Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
AMPLIFICATION OF NUCLEIC ACIDS WITH ELECTRONIC DETECTION
The present invention is a continuing application of U.S.S.N.s 60/144,698,
filed July 20, 1999;
09/238,351, filed January 27, 1999; 09/014,304, filed January 27, 1998;
60/073,011, filed January 29,
1998; 60/028,102, filed March 16, 1998; 60/084,425, filed May 6, 1998;
60/084,509, filed May 6, 1998;
and 09/135,183, filed August 17, 1998, all of which are expressly incorporated
herein in their entirety.
FIELD OF THE INVENTION
The invention relates to compositions and methods useful in the detection of
nucleic acids using a
variety of amplification techniques, including both signal amplification and
target amplification.
Detection proceeds through the use of an electron transfer moiety (ETM) that
is associated with the
nucleic acid, either directly or indirectly, to allow electronic detection of
the ETM using an electrode.
BACKGROUND OF THE INVENTION
The detection of specific nucleic acids is an important tool for diagnostic
medicine and molecular
biology research. Gene probe assays currently play roles in identifying
infectious organisms such as
bacteria and viruses, in probing the expression of normal genes and
identifying mutant genes such as
oncogenes, in typing tissue for compatibility preceding tissue
transplantation, in matching tissue or
blood samples for forensic medicine, and for exploring homology among genes
from different species.
Ideally, a gene probe assay should be sensitive, specific and easily
automatable (for a review, see
Nickerson, Current Opinion in Biotechnology 4:48-51 (1993)). The requirement
for sensitivity (i.e. low
detection limits) has been greatly alleviated by the development of the
polymerase chain reaction
(PCR) and other amplification technologies which allow researchers to amplify
exponentially a specific
nucleic acid sequence before analysis as outlined below (for a review, see
Abramson et al., Current
Opinion in Biotechnology, 4:41-47 (1993)). ,
Sensitivity, i.e. detection limits, remain a significant obstacle in nucleic
acid detection systems, and a
variety of techniques have been developed to address this issue. Briefly,
these techniques can be
1
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
classified as either target amplification or signal amplification. Target
amplification involves the
amplification (i.e. replication) of the target sequence to be detected,
resulting in a significant increase
in the number of target molecules. Target amplification strategies include the
polymerise chain
reaction (PCR), strand displacement amplification (SDA), nucleic acid sequence
based amplification
(NASBA), and transcription mediated amplification (TMA).
Alternatively, rather than amplify the target, alternate techniques use the
target as a template to
replicate a signalling probe, allowing a small number of target molecules to
result in a large number of
signalling probes, that then can be detected. Signal amplification strategies
include the ligase chain
reaction (LCR), cycling probe technology (CPT), InvaderT"', Q-beta replicase
(QBR), and the use of
"amplification probes" such as "branched DNA" that result in multiple label
probes binding to a single
target sequence.
The polymerise chain reaction (PCR) is widely used and described, and involve
the use of primer
extension combined with thermal cycling to amplify a target sequence; see U.S.
Patent Nos. 4,683,195
and 4,683,202, and PCR Essential Data, J. W. Wiley & sons, Ed. C.R. Newton,
1995, all of which are
incorporated by reference. In addition, there are a number of variations of
PCR which may also find
use in the invention, including "quantitative competitive PCR" or "QC-PCR",
"arbitrarily primed PCR" or
"AP-PCR" , "immuno-PCR", "Alu-PCR", "PCR single strand conformational
polymorphism" or "PCR-
SSCP", "reverse transcriptase PCR" or "RT-PCR", "biotin capture PCR",
"vectorette PCR". "panhandle
PCR", and "PCR select cDNA subtration", among others.
Strand displacement amplification (SDA) is generally described in Walker et
al., in Molecular Methods
for Virus Detection, Academic Press, Inc., 1995, and U.S. Patent Nos.
5,455,166 and 5,130,238, all of
which are hereby incorporated by reference.
Nucleic acid sequence based amplification (NASBA) is generally described in
U.S. Patent No.
