Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
UPA, A UNIVERSAL PROTEIN ARRAY SYSTEM
FIELD
The present invention relates to detection of interactions between polypeptide
and protein,
DNA, RNA and/or ligand molecules.
BACKGROUND
Gene expression in eukaryotic cells is controlled by numerous fundamental and
selective
protein-protein, protein-DNA, protein-RNA and protein-ligand interactions.
Cancer, as well as other
genetic diseases, results from abnormal gene expression. Interactions of
proteins with proteins and
other biomolecules play a pivotal role in almost every aspect of gene
expression. Therefore, factors
involved in these interactions, including transcription factors, signal
transduction factors, growth
factors and the products of other oncogenes, tumor suppressor genes, viral
genes and many cellular
genes, have been implicated as potential targets for new drugs (Hurst, Eur. J.
Cancer, 32A, 1857-
1863, 1996; Bustin and McKay, Br. J. Biomed. Sci., 51, 147-157, 1994; Powis,
Pharmac. Ther., 62,
57-95, 1994; Krantz, Nature Biotechnol., 16, 1294, 1998).
Use of transcription factors has proved to be a successful means to identify
new drug targets
in cancer and other human disease. The basal transcription machinery of class
II genes consists of at
least six general transcription factors, including TFIIB, TFIID, TFIIE, TFIIF,
TFIIH and RNA
polymerase II. However, an additional activators) and coactivator(s) are
required for regulated
(activated) transcription (Orphanides et al., Genes Dev., 10, 2657-2683, 1996;
Ptashne and Gann,
Nature, 386, 569-577, 1997). Both basal and activated transcriptions are
controlled largely through
protein-protein interactions between transcription factors and through protein-
DNA interactions.
Thus, insight into factor communication holds not only the key to
understanding mechanisms of gene
regulation, but also provides a means of understanding mechanisms of
pathogenesis and of
identifying anticancer drugs.
At present, in addition to the two-hybrid system and co-immunoprecipitation
assays usually
used to detect protein-protein interactions in vivo, the glutathione S-
transferase (GST) pull-down
assay is one of the more common methods to determine specific protein-protein
interactions in vitro.
Cross-linking, gel mobility shift, footprinting and others have been often
used to study protein-DNA
and protein-RNA interactions (Fields and Sternglanz, Trends Genet., 10, 286-
292, 1994; Harris,
Methods Mol. Biol., 88, 87-99, 1998). Recently, several methods, including
serial analysis of gene
expression (SAGE) (Velculescu et al., Science, 270, 484-487, 1995), cDNA
microarrays (Schena et
al., Science, 270, 467-470, 1995) and oligonucleotide-based DNA chips (Chee et
al., Science, 274,
610-614, 1996), have been employed to study the relationship between gene
expression and cancer
CA 02365431 2001-08-27
WO 00/54046 PCT/IJS00/06244
-2-
and have made significant contributions to our understanding of the mechanism
of tumorigenesis.
However, knowledge of which trans-acting factors are involved and how they
change gene
expression patterns is still limiting due to the lack of efficient and
reproducible techniques to
examine intermolecular communications.
Therefore, there still exists a strong need for reliable, simple systems for
the detection of
interactions of various molecules with proteins of interest.
SUMMARY
The present invention is a high-throughput, parallel-analysis method
(generally referred to
as a universal protein array (UPA) system) that can be used effectively and
quantitatively to
determine polypeptide interactions with other molecules, for instance
biomolecules. UPA can be
used in molecular biology and biochemistry laboratories to study protein-
protein, protein-DNA,
protein-RNA and protein-ligand interactions, for instance those involved in
gene expression
pathways, including transcription, RNA processing, replication, translation,
signal transduction and
others. UPA can also be used to screen compounds to test their possible
efficacy as new drugs based
on their ability to bind to polypeptides or block binding of other molecules
to polypeptides.
This invention provides arrays, particularly universal protein arrays. Such
arrays have a
plurality of target polypeptide samples bound to a solid support. The arrays
will include at least 10
polypeptide samples, which can be arranged in any addressable pattern
including a grid or radial
pattern. These sample polypeptides may be immobilized on the solid support. In
some
embodiments, only one polypeptide is arrayed at each address.
In certain embodiments of the invention, the sample target polypeptides used
in the array are
substantially pure. A preparation of substantially pure polypeptide for use in
the arrays of this
invention may be purified such that the desired protein represents at least
50% of the total protein
content of the preparation. In other embodiments, a substantially pure protein
will represent at least
60%, at least 70%, at least 80%, at least 85%, at least 90%, or at least 95%
or more of the total
protein content of the preparation.
Arrays of this invention include macro- and microarrays, or combinations
thereof. In these
arrays, the polypeptide samples can be supported on any solid support, for
instance glass,
nitrocellulose, polyvinylidene fluoride, nylon, fiber, or combinations
thereof. In particular
embodiments, the support is a glass slide. This slide may additionally have a
polymerized layer
attached or associated with at least one surface (e.g., face) to provide a
specific region for
immobilization of the target polypeptides.
Particular arrays of the invention contain polypeptides that are related to
each other in at
least one way or share some common characteristic. Certain arrays, for
instance, contain
polypeptides that are transcriptional factors, transcriptional activators,
and/or transcriptional
coactivators. Specific examples of such transcription-related arrays will
include polypeptides chosen
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-3-
from the following group of polypeptides: TFIIA, TFIIB, TBP, f:TFIID, TFIIE,
TFIIF, f:TFIIH, Pol
II, RXR, TR, Octl, Spl, G4-94, G4-147, G4-AH, G4-VP16, G4-CTF, G4-Spl, G4-EIA,
G4-IE, G4-
Tat, PC4-P, PC4-N, PC4-C, PC4-DS, PC4-ml, PC4-m2, PC4-m3, PC4-m4, PC4-m5, PC4-
m6, PC4-
m7, PC4-wt, p52, p75, p75-C, p300-C, PCAF, PCAF-C, TAF250, Topo I (wt), Topo I
(mt), Topo I
(wt)*, Topo I (nati), ASF, SR, GST-Nu, and GST-K. This represents specific but
non-limiting
examples of certain proteins that may be presented as targets on an array of
this invention.
The present invention also provides assays employing these arrays.
Certain embodiments of the invention are array-based protein interaction
assays, wherein an
array (either a macro- or microarray) of target polypeptide molecules is
contacted with a detectable
probe molecule under conditions sufficient to produce binding (e.g., a binding
pattern). Binding can
then be detected. In certain embodiments, the polypeptides of the array are
substantially pure
preparations of polypeptide. Polypeptides may for example be stably associated
with the surface of
the array, which may be a solid support. Examples of such assays include a
further step of removing
unbound probe molecules) prior to detecting the binding pattern of the probe.
Probes for use with assays of this invention can be any molecules that might
bind to a
polypeptide. Examples of probes include single-stranded nucleic acids (DNA or
RNA), double-
stranded nucleic acids (DNA or RNA), proteins, and ligands (e.g., drugs,
toxins, venoms, hormones,
co-factors, substrates or reaction products of enzymatic reactions or analogs
thereof, transition state
analogs, minerals, and so forth). Such probes are detectable, either due to
inherent features of the
probe (such as immunogenicity, which can be detected through interaction with
an antibody) or
through the attachment or association of a label or tag molecule. Examples of
tags include
fluorescent tags, luminescent tags, and immunogenic tags.
Other assays provided by the invention can be used to determine one or more
polypeptide-
binding characteristics of a probe molecule. Such assays may include preparing
a labeled sample of
the probe molecule (for instance, a nucleic acid molecule, polypeptide or
ligand). The probe is
contacted to an array of target polypeptides to produce a binding pattern,
which can then be detected.
In certain embodiments, unbound probe is washed or otherwise removed from the
array, for instance
prior to detecting the binding pattern, to reduce or remove background
signals. Target polypeptides
of the arrays used in these assays are stably associated with a solid support.
Examples of labels for use with any of the assays of the invention include all
labels that can
be attached to a probe molecule to facilitate detection of the molecule. Such
labels include tags that
can be directly detected (e.g., radioisotopes, fluorescent or luminescent
tags) as well as labels that
require secondary detection (e.g., immunogenic or epitope tags, members of the
strept/avidin:biotin
system). Probes can also be detectable in the sense that they can be detected
based on a characteristic
inherent in the probe itself (e.g., immunogenicity, inherent fluorescence,
etc.).
This invention also provides kits for labeling probe molecules to be used with
array-based
protein interaction assays (e.g., universal protein array based assays). Such
kits include at least a tag
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-4-
capable of being linked to a probe molecule, and instructions for how to use
the tag to label probes.
Buffers for use in the probe labeling process, or for use in performing the
array-based protein assay,
may also be provided in the kits. A probe molecule standard (either labeled or
unlabeled) may also
be included in the kit.
Certain probe labeling kits will also include one or more arrays, for instance
an array of
substantially pure polypeptide molecules.
Other kits provided in this invention are used for determining one or more
polypeptide-
binding characteristics of a probe molecule. Such kits include a polypeptide
array and instructions
for its use in determining binding characteristics of at least one probe
molecule. The target
polypeptides on these arrays can be substantially pure polypeptide samples,
and may be arranged for
instance in a grid-like or radial arrangement. Arrays provided in kits can be
macro- or microarrays,
or both, depending on the specific embodiment of the invention. Buffers for
use in the probe
labeling process, or for use in performing the array-based protein assay, may
also be provided in the
kits. One or more probe molecule standards (either labeled or unlabeled) may
also be included in the
kit.
Other embodiments of the invention are methods of analyzing proteins,
particularly protein-
molecule interactions and/or binding characteristics. Certain of these methods
include obtaining
more than one (a plurality) substantially pure protein specimen, placing a
sample of each specimen in
an addressable location on a recipient array; and probing the array of
specimens with a detectable
probe molecule. Arrays for use in these methods can be macro- or microarray,
or combinations
thereof. Probe molecules used to assay arrays in these methods can be any
molecule, for example a
nucleic acid, a polypeptide, a ligand, a fragment thereof, or mixtures
thereof.
Other methods provided include methods of analyzing a plurality of binding
characteristics
of an array of polypeptide samples. In such methods, an array of polypeptide
samples is probed at
least twice, sequentially, with at least a first and a second (different)
probe molecule. The array may
be stripped of bound first probe prior to being assayed with the second probe.
Binding patterns for
the first and second probes can be detected and analyzed to determine which
polypeptides each probe
binds to, thereby revealing multiple binding characteristics of the array of
polypeptide samples.
Arrays used in these methods can be macro- or microarrays, and will include a
plurality of target
polypeptide samples (which may be substantially pure) immobilized on a solid
support in an
addressable pattern. In these methods, the first and second (and so forth)
probes can be from any
class of molecules.
The foregoing and other features and advantages of the invention will become
more
apparent from the following detailed description of several embodiments, which
proceeds with
reference to the accompanying figures.
