Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02361646 2001-07-30
WO 01/30966 PCT/US00/29151
AN ENGINEERED RECOMBINANT MOLECULE THAT REGULATES
HUMORAL AND CELLULAR EFFECTOR FUNCTIONS OF THE IyIMUNE
SYSTEM
Technical Field
Chimeric proteins capable of confering resistance to humoral and cellular
mechanisms of
immune attack and more particularly chimeric proteins having at least a domain
derived from a
complement inhibitor protein and a domain derived from a T-Cell inhibitor
protein are provided.
DNA constructs encoding such chimeric proteins and methods of preparing such
chimeric proteins
are disclosed. Methods of using such chimeric proteins, including in the
prevention or treatment of
rejection of xenotransplants are described.
Background
Chimeric proteins, also referred to in the art as fusion proteins, are hybrid
proteins which
combine at least parts of two or more precursor proteins or peptides. Chimeric
proteins may be
produced by recombinant technology, i.e. by fusing at least a part of the
coding sequence of one
gene to at least a part of the coding sequence of another gene. The fused gene
may then be used to
transform a suitable organism which then expresses the fusion protein.
It is known in the art that T cells, also called T lymphocytes, are a part of
the vertebrate
immune system. T cells recognize foreign pathogens (such as bacteria, viruses,
or parasites),
tissues, and or organs, and help the immune system process them (causing what
is referred to in
the art as a cellular immune response), generally clearing the pathogens from
the bodv. T cell
activation is not only dependent on antigen recognition, but also on
engagement of costimulatory
molecules found on antigen presenting cells (APCs). The costimulatory signal
that determines
whether antigen recognition leads to full T cell activation or to T cell
unresponsiveness, i.e.
anergy, is that generated by the interaction of CD28 on the T cells with B7 on
the APCs; see for
example Harding et al., Nature (1992) 356:607 who demonstrated in vitro that
cross-linking of the
CD28 molecule can rescue T cells from becoming anergic. It is further known
that both B7-1
(CD80) and B7-2 (CD86) molecules on APCs provide critical costimulatory
signals in T cell
activation through their binding with the CD28 molecule on the T cell, and,
moreover, that antigens
presented in the absence of such costimulatory signals results in T cell
anergy.
It is also known in the art that the complement system, (known in the art to
be part of the
humoral immune system) is an interaction of at least 25 plasma proteins and
membrane cofactors
which act in a multistep, multiprotein cascade sequence in conjunction with
other immunological
1
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
systems of the body t~ _~fend against intrusion of foreign cells and vir~ .,s.
Complement
components achieve their immune defensive functions by interacting in a series
of intricate but
precise enzymatic cleavage and membrane binding events. The resulting
complement cascade leads
to the production of products with opsonic, immunoregulatory, and lytic
functions.
CD59 is known to be the archetypical inhibitor of part of the complement
system known as
the C5b-9 membrane attack complex (MAC). When activated and not inhibited the
C5b-9 MAC
can cause potentially deleterious cell activation including cell lysis. CD59
is a human glycoprotein,
the nucleotide and amino acid sequences for which are set forth in Figure 2E1.
CD59 is found
associated with the membranes of cells including human erythrocytes,
lymphocytes, and vascular
endothelial cells. It serves to prevent assembly of functional MACs and thus
protects cells from
complement-mediated activation and/or lysis and is tethered to the outside of
the cell membrane by
a glycosyl-phosphatidylinositol (GPI) anchor. See, for example, Sims et al.,
U.S. Pat. No.
5,135,916.
Both humoral and cellular defense mechanisms mediate the rejection of
transplanted cells,
tissues, and organs during xenotransplantation. The survival of organs and
tissues during
xenotransplantation requires multiple immunosuppressive strategies to inhibit
antibody reactivity,
complement activation, and cellular rejection.
Bi-functional complement inhibitor s including fusion proteins constructed
from the C3
family of inhibitor proteins (such DAF or CD55) and the CSb-9 family of
inhibitor proteins (such
as CD59) are known. See U.S. Patents 5,847,082, 5,624,837, and 5,627,264. It
has been
demonstrated that the CD59 moiety in a DAF-CD59 chimeric molecule functions to
inhibit MAC
when expressed membrane proximal and anchored through its endogenous GPI
linkage. See
Fodor et al., (J. Immunol., 155:4135, 1995).
Various techniques have been investigated to regulate T-cell interactions and
immune
responses mediated by such interactions. It is known that CTLA4 is a T-cell
surface receptor that
associates with the B7-1 (CD80) and B7-2 (CD86) molecules which are expressed
on antigen-
presenting cells. See for example Hancock et al. "Comparative Analysis of B7-1
and B7-2 Co-
Stimulatory Ligands: Expression and Function" J. Exp. Med., 180:631, 1994. It
is further
known that this association establishes the molecular basis for an important T
Cell co-stimulatory
pathway, the primary function of which is to induce T-cell cytokine production
and proliferation
following exposure to antigen. See for example Linsley et al., J. Exp. Med.
173:721-730,1991.
U.S. Patent 5,434,131 identifies the CTLA4 receptor as a ligand for the B7
antigen and discloses
methods for using soluble fusion proteins to regulate immune responses,
including T-cell
interactions. U.S. Patent 5,773,253 provides CTLA4 mutant molecules as ligands
for the B7
antigen and methods for expressing the mutant molecules as soluble functional
molecules which
regulate T-cell interactions. U.S. Patents 5,844,095 and 5,851,795 describe
methods of
expressing CTLA4 as an immunoglobulin fusion protein, methods of preparing
hybrid CTLA4
2
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
fusion proteins, and memods of using the soluble fusion proteins, fragm.;uts
and derivatives
thereof, to regulate cellular immune responses and T-cell interactions. U.S
Patent x,869,050
discloses methods of blocking T-cell activation using anti-B7 monoclonal
antibodies to overcome
allograft transplant rejection and/or graft versus host disease, as well as to
prevent or treat
rheumatoid arthritis.
However, no single molecule exists today which can be used in the prevention
or treatment
of both humoral and cellular rejection of xenotransplants. No such molecules
exist that when
expressed provide the cell with both protection from human serum complement
and inhibit T-cell
activation. Such a molecule would be particularly advantageous in the
production of transgenic
animals. Microinjection of recombinant DNA into the pronuclei of animal ova
for generating
transgenic animals is known. However, since this technology is dependent on
random integration
of DNA, it is a complex procedure to achieve targeted cellular expression of
two distinct
heterologous proteins by the simultaneous microinjection of their respective
DNAs (such as would
be required if CTLA4 inhibitory activity and CD59 inhibitory activity were to
be achieved through
the use of individual entities.)
Moreover, as described above, currently the soluble form of CTLA4 or CTLA4IG
fusion
proteins are used to regulate cellular immune responses and T-cell
interactions. Therefore, it
would be of additional advantage if the CTLA4 moiety could bind endogenously
expressed B7-1
and B7-2 molecules in cis and block the co-stimulation necessary for
engagement of human CD28
expressed on T-cells, thereby protecting the xenotransplanted porcine cell
from the human cellular
immune response by rendering the human T-cells unresponsive to the porcine
target cell.
Summary
Recombinant chimeric molecules that include at least a domain capable of
regulating the humoral effector functions of the immune system and another
domain capable of
regulating the cellular effector functions of the immune system now
surprisingly have been
engineered. Suitable domains capable of regulating the humoral effector
functions of the immune
system include complement inhibitory domains, such as a CSb-9 and/or C3
inhibitory domains.
Suitable domains capable of regulating the cellular effector functions of the
immune system
include T Cell inhibitory domains. In one embodiment, a membrane bound
chimeric molecule
which includes functional domains derived from CTLA4 and CD59 is provided. In
another
embodiment, a membrane bound chimeric molecule which includes functional
domains derived
from CTLA4 and DAF is provided.
Recombinant DNA constructs having DNA sequences encoding the above mentioned
chimeric proteins are provided. Cloning vectors incorporating the above DNA
constructs and cells
transformed with the vectors and host cells containing such vectors are also
provided. Transgenic
3
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
cells, tissues, organs, anu animals incorporating the above-mentioned
ch..neric molecules are
provided.
Methods for preparing a DNA construct including a DNA sequence encoding a CD59
inhibitory domain operably linked to a DNA sequence encoding a T Cell
inhibitory domain are
provided. Also provided are methods of manufacturing the above described
chimeric proteins by
transforming a cell with a suitable cloning vector including a DNA construct
encoding the
chimeric protein, and expressing the gene such that the resulting protein on
the cell membrane.
Brief Description Of The Drawings
Fig. 1 depicts a diagramatic representation of the recombinant chimeric
molecules.
Fig. 2A( 1 ) depicts the DNA used in the cloning of porcine CTLA4 - human CD59
chimeric
molecules.
Fig. 2A(2) depicts the amino acid sequence of porcine CTLA4 - human CD59
chimeric molecules.
Fig. 2B(1) depicts the DNA used in the cloning of human CTLA4 - human CD59
chimeric
molecules.
Fig. 2B(2) depicts the amino acid sequence of human CTLA4 - human CD59
chimeric molecules.
Fig. 2C ( 1 ) depicts the DNA sequence of porcine CTLA4.
Fig. 2C(2) depicts the amino acid sequence of porcine CTLA4.
Fig. 2D( 1 ) depicts the DNA sequence of human CTLA4.
Fig. 2D(2) depicts the amino acid sequence of human CTLA4.
Fig. 2E ( 1 ) depicts the DNA sequence of human CD59.
Fig. 2E(2) depicts the amino acid sequence of human CD59.
Fig. 3 are florescence activated cell sorting (FACS) profiles that demonstrate
the expression
of the CTLA4 and CD59 domains of the chimeric molecules on the cell surface of
transduced PAECs. Cell surface expression of hCC. Drug resistent populations
of
porcine aortic endothelial cells (PAECs) transduced with pBABEhCTLA4-
hCD59 or pBABE vector alone were assayed for expression of CD59 and
CTLA4. Briefly, cells were incubated with l0ug/ml anti CTLA4, ANC152.2
(Ancell, Bayport, MN) or with l0ug/ml of either of the anti-CD59 antibodies,
BRAlOG or MEM43 (Biodesign, Kennebunk, ME) , for 30 min., at 4C, in 0.1 m 1
of Dulbecco's PBS (DPBS) containing 1% Fetal Bovine Serum (FBS) or Bovine
Serum Albumin (BSA). Cells were washed with DPBS before incubation with
FITC conjugated antibodies to mouse IgG (Zymed, So.San Francisco, CA).