5,409,818; Sooknanan et al., Nucleic Acid Sequence-Based Amplificatiori, Ch.
12 (pp. 261-285) of
Molecular Methods for Virus Detection, Academic Press, 1995; and "Profiting
from Gene-based
Diagnostics", CTB International Publishing Inc., N.J., 1996, both of which are
incorporated by
reference.
Transcription mediated amplification (TMA) is generally described in U.S.
Patent Nos. 5,399,491,
5,888,779, 5,705,365, 5,710,029, all of which are incorporated by reference.
Cycling probe technology (CPT) is a nucleic acid detection system based on
signal or probe
amplification rather than target amplification, such as is done in polymerise
chain reactions (PCR).
Cycling probe technology relies on a molar excess of labeled probe which
contains a scissile linkage
of RNA. Upon hybridization of the probe to the target, the resulting hybrid
contains a portion of
2
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
RNA:DNA. This area of RNA:DNA duplex is recognized by RNAseH and the RNA is
excised, resulting
in cleavage of the probe. The probe now consists of two smaller sequences
which may be released,
thus leaving the target intact for repeated rounds of the reaction. The
unreacted probe is removed
and the label is then detected. CPT is generally described in U.S. Patent Nos.
5,011,769, 5,403,711,
5,660,988, and 4,876,187, and PCT published applications WO 95/05480, WO
95/1416, and WO
95/00667, all of which are specifically incorporated herein by reference.
The ligation chain reaction (LCR) involve the ligation of two smaller probes
into a single long probe,
using the target sequence as the template for the ligase. See generally U.S.
Patent Nos. 5,185,243
and 5,573,907; EP 0 320 308 B1; EP 0 336 731 B1; EP 0 439 182 B1; WO 90/01069;
WO 89/12696;
and WO 89/09835, all of which are incorporated by reference.
Q-beta replicase (QBR) is a mRNA amplification technique, similar to NASBA and
TMA, that relies on
an RNA-dependent RNA polymerise derived from the bacteriophage Q-beta that can
synthesize up to
a billion stands of product from a template.
InvaderT"' technology is based on structure-specific polymerises that cleave
nucleic acids in a site-
specific manner. Two probes are used: an "invader" probe and a "signalling"
probe, that adjacently
hybridize to a target sequence with a non-complementary overlap. The enzyme
cleaves at the overlap
due to its recognition of the "tail", and releases the "tail" with a label.
This can then be detected. The
InvaderT"~ technology is described in U.S. Patent Nos. 5,846,717; 5,614,402;
5,719,028; 5,541,311;
and 5,843,669, all of which are hereby incorporated by reference.
"Rolling circle amplification" is based on extension of a circular probe that
has hybridized to a target
sequence. A polymerise is added that extends the probe sequence. As the
circular probe has no
terminus, the polymerise repeatedly extends the circular probe resulting in
concatamers of the
circular probe. As such, the probe is amplified. Rolling-circle amplification
is generally described in
Baner et al. (1998) Nuc. Acids Res. 26:5073-5078; Barany, F. (1991 ) Proc.
Natl. Acid. Sci. USA
88:189-193; Lizardi et al. (1998) Nat. Genet. 19:225-232; Zhang et al., Gene
211:277 (1998); and
Daubendiek et al., Nature Biotech. 15:273 (1997); all of which are
incorporated by reference in their
entirety.
"Branched DNA" signal amplification relies on the synthesis of branched
nucleic acids, containing a
multiplicity of nucleic acid "arms" that function to increase the amount of
label that can be put onto one
probe. This technology is generally described in U.S. Patent Nos. 5,681,702,
5,597,909, 5,545,730,
5,594,117, 5,591,584, 5,571,670, 5,580,731, 5,571,670, 5,591,584, 5,624,802,
5,635,352, 5,594,118,
5,359,100, 5,124,246 and 5,681,697, all of which are hereby incorporated by
reference.
