can be
coupled to liposomes chemically.
It is possible to remove the target cells from
the body; to introduce the vector as a naked DNA plasmid;
and then to re-implant the transformed cells into the
body. Naked DNA vectors for gene therapy can be
introduced into the desired host cells by methods known in
the art, e.g., transfection, electroporation,
microinjection, transduction, cell fusion, DEAE dextran,
calcium phosphate precipitation, use of a gene gun or use
of a DNA vector transporter. See, e.g., Wu et al., J.
Biol. Chem. 267:963-7, 1992; Wu et al., J. Biol. Chem.
263:14621-4, 1988.
Antisense methodology can be used to inhibit
zfsta2 gene transcription, such as to inhibit cell
proliferation in vivo. Polynucleotides that are
complementary to a segment of a zfsta2-encoding
polynucleotide (e.g., a polynucleotide as set froth in SEQ
ID NO:1) are designed to bind to zfsta2-encoding mRNA and
to inhibit translation of such mRNA. Such antisense
polynucleotides are used to inhibit expression of zfsta2
CA 02347968 2001-04-10
WO 00/22126 PC1'/US99/Z3179
89
polypeptide-encoding genes in cell culture or in a
subject.
Transgenic mice, engineered to express the
zfsta2 gene, and mice that exhibit a complete absence of
zfsta2 gene function, referred to as "knockout mice"
(Snouwaert et al., Science 257:1083, 1992), may also be
generated (Lowell et al., Nature 366:740-42, 1993). These
mice may be employed to study the zfsta2 gene and the
protein encoded thereby in an in vivo system.
The zfsta2 polypeptides are also contemplated
for pharmaceutical use. Pharmaceutically effective
amounts of zfsta2 polypeptides, agonists or zfsta2
antagonists of the present invention can be formulated
with pharmaceutically acceptable carriers for parenteral,
oral, nasal, rectal, topical, transdermal administration
or the like, according to conventional methods.
Formulations may further include one or more diluents,
fillers, emulsifiers, preservatives, buffers, excipients,
and the like, and may be provided in such forms as
liquids, powders, emulsions, suppositories, liposomes,
transdermal patches and tablets, for example. Slow or
extended-release delivery systems, including any of a
number of biopolymers (biological-based systems), systems
employing liposomes, and polymeric delivery systems, can
also be utilized with the compositions described herein to
provide a continuous or long-term source of the zfsta2
polypeptide or antagonist. Such slow release systems are
applicable to formulations, for example, for oral, topical
and parenteral use. The term "pharmaceutically acceptable
carrier" refers to a carrier medium which does not
' interfere with the effectiveness of the biological
activity of the active ingredients and which is not toxic
to the host or patient. One skilled in the art may
formulate the compounds of the present invention in an
appropriate manner, and in accordance with accepted
practices, such as those disclosed in Remincrton's
CA 02347968 2001-04-10
WO 00/22126 PCTlUS99/23179
Pharmaceutical Sciences, Gennaro (ed.), Mack Publishing
Co., Easton, PA 1990.
As used herein a "pharmaceutically effective
amount" of a zfsta2 polypeptide, agonist or antagonist is
5 an amount sufficient to induce a desired biological
result. The result can be alleviation of the signs,
symptoms, or causes of a disease, or any other desired
alteration of a biological system. For example, an
effective amount of a zfsta2 polypeptide is that which
10 provides either subjective relief of symptoms or an
objectively identifiable improvement as noted by the
clinician or other qualified observer. Effective amounts
of the zfsta2 polypeptides can vary widely depending on
the disease or symptom to be treated. The amount of the
15 polypeptide to be administered and its concentration in
the formulations, depends upon the vehicle selected, route
of administration, the potency of the particular
polypeptide, the clinical condition of the patient, the
side effects and the stability of the compound in the
20 formulation. Thus, the clinician will employ the
appropriate preparation containing the appropriate
concentration in the formulation, as well as the amount of
formulation administered, depending upon clinical
experience with the patient in question or with similar
25 patients. Such amounts will depend, in part, on the
particular condition to be treated, age, weight, and
general health of the patient, and other factors evident
to those skilled in the art. Typically a dose will be in
the range of 0.1-100 mg/kg of subject. Doses for specific
30 compounds may be determined from in vitro or ex vivo
studies in combination with studies on experimental
animals. Concentrations of compounds found to be
effective in vitro or ex vivo provide guidance for animal
studies, wherein doses are calculated to provide similar
35 concentrations at the site of action.
CA 02347968 2001-04-10
CVO 00/22126 PCT/US99/23179
91
The dosages of the present compounds used to
practice the invention include dosages effective to result
in the desired effects. Estimation of appropriate dosages
effective for the individual patient is well within the
skill of the ordinary prescribing physician or other
appropriate health care practitioner. As a guide, the
clinician can use conventionally available advice from a
source such as the Physician's Desk Reference, 4g'h
Edition, Medical Economics Data Production Co., Montvale,
New Jersey 07645-1742 (1994).
Preferably the compositions are presented for
administration in unit dosage forms. The term "unit
dosage form" refers to physically discrete units suitable
as unitary dosed for human subjects and animals, each unit
containing a predetermined quantity of active material
calculated to produce a desired pharmaceutical effect in
association with the required pharmaceutical diluent,
carrier or vehicle. Examples of unit dosage forms include
vials, ampules, tablets, caplets, pills, powders,
granules, eyedrops, oral or ocular solutions or
suspensions, ocular ointments, and oil-in-water emulsions.
Means of preparation, formulation and administration are
known to those of skill, see generally Remington's ibid.
The invention is further illustrated by the
following non-limiting examples.