Cells were analysed on a Becton Dickenson FACSORT (Becton Dickenson,
Franklin Lakes, NJ). Phosphatidyl inositol phospholipase C (PI-PLC)
enzymatically
cleaves gpi-linked molecules from the surface of cells and therefore should
cleave the
hCTLA4-hCD59 and pCTLA4-hCD59 molecules from the transduced PAECs.
4
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Fig. 4 depicts a FACS analysis that shows the phosphatidyl inositol
phospholipase C (PI-
PLC) mediated removal of CTLA4 and CD59 domains from transduced PAECs. . PI-
PLC
Removal of CC. FACS analysis was performed as described above in Figure 3
with the following exceptions. Drug resistant populations of porcine aortic
endothelial cells (PAECs) transduced with pBABEhCTLA4-hCD59, or
pBABEpCTLA4-hCD59 or pBABE vector alone were assayed for expression of
CD59. Briefly, cells were incubated with l0ug/ml of either of the anti-CD59
antibodies, BRAlOG or MEM43 (Biodesign, Kennebunk, ME) , for 30 min., at
4C, in 0.1 ml of Dulbecco's PBS (DPBS) containing 1% Fetal Bovine Serum
(FBS) or Bovine Serum Albumin (BSA). Cells were washed with DPBS before
incubation with FITC conjugated antibodies to mouse IgG (Zymed, So.San
Francisco, CA). In addition, an aliquot of the cell lines were treated with PI-
PLC, (Boehringer Mannheim GmbH, Indianapolis, IN) at 1U/ml for lhour at
37C, prior to antibody incubations and FACS analysis on a Becton Dickenson
FACSORT (Becton Dickenson, Franklin Lakes, NJ).
Fig. ~ depicts the results of cell killing experiments in which porcine aortic
endothelia cells
(PAECs) that express the chimeric molecules are protected from human serum-
induced
complement-mediated cell lysis. 5 x 10 3 vector control or hCTLA4hCD59 cells
were seeded into the wells of a flat bottom 96 well plate 24 hours ahead of
time. Adherent cells were washed twice using HESS containing 1% BSA.
Cells were sensitized by incubating with a polyclonal anti-PAEC antibody
(Cocalico, Reamstown, PA), followed by incubation with the intracellular dye,
Calcein AM(Molecular Probes, Eugene, OR) in HBSS/BSA for 30 minutes at
37°C. Excess Calcein AM was removed with two additional washes. Normal
human serum complement source (Sigma, St. Louis, MO) was added to a
final concentration of 10, 20, or 40% in 0.05m1 volume diluted in HBSS and
incubated for 1 hour at 37°C. Supernatants containing released calcein
from
complement lysed cells was transferred to a fresh flat bottom microtiter
plate.
The remaining intact cells with retained calcein were lysed using 0.05m1 1
°/a
SDS. Released and retained fractions were read on a cytofluor 2350 (Millipore,
Bedford, MA) at 485nm. Data is presented as percent cell death.
Fig. 6 depicts a FACS analysis that proves that the CTLA4 domain of the
chimeric
molecules interacts with B7 found on the same PAECs. Co-Stimulation Assays.
The
costimulatory capacity of the PAEC was assayed using a modified endothelial
cell
costimulation assay (S. E. Maher, K. Karmann, W. Min, C. C. W. Hughes, J. S.
Pober,
A. L. M. Bothwell. 1996. J. Immunol. 157:3838). 5 x 10 4 pBABE vector controI
(Vector) or hCTLA4hCD59 (CC) PAECs were seeded of a 96 well plates (Becton
Dickenson, Franklin Lakes, NJ) 24 hours prior to co-culturing with T cells.
The following
reagents were added to final concentrations of Sug/ml antiCD28, or antiB7.2;
l0ug/ml
antiCTLA4; or Sug/well sCTLA4Ig. Prior to the costimulation assay, monolayers
were
washed gently with DPBS three times, followed by the addition of 1 x 10 5
Jurkats or T
cells as responder cells in 0.09m1 of RPMI 1640 +FBS, and incubated for 30min
at 37°C.
Phytohemagglutinin (PHA) was added in a O.Olml volume to a final concentration
of
l0ug/ml for 20hrs at 37°C. Cell free supernatants were collected 20
hours post treatment
and assayed by ELISA (R&D Systems, Minneapolis, MN). Plates were read on a
Microplate Reader 350 (Biorad, Hercules, CA) at 485nm. Jurkat supernatents
were tested
undiluted.
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Fig. 7 depicts the human amino acid sequence of DAF.
Detailed Description
It has been found that functional domains capable of regulating the humoral
effector
functions of the immune system including complement inhibitory domains, such
as a CSb-9
inhibitory domains or C3 inhibitory domains, and functional domains capable of
regulating the
cellular effector functions of the immune system, including T Cell inhibitory
domains, can
advantageously be combined to form a chimeric protein. The chimeric protein
can be expressed on
a porcine cell surface and can aid in the protection of the porcine cell,
after xenotransplantation
into a human, from both the human cellular immune response and human
complement.
As used herein. the phrase "CSb-9 inhibitory activity" is used herein to
describe the effects
of CSb-9 inhibitor molecules of the foregoing types on the complement system
and thus includes
activities that lead to inhibition of the cell activating and/or lytic
function of the membrane attack
complex (MAC).
Suitable domains which exhibit CSb-9 inhibitory activity can include the
entire amino acid
sequence for a naturally occurring CSb-9 inhibitor protein or a portion
thereof. For example, the
CSb-9 sequence can be the mature CD59 molecule (i.e., amino acids I through
103 of Fig. 2E(2)
). Alternatively, the CSb-9 sequence can be a portion of a naturally occurring
CSb-9 inhibitor
protein, such as CD59. Active portions suitable for use herein can be
identified using a variety of
assays for CSb-9 inhibitory activity known in the art. See for example
Rollins, et al.. J. Immunol.
144:3478. 1990; Rollins, et al., J. Immunol. 146:2345, 1991; Zhao, et al., J.
Biol. Chem. 266:
13418, 1991; and Rother, et al., J. Virol. 68:730, 1994. In general, the
portion used should have
at least about 25% and preferably at least about 50% of the activity of the
parent molecule.
Suitable C3 inhibitory domains include the entire amino acid sequence for a
naturally
occurring C3 inhibtor or a portion thereof, such as one or more SCRs of the C3
inhibitory domain.
For example, the C3 sequence can be the mature DAF molecule (factor H,
membrane cofactor
protein or complement recepor 1 ). Alternatively, the C3 inhibitory domain can
be a portion of a
naturally occurring C3 inhibitor protein. Following the procedures used to
identify functional
domains of DAF (Adams, et al., 1991. J. Immunol. 147:3005-3011), functional
domains of other
C3 inhibitors can be identified and used herein. In general, the portion used
should have at least
about 25% and preferably at least about 50% of the activity of the parent C3
inhibitory molecule.
Particularly useful portions of mature C3 inhibitor proteins include one or
more of the mature
molecule's SCRs. These SCRs are normally approximately 60 amino acids in
length and have four
conserved cysteine residues which form disulfide bonds, as well as conserved
tryptophan, glycine,
6
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
and phenylalanine/tyrc, ..~e residues. In one embodiment the C3 inhib~. ~
domain includes SCRs
2 through 4 of DAF (i.e. amino acids 97 through 286 shown in figure 7).
Suitable domains which exhibits T Cell inhibitory activity can include either
at least a
portion of the amino acid sequence for naturally occurring porcine CTLA4 or at
least a portion of
the entire amino acid sequence for naturally occurring human CTLA4. For
example, the amino
acid sequence which exhibits T Cell inhibitory activity can be amino acids 38
to 162 of the
porcine CTLA4 sequence shown in Fig. 2C(2) or amino acids 38 to 161 of the
human CTLA4
sequence shown in Fig. 2D(2) In general, the portion used should have at least
about 25% and
preferably at least about SO% of the activity of the parent molecule.
The amino acid sequence having CSb-9 inhibitory activity and the amino acid
secquence
having T Ce(1 inhibitory activity do not have to be directly attached to one
another. A linker
sequence can separate these two sequences. The linker preferably comprises
between about one
and at least about 6 amino. Suitable linker sequences can include glycines.
Other amino acids, as
well as combinations of amino acids, can be used in the linker region if
desired. In one
embodiment, amino acids 153 to 158 of Fig. 2A(2) (GGGGGG in pCC) are the
linker sequence.
In another embodiment, amino acids 152 to 157 of Fig. 2B(2) (SASASA in hCC)
are the linker
sequence.
Another embodiment provides recombinant cDNA that encodes an exon of the human
homologue of CTLA4 is inserted into the coding region of human CD59, bisecting
CD59 between
the leader peptide and the mature peptide post-translational processing site,
see Fig. 2A( 1 ). A
further embodiment provides recombinant cDNA which that encodes an exon of the
porcine
homologue of CTLA4 is inserted into the coding region of human CD59, bisecting
CD59 between
the leader peptide and the mature peptide post-translational processing site,
see Fig. 2B(1). In
both embodiments, the cDNA may include a coding sequence for a GPI anchor
linkage site
corresponding to amino acid 210 of CC and amino acid 77 of native CD59, see
Fig.'s 2A( 1 ) and
2B( 1 ).
Molecules comprising nucleotide sequences encoding the CTLA4 and CD59 or DAF
domains can be prepared using a variety of techniques known in the art. For
example, the
nucleotide sequences encoding the CTLA4 nucleotide # 112-483 and CD59 leader
peptide region
nucleotide 1-75 and mature peptide nucleotide 76-384 domains can be produced
using PCR
generation and/or restriction digestion of cloned genes to generate fragments
encoding amino acid
sequences having T Cell and CSb-9 inhibitory activities. These fragments can
be assembled using
PCR fusion or enzymatic ligation of the restriction digestion products
(Sambrook, et al., Molecular
Cloning: A laboratory manual. 2"d edition. Cold Spring Harbor Press, 1989);
Ausubel et al.
Current Protocols in Molecular Biology. 1991 ). Alternatively, any or all of
the nucleic acid
fragments used to assemble the chimeric genes can be synthesized by chemical
means. In another
7
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
embodiment. the nuclt _.de sequences encoding the CTLA4 and DA>~ ' .pains can
be produced
using PCR generation and/or restriction digestion of cloned genes to generate
fragments encoding
amino acid sequences having T Cell and C3 inhibitory activities. These
fragments also can be
assembled using PCR fusion or enzymatic ligation of the restriction digestion
products (Sambrook.
et al., Molecular Cloning: A laboratory manual. 2"° edition. Cold
Spring Harbor Press. 1989;
Ausubel et al., Current Protocols in Molecular Biology. 1991). Any or all of
the nucleic acid
fragments used to assemble these chimeric genes can be synthesized by chemical
means as well.
