Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-1-
Lawsonia derived gene and related hemolysin polypeptides, peptides and
proteins and their uses
FIELD OF THE INVENTION
The present invention relates generally to therapeutic compositions for the
treatment
and/or prophylaxis of intestinal disease conditions in animals and birds
caused or
exacerbated by Lawsonia intracellularis or similar or otherwise related
microorganism.
In particular, the present invention provides a novel gene derived from
Lawsonia
intracellularis which encodes an immunogenic hemolysin peptide, polypeptide or
protein. The hemolysin polypeptide described herein or a peptide homologue,
analogue or derivative thereof is particularly useful as an antigen in vaccine
preparation for conferring humoral immunity against Lawsonia intracellularis
and
related pathogens in animal hosts. The present invention is also directed to
methods
for the treatment and/or prophylaxis of such intestinal disease conditions and
to
diagnostic agents and procedures for detecting Lawsonia intracellularis or
similar or
otherwise related microorganisms.
GENERAL
Bibliographic details of the publications numerically referred to in this
specification are
collected at the end of the description. All patents, patent applications, and
publications
cited herein are incorporated by reference in their entirety.
Reference hereinafter to "Lawsonia intracellularis" or its abbreviation "L.
intracellularis"
includes all microorganisms similar to or otherwise related to this
microorganism, as
described by Stills (1991 ) or Jones et a1.(1997) or Lawson et al. (1993) or
McOrist et
al. (1995).
As used herein, the word "tlyA", or the term "tlyA gene", shall be taken to
refer to the
gene encoding the hemolysin polypeptide of th$ present invention. It shall
also be
understood that the term "TIyA polypeptide" refers to the hemolysin
polypeptide of the
invention.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_7_
As used herein the term "derived from" shall be taken to indicate that a
specified
product, in particular a macromolecule such as a peptide, polypeptide,
protein, gene
or nucleic acid molecule, antibody molecule, Ig fraction, or other
macromolecule, or a
biological sample comprising said macromolecule, may be obtained from a
particular
source, organism, tissue, organ or cell, albeit not necessarily directly from
that source,
organism, tissue, organ or cell.
Throughout this specification, unless the context requires otherwise, the word
"comprise", or variations such as "comprises" or "comprising", will be
understood to
imply the inclusion of a stated step or element or integer or group of steps
or elements
or integers but not the exclusion of any other step or element or integer or
group of
elements or integers.
Those skilled in the art will appreciate that the invention described herein
is susceptible
to variations and modifications other than those specifically described. It is
to be
understood that the invention includes all such variations and modifications.
The
invention also includes all of the steps, features, compositions and compounds
referred to or indicated in this specification, individually or collectively,
and any and all
combinations or any two or more of said steps, features, compositions and
compounds.
The present invention is not to be limited in scope by the specific
embodiments
described herein, which are intended for the purposes of exemplification only.
Functionally equ~.alent products, compositions and methods are clearly within
the
scope of the invention, as described herein.
BACKGROUND OF THE INVENTION
The meat-producing sector of the agricultural industry is dependant upon the
health
of its livestock and there is a need to maintain disease-free livestock for
human
consumption. The industry is subject to rapid economic downturn in response to
disease conditions adversely affecting livestock and the quality of meat
products
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
derived therefrom, including those diseases which may potentially be
transmitted to
humans. It is important, therefore, to have well defined treatments and
prophylactic
and diagnostic procedures available to deal with infections or potential
infections in
livestock animals and humans.
J
Meat products derived from porcine and avian species are significant
commercial
products in the agriculture industry. In particular, pigs form a major
component of the
meat industry. However, pigs are sensitive to a wide spectrum of intestinal
diseases
collectively referred to as porcine proliferative enteropathy (PPE). These
diseases
have previously been known as intestinal adenomatosis complex (Barker and van
Drumel, 1985), porcine intestinal adenomatosis (PIA), necrotic enteritis
(Rowland and
Lawson, 1976), proliferative haemorrhagic enteropathy (Love and Love, 1977),
regional ileitis (Jonsson and Martinsson, 1976), haemorrhagic bowel syndrome
(O'Neil,
1970), porcine proliferative enteritis and Campylobacterspp - induced
enteritis (Straw,
1990).
There are two main forms of PPE: a non-haemorrhagic form represented by
intestinal
adenomatosis which frequently causes growth retardation and mild diarrhoea;
and a
haemorrhagic form, which is often fatal, represented by proliferative
haemorrhagic
enteropathy (PHE), where the distal small intestine lumen becomes engorged
with
blood. PPE has been reported in a number of animal species including pigs
(McOrist
et al, 1993), hamsters (Stills, 1991 ), ferrets (Fox et al, 1989), guinea pigs
(Elwell et al,
1981 ), rabbits (Schodeb and Fox, 1990) as well as avian species (Mason et al,
1998).
The causative organism of PPE is a Campylobacter-like organism referred to
herein
as "Lawsonia intracellularis" (McOrist et al, 1995). The organism has also
been
previously referred to as Ileal symbiont intracellularis (Stills, 1991 ). PPE-
like diseases
in pigs may also be caused by other pathogens such as various species of
Campylobacter (Gebhart et al, 1983).
Lawsonia intracellularis is an intracellular, possibly obligate intracellular,
bacterium.
It can only be cultured in vitro with tissue culture cells (Jones et al.,
1997; Lawson et
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
al., 1993; McOrist et al, 1995; International Patent Application No.
PCT/US96/09576).
L. intracellularis is located in the cytoplasm of the villus cells and
intestinal crypt cells
of infected animals. Pigs suffering from PPE are characterised by
irregularities in the
villus cells and intestinal crypt structure with epithelial cell dysplasia,
wherein crypt
abscesses form as the villi and intestinal crypts become branched and fill
with
inflammatory cells.
PPE is a significant cost component associated with the pig industry,
especially in
terms of stock losses, medication costs, reduced growth rates of pigs and
increased
feed costs. PPE also contributes to downstream indirect costs in, for example,
additional labour costs and environmental costs in dealing with antibiotic
residue
contamination, and in control measures to prevent the organism from being
passed on
or carried to other animals or humans.
Current control strategies for PPE rely on the use of antibacterials. However,
such a
strategy is considered to only be short to medium term, especially since
governmental
regulatory pressures tend to discourage animal husbandry practices which
involve the
use of prophylactic antibiotics. There is a need, therefore, to develop
effective, safe
and low cost alternatives to the use of antibiotics and, in particular, to
develop vaccine
preparations capable of conferring protective immunity against Lawsonia
intracellularis
infection in livestock animals.
The most effective vaccine preparations are generally comprised of a highly
antigenic
component, such as a peptide, polypeptide, protein or other macromolecule
whilst is
derived from the pathogenic organism against which the vaccine is directed,
wherein
said antigenic component produces little or no contraindications when
administered to
a susceptible host animal, and produces little or no antigenic cross-
reactivity with
desirable organisms, such as non-pathogenic organisms that are a part of the
normal
flora of the intestinal tract or other tissues of said host animal. In
summary, an
effective vaccine preparation must be immunogenic, specific and safe.
Accordingly, there is a need to identify highly immunogenic antigens produced
by the
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_5_
bacterium Lawsonia intracellularis.
International Patent Application No. PCT/AU96/00767 describes several L.
intracellularis partial genetic sequences, and partial polypeptides encoded
thereby.
However, there is a need to further identify polypeptide immunogens produced
by the
bacterium L. intracellularis and immunogenic peptides derived therefrom,
including
those immunogens which are genus- or species-specific, for use in improved
vaccine
compositions. The presently-described invention provides such immunogens.
SUMMARY OF THE INVENTION
One aspect of the present invention is directed to an isolated or recombinant
immunogenic polypeptide which comprises, mimics or cross-reacts with a B-cell
or T-
cell epitope of Lawsonia spp. Preferably, the isolated or recombinant
immunogenic
polypeptide is selected from the group consisting of the following:
(i) a peptide, oligopeptide or polypeptide which comprises an amino acid
sequence which has at least about 70% sequence identity overall to the amino
acid sequence set forth in SEQ ID NO: 1;
(ii) a peptide, oligopeptide or polypeptide which comprises an amino acid
sequence having at least about 50% sequence identity to about amino acid
residues 1 to 50 of SEQ ID NO: 1 ; or
(iii) a homologue, analogue or derivative of (i) or (ii), which mimics a B-
cell
or T-cell epitope of Lawsonia spp.
In a preferred embodiment, the polypeptide comprises or consists esse:~tially
of the
'_'S amino sequence of SEQ ID NO: 1, or about amino acids 1 to 50 thereof.
A further aspect of the present invention provides a vaccine composition for
the
prophylaxis or treatment of infection in an animal, such as a pig or bird, by
L.
intracellularis or a similar or otherwise related microorganism, said vaccine
composition
comprising an immunologically effective amount of an immunogenic component
which
comprises an isolated or recombinant polypeptide having at least about 70%
overall
sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, or at
least
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-6-
about 50% overall sequence identity to amino acid residues 1 to 50 of SEQ ID
NO: 1
or an immunogenic homologue, analogue or aenvanve merem mm~. m
immunologically cross-reactive with Lawsonia intracellularis; and one or more
carriers,
diluents and/or adjuvants suitable for veterinary or pharmaceutical use.
In a preferred embodiment, the polypeptide of the vaccine composition
comprises or
consists essentially of the amino acid sequence of SEQ ID NO: 1 or about amino
acids
1 to 50 thereof.
A further aspect of the invention extends to an immunologically interactive
molecule,
such as an antibody or antibody fragment, which is capable of binding to the
immunogenic polypeptide of the invention.
A further aspect of the invention provides a method of diagnosing infection of
an
animal by Lawsonia intracellularis or a related microorganism, said method
comprising
the steps of contacting a biological sample derived from said animal with an
immunologically interactive molecule of the present invention for a time and
under
conditions sufficient for a complex, such as an antigen:antibody complex, to
form, and
then detecting said complex formation.
A further aspect of the present invention contemplates a method of determining
whether or not an animal has suffered from a past infection, or is currently
infected, by
Lawsonia intracellularis or a related microorganism, said method comprising
contacting
a tissue or fluid sample, such as blood or serum derived from said animal,
with the
immunogenic polypeptide of the invention for a time and under conditions
sufficient for
a complex, such as an antigen:antibody complex, to form, and then detecting
said
complex formation.
A further aspect of the present invention provides an isolated nucleic acid
molecule
which comprises a sequence of nucleotides that encodes, or is complementary to
a
nucleic acid molecule that encodes, a peptide, oligopeptide or polypeptide
selected
from the following:
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
(i) a peptide, oligopeptide or polypeptide which comprises an amino acid
sequence which has at least about 70% overall sequence identity to the amino
acid sequence set forth in SEQ ID NO: 1;
(ii) a peptide, oligopeptide or polypeptide which comprises an amino acid
sequence having at least about 50% overall sequence identity to amino acid
residues 1 to 50 of SEQ ID NO: 1; or
(iii) a homologue, analogue or derivative of (i) or (ii), which mimics a B-
cell
or T-cell epitope of Lawsonia spp.
In a preferred embodiment, the isolated nucleic acid molecule comprises the
nucleotide sequence set forth in SEQ ID NO: 2, or at least that portion of SEQ
ID NO:
2 encoding amino acid residues 1 to 50 of SEQ ID NO: 1, or a degenerate
variant
thereof, or has at least about 70% sequence identity to all or a part thereof.
A still further aspect of the invention provides a diagnostic method of
detecting
Lawsonia intracellularis or related microorganism in a biological sample
derived from
an animal subject, said method comprising the steps of hybridising one or more
polynucleotide or oligonucleotide probes or primers derived from the
nucleotide
sequence set forth in SEQ ID NO: 2 or a complementary nucleotide sequence
thereof,
or a homologue, analogue or derivative thereof, to said sample, and then
detecting
said hybridisation using a detection means. The detection means according to
this
aspect of the invention is any nucleic acid-based hybridisation or
amplification reaction.
A further aspect of the invention provides an isolated probe or primer derivcd
from
SEQ ID NO: 2 or a complementary nucleotide sequence thereto.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a schematic representation comparing the deduced amino acid
sequence
of Lawsonia intracellularis (L. int) hemolysin to the amino acid sequences of
hemolysin
polypeptides derived from Serpulina (Treponema) hyodysenteriae (S. hyo),
Mycobacterium tuberculosis (M.tub), Aquifex aeolicus (A.aeo), Borrelia
burgdorferi
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-g_
(B.bur), Helicobacter pylori (H. pyl), Synechocystis sp. (Synec) and Bacillus
subtilis
YqxC (B. sub). Gaps have been introduced to optimise the alignment. Residues
that
are identical in all eight sequences appear in boldface. The L.
intracellularis
hemolysin sequence (SEO ID NO: 1 ) was deduced by translation of the
nucleotide
sequence of the tlyA gene set forth in SEQ ID N0:2.
DETAILED DESCRIPTION OF THE INVENTION
In work leading up to the present invention, the inventors sought to identify
immunogenic proteins of Lawsonia intracellularis for use in vaccines for the
prophylaxis
and treatment of PPE in animals, including pigs and birds.
Accordingly, one aspect of the present invention is directed to an isolated or
recombinant immunogenic polypeptide which comprises, mimics or cross-reacts
with
a B-cell or T-cell epitope of Lawsonia spp.
Epitopes of Lawsonia spp. may be B cell epitopes or T-cell epitopes. It is
well-known
that antibody-binding sites (B-cell epitopes) involve linear as well as
conformational
epitopes (van Regenmortel, 1992). B-cell epitopes are predominantly
conformational.
In contrast, T-cells recognize predominantly linear epitope sequences in
combination
with MHC class II molecules.
A precise identification and careful selection of epitopes of Lawsonia spp.
facilitates
the development of diagnostic reagents and vaccine compositions for the
effective
treatment or prophylaxis of Lawsonia infections. Epitope identification and
characterization (i.e., determination of the molecular weight, amino acid
sequence, and
structure of epitopes of Lawsonia spp.) may be performed using art-recognised
techniques. For the detection of conformational epitopes, degrading and
denaturing
of the epitope molecule must be avoided in order to conserve the three-
dimensional
structure, because the antigen-antibody reaction will be diminished if the
secondary
structure of the epitope is altered significantly. In practice, the
characterisation and
isolation of linear non-conformational epitopes is easier, because any
immunoreactive
regions are contained within a single peptide fragment or single amino acid
sequence
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-9-
which is capable of being purified under a range of conditions.
Both non-conformational and conformational epitopes may be identified by
virtue of
their ability to bind detectable amounts of antibodies (such as IgM or IgG)
from sera
of animals immunised against or infected with Lawsonia spp. and, in particular
L.
intracellularis, or an isolated polypeptide derived therefrom or,
alternatively, by virtue
of their ability to bind detectable amounts of antibodies in a purified Ig
fraction derived
from such sera. The antibodies may be derived from or contained within pools
of
polyclonal sera, or may be monoclonal antibodies. Antibody fragments or
recombinant
antibodies, such as those expressed on the surface of a bacteriophage or virus
particle, such as in a phage display library, may also be employed.
The determination of T-cell epitopes is performed by analysing the ability of
the epitope
peptides to induce the proliferation of peripheral blood lymphocytes or T-cell
clones.