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-5-
BRIEF DESCRIPTION OF THE FIGURES
Figure 1: Protein-Protein Interactions
The universal protein array (UPA) provides quantitative detection of specific
protein-protein
interactions at different salt wash stringencies. Fig. lA shows the
autoradiographic signals detected
from the herein-described UPA that was incubated with 3zP-labeled GST-K-p52,
then washed with
low salt buffer A 100 ( 100 mM KCI) to remove unbound probe, as described in
Example 3. Fig. 1 B
shows the autoradiographic signals detected from the same UPA after it was
washed in high salt
A 1000 buffer ( 100 mM KCl).
Table 1 is the polypeptide target arrangement key for the array shown in Fig.
lA and 1B.
Fig. 1 C is a pictorial representation of the relative affinities of the 48
arrayed proteins for
the transcriptional cofactor p52 after the array was washed with buffer A1000
(100 mM KCl). The
units are reading units from a densitometer.
Figure 2: Protein-DNA, Protein-RNA, and Protein-Ligand Interactions
The universal protein array also permits autoradiographic detection of protein-
dsDNA (Fig.
2A), protein-ssDNA (Fig. 2B), protein-RNA (Fig. 2C), and protein-ligand (Fig.
2D) interactions.
The same UPA was probed with'zP-labeled nucleic acids (Examples 4 and 5) or
with'z5I-labeled
ligand (Example 6) as described in the text. Between each application of
probe, the UPA was
stripped and equilibrated in buffer A100, as described in Example 2.
As for Fig. 1, Table 1 contains the polypeptide target arrangement key for the
array shown
in Figure 2.
Figure 3: Detection of ASF/SF2-Interacting Proteins Using a UPA
Sixteen selected proteins/protein fractions were analyzed for interaction with
32P-labeled
6H(K)ASF/SF2. Fig. 3A shows the key grid of 16 proteins that were arrayed (in
a 4 by 4 grid
format). Fig. 3B and Fig. 3C are autoradiographs of the binding patterns on
the UPA after washing
with 100 mM KCl or 500 ml KCI, respectively.
Key to the abbreviations in Fig. 3A: CTD, the C-terminal domain of RNA
polymerase II
fused to GST; RPBS, RPB6, RPBB, RPBIOa and RPB10(3 correspond to individual
subunits of RNA
polymerase II fused to GST; TBP, TATA-binding protein; f:TFIID, affinity-
purified flag-tagged
TBP-containing TFIID complex from HeLa cells; RXR, retinoid-X receptor; TR,
thyroid hormone
receptor; His-H1, histone H1; Co-His, co-histones; HMG 1, high mobility group
protein 1; ASF,
alternative splicing factor; GST-Nu, GST-nucleolin fusion; GST-K, GST fused
with a synthetic heart
muscle kinase site.
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-6-
DETAILED DESCRIPTION
I. Abbreviations and Definitions
A. Abbreviations
ASF: alternative splicing factor
Co-His: co-histones
CTD: the C-terminal domain of RNA polymerase II fused to GST
f:TFIID: flag-tagged TBP-containing TFIID complex from HeLa cells
G4-94, G4-147, G4-AH, G4-VP16, G4-CTF, G4-Spl, G4-ElA, G4-IE, G4-Tat: Gal 4
fused to
different transcription activation domains (see Table 2)
GST: Glutathione S-transferase
GST-K: GST fused with a synthetic heart muscle kinase site
GST-Nu: GST-nucleolin fusion
His-Hi: histone Hl
HMG1: high mobility group protein I
Oct 1: B-cell specific activator
p52: novel transcription factor p52
p75: novel transcription factor p75
p75-C: C-terminal region of novel transcription factor p75
p300-C: transcriptional activator
PC4: positive cofactor 4
PC4-P, PC4-N, PC4-C, PC4-AS, PC4-ml, PC4-m2, PC4-m3, PC4-m4, PC4-m5, PC4-m6,
PC4-
m7, PC4-wt: various PC4 polypeptides (see Table 2)
PCAF: a p300/CBP-associated factor that functions as a histone
PCAF-C: C-terminal region of PCAF
Pol II: polymerase II
Spl: class II gene activator
SR: serine-arginine protein fraction prepared from HeLa cell nuclear extracts
RPBS, RPB6, RPBB, RPBlOa and RPB10(3: correspond to individual subunits of RNA
polymerase
II fused to GST
RXR: retinoid-X receptor
TAF250: transcriptional coactivator
TBP: TATA-binding protein
TFIIA, TFIIB, TBP, f:TFIID, TFIIE, TFIIF, f:TFIIH: Class II transcription
factors IIA, IIB, IID,
IIE, IIF, and IIH
Topo I (wt), Topo I (mt), Topo I (wt)*, Topo I (nati): various topoisomerase I
polypeptides (see
Table 2)
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
_7_
TR: thyroid hormone receptor
UPA: universal protein array
B. Definitions
Unless otherwise noted, technical terms are used according to conventional
usage.
Definitions of common terms in molecular biology may be found in Benjamin
Lewin, Genes VII,
published by Oxford University Press, 2000 (ISBN 0-19-899276-X); Kendrew et
al. (eds.), The
Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994
(ISBN 0-632-02182-
9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a
Comprehensive Desk
Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review of the various embodiments of the invention, the
following
definition of terms is provided:
Array: An arrangement of molecules, particularly biological macromolecules
(such as
polypeptides or nucleic acids) in addressable locations on a substrate. A
"microarray" is an array that
is miniaturized so as to require microscopic examination for evaluation.
Within an array, each arrayed molecule is addressable, in that its location
can be reliably
and consistently determined within the at least two dimensions of the array
surface. Thus, in ordered
arrays the location of each molecule sample is assigned to the sample at the
time when it is spotted
onto the array surface and usually a key is provided in order to correlate
each location with the
appropriate target. Often, ordered arrays are arranged in a symmetrical grid
pattern, but samples
could be arranged in other patterns (e.g., in radially distributed lines or
ordered clusters).
The shape of the sample application "spot" is immaterial to the invention.
Thus, though the
term "spot" is used throughout this specification, it refers generally to a
localized deposit of sample
target polypeptide, and is not limited to a round or substantially round
region. For instance,
essentially square regions of polypeptide application can be used with arrays
of this invention, as can
be regions that are essentially rectangular (such as slot blot application),
or triangular, oval, or
irregular. The shape of the array itself is also immaterial to the invention,
though it is usually
substantially flat and may be rectangular or square in general shape.
A key to one example array is shown in Table 1. Construction of this array is
described in
Example 1. This array has 48 addresses (individual spots on the array), which
are arranged in an 8
by 12 grid, with eight columns labeled "a" through "h" and twelve rows labeled
"1" through "12."
Each address position can be referred to by a row and column label (e. g.,
address "la" in the upper
left corner of the array contains transcription factor IIA, abbreviated
"TFIIA").
In this particular example array, as described below in Example 1, each target
polypeptide
has been spotted onto the array twice to provide internal controls. The
duplicate samples are found
in a pair of horizontally adjacent addresses of the array; for instance,
transcription factor IIA (TFIIA)
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
_g_
is found at both address 1 a and address 1 b, collectively addresses 1 a/b.
This pair of addresses (which
contain samples of the same polypeptide) can additionally be referred to by a
single number that
corresponds to the protein in that pair of addresses. Thus, TFIIA (at
addresses 1 a and 1 b) can also be
referred to by the numeral ( 1 ) (found centered above addresses 1 a and I b
of Table I ). Likewise, the
numeral (2) refers to addresses 1 c and 1 d ( 1 c/d), and designates the two
address that contain a sample
of transcription factor IIB (TFIIB). Horizontally arranged pairs of addresses
containing samples of
the same polypeptide are numbered this way through out this particular array,
from (I) (referring to
TFIIA, in addresses la/b) through (48) (referring to GST-K, in addresses
12g/h). These reference
numerals (1) through (48) are used in the first column of Table 2 to correlate
the binding data
discussed in some of the Examples below to the array position key.
Binding or interaction: An association between two substances or molecules.
The arrays
of this invention are used to detect binding of a probe molecule to one or
more polypeptides of the
array. A probe "binds" to a polypeptide of an array of this invention if,
after incubation of the probe
(usually in solution or suspension) with or on the array for a period of time
(usually 5 minutes or
more, for instance 10 minutes, 20 minutes, 30 minutes, 60 minutes, 90 minutes,
120 minutes or
more), a detectable amount of the probe associates with a polypeptide of the
array to such an extent
that it is not removed by being washed with a relatively low stringency buffer
(e.g., 100 mM KCl).
Washing can be carried out, for instance, at room temperature, but other
temperatures (either higher
or lower) can also be used. Probes will bind different polypeptides to
different extents, and the term
"bind" encompasses both relatively weak and relatively strong interactions.
Thus, some binding will
persist after the array is washed in a higher salt buffer (e.g., 500 mM or
1000 mM KCI).
The term "binding characteristics of an array for a particular probe" refers
to the specific
binding pattern that forms between the probe and the array after excess
(unbound or not specifically
bound) probe is washed away. This pattern (which may contain no positive
signals, some or all
positive signals, and will likely have signals of differing intensity) conveys
information about the
binding affinity of that probe for the polypeptides of the array, and can be
de-coded by reference to
the key of the array (which lists the addresses of the polypeptides on the
array surface). The relative
intensity of the binding signals from individual polypeptide spots is
indicative of the relative
affinities of the probe for those polypeptide molecules (assuming that the
same number of probe
binding sites are immobilized at each address on the array). Quantification of
the binding pattern of
an array/probe combination can be carried out using any of several existing
techniques, including
scanning the signals into a computer for calculation of relative density of
each spot.
DNA (deoxyribonucleic acid): DNA is a long chain polymer that contains the
genetic
material of most living organisms (the genes of some viruses are made of
ribonucleic acid (RNA)).
The repeating units in DNA polymers are four different nucleotides, each of
which includes one of
the four bases (adenine, guanine, cytosine and thymine) bound to a deoxyribose
sugar to which a
phosphate group is attached. Triplets of nucleotides (referred to as codons)
code for each amino acid
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-9-
in a polypeptide, or for a stop signal. The term "codon" is also used for the
corresponding (and
complementary) sequences of three nucleotides in the mRNA into which the DNA
sequence is
transcribed.
High throughput genomics: Application of genomic or genetic data or analysis
techniques
that use microarrays or other genomic technologies to rapidly identify large
numbers of genes or
proteins, or distinguish their structure, expression or function from normal
or abnormal cells or
tissues.
Isolated: An "isolated" biological component (such as a nucleic acid molecule,
protein or
organelle) has been substantially separated or purified away from other
biological components in the
cell of the organism in which the component naturally occurs, i.e., other
chromosomal and extra-
chromosomal DNA and RNA, proteins and organelles. Nucleic acids and proteins
that have been
"isolated" include nucleic acids and proteins purified by standard
purification methods. The term
also embraces nucleic acids and proteins prepared by recombinant expression in
a host cell as well as
chemically synthesized nucleic acids.
Nucleic acid: A deoxyribonucleotide or ribonucleotide polymer in either single
or double
stranded form, and unless otherwise limited, encompasses known analogues of
natural nucleotides
that hybridize to nucleic acids in a manner similar to naturally occurring
nucleotides.
