Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
-1-
VARIANTS OF TRAF2 WHICH ACT AS AN
INHIBITOR OF TNF-ALPHA (TNF a) SIGNALING PATHWAY
Field of the Invention
Tumor necrosis factor a (TNF a) is an intercellular
mediator of immune responses produced by a variety of cells,
including activated macrophages and monocytes. The responses
triggered by TNF a are initiated through its interaction with
two distinct TNF a cell surface receptors: TNFaRl and
TNFaR2. TNF a binds to these cell surface receptors and
triggers activation of transcriptional factors, for example,
nuclear factor KB (NFKB), which regulate the expression of a
variety of immune and inflammatory response genes.
Upon the binding of TNF a, the TNF a receptors interact
through their cytoplasmic domains with a variety of
intracellular signal translation proteins. O.ne group of
intracellular signal translation proteins known to associate
with the ~TNF a receptors axe the tumor necrosis factor
receptor associated factors known as the "TRAF" family of
receptor proteins. The TRAF family is comprised of a number
of homologous proteins which share common structural features
and which associate with and transduce signals from TNF a
receptor proteins. The TRAF proteins lack enzymatic activity
motifs and instead appear to function as adapter proteins
which couple the receptors to downstream signaling cascades.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 2 -
One member of the family, TRAF2, associates with a number of
TNF a receptor family proteins, including TNFaRl, TNFaR2,
CD40 and CD30. For TRAF2, direct binding of at least eight
intracellular molecules has been identified. TRAF2 has been
shown to be critical fvr TNF a mediated activation of a
variety of transcriptional factors, in particular, NFxB and
the C-jun N-terminal kinase (JNK/SAPK) and these
transcription factors are in turn responsible for expression
of an immune/inflammatory response.
There are a variety of disease states that are linked to
regulatory pathways controlled by TNF a binding. In some
instances, TNF a binding triggers an inflammatory response
which ultimately results in a disease state. Accordingly, it
would be desirable to develop means -for~preventing diseases
related to TNF a receptor binding. In particular, it would
be desirable to find a way to prevent activation of an
inflammatory response that would otherwise be initiated by
TNF a activation. The present invention provides
polypeptides which are based on TRAF2 and which are capable
of inhibiting the TNF a signaling pathways in order to treat
and prevent diseases linked to TNF a binding.
Reported Developments
The general structure of the TRAF proteins has been
described and is illustrated generally in Figure 1(a) which
shows in diagrammatic form full-length TRAF2 (TRAF2-FL).
These proteins have an N-terminal region with a zinc ring
finger motif, followed by an array of zinc finger-like
structures. The zinc finger region is followed by a.
conserved (TRAF) domain which is composed of two subdomains:
an N-terminal domain and a C-terminal domain. The C-terminal
domain is involved iri receptor association and homo-, as well
as hetero-oligomerization of TRAFs, and serves as a docking
site for a variety of other signaling proteins.
TRAF2 follows the general structure of the TRAF proteins
described above. A number of studies have attempted to
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 3 -
correlate the structural subdomains of the TRAF2 protein with
the protein's functions.
Takeuchi et al. performed extensive mutational analysis
on TRAF2 (Takeuchi et al., J. Biol. Chem., 271(33) 19935-42
(1996)). These studies suggest TRAF2 is composed of modular
domains mediating distinct activities. The authors
determined that the N-terminal ring finger and 2 adjacent
zinc fingers of TRAF2 are required for NFxB activation and
that the distinct TRAF-N and TRAF-C subdomains within the
TRAF domain appear to independently mediate self association
and interaction with TRAF1.
Song et al. (Proc. Natl. Acad. Sci. USA, 94, 9792-9796
(1997)) followed up on studies showing that the TNF a
induced activation of NFKB and the c-jun N-terminal kinase
(JNK/SAPK) requires TRAF2. The authors showed that TRAF2 is
the bifurcation point of two kinase cascades leading to
activation of NFKB and JNK. This observation supports a .
functional model for TRAF2 and other members of the TRAF
family as adaptor proteins with docking sites for additional
signaling proteins that initiate parallel downstream
responses.
Min et al. (J. Immunology, 159, 3508-3518 (1997)) used a
transfection/overexpression strategy to analyze the roles of
TRAF proteins. TRAF2 containing the TRAF domain, but lacking
amino terminal residues 1-80 had been previously shown to
inhibit TNF a induced NFxB activation. The authors
demonstrated that this TRAF2 variant also blocked JNK
activation by TNF a.
Brink et al., (J. Biol. Chem., 273, 7, 4129-4134 (1998))
described a splice variant of TRAF2 which they called
"TRAF2A." The cDNA of TRAF2A is identical to TRAF2 with the
exception of an extra 21 by of sequence encoding a seven
amino acid insert within the TRAF2A ring finger domain. The
authors found that TRAF2A mRNA expression is regulated in a
tissue specific manner and TRAF2A protein is capable of
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 4 -
binding to the cytoplasmic domain of TNFaR2. They also found
that, in contrast to TRAF2, TRAF2A is unable to stimulate
NFKB activity when overexpressed in 293 cells and acts as a
dominant inhibitor of TNFaR2 dependent NFKB activation.
Many studies have linked inflammatory processes and TNFa
with the major cardiovascular disease states (Bryant et al.,
Circulation, 97(14):1375-81 (1998); Kubota et al., Circ.
Res., 81(4):627-35 (1997); Muller Werdan et al., Eur.
Cytokine Netw., 9(4):689-91 (1998); Aukrust et al., Am. J.
Cardiol., 83(3):376-82 (1999)). Over the past five years,
evidence has accumulated which indicates that raised local
TNF a levels are associated with: (a) cardiac ischemia-
reperfusion injury which follows myocardial infarction,
coronary artery bypass surgery, cardiac transplantation or
ischemia-reperfusion injury in the CNS following stroke; (b)
the progression and rupture of advanced coronary
atherosclerotic plaques; (c) the development and progression
of congestive heart failure; and (d) endothelial cell injury
following balloon angioplasty. In addition, recent findings
suggest that apoptotic cell death may be an important factor
in the pathophysiology of myocardial cell death during heart
failure or infarction. It is known that TNF a can induce
myocyte apoptosis.
In addition to the cardiovascular disease states
mentioned above, there are a variety of other disease states
whose pathogenesis is linked to TNF a. These disease states
include Crohn's disease, psoriasis, rheumatoid arthritis,
graft versus host disease, inflammatory bowel disease, non-
insulin dependent diabetes and neurodegenerative diseases
(e. g., Parkinson's disease).
Given the relationship between TNF a and a large variety
of diseases such as those discussed above, it would be
desirable to provide compositions and methods for inhibiting
and treating these disease states.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 5 -
Summary of the Invention
In accordance with the present invention, it has been
found that variants of TRAF2, in particular, a variant that
includes a naturally occurring splice variation (TRAF2TR) and
a variant that includes the naturally occurring splice
variation and a deletion in the N-terminal region of TRAF2
(TRAF2TD), provide for inhibition of TNF a signal
transduction and the associated immune inflammatory
responses.
In accordance with one embodiment of the. present
invention, there is provided a DNA sequence encoding TRAF2TR
comprising the sequence as shown in Figure 2a.
In accordance with another embodiment of the present
invention, there is also provided a DNA sequence encoding
TRAF2TD comprising the sequence as shown in Figure 3a.
In a preferred embodiment, the TRAF2TR and TRAF2TD DNA
are cDNAs.
In other embodiments, the present invention provides a
TRAF2TR polypeptide which is capable of inhibiting tumor
necrosis factor a (TNF a) regulated pathways comprising an
amino acid sequence as shown in Figure 2b and a TRAF2TD
polypeptide which is capable of inhibiting TNF a regulated
pathways comprising an amino acid sequence as shown in Figure
3b.
Another aspect of the present invention provides a
method of inhibiting TNF a regulated pathways in a patient
comprising introducing into the body of the patient a
composition which is capable of inhibiting the TNF a
regulated pathway and which comprises an expression vector
capable of expressing TRAF2TR polypeptide, an expression
vector capable of expressing TRAF2TD polypeptide, a TRAF2TR
polypeptide and a pharmaceutically acceptable carrier, or a
TRAF2TD polypeptide and a pharmaceutically acceptable
carrier.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 6 -
Still another aspect of the present invention provides a
method of inhibiting diseases involving overproduction of TNF
a comprising administering to a patient a composition which
is capable of inhibiting TNF a regulated pathways and which
comprises an expression vector capable of expressing TRAF2TR,
an expression vector capable of expressing TRAF2TD, a TRAF2TR
polypeptide and a pharmaceutically acceptable carrier, or a
TRAF2TD polypeptide and a pharmaceutically acceptable,
carrier.
Yet another aspect of the present invention provides a
method of inhibiting TNF a pathologies involving
hyperactivation of nuclear factor xB(NFxB) dependent genes
comprising administering to a patient a composition which is
capable of inhibiting TNF a regulated pathways and which
comprises an expression vector capable of expressing TRAF2TR,
an expression vector capable of expressing TRAF2TD, a TRAF2TR
polypeptide and a pharmaceutically acceptable carrier, or a
TRAF2TD polypeptide and a pharmaceutically acceptable
carrier.
The present invention also provides a method of
inhibiting inflammatory processes involving tumor necrosis
factor a comprising administering to a patient a composition
which is capable of inhibitingrTNF a regulated pathways and
which comprises an expression vector capable of expressing
TRAF2TR, an expression vector capable of expressing TRAF2TD,
a TRAF2TR polypeptide and a pharmaceutically acceptable
carrier, or a TRAF2TR polypeptide and a pharmaceutically
acceptable carrier.
In certain embodiments, the inflammatory process is
selected from the group consisting of Crohn's disease,
psoriasis, rheumatoid arthritis, graft versus host disease,
inflammatory bowel disease, non-insulin dependent diabetes
and neurogenerative diseases.
In yet another embodiment, the inflammatory process is a
cardiovascular disease selected from the group consisting of
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
(a) cardiac ischemia-reperfusion injury following myocardial
infarction, coronary artery bypass surgery, cardiac
transplantation or ischemia-reperfusion injury in the CNS
following stroke; (b) the progression and rupture of advanced
coronary atherosclerotic plaques; (c) the development and
progression of congestive heart failure; (d) endothelial cell
injury following balloon angioplasty; and (e) apoptotic cell
death of myocardial cells.
In yet another embodiment of the present invention,
there is provided a DNA sequence encoding a TRAF2TR/2TD,
variant.
Another aspect of the present invention provides a
TRAF2TR/2TD variant polypeptide which is capable of
inhibiting TNF a-regulated pathways.
The present invention provides the advantage of being
able to treat a wide variety of disease states using variants
of a naturally-occurring protein which interferes with an
early event common to these disease states, i.e., TNF a
signal transduction.
Brief Description of the Drawings
Figure 1 is a schematic structure of full length TRAF2
(TRAF2-FL) and the alternatively spliced variant, TRAF2TR.
Figures 2a and 2b are the nucleic acid sequence (2a) of
TRAF2TR cDNA and the amino acid sequence of TRAF2TR (2b)'.
Figures 3a and 3b are the nucleic acid sequence of
TRAF2TD (3a) and the amino acid sequence of TRAF2TD (3b).
Figures 4a and 4b are the nucleic acid (4a) and amino
acid (4b) alignment of spliced TRAF2 (TRAF2TR) and full
length TRAF2.
Figure 5 illustrates the tissue distribution of TRAF2TR
variant mRNA. Lanes: 1 - control TRAF2FL cDNA; 2 - control
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- g -
TRAF2 spliced variant (TRAF2TR) cDNA; 3 - Jurkat; 4 - HeLa
cell line; 5 - Thymus; 6 - placenta; 7 - Thymus; 8'- spleen;
9 - ovary; 10 - control TRAF2FL.
Figure 6 illustrates the immunodetection of Myc-fused
TRAF2FL and TRAF2TR in transfected HeLa cells. Lanes: 1-
pcDNA3 vector; 2-myc-TRAF2FL; 3-myc-TRAF2TR.
Figure 7 illustrates an electrophoretic mobility shift
assays (EMSA) that was performed using an NFKB UAS probe.
Nuclear extracts from cells overexpressing FL TRAF2 (lanes 3
and 4) show TNF-alpha induced shifts significantly stronger
in comparison to control (lanes 1 and 2). TRAF2-TR
overexpression blocks formation of NF-kB and, as a result, no
shift has been detected in TNF a stimulated cells (lanes 5
and 6).
Detailed Description of the Invention
There are set forth hereafter definitions of terms used
herein and descriptions of preferred embodiments of the
present invention.