EXAMPLES
Example 1
Extension of EST Sequuence
The novel zfsta2 polypeptide-encoding
polynucleotides of the present invention were initially
identified by querying an EST database for follistatin
homologs. An EST discovered and predicted to be related
to the follistatin family, but lacked complete 5' and 3'
regions . To identify the corresponding full length cDNA,
CA 02347968 2001-04-10
VSO 00/22126 PCT/US99/23179
92
a clone considered likely to contain the missing 3' coding
region was used for sequencing. Using an Invitrogen
S.N.A.P.TM Miniprep kit (Invitrogen, Corp., San Diego, CA)
according to manufacturer's instructions a 5 ml overnight
culture in LB + 50 ~,g/ml ampicillin was prepared. The
template was sequenced on an ABIPRISM TM model 377 DNA
sequences (Perkin-Elmer Cetus, Norwalk, Ct.) using the ABI
PRISMTM Dye Terminator Cycle Sequencing Ready Reaction Kit
(Perkin-Elmer Corp.) according to manufacturer's
instructions. Sequencing reactions were carried out in a
Hybaid OmniGene Temperature Cycling System (National
Labnet Co., Woodbridge, NY). SEQUENCHERTM 3.0 seauence
analysis software (Gene Codes Corporation, Ann Arbor, MI)
was used for data analysis. The resulting 1965 by
sequence provided the 3' end of the zfsta2 cDNA (SEQ ID
N0:7) .
Using fetal brain, brain, spinal cord and retina
MarathonT"' cDNA libraries (Clontech, Palo Alto, CA) as
separate templates and oligonucleotide primer ZC18,415
(SEQ ID N0:5) to the initial EST and oligonucleotide
primer ZC14701 (SEQ ID N0:6) to an internal sequence of
zfsta2 from above, 5' RACE was carried out at 94oC, for
1.5 minutes, followed by 35 cycles at 94oC for 5 seconds
and 66oC for 1.5 minutes, followed by a 10 minute
extension at 72oC. A band of approximately 1255 by (SEQ
ID N0:8) was resolved by gel electrophoresis from each of
the templates. 5' RACE fragments from each of the above
reactions were ligated into a TA vector (Invitrogen Inc,
San Diego, CA) according to manufacturer's instructions.
The sequence of the 5' end of zfsta2 was confirmed from a
fetal brain PCR fragment by sequence analysis as described
above. The 3' EST-derived sequence and the 5' RACE-
derived sequence were joined together through an
overlapping sequence and the complete cDNA sequence of
zfsta2 is disclosed in SEQ ID NO:1.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
93
Example 2
Tissue Distribution
Human Multiple Tissue Northern Blots (MTN I, MTN
II and MTN III; Clontech) were probed to determine the
tissue distribution of human zfsta2 expression. An
approximately 140 by PCR derived probe (SEQ ID N0:4) was
amplified using fetal brain, brain, spinal cord and retina
MarathonT'"' cDNA libraries (Clontech) as templates and
oligonucleotide ZC12881 (SEQ ID N0:9) and ZC12884 (SEQ ID
NO:10) as primers. The amplification was carried out as
follows: 1 cycle at 94°C for 1.5 minutes, 35 cycles of 94°C
for 15 seconds and 60°C 30 seconds, followed by 1 cycle at
72°C for 10 minutes . The PCR products were visualized by
agarose gel electrophoresis and the 140 by PCR product
from fetal brain was purified using a Gel Extraction Kit
(Qiagen, Chatsworth, CA) according to manufacturer's
instructions. The probe was radioactively labeled using
the MULTIPRIME DNA labeling kit (Amersham, Arlington
Heights, IL) according to the manufacturer's instructions.
The probe was purified using a NUCTRAP push column
(Stratagene). EXPRESSHYB (Clontech) solution was used for
prehybridization and as a hybridizing solution for the
Northern blots. Hybridization and washes were done under
appropriately stringent conditions. A strong transcript
of approximately 5 kb was seen in spinal cord and
placenta, and a weaker transcript was detected in brain.
A RNA Master Dot Blot (Clontech) that contained
RNAs from various tissues that were normalized to 8
housekeeping genes was also probed and hybridized as
described above. Expression was seen in the cerebellum,
occipital lobe and pituitary gland.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/Z3179
94
Examt~le 3
Chromosomal Localization
zfsta2 was mapped to chromosome 4 using the
commercially available "GeneBridge 4Radiation Hybrid
Panel" (Research Genetics, Inc.). The GeneBridge 4
Radiation Hybrid Panel contains PCRable DNAs from each of
93 radiation hybrid clones, plus two control DNAs (the HFL
donor and the A23 recipient). A publicly available WWW
server (http://www-genome.wi.mit.edu/cgi-bin/contig/
rhmapper.pl) allows mapping relative to the Whitehead
Institute/MITCenter for Genome Research's radiation hybrid
map of the human genome (the "WICGR" radiation hybrid map)
which was constructed with the GeneBridge 4 Radiation
Hybrid Panel.
For the mapping of zfsta2 with the GeneBridge 4
RH Panel, 20 ~.1 reactions were set up in a 96-well
microtiter plate (Stratagene, La Jolla, CA) and used in a
"RoboCycler Gradient 96" thermal cycler (Stratagene).
Each of the 95 PCR reactions consisted of 2 ~1 lOX PCR
reaction buffer (Clontech) , 1.6 ~.1 dNTPs mix (2.5 mM each,
PERKIN-ELMER, Foster City, CA), 1 ~,1 sense primer, ZC
15,570 (SEQ ID N0:11), 1 ~1 antisense primer, ZC 15,575
(SEQ ID N0:12), 2 ~,1 RediLoad (Research Genetics, Inc.),
0.4 ~.1 50X Advantage KlenTaq Polymerase Mix (Clontech), 25
ng of DNA from an individual hybrid clone or control and
ddH20 for a total volume of 20 ~,1. The reactions were
overlaid with an equal amount of mineral oil and sealed.
The PCR cycler conditions were as follows: an initial 1
cycle 5 minute denaturation at 95°C, 35 cycles of a 1
minute denaturation at 95°C, 1 minute annealing at 62°C and
1.5 minute extension at 72°C, followed by a final 1 cycle
extension of 7 minutes at 72°C. The reactions were
separated by electrophoresis on a 2% agarose gel (Life
Technologies, Gaithersburg, MD).
The results showed that zfsta2 maps 2.84 cR_3000
from the framework marker WI-5113 on the chromosome 4
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
WICGR radiation hybrid map. Proximal and distal framework
markers were WI-5113 and CHLC.GATA4C05.17, respectively.