The identification of T-cell epitopes is accomplished using a variety of
methods as
know in the art, including the use of whole and fragmented native or
recombinant
antigenic protein, as well as the more commonly employed "overlapping peptide"
method. In the latter method, overlapping peptides which span the entire
sequence of
a polypeptide derived from Lawsonia spp. are synthesized and tested for their
capacity
to stimulate T-cell cytotoxic or proliferative responses in vitro.
Structure determination of both conformational non-linear and non-
conformational
linear epitopes may be performed by nuclear magnetic resonance spectroscopy
(NMR)
and X-ray crystallographic :analysis. The determination of epitopes using X-
ray
?5 techniques requires the protein-antibody complex to be crystallized,
whereas NMR
allows analysis of the complex in a liquid state. NMR measures the amount of
amino
acids as well as the neighbourhood of protons of different amino acid
residues,
wherein the alternating effect of two protons along the carbon backbone is
characteristic of a particular epitope.
A successful method to recognize non-conformational linear epitopes is the
immunoblot and in particular, the Western blot. Peptides may be generated from
a
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-10-
complete Lawsonia spp. polypeptide by digestion with site-specific proteases,
such
as trypsin or chymotrypsin, and the peptides generated thereby can be
separated
using standard electrophoretic or chromatographic procedures. For example,
after
electrophoresis according to molecular weight using SDS/PAGE
(SDS/polyacrylamide
gel electrophoresis) and/or according to isoelectric point using IEF
(isoelectric
focussing) or alternatively, by two-dimensional electrophoresis, the peptides
can be
transferred to immobilizing nylon or nitrocellulose membranes and incubated
with sera
raised against the intact polypeptides. Peptides that comprise immunogenic
regions
(i.e., B-cell or T-cell epitopes) are bound by the antibodies in the sera and
the bound
antibodies may be detected using secondary antibodies, such as anti-IgG
antibodies,
that have been labelled radioactively or enzymatically. The epitopes may then
be
characterised by purification based upon their size, charge or ability to bind
specifically
to antibodies against the intact polypeptide, using one or more techniques,
such as
size-exclusion chromatography, ion-exchange chromatography, affinity
chromatography or ELISA amongst others. After purification of the epitope,
only one
band or spot should be detectable with gel electrophoresis. The N-terminal or
total
sequencing of the peptide offers the possibility to compare the peptide with
known
proteins in databases.
Several computer-driven algorithms have now been devised to search for T-cell
epitopes in proteins (Margalit et al, 1987; Vajda and C. DeLisi, 1990; Altuvia
et al.,
1995; Parker et x!.1994; De Groot et x1.,1995; Gabriel et al, 1995; Meister et
al., 1995).
These algorithms search the amino acid sequence of a given protein for
characteristics
believed to be common to immunogenic peptides, locating regions that are
likely to
induce a cellular immune response in vitro. Computer-driven algorithms can
identify
regions of a Lawsonia spp. polypeptide that contain epitopes and are less
variable
among different isolates. Alternatively, computer-driven algorithms can
rapidly identify
regions of each isolates more variable proteins that should be included in a
multivalent
vaccine.
The AMPHI algorithm (Margalit et x1.,1987), which is based on the periodicity
of T cell
epitopes, has been widely used for the prediction of T-cell antigenic sites
from
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
sequence information alone. Essentially, AMPHI describes a common structural
pattern of MHC binding motifs, since MHC binding motifs (i.e., patterns of
amino acids
that appear to be common to most of the peptides that bind to a specific MHC
molecule) appear to exhibit the same periodicity as an alpha helix.
Identification of T-
cell epitopes by locating MHC binding motifs in an amino acid sequence
provides an
effective means of identifying immunogenic epitopes in diagnostic assays.
The EpiMer algorithm (Meister et al., 1995; Gabriel et al., 1995; De Groot et
al., 1995)
locates clustered MHC binding motifs in amino acid sequences of proteins,
based
upon the correlation between MHC binding motif-dense regions and peptides that
may
have the capacity to bind to a variety of MHC molecules (promiscuous or
multi-determinant binders) and to stimulate an immune response in these
various MHC
contexts as well (promiscuous or multi-determinant epitopes). The EpiMer
algorithm
uses a library of MHC binding motifs for multiple class I and class II HLA
alleles to
predict antigenic sites within a protein that have the potential to induce an
immune
response in subjects with a variety of genetic backgrounds. EpiMer locates
matches
to each MHC-binding motif within the primary sequence of a given protein
antigen. The
relative density of these motif matches is determined along the length of the
antigen,
resulting in the generation of a motif-density histogram. Finally, the
algorithm identifies
protein regions in this histogram with a motif match density above an
algorithm-defined
cutoff density value, and produces a list of subsequences representing these
clustered, or motif-rich regions. The regions selected by EpiMer may be more
likely to
act as multi-determinant binding peptides than randomly chosen peptides from
the
same antigen, due to their concentration of MHC-binding motif matches. The
selection
of regions that are MHC binding motif-dense increases the likelihood that the
predicted
peptide contains a "valid" motif, and furthermore, that the reiteration of
identical motifs
may contribute to peptide binding.
Additional MHC binding motif-based algorithms have been described by Parker et
a1.(1994) and Altuvia et a1.(1995). In these algorithms, binding to a given
MHC
molecule is predicted by a linear function of the residues at each position,
based on
empirically defined parameters, and in the case of the Altuvia et a1.(1995)
algorithm,
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-12-
known crystallographic structures may also be taken into consideration.
Recombinant methods offer the opportunity to obtain well characterized
epitopes of
high purity for the production of diagnostic reagents and epitope-specific
vaccine
formulations (Mohapatra et al., 1995). Based upon the amino acid sequence of a
linear
epitope and identification of the corresponding nucleotide sequence encoding
same,
polymerase chain reaction (PCR) may be performed to amplify the epitope-
encoding
region from cDNA. After cloning and expression in a suitable vector/host
system, a
large amount of epitopes of high purity can be extracted. Accordingly, the
present
invention clearly extends to both isolated non-recombinant polypeptides and
recombinant polypeptides in an impure or isolated form.
The term "polypeptide" as used herein shall be taken to refer to any polymer
consisting
of amino acids linked by covalent bonds and includes within its scope full-
length
proteins and parts or fragments thereof such as, for example, oligopeptides
and short
peptide sequences consisting of at least about 5 amino acid residues,
preferably at
least about 10 amino acid residues, more preferably at least about 12 amino
acid
residues, and even more preferably at least about 15 amino acid residues. Also
included within the scope of the definition of a "polypeptide" are amino acid
sequence
variants, containing one or more preferably conservative amino acid
substitutions,
deletions, or insertions, which do not alter at least one essential property
of said
polypeptide such as, for example, its immunogenicity, use as a diagnostic
reagent, or
effectiveness as a peptide vaccine against Lawsonia spp, amongst others.
Accordingly, a polypeptide may be isolated from a source in nature, or
chemically
synthesized. Furthermore, a polypeptide may be derived from a full-length
protein by
chemical or enzymatic cleavage, using reagents such as CNBr, trypsin, or
chymotrypsin, amongst others.
Conservative amino acid substitutions are well-known in the art. For example,
one or
more amino acid residues of a native hemolysin polypeptide of the invention
can be
substituted conservatively with an amino acid residue of similar charge, size
or polarity,
with the resulting polypeptide retaining an ability to function in a vaccine
or as a
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-l~-
diagnostic reagent as described herein. Rules for making such substitutions
include
those described by Dayhof (1978). More specifically, conservative amino acid
substitutions are those that generally take place within a family of amino
acids that are
related in their side chains. Genetically-encoded amino acids are generally
divided into
four groups: (1) acidic=aspartate, glutamate; (2) basic=lysine, arginine, and
histidine;
(3) non-polar=alanine, valine, leucine, isoleucine, proline, phenylalanine,
methionine,
and tryptophan; and (4) uncharged polar= glycine, asparagine, glutamine,
cysteine,
serine, threonine, and tyrosine. Phenylalanine, tyrosine and tryptophan are
also jointly
classified as aromatic amino acids. One or more replacements within any
particular
group such as, for example, the substitution of leucine for isoleucine or
valine or
alternatively, the substitution of aspartate for glutamate or threonine for
serine, or of
any other amino acid residue with a structurally-related amino acid residue,
will
generally have an insignificant effect on the function of the resulting
polypeptide.
The present invention is not limited by the source of the subject immunogen
and
clearly extends to isolated and recombinant polypeptides which are derived
from a
natural or a non-natural occurring source.
The term "recombinant polypeptide" as used herein shall be taken to refer to a
?0 polypeptide which is produced in vitro or in a host cell by the expression
of a genetic
sequence encoding said polypeptide, which genetic sequence is under the
control of
a suitable promoter, wherein a genetic manipulation has been performed in
order to
achieve said expression. Accordingly, the term "recombinant polypeptide"
clearly
encompasses polypeptides produced by the expression of genc~ic sequences
?5 contained in viral vectors, plasmids or cosmids that have been introduced
into
prokaryotic or eukaryotic cells, tissues or organs. Genetic manipulations
which may
be used in this context will be known to those skilled in the art and include,
but are not
limited to, nucleic acid isolation, restriction endonuclease digestion,
exonuclease
digestion, end-filling using the Klenow fragment of E. coli DNA polymerise I
or T4 DNA
30 polymerise enzymes, blunt-ending of DNA molecules using T4 DNA polymerise
or
Exolll enzymes, site-directed mutagenesis, ligation, and amplification
reactions. As will
be known to those skilled in the art, additional techniques such as nucleic
acid
WO 00/69906 CA 02372105 2001-11-09
PCT/AU00/00439
- 14-
hybridisations and nucleotide sequence analysis may also be utilised in the
preparation
of recombinant polypeptides, in confirming the identity of a nucleic acid
molecule
encoding a desired recombinant polypeptide and a genetic construct comprising
the
nucleic acid molecule.
Wherein the polypeptide of the present invention is a recombinant polypeptide,
it may
be produced in and, if desirable, isolated from a recombinant viral vector or
host cell
expression system. As will be known to those skilled in the relevant art, a
cell for
production of a recombinant polypeptide is selected on the basis of several
parameters
including the genetic constructs used to express the polypeptide under
consideration,
as well as the stability and activity of said polypeptide. It will also be
known to those
skilled in the art that the stability or activity of a recombinant polypeptide
may be
determined, at least in part, by post-translational modifications to the
polypeptide such
as, for example, glycosylation, acylation or alkylation reactions, amongst
others, which
may vary between cell lines used to produce the recombinant polypeptide.
Accordingly, in a more particularly preferred embodiment, the present
invention
extends to a recombinant polypeptide or a derivative, homologue or analogue
thereof
as present in a virus particle, or as produced in prokaryotic or eukaryotic
host cell, or
in a virus or cell culture thereof.
The present invention also extends to a recombinant polypeptide according to
any of
the foregoing embodiments which is produced in a bacterial cell belonging to
the
genus Lawsoria, in particular a cell of L. intracellularis, or a culture
thereof.
The term "isolated polypeptide" refers to a polypeptide of the present
invention which
has been purified to scme extent, preferably to at least about 20% by weight
of protein,
preferably to at least about 50% by weight of protein, more preferably to at
least about
60% by weight of protein, still more preferably to at least about 70% by
weight of
protein and even more preferably to at least about 80% by weight of protein or
greater,
from its natural source or, in the case of non-naturally-occurring
polypeptides, from the
culture medium or cellular environment in which it was produced. Such
isolation may
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-15-
be performed to improve the immunogenicity of the polypeptide of the present
invention, or to improve the specificity of the immune response against that
polypeptide, or to remove toxic or undesirable contaminants therefrom. The
necessary
or required degree of purity of an isolated polypeptide will vary depending
upon the
~ purpose for which the polypeptide is intended, and for many applications it
will be
sufficient for the polypeptide preparation to contain no contaminants which
would
reduce the immunogenicity of the polypeptide when administered to a host
animal, in
particular a porcine or avian animal being immunized against PPE or,
alternatively,
which would inhibit immuno-specific binding in an immunoassay for the
diagnosis of
PPE or a causative agent thereof.
The purity of an isolated polypeptide of the present invention may be
determined by
any means known to those skilled in the art, including the degree of
homogeneity of
a protein preparation as assessed by SDS/polyacrylamide gel electrophoresis, 2-
dimensional electrophoresis, or amino acid composition analysis or sequence
analysis.
Preferably, the polypeptide of the present invention will be substantially
homogeneous
or substantially free of nonspecific proteins, as assessed by
SDS/polyacrylamide gel
electrophoresis, 2-dimensional electrophoresis, or amino acid composition
analysis or
?0 sequence analysis.
The polypeptide of the present invention can be purified for use as a
component of a
vaccine composition by any one or a combination of methods known to those of
ordinary skill in the art, including, for example, reverse phase
chromatography, HPLC,
ion-exchange chromatography, and affinity chromatography, among others.
In a preferred embodiment, the isolated or recombinant polypeptide of the
invention
possesses hemolysin activity or is derived from a polypeptide which possesses
hemolysin activity, such as, for example, L. intracellularis hemolysin or,
alternatively,
is immunologically cross-reactive with the L. intracellularis hemolysin
polypeptide of the
present invention, as determined by standard immunoassay such as RIA or ELISA,
amongst others.
WO 00/69906 CA 02372105 2001-11-09 pCT/AU00/00439
-16-
As used herein, the term "hemolysin activity" shall be taken to mean hemolysin
enzyme activity as determined by any means known to those skilled in the art
such as,
for example, by the lysis of red blood cells as described by Basaraba et al.
(1998).
In a further preferred embodiment, the isolated or recombinant polypeptide of
the
invention is derived from Lawsonia spp. and more preferably, the subject
polypeptide
is derived from Lawsonia intracellularis.
A B cell or T cell epitope of a polypeptide or a derivative, homologue or
analogue
thereof may comprise any combination of the following:
(i) the primary amino acid sequence of said region, known in the art as a
continuous non-conformational epitope;
(ii) the secondary structure which a hemolysin polypeptide adopts, known
in the art as a continuous conformational epitope;
(iii) the tertiary structure which a hemolysin polypeptide adopts in contact
with another region of the same polypeptide molecule, known in the art
as a discontinuous conformational epitope; or
(iv) the quaternary structure which a hemolysin polypeptide adopts in contact
with a region of another polypeptide molecule, known in the art as a
discontinuous conformational epitope.
Accordingly, immunogenic polypeptides or derivatives, homologues or analogues
thereof comprising the same, or substantially the same primary amino acid
sequence
are hereinafter defined as "immunogens which comprise a B cell or T cell
epitope", or
similar term.
Immunogenic polypeptides or derivatives, homologues, or analogues thereof
comprising different primary amino acid sequences may comprise immunologically
identical immunogens, because they possess conformational B cell or T cell
epitopes
that are recognised by the immune system of a host species to be identical.
Such
immunogenic polypeptides or derivatives, homologues or analogues thereof are
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-17-
hereinafter defined as "immunogens which mimic or cross-react with a B cell or
T cell
epitope", or similar term.