Definitions
A "cloning vector" is a replicon, for example, a
plasmid, phage or cosmid, to which another DNA segment may be
attached so as to bring about the replication of the attached
segment. A "replicon" is any genetic element (e. g., plasmid,
chromosome, virus) that functions as an autonomous unit of
DNA replication in vivo, i.e., capable of replication under
its own control. A cloning vector may be capable of
replication in one cell type and expression in another
("shuttle vector"). In preferred embodiments of the present
invention, the cloning vector is capable of expression in a
host cell and the "expression vector" is able to express
TRAF2TR or TRAF2TD at sufficient levels to interfere with a
TNF a regulated pathway in the cell.
A "cassette" refers to a segment of DNA that can be
inserted into a vector at one or more specific restriction
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 9 -
sites. The segment of DNA encodes a polypeptide of interest
and the cassette and restriction sites are designed to ensure
insertion of the cassette in the proper reading frame for
transcription and translation.
A cell has been "transfected" by exogenous or
heterologous DNA when such DNA has been introduced inside the
cell. A cell has been."transformed" by exogenous or
heterologous DNA when the transfected DNA effects a
phenotypic change. The transforming DNA can be integrated
(covalently linked) into chromosomal DNA making up the genome
of the cell.
A "nucleic acid molecule" refers to the phosphate ester
polymeric form of ribonucleosides (adenosine, guanosine,
uridine or cytidine; "RNA molecules") or of deoxyribo-
nucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine,
or deoxycytidine; "DNA molecules") or of any phosphoester
analogs thereof, such as phosphorothioates and thioesters, in
either single stranded form or a double-stranded helix.
Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are'
possible. The term "nucleic acid molecule" and in particular'
DNA or RNA molecule, refers only to the primary and secondary
structure of the molecule, and does not limit it to any
particular tertiary forms. Thus, this term includes double-
stranded DNA found, inter alia, in linear or circular DNA
molecules (e.g., restriction fragments), plasmids, and
chromosomes. In discussing the structure of particular
double-stranded DNA molecules, sequences may be described
herein according to the normal convention of giving only the
sequence in the 5' to 3' direction along the nontranscribed
strand of DNA (i.e., the strand having a sequence homologous
to the mRNA). A "recombinant DNA molecule" is a DNA molecule
that has undergone a molecular biological manipulation.
A nucleic acid molecule is "hybridizable" to another
nucleic acid molecule, for example, a cDNA, genomic DNA; or
RNA, when a single stranded form of the nucleic acid molecule
can anneal to the other nucleic acid molecule under the
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 10 -
appropriate conditions of temperature and solution ionic
strength (see Sambrook et al., infra). The conditions of
temperature and ionic strength determine the "stringency" of.
the hybridization. Hybridization requires that the two
nucleic acids contain complementary sequences, although
depending on the stringency of the hybridization, mismatches
between bases are possible. The appropriate stringency for
hybridizing nucleic acids depends on the length of the
nucleic acids and the degree of complementation, variables
well known in the art.
As used herein, the term "oligonucleotide" refers to a
nucleic acid, generally of at least l8 nucleotides, that is
hybridizable to a genomic DNA molecule, a cDNA molecule, or
an mRNA molecule encoding TRAF2. Oligonucleotides can be
labeled, e.g., with 'ZP-nucleotides or nucleotides to which a
label, such as biotin, has been covalently conjugated. In
one embodiment, a labeled oligonucleotide can be used as a
probe to detect the presence of a nucleic acid encoding
TRAF2. In another embodiment, oligonucleotides (one or both
of which may be labeled) can be used as PCR primers, either
for cloning full length or a fragment of TRAF2, or to detect
the presence of nucleic acids encoding TRAF2. In a further
embodiment, an oligonucleotide can form a triple helix with a
TRAF2 DNA molecule. Generally, olig.onucleotides are prepared
synthetically, preferably on a nucleic acid synthesizer.
Accordingly, oligonucleotides can be prepared with non-
naturally occurring phosphoester analog bonds, such as
thioester bonds, etc. '
A DNA "coding sequence" is a double-stranded DNA
sequence which is transcribed and translated into a
polypeptide in a cell in vitro or in vivo when placed under
the control of appropriate regulatory sequences. The DNA
coding sequences and the appropriate regulatory sequences are
preferably provided in an expression vector. The boundaries
of the coding sequence are determined by a start codon at the
5' (amino) terminus and a translation stop codon at the 3'
(carboxyl) terminus. A coding sequence can include, but is
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 11 -
not limited to, prokaryotic sequences, cDNA from eukaryotic
mRNA, genomic DNA sequences from eukaryotic (e. g., mammalian)
DNA, and even synthetic DNA sequences. If the coding
sequence is intended for expression in a eukaryotic cell, a
polyadenylation signal and transcription termination sequence
will usually be located 3' to the coding sequence.
Transcriptional and translational control sequences are
DNA regulatory sequences, 'such as, for example, promoters,
enhancers, and terminators that provide for the expression of
a coding sequence in a host cell. In eukaryotic cells,
polyadenylation signals are control sequences.
A "promoter sequence" is a DNA regulatory region capable
of binding RNA polymerase in a cell and initiating
transcription of a downstream (3' direction) coding sequence.
For purposes of defining.the.present invention, the promoter
sequence is bounded at its 3' terminus by the transcription
initiation site and extends upstream (5' direction) to
include the minimum number of bases or elements necessary to
initiate transcription at levels detectable above background.
Within the promoter sequence will be found a transcription
initiation site (conveniently defined for example, by mapping
with nuclease S1), as well as protein binding domains
(consensus sequences) responsible for the binding of RNA
polymerase.
A coding sequence is "under the control" of
transcriptional and translational control sequences in a cell
when RNA polymerase transcribes the coding sequence into
mRNA, which is then spliced (if the coding sequence contains
introns) and translated into the protein encoded by the
coding sequence.
As used herein, the term "homologous" refers to the
relationship between proteins that possess a "common
evolutionary origin." Such proteins (and their encoding
genes) have sequence homology, as reflected by their high
degree of sequence similarity. The term "sequence
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 12 -
similarity" refers to the degree of identity or
correspondence between nucleic acid or amino acid sequences
of proteins that may or may not share a common evolutionary
origin. However, in common usage and as used herein, the
term "homologous," when modified with an adverb such as
"highly," may refer to sequence similarity and not a common
evolutionary origin.
The term "TNF a regulated pathway" and related terms
refer to signal transduction pathways involving the binding
of TNF a to a member of the tumor necrosis factor receptor
family (TNFR).
The term "corresponding to" is used herein to refer to
similar or homologous sequences, whether the exact position
is identical or different from the molecule to which the
similarity or homology is measured. A nucleic acid or amino
acid sequence alignment may include spaces. Thus, the term
"corresponding to" refers to the sequence similarity and not
the numbering of the amino.acid residues or nucleotide bases.
The term "splice variant" refers to a polypeptide
encoded by an mRNA produced by alternative processing of the
full length mRNA encoded by a gene or genes resulting in an
mRNA that contains one or more deletions relative to the full
length mRNA for the genes.
Embodiments of the Invention
The present invention relates to two variants of TRAF2
which inhibit TNF a signaling pathways. One embodiment is an
RNA processing splice variant of TRAF2 referred to
hereinafter as "TRAF2 truncated" or "TRAF2TR". Another
embodiment is based on TRAF2TR having a deletion of amino
acid residues 1 to 87 relative to TRAF2TR and is referred to
as "TRAF2 truncated-deleted" or "TRAF2TD". Both TRAF2TR and
TRAF2TD have the ability to inhibit TNF a signaling pathways.
TRAF2TD is a particularly preferred embodiment due to its
ability to dramatically reduce the response to TNF a binding.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 13 -
There follows hereinbelow a description of the structure
of these two embodiments, followed by a discussion on how to
prepare these embodiments.
Structure and Preparation of TRAF2TR Embodiment
The cDNA sequence for this splice variant is presented
in Figure 2a and the amino acid sequence is presented in
Figure 2b. Referring to Figure 1 which shows TRAF2TR
schematically, it can be seen that the deletion removes amino
acid residues 123 to 201 of TRAF2FL, which encompasses the C-
terminal portion of Zn finger domain 1 and all of the Zn
fingers 2 and 3, as well as the N-terminal residues of Zn
finger 4 .
The TRAF2TR embodiment of the present invention can be
prepared by any suitable method, including a variety of
methods known to those of skill in the art. Teachings on the
isolation, cloning and sequencing DNA can be found in a
variety of sources. General molecular biology, microbiology
and recombinant DNA techniques within the skill of the art,
are explained fully in the literature. See, e.g., Sambrook,
Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual,
Second Edition (1989) Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York (herein "Sambrook et al.,
1989"); DNA Cloning: A Practical Approach, Volumes-I and II
(D. N. Glover ed. 1985); 0ligonucleotide Synthesis (M. J. Gait
ed. 1984); Nucleic Acid Hybridization [B. D. Hames & S.J.
Higgins eds. (1985)]; Transcription And Translation [B. D.
Shames & S.J. Higgins, eds. (1984)]; Animal Cell Culture [R. I.
Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL
Press, (1986)]; B. Perbal, A Practical Guide To Molecular
Cloning (1984); F.M. Ausubel et al. (eds.), Current Protocols
in Molecular Biology, John Wiley & Sons, Inc. (1994).
Given the information in the description herein on the
DNA sequence of TRAF2TR and the known methods in the art for
obtaining cDNA, nucleotide sequences encoding TRAF2TR and
TRAF2TD can be cloned readily or prepared from wild type
TRAF2 and inserted into an appropriate vector for expression
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 14 -
of these proteins in vitro or in vivo. For a description of
methods relating to cloning cDNA and expression vectors, see
Sambrook et al., 1989, supra.
A gene encoding TRAF2, whether genomic DNA or cDNA, can
be isolated from a human genomic library or cDNA library.
Methods for obtaining a gene given the DNA sequence
information presented herein are well known in the art. The
TRAF2 DNA may be obtained by standard procedures known in the
art from cloned DNA (e. g., a DNA "library"). It is obtained
preferably from a cDNA library prepared from tissues with
high level expression of the protein (e. g., cells of lymphoid
origin, in particular, B cells or an osteosarcoma cell line,
for example, human osteosarcoma SAOS-2 (ATCC No. HTB-85) that
exhibit high levels of expression of TRAF2 or TRAF2TR). The
DNA may also be obtained by the cloning of genomic DNA, or
fragments thereof, purified from the desired cell (See, for
example, Sambrook et .al.,' 1989, supra; Glover, D.M. (ed.),
1985, DNA Cloning: A Practical Approach, MRL Press, Ltd.,
Oxford; U.K. Vol. I, II) or by chemical synthesis. Clones
derived from genomic DNA may contain regulatory and intron
DNA regions in addition to coding regions; clones derived
from cDNA will not contain intron sequences. Given that the
present invention is based in part on the isolation of a
splice variant (TRAF2TR) of full length TRAF2, it is
desirable to obtain a cDNA encoding the TRAF2TR sequence.
Methods for obtaining cDNA are well known in the art.
Briefly, these methods include isolating a mixture of
messenger RNA (mRNAs) from eukaryotic cells and employing a
series of enzymatic reactions to synthesize double-stranded
DNA copies (cDNAs) complementary to the isolated mRNAs.
It has been found that reverse transcriptase-polymerase
chain reaction (RT-PCR) cloning is an efficient way to
isolate cDNA containing the TRAF2TR splice variant as
presented in Example 1 hereinbelow. RT-PCR involves reverse
transcription of cellular mRNA with the enzyme reverse
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 15 -
transcriptase followed by subjecting the resultant DNA
product to amplification using PCR.
Regardless of the method used to obtain the desired
cDNA, the double-stranded cDNA mixture is inserted into
cloning vehicles by, any one of many known techniques,
depending at least in part on the particular vehicle used.
Various insertion methods are discussed in considerable
detail in Methods in Enzymology, 68, 16-18 (1980), as well as
in Sambrook et al., 1989, supra.
Once the DNA segments are inserted into a cloning
vehicle, the cloning vehicle is used to transform a suitable
host. These cloning vehicles usually impart an antibiotic
resistance trait on the host. Such hosts are generally
prokaryotic cells and only a few of the host cells contain
the desired cDNA. The transfected host cells constitute a
gene "library", providing a representative sample of the
mRNAs present in the cell from which the mRNAs were isolated.