Oligonucleotide: A linear polynucleotide sequence of up to about 300
nucleotide bases in
length, for example a polynucleotide (such as DNA or RNA) which is at least 6
nucleotides, for
example at least 15, 50, 100 or even 200 nucleotides long.
An oligonucleotide analog refers to moieties that function similarly to
oligonucleotides but
have non-naturally occurring portions. For example, oligonucleotide analogs
can contain non-
naturally occurring portions, such as altered sugar moieties or inter-sugar
linkages, such as a
phosphorothioate oligodeoxynucleotide. Functional analogs of naturally
occurring polynucleotides
can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules. Such
analog
molecules may also bind to or interact with polypeptides or proteins.
Oligopeptide: An oligopeptide is defined as a linear molecule of about 50 or
fewer amino
acid residues.
Peptide Nucleic Acid (PNA): An oligonucleotide analog with a backbone
comprised of
monomers coupled by amide (peptide) bonds, such as amino acid monomers joined
by peptide
bonds.
Probe: A molecule that may bind to or interact with one or more polypeptides.
A probe, as
the term is used herein, can be any molecule that is used to challenge
("probe," "assay," "interrogate"
or "screen") a polypeptide array in order to determine the binding or
interaction characteristics of the
arrayed polypeptides with that probe molecule. In specific embodiments of the
current invention,
probes may be from different and varied molecular classes. Such classes are,
for instance, nucleic
acids (such as single or double stranded DNA or RNA), oligo- or polypeptides
(such as proteins,
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
- 10-
protein fragments including domains or sub-domains, and mutants or variants of
naturally occurring
proteins), or various types of other potential polypeptide-binding molecules.
Such other molecules
are referred to herein generally as ligands (such as drugs, toxins, venoms,
hormones, co-factors,
substrates or reaction products of enzymatic reactions or analogs thereof,
transition state analogs,
minerals, and so forth).
Usually, a probe molecule is detectable for use in probing an array of the
invention. Probes
can be detectable based on their inherent characteristics (e.g.,
immunogenicity) or can be rendered
detectable by being labeled with an independently detectable tag. The tag may
be any recognizable
feature that is, for example, microscopically distinguishable in shape, size,
color, optical density, etc.;
differently absorbing or emitting of light; chemically reactive; magnetically
or electronically
encoded; or in some other way detectable. Specific examples of tags are
fluorescent or luminescent
molecules that are attached to the probe, or radioactive monomers or molecules
that can be added
during or after synthesis of the probe molecule. Other tags may be immunogenic
sequences (such as
epitope tags) or molecules of known binding pairs (such as members of the
strept/avidin:biotin
system). Other tags and detection systems are known to those of skill in the
art, and can be used in
the present invention.
Though in many embodiments of the invention a single type of probe molecule
(for instance
one protein) at a time will be used to assay the array, in some embodiments,
mixtures of probes will
be used, for instance mixtures of two proteins or two nucleic acid molecules.
Such co-applied probes
may be labeled with different tags, such that they can be simultaneously
detected as different signals
(e.g., two fluorophors that emit at different wavelengths).
Probe standard: A probe molecule for use as a control in analyzing an array.
Positive
probe standards include any probes that are known to interact with at least
one of the target
polypeptides of the array. Negative probe standards include any probes that
are known not to
interact with at least one target polypeptide of the array. Probe standards
that may be used in any one
system include molecules of the same class as the test probe that will be used
to assay the array. For
instance, if the array will be used to examine the interaction of a protein
with the polypeptides of the
array, the probe standard can be a protein or oligo- or polypeptide. However,
this will not always be
the case.
In some instances, as in certain of the kits that are subjects of this
invention, a probe
standard will be supplied that is unlabeled. Such unlabeled probe standards
can be used in a labeling
reaction as a standard for comparing labeling efficiency of the test probe
that is being studied. In
some embodiments, labeled probe standards will be provided in the kits.
Probing: As used herein, the term "probing" refers to incubating an array with
a probe
molecule (usually in solution) in order to determine whether the probe
molecule will bind to or
interact with molecules immobilized on the array. Synonyms include
"interrogating," "challenging,"
"screening" and "assaying" an array. Thus, a universal protein array of the
invention is said to be
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-11-
"probed" or "assayed" or "challenged" when it is incubated with a probe
molecule (such as a
polypeptide, nucleic acid molecule, or ligand).
Protein/Polypeptide: A biological molecule expressed by a gene or other
encoding nucleic
acid, and comprised of amino acids. More generally, a polypeptide is any
linear chain of amino
acids, usually about 50 or more amino acid residues in length.
Arrays according to the present invention include a plurality of polypeptide
samples
(targets) "spotted" at assignable locations on the surface of an array
substrate. The polypeptide at
each spot can be referred to as a target polypeptide, or target polypeptide
sample. In certain
embodiments, polypeptides are deposited on and bound to the array surface in a
substantially native
configuration, such that at least a portion of the individual polypeptides
within the spot are in a native
configuration. Such native configuration polypeptides are capable of binding
to or interacting with
molecules in solution that are applied to the surface of the array in a manner
that approximates
natural intra- or intermolecular interactions. Thus, binding of a molecule in
solution (for instance, a
probe) to a target polypeptide immobilized on an array will be indicative of
the likelihood of such
interactions in the natural situation (i.e., within a cell).
In certain arrays of the invention, referred to as pooled arrays, at least one
particular address
on the array is occupied by a pooled mixture of more than one substantially
pure target polypeptide.
All of the addresses on the array may contains pools of polypeptide, or only
some of the addresses,
depending on the use of the array. For instance, in some circumstances it may
be desirable to array a
target polypeptide associated with one or more non-target polypeptides, for
instance a stabilizing
polypeptide or linker molecule. In addition, the native conformation of
certain binding sites on
proteins can only be assayed for probe binding when the target polypeptide is
associated with other
molecules, for instance when the target polypeptide natively exists as one
subunit of a multimeric
complex. Pooled arrays of the current invention include those on which one or
more of the addresses
contains a multimeric polypeptide complex. In the case of such an array, it is
envisioned that
different probe molecules may bind to different polypeptides within the
complex of "target"
polypeptides.
Although the identity of each probe in the pooled mixture at a specific
address is known, the
individual probes in the pool are not "separately addressable." The binding
signal from a pooled
address is the binding signal of the set of different (but mixed or
associated) polypeptides occupying
that address. In general, an address is considered to display binding of a
probe molecule if at least
one polypeptide occupying the address binds to the probe molecule.
Arraying pooled samples is also a powerful tool in high-throughput
technologies for
increasing the information that is yielded each time the array is assayed.
Protein purification: Polypeptides for use in the present invention can be
purified by any
of the means known in the art. See, e.g., Guide to Protein Purification, ed.
Deutscher, Meth.
CA 02365431 2001-08-27
WO 00/54046 PCT/fJS00/06244
- 12-
Enrymol. 185, Academic Press, San Diego, 1990; and Scopes, Protein
Purification: Principles and
Practice, Springer Verlag, New York, 1982.
Purified: The term purified does not require absolute purity; rather, it is
intended as a
relative term. Thus, for example, a purified protein preparation is one in
which the specified protein
is more enriched than the protein is in its generative environment, for
instance within a cell or in a
biochemical reaction chamber. A preparation of substantially pure protein may
be purified such that
the desired protein represents at least 50% of the total protein content of
the preparation. In certain
embodiments, a substantially pure protein will represent at least 60%, at
least 70%, at least 80%, at
least 85%, at least 90%, or at least 95% or more of the total protein content
of the preparation.
Recombinant: A recombinant nucleic acid is one that has a sequence that is not
naturally
occurring or has a sequence that is made by an artificial combination of two
otherwise separated
segments of sequence. This artificial combination can be accomplished by
chemical synthesis or,
more commonly, by the artificial manipulation of isolated segments of nucleic
acids, e.g., by genetic
engineering techniques.
Stripping: Bound probe molecules can be stripped from an array, for instance a
universal
protein array, in order to use the same array for another probe interaction
analysis. Any process that
will remove essentially all of the first probe molecule from the array,
without also significantly
removing the immobilized polypeptides of the array, can be used with the
current invention. By way
of example only, one method for stripping a universal protein array is by
washing it in stripping
buffer (e.g., I M (NHQ)~SOQ and 1 M urea), for instance at room temperature
for about- .i0-60
minutes. Usually, the stripped array will be equilibrated in a low stringency
wash buffer prior to
incubation with another probe molecule.
Universal Protein Array: Universal protein arrays provide parallel analysis of
the extent
that a probe molecule (e.g., a detectable probe molecule) binds to or
interacts with several to
thousands of immobilized polypeptide molecules. Many copies of (usually) a
single type of target
molecule are bound to the array surface in a spot that may be, in the case of
a microarray,
approximately 0.1 mm or less in diameter, or will be larger in the case of a
macroarray (for instance,
a UPA constructed using a dot-blot or slot-blot apparatus). The target
molecules immobilized on the
array of a UPA are substantially pure polypeptides.
The many spots of a UPA, each containing at least two different polypeptide
targets, can be
arrayed in the shape of a grid, although other array configurations can be
used so long as the spots of
the array are addressable. The surface for arraying (the substrate) may be a
glass, or other solid
material, or a filter paper or other substance useful for attaching
polypeptides. When interrogated
with detectable probe sample (for instance, one that is labeled with a
fluorescent or a radioactive tag),
the binding of the probe to the array (possibly producing a pattern) indicates
the relative binding
affinity of the probe for each of the immobilized polypeptides. The binding of
a probe to a
polypeptide of the UPA can be visualized by detecting the labeled probe
molecule.
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
- 13-
In variations of the UPA technology, the detectable probe is a specific
protein, polypeptide,
single- or double-stranded nucleic acid, ligand or other natural or synthetic
molecule, depending on
the interactions) being tested for. Such detectable molecules are used to
detect and/or quantitate
interaction with the polypeptides of the UPA.
Unless otherwise defined, all technical and scientific terms used herein have
the same
meaning as commonly understood by one of ordinary skill in the art to which
this invention belongs.
Although methods and materials similar or equivalent to those described herein
can be used in the
practice or testing of the present invention, suitable methods and materials
are described below. In
case of conflict, the present specification, including definitions, will
control. In addition, the
materials, methods, and examples are illustrative only and are not intended to
be limiting.
II. Universal Protein Arrays
Arrays of the current invention provide several advantages over prior
technologies and
methods used for analysis of protein-molecule interactions. Although dot blot
analysis with
unpurified protein preparations has been used for the detection of specific
antibody-antigen
interactions, use of highly purified and active recombinant or native target
proteins, in an array
format, to assay for interactions with a specific probe has not previously
been reported. Additionally,
because the UPA assay can in some embodiments be carried out under non-
denaturing conditions, it
provides a simple system for detecting native interactions between
polypeptides and probe
molecules.