Accordingly, the present invention extends to an immunogen which comprises,
mimics,
or cross-reacts with a B-cell or T-cell epitope of an isolated or recombinant
polypeptide
according to any one of the foregoing embodiments or a derivative, homologue
or
analogue thereof. In a particularly preferred embodiment, the present
invention
provides an immunogen which comprises, mimics, or cross-reacts with a B-cell
or T-
cell epitope of an isolated or recombinant polypeptide which in its native
form is
obtainable from a species of Lawsonia such as, but not limited to L.
intracellularis and
which polypeptide preferably possesses hemolysin activity.
To improve the immunogenicity of a subject polypeptide of the present
invention one
or more amino acids not corresponding to the original protein sequence can be
added
to the amino or carboxyl terminus of the polypeptide. Such extra amino acids
are
useful for coupling the polypeptide to another peptide or polypeptide, to a
large carrier
protein or to a solid support. Amino acids that are useful for these purposes
include
but are not limited to tyrosine, lysine, glutamic acid, aspartic acid,
cysteine and
derivatives thereof. Additional protein modification techniques can be used
such as,
?0 e.g., NHZ-acetylation or COON-terminal amidation, to provide additional
means for
coupling the polypeptide to another polypeptide, protein, or peptide molecule,
or to a
solid support. Procedures for coupling polypeptides to each other, or to
carrier
proteins or solid supports, are well known in the art. Polypeptides containing
the
above-mentioned extra amino acid residues at either the carboxyl- or amino-
termini
'?s and either uncoupled or coupled to a carrier or solid support, are
consequently within
the scope of the present invention.
Furthermore, the polypeptide can be immobilised to a polymeric carrier or
support
material.
In an alternative embodiment, the immunogenicity of a polypeptide of the
present
invention may be improved using molecular biology techniques to produce a
fusion
WO 00/69906 CA 02372105 2001-11-09 pCT/AU00/00439
-18-
protein containing one or more polypeptides of the present invention fused to
a carrier
molecules such as a highly immunogenic protein. For example, a fusion protein
containing a polypeptide of the present invention fused to the highly
immunogenic B
subunit of cholera toxin can be used to increase the immune response to the
polypeptide. The present invention also contemplates fusion proteins
comprising a
cytokine, such as an interleukin, fused to the subject polypeptide of the
present
invention, and genes encoding same.
Preferably, the polypeptide of the present invention, or a derivative,
homologue or
analogue thereof, when administered to a mammal, induces an immune response in
said mammal. More preferably, the polypeptide of the present invention, when
administered to a mammal, in particular a porcine animal (e.g., a pig) induces
a
protective immune response against Lawsonia spp., and preferably against L.
intracellularis, therein. As used herein, the phrase "induction of a
protective immune
response", and the like, refers to the ability of the administered polypeptide
of the
present invention to prevent or detectably slow the onset, development, or
progression
of symptoms associated with Lawsonia infection, and preferably, to prevent or
detectably slow the onset, development, or progression of symptoms associated
with
PPE in pigs.
Preferably, the immunogenic polypeptide of the invention comprises an amino
acid
sequence which is substantially the same as the amino acid sequence set forth
in SEQ
ID NO: 1 or is at least about 70% identical overall to SEQ ID NO: 1, or is at
least about
75% identical to at least about 8 or more contiguous amino acids of SEQ ID NO:
1.
?5 In a preferred embodiment, the immunogenic polypeptide of the present
invention
consists essentially of the amino acid sequence of SEQ D NO: 1 or the amino
acid
sequence encoded by the hemolysin-encoding nucleotide sequence present in
pALK12 (ATCC 207195), or about the first fifty amino acids thereof.
For the purposes of nomenclature, the amino acid sequence set forth in SEQ ID
NO:
1 represents the hemolysin polypeptide encoded by the Lawsonia intracellularis
tlyA
gene, the nucleotide sequence of which is set forth in SEQ ID NO: 2.
WO 00/69906 cA o23~2105 2001-ii-os pCT/AU00/00439
-19-
Preferably, the percentage amino acid sequence identity to SEQ ID NO: 1 is at
least
about 80%, more preferably at least about 85%, even more preferably at least
about
90%, and still even more preferably at least about 95% similar to SEQ ID NO:
1.
In determining whether or not two amino acid sequences fall within these
percentage
limits, those skilled in the art will be aware that it is necessary to conduct
a side-by-side
comparison or multiple alignment of sequences. In such comparisons or
alignments,
differences will arise in the positioning of non-identical residues, depending
upon the
algorithm used to perform the alignment. In the present context, reference to
a
percentage sequence identity or similarity between two or more amino acid
sequences
shall be taken to refer to the number of identical and similar residues
respectively,
between said sequences as determined using any standard algorithm known to
those
skilled in the art. For example, amino acid sequence identities or
similarities may be
calculated using the GAP programme of the Computer Genetics Group, Inc.,
University
Research Park, Madison, Wisconsin, United States of America (Devereaux ef al,
1984). The GAP programme utilizes the algorithm of Needleman and Wunsch (1970)
to maximise the number of identical/similar residues and to minimise the
number
and/or length of sequence gaps in the alignment. Alternatively or in addition,
where
more than two amino acid sequences are being compared, the ClustalW programme
of Thompson et al (1994) can be used.
The present invention further encompasses homologues, analogues and
derivatives
of a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1.
"Homologues" of a polypeptide are those polypeptides which contain amino acid
substitutions, deletions and/or additions relative to the polypeptide without
altering one
or more of its properties, such as its immunogenicity, biological activity or
catalytic
activity. In such molecules, amino acids can be replaced by other amino acids
having
similar properties such as, for example, hydrophobicity, hydrophilicity,
hydrophobic
moment, antigenicity, propensity to form or break a-helical structures or ~3-
sheet
structures, and so on.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-20-
Substitutional variants are those in which at least one residue in the
sequence has
been removed and a different residue inserted in its place. Amino acid
substitutions
are typically of single residues, but may be clustered depending upon
functional
constraints placed upon the polypeptide; insertions will usually be of the
order of about
1-10 amino acid residues. and deletions will range from about 1-20 residues.
Preferably, amino acid substitutions will comprise conservative amino acid
substitutions, such as those described supra.
Insertional amino acid sequence variants are those in which one or more amino
acid
residues are introduced into a predetermined site in the protein. Insertions
can
comprise amino- terminal and/or carboxyl terminal fusions as well as intra-
sequence
insertions of single or multiple amino acids. Generally, insertions within the
amino acid
sequence will be smaller than amino or carboxyl terminal fusions, of the order
of about
1 to 4 residues.
Deletional variants are characterised by the removal of one or more amino
acids from
the sequence.
Amino acid variants of the polypeptide of the present invention may readily be
made
using peptide synthetic techniques well known in the art, such as solid phase
peptide
synthesis and the like, or by recombinant DNA manipulations. The manipulation
of
DNA sequences to produce variant proteins which manifest as substitutional,
insertional or deletional variants are well known in the art. For example,
techniques for
making substitution mutations at predetermined sites in DNA having known
sequence
?5 are well known to those skilled in the art, such as by M13 mutagenesis or
other site-
directed mutagenesis protocol.
"Analogues" are defined as peptides, oligopeptides and polypeptides which are
functionally equivalent to the peptides of the present invention but which
contain
certain non-naturally occurring or modified amino acid residues as will be
known to
those skilled in the art. Accordingly, an "analogue" as defined herein need
not
comprise an amino acid sequence which is similar to the amino acid sequence
set
WO 00/69906 cA o23~2105 2001-ii-os pCT/AU00/00439
-21 -
forth herein such as, for example, peptides, oligopeptides and polypeptides
which are
derived from computational predictions or empirical data revealing the
secondary,
tertiary or quaternary structure of the hemolysin polypeptide of the present
invention,
and which therefore do not comprise the same primary amino acid sequence of
said
hemolysin polypeptide, yet nevertheless mimic or cross-react with B-cell or T-
cell
epitope of Lawsonia spp. and preferably, mimic or cross-react with B-cell or T-
cell
epitope of Lawsonia intracellularis.
For example, mimotopes (polypeptide analogues that cross-react with a B-cell
or T-cell
epitope of the Lawsonia polypeptide of the invention but, however, comprise a
different
amino acid sequence to said epitope) may be identified by screening random
amino
acid sequences in peptide libraries with antibodies that bind to a desired T-
cell or B-cell
epitope. As with techniques for the identification of B-cell or T-cell
epitopes as
described supra, the antibodies used to identify such mimotopes may be
polyclonal or
1 > monoclonal or recombinant antibodies, in crude or purified form. Mimotopes
of a T-cell
epitope may then be assayed further for their ability to stimulate T-cell
cytotoxic or
proliferative responses in vitro. Mimotopes are particularly useful as
analogues of non-
linear (i.e., conformational) epitopes of the polypeptide of the present
invention,
because conformational epitopes are generally formed from non-contiguous
regions
'?0 in a polypeptide, and the mimotopes provide immunogenic equivalents
thereof in the
form of a single peptide molecule.
Additionally, the use of polypeptide analogues can result in polypeptides with
increased immunogenic and/or antigenic activity, that are less sensitive to
enzymatic
~> degradation, and which are more selective. A suitable proline analogue is 2-
aminocyclopentane carboxylic acid (~3ACSc) which has been shown to increase
the
immunogenic activity of a native polypeptide more than 20 times (Mierke et al,
1990;
Portoghese et al, 1990; Goodman et al, 1987).
30 "Derivatives" of a polypeptide described herein are those peptides,
oligopeptides and
polypeptides which comprise at least about five contiguous amino acid residues
of the
amino acid sequence set forth in SEQ ID NO: 1. A "derivative" may further
comprise
WO 00/69906 CA 02372105 2001-11-09
PCT/AU00/00439
_ 77 _
additional naturally-occurring, altered glycosylated, acylated or non-
naturally occurring
amino acid residues compared to the amino acid sequence set forth in SEQ ID
NO:
1. Alternatively or in addition, a derivative may comprise one or more non-
amino acid
substituents such as, for example, a reporter molecule or other ligand,
covalently or
~ non-covalently bound to the amino acid sequence such as, for example, a
reporter
molecule which is bound thereto to facilitate its detection.
Other examples of recombinant or synthetic mutants and derivatives of the
peptide
immunogens of the present invention include those incorporating single or
multiple
substitutions, deletions and/or additions therein, such as carbohydrates,
lipids and/or
proteins or polypeptides. Naturally occurring or altered glycosylated or
acylated forms
of the subject peptides are particularly contemplated by the present
invention.
Additionally, homopolymers or heteropolymers comprising one or more copies of
the
subject peptide listed in SEQ ID NO: 1, or one or more derivatives, homologues
or
analogues thereof, are within the scope of the invention.
Preferably, homologues, analogues and derivatives of the polypeptide of the
invention
are "immunogenic", defined hereinafter as the ability of said polypeptide, or
a
derivative, homologue or analogue thereof, to elicit B cell and/or T cell
responses in
?0 the host, in response to immunization.
Preferred homologues, analogues and derivatives of the amino acid sequence set
forth
in SEQ ID NO: 1 include those amino acid variants that function as B cell or T
cell
epitopes of sG:d amino acid sequence which are capable of mediating an immune
response such as, for example, mimotopes of the immunogenic polypeptide
described
herein which have been produced by synthetic means, such as by Fmoc chemistry.
The only requirement of such molecules is that they cross-react
immunologically with
a polypeptide which comprises the amino acid sequence set forth in SEQ ID NO:
1, or
the first 50 amino acid residues thereof, or a derivative thereof which
comprises at
least 5 contiguous amino acids in length of SEQ ID NO: 1.
As will be apparent to those skilled in the art, such homologues, analogues
and
WO 00/69906 cA o23~2105 2001-ii-os pCT/AU00/00439
-23-
derivatives of the polypeptide of the invention molecules will be useful to
prepare
antibodies that cross-react with antibodies against said polypeptide and/or to
elicit a
protective immune response of similar specificity to that elicited by said
polypeptide.
Such molecules will also be useful in diagnostic and other applications that
are
immunological in nature such as, for example, diagnostics which utilise one or
more
immunoassay formats (eg. ELISA, RIA and the like).
Accordingly, the immunogen of the present invention or a derivative, homologue
or
analogue thereof is useful in vaccine compositions that protect an individual
against
infection by L. intracellularis and/or as an antigen to elicit polyclonal or
monoclonal
antibody production and/or in the detection of antibodies against L.
intracellularis in
infected animals, particularly in porcine and avian animals.
The present inventors have also shown that the N-terminal region of SEQ ID NO:
1
is particularly unique, as compared to other immunogenic amino acid sequences,
including those of the hemolysin molecules of other animal pathogens.
Accordingly,
peptides, oligopeptides and polypeptides which comprise such unique epitope
regions
of SEQ ID NO: 1, will have improved specificity compared to other regions of
the
Lawsonia spp. hemolysin molecule. The particular advantages of such peptides
will be
immediately apparent to those skilled in the production of vaccine
compositions, where
specificity against a pathogen of interest is an important consideration.
In particular, the present inventors have shown that amino acids 1 to 50 of
the L.
intracellularis he~,~olysin polypeptide, as set forth in SEQ 'D NO: 1, is rot
highly
?5 conserved compared to the corresponding region of other hemolysin
polypeptides,
being only about 50% identical to the amino acid sequences in the N-terminal
region
of the Mycobacterium tuberculosis and Serpula hyodysenteriae hemolysin
polypeptides. Accordingly, this region of the L. intracellularis hemolysin
polypeptide
is a promising antigenic peptide for the formulation of Lawsonia-specific
vaccines and
diagnostics for the specific detection of Lawsonia spp. in biological samples.
Accordingly, in an alternative embodiment, the present invention provides an
isolated
WO 00/69906 cA o23~2105 2001-ii-os pCT/AU00/00439
-24-
or recombinant immunogenic polypeptide or a derivative, homologue or analogue
thereof which comprises, mimics or cross-reacts with a B-cell or T-cell
epitope of a
Lawsonia spp. wherein said polypeptide comprises a sequence of amino acids
which
has at least about 50% sequence identity to about amino acid residue 1 to
about
amino acid residue 50 of the L. intracellularis hemolysin polypeptide, as set
forth in
SEQ ID NO: 1. Preferably, the percentage sequence identity to amino acids 1 to
50
of SEQ ID NO: 1 is at least about 60%, more preferably at least about 70%,
even
more preferably at least about 80% and still even more preferably at least
about 90%.
In a particularly preferred embodiment, the subject polypeptide will comprise
a
sequence of amino acids from about amino acid 1 to about arnino acid 50 of SEQ
ID
NO: 1.
A second aspect of the present invention provides a vaccine composition for
the
prophylaxis or treatment of infection in a mammal or bird by L.
intracellularis or similar
or otherwise related microorganism, said vaccine composition comprising an
effective
amount of an immunogenic component which comprises an isolated or recombinant
polypeptide having at least about 70% sequence identity overall to the amino
acid
sequence set forth in SEQ ID NO: 1 or at least about 50% sequence identity
overall
to about amino acid residue 1 to about amino acid residue 50 of SEQ ID NO: 1,
or an
immunogenic homologue, analogue or derivative thereof which is immunologically
cross-reactive with Lawsonia intracellularis; and one or more carriers,
diluents or
adjuvants suitable for veterinary or pharmaceutical use.