Given the sequence information on TRAF2 provided herein,
an appropriate oligonucleotide sequence may be prepared,
preferably synthesized as discussed above, and used to
identify clones containing TRAF2 sequences. To identify
clones containing the TRAF2 sequences, individual transformed
or transfected cells are grown as colonies on a
nitrocellulose filter paper. The colonies are lysed and the
DNA is bound tightly to the filter paper by heating. The
filter paper is then incubated with a labeled oligonucleotide
probe which is complementary to TRAF2. DNA fragments with
substantial homology to TRAF2 will hybridize to the probe.
The greater the degree of homology, the more stringent
hybridization conditions can be used.
The probe hybridizes with the cDNA for which it is
complementary. It can be identified by autoradiography or by
chemical reactions that identify the presence of the probe.
The corresponding clones are characterized in order to
identify one or a combination of clones which contain all of
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 16 -
the structural information for the desired protein. The
nucleic acid sequence coding for the protein of interest is
isolated and reinserted into an expression vector. The
expression vector brings the cloned gene under the regulatory
control of specific prokaryotic or eukaryotic control
elements which allow the efficient expression (transcription
and translation) of the ds-cDNA.
Further selection can be carried out on the basis of the
properties of the gene. For example, if the gene encodes a
protein product having the isoelectric, electrophoretic,
amino acid composition, or partial amino acid sequence of the
TRAF2 protein as disclosed herein. Thus, the presence of the
gene may be detected by assays based on the physical,
chemical, or immunological properties of its expressed
product. For example, cDNA clones, or DNA clones can be
selected which produce a protein that has similar or
identical properties-to TRAF2TR with regard to
electrophoretic migration, isoelectric focusing, non-
equilibrium pH gel electrophoresis, proteol.ytic,digestion, or
antigenicity.
Struatureand Preparation of TRAF2TD Embodiment
Relative to TRAF2TR, TRAF2TD has a deletion of amino
acids 1 to 87 and the corresponding nucleotides encoding
these amino acids. The DNA sequence for TRAF2TD is presented
in Figure 3a and the amino acid sequence is presented in
Figure 3b.
Any suitable method can be used to prepare the TRAF2TD
embodiment, including, for example, a variety of methods
based on the information provided above. In particular,
there are a number of methods for creating a truncated
version of TRAF2TR containing a deletion of amino acids 1 to
87. In a preferred method of preparation, TRAF2TR cDNA is
used as a template for PCR using a 5' primer encompassing
nucleotides 262 to 280 of the TRAF2 full length coding -
sequence (ATGAGTTCGGCCTTCCCAGAT wherein the ATG codon was
included to create a translation initiation site; the 3'
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 17 -
primer was TTA TAG CCC TGT CAG GTC CAC. The resulting
construct begins at amino acid 88 of full length TRAF2 and
contains the 123 to 201 amino acid deletion of TRAF2TR.
Additional variants of TRAF2TR can be prepared using
methods such as those described above for the preparation of
TRAF2TD.
TRAF2TR~2TD Variants
The present invention includes within its scope allelic
variants, substitution, addition and deletion mutant
variants, analogs, and derivatives of TRAF2TR or TRAF2TD
(hereinafter referred to as "TRAF2TR/2TD variants") and
homologs from other species that have the same or homologous
functional activity as TRAF2TR. In preferred embodiments,
genes having deletions or substitutions that increase the
ability to inhibit TNF a signaling pathways are utilized in
the practice of the invention. Preparation or isolation of
TRAF2TR/2TD variants are within the scope of the present
invention. Accordingly, the scope of the present invention
includes TRAF2TR/2TD variants which are functionally active,
2.0 i.e., capable of exhibiting one or more functional activities
associated with TRAF2TR.
TRAF2TR/2TD variants can be made by altering encoding
nucleic acid sequences by substitutions, additions or
deletions that provide for functionally equivalent molecules.
Preferably, TRAF2TR/2TD embodiments are made that have
enhanced or increased functional activity relative to TRAF2TR
or TRAF2TD.
Due to the degeneracy of nucleotide coding sequences,
other DNA sequences which encode substantially the same amino
acid sequence as TRAF2TR, including an amino acid sequence
that contains a single amino acid variant, may be used in the
practice of the present invention. These include, but are
not limited to, allelic genes, homologous genes from other
species, and nucleotide sequences comprising all or portions
of TRAF2TR which are altered by the substitution of different
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 18 -
codons that encode the same amino acid residue within the
sequence, thus producing a silent change. Likewise,, the
TRAF2TR/2TD variants of the invention include, but are not
limited to, those containing, as a primary amino acid
sequence, all or part of the amino acid sequence of a TRAF2TR
protein including altered sequences in which functionally
equivalent amino acid residues are substituted for residues
within the sequence resulting in a conservative amino acid
substitution. For example, one or more amino acid residues
within the sequence can be substituted by another amino acid
of a similar polarity, which acts as a functional equivalent,
resulting in a silent alteration. Substitutes for an amino
acid within the sequence may be selected from other members
of the class to which the amino acid belongs. For example,
the nonpolar (hydrophobic) amino acids include alanine,
leucine, isoleucine, valine, proline, phenylalanine,
tryptophan and methionine. Amino acids containing aromatic
ring structures are phenylalanine, tryptophan, and tyrosine.
The polar neutral amino acids include glycine, serine,
threonine, cysteine, tyrosine, asparagine, and glutamine.
The positively charged (basic) amino acids include arginine,
lysine and histidine. The negatively charged (acidic) amino
acids include aspartic acid and glutamic acid. Such
alterations will not be expected to affect apparent molecular
weight as determined by polyacrylamide gel electrophoresis,
or isoelectric point.
Particularly preferred substitutions are:
- Lys for Arg and vice versa such that a positive charge
may be maintained;
- Glu for Asp and vice versa such that a negative charge
may be maintained;
- Ser for Thr such that a free -OH can be maintained;
and
- Gln for Asn such that a free CONHZ can be maintained.
Amino acid substitutions may also be introduced to
substitute an amino acid with a particularly preferable
property. For example, a Cys may be introduced a potential
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 19 -
site for disulfide bridges with another Cys. A His may be
introduced as a particularly "catalytic" site (i.e., His can
act as an acid or base and is the most common amino acid in
biochemical catalysis). Pro may be introduced because of its
particularly planar structure, which induces a-turns in the
protein's structure.
The genes encoding TRAF2TR/2TD variants of the invention
can be produced by various methods known in the art. The
manipulations which result in their production can occur at
the gene or protein level. For example, the cloned TRAF2
gene sequence can be modified by any of numerous strategies
known in the art (Sambrook et al., 1989, supra). The
sequence can be cleaved at appropriate sites with restriction
endonuclease(s), followed by further enzymatic modification
if desired, isolated, and ligated in vitro. In the
production of the gene encoding a TRAF2TR/2TD embodiment,
care should be taken to ensure that the modified gene remains
within the same translational reading frame as the TRAF2TR
gene, uninterrupted by translational stop signals, in the
gene region where the desired activity is encoded.
Additionally, the TRAF2TR/2TD-encoding nucleic acid
sequence can be mutated in vitro or in vivo to create and/or
destroy translation, initiation, and/or termination-
sequences, or to create variations in coding regions and,/or
form new restriction endonuclease sites or destroy
preexisting ones, to facilitate further in vitro
modification. Preferably, such mutations enhance the
functional activity of the mutated TRAF2TR gene product. Any
technique for mutagenesis known in the art can be used,
including but not limited to, in vitro site-directed
mutagenesis (Hutchinson, C., et al., 1978, J. Biol. Chem.
253:6551; Zoller and Smith, 1984, DNA 3:479-488; Oliphant et
al., 1986, Gene 44:177; Hutchinson et al., 1986, Proc. Natl.
Acad. Sci. U.S.A. 83:710), use of "TAB" linkers (Pharmacia),
etc. PCR techniques are preferred for site directed
mutagenesis (see Higuchi, 1989, "Using PCR to Engineer DNA",
in PCR Technolocty~ Principles and Applications for DNA
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 20 -
Amplification, H: Erlich, ed., Stockton Press, Chapter 6, pp.
61-~0) .
The discussion which follows relates to the manipulation
and expression of DNA encoding the desired polypeptides is
common to both TRAF2TR and TRAF2TD, as well as TRAF2TR/2TD
variants.
Cloning of TRAF2TR, TRAF2TD and
T_RAF2TR/2TD Variants into Cloninct/Exuression Vectors
The identified and isolated DNA sequence can be inserted
into an appropriate cloning/expression vector (hereinafter
"vector") to facilitate modifications to the sequence or,
expression of the protein. These vectors typically include
multiple cloning sites, promoters, sequences which facilitate
replication in a host cell and selection markers.
Any suitable vector can be used. There are many known
in the art. Examples of vectors that can be used-include,
but are not limited to, plasmids or modified viruses. The
vector is typically compatible with a given host cell into
which the vector is introduced to facilitate replication of
the vector and expression of the encoded proteins. The
insertion of a DNA sequence into a given vector can, for
example, be accomplished by ligating the DNA fragment into a
cloning vector which has complementary cohesive termini.
However, if the complementary restriction sites used to
fragment the DNA are not present in the cloning vector, the
ends of the DNA molecules may be enzymatically modified.
Alternatively, any site desired may be produced by ligating
nucleotide sequences (linkers) onto the DNA termini; these
ligated linkers may comprise specific chemically synthesized
oligonucleotides encoding restriction endonuclease
recognition sequences. Useful vectors may consist of
segments of chromosomal, non-chromosomal and synthetic DNA
sequences. Examples of specific vectors useful in the
practice of the present invention include, but are not
limited to, E. coli bacteriophages, for example, lambda
derivatives, or plasmids, for example, pBR322 derivatives or
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 21 -
pUC plasmid derivatives, e.g., pmal-c, pFLAG, derivatives of
SV40 and known bacterial plasmids, e.g., E. coli plasmids col
E1, pCRl, pMal-C2, pET, pGEX (Smith et al., 1988, Gene 67:31-
40), pMB9 and their derivatives, plasmids such as RP4; phage
DNAs, e.g., the numerous derivatives of phage 1, e.g., NM989,
and other phage DNA, e.g., M13 and filamentous single
stranded phage DNA; yeast vectors such as the 2 ~m plasmid or
derivatives thereof; vectors useful in eukaryotic cells, for
example, vectors useful in insect cells, such as baculovirus
vectors, vectors useful in mammalian cells; vectors derived
from combinations of plasmids and phage DNAs; plasmids that
have been modified to employ phage DNA or other expression
control sequences; and the like.
Yeast vectors that can be used according to the
invention include, but are not limited to, the non-fusion
pYES2 vector (XbaI, SphI, ShoI, NotI, GstXI, KcoRI, BstXI,
BamHi, Sacl, Kpnl, and HindIII cloning sit; Invitrogen) or
the fusion pYESHisA, B, C (XbaI, SphI, ShoI, NotI, BstXI,
EcoRI, BamHl, SacI, KpnI, and HindIII cloning site, N-
terminal peptide purified with ProBond resin and cleaved with
enterokinase; Invitrogen).
Baculovirus vectors that can be used in the practice of
the invention include a variety of vectors, including both
non-fusion transfer vectors, for example, pVL941 (BamH1
cloning site; Summers), pVL1393 (BamHi, SmaI, XbaI, EcoRl,
NotI, XmaIII, BglII, and PstI cloning site; Invitrogen),
pVL1392 (BglII, PstI, NotI, XmaIII, EcoRI, XbaI, SmaI, and
BamHl cloning site; Summers and Invitrogen), and pBlueBacIII
(BamHl, BglII, PstI, NcoI, and HindIII cloning site, with
blue/white recombinant screening possible; Invitrogen), and
fusion transfer vectors, for example, pAc700 (BamHl and KpnI
cloning site, in which the BamHl recognition site begins with
the initiation codon; Summers), pAc701 and pAc702 (same as
pAc700, with different reading frames), pAc360 (BamHl cloning
site 36 base pairs downstream of a polyhedrin initiation
codon; Invitrogen(195)), and pBlueBacNisA, B,.C (three
different reading frames, with BamHl, BglII, PstI, NcoI, and
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 22 -
HindIII cloning site, an N-terminal peptide for ProBond
purification, and blue/white recombinant screening of
plaques; Invitrogen) can be used.
Mammalian vectors contemplated for use in the invention
include, for example, vectors with inducible promoters, for
example, the dihydrofolate reductase (DHFR) promoter, e.g.,
any expression vector with a DHFR expression vector, or a
DHFR/methotrexate co-amplification vector, for example, pED
(PstI, SalI, SbaI, SmaI, and EcoRI cloning site, with the
vector expressing both the cloned gene and DHFR; see Kaufman,
Current Protocols in Molecular Biology, 16.12 (1991).