3
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Similarity, dendrimers of nucleic acids serve to vastly increase the amount of
label that can be added
to a single molecule, using a similar idea but different compositions. This
technology is as described
in U.S. Patent No. 5,175,270 and Nilsen et al., J. Theor. Biol. 187:273
(1997), both of which are
incorporated herein by reference.
Finally, U.S. Patent Nos. 5,591,578, 5,824,473, 5,770,369, 5,705,348, and
5,780,234, and PCT
application W098/20162 describe novel compositions comprising nucleic acids
containing electron
transfer moieties, including electrodes, which allow for novel detection
methods of nucleic acid
hybridization.
SUMMARY OF THE INVENTION
In accordance with the objects outlined above, the present invention provides
methods for detecting a
target nucleic acid sequence. The methods comprise hybridizing at least a
first primer nucleic acid to
the target sequence to form a first hybridization complex, and contacting the
first hybridization
complex with a first enzyme to form a modified first primer nucleic acid. The
first hybridization
complex is then disassociated. These steps may be repeated a plurality of
times. A first assay
complex is then formed comprising at least one ETM and the modified first
primer nucleic acid. The
assay complex is covalently attached to an electrode. Electron transfer is
then detected between the
ETM and the electrode as an indication of the presence of the target sequence.
The method can
include the same method on a second target sequence substantially
complementary to the the first
target sequence.
In an additional aspect, the method utilizes a DNA polymerase and the
modification to the primer is an
extension of the primer such that the polymerase chain reaction (PCR) occurs.
In a further aspect, the method utilizes a ligase and the modification to the
primer comprises a ligation
of the first primer which hybridizes to a first domain of the first target
sequence to a third primer which
hybridizes to a second adjacent domain of the first target sequence, such that
the ligase chain
reaction (LCR) occurs.
In an additional aspect, the method utilizes a first primer comprising a first
probe sequence, a first
scissile linkage and a second probe sequence. The enzyme will cleave the first
scissile linkage
resulting in the separation of the first and the second probe sequences and
the disassociation of the
hybridization complex while leaving the first target sequence intact, such
that the cycling probe
technology (CPT) reaction occurs.
In a further aspect, the method utilizes a first enzyme that is a polymerase
that extends the first primer
to form a modified first primer comprising a first newly synthesized strand,
and said method further
4
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
comprises the addition of a second enzyme comprising a nicking enzyme that
nicks the extended first
primer leaving the first target sequence intact. The method additionally
comprises extending from the
nick using the polymerase, thereby displacing the first newly synthesized
strand and generating a
second newly synthesized strand, such that strand displacement amplification
(SDA) occurs.
In an additional aspect, the method utilizes a first target sequence that is a
RNA target sequence, a
first primer nucleic acid that is a DNA primer comprising an RNA polymerase
promoter, and the first
enzyme is a reverse-transcriptase that extends the first primer to form a
first newly synthesized DNA
strand. The method further comprises the addition of a second enzyme
comprising an RNA degrading
enzyme that degrades the first target sequence. A third primer is then added
that hybridizes to the
first newly synthesized DNA strand. A third enzyme is added comprising a DNA
polymerase that
extends the third primer to form a second newly synthesized DNA strand, to
form a newly synthesized
DNA hybrid. A fourth enzyme is then added comprising an RNA polymerase that
recognizes the RNA
polymerase promoter and generates at least one newly synthesized RNA strand
from the DNA hybrid,
such that nucleic acid sequence-based amplification (NASBA) occurs.
In a further aspect, the invention provides methods for detecting a target
nucleic acid sequence
comprising forming a first hybridization complex comprising an amplifier probe
and a target sequence,
wherein the amplifier probe comprises at least two amplification sequences and
hybridizing a first
portion of at least one label probe to all or part of at least one
amplification sequence. A second
portion of the label probe is then hybridized to a detection probe covalently
attached to an electrode
via a conductive oligomer to form a second hybridization complex that contains
at least a first electron
transfer moiety (ETM). The label probe is then detected by measuring electron
transfer between said
first ETM and said electrode.