In another embodiment, recombinant expression vectors which include nucleic
acid
fragments the chimeric protein are provided. The nucleic acid molecule coding
for such a chimeric
protein can be inserted into an appropriate expression vector, i.e., a vector
that contains the
necessary elements for the transcription and translation of the inserted
protein-encoding sequence.
Suitable host vector systems include. but are not limited to, mammalian cell
systems infected with
virus (e.g., vaccinia virus, adenovirus, retroviruses, etc.); mammalian cell
systems transfected
with plasmids; insect cell systems infected with virus (e.g., baculovirusl;
microorganisms such as
yeast containing yeast expression vectors, or bacteria transformed with
bacteriophage DNA,
plasmid DNA, or cosmid DNA (see. for example, Goeddel, 1990). Commonly used
promoters
and enhancers derived from Polyoma virus, Adenovirus. Simian Virus 40 (SV40),
the Molony
murine leukemia virus (MMLV), including the long terminal repeat (MMLV-LTR),
and human
cytomegalovirus (CMV), including the cytomegalovirus immediate-early gene 1
promoter and
enhancer are suitable. Eukaryotic promotors-BetaActin (Ng et al.) & H2Kb
(Fodor et al. PNAS
1994)
In a preferred embodiment, the cDNA of interest is cloned into a retroviral
vector that is
subsequently transfected into a mouse cell line called a "packaging line." The
manipulation of
retroviral nucleic acids to construct retroviral vectors and packaging cells
is accomplished using
techniques known in the art. See for example Ausubel, et al.. 1992. Volume 1,
Section III
(units 9.10.1-9.14.3); Sambrook, et al., Molecular Cloning: A laboratory
manual. 2"d edition.
Cold Spring Harbor Press, 1989; Miller, et al., Molecular and Cellular Biology
6:2895. 1986;
Eglitis, et al., Biotechniques. 6:608-614. 1988; U.S. Pat. Nos. 4,650,764,
4,861,719,
4,980,289, 5,122,767, and 5,124,263: as well as PCT Patent Publications Nos.
WO 85/05629,
WO 89/07150, WO 90/02797, WO 90/02806, WO 90/13641, WO 92/05266, WO 92/07943,
WO
92/14829, and WO 93/14188. Typically, the retroviral vector contains a gene
that allows for
selection via resistance to drugs such as puromyacin. It also contains nucleic
acid sequence that
allows for random or directed integration of the vector into a eukaryotic
genome. Drug resistant
cell lines are selected. These cells will produce virus particles capable of
infecting other cells lines.
Porcine aortic endothelia cells (PAECs) are infected with the viruses by a
process called viral
transduction. The transduced PAECs are selected for by drug resistance. Drug
resistant cells
8
WO 01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
contain integrated copy ~f the viral vector DNA. Once in the porcine ge,._~ne,
vector sequences or
sequences associated with the chimeric gene control the expression of the
chimeric protein.
In particular, the retroviral vectors of the invention can be prepared and
used as follows.
First, a retroviral vector containing nucleic acid encoding for the chimeric
protein described herein
above is constructed and packaged into non-infectious transducing viral
particles (virions) using an
amphotropic packaging system, preferably one suitable for use in gene therapy
applications.
Examples of such packaging systems are found in, for example, Miller, et al.,
Molecular and
Cellular Biology 6:2895, 1986; Markowitz, et al., J. Virol. 62:1120-1124.
1988; Cosset, et al., J.
Virol. 64:1070-1078. 1999. U.S. Pat. Nos. 4.650,764, 4,861,719. 4,980.289,
5,122.767, and
5,124,263, and PCT Patent Publications Nos. WO 85/05629. WO 89/07150. WO
90/02797, WO
90/02806, WO 90/13641, WO 92/05266, WO 92/07943, WO 92/14829, and WO 93/14188.
A
preferred packaging cell is the PA317 packaging cell line (ATCC CRL 9078.
Rockville, MD). The
Qeneration of "producer cells" is accomplished by introducing retroviral
vectors into the packaging
cells. The producer cells generated by the foregoing procedures are used to
produce the retroviral
vector particles (virions). This is accomplished by culturing of the cells in
a suitable growth
medium. Preferably, the virions are harvested from the culture and
administered to the target cells
which are to be transduced. Examples of such retroviral vectors are found in,
for example,
Korman, et al., Proc. Natl. Acad. Sci. USA. 84:2150-2154. 1987: Morgenstern,
et al.. Nucleic
Acid Research 18:3587. 1990; U.S. Pat. Nos. 4,405,712. 4,980,289, and
5,112,767: and PCT
Patent Publications Nos. WO 85/05629, WO 90/02797, and WO 92/07943. A
preferred retroviral
vector is the MMLV derived expression vector pLXSN (See Miller, et al.,
Biotechniques. 7:981
1989). DNA can be introduce into cells by any standard method of transfection
such as polybrene,
DEAF, calcium phosphate, lipofection. electroporation. (See Sambrook, et al.,
Molecular cloning:
a laboratory manual. Second Edition. Cold Spring Harbor Laboratory Press. Cold
Spring Harbor,
N.Y. 1989 )
Engineered transgenic animals (for example, rodent, e.g., mouse, rat,
capybara, and the
like, lagomorph, e.g., rabbit, hare, and the like, ungulate, e.g., pig, cow,
goat, sheep, and the
like, etc.) that express the chimeric protein described herein on the surfaces
of their cells are
provided using any suitable techniques known in the art. These techniques
include, but are not
limited to, microinjection, e.g., of pronuclei, electroporation of ova or
zygotes, nuclear
transplantation, and/or the stable transfection or transduction of embryonic
stem cells derived from
the animal of choice.
A common element of these techniques involves the preparation of a transgene
transcription
unit. Such a unit includes a DNA molecule which generally includes: 1 ) a
promoter, 2) the nucleic
acid sequence, and 3) a polyadenylation signal sequence. Other sequences, such
as, enhancer and
intron sequences, can optionally be included. The unit can be conveniently
prepared by isolating a
restriction fragment of a plasmid vector which expresses the CTLA4-CD59
protein in, for
9
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
example, mammalian . .s. rreferably. the restriction fragment is free o.
acterially derived
sequences that are known to have deleterious effects on embryo viability and
gene expression.
The most well known method for making transgenic animals is that used to
produce
transgenic mice by superovulation of a donor female, surgical removal of the
egg, injection of the
transgene transcription unit into the pro-nuclei of the embryo, and
introduction of the transgenic
embryo into the reproductive tract of a pseudopregnant host mother, usually of
the same species.
See for example U.S. Pat. No. 4,873,191, Brinster. et al.. 1985. Proc. Natl.
Acad. Sci. USA.
82:4438-4442.. Hogan, et al., in "Manipulating the Mouse Embryo: A Laboratory
Manual". Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1986. , Robertson. 1987.
in Robertson.
ed. "Teratocarcinomas and Embryonic Stem Cells a Practical Approach" IRI.
Press, Eynsham.
Oxford, England, Pedersen, et al., 1990. "Transgenic Techniques in Mice--A
Video Guide", Cold
Spring Harbor Laboratory, Cold Spring Harbor. N.Y.
The use of this method to make transgenic livestock is also widely practiced
by those of
skill in the art. As an example, transgenic swine are routinely produced by
the microinjection of a
transgene transcription unit into pig embryos. See, for example, PCT
Publication No.
W092/11757. In brief, this procedure may, for example, be performed as
follows. First, the
transgene transcription unit is gel isolated and extensively purified through,
for example, an
ELUTIP column (Schleicher & Schuell, Keene, N.H.), dialyzed against pyrogen
free injection
buffer ( 10 mM Tris, pH 7.4+0.1 mM EDTA in pyrogen free water) and used for
embryo injection.
Embryos are recovered from the oviduct of a hormonally synchronized, ovulation
induced sow,
preferably at the pronuclear stage. They are placed into a 1.5 ml microfuge
tube containing
approximately 0.5 ml of embryo transfer media (phosphate buffered saline with
10% fetal calf
serum). These are centrifuged for 12 minutes at 16.OOO×g in a
microcentrifuge. Embryos are
removed from the microfuge tube with a drawn and polished Pasteur pipette and
placed into a 35
mm petri dish for examination. If the cytoplasm is still opaque with lipid
such that the pronuclei are
not clearly visible, the embryos are centrifuged again for an additional 1 S
minutes. Embryos to be
microinjected are placed into a drop of media (approximately 100 µl) in the
center of the lid of a
100 mm petri dish. Silicone oil is used to cover this drop and to fill the lid
to prevent the medium
from evaporating. The petri dish lid containing the embryos is set onto an
inverted microscope
equipped with both a heated stage (37.S°-38° C.) and Hoffman
modulation contrast
optics (200× final magnification). A finely drawn and polished
micropipette is used to
stabilize the embryos while about 1-2 picoliters of injection buffer
containing approximately 200-
500 copies of the purified transgene transcription unit is delivered into the
nucleus, preferably the
male pronucleus, with another finely drawn and polished micropipette. Embryos
surviving the
microinjection process as judged by morphological observation are loaded into
a polypropylene
tube (2 mm m) for transfer into the recipient pseudopregnant sow. Offspring
are tested for the
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
presence of the transgt by Isolating genomic DNA from tissue remov. :rom the
tail of each
piglet and subjecting about ~ micrograms of this genomic DNA to nucleic acid
hybridization
analysis with a transgene specific probe. In a preferred embodiment,
transgenic animals are
produced according to the methods disclosed in PCT Publicaton No. WO/9907829,
the contents of
which are incorporated herein by reference.
Another commonly used technique for generating transgenic animals involves the
genetic
manipulation of embryonic stem cells (ES cells) as described in PCT Patent
Publication No. WO
93/02188 and Robertson, in Robertson. ed. "Teratocarcinomas and Embryonic Stem
Cells a
Practical Approach" IRL Press, Eynsham, Oxford, England 1987. In accordance
with this
technique, ES cells are grown as described in, for example, Robertson. in
Robertson. ed.
"Teratocarcinomas and Embryonic Stem Cells a Practical Approach" IRL Press,
Eynsham.
Oxford, England; 1987, and in U.S. Pat. No. 5,166,06 to Williams et al.
Genetic material is
introduced into the embryonic stem cells by, for example, electroporation
according, for example,
to the method of McMahon, et al., Cell. 62:1073; 1990, or by transduction with
a retroviral vector
according, for example, to the method of Robertson, et al., Nature. 323:445;
1986, or by any of
the various techniques described by in Robertson. ed. "Teratocarcinomas and
Embryonic Stem
Cells a Practical Approach" IRL Press, Eynsham, Oxford, England, 1987.
Chimeric animals are
generated as described, for example, in Bradley, in Robertson. ed.