Known techniques fall far short of the UPA invention disclosed herein. In the
case of far-
western blot analysis, protein fractions were usually analyzed by SDS-PAGE and
electrotransferred
to a membrane, followed by denaturation and renaturation before probing with a
radiolabeled protein
probe. On average, only I-10% of the activity (without considering the loss of
protein during the
transfer process) could be recovered for most proteins with such a procedure
(Ge et al., Mol. Cell, 2,
751-759, 1998). In contrast, UPA analysis as described herein simply uses
active proteins directly
spotted onto a substrate, such as a membrane. Therefore, it is at least 10- to
100-fold more sensitive
than the far-western blot assay.
Since the amount of active protein assayed for interaction with the probe on a
UPA can be
the amount of protein applied, the affinities of individual proteins for a
specific probe molecule,
either a protein or another type of biomolecule or other ligand, can be easily
quantified and compared
with each other.
Most existing assay systems were designed for a single purpose (to be probed
with a single
type of molecule). For example, the two hybrid system, co-immunoprecipitation,
far-western
blotting and GST assays were all used only for protein-protein interaction;
the gel mobility shift,
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
- 14-
footprinting and cross-linking assays were used for protein-nucleic acid (DNA
or RNA) interactions,
and microarrays or DNA chips were used only for nucleic acid interactions. In
contrast, the same
UPA as described herein has been successfully used for detection of protein-
protein, protein-DNA,
protein-RNA and protein-ligand interactions. It is also useful for detecting
protein-metal ion
interactions.
Given that the major part of the human genome sequence has been identified,
that the entire
genome sequence is expected to be completed by the year 2003 (Collins et al.,
Science, 282, 682-
689, 1998) and that most active proteins can be overexpressed in and purified
from either bacteria,
baculovirus or mammalian cells, the availability of 100,000 human gene
products (Collins et al.,
Science, 282, 682-689, 1998) will provide a rich source of proteins for UPA-
mediated polypeptide
interaction studies. The UPA system not only provides an alternative and
efficient method to explore
the mechanisms of gene expression pathways, but also a new pipeline to screen
and to design new
drugs, with tremendous potential for disease diagnosis.
Below are described several characteristics of the universal protein arrays of
the invention.
The embodiments and examples given are meant in no way to limit the invention.
A. Choice of polypeptide targets
The targets) of interest will be selected according to a wide variety of
methods. For
example, certain targets of interest are well known and included in public
databases such as GenBank
or a similar commercial database. Other targets will be identified from
journal articles, or from other
investigations using high throughput technologies (e.g., cDNA microarrays or
Gene Chips), or with
other techniques. In certain embodiments, the sequences of arrayed target
polypeptides can be
provided via an ASCII text file, for instance to assist data storage, sorting
and comparison.
Any polypeptides can serve as targets for use in the subject arrays. For
instance, an array
could be assembled that reflects every protein encoded for by the genome of an
organism.
Alternatively, arrays can be designed that contain a specific family of
proteins. Such families can be
defined in various ways, including proteins that act in a specific cellular
process (e.g., transcription-
related proteins), proteins that are in a linked biochemical pathway (e.g.,
proteins involved in the
respiratory pathway), proteins known to be involved in diseases, etc. Arrays
can also be produced
that include proteins of a specific type (e.g., DNA polymerases) from various
different species.
Arrays of the oligopeptides or polypeptides encoded for by ESTs can also be
created, and are useful
for identifying the function of individual EST-linked genes and the proteins
they encode.
In essence, any combination or grouping of polypeptides can be assembled
together one or a
set of UPAs for simultaneous analysis of interaction with one or more probes
of interest.
By way of example, there are approximately 100,000 different genes in the
human genome,
and it is expected that all of them will be known within the next few years.
With the provision of
every gene in the human genome, every protein encoded for by each human gene
can be arrayed on
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
- 15-
one or a collection of UPAs, such that the entire human complement of proteins
can be screened for
probe interactions. Arrays can also be arranged that contain the entire
collection of proteins encoded
on a single human chromosome, such that a collection of 23 UPAs would
encompass the entire
human genome.
Genome-wide or chromosome-specific polypeptide arrays or array sets are not
limited to the
human genome. Any species for which the genome is known or becomes known could
be arrayed on
one or a collection of arrays according to this invention. Such non-human
genomes include those
from disease organisms (e.g., viruses, bacteria, parasites, etc.), research
organisms (Drosophila
melanogaster, Caenorhabditis elegans, Xenopus laevis, Arabidopsis,
Saccharomyces cereviseae,
Escherichia coli, etc.), and so forth.
As demonstrated below (Example 3), UPA is an effective method to map protein
interaction
domains and DNA- or RNA-binding domains of a protein. In certain UPAs of this
invention,
therefore, the target polypeptides are collections of closely related
sequences, for instance a series of
nested polypeptide deletions of varying length or a series of polypeptides
with different amino acid
residues at single sites throughout the sequence. Another alternative is a
collection of different
domain fragments of one protein or a family of closely related proteins; the
domains may be fused to
another (non-target) protein. Such domain or mutation arrays can be used to
determine which amino
acid residues or domains are important in known or suspected binding
interactions between the base
target protein and the probe or probes used to assay the array.
Applications of the universal protein array technology are not limited to
studies of
transcriptional factors, although the following Examples 1-6 disclose
embodiments of its use in
connection with analysis of such factors. UPA analysis could also be
instrumental in understanding
polypeptide binding characteristics of multiple protein profiles expressed
during various disease
states or growth conditions, as well as in normal human or animal protein
profiles, including profiles
from different transgenic animals or cultured cells.
Polypeptide arrays according to this invention may also be used to perform
further analysis
on genes and targets discovered from, for example, high-throughput genomics,
such as DNA
sequencing, DNA microarrays, or SAGE (Serial Analysis of Gene Expression)
(Velculescu et al.,
Science 270:484-487, 1995). Polypeptide arrays according to this invention may
also be used to
evaluate reagents for disease or cancer diagnostics, for instance specific
antibodies or probes that
react with certain polypeptides from infectious organisms or from tissues at
different stages of cancer
development. This technology can also be used to follow progression of
polypeptide changes both in
the same and in different cancer types, or in diseases other than cancer.
Polypeptide arrays according
to this invention may be used to identify and analyze prognostic markers or
markers that predict
therapy outcome for various diseases or abnormal conditions, such as cancers.
Arrays compiled from
the proteins of hundreds of cancers derived from patients with known disease
outcomes permit
binding or association assays to be performed on those arrays, to determine
important prognostic
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
- 16-
markers, or markers predicting therapy outcome, which are associated with
polypeptide binding
characteristics.
Polypeptide arrays according to this invention may also be used to help assess
the ability of
certain drugs or potential drugs to interact with target polypeptides, or the
ability of such molecules
to block the interaction of other probes with arrayed polypeptides.
The UPAs of this invention can be used to investigate receptor specificity of
different types
of known and suspected receptor molecules. Examples of receptors that can be
investigated for
probe-specific binding by arrays according to this invention include but are
not limited to
microorganism receptors (for instance, those found in fungi, protozoa, and
bacteria, especially
bacterial strains that are resistant to antibiotics); hormone receptors
(including those involved in
diabetes, growth regulation, vasoregulation, and so forth); and opiate
receptors (involved in
biological responses, for instance to addictive drugs).
Also envisioned are arrays that are custom produced for the researcher, with
an arrayed
collection of polypeptides tailored to a specific research project, research
system, etc.
Not in any way intending to be limited to the list below, the following is a
list of the types of
collections of polypeptides that can be arrayed on a UPA according to this
invention: all or
substantially all the proteins encoded for by the genome of an organism; all
or substantially all the
proteins encoded for by a chromosome of an organism; proteins expressed in a
cell during a
particular growth phase or environmental condition; proteins expressed in a
cell under a particular
abnormal state (such as cancer, disease, or infection); proteins expressed in
cells at various times
during the progression of a disease or condition (e.g., during progression of
a tumor, or development
of a chronic disease such as Alheizmers); proteins expressed in a particular
cell type; proteins from a
particular protein family (e.g., DNA polymerases, cell surface proteins,
transmembrane proteins or
fragments [such as soluble fragments] thereof, oncogene proteins, tumor
suppressor proteins, and so
forth); proteins that show sequence homology to each other; proteins that
share secondary structural
characteristics; proteins that associate to form multimeric complexes (e.g.,
the subunits of a ribosome
or a membrane ATPase); viral epitopes; domains of proteins; proteins from
different species; and
collections of fragments of any of these protein collections.
B. Production of substantially pure target polypeptides
Polypeptides for use as targets on the subject arrays can be produced by any
technique that
yields native protein. These techniques in general include expression from
engineered DNA
constructs, extraction from native samples (e.g., clinical samples), or de
novo synthesis of
oligopeptide or polypeptide fragments.
Expression of the target polypeptides can be carried out using well known
techniques. For
instance, partial or full-length cDNA sequences, which encode the protein of
interest as a target on
the UPA, may be ligated into bacterial expression vectors. Methods for
expressing large amounts of
protein from a cloned gene introduced into Escherichia coli (E. coli) may be
utilized for the
CA 02365431 2001-08-27
WO 00/54046 PCT/f1S00/06244
- 17-
production and purification of intact, native target proteins. Methods and
plasmid vectors for
producing fusion proteins and intact native proteins in bacteria are described
in Sambrook et al.
(Sambrook et al., In Molecular Cloning: A Laboratory Manual, Ch. 17, CSHL, New
York, 1989).
Such fusion proteins may be made in large amounts and are easy to purify.
Native proteins can be
S produced in bacteria by placing a strong, regulated promoter and an
efficient ribosome-binding site
upstream of the cloned gene. If low levels of protein are produced, additional
steps may be taken to
increase protein production; if high levels of protein are produced,
purification is relatively easy.
Suitable methods are presented in Sambrook et al. (In Molecular Cloning: A
Laboratory Manual,
CSHL, New York, 1989) and are well known in the art. Often, proteins expressed
at high levels are
found in insoluble inclusion bodies. Methods for extracting proteins from
these aggregates are
described by Sambrook et al. (In Molecular Cloning: A Laboratory Manual, Ch.
17, CSHL, New
York, 1989). Vector systems suitable for the expression of lacZ fusion genes
include the pUR series
of vectors (Ruther and Muller-Hill, EMBOJ. 2:1791, 1983), pEXI-3 (Stanley and
Luzio, EMBOJ.
3:1429, 1984) and pMR100 (Gray et al., Proc. Natl. Acad. Sci. USA 79:6598,
1982). Vectors
suitable for the production of intact native proteins include pKC30 (Shimatake
and Rosenberg,
Nature 292:128, 1981), pKK177-3 (Amann and Brosius, Gene 40:183, 1985) and pET-
3 (Studiar and
Moffatt, J. Mol. Biol. 189:113, 1986).
C. Choice of array format and structure
UPAs may vary significantly in their structure, composition, and intended
functionality.