Alternatively,~a glutamine synthetase/methionine sulfoximine
co-amplification vector, for example, pEEl4 (HindIII, XbaI,
SmaI, SbaI, EcoRI, and BclI cloning site, in which the vector
expresses glutamine synthase and the cloned gene; Celltech).
In another embodiment, a vector that directs episomal
expression under control of Epstein Barr Virus (EBV) can be
used, for example, pREP4 (BamHl, SfiI, XhoI, NotI, NheI,
HindIII, NheI, PvuII, and KpnI cloning site, constitutive
Rous Sarcoma Virus Long Terminal Repeat (RSV-LTR) promoter,
hygromycin selectable marker; Invitrogen), pCEP4 (BamHl,
SfiI, XhoI, NotI, NheI; HindIII, NheI, PvuII, and KpnI
cloning site, constitutive human cytomegalovirus (hCMV)
immediate early gene, hygromycin selectable marker;-
Invitrogen), pMEP4 (KpnI, PvuI, NheI, HindIII; NotI, XhoI,
SfiI, BamHl cloning site, inducible methallothionein IIa gene
promoter, hygromycin selectable marker: Invitrogen), pREP8
(BamHl, XhoI, NotI, HindIII, NheI, and KpnI cloning site,
RSV-LTR promoter, histidinol selectable marker; Invitrogen),
pREP9 (KpnI, NheI, HindIII, NotI, XhoI, SfiI, and BamHI
cloning site, RSV-LTR promoter, 6418 selectable marker;
Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycin
selectable marker, N-terminal peptide purifiable via ProBond
resin and cleaved by enterokinase; Invitrogen). Selectable
mammalian expression vectors for use in the invention include
pRc/CMV (HindIII, BstXI, NotI, SbaI, and ApaI cloning site,
6418 selection; Invitrogen), pRc/RSV (HindIII, Spel, BstXI,
NotI, XbaI cloning site, 6418 selection; Invitrogen), pcDNA3
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 23 -
(HindIII, KpnI, BamHI, BstXI, EcoRI, EcoRV, BstXI [repeat],
NotI, XhoI, XbaI, ApaI, cloning sites, 6418, ampicillin
selection, Invitrogen) and others. Vaccinia virus mammalian
expression vectors (see, Kaufman, 1991, supra) for use
according to the invention include but are not limited to
pSCl1 (SmaI cloning site, TK- and [i-gal selection), pMJ601
(SalI, SmaI, AflI, NarI, BspMII, BamHI, ApaI, NheI, SacII,
KpnI, and HindIII cloning site; TK- and (3-gal selection), and
pTKgptFlS (EcoRI, PstI, SalI, AccI, HindII, SbaI, BamHI, and
Hpa cloning site, TK or XPRT selection).
A variety of methods may be used to confirm that the
desired DNA sequence encoding TRAF2TR, TRAF2TD or TRAF2TR/2TD
variants have been cloned into a vector. In general, one or
more of the following approaches is used: (a) PCR
amplification of the desired plasmid DNA or specific mRNA,
(b) nucleic acid hybridization, (c) presence or absence of
selection marker gene functions, (d) analyses with
appropriate restriction endonucleases, and (e) expression of
inserted sequences. In the first approach, the nucleic acids
can be amplified by PCR to provide for detection of the
amplified product. In the second approach, the presence of a
foreign gene inserted in an expression vector can be detected
by nucleic acid hybridization using probes comprising
sequences that are homologous to an inserted marker-gene. In
the third approach, the recombinant vector/host system can be
identified and selected based upon the presence or absence of
certain "selection marker" gene functions (e.g., (3
galactosidase activity, thymidine kinase activity, resistance
to antibiotics, transformation phenotype, occlusion body
formation in baculovirus; etc.) caused by the insertion of
foreign genes in the vector. In another example, if the
nucleic acid encoding TRAF2TR is inserted within the
"selection marker" gene sequence of the vector, recombinants
containing the TRAF2TR insert can be identified by the
absence of the selection marker gene function. In the fourth
approach, recombinant expression vectors are identified by
digestion with appropriate restriction enzymes. In the fifth
approach, recombinant expression vectors can be identified by
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 24 -
assaying for the activity, biochemical, or immunological
characteristics of the gene product expressed by the
recombinant, provided that the expressed protein assumes a
functionally active conformation.
Promoters
The nucleotide sequence coding for TRAF2TR or TRAF2TD or
a TRAF2TR/2TD variant thereof can be inserted into an
expression vector which contains the necessary elements for
the transcription and translation of the inserted protein-
coding sequence. Such elements are termed herein a
"promoter." Thus, the nucleic acid encoding the polypeptides
of the invention is operationally associated with a promoter
in an expression vector of the invention. Both cDNA and
genomic sequences can be cloned and expressed under control
of such regulatory sequences. An expression vector also
preferably includes a replication origin. The necessary
transcriptional and translational signals can be provided on
a recombinant expression vector, or they may be supplied by
the native gene encoding TRAF2 and/or its flanking regions.
Any of the methods previously described for the insertion of
DNA fragments into a cloning vector may be used to construct
expression vectors containing a gene consisting of
appropriate transcriptional/translational control signals and
the protein coding sequences. These methods may include in
vitro recombinant DNA and synthetic techniques and in vivo
recombination (genetic recombination).
Expression may be controlled by any promoter/enhancer
element known in the art, but these regulatory elements.must
be functional in the host selected for expression. Promoters
which may be used to control TRAF2TR gene expression include,
but are not limited to, the SV40 early promoter region
(Benoist and Chambon, 1981, Nature 290:304-310), the promoter
contained in the 3' long terminal repeat of Rous sarcoma
virus (Yamamoto, et al., 1980, Cell 22:787-797), the herpes
thymidine kinase promoter (Wagner et al., 1981, Proc. Natl.
Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of
the metallothionein gene (Brinster et al., 1982, Nature
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 25 -
296:39-42); prokaryotic expression vectors for example, the
(3-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc.
Natl. Acad. Sci. U.S.A., 75:3727-3731), or the tac promoter
(DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A., 80:21-
25); see also "Useful proteins from'recombinant bacteria" in
Scientific American, 1980, 242:74-94; promoter elements from
yeast or other fungi for example, the Gal 4 promoter, the ADC
(alcohol dehydrogenase) promoter, PGK (phosphoglycerol
kinase) promoter, alkaline phosphatase promoter; and the
animal transcriptional control regions, which exhibit tissue
specificity and have been utilized in transgenic animals:
elastase I gene control region which is active in pancreatic
acinar cells (Swift et al., 1984, Cell 38:639-646; Ornitz et
al., 1986, Cold Spring Harbor Symp. Quant. Biol.,. 50:399-409;
MacDonald, 1987, Hepatology 7:425-515); insulin gene control
region which is active in pancreatic beta cells (Hanahan,
1985, Nature 315:115-122), immunoglobulin gene control region
which is active in lymphoid cells (Grosschedl et al., 1984,
Cell 38:647-658; Adames et al., 1985, Nature 318:533-538;
Alexander et al., 1987, Mol. Cell. Biol., 7:1436-1444), mouse:
mammary tumor virus control region which is active in
testicular, breast, lymphoid and mast cells (Leder et al.,
1986, Cell 45:485-495), albumin gene control region which is
active in liver (Pinkert et al., 1987, Genes and Devel.
1:268-276), alpha-fetoprotein gene control region which is
active in liver (Krumlauf et al., 1985, Mol. Cell. Biol.,
5:1639-1648; Hammer et al., 1987, Science 235:53-58), alpha
1-antitrypsin gene control region which is active in the
liver (Kelsey et al., 1987, Genes and Devel., 1:161-171),
beta-globin gene control region which is active in myeloid
cells (Mogram et al., 1985, Nature 315:338-340; Kollias et
al., 1986, Cell 46:89-94), myelin basic protein gene control
region which is active in oligodendrocyte cells in the brain
(Readhead et al., 1987, Cell 48:703-712), myosin light chain-
2 gene control region which is active in skeletal muscle
(Sani, 1985, Nature 314:283-286), and gonadotropic releasing
hormone gene control region which is active in the -.
hypothalamus (Mason et al., 1986, Science 234:1372-1378).
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 26 -
Introduction of Vectors into Host Cells
Vectors can be introduced into host cells by any
suitable method, including, e.g., transfection,
electroporation, microinjection, transduction, cell fusion,
DEAE dextran, calcium phosphate precipitation, lipofection
(lysosome fusion), use of a gene gun, or a DNA vector
transporter (see, e.g., Wu et al., 1992, J. Biol. Chem.
267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624;
Hartmut et al., Canadian Patent Application No. 2,012,311,
filed March 15, 1990), so that many copies of the gene
sequence are generated. Preferably, the cloned gene is ,
contained on a shuttle vector plasmid, which provides for
expansion in a cloning cell, e.g., E. coli., and facilitates
purification for subsequent insertion into an appropriate
expression cell line. For example, a shuttle vector, which
is a vector that can replicate in more than one type of
organism,.can be prepared for replication in both E. coli and..
Saccharomyces cerevisiae by linking sequences from an E. coli
plasmid. with sequences from the yeast 2 ~m plasmid.
Host Cell Systems
Potential host cell systems include but are not limited
to mammalian host cell systems infected with virus (e. g.,
vaccinia virus, adenovirus, etc.); insect host cell systems
infected with virus (e. g., baculovirus); microorganisms such
as yeast containing yeast vectors; or bacteria transformed
with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The
expression elements of vectors vary in their strengths and
specificities. Depending on the host cell system utilized,
any one of a number of suitable transcription and translation
elements may be used.
In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or
modifies and processes the gene product in the specific
fashion desired. Different host cells have characteristic
and specific mechanisms for the translational and post-
translational processing and modification of proteins.
Appropriate cell lines or host systems can be chosen to
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 27 -
ensure the desired modification and processing of the foreign
protein expressed. Expression in yeast can produce a
biologically active product. Expression in eukaryotic cells
can increase the likelihood of "native" folding. Moreover,
expression in mammalian cells can provide a tool for
reconstituting, or constituting, TRAF2TR-inhibiting activity.
Furthermore, different vector/host expression systems may
affect processing reactions, such as proteolytic cleavages,
to a different extent. Expression vectors of the invention
can be used, as pointed out above, both to transfect cells
for screening or biological testing of modulators of TRAF2TR
activity.
A recombinant TRAF2TR, TRAF2TD or TRAF2TR/2TD variant of
the invention may be expressed chromosomally, after
integration of the coding sequence by recombination. In this
regard, any of a number of amplification systems may be used
to achieve high levels of stable gene expression (See
Sambrook et al., 1989, supra).
The cell into which the recombinant vector comprising
the nucleic acid encoding TRAF2TR is introduced is cultured
in an appropriate cell culture medium under conditions that
provide for expression of TRAF2TR by the cell.
Once a suitable host system and growth conditions are
established, recombinant expression vectors can be propagated
and prepared in quantity. Soluble forms of the protein can
be obtained by collecting culture fluid, or solubilizing
inclusion bodies, e.g., by treatment with detergent, and if
desired sonication or other mechanical processes, as
described above. The solubilized or soluble protein can be
isolated using various techniques, including polyacrylamide
gel electrophoresis (PAGE), isoelectric focusing, 2-
dimensional gel electrophoresis, chromatography (e.g., ion
exchange, affinity, immunoaffinity, and sizing column
chromatography), centrifugation, differential solubility,
immunoprecipitation, or by any other standard technique for
the purification of proteins.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 28 -
As discussed above, a "vector" is any means for the
transfer of a nucleic acid according to the invention into a
host cell. Preferred vectors are viral vectors, for example,
retroviruses, herpes viruses, adenoviruses, and adeno-
associated viruses. Thus, a gene encoding a protein or
polypeptide domain fragment of the present invention is
introduced in vivo, ex vivo, or in vitro using a viral vector
or through direct introduction of DNA. Expression in
targeted tissues can be effected by targeting the transgenic
vector to specific cells, such as with a viral vector or a
receptor ligand, or by using a tissue-specific promoter, or
both.