"Teratocarcinomas and
Embryonic Stem Cells a Practical Approach" IRL Press. Eynsham, Oxford.
England. 1987.
Brietly, genetically modified ES cells are introduced into blastocysts and the
modified blastocysts
are then implanted in pseudo-pregnant female animals. Chimeras are selected
from the offspring,
for example by the observation of mosaic coat coloration resulting from
differences in the strain
used to prepare the ES cells and the strain used to prepare the blastocysts,
and are bred to produce
non-chimeric transgenic animals.
Other methods for the production of transgenic animals are disclosed in U.S.
Pat. No. 5,032,407
and PCT Publication No. W090/08832.
In order that those skilled in the art may be better able to practice the
compositions and
methods described herein, the following examples are given an illustration of
the preparation of
chimeric proteins having both complement inhibitory domains and T Cell
inhibitory domains, as
well as their ability to be expressed on a cell surface of an antigen
presenting cell, bind targets on
the same antigen presenting cell, and exhibit T Cell inhibitory activity. It
is to be understood that
commercially available reagents and/or instrumentation referred to in the
examples were used
according to the manufacturer's instructions unless otherwise indicated.
11
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Example I
Construction of human CTLA4-human CD59 chimeric molecules
A full length human CTLA4 cDNA was isolated from human peripheral blood
leukocytes
(PBLs) that were activated with 3ng/ml phorbol 12 myristate 13 acetate (PMA)
and 0.4ug/ml
ionomycin (commercially available from Sigma, St. Louis. MO). First strand
cDNA synthesized
from PBL RNA using reverse transcriptase as recommended by the
vendor(Seikagaku America,
Inc., Rockville, MD) was used as a template in a polymerase chain reaction
(PCR) to amplify the
extracellular domain encoded by exon 2 (according to methods desrcibed in
Brunet, et al, "A
Differential Molecular Biology Search for Genes Preferentially Expressed in
Functional T
Lymphocytes: The CTLA Genes". Immunol. Rev. 103:? I-36 ( 1988), and Dariavach,
et al,
''Human Ig Superfamily CTLA-4 Gene: Chromosomal Localization and Identity of
Protein
Sequence Between Murine and Human CTLA-4 Cytoplasmic Domains." Eur. J.
Immunol.
18:1901-1905 (1988).). The 5' forward oligonucleotide:
~'GCCTGCAGATGCACGTGGCC3'
and the 3' reverse oligonucleotide;
5'GGCTGCAGGGAGGCGGAGGCGGAGGCGTCAGAATCTGG3', which contained
homologous nucleotides and nucleotide encoding linker sequence, were used in
the following
PCR reaction mixture to amplify a 406 base pair CTLA4 DNA fragment. Five
microliters of a first
strand synthesis of cDNA made from activated PBLs was amplified in the
presence of l OmM
magnesium chloride, SOOmM dNTPs, 2uM oligonucleotides, 2.5 Units Taq
polymerase (Perkin
Elmer, Norwalk, CT) for forty cycles. Each cycle consisted of denaturing for
one minute at 95°C,
annealing at 55°C for one minute, and polymerizing at ?2"C for one
minute. One cycle of
polymerization at 72°C for ten minutes insured the addition of
thymidine overhang for TA cloning.
The CTLA4 exon 2 fragment was ligated into the pCRII.ITOPO vector using the
TOPO TA
cloning kit (commercially available from lnvitrogen, Carlsbad, CA) and used to
transform the TOP
strain of E.Coli (commercially available from Invitrogen, Carlsbad. CA).
Plasmids containing
the appropriately sized fragment were isolated and the inserts were subjected
to DNA sequencing to
confirm the integrity and identity of the DNA ( Wm. Keck Foundation
Biotechnology Resource
Laboratory Yale University, New Haven, CT). Plasmids that contained the
verified CTLA4 exon
2 insert were digested with Pstl and the 406bp CTLA4 exon 2 fragment was
isolated. A GEM7Z
plasmid (commercially available from Clontech, Palo Alto, CA) that contained
the human CD59
sequence (gift from Dr. A. Bothwell, Yale University) that has a unique PstI
site located between
the human CD59 signal sequence and mature protein coding
sequence was digested with PstI. The PstI fragment that contained CTLA4 exon 2
was ligated into
the corresponding PstI site on GEM7Z and plasmids that contained the correct
insert were selected.
A BamHI-EcoRI fragment containing the entire chimeric human CTLA-human CD59
(hCTLA4hCD59) gene was excised from the plasmid and then subcloned into the
amphitropic
retroviral expression vector pBABEpuro (Morganstem, et all to generate the
expression vector
hCTLA4hCD59BABEpuro.
12
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Example II
Cloning of porcine CTLA4
Porcine cDNA was prepared from porcine PBLs that were activated with 3ng/ml
PMA and
0.4ug/ml ionomycin (commercially available from Sigma, St. Louis. MO). The
cDNA was used
as a template in a PCR using redundant primers designed from a comparison of
human t Genbank
accession # NM005214), mouse (X05719), rabbit (D49844), and bovine (X93305)
CTLA4
nucleotide sequences. The 5' foreward oligonucleotide:
5'CCCMYMAGCCATGGCTYYYGG3' together with the 3' reverse oligonucleotide:
~'CCTCARTTRATRGGA4AAAATAAGGTG3' were used in PCR conditions as described
in Example I, except annealing occurred at 4~C, and twenty cycles of
amplification were used.
The PCR produced a 672 base pair fragment that was cloned into the TOPO vector
using the TOPO
TA cloning kit (commercially available from Invitrogen, Carlsbad, CA1. DNA
Sequence analysis
confirmed that the insert was the full-length porcine CTLA~ clone.
Example III
Construction of porcine CTLA4-human CD59 chimeric molecules
The extracellular domain of porcine CTLA4 encoded by exon 2 was PCR
amplified from the TOPO plasmid prepared in Example II using a 5' foreward
oligonucleotide:
5'CCATGCATAT GCACGTGGCC CAGCCTGCAG, and a 3'
oligonucleotide: 5'CATGCATGCC ACCGCCACC GCCACCGAAA TCAGAATCTG
GGCATGGTTC TGGATCAATG3' that contained homologous pCTLA4 sequence restriction
sites and linker sequence using the same PCR conditions as described in
Example I, except that
only 35 cycles of amplification were used to generate a 393 base pair DNA
fragment. The
fragment was cloned into the TOPO vector using the TOPO TA cloning kit
(commercially available
from Invitrogen, Carlsbad, CA). DNA sequence analysis confirmed that the
insert was the porcine
CTLA4 exon 2. The plasmid was digested with Nsi I and the fragment that
contained the CTLA4
exon 2 was isolated and ligated into the PstI site of the GEM7Z plasmid that
contained human
CD59 as described in Example I. The BamEl-EcoRl fragment containing the
chimeric pig CTLA~-
human CD59 molecule (pCTLA4hCD59) was excised from the plasmid and then
subcloned into
the amphitropic retroviral expression vector pBABEpuro (See Morgenstern, et
al., Nucleic Acids
Res. 18:3587 1990.) to generate the expression vector pCTLA4hCD59BABEpuro.
Example IV
Cell surface expression of hCTLA4-hCD59 chimeric molecules
To create a cell line that expresses the human CTLA4-humanCD59 chimeric
molecule a cell
line must be created that produces retroviral vectors that contain the
necessary gene. Another cell
line must then be transduced with the virus to create a population of cells
that express the protein.
To produce the retrovirus, the murine amphitropic packaging cell line PA317
(ATCC, Rochville,
MD) was transfected with the expression vector prepared in Example I
(hCTLA4hCD59BABEpurol , example 3 or BABEpuro (vector control DNA) by the
polybrene
method (See Sambrook, et al., Molecular cloning: a laboratory manual. Second
Edition. Cold
13
CA 02361646 2001-07-30
WO 01/30966 PCT/US00/29151
Spring Harbor Labora..,ry Press, Cold Spring Harbor, N.Y. 1989.) Te,,
micrograms of DNA
were added to PA317 cells in ~ml of Dulbecco minimum essential medium (DMEM) .
available
from Cellgro, Herndon. VA. containing 10% heat inactivated fetal bovine serum
(FBSI followed
by a five hour treatment with 30mg/ml polybrene (Sigma. St.Louis. MO) ,
without a
dimethylsufoxide (DMSO) shock. The cells were washed and incubated in DMEM
with 10% FBS
and 48 hours post transfection, the cells were treated with 3mg/ml puromycin
to select drug
resistant transfectants. The transfected PA317 cells produced retrovirus and
viral supernatents
which were harvested as described by Morgenstern, et al. Land, H. Advanced
mammalian gene
transfer: high titre retroviral vectors with multiple drug selection markers
and a complementary
helper free packaging cell line. 1990. Nucleic Acid Research. 18:3587. The
next step was to
transduce porcine cells to create a porcine cell line that expresses human
CTLA4-humanCD59
protein and the porcine CTLA4-hCD59. Using standard methods 5 x 105 porcine
aortic
endothelial cells (PAEC) were transduced using 1.5 ml of viral supenatent
added to 3.~ ml of
DMEM with 10% FBS followed by the addition of polybrene to 8 mg/ml for 5
hours. Following
transduction the cells were incubated in DMEM with 10% FBS for 48 hours. The
cells were split
into selection medium (DMEM with 10% FBS and 3ug/ml puromycin). Puromycin
resistent cell
populations that express human CTLA4-human CD59 chimeric molecules were
identified by
florescence activated cell sorting (FACS) analysis using antibodies to human
CTLA4 and human
CD59 using standard methodologies (Current Protocols in Immunology, ed. J. E.
Coligan, et al).
Populations of PAEC transduced with hCTLA4hCD59BABEpuro, pCTLA4hCD59 or
BABEpuro
vector alone were assayed for cell surface expression of CD59 and CTLA4 by
FACS analysis
using antibodies to human CTLA4 and human CD59. Briefly, cells were incubated
with l Omg/ml
anti CTLA4 (commercially available from Ancell. Bayport. NIN) for 30 min., at
4°C. in 0. I ml of
Dulbecco's phosphate buffered saline (DPBS) containing 1 % FBS or bovine serum
albumin
(BSA). Cells were washed with DPBS before incubation with FITC conjugated
antibodies to
mouse IgG (commercially available from Zymed, Co., San Francisco, CA). FACS
analysis was
carried out on a Becton Dickenson FACSORT (Becton Dickenson, Franklin Lakes,
NJ) instrument
using standard methodologies ( Current Protocols in Immunology, Ed.
J.E.Coligan). The
pBABEpuro transduced cells were negative for hCTLA4 expression (Figure 3). The
hCTLA4hCD59 PAECs exhibited high level expression of hCTLA4 and hCD59 as
determined by
FACS analysis with antibodies specific to each moiety (Fig. 3 and Fig. 4).