The UPA system is amenable to use in either a macroarray or a microarray
format, or a combination
thereof. Such arrays can include, for example, at least 50, 100, 150, 200,
500, 1000, or 5000 or more
array elements (such as spots). In the case of macro-UPAs, no additional
sophisticated equipment is
usually required to detect the bound probe on the UPA, though quantification
may be assisted by
known automated scanning and/or quantification techniques and equipment. Thus,
macro-UPA
analysis can be carried out in most research laboratories and biotechnology
companies, without the
need for investment in specialized and expensive reading equipment.
Examples of substrates for UPAs include glass (e.g., functionalized glass),
Si, Ge, GaAs,
GaP, SiO,, SiN4, modified silicon nitrocellulose, polyvinylidene fluoride,
polystyrene,
polytetrafluoroethylene, polycarbonate, nylon, fiber, or combinations thereof.
Array substrates can
be stiff and relatively inflexible (e.g., glass or a supported membrane) or
flexible (such as a polymer
membrane). One commercially available microarray system that can be used with
the arrays of this
invention is the FASTT"' slides system (Schleicher & Schuell, Dassel,
Germany), which incorporates
a patch of polymer on the surface of a glass slide.
In general, a target on the array should be discrete, in that signals from
that target can be
distinguished from signals of neighboring targets, either by the naked eye
(macroarrays) or by
scanning or reading by a piece of equipment or with the assistance of a
microscope (microarrays).
Macro-UPAs are often arrayed on polymer membranes, either supported or not,
and can be
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
- 18-
of any size, but typically will be greater than a square centimeter. Other
examples of macroarray
substrates include glass, fiber, plastic and metal. Macroarrays are generally
used when the number of
polypeptides in the target set is relatively small, on the order of tens to
hundreds of samples, however
macroarrays with a larger number of array elements can be used on large
substrates. Spot
arrangement on the macroarray is such that individual spots can be
distinguished from each other
when the sample is read; typically, the diameter of the spot is about equal to
the spacing between
individual dots.
Sample spots on macroarrays are of a size large enough to permit their
detection without the
assistance of a microscope or other sophisticated enlargement equipment. Thus,
spots may be as
small as about 0. I mm across, with a separation of about the same distance,
and can be larger.
Larger sample spots on macroarrays, for example, may be about 0.5, l, 2, 3, 5,
7, or 10 mm across.
Even larger spots may be larger than 10 mm ( 1 cm) across, in certain specific
embodiments. The
array size will in general be correlated the size of the sample spots applied
to the array, in that larger
spots will usually be found on larger arrays, while smaller spots may be found
on smaller arrays.
IS This correlation is not necessary to the invention, though.
In microarray UPAs, a common feature is the small size of the target array,
for example on
the order of a squared centimeter or less. A squared centimeter ( 1 cm by 1
cm) is large enough to
contain over 2,500 individual target spots, if each spot has a diameter of 0.1
mm and spots are
separated by 0.1 mm from each other. A two-fold reduction in spot diameter and
separation can
allow for 10,000 such spots in the same array, and an additional halving of
these dimensions would
allow for 40,000 spots. Using microfabrication technologies, such as
photolithography, pioneered by
the computer industry, spot sizes of less than 0.01 mm are feasible,
potentially providing for over a
quarter of a million different target sites. The power of microarray-format
UPAs resides not only in
the number of different polypeptides that can be probed simultaneously, but
also in how little protein
is need for the target.
The amount of polypeptide target sample that is applied to each address of an
array will be
largely dependent on the array format used. For instance, microarrays will
generally have less
polypeptide applied at each address than will macroarrays. By way of example,
individual targets on
a macroarray can be applied in the amount of about 1 pmol or greater, for
instance about 3 pmol,
about 5 pmol, about 7.5 pmol, about 10 pmol, about 15 pmol or more. In
contrast, samples applied
to individual spots on a microarray will usually be less than 1 pmol in each
spot, for instance, about
.8 pmol, about 0.5 pmol, about 0.3 pmol, about 0.1 pmol, about .OS pmol or
less.
In addition, the surface area of sample application for each "spot" will
influence how much
polypeptide is immobilized on the array surface. Thus, a larger spot (having a
greater surface area)
will generally accept or require a greater amount of target molecule than a
smaller sample spot
(having a smaller surface area).
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
- 19-
The target polypeptide itself (e.g., the length of the polypeptide, its
primary and secondary
structure, its binding characteristics in relation to the array substrate,
etc.) will influence how much of
each target polypeptide is applied to an array. Optimal amounts of target
molecule for application to
an array of the invention can be easily determined, for instance by applying
varying amounts of the
target polypeptide to an array surface and probing the array with a probe
molecule known to interact
with that target. In this manner, it is possible for one of ordinary skill in
the art to empirically
determine of range of target molecule amounts that produce interpretable
results.
Another way to describe an array is its density - the number of samples in a
certain
specified surface area. For macroarrays of the current invention, array
density will usually be
between about one target per squared decimeter (or one target address in a 10
em by 10 cm region of
the array substrate) to about 50 targets per squared centimeter (50 targets
within a 1 cm by 1 cm
region of the substrate). For microarrays, array density will usually be one
target per squared
centimeter or more, for instance about 50, about 100, about 200, about 300,
about 400, about 500,
about 1000, about 1500, about 2,500, about 5,000, about 10,000, about 50,000,
about 100,000 or
more targets per squared centimeter.
D. Application of targets to arrays
Targets on the array may be made of oligopeptides, polypeptides, proteins, or
fragments of
these molecules. Oligopeptides, containing between about 8 and about 50 linked
amino acids, can be
synthesized readily by chemical methods. Photolithographic techniques allow
the synthesis of
hundreds of thousands of different types of oligopeptides to be separated into
individual spots on a
single chip, in a process referred to as in situ synthesis, as has been done
with oligonucleotide arrays.
Longer polypeptides or proteins, on the other hand, contain up to several
thousand amino
acid residues, and are not as easily synthesized through in vitro chemical
methods. Instead,
polypeptides and proteins for use in UPAs are usually expressed using one of
several well known
cellular expression systems, including those described above. Alternatively,
proteins can be isolated
from their native environment, for instance from tissue samples or
environmental samples, or from
expression chambers in the case of engineered expressed polypeptides. After
extraction and
appropriate purification, the polypeptide can be deposited onto the array
using any of a variety of
techniques.
In the methods disclosed in this applications, target polypeptides can be
delivered to the
substrate of the array by various different mechanisms. One is by flowing
within a channel defined
on predefined regions of the array substrate. Typical "flow channel"
application methods for
applying the polypeptides to arrays of the present invention are represented
by dot-blot or slot-blot
systems (see, e.g., U.S. Patents No. 4,427,415 and 5,283,039). One alternative
method for applying
the targets to the array substrate is "spotting" the target polypeptide on
predefined regions (each
corresponding to an array address). In a spotting technique, the target
molecules are delivered by
directly depositing (rather than flowing) relatively small quantities of them
in selected regions. For
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-20-
instance, a dispenser can move from address to address, depositing only as
much target as necessary
at each stop. Typical dispensers include an ink jet printer or a micropipette
to deliver the target in
solution to the substrate and a robotic system to control the position of the
micropipette with respect
to the substrate. In other embodiments, the dispenser includes a series of
tubes, a manifold, an array
of pipettes, or the like so that the target polypeptides can be delivered to
the reaction regions
simultaneously.
Usually, the target polypeptides are deposited on the array substrate in such
a way that they
are substantially irreversibly bound to the array. For example, a target may
be bound such that no
more than 30% of the polypeptide on the array at the end of the binding
process can be washed off
using buffers of the UPA system (e.g., low or high salt buffers or stripping
buffers). In other
embodiments, no more than 25%, no more than 20%, no more than 15%, no more
than 10%, no more
than 5%, or no more than 3% of the polypeptide on the array at the end of the
binding process can be
washed off using buffers of the UPA system.
Depending on the array substrate used, the substrate alone may substantially
irreversibly
bind the target without further linking being necessary (e.g., nitrocellulose
and PVDF membranes).
In other instances, a linking or binding process must be performed to ensure
binding of the
polypeptides. Examples of linking processes are known to those of skill in the
art, as are the
substrates that require such a linking process in order to bind polypeptide
molecules. The target
polypeptides optionally may be attached to the array substrate through linker
molecules.
In certain embodiments, the non-sample regions of the array surface (those
regions of the
array surface that do not contain target molecules) are blocked in order to
prevent or inhibit binding
of the probe molecules directly to the array surface.
It is beneficial in certain embodiments to apply a known amount of each target
polypeptide
on the array. In particular embodiments, an essentially equal amount of each
target polypeptide is
applied to each spot. Quantification and equivalent application of the targets
permits comparison of
probe binding affinity between the different targets. Measurements of the
amount of specific target
proteins may be carried out through many techniques well known in the art.
These include
quantitative immunoblot analysis, enzyme activity assays (where appropriate),
and commercially
available protein quantification kits (e.g., Bio-Rad protein assay systems),
which determine the
concentration of protein in a sample regardless of biological characteristics
of the specific protein
being measured.
Many other techniques could be used to measure the amount of a target protein
present in a
sample. For instance, the amount of target protein in a sample could be
measured using a
quantitative enzyme-linked immunosorbant assay ('ELISA') as described by
Aboagye-Mathiesen et
al. (Placenta 18:155-61, 1997).
In certain arrays of the invention, referred to as pooled arrays, at least one
particular address
on the array is occupied by a pooled mixture of more than one substantially
pure target polypeptide.
CA 02365431 2001-08-27
WO 00/54046 PCT/LTS00/06244
-21 -
All of the addresses on the array may contains pools of polypeptide, or only
some of the addresses,
depending on the use of the array. For instance, in some circumstances it may
be desirable to array a
target polypeptide associated with one or more non-target polypeptides, for
instance a stabilizing
polypeptide or linker molecule. In addition, the native conformation of
certain binding sites on
proteins can only be assayed for probe binding when the target polypeptide is
associated with other
molecules, for instance when the target polypeptide natively exists as one
subunit of a multimeric
complex. Pooled arrays of the current invention include those on which one or
more of the addresses
contains a multimeric polypeptide complex. In the case of such an array, it is
envisioned that
different probe molecules may bind to different polypeptides within the
complex of "target"
polypeptides.
Although the identity of each probe in the pooled mixture at a specific
address is known, the
individual probes in the pool are not "separately addressable." The binding
signal from a pooled
address is the binding signal of the set of different (but mixed or
associated) polypeptides occupying
that address. In general, an address is considered to display binding of a
probe molecule if at least
one polypeptide occupying the address binds to the probe molecule.
Arraying pooled samples is also a powerful tool in high-throughput
technologies for
increasing the information that is yielded each time the array is assayed.
Methods for analyzing
signals from arrays containing pooled samples have been described, for
instance in U.S. Patent No.
5,744,305, incorporated herein by reference in its entirety.
E. Choice of probe molecules)
Any molecule that might bind to or interact with one or more polypeptides can
be used as a
probe with the disclosed arrays. In specific embodiments of the current
invention, probes may be
from different molecular classes (e.g., nucleic acids, oligo- or polypeptides,
or various types of
ligands). Probes (especially those that are polymeric chains) may be of
various lengths, and different
results may be obtained from the same array by using related probe molecules
of different length.