The use of surrounding markers positions zfsta2 in the
4q28.3 region on the integrated LDB chromosome 4 map (The
5 Genetic Location Database, University of Southhampton, WWW
server:http://cedar.genetics.soton.ac.uk/public html/).
From the foregoing, it will be appreciated that,
although specific embodiments of the invention have been
10 described herein for purposes of illustration, various
modifications may be made without deviating from the
spirit and scope of the invention. Accordingly, the
invention is not limited except as by the appended claims.
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
1
SEQUENCE LISTING
<110> ZymoGenetics. Inc.
<120> FOLLISTATIN RELATED PROTEIN ZFSTA2
<130> 98-50PC
<160> 12
<170> FastSEQ for Windows Version 3.0
<210>1
<211>3192
<212>DNA
<213>Homo Sapiens
<220>
<221> CDS
<222> (58)...(3006)
<400> 1
gaattcggct tcctggggga ttgtgtgact gttaaaataa ggtgaaaagc aataagg atg 60
Met
1
ttt aag tgc tgg tca gtt gtc ttg gtt ctc gga ttc att ttt ctg gag 108
Phe Lys Cys Trp Ser Val Val Leu Val Leu Gly Phe Ile Phe Leu Glu
10 15
tcg gaa gga agg cca acc aaa gaa gga gga tat ggc ctt aaa tcc tat 156
Ser Glu Gly Arg Pro Thr Lys Glu Gly Gly Tyr Gly Leu Lys Ser Tyr
20 25 30
cag cct cta atg aga ttg cga cat aag cag gaa aaa aat caa gaa agt 204
Gln Pro Leu Met Arg Leu Arg His Lys Gln Glu Lys Asn Gln Glu Ser
35 40 45
tca aga gtc aaa gga ttt atg att cag gat ggc cct ttt gga tct tgt 252
Ser Arg Val Lys Gly Phe Met Ile Gln Asp Gly Pro Phe Gly Ser Cys
50 55 60 65
gaa aat aag tac tgt ggt ttg gga aga cac tgt gtt acc agc aga gag 300
Glu Asn Lys Tyr Cys Gly Leu Gly Arg His Cys Val Thr Ser Arg Glu
CA 02347968 2001-04-10
WO 00/22126 PCTNS99/23179
2
70 75 80
aca ggg caa gca gaa tgt gcc tgt atg gac ctt tgc aaa cgt cac tac 348
Thr Gly Gln Ala Glu Cys Ala Cys Met Asp Leu Cys Lys Arg His Tyr
85 90 95
aaa cct gtg tgt gga tct gac gga gaa ttc tat gaa aac cac tgt gaa 396
Lys Pro Val Cys Gly Ser Asp Gly Glu Phe Tyr Glu Asn His Cys Glu
100 105 110
gtg cac aga get get tgc ctg aaa aaa caa aag att acc att gtt cac 444
Val His Arg Ala Ala Cys Leu Lys Lys Gln Lys Ile Thr Ile Val His
115 120 125
aat gaa gac tgc ttc ttt aaa gga gat aag tgc aag act act gaa tac 492
Asn Glu Asp Cys Phe Phe Lys Gly Asp Lys Cys Lys Thr Thr Glu Tyr
130 135 140 145
agc aag atg aaa aat atg cta tta gat tta caa aat caa aaa tat att 540
Ser Lys Met Lys Asn Met Leu Leu Asp Leu Gln Asn Gln Lys Tyr Ile
150 155 160
atg caa gaa aat gaa aat cct aat ggc gac gac ata tct cgg aag aag 588
Met Gln Glu Asn Glu Asn Pro Asn Gly Asp Asp Ile Ser Arg Lys Lys
165 170 175
cta ttg gtg gat caa atg ttt aaa tat ttt gat gca gac agt aat gga 636
Leu Leu Val Asp Gln Met Phe Lys Tyr Phe Asp Ala Asp Ser Asn Gly
180 185 190
ctt gta gat att aat gaa cta act cag gtg ata aaa cag gaa gaa ctt 684
Leu Val Asp Ile Asn Glu Leu Thr Gln Ual Ile Lys Gln Glu Glu Leu
195 200 205
ggc aag gat ctc ttt gat tgt act ttg tat gtt cta ttg aaa tat gat 732
Gly Lys Asp Leu Phe Asp Cys Thr Leu Tyr Ual Leu Leu Lys Tyr Asp
210 215 220 225
gat ttt aat get gac aag cac ctg get ctt gaa gaa ttt tat aga gca 780
Asp Phe Asn Ala Asp Lys His Leu Ala Leu Glu Glu Phe Tyr Arg Ala
230 235 240
ttc caa gtg atc cag ttg agt ctg cca gaa gat cag aaa cta agc atc 828
Phe Gln Val Ile Gln Leu Ser Leu Pro Glu Asp Gln Lys Leu Ser Ile
245 250 255
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
3
act gca gca act gtg gga caa agt get gtt ctg agc tgt gcc att caa 876
Thr Ala Ala Thr Val Gly Gln Ser Ala Val Leu Ser Cys Ala Ile Gln
260 265 270
gga acc ctg aga cct ccc att atc tgg aaa agg aac aat att att cta 924
Gly Thr Leu Arg Pro Pro Ile Ile Trp Lys Arg Asn Asn Ile Ile Leu
275 280 285
aat aat tta gat ttg gaa gac atc aat gac ttt gga gat gat ggg tcc 972
Asn Asn Leu Asp Leu Glu Asp Ile Asn Asp Phe Gly Asp Asp Gly Ser
290 295 300 305
ttg tat att act aag gtt acc aca act cac gtt ggc aat tac acc tgc 1020