As used herein, the term "immunogenic component" refers to a peptide,
polypeptide
or a protein encoded by DNA from, or derived from, L. intracellularis or a
related
microorganism thereto which is capable of inducing a protective immune
response in
an animal, in particular a porcine or avian animal, whether or not said
peptide,
polypeptide or protein is in an isolated or recombinant form. Accordingly, the
vaccine
composition clearly encompasses those vaccine compositions which comprise
attenuated, killed or non-pathogenic isolates or forms of L. intracellularis
or related
microorganisms thereto which comprise or express said peptide, polypeptide or
protein.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_7j_
By "protective immune response" is meant that the immunogenic component
elicits an
immune response in the animal to which the vaccine composition is administered
at
the humoral and/or cellular level which is sufficient to prevent infection by
Lawsonia
intracellularis or a related microorganism thereto and/or which is sufficient
to detectably
reduce one or more symptoms or conditions, or to detectably slow the onset of
one or
more symptoms or conditions, associated with infection by Lawsonia
intracellularis or
a related microorganism thereto in an animal host, as compared to a control
infected
animal. The term "effective amount" of an immunogenic component present in the
vaccine composition refers to that amount of said immunogenic component that
is
capable of inducing a protective immune response after a single complete dose
has
been administered, or after several divided doses have been administered.
Preferably, the polypeptide component of the subject vaccine composition
comprises
an amino acid sequence which is both immunogenic and specific, by virtue of
its
immunological cross-reactivity with the causative agent of PPE, Lawsonia
intracellularis. In this regard, it will be apparent from the preceding
description that
such polypeptide components may comprise an amino acid sequence derived from
SEQ ID NO: 1 or a homologue, analogue or derivative of the amino acid sequence
set
forth in SEQ ID NO: 1 such as, for example, a mimotope of said sequence.
The immunogenic polypeptide or immunogenic homologue, analogue or derivative
may
be a naturally-occurring peptide, oligopeptide or polypeptide in isolated or
recombinant
form according to any of the embodiments described supra or exemplified
herein.
Preferably, the immunogenic polypeptide or immunogenic homologue, analogue or
'_'~ derivative is derived from Lawsonia spp., in particular L.
intracellularis or a
microorganism that is related thereto.
Preferably, the immunogenic component has undergone at least one purification
step
or at least partial concentration from a cell culture comprising L.
intracellularis or a
s0 related microorganism thereto, or from a lysed preparation of L.
intracellularis cells or
related microorganism, or from another culture in which the immunogenic
component
is recombinantly expressed. The purity of such a component which has the
requisite
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-26-
immunogenic properties is preferably at least about 20% by weight of protein
in a
particular preparation, more preferably at least about 50%, even more
preferably at
least about 60%, still more preferably at least about 70% and even more
preferably at
least about 80% or greater.
The immunogenic component of the vaccine of the present invention can comprise
a
single peptide, polypeptide or protein, or a range or combination of different
peptides,
polypeptides or proteins covering different or similar epitopes. In addition
or,
alternatively, a single polypeptide can be provided with multiple epitopes.
The latter
type of vaccine is referred to as a polyvalent vaccine. A multiple epitope
includes two
or more epitopes located within a peptide or polypeptide molecule.
The formulation of vaccines is generally known in the art and reference can
conveniently be made to Remington's Pharmaceutical Sciences, 17th ed., Mack
Publishing Co., Easton, Pennsylvania, USA.
A particularly useful form of the vaccine is a recombinant vaccine produced,
for
example, in a vaccine vector, such as but not limited to a cell transfected
with a
vaccinia virus vector or a bacterial cell capable of expressing the
immunogenic
component.
The present invention clearly extends to recombinant vaccine compositions in
which
the immunogenic component at least is contained within killed vaccine vectors
prepared, for example, by heat, formalin or other chemical treatment, electric
shock
or high or low pressure forces. According to this embodiment, the immunogenic
component of the vaccine is generally synthesized in a live vaccine vector
which is
killed prior to administration to an animal.
Furthermore, the vaccine vector expressing the immunogenic component may be
non-
pathogenic or attenuated. Within the scope of this embodiment are cells that
have
been transfected with non-pathogenic or attenuated viruses encoding the
immunogenic component of the vaccine and non-pathogenic or attenuated cells
that
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-27-
directly express the immunogenic component.
Attenuated or non-pathogenic host cells include those cells which are not
harmful to
an animal to which the subject vaccine is administered. As will be known to
those
~ skilled in the art, "live vaccines" can comprise an attenuated virus vector
encoding the
immunogenic component or a host cell comprising same, which is capable of
replicating in an animal to which it is administered, and using host cell
machinery to
express the immunogenic component, albeit producing no adverse side-effects
therein.
Such vaccine vectors may colonise the gut or other organ of the vaccinated
animal.
Such live vaccine vectors are efficacious by virtue of their ability to
continually express
the immunogenic component in the host animal for a time and at a level
sufficient to
confer protective immunity against a pathogen which expresses an immunogenic
equivalent of said immunogenic component. The present invention clearly
encompasses the use of such attenuated or non-pathogenic vectors and live
vaccine
preparations.
The vaccine vector may be a virus, bacterial cell or a eukaryotic cell such as
an avian,
porcine or other mammalian cell or a yeast cell or a cell line such as COS,
VERO,
HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney
(BHK) or MDCK cell lines. Suitable prokaryotic cells include Mycobacterium
spp.,
Corynebacterium spp., Salmonella spp., Escherichia coli, Bacillus spp. and
Pseudomonas spp, amongst others. Bacterial strains which are suitable for the
present purpose are well-known in the relevant art (Ausubel et al, 1987;
Sambrook et
al, 1989).
Such cells and cell lines are capable of expression of a genetic sequence
encoding a
peptide, polypeptide or protein of the present invention from L.
intracellularis in a
manner effective to induce a protective immune response in the animal. For
example,
a non-pathogenic bacterium could be prepared containing a recombinant sequence
capable of encoding a peptide, polypeptide or protein from L. intracellularis.
The
recombinant sequence would be in the form of an expression vector under the
control
of a constitutive or inducible promoter. The bacterium would then be permitted
to
CA 02372105 2001-11-09
WO 00/69906 PCT/AiJ00/00439
-28-
colonise suitable locations in a pig's gut and would be permitted to grow and
produce
the recombinant peptide, polypeptide or protein in amount sufficient to induce
a
protective immune response against L. intracellularis.
In a further alternative embodiment, the vaccine can be a DNA or RNA vaccine
comprising a DNA or RNA molecule encoding a peptide, polypeptide or protein of
the
present invention which is injected into muscular tissue or other suitable
tissue in a pig
under conditions sufficient to permit transient expression of said DNA or RNA
to
produce an amount of peptide, polypeptide or protein effective to induce a
protective
immune response. In a preferred embodiment, the DNA vaccine is in the form of
a
plasmid, in which the DNA is operably connected with a promoter region capable
of
expressing the nucleotide sequence encoding the immunogen in cells of the
immunized animal.
In the production of a recombinant vaccine, except for a DNA vaccine described
herein, it is therefore necessary to express the immunogenic component in a
suitable
vector system. For the present purpose, the immunogenic component can be
expressed by:
(i) placing an isolated nucleic acid molecule in an expressible format, said
nucleic acid molecule comprising the coding region of the nucleotide sequence
set forth in SEQ ID NO: 2 or a protein-encoding homologue, analogue or
derivative of SEQ ID NO: 2 selected from the group consisting of:
(a) nucleotide sequences that have at least about 70% sequence identity
to SEQ ID NO: 2;
(b) nucleotide sequences that hybridise under at least low stringency
hybridisation, preferably under at least moderate stringency conditions,
and even more preferably under high stringency conditions, to the
complement of SEQ ID NO: 2; and
(c) nucleotide sequences that encode the amino acid sequence set forth
in SEQ ID NO: 1 or a homologue, analogue or derivative thereof,
including, for example, a mimotope of the amino acid set forth in SEQ
ID NO: 1;
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-29-
(ii) introducing the isolated nucleic acid molecule of (i) in an expressible
format into a suitable vaccine vector; and
(iii) incubating or growing the vaccine vector for a time and under conditions
sufficient for expression of the immunogenic component encoded by said
nucleic acid molecule to occur.
For the purposes of defining the level of stringency, a low stringency is
defined herein
as being a hybridisation and/or a wash carried out in 6xSSC buffer, 0.1 %
(w/v) SDS
at 28°C. A moderate stringency is defined herein as being a
hybridisation and/or
washing carried out in 2xSSC buffer, 0.1 % (w/v) SDS at a temperature in the
range
45°C to 65°C. A high stringency is defined herein as being a
hybridisation and/or
wash carried out in 0.1xSSC buffer, 0.1% (w/v) SDS at a temperature of at
least 65°C.
Generally, the stringency is increased by reducing the concentration of SSC
buffer,
and/or increasing the concentration of SDS and/or increasing the temperature
of the
hybridisation and/or wash. Those skilled in the art will be aware that the
conditions for
hybridisation and/or wash may vary depending upon the nature of the
hybridisation
membrane or the type of hybridisation probe used. Conditions for
hybridisations and
washes are well understood by one normally skilled in the art. For the
purposes of
clarification of the parameters affecting hybridisation between nucleic acid
molecules,
reference is found in pages 2.10.8 to 2.10.16. of Ausubel et al. (1987), which
is herein
incorporated by reference.
As used herein, a "nucleic acid molecule in an expressible forma+" is a
protein-
?5 encoding region of a nucleic acid molecule placed in operable connection
with a
promoter or other regulatory sequence capable of regulating expression in the
vaccine
vector system.
Reference herein to a "promoter" is to be taken in its broadest context and
includes the
transcriptional regulatory sequences of a classical genomic gene, including
the TATA
box which is required for accurate transcription initiation, with or without a
CCAAT box
sequence and additional regulatory elements (i.e., upstream activating
sequences,
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-30-
enhancers and silencers) which alter gene expression in response to
developmental
and/or external stimuli, or in a tissue-specific manner. In the present
context, the term
"promoter" is also used to describe a recombinant, synthetic or fusion
molecule, or
derivative which confers, activates or enhances the expression of a nucleic
acid
molecule to which it is operably connected, and which encodes the immunogenic
polypeptide. Preferred promoters can contain additional copies of one or more
specific
regulatory elements to further enhance expression and/or to alter the spatial
expression and/or temporal expression of the said nucleic acid molecule.
Placing a nucleic acid molecule under the regulatory control of i.e., "in
operable
connection with" a promoter sequence means positioning the said molecule such
that
expression is controlled by the promoter sequence. Promoters are generally,
but not
necessarily, positioned 5' (upstream) to the genes that they control. In the
construction of heterologous promoter/structural gene combinations it is
generally
preferred to position the promoter at a distance from the gene transcription
start site
that is approximately the same as the distance between that promoter and the
gene
it controls in its natural setting, i.e., the gene from which the promoter is
derived.
Furthermore, the regulatory elements comprising a promoter are usually
positioned
within 2 kb of the start site of transcription of the gene. As is known in the
art, some
~0 variation in this distance can be accommodated without loss of promoter
function.
Similarly, the preferred positioning of a regulatory sequence element with
respect to
a heterologous gene to be placed under its control is defined by the
positioning of the
element in its natural setting, i.e., the genes from which it is derived.
Again, as is
known in the ~.rt, some variation in this distance can also occur.
?5
The prerequisite for producing intact polypeptides in bacteria such as E. coli
is the use
of a strong promoter with an effective ribosome binding site. Typical
promoters
suitable for expression in bacterial cells such as E. coli include, but are
not limited to,
the lacz promoter, temperature-sensitive A~ or >\R promoters, T7 promoter or
the IPTG-
30 inducible tac promoter. A number of other vector systems for expressing the
nucleic
acid molecule of the invention in E. coli are well-known in the art and are
described,
for example, in Ausubel et al (1987) or Sambrook et al (1989). Numerous
plasmids
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-31 -
with suitable promoter sequences for expression in bacteria and efficient
ribosome
binding sites have been described, such as for example, pKC30 (7~~: Shimatake
and
Rosenberg, 1981 ), pKK173-3 (tac: Amann and Brosius, 1985), pET-3 (T7: Studier
and
Moffat, 1986), the pFLEX series of expression vectors (Pfizer Inc., CT, USA)
or the
~ pQE series of expression vectors (Qiagen, CA), amongst others. Typical
promoters
suitable for expression in viruses of eukaryotic cells and eukaryotic cells
include the
SV40 late promoter, SV40 early promoter and cytomegalovirus (CMV) promoter,
CMV
IE (cytomegalovirus immediate early) promoter amongst others.
Means for introducing the isolated nucleic acid molecule or a genetic
construct
comprising same into a cell for expression of the immunogenic component of the
vaccine composition are well-known to those skilled in the art. The technique
used for
a given organism depends on the known successful techniques. Means for
introducing
recombinant DNA into animal cells includes microinjection, transfection
mediated by
DEAF-dextran, transfection mediated by liposomes such as by using
lipofectamine
(Gibco, MD, USA) and/or cellfectin (Gibco, MD, USA), PEG-mediated DNA uptake,
electroporation and microparticle bombardment such as by using DNA-coated
tungsten
or gold particles (Agracetus Inc., WI, USA) amongst others.
The immunogenic component of a vaccine composition as contemplated herein
exhibits excellent therapeutic activity, for example, in the treatment and/or
prophylaxis
of PPE when administered in an amount which depends on the particular case.
For
example, for recombinant peptide molecules, from about 0.5 pg to about 20 mg,
may
be administered, preferably from about 1 ~g to about 10 mg, more preferably
from
?5 about 10 ~cg to about 5 mg, and most preferably from about 50 ~cg to about
1 mg
equivalent of the immunogenic component in a volume of about 1 ml to about 5
ml. For
DNA vaccines, a preferred amount is from about 0.1 ~g/ml to about 5 mg/ml in a
volume of about 1 to about 5 ml. The DNA can be present in "naked" form or it
can
be administered together with an agent facilitating cellular uptake (e.g., in
liposomes
or cationic lipids). The important feature is to administer sufficient
immunogen to
induce a protective immune response. The above amounts can be administered as
stated or calculated per kilogram of body weight. Dosage regime can be
adjusted to
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-32-
provide the optimum therapeutic response. For example, several divided doses
can
be administered or the dose can be proportionally reduced as indicated by the
exigencies of the therapeutic situation. Booster administration may also be
required.
The vaccine of the present invention can further comprise one or more
additional
immunomodulatory components such as, for example, an adjuvant or cytokine
molecule, amongst others, that is capable of increasing the immune response
against
the immunogenic component. Non-limiting examples of adjuvants that can be used
in
the vaccine of the present invention include the RIBI adjuvant system (Ribi
Inc.,
Hamilton, MT, USA), alum, mineral gels such as aluminium hydroxide gel, oil-in-
water
emulsions, water-in-oil emulsions such as, for example, Block co-polymer
(CytRx,
Atlanta GA, USA),QS-21 (Cambridge Biotech Inc., Cambridge MA, USA), SAF-M
(Chiron, Emeryville CA, USA), AMPHIGEN ~ adjuvant, Freund's complete adjuvant;
Freund's incomplete adjuvant; and Saponin, QuilA or other saponin fraction,
monophosphoryl lipid A, and Avridine lipid-amine adjuvant. Other
immunomodulatory
agents that can be included in the vaccine include, for example, one or more
cytokines, such as interferon and/or interleukin, or other known cytokines.