In an additional aspect, the invention provides methods for detecting a target
nucleic acid sequence
comprising forming a first hybridization complex comprising an amplifier probe
and a target sequence,
wherein the amplifier probe comprises at least two amplification sequences and
wherein the first
hybridization complex is covalently attached to an electrode comprising a
monolayer comprising
conductive oligomers. At least one label probe comprising at least one
electron transfer moiety (ETM)
is hybridized to all or part of at least one amplification sequence, and the
label probe is detected by
measuring electron transfer between said first ETM and said electrode.
In a further aspect, the invention provides kits for the detection of a first
target nucleic acid sequence
comprising at least a first nucleic acid primer substantially complementary to
at least a first domain of
the target sequence and at least a first enzyme that will modify the first
nucleic acid primer. The kits
additionally comprise an electrode comprising at least one detection probe
covalently attached to the
electrode via a conductive oligomer.
5
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In an additional aspect, the invention provides methods of detecting target
sequences comprising
providing a rolling circle probe (RCP) comprising a first ligation sequence
substantially complementary
to a first domain of said target sequence, a second ligation sequence
substantially complementary to a
second domain of said target sequence; and a priming sequence. The methods
further comprise
hybridizing the first ligation sequence to said first domain and the second
ligation sequence to the
second domain to form a first hybridization complex and ligating the first and
second ligation
sequences together. A primer substantially complementary to said priming
sequence, a polymerase,
dNTPs and an ETM are added to the first hybridization complex under conditions
whereby a rolling
circle concatamer is formed, and the ETM is detected as an indicator of the
presence of the target
sequence. The RCP may further optionally comprise a cleavage site and a
capture sequence.
In a further aspect, the invention provides methods for detecting a first
target nucleic acid sequence
comprising hybridizing an invader primer and a signaling primer to form a
first hybridization complex.
The signaling primer comprises a first portion comprising a sequence that will
hybridize to a first
portion of the target sequence; a cleavage site and a detection sequence that
does not hybridize with
the target sequence. The first hybridization complex is contacted with a
structure specific cleavage
enzyme such that the signaling primer is cleaved and the detection sequence is
released. The
released detection sequence is contacted with an electrode comprising a
capture probe to form a
second hybridization complex, wherein the second hybridization complex
comprises at least one ETM.
The ETM is detected as an indication of the presence of said target sequence.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-1 O depict depict a number of different compositions of the
invention; the results are shown
in Example 1 and 2. Figure 1A depicts I, also referred to as P290. Figure 1 B
depicts II, also referred
to as P291. Figure 1 C depicts III, also referred to as W31. Figure 1 D
depicts IV, also referred to as
N6. Figure 1 E depicts V, also referred to as P292. Figure 1 F depicts II,
also referred to as C23.
Figure 1 G depicts VII, also referred to as C15. Figure 1 H depicts VIII, also
referred to as C95. Figure
1 I depicts Y63. Figure 1J depicts another compound of the invention. Figure 1
K depicts N11. Figure
1 L depicts C131, with a phosphoramidite group and a DMT protecting group.
Figure 1 M depicts W38,
also with a phosphoramidite group and a DMT protecting group. Figure 1 N
depicts the commercially
available moiety that enables "branching" to occur, as its incorporation into
a growing oligonucleotide
chain results in addition at both the DMT protected oxygens. Figure 1 O
depicts glen, also with a
phosphoramidite group and a DMT protecting group, that serves as a non-nucleic
acid linker. Figures
1A to 1G and 1J are shown without the phosphoramidite and protecting groups
(i.e. DMT) that are
readily added.
6
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Figure 2 depicts the synthetic scheme of a preferred attachment of an ETM, in
this case ferrocene, to
a nucleoside (in this case adenosine) via an oxo linkage to the ribose,
forming the N6 compound of
the invention.
Figure 3 is similar to Figure 2 except that the nucleoside is cytidine,
forming the W38 compound of the
invention.