Leu Tyr Ile Thr Lys Val Thr Thr Thr His Val Gly Asn Tyr Thr Cys
310 315 320
tat gca gat ggc tat gaa caa gtc tat cag act cac atc ttc caa gtg 1068
Tyr Ala Asp Gly Tyr Glu Gln Val Tyr Gln Thr His Ile Phe Gln Val
325 330 335
aat gtt cct cca gtc atc cgg gtg tat cca gag agt cag get aga gag 1116
Asn Val Pro Pro Val Ile Arg Val Tyr Pro Glu Ser Gln Ala Arg Glu
340 345 350
cct ggg gta act gcc agt ctt agg tgc cat gca gag ggc ata cca aag 1164
Pro Gly Val Thr Ala Ser Leu Arg Cys His Ala Glu Gly Ile Pro Lys
355 360 365
cct cag ctt ggc tgg ttg aag aat gga att gat att aca cca aag ctt 1212
Pro Gln Leu Gly Trp Leu Lys Asn Gly Ile Asp Ile Thr Pro Lys Leu
370 375 380 385
tcc aaa caa ctc acg ctt caa gca aat ggc gca act gtg gga caa agt 1260
Ser Lys Gln Leu Thr Leu Gln Ala Asn Gly Ala Thr Val Gly Gln Ser
390 395 400
get gtt ctg agc tgt gcc att caa gga acc ctg aga cct ccc att atc 1308
Ala Val Leu Ser Cys Ala Ile Gln Gly Thr Leu Arg Pro Pro Ile Ile
405 410 415
tgg aaa agg aac aat att att cta aat aat tta gat ttg gaa gac atc 1356
Trp Lys Arg Asn Asn Ile Ile Leu Asn Asn Leu Asp Leu Glu Asp Ile
420 425 430
CA 02347968 2001-04-10
WO 00/2Z1Z6 PCT/US99/23179
4
aat gac ttt gga gat gat ggg tcc ttg tat att act aag gtt acc aca 1404
Asn Asp Phe Gly Asp Asp Gly Ser Leu Tyr Ile Thr Lys Val Thr Thr
435 440 445
act cac gtt ggc aat tac acc tgc tat gca gat ggc tat gaa caa gtc 1452
Thr His Val Gly Asn Tyr Thr Cys Tyr Ala Asp Gly Tyr Glu Gln Val
450 455 460 465
tat cag act cac atc ttc caa gtg aat gtt cct cca gtc atc cgg gtg 1500
Tyr Gln Thr His Ile Phe Gln Val Asn Val Pro Pro Val Ile Arg Val
470 475 480
tat cca gag agt cag get aga gag cct ggg gta act gcc agt ctt agg 1548
Tyr Pro Glu Ser Gln Ala Arg Glu Pro Gly Val Thr Ala Ser Leu Arg
485 490 495
tgc cat gca gag ggc ata cca aag cct cag ctt ggc tgg ttg aag aat 1596
Cys His Ala Glu Gly Ile Pro Lys Pro Gln Leu Gly Trp Leu Lys Asn
500 505 510
gga att gat att aca cca aag ctt tcc aaa caa ctc acg ctt caa gca 1644
Gly Ile Asp Ile Thr Pro Lys Leu Ser Lys Gln Leu Thr Leu Gln Ala
515 520 525
aat ggc agt gag gtt cac ata agc aat gtg cgc tat gaa gat act gga 1692
Asn Gly Ser Glu Val His Ile Ser Asn Val Arg Tyr Glu Asp Thr Gly
530 535 540 545
gca tac act tgt atc gca aag aat gaa gca gga gtg gat gaa gac atc 1740
Ala Tyr Thr Cys Ile Ala Lys Asn Glu Ala Gly Val Asp Glu Asp Ile
550 555 560
tct tct ctt ttt gtg gaa gac tct get aga aag acc cta get aac ata 1788
Ser Ser Leu Phe Val Glu Asp Ser Ala Arg Lys Thr Leu Ala Asn Ile
565 570 575
tta tgg aga gaa gaa ggt ctg gga att ggg aac atg ttc tat gtt ttt 1836
Leu Trp Arg Glu Glu Gly Leu Gly Ile Gly Asn Met Phe Tyr Val Phe
580 585 590
tat gaa gat gga atc aaa gtg ata caa ccc ata gaa tgt gaa ttt cag 1884
Tyr Glu Asp Gly Iie Lys Val Ile Gln Pro Ile Glu Cys Glu Phe Gln
595 600 605
agg cac att aag cct agt gaa aag ctc ctt gga ttt cag gat gaa gtc 1932
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
Arg His Ile Lys Pro Ser Glu Lys Leu Leu Gly Phe Gln Asp Glu Val
610 615 620 625
tgt ccc aaa get gag gga gat gaa gtt cag agg tgt gtg tgg gca tca 1980
Cys Pro Lys Ala Glu Gly Asp Glu Ual Gln Arg Cys Val Trp Ala Ser
630 635 640
get gtt aat gtc aaa gac aag ttc att tat gtt gca cag cca act ttg 2028
Ala Val Asn Val Lys Asp Lys Phe Ile Tyr Val Ala Gln Pro Thr Leu
645 650 655
gac aga gtc ctt att gtt gat gtg cag tcc caa aaa gtt gtt cag gca 2076
Asp Arg Val Leu Ile Val Asp Val Gln Ser Gln Lys Val Val Gln Ala
660 665 670
gtg agc aca gac cct gtc cca gtt aaa tta cac tat gac aaa tca cat 2124
Val Ser Thr Asp Pro Val Pro Val Lys Leu His Tyr Asp Lys Ser His
675 680 685
gat cag gtc tgg gtg cta agc tgg ggt acc ttg gag aag aca tca cca 2172
Asp Gln Val Trp Val Leu Ser Trp Gly Thr Leu Glu Lys Thr Ser Pro
690 695 700 705
aca cta cag gta att acc ctg gcc agt ggg aat gtg cct cac cac acg 2220
Thr Leu Gln Val Ile Thr Leu Ala Ser Gly Asn Val Pro His His Thr
710 715 720
atc cac acc caa cca gtg gga aag caa ttt gac aga gtg gat gat ttt 2268