The hCTLA4hCD59 cell line was also treated with PI-PLC and then assayed for
expression
of the chimeric molecule to further demonstrate that the chimeric molecules
were anchored to the
cell surface with a CD59 GPI anchor linkage, by enzymatically cleaving the
CD59 GPI membrane
attachment. Figure 4 illustrates the loss of cell surface expression following
PIPLC treatment, as
indicated by reduced antibody reactivity following enzymatic digestion.
Example V
14
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Cell surface expression. ~i pL rLA4-hCD59 chimeric molecules
Production of a PAEC line to express pCTLA4hCD59 was carried out in the same
manner as
described in Example IV, however the DNA used to transfect the virus producing
cell line was the
expression vector pCTLA4hCD59BABEpuro prepared in Example III. FACS analysis
for cell
surface expression was carried out as described in Example IV. However,
detection of the
pCLTA4 had to be accomplished by a different method because the human specific
anti CTLA4
antibody, ANC152.2, only bound to the human CTLA4 molecule and did not cross
react to the pig
molecule (data not shown). Therefore, the pCTLA4-hCD59 molecule was detected
with the anti
CD59 mAb, BRAIOG or MEM 43 (Biodesign, Kinnebunk. ME). Figure 4 illustrates
CD59
expression on hCTLA4-hCD59 and pCTLA4-hCD59 transduced PAEC.
The pCTLA4hCD59 cell line was also treated with PI-PLC and then assayed for
expression
of the chimeric molecule to demonstrate that the chimeric molecules were
anchored to the cell
surface with a CD59 GPI anchor linkage by cleaving the CD59 GPI membrane
attachment. Fig. 4
illustrates the loss of cell surface expression following PI-PLC treatment.
Both moieties could not
be detected post digestion.
Example VI
Demonstration of human CD59 activity in the hCTLA4-hCD59 chimera
To determine if the CD59 moiety was functional, complement-mediated killing
assays were
performed using normal human serum as a source of complement. PAECs (5 x 103)
transduced
with vector control or hCTLA4hCD59 were seeded into the wells of a flat bottom
96 well plates.
After 24 hours adherent cells were washed twice using Hanks balanced salt
solution (HBSS)
containing 1 % BSA (HBSS/BSA). Cells were sensitized by incubating with a
polyclonal anti-
PAEC antibody ( Cocalico, Reamstown, PA), followed by incubation with the
intracellular dye,
Calcein AM (commercially available from Molecular Probes, Eugene, OR) in
HBSS/BSA for 30
minutes at 37°C. Excess Calcein AM was removed with two additional
washes. Normal human
serum (commercially available from Sigma, St. Louis, MO) was used as a
complement source and
was added to a final concentration of 10%, 20%, or 40% in O.OSmI volume
diluted in HBSS and
the cells were incubated for 1 hour at 37°C. Supernatants containing
released calcein from
complement lysed cells was transferred to fresh flat bottom microtiter plates.
The remaining intact
cells with retained calcein were lysed using O.OSmI 1 % sodium
dodecylphosphate (SDS). The
optical density (OD) at 485 nm was determined for all samples using a
cytofluor 2350
spectrophotometer (commercially available from Millipore, Bedford, MA). The
percent cell death
is determined by comparing the OD obtained from untreated cells to that
obtained from treated
cells. Figure 5 illustrates the percentage of cell death due to increasing
concentrations of human
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
serum. Vector transdu,..;d P.yECs were susceptible to human serum in ~ .pose
dependent manner.
However, hCTLA4hCD59 PAECs were 2-3 fold more resistant to human serum induced
cell lysis
at all concentrations of serum tested as compared to control PAECs.
Example VII
Demonstration of human CTLA4 activity in the hCTLA4-hCD59 chimera
When antigen presenting cells (APC) such as PAECs are co-cultured with Jurkat
cells, a
human T-cell line ATCC TIB 152 or human T cells (responder cells) a
costimulatory signal results
that elicits interleukin 2 (IL-2) production from the responder cells.
Therefore, to test the function
of the hCTLA4 molecule in the context of the chimeric molecule, costimulation
assays were
performed using Jurkat cells as responder cells and vector control,
hCTLA4hCD59 PAECs or
pCTLA4-CD59 as APCs, respectively. The costimulatory capacity of the various
PAECs was
assayed using a modified endothelial cell costimulation assay (as described in
Maher. et al.,
Journal of Immunology, 157:3838 1999 ). PAECs transduced with pBABE vector
control,
hCTLA4hCD59, or pCTLA4-hCD59 were seeded at 5 x 104 cells per well in 96 well
plates
(commercially available from Becton Dickenson, Franklin Lakes, NJ) 24 hours
prior to coculturing
with T cells. The following reagents were added to final concentrations of
Sug/ml for antiCD28,
or antiB72(see for example); l0ug/ml antiCTLA4 (Ancell, Bayport, MN); or
Sug/well
sCTLA4Ig(Ancell, Bayport, MN). Prior to the costimulation assay, monolayers
were washed
gently with DPBS three times, followed by the addition of I x 105 Jurkats or T
cells as responder
cells in 0.09m1 of (spell out RPMI) (RPMI 1640) with FBS, and incubated for
30min at 37°C
PHA, phytohemaglutinin (Sigma L7019) was added in a O.lml volume to a final
concentration of
lOmg/ml for 20hrs, at 37°C. Cell free supernatants were collected 20
hours post treatment and
assayed for IL-2 by enzyme linked immunosorbant assay (ELISA) (commercially
available from
R&D Systems, Minneapolis, MN). Optical density (OD) at 485nm was determined
using a
Microplate Reader 3550 (commercially available from Biorad, Hercules, CA) and
the OD is
proportional to IL-2 production and determined by comparison to a calibration
curve generated
with known amounts of IL-2. Jurkat supenatents were tested undiluted.
IL-2 release from stimulated Jurkat cells is depicted in Figure 6. The amount
of IL-2 elicited
from Junket cells in the presence or absence of pig aortic endothelial cells
as antigen presenting
cells requires primary and secondary stimulatory signals. Without the
secondary co-stimulatory
signal provided by an APC or anti CD28, Jurkats remain unactivated, and
secrete little to no IL2.
The assay utilizes the lectin, phytohemaglutinin (PHA) to cross-link the T
cell receptor complex
and stimulate the primary signal. When both the primary and secondary signals
are provided,
446pg/ml of IL-2 is secreted. If the secondary signal is provided by vector
control PAEC as APC
instead of anti CD28, 406pg/ml IL-2 is secreted. An antibody to pig B7.2
blocks the secondary
signal and therefore IL,-2 production by specifically binding to the B7.2
molecules on the APC
thereby blocking the co-stimulatory second signal. CTLA4 is an alternate
ligand for B7.1 and
16
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
B7.2 and has a ten to twenty told higher binding affinity than CD28.
T~..,refore. using a soluble
form of CTLA4, shCTLA4Ig binds to B7 on PAEC preventing binding of CD28 on
Jurkats
resulting in no secondary signal. If the secondary signal is provided by an
APC bearing the
hCTLA4-hCD59, a huge reduction is seen in the secretion of IL-2 to 69pg/ml,
nearly to levels
attained with anti pB7.2 or shCTLA4. CTLA4 in the chimeric molecule binds B7.2
in cis
preventing Jurkats from CD28 engagement. A blocking antibody to hCTLA4
specifically binds the
CTLA4 mioety of the hCTLA4-hCD59 molecule and prevents it from binding to
pB7.2 on the
CCPAEC surface. B7.2 is therefore available to bind CD28 on Jurkat cells
leading to activation
and IL-2 secretion. HCTLA4-hCD59 is a gpi linked molecule and. can be cleaved
off the cell
surface of the cells by phosphotidyl inositol phospholipase C. When hCTLA4-
hCD59 is removed
the secondary signal is restored, and the Junket cells become activated and
secret IL-2.
REFERENCES
The following references are incorporated herein by reference to more fully
describe the
state of the art. All patent and literature references cited in the present
specification are hereby
incorporated by reference in their entirety.
A. Aruffo, B. Seed. 1987. Molecular cloning of a CD28 cDNA by a high-
efficiency COS cell
expression system. PNAS 84:8573. (cloning CD28)
A. S. B. Edge, M. E. Gosse. J. Dinsmore. 1998. Xenogeneic cell therapy: cur-
rent progress
and future developments in porcine cell transplantation. Cell Transpl. 7:525.
Adams. et al., 1991. "Contribution of the Repeating Domains of Membrane
Cofactor Protein
(CD46) of the Complement System to Liaand Binding and Cofactor Activity"
Journal of
Immunology 147:3005-301 1.
Albrecht, et al., 1992. "Herpesvirus Saimiri Has a Gene Specifying a Homologue
of the
Cellular Membrane Glycoprotein CD59" Virology 190:527-530.
Allen, "Antigen Processing at the Molecular Level", Immunol. Today 8:270-273 (
1987).
Aruffo and Seed, "Molecular Cloning of a CD28 cDNA by a High-Efficiency COS
Cell
Expression System", Proc. Natl. Acad. Sci. 84:8573-8577 (1987).
Auchincioss Jr., H., R. Lee, S. Shea, J. S. Markowitz, M. J. Grusby, L. H.
Glimcher. 1993.
The role of "indirect" recognition in initiating rejection of skin grafts from
major
histocompatibility complex class 11-deficient mice. PNAS 90:3373.
Auchincloss, H. ( 1988) Xenogeneic transplantation. A review. Transplantation
46,1-20.
Auchincloss, H. (1998) Xenogeneic transplantation. Annu. Rev. Immunol. 16.433-
470
B.R. Blazar, P. A. Taylor, A. Panoskaltsis-Mortari. G. S. Gray, D. A. Vallera.
1995.
Coblockade of the LFAI:ICAM and CD28/CTLA4:B7 pathways is a highly effective
means of
preventing acute lethal graft-versus-host disease induced by fully major
histocompatibility
complex- disparate donor grafts. Blood. 9:2607.
17
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Ausubel, F.M., B._.~t, tc., Kingston. R.E., Moore, D.D., Seidma._. J.G.,
Smith. J.A..
Struhl. K. eds., Current Protocols in Molecular Biology. 1991.
Bach. F. H., Turinan, M. A.. Vercelloti. G. M.. Platt. J. L.. and Dalmasso, A.
P. ( 1991
Accomodation: a working paradigm for progressing toward discordant
xenografting.
Transplant. Proc. 23,205-208
Brunet et al., "A Differential Molecular Biology Search for Genes
Preferentially Expressed in
Functional T Lymphocytes: The CTLA Genes", Immunol. Rev. 103:21-36 ( 1988).