Likewise, varying the sequence of polymeric chain probes may provide valuable
binding data.
Though in many embodiments of the invention a single type of probe molecule
(for instance
one protein) at a time will be used to assay the array, in some embodiments,
mixtures of probes will
be used simultaneously, for instance mixtures of two proteins or two nucleic
acid molecules.
Simultaneous multiple-probing (e.g. double-probing) can be used to detect
either competitive binding
or binding systems that require the interaction of more molecules than just
one polypeptide target and
one probe molecule.
F. Labeling and detection of probe molecules)
Usually, probe molecules used to assay the disclosed UPAs are detectable.
Probes can be
detectable based on their inherent characteristics (e.g., immunogenicity) or
can be rendered
detectable by being labeled with an independently detectable tag. Such tags
include fluorescent or
luminescent molecules that are attached to the probe, or radioactive monomers
or molecules that can
CA 02365431 2001-08-27
WO 00/54046 PCT/fJS00/06244
-22-
be added during or after synthesis of the probe molecule. Other tags may be
immunogenic sequences
(such as epitope tags) or molecules of known binding pairs (such as members of
the
strept/avidin:biotin system). Other tags and detection systems are known to
those of skill in the art,
and can be used in the present invention.
Labeling different probes with different tags to enable simultaneous detection
of binding of
two or more probes on the polypeptides of an array. Multiple-label challenges
to an array of this
invention can also be used to examine any competitive binding between the two
arrays on different
polypeptides of the array. For competitive binding assays, however, only one
of the probes needs to
be detectable.
G. Computer assisted (automated) detection and analysis of UPAs
The data generated by assaying a universal protein array according to this
invention can be
analyzed using known computerized systems. For instance, the array can be read
by a computerized
"reader" or scanner and the quantification of the binding of probe to
individual addresses on the array
carried out using computer algorithms. Such analysis of the array can be
referred to as "automated
detection" in that the data is being gathered by an automated reader system.
In the case of labels that emit detectable electromagnetic wave or particles,
the emitted light
(e.g., fluorescence or luminescence) or radioactivity can be detected by very
sensitive cameras,
confocal scanners, image analysis devices, radioactive film or a
Phosphoimager, which capture the
signals (such as a color image) from the array. A computer with image analysis
software detects this
image, and analyzes the intensity of the signal for each probe location in the
array. Signals can be
compared between spots on a single array, or between arrays (such as a single
array that is
sequentially probed with multiple different probe molecules).
Computer algorithms can also be used for comparison between spots on a single
array or on
multiple arrays. In addition, the data from an array can be stored in a
computer readable form
Certain examples of automated array readers (scanners) will be controlled by a
computer
and software programmed to direct the individual components of the reader
(e.g., mechanical
components such as motors, analysis components such as signal interpretation
and background
subtraction). Optionally software may also be provided reader to control a
graphic user interface and
one or more systems for sorting, categorizing, storing, analyzing, or
otherwise processing the data
output of the reader.
To "read" an array according to this invention, an array that has been assayed
with a
detectable probe to produce binding (e.g., a binding pattern) can be placed
into (or onto, or below,
etc., depending on the location of the detector system) the reader and a
detectable signal indicative of
probe binding detected by the reader. Those addresses at which the probe has
bound to immobilized
polypeptide sample provide a detectable signal, e.g., in the form of
electromagnetic radiation. These
detectable signals could be associated with an address identifier signal,
identifying the site of the
complex. The reader gathers information from each of the addresses, associates
it with the address
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-23-
identifier signal, and recognizes addresses with a detectable signal as
distinct from those not
producing such a signal. The reader is also capable of detecting intermediate
levels of signal,
between no signal at all and a high signal, such that quantification of
signals at individual addresses
is enabled.
Certain readers that can be used to collect data from the arrays of this
invention, especially
those that have been probed using a fluorescently tagged molecule, will
include a light source for
optical radiation emission. The wavelength of the excitation light will
usually be in the UV or visible
range, but in some situations may be extended into the infra-red range. A beam
splitter can direct the
reader-emitted excitation beam into the object lens, which for instance may be
mounted such that it
can move in the x, y and z directions in relation to the surface of the array
substrate. The objective
lens focuses the excitation light onto the array, and more particularly onto
the (polypeptide) targets
on the array. Light at longer wavelengths than the excitation light is emitted
from addresses on the
array that contain fluorescently-labeled probe molecules (i.e., those
addresses containing a
polypeptide to which the probe binds).
In certain embodiments of the invention, the array may be movably disposed
within the
reader as it is being read, such that the array itself moves (for instance,
rotates) while the reader
detects information from each address. Alternatively, the array may be
stationary within the reader
while the reader detection system moves across or above or around the array to
detect information
from the addresses of the array. Specific movable-format array readers are
known and described, for
instance in U.S. Patent No. 5, 922,617, hereby incorporated in its entirety by
reference. Examples of
methods for generating optical data storage focusing and tracking signals are
also known (see, for
example, U.S. Pat. No. 5,461,599, hereby incorporated in its entirety by
reference).
For the electronics and computer control, a detector (e.g., a photomultiplier
tube, avalanche
detector, Si diode, or other detector having a high quantum efficiency and low
noise) converts the
optical radiation into an electronic signal. An op-amp first amplifies the
detected signal and then an
analog-to-digital converter digitizes the signal into binary numbers, which
are then collected by a
computer.
III. Examples
Example 1: Preparation of a UPA
Methods and Materials
To identify target proteins to which the transcriptional coactivator p52 will
bind, the protein
array system for which a target arrangement key is shown in Table 1 was
provided. The general
transcription factors, activators and coactivators arrayed were overexpressed
either in bacteria,
baculovirus or in mammalian cells and purified to near homogeneity as
previously described (Chiang
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-24-
et al., EMBO J., 12, 2749-2762, 1993; Kershnar et al., J. Biol. Chem., 18,
34444-34453, 1998; Luo
et al., Cell, 71, 231-241, 1992; Jackson and Tjian, Proc. Natl. Acad Sci. USA,
86, 1781-1785, 1989;
Ge et al., Methods Enrymol., 274, 57-71, 1996). The serine-arginine (SR)
protein fraction was
prepared from HeLa cell nuclear extracts essentially according to Zahler et
al. (Genes Dev., 6, 837-
847, 1992). GST-nucleolin fusion protein (GST-Nu, address 12e/fJ was prepared
by overexpressing
plasmid GST-HNB (provided by Dr M. Srivastava), which contains nucleolin
coding sequence
positions 290-707, in bacteria and purified on a glutathione-Sepharose column.
Glutathione S-
transferase fused to a HMK site (RRASV) (GST-K) (Ge et al., Mol. Cell, 2, 751-
759, 1998) was used
as a negative control in the experiments.
An average of 7.5 pmol (normalized by Bio-Rad protein assay, Bio-Rad,
Hercules, CA) of
each of the 48 highly purified proteins (or fractions) was spotted on a 12 x 8
cm nitrocellulose
membrane using a 96-well dot blot apparatus (Bio-Rad, Hercules, CA). This
apparatus provides
sample application to a membrane to form an array arranged in twelve rows and
eight columns. The
arrangement of the polypeptide targets in the array is shown in Table 1, which
corresponds to the
array results shown in Figures 1 and 2. Each sample was duplicated in two
adjacent wells to provide
a useful internal control.
Each sample was diluted to 100 pl with buffer A100 (100 mM KCI, 10% glycerol,
20 mM
HEPES Na pH 7.9, 0.2 mM EDTA, 10 mM 2-mercaptoethanol and 0.5 mM PMSF) and
duplicated in
two adjacent wells. Each well was rinsed with 2 x 500 pl buffer A100 and the
vacuum kept for 3-5
minutes. After removal from the dot blot apparatus, the protein array was
rinsed with two changes of
buffer A 100.
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-25-
Table 1 a
a b c d a f g h
1 (1) (2) (3) (4)
TFIIA TFIIA TFIIB TFIIB TBP TBP f:TFIID f:TFIID
2 (5) (6) (7) (8)
TFIIE TFIIE TFIIF TFIIF f:TFIIH f:TFIIHPoIII PoIII
3 (9) (10) (11) (12)
RXR RXR TR TR Oct 1 Oct Sp 1 Sp 1
1
4 (13) (14) (15) (16)
G4-94 G4-94 G4-147 G4-147G4-AH G4-AH G4-VP16 G4-VP16
(17) (18) (19) (20)
G4-CTF G4-CTF G4-Sp 1 G4-SpG4-E 1 A G4-EG4-IE G4-IE
1 1 A
6 (21 ) (22) (23) (24)
G4-Tat G4-Tat PC4-P PC4-P PC4-N PC4-N PC4-C PC4-C
7 (25) (26) (27) (2g)
PC4-4S PC4-0S PC4-m 1 PC4-mPC4-m2 PC4-m2PC4-m3 PC4-m3
1
8 (29) (30) (31) (32)
PC4-m4 PC4-m4 PC4-m5 PC4-m5PC4-m6 PC4-m6PC4-m7 PC4-m7
(33) (34) (35) (36)
PC4-wt PC4-wt 52
p p52 p75 p75 p75-C p75-C
10(37) (38) (39) (40)
p300-C p300-C PCAF PCAF PCAF-C PCAF-CTAF250 TAF250
(41 ) (42) (43) (44)
1 Topo I Topo Topo I Topo Topo I Topo Topo I Topo
1 I I I 1
(wt) (wt) (mt) (mt) (wt)* (wt)* (nati) (nati)
(45) (46) (47) (48)
12 SR SR GST-Nu GST-NuGST-K GST-K
ASF ASF (+nucl) (+nucl)
Abbremanons used in Table 1 are explained above, in the Abbreviations section
(IA).
Each sample was duplicated in two adjacent wells. The actual size of the
membrane is 12 X
8 cm (height X width) with eight columns and twelve rows.
Example 2: Removal of probe molecules from
the UPA.
Methods and Materials
The same universal protein array that was prepared in Example 1 was reused
with a protein
probe (Example 3), a dsDNA probe (Example 4), a ssDNA probe (Example 4), a RNA
probe
(Example 5) and a ligand probe (Example 6). After each use, the filter was
stripped with buffer A
containing 1 M (NH4)=S04 and 1 M urea at room temperature for 30-60 minutes.
Then the stripped
array was equilibrated with buffer A 100 before being incubated with another
probe.
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-26-
Example 3: Interaction with a protein probe.
Methods and Materials
Purified GST-K-p52 protein (Ge et al., Mol. Cell, 2, 751-759, 1998) was
labeled by heart
muscle kinase (HMK) in a 50 pl reaction containing 10 pg of substrate protein,
40 pCi [y-'ZP]ATP
and 10 U of the catalytic subunit of Ca-independent protein kinase A from
bovine heart (Sigma, St.