Non-ionic
surfactants such as, for example, polyoxyethylene oleyl ether and n-hexadecyl
polyethylene ether may also be included in the vaccines of the present
invention.
The vaccine composition can be administered in a convenient manner such as by
oral,
intravenous (where water soluble), intramuscular, subcutaneous, intranasal,
intradermal or suppository routes or by implantation (e.g., using slow release
technology). Depending on the route of administration, the immunogenic
component
may be required to be coated in a material to protect it from the action of
enzymes,
acids and other natural conditions which may inactivate it, such as those in
the
digestive tract.
The vaccine composition may also be administered parenterally or
intraperitoneally.
Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and
mixtures
thereof, or in oils. Under ordinary conditions of storage and use, these
preparations
can contain a preservative to prevent the growth of microorganisms.
Alternatively, the
WO 00/69906 cA o23~2105 2001-ii-os pCT/AU00/00439
-, -,
_ JJ _
vaccine composition can be stored in lyophilised form to be rehydrated with an
appropriate vehicle or carrier prior to use.
Pharmaceutical forms suitable for injectable use include sterile aqueous
solutions
(where water soluble) or dispersions and sterile powders for the
extemporaneous
preparation of sterile injectable solutions or dispersion. In all cases the
form must be
fluid to the extent that easy syringeability exists, unless the pharmaceutical
form is a
solid or semi-solid such as when slow release technology is employed. In any
event,
it must be stable under the conditions of manufacture and storage and must be
preserved against the contaminating action of microorganisms.
The carrier may be a solvent or dispersion medium containing, for example,
water,
ethanol, polyol (for example, glycerol, propylene glycol and liquid
polyethylene glycol,
and the like), suitable mixtures thereof and vegetable oils. The proper
fluidity can be
maintained, for example, by the use of a coating such as lecithin, by the
maintenance
of the required particle size in the case of dispersion and by the use of
surfactants.
The prevention of the action of microorganisms can be brought about by various
antibacterial and antifungal agents such as, for example" parabens,
chlorobutanol,
phenol, sorbic acid, thimerosal and the like. In many cases, it will be
preferable to
?0 include isotonic agents such as, for example" sugars or sodium chloride.
Prolonged
absorption of the injectable compositions can be brought about by the use in
the
compositions of agents delaying absorption such as, for example" aluminum
monostearate and gelatin.
?5 Sterile injectable solutions are prepared by incorporating the active
compound in the
required amount in the appropriate solvent with various of the other
ingredients
enumerated above, as required, followed by filter-sterilization. Generally,
dispersions
are prepared by incorporating the sterilized active ingredient into a sterile
vehicle which
contains the basic dispersion medium and the required other ingredients
selected from
30 those enumerated above. In the case of sterile powders for the preparation
of sterile
injectable solutions, the preferred methods of preparation are vacuum drying
and the
freeze-drying technique which yield a powder of the active ingredient plus any
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-34-
additional desired ingredient from previously sterile-filtered solution
thereof.
The present invention extends to vaccine compositions which confer protection
against
infection by one or more isolates or sub-types of L. intracellularis including
those that
~ belong to the same serovar or serogroup as Lawsonia intracellularis. The
vaccine
composition preferably also confers protection against infection by other
species of the
genus Lawsonia or other microorganisms related thereto as determined at the
nucleotide, biochemical, structural, physiological and/or immunointeractive
level; the
only requirement being that said other species or other microorganism
expresses a
polypeptide which is immunologically cross-reactive to the polypeptide of the
invention
described herein. For example, such related microorganisms may comprise
genomic
DNA which is at least about 70% identical overall to the genomic DNA of
Lawsonia
intracellularis as determined using standard genomic DNA hybridisation and
analysis
techniques.
1~
The terms "serogroup" and "serovar" relate to a classification of
microorganisms which
is based upon serological typing data, in particular data obtained using
agglutination
assays such as the microscopic agglutination test (MAT). Those skilled in the
art will
be aware that serovar and serogroup antigens are a mosaic on the cell surface
and,
'_'0 as a consequence there will be no strict delineation between bacteria
belonging to a
serovar and/or serogroup. Moreover, organisms which belong to different
species may
be classified into the same serovar or serogroup because they are
indistinguishable
by antigenic determination. As used herein, the term "serovar" means one or
more
Lawsonia strains which are antigenically-identical with respect to antigenic
determinants produced by one or more loci. Quantitatively, serovars may be
differentiated from one another by cross-agglutination absorption techniques.
As used
herein, the term "serogroup" refers to a group of Lawsonia spp. whose members
cross-agglutinate with shared group antigens and do not cross-agglutinate with
the
members of other groups and, as a consequence, the members of a serogroup have
30 more or less close antigenic relations with one another by simple cross-
agglutination.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
The present invention thus clearly extends to vaccine compositions for the
treatment
and/or prophylaxis of animals, in particular, vaccine compositions for the
treatment
and/or prophylaxis of porcine and/or avian species, against any bacterium
belonging
to the same serovar or serogroup as Lawsonia intracellularis. Preferably, such
organisms will express a polypeptide having an amino acid sequence identity of
at
least about 70% overall with respect to SEQ ID NO: 1 and/or at least about 50%
with
respect to amino acids 1 to 50 of SEQ ID NO: 1.
The present invention extends further to vaccine compositions capable of
conferring
protection against a "genetic variant" of Lawsonia intracellularis, the only
requirement
being that said variant expresses a polypeptide having an overall amino acid
sequence
identity of at least about 70% with respect to SEQ ID NO: 1 and/or at least
about 50%
with respect to amino acids 1 to 50 of SEQ ID NO: 1 or a homologue, analogue
or
derivative thereof which is immunologically cross-reactive thereto. Genetic
variants of
IS L. intracellularis can be developed by mutation, recombination, conjugation
or
transformation of L. intracellularis or may occur naturally. It will be known
to a person
skilled in the art how to produce such variants.
In a particularly preferred embodiment, the vaccine composition of the
invention is
intended for or suitable for the prophylaxis and/or treatment of infection in
a porcine
or avian animal by L. intracellularis.
Those skilled in the art will recognise the general applicability of the
invention in
vaccinating animals other :han porcine and avian animals against L.
intracellularis
and/or related microorganisms. In the general application of the vaccine of
the present
invention, the only prerequisite is that the animal on which protection is
conferred is
capable of being infected with Lawsonia intracellularis andlor a related
microorganism
thereto and that, in the case of a related microorganism to L.
intracellularis, said
related microorganism expresses a B-cell or T-cell epitope which mimics or
cross-
reacts with the polypeptide component of the vaccine composition described
herein.
Animals which may be protected by the vaccine of the present invention
include, but
are not limited to, humans, primates, companion animals (e.g., cats, dogs),
livestock
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-36-
animals (e.g., pigs, sheep, cattle, horses, donkeys, goats), laboratory test
animals
(e.g., mice, rats, guinea pigs, rabbits) and captive wild animals (e.g.,
kangaroos, foxes,
deer). The present invention also extends to the vaccination of birds such as
poultry
birds, game birds and caged birds.
J
The present invention further extends to combination vaccines comprising an
effective
amount of a first immunogenic component comprising the polypeptide of the
present
invention combined with an effective amount of a second immunogenic component
comprising one or more other antigens capable of protecting a porcine animal,
or bird,
against either Lawsonia spp. or another pathogen that infects and causes
disease in
said animal. In a preferred embodiment, the second immunogenic component is
selected from the group consisting of the L. intracellularis autolysin, OmpH,
FIgE, and
SodC polypeptides and homologues, analogues or derivatives thereof, in
particular
immunogenic variants or derivatives thereof, and nucleic acid molecules
encoding
I S same.
The isolated or recombinant polypeptide of the invention or an immunologically-
equivalent homologue, analogue or derivative thereof is also useful for the
preparation
of immunologically interactive molecules which are useful in the diagnosis of
infection
?0 of an animal by Lawsonia spp., in particular by L. in>'racellularis or a
related organism
thereto.
As used herein, the term "immunologically interactive molecule" includes
antibodies
and antibody derivatives and functional equivalents, such as a Fab, or a SCAB
(single-
25 chain antibody), any of which optionally can be conjugated to an enzyme,
radioactive
or fluorescent tag, amongst others. The only requirement of such
immunologically
interactive molecules is that they are capable of binding specifically to the
immunogenic polypeptide of the present invention as hereinbefore described.
30 Accordingly, a further aspect of the invention extends to an
immunologically interactive
molecule which is capable of binding to any one or more of the following:
(i) a peptide, oligopeptide or polypeptide which comprises an amino acid
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_;7 _
sequence which has at least about 70% sequence identity overall to the amino
acid sequence set forth in SEQ ID NO: 1;
(ii) a peptide, oligopeptide or polypeptide which comprises an amino acid
sequence having at least about 50% overall sequence identity to amino acid
residues 1 to 50 of SEQ ID NO: 1; or
(iii) a homologue, analogue or derivative of (i) or (ii) which mimics a B-cell
or
T-cell epitope thereof .
In a preferred embodiment, the immunologically interactive molecule is an
antibody
that binds specifically to a polypeptide consisting of the amino acid of SEQ
ID NO: 1,
or to the first fifty amino acids thereof.
Conventional methods can be used to prepare the immunologically interactive
molecules. For example, by using a polypeptide of the present invention,
polyclonal
antisera or monoclonal antibodies can be made using standard methods. For
example,
a mammal, (e.g., a mouse, hamster, or rabbit) can be immunized with an
immunogenic
form of the polypeptide of the present invention which elicits an antibody
response in
the mammal. Techniques for conferring immunogenicity on a polypeptide include
conjugation to carriers or other techniques well known in the art. For
example, the
~0 polypeptide can be administered in the presence of adjuvant or can be
coupled to a
carrier molecule, as known in the art, that enhances the immunogenicity of the
polypeptide. The progress of immunization can be monitored by detection of
antibody
titres in plasma or serum. Standard ELISA or other immunoassay can be used
with
the immunogen as antigen to assess the levels of antibodies. Followinc
immunization,
?~ antisera can be obtained and, for example, IgG molecules corresponding to
the
polyclonal antibodies can be isolated from the antisera.
To produce monoclonal antibodies, antibody producing cells (lymphocytes) can
be
harvested from an animal immunised with a peptide of the present invention and
fused
30 with myeloma cells by standard somatic cell fusion procedures, thus
immortalizing
these cells and yielding hybridoma cells. Such techniques are well known in
the art,
and include, for example, the hybridoma technique originally developed by
Kohler and
WO 00/69906 CA 02372105 2001-11-09 pCT/AU00/00439
_38_
Milstein (1975), as well as other techniques such as the human B-cell
hybridoma
technique (Kozbor et al., 1983), the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole et al., 1985), and screening of combinatorial
antibody
libraries (Huse et al., 1989). Hybridoma cells can be isolated and screened
immunochemically for production of antibodies that are specifically reactive
with the
polypeptide, and monoclonal antibodies isolated therefrom.
As with all immunogenic compositions for eliciting antibodies, the
immunogenically
effective amounts of the peptides of the invention must be determined
empirically.
Factors to be considered include the immunogenicity of the native peptide,
whether or
not the peptide will be complexed with or covalently attached to an adjuvant
or carrier
protein or other carrier, the route of administration for the composition,
i.e.,
intravenous, intramuscular, subcutaneous, etc., and the number of immunizing
doses
to be administered. Such factors are known in the vaccine art and it is well
within the
1~ skill of immunologists to make such determinations without undue
experimentation.
The term "antibody" as used herein, is intended to include fragments thereof
which are
also specifically reactive with a peptide that mimics or cross-reacts with a B
cell or T
cell epitope of the Lawsonia intracellularis hemolysin polypeptide set forth
in SEQ ID
?0 NO: 1. Antibodies can be fragmented using conventional techniques and the
fragments screened for utility in the same manner as described above for whole
antibodies. For example, F(ab')2 fragments can be generated by treating
antibody
with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide
bridges
to produce Fah' fragments.
?5
It is within the scope of this invention to include any secondary antibodies
(monoclonal,
polyclonal or fragments of antibodies), including anti-idiotypic antibodies,
directed to
the first mentioned antibodies discussed above. Both the first and second
antibodies
can be used in detection assays or a first antibody can be used with a
commercially
30 available anti-immunoglobulin antibody. An antibody as contemplated herein
includes
any antibody specific to any region of a peptide which mimics, or cross-reacts
with a
B cell or T cell epitope of the Lawsonia in>'racellularis hemolysin
polypeptide set forth
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
in SEQ ID NO: 1 as hereinbefore described.
The antibodies described herein are useful for determining B cell or T cell
epitopes of
the amino acid sequence set forth in SEQ ID NO: 1 such as, for example, by
testing
the ability of synthetic peptides to cross-react immunologically with said
amino acid
sequence or to elicit the production of antibodies which cross-react with said
amino
acid sequence. Using methods described herein, polyclonal antibodies,
monoclonal
antibodies or chimeric monoclonal antibodies can also be raised to peptides
which
mimic or cross-react with a B cell or T cell epitope of the Lawsonia
intracellularis
hemolysin pofypeptide set forth in SEQ ID NO: 1.
More particularly, the polyclonal, monoclonal or chimeric monoclonal
antibodies can
be used to detect the peptides of the invention and/or any homologues,
analogues or
derivatives thereof, in various biological materials. For example, they can be
used in
an ELISA, radioimmunoassay, or histochemical test. In other words, the
antibodies
can be used to test for binding to a polypeptide of the invention or to a
homologue,
analogue or derivative thereof, in a biological sample to diagnose the
presence of
Lawsonia intracellularis therein.
?0 Accordingly, a further aspect of the invention provides a method of
diagnosing infection
of an animal by Lawsonia intracellularis or a related microorganism thereto,
said
method comprising the steps of contacting a biological sample derived from
said
animal with an immunologically interactive molecule which is capable of
binding to a
peptide, oligopept~de or polypeptide comprising the amino acid sequence sPt
forth in
SEQ ID NO: 1 or a homologue, analogue or derivative thereof, for a time and
under
conditions sufficient for an antigen:antibody complex to form, and detecting
said
complex formation. According to this embodiment of the present invention, the
immunologically interactive molecule is preferably an antibody molecule
prepared
against the Lawsonia intracellularis hemolysin polypeptide set forth in SEQ ID
NO: 1
or an analogue or derivative thereof.
The biological sample is one which might contain a polypeptide having an amino
acid
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-40-
sequence set forth in SEQ ID NO: 1 or a homologue, analogue or derivative
thereof,
in particular a biological sample derived from a porcine or avian host of the
pathogen
Lawsonia intracellularis or a related microorganism thereto, and can include
any
appropriate tissue or fluid sample from the animal. Preferred biological
samples are
derived from the ileum, caecum, small intestine, large intestine, whole serum
or lymph
nodes of the porcine or avian host animal being tested. Alternatively or in
addition, the
biological test sample may comprise faeces or a rectal swab derived from the
animal.