Brunet et al., "A New Member of the Immunoalobulin Superfamily-CTLA-s", Nature
328:267-270 ( 1987). ~ .
Byme, G. W., McCurry, K. R., Martin, M. J., McClellan. S. M.. Platt. J. L.,
and Logan, J.
S. ( 1997) Transgenic pigs expressing human CD59 and decay accelerating factor
produce an
intrinsic barrier to complement-mediated daTnage. Transplantation 63, 149-155
C. A. Bravery, P. Batten. M. H. Yacoub, M. L. Rose. 1995. Direct recognition
of SLA- and
HLA- like class 11 antigens on porcine endothelium by human T cells results in
T cell
activation and release of interleukin-2. Transpl. 60:1024.
C. B. Thompson. T. Lindsten. J. A. Ledbetter, S. L. Kunkel, H. A. Young S. G.
Emerson.
J. M. Leiden, C. H. June. 1989. CD28 activation pathway regulates the
production of multiple
T-cell- derived lymphokines/cytokines. PNAS 84:1333. (IL-2 secretion due to
CD281
C. F. Morris. C. J. Simeonovic, M. Fung, J. D. Wilson, A. J. Hapel. 1995.
Intragraft
expression of cytokine transcripts during pig proislet xenograft rejection and
tolerance in mice.
J. Immunol. 154:2470. (CD4+T mediate xenorejectionl
C. H. June. J. A. Ledbetter, P. S. Linsley, C. B. Thompson. 1990. Role of CD28
receptor in
T cell activation. Immunol. Today 1 1:21 1.
Chahine, A. A., M. Yu, M. M. McKeman. C. Stoechert, H. T. Lau. 1995.
Immunomodulation of pancreatic islet allografts in mice with CTLA41 g
secreting muscle cells.
Transpl. 59:1313.
Chen. C. G., Fisicaro, N., Shinkel, T. A., Aitken, V., Katerelos, M., van
Denderen, B. J.
W., Tange, M. J., Crawford. R. J.. Robins. A. J., Pearse. M. J., and D'Apice.
A. J. F.
( 1996) Reduction in Gal- alpha 1.3-Gal epitope expression in transgenic mice
expressing
human Htransferase. Xenotransplantation 3. 69-75
Chen. C. G., Salvaris. E. J.. Romanella, M., Katerelos, M.. Fisicaro, N.,
Aminian, A.,
D'Apice, A. J. F., and A. J., Pearse. M. J. ( 1996) Trans~enic expression of
human
ocl,2fucosyltransferase (H- transferase) prolongs mouse heart survival in an
ex vivo model of
xenograft rejection. Transplantation 6~. 832-837
Clark et al., "Polypeptides on Human B Lymphocytes Associated with Cell
Activation",
Human Immunol. 16:100-113 (1986).
Cohney, S.. McKenzie, 1. F. C., Patton, K.. Prenzoska, J.. Ostenreid, K.,
Fodor, W. I
Costa, C., Zhao, L., DeCesare. S., and Fodor, W. L. Comparative analysis of
three genetic
modifications designed to inhibit human serum-mediated cv_ tolysis.
Xenotransplanration (in
press).
Coligan, J.E.. Kruisbeek, A.M., Margulies. D.H., Shevach, E.M., Strober, W.
eds. 1992.
Current Protocols in Immunology. J.Wiley and Sons, NY.
Cowan" P. J., Chen, C. G., Shinkel, T. A.. Fisicaro, N., Salvaris, E.,
Aminian, A.,
Romanella, M., Pearse, M. J., and D'Apice. A. J. F. (1998) Knock-out of
a1,3-galactosyltransferase or expression of ccl,2-fucosyltransferase further
protects CD55- and
CD59-expressing mouse hearts in an ex vivo model of xenograft rejection.
Transplantation 65.
1599-1604
18
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Coyne et al., 199. Mapping of epitopes, glycosylation sites, and ~~~nplement
regulatory
domains in human decay accelerating factor," Journal of Immunology 149:2906-
2913.
Cozzi, E. Yannoutsos, N., Langford, G. A., Pino-Chavez, G., Wallwork, and
White, D. J.
G. (1997) Effect of transgenic expression of human decay-accelerating factor
on the inhibition
of hyperacute rejection of pig organs. In Xenotransplantation (Cooper. D. K.
C.and Kemp,
E., eds) pp 665-682, Springer-Verlag, Berlin, Heidelberg
Cramer, D. V. ( 1996) Natural antibodies. In Transplantation biology: cellular
and molecular
aspects. (Tilney, N. L., Strom, T. B., Paul, L. C., eds) pp 473-481, Raven
Press, New York
CTLA-4 is a second receptor for the B cell activation antigen B7. J. Exp. Med.
174:561.
Dalmasso. A. P., Vercellotti, G. M., Platt. J. L., and Bach, F. H. ( 1991 )
Inhibition of
complement- mediated endothelial cell cytotoxicity by decay-accelarating
factor.
Tran.spLantation 52, 530-533
Dalmasso, A. P., Vercelotti. G. M., Fischel, R. J., Bolman, R. M. Bach. F. H.,
and Platt, J.
L. ( 1992) Mechanism of complement activation in the hyperacute rejection of
porcine organs in
primate recipients. Arn. JPathol. 140, 1157-1 166
Dalrnasso, A.P. et al. (1991) "Inhibition of complement-mediated endothelial
cell cytotoxicity
by decay-accelerating factor" Transplantation X2(3):530-533.
Damle et al., "Alloantigen-Specific Cytotoxic and Supressor T Lymphocytes are
Derived from
Phenotypically Distinct Precursors", J. Immunol. 131:2296-2300 ( 1983).
Damle et al., "Immunoregulatory T Lymphocytes in Man", J. Immunol. 139:1501-
1508
( 1987).
Damle et al., "Monoclonal Antibody Analysis of Human T Lymphocyte
Subpopulations
Exhibiting Autologous Mixed Lymphocyte Reaction", Proc. Natl. Acad. Sci.
78:5096-5098
(1981).
Dariavach et al., "Human Ig Superfamily CTLA-4 Gene: Chromosomal Localization
and
Identity of Protein Sequence Between Murine and Human CTLA-4 Cytoplasmic
Domains."
Eur. J. Immunol. 18:1901-1905 (1988).
Davies. et al., 1989. "CD59, an LY-6-like protein expressed in human lymphoid
cells.
regulates the action of the complement membrane attack complex on homologous
cells" J. Exp.
Med. 170:637-654.
Davis, E. A., Pruitt, S. K., Greene, P. S., Ibrahim, S., Lam, T. T., Levin, J.
L., Baldwin
I 11, W. M., Sanfilippo, F. ( 1996) Inhibition of complement, evoked antibody,
and cellular
response prevents rejection of pig-to-primate cardiac xenografts.
Transplantation 62. 10181023
Diamond, L. E., McCurry, K. R., Martin, M. J., McClellan, Oldham, E. R.,
Platt. J. L., and
Logan, J. S. ( 1996) Characterization of transgenic pigs expressing
fimctionally active human
CD59 on cardiac endothelium. Transplantation 61, 1241-1249
Fodor, W. L., Williams, B. L., Matis, L. A., Madri, J. A., Rollins, S. A.,
Knight, J. W.,
Velander, W., and Squinto, S. P. (1994) Expression of a functional human
complement
inhibitor in a transgenic pig as a model for the prevention of xenogeneic
hyperacute organ
rejection. Proc. Natl. Acad. Sci. USA 9I. I 1153-11157
Galili, U. ( 1993) Evolution and pathophysiology of the human anti-a-
galactosyl IgG (antiGal)
antibody. SpringerSemin. ImmunopathoL 15,155-171
Gallili U. ( 1997) Anti-agalactosyl (Anti-Gal) antibody damage beyond
hyperacute rejection. In
Xenotransplantation (Cooper, D. K. C.and Kemp, E.. eds) pp 95-103, Springer-
Verlag,
Berlin, Heidelberg
Goodman, D. J., Millan, M. T., Ferran, C., and Bach, F. H. (1997) Mechanisms
of delayed
xenograft rejection. In Xenotransplantation (Cooper, D. K. C.and Kemp, E.,
eds) pp 95-103,
Springer-Verlag, Berlin, Heidelberg
19
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
H. Auchincloss, J. , D. t-~. Sachs. 1998. Xenogeneic transplantatic,, . Ann.
Rev. Immunol.
I 6:433.
Hancock, W. W., M. H. Sayegh, X. Zheng, R. Peach. P. S. Linsley, L. A. Turka.
1996.
Costimulatory function and expression o CD40 ligand. CD80, and CD86 in
vascularized
murine cardiac allograft rejection. PNAS 93:13967.
Harper. K., C. Balzano. E. Rouvier, M. Mattei, M. Luciani. P. Golstein. 1991.
CTLA4
and CD28 activated lymphocyte molecules are closely related in both mouse and
human as
to sequence, message expression, gene structure, and chromosomal location. J.
hmmmol.
147:1037.
Hayes, C. E., and Goldstein, 1. J. (1974) An a-D-galactosyl-binding lectin
from Bandeir-aea
simplicifolia seeds. J BioL Chem. 249. 1904- I 914
Higgins, P.J.,Ko.J.L., Lobell.R., Sardonini,C., Alessi,M.K.. Yeh, C.G. 1997.
J.1. 158:
287281. A soluble chimeric complement inhibitory protein that possesses both
decay-accelerating and factor I cofactor activities.
Inverardi. L., Clissi, B., Stolzer. A. L.. Bender, J. R.. Sandrin. M. S., and
Pardi. R. ( 1997)
Human natural killer lymphocytes directly recognize evolutionary conserved
oliQosaccharide
ligands expressed by xenogeneic tissues. Transplantation 63. 1318-1330
J. A. Bluestone. 1997. Is CTLA-4 a master switch for peripheral T cell
tolerance? J. Irnmunol.
158:1989.
June et al., "T-Cell Proliferation Involving the CD28 Pathway is Associated
with
Cyclosporine-Resistant Interleukin 2 Gene Expression", Mol. Cell. Biol. 7:4472-
4481 ( 1987).
K. lwata, T. Seya, H. Arita, S. Nagasawa. 1994. Expression of a hybrid
complement
regulatory protein, membrane cofactor protein decay accelerating factor on
Chinese hamster
ovary. Comparison of its regulatory effect with those of decay accelerating
factor and
membrane cofactor protein. J. Immunol. 152:3436.
Kalli, K.R. et al. (1991) "Mapping of the C3b-binding Site of CRl and
Constmction of a
(CRl)<sub>2-F</sub>(ab')<sub>2</sub> Chimeric Complement Inhibitor." J. Exp. Med. 174:1451-
1460.