Ile His Thr Gln Pro Val Gly Lys Gln Phe Asp Arg Val Asp Asp Phe
725 730 735
ttc att ccc acc aca aca ctc att atc acc cat atg agg ttt gga ttt 2316
Phe Ile Pro Thr Thr Thr Leu Ile Ile Thr His Met Arg Phe Gly Phe
740 745 750
att ctt cat aaa gat gaa get gca cta caa aaa att gat ctt gaa acc 2364
Ile Leu His Lys Asp Glu Ala Ala Leu Gln Lys Ile Asp Leu Glu Thr
755 760 765
atg tca tac atc aag aca att aac ttg aag gac tat aag tgc gtt cct 2412
Met Ser Tyr Ile Lys Thr Ile Asn Leu Lys Asp Tyr Lys Cys Val Pro
770 775 780 785
cag tca ttg gca tat aca cac ttg gga ggc tac tac ttc att ggc tgc 2460
Gln Ser Leu Ala Tyr Thr His Leu Gly Gly Tyr Tyr Phe Ile Gly Cys
CA 02347968 2001-04-10
WO 00/Z2126 PCT/US99/23179
6
790 795 800
aaa cct gac agc acc gga gca gtt tcc cca cag gtc atg gtg gac ggt 2508
Lys Pro Asp Ser Thr Gly Ala Val Ser Pro Gln Val Met Ual Asp Uly
805 810 815
gta act gac tca gtc att ggg ttc aat agt gat gtg acg ggc act cca 2556
Val Thr Asp Ser Val Ile Gly Phe Asn Ser Asp Ual Thr Gly Thr Pro
820 825 830
tat gtc tct cca gat ggc cac tac ctt gtc agc att aat gat gtg aaa 2604
Tyr Val Ser Pro Asp Gly His Tyr Leu Val Ser Ile Asn Asp Val Lys
835 840 845
ggt ctt gta agg gtt cag tac att acc atc aga gga gaa ata cag gag 2652
Gly Leu Val Arg Val Gln Tyr Ile Thr Ile Arg Gly Glu Ile Gln Glu
850 855 860 865
get ttt gat att tac aca aat ctg cac ata tct gat ctg gca ttt caa 2700
Ala Phe Asp Ile Tyr Thr Asn Leu His Ile Ser Asp Leu Ala Phe Gln
870 875 880
cca tcc ttt act gaa gcc cac caa tat aac atc tac ggt agt tca agc 2748
Pro Ser Phe Thr Glu Ala His Gln Tyr Asn Ile Tyr Gly Ser Ser Ser
885 890 895
aca caa act gat gtg ctc ttt gtg gag ctc tct tct ggg aag gtc aag 2796
Thr Gln Thr Asp Val Leu Phe Ual Glu Leu Ser Ser Gly Lys Val Lys
900 905 9i0
atg ata aag agt ctc aag gaa cca ctc aag gca gaa gaa tgg cct tgg 2844
Met Ile Lys Ser Leu Lys Glu Pro Leu Lys Ala Glu Glu Trp Pro Trp
915 920 925
aac cgg aaa aac agg caa atc cag gac agt ggc ttg ttt ggt caa tac 2892
Asn Arg Lys Asn Arg Gln Ile Gln Asp Ser Gly Leu Phe Gly Gln Tyr
930 935 940 945
ctg atg aca cct tcc aag gac tct ctc ttc atc cta gat gga cga ctc 2940
Leu Met Thr Pro Ser Lys Asp Ser Leu Phe Ile Leu Asp Gly Arg Leu
950 955 960
aat aaa tta aac tgt gag atc act gaa gtt gaa aaa gga aat aca gtc 2988
Asn Lys Leu Asn Cys Glu Ile Thr Glu Val G1u Lys Gly Asn Thr Ual
965 970 975
CA 02347968 2001-04-10
WO 00/22126 PCTNS99/23179
7
att tgg gtt gga gat gcc taaaaaccct acgatacaat tattgaatga 3036
Ile Trp Val Gly Asp Ala
980
agcgttttac aatacattgc acttaatcca ttgtttaaat ttacaactta actttccaag 3096
tttatatcct agtcaaacaa aatttacttg gttggtccaa ataaaataaa ttgtttttga 3156
ctaagaaaaa aaaaaaaaaa aaattcctgc ggccgc 3192
<210> 2
<211> 983
<212> PRT
<213> Homo sapiens
<400> 2
Met Phe Lys Cys Trp Ser Val Val Leu Val Leu Gly Phe Ile Phe Leu
1 5 10 15
Glu Ser Glu Gly Arg Pro Thr Lys Glu Gly Gly Tyr Gly Leu Lys Ser
20 25 30
Tyr Gln Pro Leu Met Arg Leu Arg His Lys Gln Glu Lys Asn Gln Glu
35 40 45
Ser Ser Arg Val Lys Gly Phe Met Ile Gln Asp Gly Pro Phe Gly Ser
50 55 60
Cys Glu Asn Lys Tyr Cys Gly Leu Gly Arg His Cys Val Thr Ser Arg
65 70 75 80
Glu Thr Gly Gln Ala Glu Cys Ala Cys Met Asp Leu Cys Lys Arg His
85 90 95
Tyr Lys Pro Val Cys Gly Ser Asp Gly Glu Phe Tyr Glu Asn His Cys
100 105 110
Glu Val His Arg Ala Ala Cys Leu Lys Lys Gln Lys Ile Thr Ile Val
115 120 125
His Asn Glu Asp Cys Phe Phe Lys Gly Asp Lys Cys Lys Thr Thr Glu
130 135 140
Tyr Ser Lys Met Lys Asn Met Leu Leu Asp Leu Gln Asn Gln Lys Tyr
145 150 155 160
Ile Met Gln Glu Asn Glu Asn Pro Asn Gly Asp Asp Ile Ser Arg Lys
165 170 175
Lys Leu Leu Val Asp Gln Met Phe Lys Tyr Phe Asp Ala Asp Ser Asn
180 185 190
Gly Leu Val Asp Ile Asn Glu Leu Thr Gln Val Ile Lys Gln Glu Glu
195 200 205
Leu Gly Lys Asp Leu Phe Asp Cys Thr Leu Tyr Val Leu Leu Lys Tyr
210 215 220
Asp Asp Phe Asn Ala Asp Lys His Leu Ala Leu Glu Glu Phe Tyr Arg
225 230 235 240