Use of Viral Vector Systems for
ex vivo and in vivo Treatment Methods
Viral vectors commonly used for in vivo or ex vivo
targeting and therapy procedures are DNA-based vectors and
retroviral vectors. Methods for constructing and using viral
vectors are known in the art [see, e.g., Miller and Rosman,
BioTechnigues 7:980-990 (1992)]. Preferably, the viral
vectors are replication defective, that is, they are unable
to replicate autonomously in the target cell. In general, the
genome of the replication defective viral vectors which are
used within the scope of the present invention lack at least
one region which is necessary.for the replication of the
virus in the infected cell. These regions can either be
eliminated (in whole or in part), or be rendered non-
functional by any technique known to a person skilled in the
art. These techniques include the total removal,
substitution (by other sequences, in particular by the
inserted nucleic acid), partial deletion or addition of one
or more bases to an essential (for replication) region. Such
techniques. may be performed in vitro (on the isolated DNA) or
in situ, using the techniques of genetic manipulation or by
treatment with mutagenic agents. Preferably, the replication
defective virus retains the sequences of its genome which are
necessary for encapsulating the viral particles.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 29 -
DNA viral vectors include an attenuated or defective DNA
virus,. such as but not limited to herpes simplex virus (HSV),
papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-
associated virus (AAV), vaccinia virus, and the like.
Defective viruses, which entirely or almost entirely lack
viral genes, are preferred. Defective virus is not
replication competent after introduction into a cell, and
thus does not lead to a productive viral infection. Use of
defective viral vectors allows for administration to cells in
a specific, localized area, without concern that the vector
can infect other cells. Thus, a specific tissue can be
specifically targeted. Examples of particular vectors
include, but are not limited to, a defective herpes virus 1
(HSV1). vector [Kaplitt et al., Molec. Cell. Neurosci. 2:320-
330 (1991)], defective herpes virus vector lacking a glyco-
protein L gene [Patent Publication RD 371005 A], or other
defective herpes virus vectors [International Patent
Publication No. WO 94/21807, published September 29, 1994;
International Patent Publication No. WO 92/05263, published
April 2, 1994]; an attenuated adenovirus vector, such as the
vector described by Stratford-Perricaudet et al. [J. Clin.
Invest. 90:626-630 (1992); see also La.Salle,et al., Science
259:988-990 (1993)]; and a defective adeno-associated virus
vector [Samulski et al., J. Virol.-61:3096-3101 (1987);
Samulski et~al., J. Virol. 63:3822-3828 (1989); Lebkowski et
al., Mol. Cell. Biol. 8:3988-3996 (1988)].
Preferably, for in vivo administration, an appropriate
immunosuppressive treatment is employed in conjunction with
the viral vector, e.g., adenovirus vector, to avoid immuno-
deactivation of the viral vector and transfected cells.. For
example, immunosuppressive cytokines, such as interleukin-12
(IL-12), interferon-g (IFN-g), or anti-CD4 antibody, can be
administered to block humoral or cellular immune responses to
the viral vectors [see, e.g., Wilson, Nature Medicine
(1995)]. In addition, it is advantageous to employ a viral
vector that is engineered to express a minimal number of
antigens.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 30 -
Naturally, the invention contemplates delivery of a
vector that will express a therapeutically effective amount
of TRAF2TR for gene therapy applications. The phrase
"therapeutically effective amount" is used herein to mean an
amount sufficient to reduce and most preferably prevent an
immune response resulting in a clinically significant
manifestation of a disease linked to TNF a binding.
Alternatively, a therapeutically effective amount is
sufficient to cause an improvement in a clinically
significant condition in the host.
Preferred Viral Vector Systems
Used in ex vivo and in vivo Treatment Methods
Certain viral vector systems are well developed in the
art and are suited to the treatment methods of the present
invention.
a. Adenovirus Vector systems
In a preferred embodiment, the vector is an adenovirus
vector. Adenoviruses are eukaryotic DNA viruses that can be
modified to efficiently deliver a nucleic acid of the
invention to a variety of cell types. Various serotypes of
adenovirus exist. Of these serotypes, preference is given,
within the scope of the present invention, to using type 2 or
type 5 human adenoviruses (Ad 2 or Ad 5) or adenoviruses of
animal origin (see W094/26914). Those adenoviruses of animal
origin which can be used within the scope of the present
invention include adenoviruses of canine, bovine, murine
(example: Mavi, Beard et al., Virology 75 (1990) 81), ovine,
porcine, avian, and simian (example: SAV) origin.
Preferably, the adenovirus of animal origin is a canine
adenovirus, more preferably a CAV2 adenovirus (e. g. Manhattan
or A26/61 strain (ATCC VR-800), for example).
Preferably, the replication defective adenoviral vectors
of the invention comprise the ITRs, an encapsidation sequence
and the nucleic acid of interest. Still more preferably, at
least the E1 region of the adenoviral vector. is non-
functional. The deletion in the E1 region preferably extends
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 31 -
from nucleotides 455 to 3329 in the sequence of the Ad5
adenovirus (PvuII-BglII fragment) or 382 to 3446 (HinfII-
Sau3A fragment). Other regions may also be modified, in
particular the E3 region (W095/02697), the E2 region
(W094/28938), the E4 region (W094/28152, W094/12649 and
W095/02697), or in any of the late genes L1-L5.
In a preferred embodiment, the adenoviral vector has a
deletion in the E1 region (Ad 1.0). Examples of E1-deleted
adenoviruses are disclosed in_EP 185,573, the contents of
which are incorporated herein by reference. In another
preferred embodiment, the adenoviral vector has a deletion in
the El and E4 regions (Ad 3.0). Examples of E1/E4-deleted
adenoviruses are disclosed in W095/02697 and W096/22378, the
contents of which are incorporated herein by reference. In
still another preferred embodiment; the adenoviral vector has
a deletion in the E1 region into which the E4 region and the
nucleic acid sequence are inserted (see FR94 13355, the
contents of which are incorporated herein by reference).
The replication defective recombinant adenoviruses
according to the invention can be prepared by any technique
known to the person skilled in the art (Levrero et al., Gene
101 (1991) 195, EP 185 573; Graham, EMBO J. 3 (1984) 2917).
In particular, they can be prepared by homologous -
recombination between an adenovirus and a plasmid which
carries, inter alia, the DNA sequence of interest. The
homologous recombination is effected following cotransfection
of the adenovirus and plasmid into an appropriate cell line.
The cell line which is employed should preferably (i) be
transformable by the said elements, and (ii) contain the
sequences which are able to complement the part of the genome
of the replication defective adenovirus, preferably in
integrated form in order to avoid, the risks of recombination.
Examples of cell lines which may be used are the human
embryonic kidney cell line 293 (Graham et al., J. Gen. Virol.
36 (1977) 59) which contains the left-hand portion of the
genome of an Ad5 adenovirus (12%) integrated into its genome,
and cell lines which are able to complement the E1 and E4
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 32 -
functions, as described in applications W094/26914 and
W095/02697. Recombinant adenoviruses are recovered and
purified using standard molecular biological techniques,
which are well known to one of ordinary skill in the art.
b. Adeno-Associated Virus Vector Systems
The adeno-associated viruses (AAV) are DNA viruses of
relatively small size which can integrate, in a stable and
site-specific manner, into the genome of the cells which they
infect. They are able to infect a wide spectrum of cells
without inducing any effects on cellular growth, morphology
or differentiation, and they do not appear to be involved in
human pathologies. The AAV genome has been cloned, sequenced
and characterised. It encompasses approximately 4700 bases
and contains an inverted terminal repeat (ITR) region of
15- approximately 145 bases at each end, which serves as an
origin of replication for the virus. The remainder of the
genome is divided into two essential regions which carry the
encapsulation functions: the left-hand part of the genome,
which contains the rep gene involved in viral replication and
expression of the viral genes; and the right-hand part of the
genome, which contains the cap gene encoding the capsid
proteins of the virus.
The use of vectors derived from the AAVs for -
transferring genes in vitro and in vivo has been described
(see WO 91/18088; WO 93/09239; US 4,797,368, US 5,139,941, EP
488 528). These publications describe various AAV-derived
constructs in which the rep and/or cap genes are deleted and
replaced by a gene of interest, and the use of these
constructs for transferring the said gene of interest in
vitro (into cultured cells) or in vivo, (directly into an
organism). The replication defective recombinant AAVs
according to the invention can be prepared by cotransfecting
a plasmid containing the nucleic acid sequence of interest
flanked by two AAV inverted terminal repeat (ITR) regions,
and a plasmid carrying the AAV encapsulation genes (rep and
cap genes), into a cell line which is infected with a human
helper virus (for example an adenovirus). The AAV
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 33 -
recombinants which are produced are then purified by standard
techniques.
The invention also relates, therefore, to an AAV-derived
recombinant virus whose genome encompasses a sequence
encoding a nucleic acid encoding TRAF2TR or TRAF2TD flanked
by the AAV ITRs. The invention also relates to a plasmid
encompassing a sequence encoding a nucleic acid encoding
TRAF2TR or TRAF2TD flanked by two ITRs from an AAV. Such a
plasmid can be used as it is for transferring the nucleic
acid sequence, with the plasmid, where appropriate, being
incorporated into.a liposomal vector (pseudo-virus).
c. Retrovirus Vector Systems
In another embodiment the gene can be introduced iri a
retroviral vector, e.g., as described in Anderson et al.,
U.S. Patent No. 5,399,346; Mann et al., 1983, Cell 33:153;
Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S.
Patent No. 4,980,289; Markowitz et al., 1988, J. Virol.~
62:1120; Temin et al., U.S. Patent No. 5,124,263; EP 453242,
EP178220; Bernstein et al. Genet. Eng. 7 (1985) 235;
McCormick, BioTechnology 3 (1985) 689; International Patent
Publication No. WO 95/07358, published March 16, 1995, by
Dougherty et al.; and Kuo et al., 1993, Blood 82:845. The
retroviruses are integrating viruses which infect dividing
cells. The retrovirus genome includes two LTRs, an
encapsulation sequence and three coding regions (gag, pol and
envy. In recombinant retroviral vectors, the gag, pot and
env genes are generally deleted, in whole or in part, and
replaced with a heterologous nucleic acid sequence of
interest. These vectors can be constructed from different
types of retrovirus, such as, HIV, MoMuLV ("murine Moloney
leukaemia virus" MSV ("murine Moloney sarcoma virus"), HaSV
("Harvey sarcoma virus"); SNV ("spleen necrosis virus"); RSV
("Rous sarcoma virus") and Friend virus. Defective retroviral
vectors are disclosed in W095/02697.
In general, in order to construct recombinant
retroviruses containing a nucleic acid sequence, a plasmid is
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 34 -
constructed which contains the LTRs, the encapsulation
sequence and the coding sequence. This construct is used to
transfect a packaging cell line, which cell line is able to
supply in trans the retroviral functions which are deficient
in the plasmid. In general, the packaging cell lines are
thus able to express the gag, pol and env genes. Such
packaging cell lines have been described in the prior art, in
particular the cell line PA317 (US 4,861,719); the PsiCRIP
cell line (W090/02806) and the GP+envAm-12 cell line
(W089/07150). In addition, the recombinant retroviral
vectors can contain modifications within the LTRs for
suppressing transcriptional activity as well as extensive
encapsulation sequences which may include a part of the gag
gene (Bender et al., J. Virol. 61 (1987) 1639). Recombinant
retroviral vectors are purified by standard techniques known
to those having ordinary skill in the art.
Retroviral vectors can be constructed to function as
infections particles or to undergo a single round of
transfection. In the former case, the virus is modified to
retain all of its genes except for those responsible for
oncogenic transformation properties, and to express the
heterologous gene. Non-infectious viral vectors are prepared
to destroy the viral packaging signal, but retain the
structural genes required to package the co-introduced virus
engineered to contain the heterologous gene and the packaging
signals. Thus, the viral particles that are produced are not
capable of producing additional virus. Targeted gene
delivery is described in International Patent Publication WO
95/28494, published October 1995.
Non-Viral systems Used in
ex vivo and in vivo Treatment Methods
Certain non-viral systems have been used in the art and
can facilitate introduction of DNA encoding the polypeptides
of the present invention to desired target cells.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 35 -
a. Lipofection Delivery Systems
A vector can be introduced in vivo by lipofection. For
the past decade, there has been increasing use of liposomes
for encapsulation and transfection of nucleic acids in vitro.
Synthetic cationic lipids designed to limit the difficulties
and dangers encountered with liposome mediated transfection
can be used to prepare liposomes for in vivo transfection of
a gene encoding a marker [Felgner, et. al., Proc. Natl. Acad.
Sci. U.S.A. 84:7413-7417 (1987); see Mackey, et al., Proc.
Natl. Acad. Sci. U.S.A. 85:8027-8031 (1988); Ulmer et al.,
Science 259:1745-1748 (1993)]. The use of cationic lipids
may promote encapsulation of negatively charged nucleic
acids, and also promote fusion with negatively charged cell
membranes [Felgner and Ringold, Science 337:387-388 (1989)].