Kennedy, S. P., Rollins, S. A., Burton, W. V., Sims, P. J., Bothwell. A. L.
M., Squinto. S.
P., and Zavoico, G. B. ( 1994) Protection of porcine aortic endothelial cells
ftom
complementmediated cell lysis and activation by recombinant human CD59.
Transplantation
57, 14941501
Kohno et al., "CD28 Molecule as a Receptor-Like Function for Accessory Signals
in Cell-
Mediated Augmentation of IL-2 Production", Cell Immunol. 131:1-10 ( 1990).
Koike, C., Kannagi, R., Takuma, Y., Akutsu. F., Hayashi. S., Hiraiwa, N.,
Kadomatsu, T.,
Murainatsu, T., Yarnakawa, H., Nagai, T., Kobayashi. S., Okada, H., Nakashima,
L,
Uchida, K., Yokoyama, L, and Takagi, H. (1996) Introduction of cc(1,2)-
fticosyltransferase
and its effect on (x-Gal epitopes in transgenic pig. Xenotransplantation 3. 81-
86
Kroshus, T. J., Bohnan I 11, R. M., Dalmasso, A. P., Rollins, S. A.,
Guilmette, E. R.,
Williarns, B. L., Squinto, S. P., and Fodor. W. L. ( 1996) Expression of human
CD59 in
transgenic pig organs enhances organ survival in an ex vivo xenogeneic
perftision model.
Transplantation 61, 1513- 1521
Lafage-Pochitaloff et al., "Human CD28 and CTLA-4 Ig Superfamily Genes are
Located on
Chromosome 2 at Bands q33-q34", Immunogenetics 31:198-201 (1990).
Lambrigts, D., Sachs, D. H., and Cooper. D. K. C. ( 1998) Discordant organ
xenotransplantation in primates. Transplantation 66, 547-561
Larsen. C. P., E. T. Elwood, D. Z. Alexander, S. C. Ritchie, R. Hendrix, C.
Tucker-Burden,
H. R. Cho, A. Aruffo, D. Hollenbaugh, P. S. Linsley, K. J. Wino, T. C.
Pearson. 1996.
Long -terrn acceptance of skin and cardiac allografts after blocking CD40 and
CD28 pathways.
Nature 381:434.
CA 02361646 2001-07-30
WO 01/30966 PCT/US00/29151
Larsen, R. D., Ri _ra-mlarrero, C. A., Emst, L. K., Cummings, _ D., and Lowe,
J. B.
(1990) Frameshift and non sense mutations in a human genomic sequence
homologous to a
murine UDP- GaI:B-D-Gal 1,4-D-GIcNAccd,3-galactosyl transferase eDNA. J BioL
Chem.
265, 7055-7061
Ledbetter et al., "CD28 Ligation in T-Cell Activation: Evidence for Two Signal
Transduction
Pathways", Blood 75:1531-1539 (1990).
Ledbetter et al., "Crosslinking of Surface Antigens Causes Mobilization of
Intracellular Ionized
Calcium in T Lymphocytes", Proc. Natl. Acad. Sci. 84:1384-1388 (1987).
Lehto, T. et al. ( 1993) "Interactions of soluble CD59 with the terminal
complement complexes"
J. Immunol. 151 (9 ):494 I -4949.
Lenschow, D. J., Y. Zeng, J. R. Thistlethwaite, A. Montag, W. Brady, M. G.
Gibson. P. S.
Linsley, J. A. Bluestone. 1992. Long-terrn survival of xenogeneic pancreatic
islet ~afts
induced by CTLA4Ig. Sci 257:789.
Lesslauer et al., "T90/44 (9.3 Antigen), A Cell Surface Molecule with a
Function in Human T
Cell Activation", Eur. J. Immunol. 16:1289-1296 (1986).
Leventhal, J. R.. Dahnasso, A. P., Cromwell, J. W.. Platt. J. L.. Manivel. C.
J.. Bolman
1 11, R. M., and Matas, A. J. ( 1993) Prolongation of cardiac xenograft
survival by depletion
of complement. Transplantation 55, 857-866
Leventhal, J. R., John, R., Fryer, J. P., Witson. J. C., Derlich, J. -M..
Remiszewski, J.,
Dalmasso. A. P., Matas, A. J.. Bolman 1 11. R. M. ( 1995) Removal of baboon
and human
antiporcine IgG and IgM natural antibodies by immunoabsotption.
Transplantation ~9,
294-300
Leventhal, J. R., Sakiyalak, P., Witson, J., Simone, P., Matas, A. J., Bohnan.
R. M., and
Dalmasso, A. P. ( 1994) The synergistic effect of combined antibody and
complement depletion
on discordant cardiac xenograft survival in nonhuman primates. Transplantation
57,974-978
Lin, S. S.. Weidner, B. C., Byme. G. W., Diamond, L. E.. Lawson. J. H.,
Hoopes, C. W..
Daniels, L. J., Dagget, C. W., Parker. W., Harland, R. C.. Davis, R. D.,
Bollinger, R. R.,
Logan, J. S., and Platt. J. L. ( 1998) The role of antibodies in acute
vascular resection of
pigto-baboon cardiac transplants. J Clin. Invest. 101, 1745-1756
Lindsten. T.. K. P. Lee, E. S. Harris. B. Petryniak, N. Craighead. P. J.
Reynolds. D. B.
Lombard, G.J. Freeman. L. M. Nadler, G. S. Gray, C. B. Thompson. C. H. June.
1993. J.
hnmunol. 151:3489.
Linsley et al., "Binding of the B Cell Activation Antigen B7 to CD28
Costimulates T Cell
Proliferation and Interleukin 2 mRNA Accumulation", J. Exp. Med. 173:721-730 (
1991 ).
Linsley et al., "T-Cell Antigen CD28 Mediates Adhesion with B Cells by
Interacting with
Activation Antigen B7BB-1", Proc. Natl. Acad. Sci. USA, 87:5031-5035 (1990).y
Lu, C. Y., Khair-El-Din, T., Dawidson, I. A., Butler, T. M., Brasky, K. M.,
Vazquez, M.
A., Sicher, S. C. (1994). Xenotransplantation. FASEB J 8, 1122-1130
Lublin, et al., "Decay-accelerating factor: Biochemistry, molecular biology,
and function,"
Ann. Rev. Immunol., 7:35-38, 1989.
Lublin, et al., "Molecular cloning and chromosomal localization of human
membrane cofactor
protein (MCP)," J. Exp. Med., I 68:181- I 94, I 988.
Lublin, et al., "Phospholipid-anchored and Transmembrane Versions of Either
Decay-
accelerating Factor or Membrane Cofactor Protein Show Equal Efficiency in
Protection from
Complement-mediated cell Damage," J. Exp. Med., 174:35-44, 1991.
21
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Marengere, Wate. ruse, Duncan, Mittrucker. Feng, T. Mak. 199f.. .cience
272:1170.
Matsumoto, L, and Osawa, T. (1969) Purification and characterization of an
antiH(O)
phytohemagglutinin of Ulex europeus. Biochim. Bioplays. Acta 194,180-189
McCurry, K. R., Kooyman, D. L., Alvarado, C. G., Cotterel, A. H., Martin, M.
J., Logan,
J. S., and Plaft, J. L. (1995) Human complement regulatory proteins protect
swine-to primate
cardiac xenografts from humoral injury. Nat. Med. 7, 423-427
Meri, et al., 1990. "Human protectin (CD59), an 18,000-20,000 MW complement
lysis
restricting factor, inhibits C5b-8 catalysed insertion of C9 into lipid
bilayers" Immunology
71:1-9.
Miller, A.D., Buttimore, C. Redesign of retrovirus packaging cell lines to
avoid recombination
leading to helper virus production. Molecular and Cellular Biology 6:2895-
2902, 1986.
Miyagawa, S., Shirakura, R., lwata, K., Nakata, S., Matsumiya, G., Izutani.
H., Matsuda,
H., Terado, A., Matsumoto, M., Nagasawa, S., and Seya, T. (1994) Effects of
transfected
complement regulatory proteins, MCP, DAF, and MCP/DAF hybrid, on
complementmediated
swine endothelial cell lysis. Transplantation 58, 834-840
Moran, et al., 1992. "Human recombinant soluble decay accelerating factor
inhibits
complement activation in vitro and in vivo," J. Immunol. 149:1736-1743.
Morganstern, J.P., Land, H. Advanced mammalian gene transfer: high titre
retroviral vectors
with multiple drug selection markers and a complementary helper free packaging
cell line.
1990. Nucleic Acid Research. 18:3587.
Norris, et al., 1993. "Structure-Function Relationships of CD59," Blood, 82
(Suppl.):202a.
O'Hair, D. P., McManus, R. P., Komorowski, R. (1994) Inhibition of chronic
rejection in
primate cardiac xenografts using mycophenolate mofetil. Ann. Thorac. Surg. 58,
1311-1315
Okada, et al., 1989. "Monoclonal antibodies capable of causing hemolysis of
neuraminidase-
treated human erythrocytes by homologous complement" J. Immunol. 143:2262-
2266.
P. M. Wallace, J. S. Johnson, J. F. MacMaster, K. A. Kennedy, P. Gladstone. P.
S. Linsley.
1994. CTLA4Ig treatment ameliorates the lethality of murine graft-versus-host
disease across
major histocomatibility complex barriers. Transpl. 58:602. (ms is better on ms
than hu
CTLA41 g)
P. S. Linsley, W. Brady, M. Umes, L. S. Grosmaire, N. K. Dainle, J. A.
Ledbetter. 1991.
Pearson, T. C., D. Z. Alexander, K. J. Winn, P. S. Linsley, R. P. Lowry, C. P.
Larsen.
1994. Transplantation tolerance induced by CTLA4-1 a. Transpl. 57:1701.
Perkins et al., 1988. "A Study of the Structure of Human Complement Component
Factor H
by Fourier Transform Infared Spectroscopy and Secondary Structure Averaging
Methods,"
Biochemistry, 27:4004-4012.
Petranka, et al., 1993. "The Structure and Function of CD59: The Importance of
the Disulfide
Structure and Identification of a Primary Epitope," Molec. Immunol. 30 (suppl.
1):44.
Philbrick, et al., 1990. "The CD59 antigen is a structural homologue of murine
Ly-6 antigens
but lacks interferon inducibility" Eur. J. Immunol. 20:87-92.
Platt, J. L., and Bach, F. H. (1991) Discordant xenografting: challenges and
controversies.
Curr. Opin. Immun. 3, 735-739
Pruitt, S. K., Kirk, A. D., Bollinger, R. R.. Marsh, H. C. Jr., Collins, B.