Louis, MO) at 30°C for 30 minutes. The'ZP-labeled protein was purified
through glutathione-
Sepharose beads to separate uncoupled free nucleotide. 1n the case of the
ASF/SF2 probe, pETI la-
6H(K)-ASF/SF2 was created by inserting the ASF/SF2 coding region into the
vector pETI 1 a-6H(K)
(Ge et al., Mol. Cell, 2, 751-759, 1998) and overexpressed in Escherichia coli
cells. Recombinant
protein was affinity purified and labeled by HMK in vitro as described above.
Pre-treatment took
place in buffer A100 containing 1% non-fat milk at room temperature for at
least 30 minutes. The
array was then incubated with 30-SO ng probe/ml buffer A100 (+1% milk) at
4°C for over 12 hours.
After incubation, the array was sequentially washed with three changes of
buffer A 100 ( 100 mM
IS KCl), A500 (500 mM KCI) and A1000 (1000 mM KCl). The resulting signals were
visualized by
autoradiography (exposure from 30 minutes to 10 hours) and quantified with a
densitometer
(Molecular Dynamics, Sunnyvale, CA).
Results
GST-K-p52 was labeled in vitro with [y-''-P]ATP by HMK (Ge et al., Mol. Cell,
2, 751-759,
1998) and further purified through glutathione-Sepharose beads. The protein
array was first treated
with buffer A100 containing 1% non-fat milk and then incubated with 3=P-
labeled GST-K-p52 as
described in Materials and Methods. The filter was extensively washed with
buffer A containing
100, 500 and 1000 mM KCl prior to each autoradiographic analysis. A low salt
wash (with 100 mM
KCl) allowed the detection of most possible interactions (Fig. lA), while a
high salt (with 500-1000
mM KCl) allowed the detection of highly specific and high affinity
interactions (Fig. I B). No
significant difference was found between the S00 and 1000 mM salt washes. The
relative affinity of
each tested protein for the probe could be measured with either a densitometer
or a phosphorimager
(Fig. 1 C). Among all 48 proteins (or fractions), the SR protein fraction
(addresses 12c/d) and the
recombinant GST-nucleolin (addresses 12e/f) had the highest affinities for the
transcriptional
coactivator p52.
It has previously been shown that, in addition to the ability to interact
specifically with a 34
kDa doublet corresponding to the splicing factor ASF/SF2, p52 could also
interact strongly with a
100 kDa protein found to be present in the SR fraction by far-western blot
analysis (Ge et al., Mol.
Cell, 2, 751-759, 1998). Protein microsequence analysis indicated that the 100
kDa band isolated
from the SR protein fraction contained two proteins, nucleolin and DNA
topoisomerase I (topo I). In
the present experiment, p52 strongly interacted with the recombinant GST-
nucleolin but not with
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-27-
topo I, either recombinant proteins expressed in baculovirus (Fig. 1,
addresses I la-f) or naturally
purified protein from mammalian cells (addresses I lg/h). This observation
demonstrates that p52
interacts with the nucleolin rather than the topo I present in the SR protein
fraction, which is
consistent with the recent observation that nucleolin is a component of the
multiprotein complex
associated with p52 in HeLa cells.
Nucleolin has been implicated in regulating pre-rRNA processing (Bouvet et
al., EMBO J.,
16, 5235-5246, 1997), pre-mRNA splicing (Ishikawa et al., MoL Cell. Biol., 13,
4301-4310, 1993), B
cell-specific transcription (Hanakahi et al., Proc. Natl. Acad. Sci. USA, 94,
3605-3610, 1997),
unwinding DNA, RNA or DNA-RNA duplexes (Tuteja et al., Gene, 28, 143-148,
1995) and
mediating cell doubling time in human cancer cells (Derenzini et al., Lab.
Invest., 73, 497-502,
1995). Like the splicing factor ASF/SF2, nucleolin also contains RNP type RNA-
binding domains as
well as RGG repeats (Bouvet et al., EMBO J., 16, 5235-5246, 1997; Valdez et
al., MoL Immunol.,
32, 1207-1213, 1995). Its activity can be modulated through mitosis-specific
phosphorylation by
p34cdc2 kinase or casein kinase II (Tuteja et al., Gene, 28, 143-148, 1995).
Therefore, it would be
interesting to further examine the biological significance of nucleolin
interaction with the general
transcriptional coactivator and splicing regulator p52.
In addition to GST-K-p52, other protein probes have also been tested in the
UPA system.
Figure 3 shows the binding activity of'=P-labeled splicing factor ASF/SF2, a
member of the SR
protein family, to 16 different selected proteins in a 4 by 4 array (Fig. 3A).
ASF/SF2 significantly
bound to five of the 16 proteins, including the affinity-purified TFIID
complex (Fig. 3B and C,
address 2d), retinoid-X receptor (address 3a), histone H1 (address 3c), co-
histones (address 3d) and
ASF/SF2 itself (address 4b). However, after washing the UPA with 500 mM KCI,
ASF/SF2
appeared to have the highest affinity for itself (Fig. 3C, address 4b), which
is in agreement with the
previous observation that in vitro translated ASF/SF2 could strongly bind to
GST-ASF/ SF2 in a GST
pull down assay (Xiao and Manley, EMBOJ., 17, 6359-6367, 1998). However,
ASF/SF2 also
showed high affinity for the TFIID complex. Since ASF/SF2 did not interact
with TBP (address 2c),
ASF/SF2 might interact directly with TBP-associated factors. Whether such an
interaction reflects
the function of TFIID or ASF/SF2 in transcription or pre-mRNA splicing or
coupling of these could
also to be investigated using the disclosed UPA technology. Taken together,
these experiments
demonstrate that UPA can be used to detect protein interactions with various
targets.
Using the same UPA, it is shown that PC4 with a single point mutation (Phe-
>Pro) at
position 77 lost both dsDNA- and ssDNA-binding activity (Fig. 2A and B,
addresses 8c/d), but still
retained RNA-binding activity (Fig. 2C, addresses 8c/d). In contrast,
phosphorylation of PC4 by
casein kinase II stimulated the DNA-binding activity (Fig. 2A and B, addresses
6c/d), but reduced its
RNA-binding activity (Fig. 2C, addresses 6c/d). These observations demonstrate
that UPA is an
effective method to map protein interaction domains and DNA- or RNA-binding
domains of a
protein.
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-28-
Example 4: Interaction with a DNA probe.
Methods and Materials
To test whether the UPA system could also be used to detect interactions with
other (e.g.,
biological) molecules, the same array was stripped (see Example 2) and
reprobed with a'=P-labeled
double-stranded oligonucleotide (64 bp) containing the adenovirus major late
core promoter
elements.
A double-stranded (ds) oligonucleotide (64 by with plus strand 5'-
GGGGGGCTATAAAA-
GGGGGTGGGGGCGCGTTCGTCCTCACTCTCTTCCGCATCGCTGTCTGCG and minus strand
5'-CCCTCGCAGACAGCGATGCGGAAGAGAGTGAGGACGAACGCGCCCCCACCCCCTTTT-
ATAGCCC) corresponding to the adenovirus major late promoter region from -39
to +29 was
labeled at the 3'-end of the minus strand with Klenow fragment in the presence
of ['=P]dCTP. After
labeling, the free nucleotides were separated from the probe by passing the
labeling reaction through
a G-50 nick column (Pharmacia Biotech, United Kingdom). Pre-treatment took
place with buffer A
containing 60 mM KC1, 2x Denhardt's solution and 25 ltg/ml poly(dG~dC) (Sigma,
St. Louis, MO) at
room temperature for 30 minutes. For interaction, 5 ng/ml of 3=P-labeled
double-stranded (ds)DNA
was added to the same buffer and incubation was carried out at 4° C for
> 12 hours. The array was
then sequentially washed with three changes of buffer A 100, A500 and A 1000
followed by
autoradiography and quantification.
To analyze the array with a single-stranded (ss)DNA probe, the 64-mer minus
strand of the
dsDNA probe was labeled at the 5'-end by T4 polynucleotide kinase in the
presence of y-[''-P]ATP.
Other conditions were exactly the same as those for the dsDNA probe.
Results
The results shown in Figure 2A indicate that, after washing with 500 mM salt,
phosphorylated PC4 (PC4-P, addresses 6c/d), an inactive form of a previously
described
transcriptional coactivator (Ge et al., Proc. Natl. Acad. Sci. USA, 91, 12691-
12695, 1994), purified
from HeLa cells had the highest affinity for the tested dsDNA probe among 48
samples (see
quantification in Table 2). PC4-P had 3- to 5-fold higher affinity for dsDNA
compared to other PC4
derivatives, including wild-type PC4 (addresses 9a/b). In contrast, a single
amino acid change at
position 77 (Phe-->Pro) completely abolished the dsDNA binding ability of PC4
(addresses 8c/d).
These results are in agreement with the observations reported recently using
gel mobility shift assays
that phosphorylated PC4 bound bubble DNA with higher affinity and the region
around position 77
was critical for the DNA-binding activity of PC4 (Werten, et al., EMBO J., 17,
5103-51 11, 1998).
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-29-
Although it is known that TBP can specifically bind the present probe, the
signal is
relatively weak compared to other DNA-binding proteins. This result is
consistent with the
observation from gel mobility shift assays that the binding activity of TBP to
TATA box-containing
DNA was barely detectable. However, it can be significantly enhanced by the
presence of another
transcription factor, TFIIA (Orphanides et al., Gerres Dev., 10, 2657-2683,
1996). On the other hand,
however, many other general (non-sequence-specific) DNA-binding proteins had
much stronger
signals than TBP, suggesting that the present system may not be suitable for
determining the binding
activity of sequence-specific DNA-binding (and/or RNA-binding) proteins.
ASF/SF2 was identified
as an RNA-binding protein playing an essential roles) in pre-mRNA splicing.
Both the recombinant
ASF/SF2 (addresses 12a/b) and the native ASF/SF2-containing SR protein
fraction (12c/d) bound
dsDNA as well as ssDNA (see below) very strongly, even tighter than most of
the DNA-binding
proteins tested (see quantification in Table 2), indicating that ASF/SF2 is
also a DNA-binding
protein. After the array was analyzed with a ssDNA probe (Fig. 2B), although
several differences
were observed, the overall pattern of protein-ssDNA interactions was similar
to that of protein-
dsDNA interactions, suggesting that most DNA-binding proteins are capable of
binding both dsDNA
and ssDNA.
Example 5: Interaction with a RNA probe.
Methods and Materials
An SV40 early pre-mRNA was synthesized in vitro from the plasmid pSVi66 by SP6
RNA
polymerase as previously described (Ge et al., Mol. Cell, 2, 751-759, 1998).
Interaction was carried
out at 4° C for > 12 hours in the presence of 20 mM HEPES Na pH 7.9, 5%
glycerol, 10 mM 2-
mercaptoethanol, 0.2 mM EDTA Na pH 8.0, 60 mM KCI, 2 mM MgCI,, 0.5 mg/ml BSA,
25 pg/ml
tRNA and -5 ng/ml 3'P-labeled SV40 early pre-mRNA. The array was then
sequentially washed and
visualized by autoradiography as described for the DNA probes.