Conventional immunoassays can be used to perform this embodiment of the
invention.
A wide range of immunoassay techniques are available as can be seen by
reference
to US Patent Nos. 4,016,043, 4,424,279 and 4,018,653. These, of course,
include
both single-site and two-site or "sandwich" assays of the non-competitive
types, as well
as the traditional competitive binding assays. These assays also include
direct binding
of a labelled antibody to a target. It will be readily apparent to the skilled
technician
how to modify or optimise such assays to perform this embodiment of the
present
invention, and all such modifications and optimisations are encompassed by the
present invention.
In one alternative embodiment, the present invention contemplates a method of
identifying whether or not an animal has suffered from a past infection, or is
currently
infected with Lawsonia in>~racellularis or a related microorganism thereto,
said method
comprising contacting blood or serum derived from said animal with the
immunogenic
polypeptide of the invention for a time and under conditions sufficient for an
antigen:antibody ccmplex to form, and detecting said complex formation. This
embodiment differs from the embodiment described supra in that it relies upon
the
detection of circulating antibodies against Lawsonia intracellularis or
related organism
in the animals blood or serum which are present as a consequence of a past or
present infection by this pathogen. However, it will be apparent to those
skilled in the
art that the principle of the assay format is the same. As with other
embodiments of the
invention referred to supra, conventional immunoassays can be used. Persons
skilled
in the art will readily be capable of varying known immunoassay formats to
perform the
present embodiment. This embodiment of the invention can also utilise
derivatives of
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-41 -
blood and serum which comprise immunologically interactive molecules, for
example
partially-purified IgG or IgM fractions and buffy coat samples, amongst
others. The
preparation of such fractions will also be known to those skilled in the art.
~ A further aspect of the present invention provides an isolated nucleic acid
molecule
which comprises a sequence of nucleotides which encodes, or is complementary
to
a nucleic acid molecule which encodes, a peptide, oligopeptide or polypeptide
selected
from the following:
(i) a peptide, oligopeptide or polypeptide which comprises an amino acid
sequence which has at least about 70% sequence identity overall to the amino
acid sequence set forth in SEQ ID NO: 1;
(ii) a peptide, oligopeptide or polypeptide which comprises an amino acid
sequence having at least about 50% sequence identity overall to about amino
acid residue 1 to about amino acid residue 50 of SEQ ID NO: 1; or
(iii) a homologue, analogue or derivative of (i) or (ii) which mimics a B-cell
or
T-cell epitope of Lawsonia spp.
In a preferred embodiment, the present invention provides an isolated nucleic
acid
molecule comprising a sequence of nucleotides which encodes, or is
complementary
to a nucleic acid molecule which encodes, a polypeptide immunogen which
comprises,
mimics or cross-reacts with a B cell or T cell epitope of the Lawsonia
intracellularis
hemolysin polypeptide set forth in SEQ ID NO: 1.
In a particularly preferred embodiment, the present invention provides an
isolated
?~ nucleic acid molecule comprising a sequence of nucleotides encoding the L.
intracellularis hemolysin polypeptide having an amino acid sequence set forth
in SEQ
ID NO: 1 or encoding about the first fifty amino acid residues thereof.
It is within the scope of the invention to encompass polymeric forms of the
immunogenic polypeptide described herein, such as aggregates of the amino acid
sequence set forth in SEQ ID N0:1 or a homologue, analogue or derivative
thereof or,
alternatively, as polypeptides comprising repeats of the amino acid sequence
set forth
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_ ~'7 _
in SEQ ID N0:1 or a homologue, analogue or derivative thereof. The present
invention
extends further to nucleic acid molecules encoding such polymeric forms.
Alternatively or in addition, the isolated nucleic acid molecule of the
invention further
comprises a sequence of nucleotides which has at least about 70% overall
sequence
identity to the nucleotide sequence set forth in SEQ ID NO: 2 or to a
complementary
nucleotide sequence thereof. More preferably, the percentage sequence identity
to
SEQ ID NO: 2 or to a complementary nucleotide sequence thereto is at least
about
80%. Still more preferably, the percentage sequence identity is at least about
90%.
Yet still more preferably, the percentage sequence identity is at least about
95%.
In a preferred embodiment, the nucleic acid molecule comprises the nucleotide
sequence set forth in SEQ ID NO: 2 or the hemolysin-encoding nucleotide
sequence
present in pALK12 (ATCC 207195), or a degenerate variant thereof, and
complements
thereof.
In determining whether or not two nucleotide sequences fall within these
percentage
limits, those skilled in the art will be aware that it is necessary to conduct
a side-by-side
comparison or multiple alignment of sequences. In such comparisons or
alignments,
differences may arise in the positioning of non-identical residues, depending
upon the
algorithm used to perform the alignment. In the present context, reference to
a
percentage identity between two or more nucleotide sequences shall be taken to
refer
to the number of identical residues between said sequences as determined using
any
standard algorithm known to those s~.iiled in the art. For example, nucleotide
sequences may be aligned and their identity calculated using the BESTFIT
programme
or other appropriate programme of the Computer Genetics Group, Inc.,
University
Research Park, Madison, Wisconsin, United States of America (Devereaux et al,
1984).
,0 Alternatively or in addition, the isolated nucleic acid molecule of the
invention is
capable of hybridising under at least low stringency conditions to the
nucleotide
sequence set forth in SEQ ID NO: 2 or to a complementary nucleotide sequence
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_ c~ ~ _
thereto or to a nucleic acid fragment comprising at least about 20 contiguous
nucleotides in length derived from the sequence set forth in SEQ ID NO: 2 or
to a
complementary nucleotide sequence thereto.
Preferably, said nucleic acid molecule is capable of hybridising under at
least moderate
stringency conditions, and even more preferably under high stringency
conditions.
The present invention clearly encompasses genetic constructs comprising the
subject
nucleic acid molecule in an expressible format suitable for the preparation of
a
recombinant immunogenic polypeptide of the present invention, such as for use
in
recombinant univalent or polyvalent recombinant vaccines.
In such cases, the nucleic acid molecule will be operably connected to a
promoter
sequence which can thereby regulate expression of said nucleic acid molecule
in a
prokaryotic or eukaryotic cell as described supra.
The genetic construct optionally further comprises a terminator sequence. The
term
"terminator" refers to a DNA sequence at the end of a transcriptional unit
which signals
termination of transcription. A "terminator" is a nucleotide sequence,
generally located
within the 3'-non-translated region of a gene or mRNA, comprising a
polyadenylation
signal to facilitate the post-transcriptional addition of a polyadenylate
sequence to the
3'-end of a primary mRNA transcript. Terminator sequences may be isolated from
the
genetic sequences of bacteria, fungi, viruses, animals and/or plants.
Terminators
active in animal cells are known and described in the literature.
In a preferred embodiment, the genetic construct can be a cloning or
expression
vector, as known in the art, such as a plasmid, cosmid, or phage, comprising a
nucleic
acid molecule of the present invention, and host cells transformed or
transfected
therewith. In a non-limiting embodiment, the vector is plasmid pALK12 (ATCC
Accession No. 207195).
The genetic constructs of the present invention are particularly useful for
producing the
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-44-
immunogenic component of the vaccine composition described herein or for use
in a
DNA vaccine.
A range of genetic diagnostic assays to detect infection of an animal by
Lawsonia
intracellularis or a related microorganism can be employed using the nucleic
acid
molecule described herein such as, for example, assays based upon the
polymerase
chain reaction (PCR) and nucleic acid hybridisation. All such assays are
contemplated
in the present invention.
Accordingly, a still further aspect of the invention provides a diagnostic
method of
detecting Lawsonia intracellularis or related microorganism in a biological
sample
derived from an animal subject, said method comprising the steps of
hybridising one
or more probes or primers derived from the nucleotide sequence set forth in
SEQ ID
NO: 2 or a complementary nucleotide sequence thereto or a homologue, analogue
or
derivative thereof, to a DNA or RNA molecule present in said sample and then
detecting said hybridisation using a detection means.
As used herein, the term "probe" refers to a nucleic acid molecule which is
derived
from the nucleotide sequence set forth in SEQ ID NO: 2 and which is capable of
being
?0 used in the detection thereof. Probes may comprise DNA (single-stranded or
double-
stranded) or RNA (i.e., riboprobes) or analogues thereof.
The term "primer" refers to a probe as hereinbefore defined which is further
capable
of being used to amplify a nucleotide sequence from Lawsonia intracellularis
or a
related microorganism thereto in a PCR.
Preferred probes and primers include fragments of the nucleotide sequence set
forth
in SEQ ID NO: 2 and synthetic single-stranded DNA or RNA molecules of at least
about 15 nucleotides in length derived from the sequence set forth in SEQ ID
NO: 2
or a complementary nucleotide sequence thereto.
Preferably, probes and primers according to this embodiment will comprise at
least
WO 00/69906 CA 02372105 2001-11-09
PCT/AU00/00439
about 20 contiguous nucleotides derived from SEO ID NO: 2 or a complementary
sequence thereto, even more preferably at least about 25 contiguous
nucleotides, still
even more preferably at least about 50 contiguous nucleotides and even more
preferably at least about 100 nucleotides to about 500 nucleotides derived
from the
sequence set forth in SEQ ID NO: 2 or a complement thereof. Probes and primers
comprising the full-length of SEQ ID NO: 2 or a complementary nucleotide
sequence
thereto are also encompassed by the present invention.
For the present purpose, "homologues" of a nucleotide sequence shall be taken
to
refer to an isolated nucleic acid molecule which encodes a polypeptide that is
functionally equivalent to the polypeptide encoded by the nucleic acid
molecule of the
present invention or to a polypeptide which is a homologue, analogue or
derivative of
SEQ ID NO: 1, notwithstanding the occurrence within said sequence, of one or
more
nucleotide substitutions, insertions, deletions, or rearrangements.
"Analogues" of a nucleotide sequence set forth herein shall be taken to refer
to an
isolated nucleic acid molecule which encodes a functionally-equivalent
polypeptide to
the polypeptide encoded by the nucleic acid molecule of the present invention
or a
homologue, analogue or derivative of a polypeptide having the amino acid
sequence
of SEQ ID NO: 1, notwithstanding the occurrence of any non-nucleotide
constituents
not normally present in said isolated nucleic acid molecule such as, for
example,
carbohydrates, radiochemicals including radio nucleotides, reporter molecules
such
as, but not limited to biotin, DIG, alkaline phosphatase or horseradish
peroxidase,
amongst others.
"Derivatives" of a nucleotide sequence set forth herein shall be taken to
refer to any
isolated nucleic acid molecule which contains at least about 50% nucleotide
seruence
identity to 15 or more contiguous nucleotides present in the nucleotide
sequence set
forth in SEQ ID NO: 2 or a complementary nucleotide sequence thereto.
Generally,
the nucleotide sequence of the present invention may be subjected to
mutagenesis to
produce single or multiple nucleotide substitutions, deletions and/or
insertions.
Nucleotide insertional derivatives of the nucleotide sequence of the present
invention
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-46-
include 5' and 3' terminal fusions as well as intra-sequence insertions of
single or
multiple nucleotides or nucleotide analogues. Insertional nucleotide sequence
variants
are those in which one or more nucleotides or nucleotide analogues are
introduced
into a predetermined site in the nucleotide sequence of said sequence,
although
random insertion is also possible with suitable screening of the resulting
product being
performed. Deletional nucleotide sequence variants are characterised by the
removal
of one or more nucleotides from the nucleotide sequence. Substitutional
nucleotide
sequence variants are those in which at least one nucleotide in the sequence
has been
removed and a different nucleotide or nucleotide analogue inserted in its
place. In a
preferred embodiment, such substitutions are selected based on the degeneracy
of the
genetic code, as known in the art, with the resulting substitutional variant
encoding the
amino acid sequence of SEQ ID NO: 1 or at least about the first 50 amino acids
thereof.
Probes or primers can comprise inosine, adenine, guanine, thymidine, cytidine
or uracil
residues or functional analogues or derivatives thereof that are capable of
being
incorporated into a polynucleotide molecule, provided that the resulting probe
or primer
is capable of hybridising under at least low stringency conditions to SEQ ID
NO: 2 or
to a complementary nucleotide sequence thereof, or is at least about 70%
identical to
~0 SEQ ID NO: 2 or to a complementary nucleotide sequence thereof.
The biological sample according to this aspect of the invention includes any
organ,
tissue, cell or exudate which contains or is likely to contain Lawsonia
intracellularis or
a nucleic acid derived therefrom. A biological sample can be prepared in a
suitable
~5 solution such as, for example, an extraction buffer or suspension buffer.
The present
invention extends to the testing of biological solutions thus prepared, the
only
requirement being that said solution at least comprises a biological sample as
described herein.
30 The diagnostic assay of the present invention is useful for the detection
of Lawsonia
intracellularis or a microorganism which is related thereto which expresses
the
hemolysin polypeptide of the present invention or a hemolysin-like
polypeptide.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-47-
The present invention clearly contemplates diagnostic assays which are capable
of
both genus-specific and species-specific detection. Accordingly, in one
embodiment,
the probe or primer, or a homologue, analogue or derivative thereof, comprises
DNA
capable of being used to detect multiple Lawsonia spp. In an alternative
embodiment,
the probe or primer or a homologue, analogue or derivative thereof comprises
DNA
capable of being used to distinguish Lawsonia intracellularis from related
microorganisms.
Less-highly conserved regions within SEQ ID NO: 2, such as those encoding
about
amino acid residues 1 to 50 of the Lawsonia intracellularis hemolysin
polypeptide are
particularly useful as species-specific probes and/or primers for the
detection of L.
intracellularis and very closely related species.
Furthermore, the diagnostic assays described herein can be adapted to a genus-
1~ specific or species-specific assay by varying the stringency of the
hybridisation step.
Accordingly, a low stringency hybridisation can be used to detect several
different
species of Lawsonia in one or more biological samples being assayed, while a
high
stringency hybridisation can be used to distinguish Lawsonia intracellularis
from such
other species.
The detection means according to this aspect of the invention may be any
nucleic acid-
based detection means such as, for example, nucleic acid hybridisation
techniques or
paper chromatography hybridisation assay (PACHA), or an amplification reaction
such
as PCR, or nucleic acid sequence-based amplification (NASBA) system. The
invention
'?~ further encompasses the use of different assay formats of said nucleic
acid-based
detection means, including restriction fragment length polymorphism (RFLP),
amplified
fragment length polymorphism (AFLP), single-strand chain polymorphism (SSCP),
amplification and mismatch detection (AMD), interspersed repetitive sequence
polymerase chain reaction (IRS-PCR), inverse polymerase chain reaction (iPCR),
in
situ polymerase chain reaction and reverse transcription polymerase chain
reaction
(RT-PCR), amongst others.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-48-
Where the detection means is a nucleic acid hybridisation technique, the probe
can be
labelled with a reporter molecule capable of producing an identifiable signal
(e.g., a
radioisotope such as 32P or 35 S, or a biotinylated molecule). According to
this
embodiment, those skilled in the art will be aware that the detection of said
reporter
molecule provides for identification of the probe and that, following the
hybridisation
reaction, the detection of the corresponding nucleotide sequences in the
biological
sample is facilitated. Additional probes can be used to confirm the assay
results
obtained using a single probe.