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
8
Ala Phe Gln Val Ile Gln Leu Ser Leu Pro Glu Asp Gln Lys Leu Ser
245 250 255
Ile Thr Ala Ala Thr Val Gly Gln Ser Ala Val Leu Ser Cys Ala Ile
200 265 270
Gln Gly Thr Leu Arg Pro Pro Ile Ile Trp Lys Arg Asn Asn Ile Ile
275 280 285
Leu Asn Asn Leu Asp Leu Glu Asp Ile Asn Asp Phe Gly Asp Asp Gly
290 295 300
Ser Leu Tyr Ile Thr Lys Val Thr Thr Thr His Val Gly Asn Tyr Thr
305 310 315 320
Cys Tyr Ala Asp Gly Tyr Glu Gln Val Tyr Gln Thr His Ile Phe Gln
325 330 335
Val Asn Val Pro Pro Val Ile Arg Val Tyr Pro Glu Ser Gln Ala Arg
340 345 350
Glu Pro Gly Val Thr Ala Ser Leu Arg Cys His Ala Glu Gly Ile Pro
355 360 365
Lys Pro Gln Leu Gly Trp Leu Lys Asn Gly Ile Asp Ile Thr Pro Lys
370 375 380
Leu Ser Lys Gln Leu Thr Leu Gln Ala Asn Gly Ala Thr Val Gly Gln
385 390 395 400
Ser Ala Val Leu Ser Cys Ala Ile Gln Gly Thr Leu Arg Pro Pro Ile
405 410 415
Ile Trp Lys Arg Asn Asn Ile Ile Leu Asn Asn Leu Asp Leu Glu Asp
420 425 430
Ile Asn Asp Phe Gly Asp Asp Gly Ser Leu Tyr Ile Thr Lys Val Thr
435 440 445
Thr Thr His Val Gly Asn Tyr Thr Cys Tyr Ala Asp Gly Tyr Glu Gln
450 455 460
Val Tyr Gln Thr His Ile Phe Gln Val Asn Val Pro Pro Ual Ile Arg
465 470 475 480
Val Tyr Pro Glu Ser Gln Ala Arg Glu Pro Gly Ual Thr Ala Ser Leu
485 490 495
Arg Cys His Ala Glu Gly Ile Pro Lys Pro Gln Leu Gly Trp Leu Lys
500 505 510
Asn Gly Ile Asp Ile Thr Pro Lys Leu Ser Lys Gln Leu Thr Leu Gln
515 520 525
Ala Asn Gly Ser Glu Val His Ile Ser Asn Val Arg Tyr Glu Asp Thr
530 535 540
Gly Ala Tyr Thr Cys Ile Ala Lys Asn Glu Ala Gly Ual Asp Glu Asp
545 550 555 560
Ile Ser Ser Leu Phe Val Glu Asp Ser Ala Arg Lys Thr Leu Ala Asn
565 570 575
Ile Leu Trp Arg Glu Glu Gly Leu Gly Ile Gly Asn Met Phe Tyr Val
580 585 590
Phe Tyr Glu Asp Gly Ile Lys Val Ile Gln Pro Ile Glu Cys Glu Phe
CA 02347968 2001-04-10
WO 00/22126 PCTNS99/23179
9
595 600 605
Gln Arg His Ile Lys Pro Ser Glu Lys Leu Leu Gly Phe Gln Asp Glu
610 615 620
Val Cys Pro Lys Ala Glu Gly Asp Glu Val Gln Arg Cys Val Trp Ala
625 630 635 640
Ser Ala Val Asn Vai Lys Asp Lys Phe Ile Tyr Val Ala Gln Pro Thr
645 650 655
Leu Asp Arg Val Leu Ile Val Asp Val Gln Ser Gln Lys Val Ual Gln
660 665 670
Ala Val Ser Thr Asp Pro Ual Pro Val Lys Leu His Tyr Asp Lys Ser
675 680 685
His Asp Gln Val Trp Val Leu Ser Trp Gly Thr Leu Glu Lys Thr Ser
690 695 700
Pro Thr Leu Gln Val Ile Thr Leu Ala Ser Gly Asn Val Pro His His
705 710 715 720
Thr Ile His Thr Gln Pro Val Gly Lys Gln Phe Asp Arg Val Asp Asp
725 730 735
Phe Phe Ile Pro Thr Thr Thr Leu Ile Ile Thr His Met Arg Phe Gly
740 745 750
Phe Ile Leu His Lys Asp Glu Ala Ala Leu Gln Lys Ile Asp Leu Glu
755 760 765
Thr Met Ser Tyr Ile Lys Thr Ile Asn Leu Lys Asp Tyr Lys Cys Val
770 775 780
Pro Gln Ser Leu Ala Tyr Thr His Leu Gly Gly Tyr Tyr Phe Ile Gly
785 790 795 800
Cys Lys Pro Asp Ser Thr Gly Ala Val Ser Pro Gln Ual Met Val Asp
805 810 815
Gly Val Thr Asp Ser Ual Ile Gly Phe Asn Ser Asp Val Thr Gly Thr
820 825 830
Pro Tyr Val Ser Pro Asp Gly His Tyr Leu Ual Ser Ile Asn Asp Val
835 840 845
Lys Gly Leu Ual Arg Val Gln Tyr Ile Thr Ile Arg Gly Glu Ile Gln
850 855 860
Glu Ala Phe Asp Ile Tyr Thr Asn Leu His Ile Ser Asp Leu Ala Phe
865 870 875 880
Gln Pro Ser Phe Thr Glu Ala His Gln Tyr Asn Ile Tyr Gly Ser Ser
885 890 895
Ser Thr Gln Thr Asp Val Leu Phe Val Glu Leu Ser Ser Gly Lys Val
900 905 910
Lys Met Ile Lys Ser Leu Lys Glu Pro Leu Lys Ala Glu Glu Trp Pro
915 920 925
Trp Asn Arg Lys Asn Arg Gln Ile Gln Asp Ser Gly Leu Phe Gly Gln
930 935 940
Tyr Leu Met Thr Pro Ser Lys Asp Ser Leu Phe Ile Leu Asp Gly Arg
945 950 955 960
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
Leu Asn Lys Leu Asn Cys Glu Ile Thr Glu Val Glu Lys Gly Asn Thr
965 970 975
Val Ile Trp Val Gly Asp Ala
980
<210> 3
<211> 2949
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate oligonucleotide sequence encoding the
zfsta2 polypeptide of SEQ ID N0:2.