Results
This protein array system was also used successfully to analyze interactions
with an RNA
probe transcribed from the SV40 early region-containing plasmid pSVi66 (Ge et
al., Mol. Cell, 2,
751-759, 1998). Several interesting observations were revealed (see Fig. 2C).
First, phosphorylation
by casein kinase II in vivo apparently decreased the affinity of PC4 for the
RNA probe (addresses
6c/d in Fig. 2C; see also Table 2), although it increased the affinity of PC4
for both the dsDNA and
ssDNA probes (addresses 6c/d in Fig. 2A and B). Second, in contrast to the DNA-
binding activity,
the RNA-binding activity of PC4 was not significantly affected by the mutation
at position 77
(addresses 8c/d in Fig. 2C). Third, both p52 and p75 strongly bind the RNA
probe (addresses 9c-h in
Fig. 2C), but did not significantly bind either the dsDNA or ssDNA probe in
this assay (addresses 9c-
CA 02365431 2001-08-27
WO 00/54046 PCT/US00106244
-30-
h in Fig2A and B). Finally, PCAF, a p300/CBP-associated factor that functions
as a histone
(Ogryzko et al., Cell, 87, 953-959, 1996), could bind the RNA probe very
strongly (addresses lOc-f
in Fig. 2C; see Table 2 for quantification), suggesting a possible role of
PCAF in RNA metabolism.
Example 6: Interaction with a ligand probe
Methods and Materials
t.-3,5,3'-['ZSI]Triiodothyronine (T3) was purchased from NEN (Boston, MA,
catalog no.
NEX 1 l OH). The interaction conditions were essentially the same as for the
RNA probe except that
tRNA was omitted and 0.3 ~tCi/ml ['-'SI]T3 was added instead of the RNA probe.
Results
This protein array system was also used successfully to analyze interactions
with a''-SI-
labeled ligand, T3. Only the recombinant thyroid hormone receptor bound''-51-
labeled T3 strongly
and specifically (addresses 3c/d in Fig. 2D).
Table 2
ds ss
PositionProtein/sourcep52DNA"DNA"RNA"Function/Description
"
1 1 alb TFIIA/bacteria12.30.9 15.10.3 class II gene transcription
a
2 1 c/d TFIIB/bacteria0 0 0.2 0 class II gene transcription
"
3 le/f TBP/bacteria"5.10.5 5.9 35.8class II gene transcription
4 1 g/h f:TFIID/HeLa 8 3.3 1.9 12.4class II gene transcription
b
5 2alb TFIIE/bacteria0 0 0.2 0.6 class II gene transcription
"
6 2c/d TFIIF/bacteria0:70 0.3 1.4 class 11 gene transcription
~
7 2e/f f:TFIIH/HeLa 1.42.5 0.4 4.7 class II gene transcription
8 2g/h RNA pol II/HeLa9 22.410.86.1 class 11 gene transcription
A
9 3alb RXR/bacteria 30 I 37.934.6activator (retinoid-X
1.2 receptor)
103c/d TR/bacteria 16.329.327.552.4activator (thyroid
hormone receptor)
113e/f Octl/HeLa 10.53.5 4.7 9 B cell specific activator
d
123g/h Spl/HeLa ' 3.22.6 2.2 1.3 class 11 gene activator
134alb G4-94/bacteria0.50.2 1 40.2activator (DNA binding
domain)
144c/d G4-147/bacteria3 0.1 0.1 8.7 activator (DNA binding
domain)
I 4e/f G4-AH/bacteria1.90.5 0.3 3.8 class II gene activator
S a
164g/h G4-VP16/bacteria1.51.3 0 0 class II gene activator
175alb G4-CTF/bacteria0.90 0.1 8.2 class II gene activator
185c/d G4-Spl/bacteria4.516.69.3 76.7class II gene activator
195e/f G4-ElA/bacteria1.81.2 0 8 class II gene activator
205g/h G4-IE/bacteria4 0.8 0 0.9 class II gene activator
216alb G4-Tat/bacteria2.31.6 3.4 15.7class II gene activator
226c/d PC4-P/HeLa 5.4100 77.514.5coactivator (phosphorylated)
'
236e/f PC4-N/bacteria16.82.3 0.8 10.6PC4 (C-terminal deletion)
246g/h PC4-C/bacteria30.31.6 0.1 37.5PC4 (N-terminal deletion)
257alb PC4-OS/bacteria3.935 41.687 PC4 (CKII sites mutated)
267c/d PC4-ml/bacteria3.923.244.475.1PC4 K231/K29A)
~ 7e/f PC4-m2/bacteria10.423.648.371.9PC4 (K35I/K41A)
27~ I
~
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-31-
287g/h PC4-m3/bacteria5.4 21.741.261.2PC4 (R27A/K281/K29A)
298alb PC4-m4/bacteria3.8 31.545 700 PC4 (R47N/K531/R59A)
308c/d PC4-m5/bacteria2.2 1.44.5 89.5PC4 (F77P)
318e/f PC4-m6/bacteria2.8 37 66.787.3PC4 (K29A)
328g/h PC4-m7/bacteria0.6 27.456.975.4PC4 (K41A)
339alb PC4-wt/bacteria2.8 37 66.772.7transcriptional coactivator
(wild type)
349c/d p52/bacteria 2.1 0.80 49.8transcriptional coactivator
g
359e/f p75/bacteria 5 1.40 54.6transcriptional coactivator
g
369g/h p75-C/bacteria0 1.30.7 66.2coactivator (C-terminal
g 326-530)
37l0albp300-C/baculovirus"4.6 11.611.314.5transcriptional coactivator
(1135-2414)
38I PCAF/baculovirus2.5 2.414.598.5histone acetyltransferse
Oc/d "
39l0e/fPCAF-C/baculovirus5.3 8.48 74.3PCAF (352-832)
"
40lOg/hTAF250/baculovirus'1.7 I.10.6 10.9transcriptional coactivator
411 Topo I/baculovirus1.1 1 0.9 12.4DNA unwinding/transcription
1 ~
alb
4211 Topo I/baculovirus4.7 2.42.1 12.6Topo I (Y723F)
c/d ~
4311 Topo I/baculovirus5 1.61.1 6 Topo I (wild type)
e/f k
441 Topo I/HeLa 2.3 1.70.7 76.5native Topo I
Ig/h
45l2albASF/SF2/bacteria13.533.589 40.4splicing factor (SR
~ protein)
4612c/dSR/I-IeLa' S5 80 100 9.7 splicing factors (SR
family)
4712e/fGST-Nu/bacteria'"100 0.43.3 8.3 pre-rRNA processing
factor (nucleolin)
~ 12g/hGST-K/bacteria2.8 0.41.5 1.8 negative control
48~ ~ ~
~
Ge et al., Methods Enrymol., 274, 57-71, 1996
" Chiang et al., EMBO J., 12, 2749-2762, 1993
' Ivershnar et al., J Biol. Chem., 18, 34444-34453, 1998
d Luo e! al., Cell, 71, 231-241, 1992
' Jackson and Tjian, Proc. Natl. Acad. Sci. USA, 86. 1781-1785, 1989
r Ge et al., Proc. Natl. Acad. Sci. USA, 91, 12691-12695, 1994
g Ge et al., Mol. Cell, 2, 751-759, 1998
" Ogryzko et al., Cell, 87, 953-959, 1996
' Mizzen et al., Cell, 87, 1261-1270, 1996
' Wang and Roeder, Mol. Cell, I, 749-757, 1998
'' Pourquier et al., J Biol. Chem., 272, 26441-26447. 1997
' Zahler et al., Genes Dev., 6, 837-847, 1992
'" Valdez et al., Mol. Immunol., 32, 1207-1213, 1995
1$ " Relative binding affinity of the specified probe to each target on the
array, normalized to the highest signal for each probe.
° TopoGEN Inc., Columbus, OH
The number, position (address), name/source (and related reference),
affinities for each probe
and known function for each of the 48 target polypeptides are indicated. The
highest affinities of the
individualized proteins for each probe molecule [GST-nucleolin for p52
(addresses 12e/f), PC4-P for
the dsDNA (addresses 6c/d), SR for the ssDNA (addresses 12c/d) and PC4-m4 for
the RNA
(addresses 8a/b)] where normalized to 100 and are indicated in bold.
Example 7: Kits
UPAs as disclosed herein can be supplied in the form of a kit for use in
molecule binding
analyses. In such a kit, at lest one polypeptide array is provided. The kit
will also include
instructions, usually written instructions, to assist the user in probing the
array. Such instructions can
optionally be provided on a computer readable medium.
Kits may additionally include one or more buffers for use during assay of the
provided
array. For instance, such buffers may include a low stringency, a high
stringency wash, and/or a
CA 02365431 2001-08-27
WO 00/54046 PCT/US00/06244
-32-
stripping solution. These buffers may be provided in bulk, where each
container of buffer is large
enough to hold sufficient buffer for several probing or washing or stripping
procedures.
Alternatively, the buffers can be provided in pre-measured aliquots, which
would be tailored to the
size and style of array included in the kit.
Certain kits may also provide one or more containers in which to carry out
array-probing
reactions.
Kits may in addition include either labeled or unlabeled control probe
molecules, to provide
for internal tests of either the labeling procedure or probing of the UPA, or
both. The control probe
molecules may be provided suspended in an aqueous solution or as a freeze-
dried or lyophilized
powder, for instance. The containers) in which the controls are supplied can
be any conventional
container that is capable of holding the supplied form, for instance,
microfuge tubes, ampoules, or
bottles. In some applications, control probes may be provided in pre-measured
single use amounts in
individual, typically disposable, tubes or equivalent containers.
The amount of each control probe supplied in the kit can be any particular
amount,
depending for instance on the market to which the product is directed. For
instance, if the kit is
adapted for research or clinical use, sufficient control probes) likely will
be provided to perform
several controlled analyses of the array. Likewise, where multiple control
probes are provided in one
kit, the specific probes provided will be tailored to the market. In certain
embodiments, a plurality of
different control probes will be provided in a single kit, each control probe
being from a different
class of molecules (e.g., a nucleic acid probe, a protein probe, a ligand
probe, etc.).
In some embodiments of the current invention, kits may also include the
reagents necessary
to carry out one or more probe-labeling reactions. The specific reagents
included will be chosen in
order to satisfy the end user's needs, depending on the type of probe molecule
(e.g., nucleic acid,
polypeptide, or ligand) and the method of labeling (e.g., radiolabel
incorporated during probe
synthesis, attachable fluorescent tag, etc.).
Further kits are provided for the labeling of probe molecules for use in
assaying arrays
provided herein. Such kits may optionally include an array to be assayed by
the so labeled probe
molecules. Other components of the kit are largely as described above for kits
for the assaying of
UPAs.
In view of the many possible embodiments to which the principles of our
invention may be
applied, it should be recognized that the illustrated embodiments are only a
certain examples of the
invention and should not be taken as a limitation on the scope of the
invention. Rather, the scope of
the invention is defined by the following claims. We therefore claim as our
invention all that comes
within the scope and spirit of these claims.