Particularly useful lipid compounds and compositions for
transfer of nucleic acids are described in International
Patent Publications W095/18863 and W096/17823, and in U.S.
Patent No. 5,459,127. The use of lipofection to introduce
exogenous genes into the specific organs in vivo has certain
practical advantages. Molecular targeting of liposomes to
specific cells represents one area of benefit. It is clear
that directing transfection to particular cell types would be
particularly advantageous in a tissue with cellular
heterogeneity, for example, pancreas, liver, kidney, and the
brain. Lipids may be chemically coupled to other molecules
for the purpose of targeting [see Mackey, et. al., supra].
Targeted peptides, e.g., hormones or neurotransmitters, and
proteins for example, antibodies, or non-peptide molecules
could be coupled to liposomes chemically.
Other molecules are also useful for facilitating
transfection of a nucleic acid in vivo, for example, a
cationic oligopeptide (e. g., International Patent Publication
W095/21931), peptides derived from DNA binding proteins
(e.g., International Patent Publication W096/25508), or a
cationic polymer (e. g., International Patent Publication
W095/21931).
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 36 -
b. Naked DNA Delivery Systems
It is also possible to introduce the vector in vivo as a
naked DNA plasmid (see U.S. Patents 5,693,622, 5,589,466 and
5,580,859). Naked DNA vectors for gene therapy can be
introduced into the desired host cells by methods known in
the art, e.g., transfection, electroporation, microinjection,
transduction, cell fusion, DEAE dextran, calcium phosphate
precipitation, use of a gene gun, or use of a DNA vector
transporter [see, e.g., Wu et al., J. Biol. Chem. 267:963-967
(1992); Wu and Wu, J._Biol. Chem. 263:14621-14624 (1988);
Hartmut et al., Canadian Patent Application No. 2,012,311,
filed March 15, 1990; Williams et al., Proc. Natl. Acad. Sci.
USA 88:2726-2730 (1991)]. Receptor-mediated DNA delivery
approaches can also be used [Curiel et al., Hum. Gene Ther.
3:147-154 (1992); Wu and Wu, J. Biol. Chem. 262:4429-4432
(1987)].
Methods to Identify
Therapeutically Useful Variants of TRAF2TR
There are a variety of methods which may be used to
determine whether a TNF a regulated pathway is involved in a
disease state and to determine the effect of the polypeptides
of the present invention on these pathways. For example, to
study the role of TRAF2TR in NFKB regulation, electrophoretic
mobility shift assay (EMSA) analysis was performed using NFKB
UAS as a probe (Figure 7). Nuclear extracts from cells
overexpressing FL TRAF (lanes 3 and 4) show TNF a induced
shifts significantly stronger in comparison to control (lanes
1 and 2). TRAF2TR overexpression blocks formation of NFKB
and, as a result, no shift has been detected in TNF a
stimulated cells (lanes 5 and 6). These results suggested
strong inhibition of NFKB formation as no shift band appeared
in TNF a stimulated cells. Increased amount of NF KB binding
activity is present in cells overexpressing full-length TRAF2
after stimulation with TNF a (lane 4).
Experiments of the type discussed hereinabove can be
utilized to determine whether a given pathway implicated in a
disease state might be treated using the compositions of the
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 37 -
present invention. In general, the experiments described
above can be performed substituting TRAF2TR~or TRAF2TD with
an isolated or prepared variant of TRAF2 to determine if the
variant has the ability to inhibit TNF a regulated pathways.
Disease States Related to TNF a Regulated Pathways
As discussed above, the present invention relates to the
use of TRAF2TR and TRAF2TD and variants thereof to inhibit
TNF a regulated pathways. In particular, the present
invention relates to using the aforementioned to effectively
block TNF a induced activation of several transcriptional
factors, including NFxB and AP-1. TRAF2TR and TRAF2TD and
variants thereof are useful in inhibiting TNF a signal
transduction pathways in pathologies which involve
overproduction of TNF a and hyperactivation of NFxB dependent
genes. A variety of diseases appear to involve TNF~a
regulated pathways and the pathological basis for these
diseases may involve overproduction of TNF a or
hyperactivation of NFKB dependent genes. These diseases can
be treated using the TRAF2TR and TRAF2TD proteins and their
variants.
Given the evidence that inflammatory processes
contribute heavily to the pathology of all the major
cardiovascular disease states and given that elevated TNF a
levels are associated with these inflammatory processes, it
is believed that a variety of major cardiovascular disease
states can be treated using the compositions and methods of
the present invention. These diseases include, but are not
limited to, cardiovascular disease states, including cardiac
ischemia-reperfusion injury following myocardial infarction,
coronary artery bypass surgery, cardiac transplantation or
ischemia-reperfusion injury in the CNS following stroke; the
progression and rupture of advanced coronary atherosclerotic
plaques; the development and progression of congestive heart
failure; and endothelial cell injury following balloon
angioplasty. In addition, the present invention can be used
to prevent apoptotic cell death of myocardial cells during
heart failure or infarction and to avoid myocyte apoptosis.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 38 -
By blocking TNF a receptor signaling, a gene therapy
approach using TRAF2TR or TRAF2TD or a variant thereof can be
used to treat these diseases. The use of TRAF2TD is
preferred, given its highly effective inhibition of TNF a
regulated pathways.
Similarly, by blocking TNF a receptor signaling, gene
therapy with TRAF2TR of TRAF2TD or a variant thereof can be
used to treat other disease states where TNF a is involved in
the pathogenesis. These disease states include, but are not
limited to, Crohn's disease, psoriasis, rheumatoid arthritis,
graft versus host disease, inflammatory bowel disease, non-
insulin dependent diabetes and neurodegenerative diseases
(e. g., Parkinson's disease).
Additionally, TRAF2TD can be used in various assays to
study the mechanisms of TRAF2-dependent signal transduction
pathways.
Therapeutic Compositions and Dosages
In use, any vector, viral or non-viral, of the invention
is preferably introduced in vivo in a pharmaceutically
acceptable vehicle or carrier. The phrase "pharmaceutically
acceptable" refers to molecular entities and compositions
that are physiologically tolerable and do not typically
produce a significant allergic or similar untoward reaction,
such as gastric upset, dizziness and the like, when
administered to a human. Preferably, as used herein, the
term "pharmaceutically acceptable" means approved by a
regulatory agency of the Federal or a state government or
listed in the U.S. Pharmacopeia or other generally recognized
pharmacopeia for use in animals, and more particularly in
humans. The term "carrier" refers to a diluent, adjuvant,
excipient, or vehicle with which the compound is
administered. Such pharmaceutical carriers can be sterile
liquids, for example, water and oils, including those of
petroleum, animal, vegetable or synthetic origin, for
example, peanut oil, soybean oil, mineral oil, sesame oil and
the like. Water or aqueous solution saline solutions and
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 39 -
aqueous dextrose and glycerol solutions are preferably .
employed as carriers, particularly for injectable solutions.
Suitable pharmaceutical carriers are described in
"Remington's Pharmaceutical Sciences" by E.W: Martin.
The present invention provides methods of treatment
which comprise the administration to a human or other animal
of an effective amount of a composition of the invention.
Effective amounts may vary, depending on the age, type
and severity of the condition to be treated, body weight,
desired duration of treatment, method of administration, and
other parameters. Effective amounts are determined by a
physician or other qualified medical professional.
It is believed that polypeptides according to the
invention will be used most widely in doses of about 0.01
mg/kg to about 100 mg/kg of body weight per day. Preferred
doses are about-0.1 mg/kg to about 50 mg/kg,.with doses of
about 1 mg/kg to about 10 mg/kg of body weight per day being
more preferred.
Recombinant viruses according to the invention are
generally formulated and administered in the form of doses of
between about 104 and' about 1014 pfu. In the case of AAVs and
adenoviruses, doses of from about 106 to about 1011 pfu are
preferably used. The term "pfu" ("plaque-forming unit")
corresponds to the infective power of a suspension of virions
and is determined by infecting an appropriate cell culture
and measuring the number of plaques formed. The techniques
for determining the pfu titre of a viral solution are well
documented in the prior art.
The following examples are illustrative of the present
invention.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 40 -
EXAMPLES
EXAMPLE 1 - Isolation of cDNA Encodinct TRAF2TR
The TRAF2 splice variant, TRAF2TR, was isolated during
RT PCR cloning (Current Protocols in Molecular Bioloay, 1996)
of full length TRAF2 using mRNA from the human Osteosarcoma
cell line (OSA1). While using primers to produce full length
TRAF2 cDNA, a smaller PCR product was observed. The fragment
was excised and cloned independently. The 5' primer used for
the RT PCR was ATG GCT GCA GCT AGC GTG ACC and the 3' primer
was TTA TAG CCC TGT CAG GTC CAC.
Upon sequencing of this smaller clone (TRAF2TR), an in-
frame deletion of the codons encoding amino acid residues 123
to 201 were identified. Figures 4a and 4b compare the
nucleic and amino acid sequences of full length TRAF2 and
TRAF2TR.
A variety of tissues in the body have been identified as
sources of TRAF2TR mRNA and may be used to isolate the
TRAF2TR mRNA using the protocol described above. To
determine the tissue distribution of TRAF2TR, RT-PCR was
performed using a pair of primers outside of the spliced
region. The primer on the 5' side of the deletion was: GGT
GGA GAG CCT GCC GGC CG and the primer on the 3' side of the
deletion was: GGC AGC CGA TGG CGT GGA ATC TG, and cDNA was
generated using an oligo-dT primer from total RNA from
different tissues. The cDNAs were separated by agar
electrophoresis and transferred to nitrocellulose.
Hybridization was performed using a specific probe from the
TRAF2 sequence adjacent to the 5' end of the spliced region
(5' - GAT GCA CCT GGA AGG GGA CCC TGA AAT - 3'). This probe
recognizes both non-spliced and spliced variants of TRAF2.
The expected size for the non-spliced variant (TRAF2FL) is
373 by and for the spliced variant (TRAF2TR), 136 bp.
Referring now to Figure 5, Lanes: 1-control TRAF2-FL cDNA; 2-
control TRAF2 spliced variant cDNA; 3-Jurkat; 4-HeLa cell
line; 5-thymus; 6-placenta; 7-thymus; 8-spleen; 9-ovary.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 41 -
Western blot analysis of lysates from various cell
sources does not unequivocally detect the presence of the
truncated TRAF2 variant at the level of expressed protein.
It appears that the high level expression and production of
the protein are limited developmentally, temporally, or
controlled by an undefined, mechanism, in a cell type
dependent manner (e. g., B cell maturation in Germinal
centers.).
The deletion in the splice variant TRAF2TR retains an
open reading frame and the 5' splice boundary matches
canonical splice donor sequence. The deletion removes amino
acid residues 123-201 of WT TRAF2, which encompasses the C-
terminal portion of zinc finger domain 1 and all of zinc
fingers 2 and 3 as well as the N-terminal residues of zinc
finger 4 (Figure 1). This deletion more than likely disrupts
the function of the zinc finger region, and is similar to the
deletion created by Takeuchi et al., J. Biol. Chem. 271(33),
19935-19942.(1996) which they report exhibits a dominant
negative effect on TNF a induced NFKB activation.
EXAMPLE 2 Pret~aration of TRAF2TD
It is known that deletion of N-amino terminal 87 amino
acids (representing the ring fingers domain, see Figure 1) of
TRAF2 creates a protein which acts as a dominant inhibitor
(dominant negative) of TNF a dependent NFKB activation
(Takeuchi et al., J. Biol. Chem. 271(33), 19935-19942
(1996)). In order to determine if an N-terminal deletion
would affect the activity of TRAF2TR, a construct
representing TRAF2TR with a deletion of 87 amino acids from
the N-terminus of the protein (residues 1 to 87) was
prepared. To prepare this variant of TRAF2TR, TRAF2TR cDNA
was used as a template for PCR using a 5' primer encompassing
nucleotides 262 to 280 of the TRAF2 full length coding
sequence (ATGAGTTCGGCCTTCCCAGAT wherein the ATG codon was
included to create a translation initiation site; the 3'
primer was TTA TAG CCC TGT CAG GTC CAC. The resulting
construct begins at amino acid 88 of full length TRAF2 and
contains the 123 to 201 amino acid deletion of TRAF2TR,
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 42 -
providing a "double deletion" construct. The construct was
verified by DNA sequencing and cloned into a mammalian
expression vector (pcDNA3, Invitrogen).