H., Levin, J. L.,
Mault, J. R., Heinle, J. S., Ibrahim, S., Rudolph, A. R., Baldwin 111, W. M.,
and
Sanfilippo, F. (1994) The effect of soluble complement receptor type I on
hyperacute rejection
of porcine xenografts. Transplantation 57, 363-370
R. H. Schwartz. 1989. Clonal expansion vs. functional clonal inactivation: a
costimulatory
signalling pathway determines the outcome of T cell antigen receptor
occupancy. Annu. Rev.
Immunol. 7:445. (Signal two)**
22
CA 02361646 2001-07-30
WO 01/30966 PCT/US00/29151
R. H. Schwartz. 1~,~. C:ostimulation of T lymphocytes: The role o, ~D28. CTLA-
4, and
B7BB I in interleukin-2 production and immunotherapy. Cell 71:1065. (rev)
Rollins, et al., 1990. "The complement-inhibitory activity of CD59 resides in
its capacity to
block incorporation of C9 into membrane C5b-9" J. Immunol. 144:3478-3483.
Rollins, et al., 1991, "Inhibition of homologous complement by CD59 is
mediated by a
species-selective recognition conferred through binding to C8 within C5b-8 or
C9 within C5b-
9" J. Immunol. 146:2345-2351.
Ross, S. C., and Densen, P. (1984) Complement deficiency states and infection:
epidemiology, pathogenesis and consequences of Neisserial and other infections
in an immune
deficiency. Medicine 63, 243-273
Rother, et al.. 1994. "Inhibition of Complement-Mediated Cytolysis by the
Terminal
Complement Inhibitor of Herpesvirus Saimiri," J. Virol. 68:730-737.
S. A. Rollins, S. P. Kennedy, A. J. Chodera, E. A. Elliott. G. B. Zavoico, L.
A. Matis.
1994. Evidence that activation of human T cells by porcine endothelium
involves direct
recognition of porcine SLA and costimulation by porcine ligands for LFA-1 and
CD2.
Transp1.57:1709.
S. E. Maher, K. KarTnann, W. Min, C. C. W. Hughes, J. S. Pober, A. L. M.
Bothwell.
1996. Porcine endothelial CD86 is a major costimulator of xenogeneic human T
cells. J.
Immunol. 157:3838.
Saadi, S., and Platt, J. L. ( 1995) Transient perturbations of endothelial
integrity induced by
natural antibodies and complement. J Exp. Med. 181. 21-31
Sambrook, J., Fritsch, E.F., and T. Maniatis. 1989. Molecular Cloning: A
laboratory manual.
2"a edition. Cold Spring Harbor Press.
Sandrin, M. S. (1997) Down-regulation of Galcc(1,3)Gal expression by alpha
l,2fucosyltransferase. Further characterization of alpha I?-fucosyltransferase
transgenic mice.
Transplantation 64, 495-500
Sandrin, M. S., Fodor, W. L., Mouhtouris. E., Osman, N., Cohney, S., Rollins,
S. A.,
Guilmette, E. R., Setter, E., Squinto, S. P., and McKenzie, 1. F. C. ( 1995)
Enzymatic
remodelling of the carbohydrate surface of a xenogenic cell substantially
reduces human
antibody binding and complement-mediated cytolysis. Nature Med. l, 1261-1267
Sandrin. M. S., Vaughan, H. A.. Dabkowski. P. L., and McKenzie, 1. F. C. (
1993) Anti-pig
IgM antibodies in human serum reacts predominantly with Gal((XI,3)Gal
epitopes. Proc. Natl.
Acad. Sci. USA 90,11391-11395
Sawada, et al., 1990. "Isolation and expression of the full-length cDNA
encoding CD59
antigen of human lymphocytes" DNA and Cell. Biol. 9: 213-220.
Schaapherder, A. F. M., Daha, M. R., Te Bulte, M. -T. J. W., Van der Woude, F.
J., and
Gooszen, H. G. ( 1994) Antibody-dependant cell-mediated cytotoxicity against
porcine
endothelium induced by a majority of human sera. Transplantation 57, 1376-1382
Schwartz, "A Cell Culture Model for T Lymphocyte Clonal Anergy", Science
248:1349-1356
( 1990).
Sharma, A., Okabe, J., Birch, P., McClellan, S. B., Martin, M. J., Platt. J.
L., and Logan, J.
S. (1996) Reduction in the level of Galcc(1,3)Gal in transgenic mice and pigs
by expression of
an (x(1,2)fucosyltransferase. Proc. NatL Acad. Sci. USA 93, 7190-7195
Sommerville, C. A., and D'Apice, A. J. F. (1993) Future directions in
transplantation:
xenotransplantation. Kidney International 44, Suppl. 42, S I 12-S 121
Southern. E. M. ( 1975) Detection of specific sequences among DNA fragments
separated by
gel electrophoresis. J MoL BioL 98, 503-517
23
CA 02361646 2001-07-30
WO 01/30966 PCT/US00/29151
Stefanova, et al., 1~a9. "Characterization of a broadly expressed hm.'an
leucocyte surface
antigen MEM-43 anchored in membrane through phosphatidylinositol" Mol.
Immunol. 26:153-
161.
Storb and Thomas, "Graft-Versus-Host Disease in Dog and Man: The Seattle
Experience",
Immunol. Rev. 88:215-238 ( 1985).
Su, et al., 1991. "The Glycosyl Phosphatidylinositol Anchor Is Critical for Ly-
6A/E-mediated
T Cell Activation," J. Cell Biol. 112:377-384.
Sun, H. V. Subbotin, C. Chen, A. Aitouche, L. A. Valdivia, M. H. Sayegh, P. S.
Linsley, J.
J. Fung, T. E. Starzl, A. S. Rao. 1997. Prevention of chronic rejection in
mouse aortic
allografts by combined treatment with CTLA4-Ig and anti-CD40 ligand monoclonal
antibody.
Transpl. 64:1838.
Thompson et al., "CD28 Activation Pathway Regulates the Production of Multiple
T-Cell-
Derived Lymphokines/Cytokines", Proc. Natl. Acad. Sci. 86:1333-1337 (1989).
Tone, et al., 1992. "Gene structure of human CD59 and demonstration that
discrete mRNAs
are generated by alternative polyadenylation" J. Mol. Biol. 227:971-976.
Tran, H. M., P. W. Nicherson. A. C. Restifo, M. A. Ivis-Woodward, A. Patel, R.
D. Allen.
T. B. Strom, P. J. O'Connell. 1997. Distinct mechanisms for the induction and
maintenance of
allograft tolerance with CTLA4-fc treatment. J. Immunol. 159:2232.
Vanhove, B., deMartin, R., Lipp, J., and Bach, F. H. (1994) Human xenoreactive
natural
antibodies of IgM isotype activate pig endothelial cells. Xenotransplantation
l, 17-22
Venneker, et al., 1992. "CD59: a molecule involved in antigen presentation as
well as
downregulation of membrane attack complex" Exp. Clin. Immunogenet. 9:33-47.
W. L. Fodor, S. A. Rollins, E. R. Guilmette, E. Setter, S. P. Squinto. 1995. A
novel
bifimctional chimeric complement inhibitor that regulates C3 convertase and
fon-nation of the
membrane attack complex. J. Immunol 155:4135.
W. Steurer, P. W. Nickerson, S. W. Steele, J. Steiger. X. X. Zheng T. B. Strom
1995. Ex
vivo coating of Islet cell allografts with murine CTLA4/fc promotes graft
tolerance. J.
Immunol. 155:1165.
Walsh, et al., 1991. "Transfection of human CD59 complementary DNA into rat
cells confers
resistance to human complement" Eur. J. Immunol. 21:847-850.
Walunas, T. L., D. J. Lenschow, C. Y. Bakker. P. S. Linsley, G. J. Freeman. J.
M. Green.
C. B. Thompson, J. A. Bluestone. 1994. CTLA-4 can ftinction as a negative
regulator of T
cell activation. Immunity 1:405.
Waterhouse, P., J. M. Penninger, E. Timms, A. Wakeham, A. Shahinian. K. P.
Lee, C. B.
Thompson, H. Griesser, T. W. Mak. 1995. Lymphoproliferative disorders with
early lethality
in mice deficient in CTLA-4. Sci 270:985.
Weaver and Unanue, "The Costimulatory Function of Antigen-Presenting Cells",
Immunol.
Today 11:49-55 ( 1990).
Weiss, "Structure and Function of the T Cell Antigen Receptor", J. Clin.
Invest. 86:1015-1022
( 1990).
Whitlow, et al., 1990. "H19, a surface membrane molecule involved in T-cell
activation,
inhibits channel formation by human complement" Cell. Immunol. 126:176-184.
Wing, et al., 1992. "Oligodendrocytes lack glycolipid anchored proteins which
protect them
against complement lysis. Restoration of resistance to lysis by incorporation
of CD59"
Immunology 76:140-145.
Wm. Paul. 1998. Fundamental Immunology. Fourth Edition
24
WO01/30966 ~ 02361646 2001-07-30 pCT~S00/29151
Yokochi et al., "B L~mpnoblast Antigen (BB-1) Expressed on Epstv__'-Barr Virus-
Activated B
Cells Blasts, B Lymphoblastoid Cell Lines, and Burkitt's Lv_ mphomas", J.
Immunol.
128:823:827 (1981).
Zhao, et al., 1991. "Amplified gene expression in CD59-transfected Chinese
hamster ovary
cells confers protection against the membrane attack complex of human
complement"J. Bioi.
Chem. 266: 13418-13422.
It will be understood that various modifications may be made to the
embodiments disclosed
herein. For example, the CSb-9 inhibitory domain and/or the T Cell inhibitory
domain may be
modified by creating amino acid substitutions or nucleic acid mutations
provided at least some
complement regulatory activity and some T Cell inhibitory activity remains
after such
modifications. Similarly, the nucleotide sequences of the chimeric protein
protein may be
modified by creating nucleic acid mutations which do not significantly change
the encoded amino
acid sequences, including third nucleotide changes in degenerate codons (and
other "silent"
mutations that do not change the encoded amino acid sequence). Mutations which
result in a
highly conservative or silent amino acid substitution for an encoded amino
acid while leaving the
characteristics of the chimeric proteins essentially unchanged are also within
the scope of
disclosure. Also included are sequences comprising changes that are found as
naturally occurring
allelic variants of the genes for the T Cell inhibitory molecules and the CSb-
9 inhibitory molecules
used to create chimeric molecules described herein. All of the foregoing shall
be considered as
equivalents of the specific embodiments set forth herein. Therefore, the above
description should
not be construed as limiting, but merely as exemplifications of preferred
embodiments. Those
skilled in the an will envision other modifications within the scope of the
claims appended hereto.