A variation of the nucleic acid hybridisation technique contemplated by the
present
invention is the paper chromatography hybridisation assay (PACHA) described by
Reinhartz et al. (1993) and equivalents thereof, wherein a target nucleic acid
molecule
is labelled with a reporter molecule such as biotin, applied to one end of a
nitrocellulose or nylon membrane filter strip and subjected to chromatography
under
the action of capillary or other forces (e.g., an electric field) for a time
and under
conditions sufficient to promote migration of said target nucleic acid along
the length
of said membrane to a zone at which a DNA probe is immobilised thereto such
as, for
example, in the middle region. According to this detection format, labelled
target
nucleic acid comprising the Lawsonia spp. nucleotide sequences complementary
to
the probe will hybridise thereto and become immobilised in that region of the
membrane to which the probe is bound. Non-complementary sequences to the probe
will diffuse past the site at which the probe is bound. The target nucleic
acid may
comprise a crude or partially-pure extract of DNA or RNA or, alternatively, an
amplified
or purified DNA. Additional variations of this detection means which utilise
the
nucleotide sequences described herein are clearly encompassed by the present
invention.
Wherein the detection means is a RFLP, nucleic acid derived from the
biological
sample, in particular DNA, is digested with one or more restriction
endonuclease
enzymes and the digested DNA is subjected to electrophoresis, transferred to a
solid
support such as, for example, a nylon or nitrocellulose membrane, and
hybridised to
a probe optionally labelled with a reporter molecule as hereinbefore defined.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-49-
According to this embodiment, a specific pattern of DNA fragments is displayed
on the
support, wherein said pattern is preferably specific for a particular Lawsonia
species.,
to enable the user to distinguish between different species of the bacterium.
Wherein the detection means is an amplification reaction such as, for example,
a
polymerise chain reaction or a nucleic acid sequence-based amplification
(NASBA)
system or a variant thereof, one or more nucleic acid primer molecules of at
least 15
contiguous nucleotides in length derivable from SEQ ID NO: 2 or its
complementary
nucleotide sequence, or a homologue, analogue or derivative thereof, is
hybridised to
nucleic acid derived from a biological sample, and nucleic acid copies of the
hemolysin-encoding genetic sequences in said sample, or a part or fragment
thereof,
are enzymically-amplified.
Those skilled in the art will be aware that there must be a sufficiently high
percentage
of nucleotide sequence identity between the primers and the sequences in the
biological sample template molecule to which they hybridise (i.e., the
"template
molecule"). As stated previously, the stringency conditions can be selected to
promote
hybridisation.
Preferably, each primer is at least about 95% identical to a region of SEQ ID
NO: 2 or
its complementary nucleotide sequence in the template molecule to which it
hybridises.
Those skilled in the art will also be aware that, in one format, PCR provides
for the
hybridisation of non-complementary primers to differ vnt strands of the
template
molecule, such that the hybridised primers are positioned to facilitate the
5'~ 3'
synthesis of nucleic acid in the intervening region, under the control of a
thermostable
DNA polymerise enzyme. As a consequence, PCR provides an advantage over other
detection means in so far as the nucleotide sequence in the region between the
hybridised primers may be unknown and unrelated to any known nucleotide
sequence.
In an alternative embodiment, wherein the detection means is AFLP, the primers
are
selected such that, when nucleic acid derived from the biological sample, in
particular
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-50-
DNA, is amplified, different length amplification products are produced from
different
Lawsonia spp. The amplification products can be subjected to electrophoresis,
transferred to a solid support such as, for example, a nylon or nitrocellulose
membrane, and hybridised to a probe optionally labelled with a reporter
molecule as
hereinbefore described. According to this embodiment, a specific pattern of
amplified
DNA fragments is displayed on the support, said pattern optionally specific
for a
particular Lawsonia ssp., to enable the user to distinguish between different
species
of the bacterium in much the same way as for RFLP analysis.
The technique of AMD facilitates, not only the detection of Lawsonia spp. DNA
in a
biological sample, but also the determination of nucleotide sequence variants
which
differ from the primers and probes used in the assay format. Wherein the
detection
means is AMD, the probe is end-labelled with a suitable reporter molecule and
mixed
with an excess of the amplified template molecule. The mixtures are
subsequently
denatured and allowed to renature to form nucleic acid "probeaemplate hybrid
molecules" or "hybrids", such that any nucleotide sequence variation between
the
probe and the temple molecule to which it is hybridised will disrupt base-
pairing in the
hybrids. These regions of mismatch are sensitive to specific chemical
modification
using hydroxylamine (mismatched cytosine residues) or osmium tetroxide
(mismatched
thymidine residues), allowing subsequent cleavage of the modified site using
piperidine. The cleaved nucleic acid may be analysed using denaturing
polyacrylamide
gel electrophoresis, followed by standard nucleic acid hybridisation as
described supra,
to detect the Lawsonia-derived nucleotide sequences. Those skilled in the art
will be
aware of the means of end-labelling a genetic probe according to the
performance of
the invention described in this embodiment.
According to this embodiment, the use of a single end-labelled probe allows
unequivocal localisation of the sequence variation. The distance between the
points)
of sequence variation and the end-label is represented by the size of the
cleavage
product.
In an alternative embodiment of AMD, the probe is labelled at both ends with a
reporter
WO 00/69906 CA 02372105 2001-11-09 PCT/AU00/00439
-51
molecule, to facilitate the simultaneous analysis of both DNA strands.
Wherein the detection means is RT-PCR, the nucleic acid sample comprises an
RNA
molecule which is a transcription product of Lawsonia-derived DNA or a
homologue,
analogue or derivative thereof. As a consequence, this assay format is
particularly
useful when it is desirable to determine expression of one or more Lawsonia
genes.
According to this embodiment, the RNA sample is reverse-transcribed to produce
the
complementary single-stranded DNA which is subsequently amplified using
standard
procedures.
Variations of the embodiments described herein are described in detail by
McPherson
et al. (1991 ).
The present invention clearly extends to the use of any and all detection
means
referred to supra for the purposes of diagnosing Lawsonia spp. and in
particular
Lawsonia intracellularis infection in animal.
The amplification reaction detection means described supra can be further
coupled to
a classical hybridisation reaction detection means to further enhance
sensitivity and
specificity of the inventive method, such as by hybridising the amplified DNA
with a
probe which is different from any of the primers used in the amplification
reaction.
Similarly, the hybridisation reaction detection means described supra can be
further
coupled to a second hybridisation step employing a probe which is different
from the
probe used in the first hybridisation reaction.
A further aspect of the invention provides an isolated probe or primer derived
from
SEQ ID NO: 2 or a complementary nucleotide sequence thereto.
The present invention is further described by the following non-limiting
examples.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_j2_
EXAMPLE 1
SOURCES OF PIG TISSUE
Infected Pig Intestines
Sections of grossly thickened ilea were taken from pigs naturally or
experimentally
affected by PPE. The presence of L, intracellularis bacteria in the ilea was
confirmed
using immunofluorescent staining with specific monoclonal antibodies (McOrist
et al,
1987). An example of a suitable antibody is monoclonal antibody IG4 available
from
the University of Edinburgh, UK.
EXAMPLE 2
ISOLATION OF LAWSONIA INTRACELLULARIS BACTERIA FROM THE
INFECTED PIG ILEUM
Lawsonia intracellularis bacteria were extracted directly from lesions of PPE
in pigs by
filtration and further purified over a Percoll (Pharmacia, Uppsala, Sweden)
gradient as
follows. Infected ilea were collected from pigs and the presence of L.
intracellularis
was confirmed histologically before storage at -80°C. Sections of ileum
were thawed
and approximately 8g of infected mucosa were scraped from the intestinal wall.
The
mucosa was homogenised with 40 ml sterile phosphate buffered saline (PBS) on
half
speed for 10 seconds using a Sorvall omnimixer. This suspension was
centrifuged at
2000 xg for 4 minutes. The supernatant was discarded and the cell pellet was
resuspended in 40 ml PBS and re-centrifuged. This washing step was repeated
twice.
The cell pellet was then resuspended in 20 ml PBS and homogenised at full
speed for
one minute to release L. intracellularis bacteria.
This homogenate was centrifuged at 1000 xg for 4 minutes giving a pellet
containing
a crude mixture of homogenised epithelial cells and intestinal bacteria. The
supernatant was filtered using filters with pore sized 3 ~cm, 1.2 ,um and 0.8
,um
(Millipore Corporation, MA, USA). The filtrate was centrifuged at 8000 xg for
30
minutes, resulting in a small pellet of L. intracellularis bacteria. The L,
intracellularis
WO 00/69906 cA o23~2105 2001-ii-os pCT/AU00/00439
_j3_
bacteria were further purified using a 45% self forming percoll gradient as
follows: 2
mls of the bacterial preparation was mixed by inversion into 30 mls of a 45%
self
forming Percoll (Pharmacia LKB, Uppsala, Sweden) gradient (45% viv of Percoll,
150
mM NaCI). The gradients were centrifuged in a Sorvall centrifuge using the
SS34 rotor,
at 20,000 rpm for 30 minutes at 4°C. Usually a number of bands form
within the
gradient. The band (usually located approx. 10-20 mm from the base of the
tube)
containing the L. intracellularis bacteria was collected and the volume made
up to 16
mls with PBS. The solution was then centrifuged for 15 minutes at 8000 rpm.
The
resultant pellet was washed with PBS before being resuspended in a final
volume of
approximately one ml.
EXAMPLE 3
PURIFICATION OF LAVIlSONIA INTRACELLULARIS GENOMIC DNA
Genomic DNA was extracted from percoll-gradient purified Lawsonia
intracellularis
bacteria recovered from infected pig ilea scrapings (Example 2) by the methods
described by Anderson et al (1984) and Sambrook et al (1989).
Briefly, the L. intracellularis cells were pelleted by centrifugation at
14,000 x g at 4°C
for 15 min. The cells were resuspended in 10 ml of TE buffer (1 mM Tris-HCI,
0.1 mM
EDTA, pH 8.0) and centrifuged as before. The pellet was then resuspended in 4
ml
of TE buffer containing 4 mgiml lysozyme (Sigma Chemical Co.) and incubated at
37°C for 20 min. SDS and proteinase K (Promega, WI, USA) were added to
final
concentrations of 1 % (w/v) and 200 ~g/ml, respectively, and incubation was
continued
?5 at 45°C for 4 hours. The lysate was then extracted with an equal
volume of phenol,
phenol:chloroform (1:1) and chloroform, respectively, and the nucleic acids
were
recovered from the supernatant by ethanol precipitation. The pellet was gently
dissolved in TE, treated with RnaseA (Promega, WI, USA) at 37°C for 30
min and then
digested with proteinase K in the presence of 0.5% (w/v) SDS for 1 h at
50°C. After
another round of phenol:chloroform (1:1) and ethanol precipitation, the
purified DNA
was dissolved in TE. The DNA was then stored at 4°C.
WO 00/69906 CA 02372105 2001-11-09
PCT/AU00/00439
-54-
EXAMPLE 4
IMMUNOSCREENING OF A L. INTRACELLULARIS LIBRARY USING
EXPERIMENTAL SERA FROM VACCINATED PIGS
The genomic DNA from Example 3 was partially digested with the restriction
endonuclease Sau3A (Promega) and ligated into Lambda ZAP Express (Stratagene,
CA, USA). The lambda library was plated on a lawn of E. coli XLI-Blue cells at
a
density of 1,000 phage forming units (pfu) per 150 mm L-broth agar plate. The
library
was screened using the method described in the Protoblot Technical Manual
(Promega, WI, USA). The filters were blocked in blocking buffer (10 mM Tris-
HCI, pH
8.0, 150 mM NaCI, 0.05% Tween 20 and 5% blotto,) prior to screening with sera
from
the pigs Y12 and/or 395. The pigs Y12 and 395 had previously been immunised
with
formalin-killed L. intracellularis and heat-killed L. intracellularis,
respectively, as
described in International Patent Application No. PCT/AU96/00767. Positive
plaques
identified in the primary screen were picked, replated at a lower density and
rescreened with either or both sera until an individual positive plaque was
identified.
Plasmid DNA from the positive lambda phage clone was isolated by in vivo
excision,
as recommended by the manufacturer (Stratagene, CA, USA). This clone contained
the partial tlyA gene of L. intracellularis.
EXAMPLE 5
ANALYSIS OF L. INTRACELLULARIS EXPRESSING PHAGE CLONES
Phagemi~DfvA from positive AZAP Express phage clones was isolated by in vivo
excision, by the conditions recommended by the manufacturer (Stratagene).
Plasmid DNA for restriction analysis was extracted by alkaline-lysis, as
described by
Sambrook et al (1989), and for automated sequencing, using the High Pure
Plasmid
Kit, as recommended by the manufacturer (Boehringer Mannheim, Mannheim,
Germany).
The nucleotide sequence (320 bp) of the 3' region of the tlyA gene of Lawsonia
WO 00/69906 CA 02372105 2001-11-09 pCT/AU00/00439
_ JJ _
intracelluaris was obtained from the lambda clone described in Example 4. The
remaining portion of the tlyA gene was amplified from L. intracellularis
genomic DNA,
using the Vectorette System as described by the manufacturers (Genosys
Biotechnologies Inc., TX, USA).
Briefly, the Vectorette System enables the amplification of specific DNA
fragments
where the sequence of only one primer is known. There are three basic steps as
follows:
(i) digestion of target DNA (L. intracelluaris genomic DNA in this case) with
a restriction enzyme;
(ii) ligation of synthetic Vectorette oligonucleotides to the digested DNA;
and
(iii) amplification of the remaining nucleotide sequence of the tlyA gene
using
a specific primer to the known sequence of tlyA obtained from the lambda clone
described in Example 4 and a second primer directed toward the ligated
synthetic Vectorette oligonucleotide.
The nucleotide sequence of the amplified product containing the tlyA gene was
then
obtained.
?0 DNA sequencing of amplified DNA and isolated clone inserts was performed by
the
Dye-terminator method of automated sequencing (ABI Biosystems, CA, USA).
The nucleotide sequence of the complete coding region of the tlyA gene is set
out in
SEQ ID NO: 2.
7J
EXAMPLE 6
IDENTIFICATION OF L. INTRACELLULARIS COMPONENTS
30 Sequence similarity of the DNA molecules encoding putative vaccine
candidates
identified from Example 4 and 5, was identified using BLAST algorithms (Gish
and
States, 1993) to search GenBANK. The nucleotide sequence set forth herein as
SEQ
WO 00/69906 CA 02372105 2001-11-09 PCT/AU00/00439
-56-
ID NO: 2 and its corresponding deduced amino acid sequence set forth as SEQ ID
NO: 1 have some degree of sequence similarity to hemolysin-encoding genes and
polypeptides respectively, that are derived from other pathogenic
microorganisms
(Figure 1 ).
Unique regions of the Lawsonia intracellularis hemolysin polypeptide are
apparent from
a comparison of the amino acid sequence of this polypeptide to those from
other
microorganisms (Figure 1 ).