EXAMPLE 3 - Transfection of HeLa Cells with TRAF2TR
To determine the effect of TRAF2TR on NFKB activation,
truncated as well as the full length (FL) TRAF2 were
constructed with N-Myc affinity tags in a mammalian
expression vector (pcDNA3, INVITROGEN). To prepare N-myc
fusion constructs, a 5' PCR primer was synthesized containing
the sequence of the Myc tag with a starting methionine
(MetGluGlnLysLeuIleSerGluGluAspLeuAsn) followed by the first
nucleotides of the TRAF2 cDNA: 5' - ATG GAG CAG AAA TTG
ATT TCC GAG GAA GAT CTG AAC ATG GCT GCA GCT AGC GTG AC - 3'.
The 3' PCR primer sequence was: 5' - TTAGAGCCCTGTCAGGTCCACAA
15 - 3'. The PCR product was purified and cloned into the
pcDNA3 vector using standard techniques.
HeLa cells were transfected with pcDNA3-myc TRAF2
constructs using LipoFectamine (BRL, Gibco) reagent using the
protocol provided by the reagent supplier. In brief, 4 ml of
20 LipoFectamine were mixed with 1 mg of the DNA in 1 ml of
Serum free DMEM (BRL) media and 3 x 105 cells in 60 mm Petri
dish were incubated with that mixture overnight at 37°C at 5%.
COZ incubator. Twenty-four hours after transfection, cells
were washed with phosphate buffered saline and lysed in 200
ml of an SDS electrophoresis sample buffer (SIGMA). Ten ml
of the lysate was separated by electrophoresis and Western
blotted to a nitrocellulose membrane. Immunostaining and ECL
(AMERSHAM) detection was performed according to the
recommendations of the antibody supplier.
Anti-Myc antibodies (BABCO, Berkeley) detected proteins
of the expected size in HeLa cells transfected with pcDNA-
TRAF2FL and pcDNA-TRAF2TR (Fig. 6).
The results, shown in Figure 6, show the immunodetection
of Myc-fused TRAF2FL and TRAF2TR in transfected HeLa cells.
HeLa cells were transfected with expression constructs of
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 43 -
TRAF-FL and TRAF-TR using lipofectamine (Gibco BFL) and after
24 hours cells were lysed in SDS loading buffer. Myc-fusion
proteins were detected using anti-myc Ab and ECL detection
system. Lanes: 1-pcDNA3 vector; 2-myc-TRAF2FL; 3-myc-
TRAF2TR.
EXAMPLE 4 - NFKB Reporter System
In order to determine the effect of TRAF2TR, TRAF2TD or
variants of these polypeptides on NFKB regulated gene
expression, an NFxB reporter system can be used, such as the
system utilized and described in Takeuchi et al., J. Biol.
Chem., 271(33), 19935-42 (1996). An NFKB reporter activation
system may be utilized in conjunction with appropriate cells,
such as 293 cells, COS7 cells-or HeLa cells. The cells would
be transfected with different TRAF2 constructs, i.e., full
length TRAF2, TRAF2TR and TRAF2TD, using the lipofectamine
protocol discussed in Example 3. The effect of the different
TRAF2_fragments on activation of a cotransfected NFKB
reporter can then be compared to identify the most effective..
inhibitor species. As an example, TRAF2 constructs
comprising full length TRAF2, TRAF2TR and TRAF2TD, as well as
variants of TRAF2TR and TRAF2TD, can be transfected into 2.93
cells and the level of NFKB reporter activity monitored in
the presence or absence of TNFa. The full-length TRAF2 would
be expected to activate the cotransfected NFKB reporter while
the other TRAF2 constructs would be expected to block TNF a
mediated activation of the NFKB reporter to varying degrees.
EXAMPLE 5 - Ex Vivo Treatment Methods
Methods of ex vivo gene therapy are known in the art and
generally involve four stages. In the first stage, cells of
a given type are collected from the patient to be treated.
In the second stage, the desired gene is transfected into the
isolated cells. In the third stage, those cells which have
taken up the desired gene are selected and grown. In the
fourth stage, the cells are either infused or transplanted
back into the patient where they express the desired gene and
treat the disease.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 44 -
In the first stage of an ex vivo treatment method
utilizing the present invention, cells are obtained from the
patient. The choice of cell is based on a number of factors,
primarily the specific disease being treated. Blocking
activation in these target cells would inhibit expression of
pro-inflammatory cytokines and other.proteins involved in the
inflammatory processes linked to manifestation of a
cardiovascular disease state.
In the second stage, the TRAF2TR or TRAF2TD or variant
cDNA is cloned into an appropriate mammalian expression
vector. For transfection protocols involving lipofection, an
expression vector, for example, pcDNA3 can be used. In a
preferred embodiment, TRAF2TD, given its enhanced ability to
inhibit TNF a binding effects, is cloned into pcDNA3 or
another suitable mammalian expression vector. The promoter
utilized in the expression vector is chosen based on the type
of cells being transfected and the desired method for
regulating the level of expression. An appropriate.promoter
can be selected from among the promoters discussed supra.
For gene therapy of heart diseases, a promoter, for example,
2MHC (see Palermo et al., Circ. Res., 78(3), 504-9 (1,996)),
MLC2 (see Sani, Nature, 314:283-286 (1985)), CARP (see
Jeyaseelan et al., J. Biol. Chem., 272(36), 22800-8 (1997)),
is inserted upstream of the TRAF2TD cDNA. The TRAF2TD cDNA
containing expression vector is then used in a liposome-
mediated transfection utilizing lipofectamine (BRL, Gibco)
reagent using the supplied protocol. For transfection
protocols using viral transduction, the second stage of the
ex vivo treatment protocol utilizes a recombinant adenovirus
vector system. In this protocol, the TRAF2TD cDNA is cloned
into an adenovirus expression vector, for example, adeno-
quest pQBI-AdBN/NB (QUANTUM Biotechnologies Inc.). The
adenoviral transfer vector now containing the TRAF2TD cDNA is
then co-transfected with adenovirus viral DNA into 293 cells.
Following plaque purification and positive clone selection,
recombinant adenovirus containing the TRAF2TD cDNA is
amplified and then purified using conventional CsCl step
gradient purification, followed by dialysis using an
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 45 -
appropriate buffer, for~example, phosphate buffered saline.
The recombinant adenovirus is then used to transfect the
target cells ex vivo.
Recombinant viruses according to the invention are
formulated and administered in the form of doses of between
about 10' and about 1014 pfu. In the case of AAVs and
adenoviruses, doses of from about 106 to about 1011 pfu are
preferably-used. The term "pfu" ("plaque-forming unit")
corresponds to the infective power of a suspension of virions
and is determined by infecting an appropriate cell culture
and measuring the number of plaques formed. The techniques
for determining the pfu titre of a viral solution are well
documented in the prior art.
Tn the third stage, the transfected cells obtained by
either lipofection or recombinant adenovirus infection. are
grown up in culture, selecting for those cells which have
been transfected. Selection can be done in a variety of
ways, including using a drug marker that provides for
survival and growth of only those cells which have taken up
the expression vector.
In the fourth stage, the transfected cells are infused
or transplanted directly into the patient, either near the
tissue to be treated or at a location that allows the TRAF2TD
cDNA product to be released into the circulation so as to
interact with the cells subject to activation by TNF a
binding. Delivery means include, but are not limited to,
direct injection, or delivery by catheter, infusion pump or
stent.
EXAMPLE 6 - In Vivo Treatment Methods
Methods of in vivo treatment can utilize a variety of
different viral vectors, including adenovirus vectors, adeno-
associated virus vectors, and retrovirus vectors. In a
preferred in vivo treatment method of the present invention,
an adenovirus system is used to introduce the TRAF2TR or
TRAF2TD cDNA into host cells. Given the relatively greater
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 46 -
ability of the TRAF2TD cDNA to inhibit TNF a binding
activation, it is preferable to use the TRAF2TD cDNA in the
adenovirus expression vector. In this method, the TRAF2TD
cDNA is cloned into an adenovirus transfer vector, for
example, the adeno-Quest pQBI-AdBN/NB (QUANTUM
Biotechnologies Inc.) or another adenovirus vector from those
described supra. The promoter utilized in the expression
vector is chosen based on the type of cells being transfected
and the desired method for regulating the level of
expression. An appropriate promoter can be selected from
among the promoters discussed supra.
The adenoviral transfer vector containing the desired
promoter and the TRAF2TD cDNA would be then co-transfected
with adenovirus viral DNA into 293 cells. Following plaque
purification and positive-clone selection, recombinant
adenovirus containing the TRAF2TD cDNA is amplified and then
purified using conventional CsCl step gradient purification,
followed by dialysis using,an appropriate buffer, for
example, phosphate buffered saline.
Prior to transfecting cells in vivo, viral particle
titer is determined and experiments in vitro are performed to
determine the level of protein expression and the tissue
culture infectious dose (TCID50). Recombinant viruses
according to the invention are formulated and administered in
the form of doses of between about 104 and about 10'4 pfu. In
the case of AAVs and adenoviruses, doses of from about 106 to
about 10" pfu are preferably used. The term "pfu" ("plaque-
forming unit") corresponds to the infective power of a
suspension of virions and is determined by infecting an
appropriate cell culture and measuring the number of plaques
formed. The techniques for determining the pfu titre of a
viral solution are well documented in the prior art.
The recombinant adenovirus would then be used to infect
the patient at a dose of between about 106 to about 10'1 pfu.
The recombinant adenovirus may be introduced by inhalation,
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
- 47 -
by infusion, by surgical implantation, by direct injection or
delivery by catheter, infusion pump or stmt.
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
1
SEQUENCE LISTING
<110> Searfoss III, George H.
Pagnoni, Marco F.
Ivashchenko, Yuri D.
Guo, Kun
Clark, Kenneth L.