Figure 4 depicts the synthetic scheme of a preferred attachment of an ETM, in
this case ferrocene, to
a nucleoside via the phosphate, forming the Y63 compound of the invention.
Figure 5 depicts the synthetic scheme of a triphosphate nucleotide, in this
case adenosine, with an
attached ETM, in this case ferrocene, via an oxo linkage to the ribose.
Figure 6 depicts the use of an activated carboxylate for the addition of a
nucleic acid functionalized
with a primary amine to a pre-formed SAM.
Figure 7 depicts a schematic of the use of "universal" type gene chips,
utilizing restriction
endonuclease sites.
Figures 8A and 8B depicts two phosphate attachments of conductive oligomers
that can be used to
add the conductive oligomers at the 5' position, or any position.
Figure 9 depicts the synthesis of an insulator (C109) to the ribose of a
nucleoside for attachment to an
electrode.
Figure 10 depicts the synthetic scheme of ethylene glycol terminated
conductive oligomers.
Figures 11 A, 11 B and 11 C depict the synthesis of three different "branch"
points (in this case each
using adenosine as the base), to allow the addition of ETM polymers. Figure
11A depicts the
synthesis of the N17 compound of the invention. Figure 11 B depicts the
synthesis of the W90
compound, and Figure 11 C depicts the synthesis of the N38 compound.
Figure 12 depicts a schematic of the synthesis of simultaneous incorporation
of multiple ETMs into a
nucleic acid, using the N17 "branch" point nucleoside.
Figure 13 depicts a schematic of an alternate method of adding large numbers
of ETMs
simultaneously to a nucleic acid using a "branch" point phosphoramidite, in
this case utilizing three
branch points (although two branch points are also possible; see for example
Figure 1 N) as is known
in the art. As will be appreciated by those in the art, each end point can
contain any number of ETMs.
7
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Figure 14 shows a representative hairpin structure. 500 is a target binding
sequence, 510 is a loop
sequence, 520 is a self-complementary region, 530 is substantially
complementary to a detection
probe, and 530 is the "sticky end", that is, a portion that does not hybridize
to any other portion of the
probe, that contains the ETMs.
Figures 15A, 15B and 15C depict three preferred embodiments for attaching a
target sequence to the
electrode. Figure 15A depicts a target sequence 120 hybridized to a capture
probe 100 linked via a
attachment linker 106, which as outlined herein may be either a conductive
oligomer or an insulator.
The electrode 105 comprises a monolayer of passivation agent 107, which can
comprise conductive
oligomers (herein depicted as 108) and/or insulators (herein depicted as 109).
As for all the
embodiments depicted in the figures, n is an integer of at least 1, although
as will be appreciated by
those in the art, the system may not utilize a capture probe at all (i.e. n is
zero), although this is
generally not preferred. The upper limit of n will depend on the length of the
target sequence and the
required sensitivity. Figure 15B depicts the use of a single capture extender
probe 110 with a first
portion 111 that will hybridize to a first portion of the target sequence 120
and a second portion that
will hybridize to. the capture probe 100. Figure 15C depicts the use of two
capture extender probes
110 and 130. The first capture extender probe 110 has a first portion 111 that
will hybridize to a first
portion of the target sequence 120 and a second portion 112 that will
hybridize to a first portion 102 of
the capture probe 100. The second capture extender probe 130 has a first
portion 132 that will
hybridize to a second portion of the target sequence 120 and a second portion
131 that will hybridize
to a second portion 101 of the capture probe 100. As will be appreciated by
those in the art, any of
these attachment configurations may be used with any of the other systems,
including the
embodiments of Figure 16.
Figures 16A, 16B, 16C, 16D, 16E, 16F and 16G depict some of the embodiments of
the invention. All
of the monolayers depicted herein show the presence of both conductive
oligomers 108 and insulators
107 in roughly a 1:1 ratio, although as discussed herein, a variety of
different ratios may be used, or
the insulator may be completely absent. In addition, as will be appreciated by
those in the art, any one
of these structures may be repeated for a particular target sequence; that is,
for long target
sequences, there may be multiple assay complexes formed. Additionally, any of
the electrode-
attachment embodiments of Figure 15 may be used in any of these systems.