<221> variation
<222> (1)...(2949)
<223> Each N is independently any nucleotide.
<400> 3
atgttyaart gytggwsngtngtnytngtnytnggnttyathttyytngarwsngarggn60
mgnccnacna argarggnggntayggnytnaarwsntaycarccnytnatgmgnytnmgn120
cayaarcarg araaraaycargarwsnwsnmgngtnaarggnttyatgathcargayggn180
ccnttyggnw sntgygaraayaartaytgyggnytnggnmgncaytgygtnacnwsnmgn240
garacnggnc argcngartgygcntgyatggayytntgyaarmgncaytayaarccngtn300
tgyggnwsng ayggngarttytaygaraaycaytgygargtncaymgngcngcntgyytn360
aaraarcara arathacnathgtncayaaygargaytgyttyttyaarggngayaartgy420
aaracnacng artaywsnaaratgaaraayatgytnytngayytncaraaycaraartay480
athatgcarg araaygaraayccnaayggngaygayathwsnmgnaaraarytnytngtn540
gaycaratgt tyaartayttygaygcngaywsnaayggnytngtngayathaaygarytn600
acncargtna thaarcargargarytnggnaargayytnttygaytgyacnytntaygtn660
ytnytnaart aygaygayttyaaygcngayaarcayytngcnytngargarttytaymgn720
gcnttycarg tnathcarytnwsnytnccngargaycaraarytnwsnathacngcngcn780
acngtnggnc arwsngcngtnytnwsntgygcnathcarggnacnytnmgnccnccnath840
athtggaarm gnaayaayathathytnaayaayytngayytngargayathaaygaytty900
ggngaygayg gnwsnytntayathacnaargtnacnacnacncaygtnggnaaytayacn960
tgytaygcng ayggntaygarcargtntaycaracncayathttycargtnaaygtnccn1020
ccngtnathm gngtntayccngarwsncargcnmgngarccnggngtnacngcnwsnytn1080
mgntgycayg cngarggnathccnaarccncarytnggntggytnaaraayggnathgay1140
athacnccna arytnwsnaarcarytnacnytncargcnaayggngcnacngtnggncar1200
wsngcngtny tnwsntgygcnathcarggnacnytnmgnccnccnathathtggaarmgn1260
aayaayatha thytnaayaayytngayytngargayathaaygayttyggngaygayggn1320
wsnytntaya thacnaargtnacnacnacncaygtnggnaaytayacntgytaygcngay1380
ggntaygarc argtntaycaracncayathttycargtnaaygtnccnccngtnathmgn1440
gtntayccng arwsncargcnmgngarccnggngtnacngcnwsnytnmgntgycaygcn1500
garggnathc cnaarccncarytnggntggytnaaraayggnathgayathacnccnaar1560
CA 02347968 2001-04-10
WO 00/22126 PCT/US99123179
11
ytnwsnaarcarytnacnytncargcnaayggnwsngargtncayathwsnaaygtnmgn1620
taygargayacnggngcntayacntgyathgcnaaraaygargcnggngtngaygargay1680
athwsnwsnytnttygtngargaywsngcnmgnaaracnytngcnaayathytntggmgn1740
gargarggnytnggnathggnaayatgttytaygtnttytaygargayggnathaargtn1800
athcarccnathgartgygarttycarmgncayathaarccnwsngaraarytnytnggn1860
ttycargaygargtntgyccnaargcngarggngaygargtncarmgntgygtntgggcn1920
wsngcngtnaaygtnaargayaarttyathtaygtngcncarccnacnytngaymgngtn1980
ytnathgtngaygtncarwsncaraargtngtncargcngtnwsnacngayccngtnccn2040
gtnaarytncaytaygayaarwsncaygaycargtntgggtnytnwsntggggnacnytn2100
garaaracnwsnccnacnytncargtnathacnytngcnwsnggnaaygtnccncaycay2160
acnathcayacncarccngtnggnaarcarttygaymgngtngaygayttyttyathccn2220
acnacnacnytnathathacncayatgmgnttyggnttyathytncayaargaygargcn2280
gcnytncaraarathgayytngaracnatgwsntayathaaracnathaayytnaargay2340
tayaartgygtnccncarwsnytngcntayacncayytnggnggntaytayttyathggn2400
tgyaarccngaywsnacnggngcngtnwsnccncargtnatggtngayggngtnacngay2460
wsngtnathggnttyaaywsngaygtnacnggnacnccntaygtnwsnccngayggncay2520
tayytngtnwsnathaaygaygtnaarggnytngtnmgngtncartayathacnathmgn2580
ggngarathcargargcnttygayathtayacnaayytncayathwsngayytngcntty2640
carccnwsnttyacngargcncaycartayaayathtayggnwsnwsnwsnacncaracn2700
gaygtnytnttygtngarytnwsnwsnggnaargtnaaratgathaarwsnytnaargar2760
ccnytnaargcngargartggccntggaaymgnaaraaymgncarathcargaywsnggn2820
ytnttyggncartayytnatgacnccnwsnaargaywsnytnttyathytngayggnmgn2880
ytnaayaarytnaaytgygarathacngargtngaraarggnaayacngtnathtgggtn2940
ggngaygcn
2949
<210> 4
<211> 147
<212> DNA
<213> Artificial Sequence
<220>
<223> 147 by probe
<400> 4
ggatttatga ttcaggatgg cccttttgga tcttgtgaaa ataagtactg tggtttngga 60
agacactgtg ttacccagca gagagacagg gcaagcagaa tgtgcctgta tggacctttg 120
caaacgtcac tacaaacctg tgtgtgg 147
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC18415
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
12
<400> 5
cctgggggat tgtgtgactg ttaaa 25
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> 0ligonucleotide ZC14701
<400> 6
ctgccatttg cttgaagcgt gagt 24
<210> 7
<211> 1255
<212> DNA
<213> Artificial Sequence
<220>
<223> 3' end of zfsta2 nucleotide sequence
<400>
7