EXAMPLE 7
PREPARATION OF BIOLOGICAL MATERIAL FOR
DEPOSIT - AMPLIFICATION OF tlyA
Template DNA was purified from pig intestinal mucosa isolated from the ileum
of pigs
infected with L. intracellularis. DNA purification from intestinal mucosa was
performed
according to the method of Nollau et al. (1996). Due to the presence of
contaminating
polysaccharides and other material, the DNA content of the samples was not
quantified and samples were used empirically in PCR amplifications.
The PCR amplifications consisted of 1 ~cl DNA isolated from infected pig
intestinal
mucosa, 1 ~M each of the forward (RA168: 5' AAATAATAAGATGAG 3'; SEQ ID
N0:3) and reverse primers (RA169: 5' ATAGAATACAAATTATAATAAG 3'; SEQ ID
N0:4), 7.5 units KIenTaql polymerase (Ab Peptides, Inc., St. Louis,
Mis:.:~uri), 0.075
?5 units Pfu polymerase (Stratagene Cloning Systems, La Jolla, California), 1x
PC2
(KIenTaql) buffer and 0.2 mM dNTPs in a 50 ~cl volume. PCR was carried out in
4
stages: (i) 94°C for 5 min; (ii) 94°C for 1 min, 58°C for
30 seconds, 72°C for 2 min, x
33 cycles; (iii) 72°C for 10 min, (iv) hold at 4°C.
The PCR fragment comprising the tlyA gene of L. intracellularis was subcloned
into
pCR2.1-TOPO (Invitrogen Corp., Carlsbad, CA) and designated pALK12.
WO 00/69906 CA 02372105 2001-11-09 pCT/AU00/00439
-57-
DEPOSIT OF BIOLOGICAL MATERIAL
The plasmid pALK12 was deposited with the American Type Culture Collection
(ATCC)
at 10801 University Boulevard, Manassas, VA 20110, USA on 8th April, 1999 and
was
assigned ATCC Accession No. 207195.
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_j8_
REFERENCES
1. Altuvia, Y., Schueler, O., and Margalit, H. (1995) J. Mol. Biol. 249:244-
250.
2. Amann and Brosius (1985). Gene 40: 183.
3. Anderson, B.J., M.M. Bills, J.R. Egerton, and J.S. Mattick. (1984) Journal
of
Bacteriology 160:748-754.
4. Ausubel, F. M., Brent, R., Kingston, RE, Moore, D.D., Seidman, J.G., Smith,
J.A.,
and Struhl, K. (1987). ln: Current Protocols in Molecular Biology. Wiley
Interscience (ISBN 047150338).
5. Barker, I.K. and Van Dreumel, A.A. (1985) In "Pathology of Domestic
Animals,"
3rd Edition, Vol. 2 p. 1-237, eds K.V.F. Jubb, P.C. Kennedy and N. Palmer.
(Academic Press: Orlando).
6. Basaraba, R.J., Byerly, A.N., Stewart, G.C., MOSIER, D.A., Fenwick B.W.,
Chengappa, M.M., and Laegreid, W.W.(1998) Actin enhances the haemolytic
activity of Escherichia coli, Microbiology, 144:1845-1852.
7. Cole et al. (1985) In: Monoclonal antibodies in cancer therapy, Alan R.
Bliss Inc.,
pp 77-96.
8. Dayhof, M.D. (1978) In: Nat. Biomed. Res. Found. Washington D. C. VolS,
Suppl. 3.
9. De Groot, A.S., Carter, E.J., Roberts, C.G.P., Edelson, B.T., Jesdale,
B.M.,
Meister, G.E., Houghten, R.A., Montoya, J., Romulo, R.C., Berzofsky, J.A., and
Ramirezm, B.D.L.L. (1995)Vaccines 96, Cold Spring Harbor Laboratory, Cold
Spring Harbor NY.
10. Devereux, J., Haeberli, P. and Smithies, O. (1984). Nucl. Acids Res. 12:
387-395.
11. Elwell, MR, Chapman, AL and Frenkel, JK (1981 ) Veterinary Pathology 18:
136-
139.
12. Fox, JG, Murphy, JC, Otto, G Pecquet-Goad, ME, Larson, QHK and Scott JA
(1989) Veterinary Pathology 26: 515-517.
13. Gabriel, E. Meister, G.E., Caroline, G.P., Roberts, C.G.P., Berzofsky,
J.A., and
De Groot, A.S. (1995) Vaccines 95, Cold Spring Harbor Laboratory, Cold Spring
Harbor NY.
WO 00/69906 CA 02372105 2001-11-09
PCT/AU00/00439
-59-
14. Gebhart, C.J., Ward, G.E., Chang, K. And Kurtz, H.J. (1983). American
Journal
of Veterinary Research 44:361-367.
15. Gish, W and States, D.J. (1993) Nature Genetics 3: 266-272.
16. Goodman et al. (1987) Biopolymers 26: 525-532.
17. Huse et al. (1989) Science 246: 1275-1281.
18. Jones, L.A., Nibbelink, S., and Glock, R.D. (1997) Am. J. Vet. Res. 58:
1125-
1131.
19. Jonsson, L. and Martinsson, K. (1976) Acta Veterinaria Scandinavica 17:223-
232.
20. Kohler and Milstein (1975) Nature 256: 495-499
21. Kozbor et al. (1983) Immunol. Today 4: 72.
22. Lawson, G.H.K., McOrist, S., Jansi, S. and Mackie, R.A. (1993) Journal of
Clinical Microbiology 31:1136-1142.
23. Love, R.J. and Love, D.M. (1977) Veterinary Record 100:473
24. Margalit, H., Spouge, J.L., Cornette, J.L., Cease, K.B., DeLisi, C., and
Berzofsky,
J.A. (1987) J. Immunol. 138:2213-2229.
25. Mason, RW, Monkton, P and Hasse D (1998) Australian Veterinary Journal
(submitted for publication).
26. McOrist, S., Boid, R., Lawson, G.H.K. and McConnell, I. (1987) The
Veterinary
Record 121:421-422.
27. McOrist, S, Jasni, S, Mackie, RA, Maclntyre, N, Neef, N. and Lawson GHK
(1993) Infection and Immmunify 61: 4286-4292.
28. McOrist, S et al (1995) International Journal of Systematic Bacteriology
45:
820-825.
29. McPherson, M.J., Quirke, P., and Taylor, G.R. (1991)!n: PCR: A Practical
Approach. (series editors, D. Rickwood and B.D. Names) IRL Press Limited,
Oxford. pp1-253.
30. Meister, G.E., Roberts, C.G.P., Berzofsky, J.A., and De Groot, A.S.
( 1995) Vaccine 13: 581-591.
31. Mierke et al. (1990) Int. J. Peptide Protein Research 35:35-45.
32. Mohapatra, S.S., Cao, Y., Ni, H., and Salo, D. (1995) Allergy 50:37-44.
WO 00/69906 CA 02372105 2001-11-09
PCT/AU00/00439
-60-
33. Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453.
34. Nollau, P., Moser, C. and C. Wagener (1996) BioTechniques 20:784-788.
35. O'Neil, I. P.A. (1970) Veterinary Record 87:742-747.
36. Parker, K.C., Bednarek, M.A., and Coligan, J.E. (1994) J. Immunol. 152:163-
175.
37. Portoghese et al. (1990) J. Med. Chem. 33:1714-1720.
38. Reinhartz, A., Alajem, S., Samson, A. and Herzberg, M.(1993). Gene 136:
221-
226.
39. Rowland, A.C. and Lawson, G.H.K. (1976) Veterinary Record 97:178-180.
40. Sambrook, J., E.F. Fritsch, and T. Maniatis. (1989) Molecular cloning. A
laboratory manual. Second edition. Cold Spring Harbour Laboratory, Cold
Spring Harbour, N.Y.
41. Schodeb, TR and Fox JG (1990) Veterinary Pathology 27: 73-80.
42. Shimatake and Rosenberg (1981) Nature 292: 128.
43. Stills, H.F. (1991 ). Infection and immunology 59: 3227-3236.
44. Straw, B.E. (1990). Journal of American Veterinary Medical Association
197:
355-357.
45. Studier and Moffat (1986) J. Mol. Biol. 189: 113.
46. Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994) Nucl. Acids Res.
22:
4673-4680.
47. Vajda, S. and DeLisi, C. (1990) Biopolymers 29:1755-1772.
48. van Regenmortel, M. (1992) Molecular dissection of protein antigens. In:
Structure of antigens, (van Regenmortel M. ed.) CRC Press, London, pp1-27.
WO 00/69906 CA 02372105 2001-11-09 PCT/AU00/00439
SEQUENCE LISTING
<110> Agriculture Victoria Services Pty Ltd AND Pig Research and Development
Corporation AND Pfizer Products Inc.
<120> Novel lawsonia spp. gene and uses therefor I
<130> p:\oper\mro\lawson-1. pct
<140>
<141>
<150> US 60/134,022
<151> 1999-05-12
<160> 4
<170> PatentIn Ver. 2.0
<210> 1
<211> 251
<212> PRT
<213> Lawsonia intracellularis
<400> 1
Met Ala Lys His Lys Val Arg Ala Asp Glu Leu Val Phe Leu Gln Gly
1 5 10 15
Leu Ala Glu Ser Arg Glu Gln Ala Lys Arg Leu Ile Met Ala Gly Lys
20 25 30
Val Thr Leu Thr Asn Asn Ser Thr Thr Ile Pro Leu Arg Leu Glu Lys
35 40 45
Pro Gly His Lys Tyr Pro Leu Glu Ser Ile Cys Ser Leu Ile Gly Val
50 55 60
Glu Arg Phe Val Ser Arg Gly Ala Tyr Lys Leu Leu Thr Ala Leu Asp
65 70 75 80
Phe Phe Lys Ile Asp Val Lys Ser Cys Ile Cys Leu Asp Ala Gly Ala
85 90 95
Ser Thr Gly Gly Phe Thr Asp Cys Leu Leu Gln His Gly Ala Ser Lys
100 105 110
Val Tyr Ala Ile Asp Val Gly Lys Gly Gln Leu His Glu Lys Leu Tyr
115 120 125
Thr Asn Glu Gln Val Ile Asn Ile Glu Gly Val Asn Leu Arg Thr Ala
130 135 140
Ser Lys Asp Leu Ile Pro Glu Glu Val Asp I1e Leu Thr Ile Asp Val
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
_7_
145 150 155 160
Ser Phe Ile Ser Leu Thr Leu Ile Leu Prc Ser Cys I1e Arg Trp Leu
165 170 175
Lys Ala Ser Gly Ile Ile Ile Ala Leu Ile Lys Pro Gln Phe Glu Leu
180 185 190
Tyr Pro Asp Lys Ile Lys Lys Gly Val Val Lys Glu Thr Ser Leu Gln
195 200 205
Tyr Glu Ala Val Glu Lys I1e I1e His Phe Cys Gln Ser Glu Leu Gly
210 215 220
Leu Ile Phe Ile Gly Val Val Pro Ser Val I1e Lys Gly Pro Lys Gly
225 230 235 240
Asn Gln Glu Tyr Leu Ile Tyr Leu Lys Lys Arg
245 250
<210> 2
<211> 756
<212> DNA
<213> Lawsonia intracellularis
<220>
<221> CDS
<222> (1)..(753)
<400> 2
atg gcc aaa cat aaa gta cgt get gat gaa ctt gtt ttt tta caa ggg 48
Met Ala Lys His Lys Val Arg Ala Asp Glu Leu Val Phe Leu Gln Gly
1 5 10 15
tta gca gaa agt cgt gaa caa get aaa cga ctt att atg gca ggt aag 96
Leu Ala Glu Ser Arg Glu Gln A1a Lys Arg Leu Ile Met Ala Gly Lys
20 25 30
gtt aca tta act aat aat tct aca act ata cca tta cgt ttg gaa aaa 144
Val Thr Leu Thr Asn Asn Ser Thr Thr Ile Pro Leu Arg Leu Glu Lys
35 40 95
cca gga cat aaa tat cca tta gaa agt atc tgc agt tta ata ggg gta 192
Pro Gly His Lys Tyr Pro Leu Glu Ser Ile Cys Ser Leu Ile Gly Val
50 55 60
gaa cgt ttt gtg agt aga gga gca tat aag cta tta act get cta gat 240
Glu Arg Phe Val Ser Arg Gly A1a Tyr Lys Leu Leu Thr Ala Leu Asp
65 70 75 80
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
ttt ttt aaa att gat gta aaa agt tgt att tgt ctt gat gca ggc gca 288
Phe Phe Lys Ile Asp Vai Lys Ser Cys Ile Cys Leu Asp Ala Gly Ala
g5 90 95
tct act ggt ggg ttt aca gat tgt ctt tta caa cat gga gca tct aaa 336
Ser Thr Gly Gly Phe Thr Asp Cys Leu Leu Gln His Gly Ala Ser Lys
100 105 110
gta tat gcg att gat gta ggc aaa ggt caa tta cat gag aaa ctg tat 384
Val Tyr Ala Ile Asp Val Gly Lys Gly Gln Leu His Glu Lys Leu Tyr
115 120 125
act aat gaa caa gtt ata aat att gag gga gtg aat tta cgt aca gca 432
Thr Asn Glu Gln Val Ile Asn Ile Glu Gly Val Asn Leu Arg Thr Ala
130 135 140
tct aaa gat ctt att cct gaa gaa gta gat att tta act att gat gtt 480
Ser Lys Asp Leu Ile Pro Glu Glu Val Asp Ile Leu Thr Ile Asp Val
145 150 155 160
tct ttt ata tcg ctt act ttg att tta ccg tca tgt ata cgt tgg cta 528
Ser Phe Ile Ser Leu Thr Leu Ile Leu Pro Ser Cys Ile Arg Trp Leu
165 170 175
aag get tcc gga att att att gcc tta ata aag cct caa ttt gaa tta 576
Lys Ala Ser Gly Ile I1e Ile Ala Leu Ile Lys Pro Gln Phe Glu Leu
180 185 190
tat cca gat aaa ata aaa aaa ggt gta gta aaa gaa act agc ttg caa 624
Tyr Pro Asp Lys Ile Lys Lys Gly Val Val Lys Glu Thr Ser Leu Gln
195 200 205
tat gaa gca gta gaa aaa att att cat ttt tgt caa tca gaa ctt gga 672
Tyr Glu Ala Val Glu Lys Ile Ile His Phe Cys Gln Ser Glu Leu Gly
210 215 220
ctt ata ttt att ggt gtt gtt ccg tcg gta ata aaa ggt cca aaa gga 720
Leu Ile Phe Ile Gly Val Val Pro Ser Val I1e Lys Gly Pro Lys Gly
225 230 235 240
aat caa gaa tat ctt att tac ttg aaa aaa cgt taa 756
Asn Gln Glu Tyr Leu Ile Tyr Leu Lys Lys Arg
245 250
CA 02372105 2001-11-09
WO 00/69906 PCT/AU00/00439
-4-
<210> 3
<211> 15
<212> DNA
<213> synthetic oligo~vcleotide
<400> 3
aaataataag atgag 15
<210> 4
<211> 22
<212> DNA
<213> synthetic oligonucleotide
<400> 4
atagaataca aattataata ag 22