<120> VARIANTS OF TRAF2 WHICH ACT AS AN INHIBITOR OF
TNF-ALPHA (TNFa) SIGNALING PATHWAY
<130> 22816 PCT
<140> As yet unassigned
<141> 2000-04-06
<150> 60/131940
<151> 1999-04-30
<160> 5
<170> PatentIn Ver. 2.0
<210> 1
<211> 1269
<212> DNA
<213> Homo Sapiens
<400> 1
atggctgcag ctagcgtgac cccccctggc tccctggagt tgctacagcc cggcttctcc 60
aagaccctcc tggggaccaa gctggaagcc aagtacctgt gctccgcctg cagaaacgtc 120
ctccgcaggc ccttccaggc gcagtgtggc caccggtact gctccttctg cctggccagc 180
atcctcagct ctgggcctca gaactgtgct gcctgtgttc acgagggcat atatgaagaa 240
ggcatttcta ttttagaaag cagttcggcc ttcccagata atgctgcccg cagggaggtg 300
gagagcctgc cggccgtctg tcccagtgat ggatgcacct ggaaggggac cctgaaagaa 360
tacgagtttc aggaccacgt caagacttgt ggcaagtgtc gagtcccttg cagattccac 420
gccatcggct gcctcgagac ggtagagggt gagaaacagc aggagcacga ggtgcagtgg 480
ctgcgggagc acctggccat gctactgagc tcggtgctgg aggcaaagcc cctcttggga 540
gaccagagcc acgcggggtc agagctcctg cagaggtgcg agagcctgga gaagaagacg 600
gccacttttg agaacattgt ctgcgtcctg aaccgggagg tggagagggt ggccatgact 660
gccgaggcct gcagccggca gcaccggctg gaccaagaca agattgaagc cctgagtagc 720
aaggtgcagc agctggagag gagcattggc ctcaaggacc tggcgatggc tgacttggag 780
cagaaggtct tggagatgga ggcatccacc tacgatgggg tcttcatctg gaagatctca 840
gacttcgcca ggaagctcca ggaagctgtg gctggccgca tacccgccat cttctcccca 900
gccttctaca ccagcaggta cggctacaag atgtgtctgc gtatctacct gaacggcgac 960
ggcaccgggc gaggaacaca cctgtccctc ttctttgtgg tgatgaaggg cccgaatgac 1020
gccctgctgc ggtggccctt caaccagaag gtgaccttaa tgctgctcga ccagaataac 1080
cgggagcacg tgattgacgc cttcaggccc gacgtgactt catcctcttt tcagaggcca 1140
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
2
gtcaacgaca tgaacatcgc aagcggctgc cccctcttct gccccgtctc caagatggag 1200
gcaaagaatt cctacgtgcg ggacgatgcc atcttcatca aggccattgt ggacctgaca 1260
gggctctaa 1269
<210> 2
<211> 422
<212> PRT
<213> Homo Sapiens
<400> 2
Met Ala Ala Ala Ser Val Thr Pro Pro Gly Ser Leu Glu Leu Leu Gln
1 5 10 15
Pro Gly Phe Ser Lys Thr Leu Leu Gly Thr Lys Leu Glu Ala Lys Tyr
20 25 30
Leu Cys Ser Ala Cys Arg Asn Val Leu Arg Arg Pro Phe Gln Ala Gln
35 40 45
Cys Gly His Arg Tyr Cys Ser Phe Cys Leu Ala Ser Ile Leu Ser Ser
50 55 60
Gly Pro Gln Asn Cys Ala Ala Cys Val His Glu Gly Ile Tyr Glu Glu
65 70 75 80
Gly Ile Ser Ile Leu Glu Ser Ser Ser Ala Phe Pro Asp Asn Ala Ala
85 90 95
Arg Arg Glu Val Glu Ser Leu Pro Ala Val Cys Pro Ser Asp Gly Cys
100 105 110
Thr Trp Lys Gly Thr Leu Lys Glu Tyr Glu Phe Gln Asp His Val Lys
115 120 125
Thr Cys Gly Lys Cys Arg Val Pro Cys Arg Phe His Ala Ile Gly Cys
130 135 140
Leu Glu Thr Val Glu Gly Glu Lys Gln Gln Glu His Glu Val Gln Trp
145 150 155 160
Leu Arg Glu His Leu Ala Met Leu Leu Ser Ser Val Leu Glu Ala Lys
165 170 175
Pro Leu Leu Gly Asp Gln Ser His Ala Gly Ser Glu Leu Leu Gln Arg
180 185 190
Cys Glu Ser Leu Glu Lys Lys Thr Ala Thr Phe Glu Asn Ile Val Cys
195 200 205
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
3
Val Leu Asn Arg Glu Val Glu Arg Val Ala Met Thr Ala Glu Ala Cys
210 215 220
Ser Arg Gln His Arg Leu Asp Gln Asp Lys Ile Glu Ala Leu Ser Ser
225 230 235 240
Lys Val Gln Gln Leu Glu Arg Ser Ile Gly Leu Lys Asp Leu Ala Met
245 250 255
Ala Asp Leu Glu Gln Lys Val Leu Glu Met Glu Ala Ser Thr Tyr Asp
260 265 270
Gly Val Phe Ile Trp Lys Ile Ser Asp Phe Ala Arg Lys Leu Gln Glu
275 280 285
A1a Val Ala Gly Arg Ile Pro Ala Ile Phe Ser Pro Ala Phe Tyr Thr
290 295 300
Ser Arg Tyr Gly Tyr Lys Met Cys Leu Arg Ile Tyr Leu Asn Gly Asp
305 310 315 320
Gly Thr Gly Arg Gly Thr His Leu Ser Leu Phe Phe Val Val Met Lys
325 330 335
Gly Pro Asn Asp Ala Leu Leu Arg Trp Pro Phe Asn Gln Lys Val Thr
340 345 350
Leu Met Leu Leu Asp Gln Asn Rsn Arg Glu His Val Ile Asp Ala Phe
355 360 365
Arg Pro Asp Val Thr Ser Ser Ser Phe Gln Arg Pro Val Asn Asp Met
370 375 380
Asn Ile Ala Ser Gly Cys Pro Leu Phe Cys Pro Val Ser Lys Met Glu
385 390 395 400
Ala Lys Asn Ser Tyr Val Arg Asp Asp Ala Ile Phe Ile Lys Ala Ile
405 910 415
Val Asp Leu Thr Gly Leu
420
<210> 3
<211> 1011
<212> DNA
<213> Homo sapiens
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
4
<400> 3
atgagttcgg ccttcccaga taatgctgcc cgcagggagg tggagagcct gccggccgtc 60
tgtcccagtg atggatgcac ctggaagggg accctgaaag aatacgagtt tcaggaccac 120
gtcaagactt gtggcaagtg tcgagtccct tgcagattcc acgccatcgg ctgcctcgag 180
acggtagagg gtgagaaaca gcaggagcac gaggtgcagt ggctgcggga gcacctggcc 240
atgctactga gctcggtgct ggaggcaaag cccctcttgg gagaccagag ccacgcgggg 300
tcagagctcc tgcagaggtg cgagagcctg gagaagaaga cggccacttt tgagaacatt 360
gtctgcgtcc tgaaccggga ggtggagagg gtggccatga ctgccgaggc ctgcagccgg 420
cagcaccggc tggaccaaga caagattgaa gccctgagta gcaaggtgca gcagctggag 480
aggagcattg gcctcaagga cctggcgatg gctgacttgg agcagaaggt cttggagatg 540
gaggcatcca cctacgatgg ggtcttcatc tggaagatct cagacttcgc caggaagctc 600
caggaagctg tggctggccg catacccgcc atcttctccc cagccttcta caccagcagg 660
tacggctaca agatgtgtct gcgtatctac ctgaacggcg acggcaccgg gcgaggaaca 720
cacctgtccc tcttctttgt ggtgatgaag ggcccgaatg acgccctgct gcggtggccc 780
ttcaaccaga aggtgacctt aatgctgctc gaccagaata accgggagca cgtgattgac 840
gccttcaggc ccgacgtgac ttcatcctct tttcagaggc cagtcaacga catgaacatc 900
gcaagcggct gccccctctt ctgccccgtc tccaagatgg aggcaaagaa ttcctacgtg 960
cgggacgatg ccatcttcat caaggccatt gtggacctga cagggctcta a 1011
<210> 4
<211> 336
<212> PRT
<213> Homo Sapiens
<400> 4
Met Ser Ser Ala Phe Pro Asp Asn Ala Ala Arg Arg Glu Val Glu Ser
1 5 10 15
Leu Pro Ala Val Cys Pro Ser Asp Gly Cys Thr Trp Lys Gly Thr Leu
20 25 30
Lys Glu Tyr Glu Phe Gln Asp His Val Lys Thr Cys Gly Lys Cys Arg
35 90 45
Val Pro Cys Arg Phe His Ala Ile Gly Cys Leu Glu Thr Val Glu Gly
50 55 60
Glu Lys Gln Gln Glu His Glu Val Gln Trp Leu Arg Glu His Leu Ala
65 70 75 80
Met Leu Leu Ser.Ser Val Leu Glu Ala Lys Pro Leu Leu Gly Asp Gln
85 90 95
Ser His Ala Gly Ser Glu Leu Leu Gln Arg Cys Glu Ser Leu Glu Lys
100 105 110
Lys Thr Ala Thr Phe Glu Asn Ile Val Cys Val Leu Asn Arg Glu Val
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
115 120 125
Glu Arg Val Ala Met Thr Ala Glu Ala Cys Ser Arg Gln His Arg Leu
130 135 140
Asp Gln Asp Lys Ile Glu Ala Leu Ser Ser Lys Val Gln Gln Leu Glu
145 150 155 160
Arg Ser Ile Gly Leu Lys Asp Leu Ala Met Ala Asp Leu Glu Gln Lys
165 170 175
Val Leu Glu Met Glu Ala Ser Thr Tyr Asp Gly Val Phe Ile Trp Lys
180 185 190
Ile Ser Asp Phe Ala Arg Lys Leu Gln Glu Ala Val Ala Gly Arg Ile ,
195 200 205
Pro Ala Ile Phe Ser Pro Ala Phe Tyr Thr Ser Arg Tyr Gly Tyr Lys
210 215 220
Met Cys Leu Arg Ile Tyr Leu Asn Gly Asp Gly Thr Gly Arg Gly Thr
225 230 235 240
His Leu Ser Leu Phe Phe Val Val Met Lys Gly Pro Asn Asp Ala Leu
245 250 255
Leu Arg Trp Pro Phe Asn Gln Lys Val Thr Leu Met Leu Leu Asp Gln
260 265 270
Asn Asn Arg Glu His Val Ile Asp Ala Phe Arg Pro Asp Val Thr Ser
275 280 285
Ser Ser Phe Gln Arg Pro Val Asn Asp Met Asn Ile Ala Ser Gly Cys
290 295 300
Pro Leu Phe Cys Pro Val Ser Lys Met Glu Ala Lys Asn Ser Tyr Val
305 310 315 320
Arg Asp Asp Ala Ile Phe Ile Lys Ala Ile Val Asp Leu Thr Gly Leu
325 330 335
<210> 5
<211> 2262
<212> DNA
CA 02372803 2001-10-30
WO 00/66737 PCT/US00/09178
6
<213> Homo sapiens
<220>
<221> misc_feature
<222> ()..)
<223> TRAF2 truncated sequence contains an internal
deletion of base pairs 421 to 657
<400> 5
gaattccggc gcgctgcgac cgttggggct ttgttcgcgg gggtcacagc tctcatggct 60
gcagctagcg tgaccccccc tggctccctg gagttgctac agcccggctt ctccaagacc 120
ctcctgggga ccaagctgga agccaagtac ctgtgctccg cctgcagaaa cgtcctccgc 180
aggcccttcc aggcgcagtg tggccaccgg tactgctcct tctgcctggc cagcatcctc 240
agctctgggc ctcagaactg tgctgcctgt gttcacgagg gcatatatga agaaggcatt 300
tctattttag aaagcagttc ggccttccca gataatgctg cccgcaggga ggtggagagc 360
ctgccggccg tctgtcccag tgatggatgc acctggaagg ggaccctgaa agaatacgag 420
agctgccacg aaggccgctg cccgctcatg ctgaccgaat gtcccgcgtg taaaggcctg 480
gtccgccttg gtgaaaagga gcgccacctg gagcacgagt gcccggagag aagcctgagc 540
tgccggcatt gccgggcacc ctgctgcgga gcagacgtga aggcgcacca cgaggtctgc 600
cccaagttcc ccttaacttg tgacggctgc ggcaagaaga agatcccccg ggagaagttt 660
caggaccacg tcaagacttg tggcaagtgt cgagtccctt gcagattcca cgccatcggc 720
tgcctcgaga cggtagaggg tgagaaacag caggagcacg aggtgcagtg gctgcgggag 780
cacctggcca tgctactgag ctcggtgctg gaggcaaagc ccctcttggg agaccagagc 840
cacgcggggt cagagctcct gcagaggtgc gagagcctgg agaagaagac ggccactttt 900
gagaacattg tctgcgtcct gaaccgggag gtggagaggg tggccatgac tgccgaggcc 960
tgcagccggc agcaccggct ggaccaagac aagattgaag ccctgagtag caaggtgcag 1020
cagctggaga ggagcattgg cctcaaggac ctggcgatgg ctgacttgga gcagaaggtc 1080
aggcccttcc aggcgcagtg tggccaccgg tactgctcct tctgcctggc cagcatcctc 1140
aggaagctcc aggaagctgt ggctggccgc atacccgcca tcttctcccc agccttctac 1200
accagcaggt acggctacaa gatgtgtctg cgtatctacc tgaacggcga cggcaccggg 1260
cgaggaacac acctgtccct cttctttgtg gtgatgaagg gcccgaatga cgccctgctg 1320
cggtggccct tcaaccagaa ggtgacctta atgctgctcg accagaataa ccgggagcac 1380
gtgattgacg ccttcaggcc cgacgtgact tcatcctctt ttcagaggcc agtcaacgac 1440
atgaacatcg caagcggctg.ccccctcttc tgccccgtct ccaagatgga ggcaaagaat 1500
tcctacgtgc gggacgatgc catcttcatc aaggccattg tggacctgac agggctctaa 1560
ctgcccccta ctggtgtctg ggggttgggg gcagccaggc acagccggct cacggagggg 1620
ccaccacgct gggccagggt ctcactgtac aagtgggcag gggccccgct tgggcgcttg 1680
ggagggtgtc ggcctgcagc caagttcact gtcacggggg aaggagccac cagccagtcc 1740
tcagatttca gagactgcgg aggggcttgg cagacggtct tagccaaggg ctgtggtggc 1800
attggccgag ggtcttcggg tgcttcccag cacaagctgc ccttgctgtc ctgtgcagtg 1860
aagggagagg ccctgggtgg gggacactca gagtgggagc acatcccagc agtgcccatg 1920
tagcaggagc acagtggatg gccttgtgtc cctcgggcat gacaggcaga aacgagggct 1980
gctccaggag aagggcctcc tgctggccag agcaaggaag gctgagcagc ttggttctcc 2040
cctctggccc ctggagagaa gggagcattc ctagacccct gggtgcttgt ctgcacagag 2100
ctctggtctg tgccaccttg gccaggctgg ctgtgggagg gtctggtccc acgccgcctc 2160
tgctcagaca ctgtgtggga gggcacagca cagctgcggg t~aaagtgtga gagcttgcca 2220
tccagctcac gaagacagag ttattaaacc attacaaatc tc 2262