gaattcggcttcctgggggattgtgtgactgttaaaataaggtgaaaagcaataaggatg60
tttaagtgctggtcagttgtcttggttctcggattcatttttctggagtcggaaggaagg120
ccaaccaaagaaggaggatatggccttaaatcctatcagcctctaatgagattgcgacat180
aagcaggaaaaaaatcaagaaagttcaagagtcaaaggatttatgattcaggatggccct240
tttggatcttgtgaaaataagtactgtggtttgggaagacactgtgttaccagcagagag300
acagggcaagcagaatgtgcctgtatggacctttgcaaacgtcactacaaacctgtgtgt360
ggatctgacggagaattctatgaaaaccactgtgaagtgcacagagctgcttgcctgaaa420
aaacaaaagattaccattgttcacaatgaagactgcttctttaaaggagataagtgcaag480
actactgaatacagcaagatgaaaaatatgctattagatttacaaaatcaaaaatatatt540
atgcaagaaaatgaaaatcctaatggcgacgacatatctcggaagaagctattggtggat600
caaatgtttaaatattttgatgcagacagtaatggacttgtagatattaatgaactaact660
caggtgataaaacaggaagaacttggcaaggatctctttgattgtactttgtatgttcta720
ttgaaatatgatgattttaatgctgacaagcacctggctcttgaagaattttatagagca780
ttccaagtgatccagttgagtctgccagaagatcagaaactaagcatcactgcagcaact840
gtgggacaaagtgctgttctgagctgtgccattcaaggaaccctgagacctcccattatc900
tggaaaaggaacaatattattctaaataatttagatttggaagacatcaatgactttgga960
gatgatgggtccttgtatattactaaggttaccacaactcacgttggcaattacacctgc1020
tatgcagatggctatgaacaagtctatcagactcacatcttccaagtgaatgttcctcca1080
gtcatccgggtgtatccagagagtcaggctagagagcctggggtaactgccagtcttagg1140
tgccatgcagagggcataccaaagcctcagcttggctggttgaagaatggaattgatatt1200
acaccaaagctttccaaacaactcacgcttcaagcaaatggcagaagccgaattc 1255
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
13
<210> 8
<211> 1896
<212> DNA
<213> Artificial Sequence
<220>
<223> 5' end of zfsta2 nucleotide sequence
<400> 8
aagcttggcacgagggcaactgtgggacaaagtgctgttctgagctgtgccattcaagga60
accctgagacctcccattatctggaaaaggaacaatattattctaaataatttagatttg120
gaagacatcaatgactttggagatgatgggtccttgtatattactaaggttaccacaact180
cacgttggcaattacacctgctatgcagatggctatgaacaagtctatcagactcacatc240
ttccaagtgaatgttcctccagtcatccgggtgtatccagagagtcaggctagagagcct300
ggggtaactgccagtcttaggtgccatgcagagggcataccaaagcctcagcttggctgg360
ttgaagaatggaattgatattacaccaaagctttccaaacaactcacgcttcaagcaaat420
ggcagtgaggttcacataagcaatgtgcgctatgaagatactggagcatacacttgtatc480
gcaaagaatgaagcaggagtggatgaagacatctcttctctttttgtggaagactctgct540
agaaagaccctagctaacatattatggagagaagaaggtctgggaattgggaacatgttc600
tatgttttttatgaagatggaatcaaagtgatacaacccatagaatgtgaatttcagagg660
cacattaagcctagtgaaaagctccttggatttcaggatgaagtctgtcccaaagctgag720
ggagatgaagttcagaggtgtgtgtgggcatcagctgttaatgtcaaagacaagttcatt780
tatgttgcacagccaactttggacagagtccttattgttgatgtgcaggatcaggtctgg840
gtgctaagctggggtaccttggagaagacatcaccaacactacaggtaattaccctggcc900
agtgggaatgtgcctcaccacacgatccacacccaaccagtgggaaagcaatttgacaga960
gtggatgattttttcattcccaccacaacactcattatcacccatatgaggtttggattt1020
attcttcataaagatgaagctgcactacaaaaaattgatcttgaaaccatgtcatacatc1080
aagacaattaacttgaaggactataagtgcgttcctcagtcattggcatatacacacttg1140
ggaggctactacttcattggctgcaaacctgacagcaccggagcagtttccccacaggtc1200
atggtggacggtgtaactgactcagtcattgggttcaatagtgatgtgacgggcactcca1260
tatgtctctccagatggccactaccttgtcagcattaatgatgtgaaaggtcttgtaagg1320
gttcagtacattaccatcagaggagaaatacaggaggcttttgatatttacacaaatctg1380
cacatatctgatctggcatttcaaccatcctttactgaagcccaccaatataacatctac1440
ggtagttcaagcacacaaactgatgtgctctttgtggagctctcttctgggaaggtcaag1500
atgataaagagtctcaaggaaccactcaaggcagaagaatggccttggaaccggaaaaac1560
aggcaaatccaggacagtggcttgtttggtcaatacctgatgacaccttccaaggactct1620
ctcttcatcctagatggacgactcaataaattaaactgtgagatcactgaagttgaaaaa1680
ggaaatacagtcatttgggttggagatgcctaaaaaccctacgatacaattattgaatga1740
agcgttttacaatacattgcacttaatccattgtttaaatttacaacttaactttccaag1800
tttatatcctagtcaaacaaaatttacttggttggtccaaataaaataaattgtttttga1860
ctaagaaaaaaaaaaaaaaaaaattcctgcggccgc 1896
<210> 9
<211> 23
CA 02347968 2001-04-10
WO 00/22126 PCT/US99/23179
14
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC12881
<400> 9
ggatttatga ttcaggatgg ccc 23
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC12884
<400> 10
ccacacacag gtttgtagtg ac 22
<210> 11
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC15510
<400> 11
tggacggtgt aactgact 18
<210> 12
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC15575
<400> 12
aagcctcctg tatttctc 18