Figures 16A, 16B and 16D have the target sequence 120 containing the ETMs 135;
as discussed
herein, these may be added enzymatically, for example during a PCR reaction
using nucleotides
modified with ETMs, resulting in essentially random incorporation throughout
the target sequence, or
added to the terminus of the target sequence. Figure 16C depicts the use of
two different capture
probes 100 and 100', that hybridize to different portions of the target
sequence 120. As will be
8
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
appreciated by those in the art, the 5'-3' orientation of the two capture
probes in this embodiment is
different.
Figure 16C depicts the use of label probes 145 that hybridize directly to the
target sequence 120.
Figure 16C shows the use of a label probe 145, comprising a first portion 141
that hybridizes to a
portion of the target sequence 120, a second portion 142 comprising ETMs 135.
Figures 16E, 16F and 16G depict systems utilizing label probes 145 that do not
hybridize directly to the
target, but rather to amplifier probes that are directly (Figure 16E) or
indirectly (Figures 16F and 16G)
hybridized to the target sequence. Figure 16E utilizes an amplifier probe 150
has a first portion 151
that hybridizes to the target sequence 120 and at least one second portion
152, i.e. the amplifier
sequence, that hybridizes to the first portion 141 of the label probe. Figure
16F is similar, except that
a first label extender probe 160 is used, comprising a first portion 161 that
hybridizes to the target
sequence 120 and a second portion 162 that hybridizes to a first portion 151
of amplifier probe 150. A
second portion 152 of the amplifier probe 150 hybridizes to a first portion
141 of the label probe 140,
which also comprises a recruitment linker 142 comprising ETMs 135. Figure 16G
adds a second label
extender probe 170, with a first portion 171 that hybridizes to a portion of
the target sequence 120 and
a second portion that hybridizes to a portion of the amplifier probe.
Figure 16H depicts a system that utilizes multiple label probes. The first
portion 141 of the label probe
140 can hybridize to all or part of the recruitment linker 142.
Figures 17A, 17B, 17C, 17D and 17E depict different possible configurations of
label probes and
attachments of ETMs. In Figures 17A-C, the recruitment linker is nucleic acid;
in Figures 17D and E,
is is not. A = nucleoside replacement; B = attachment to a base; C =
attachment to a ribose; D =
attachment to a phosphate; E = metallocene polymer (although as described
herein, this can be a
polymer of other ETMs as well), attached to a base, ribose or phosphate (or
other backbone analogs);
F = dendrimer structure, attached via a base, ribose or phosphate (or other
backbone analogs); G =
attachment via a "branching" structure, through base, ribose or phosphate (or
other backbone
analogs); H = attachment of metallocene (or other ETM) polymers; I =
attachment via a dendrimer
structure; J = attachment using standard linkers.
Figure 18 depicts an improvement utilizing a stem-loop probe. This can be
desirable as it creates
torsional strain on the surface-bound probe, which has been shown to increase
binding efficiency and
in some cases thermodynamic stability. In this case, the surface bound probe
comprises a capture
probe 100, a first stem-loop sequence 550, a target binding sequence 560, and
a second stem-loop
sequence 570 that is substantially complementary to the first stem-loop
sequence. Upon addition of
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
the target sequence 120, which can contain the ETMs 135 either directly or
indirectly using a label
probe 145, the effective concentration of the target at the surface increases.
Figures 19A-19AA depict some of the sequences used in Example 1.
Figures 20A - 200 depict representative scans from the experiments outlined in
Example 1. Unless
otherwise noted, all scans were run at initial voltage -0.11 V, final voltage
0.5 V, with points taken
every 10 mV, amplitude of 0.025, frequency of 10 Hz, a sample period of 1 sec,
a quiet time of 2 sec.
Figure 20A has a peak potential of 0.160 V, a peak current of 1.092 X 10-8 A,
and a peak A of 7.563 X
10-'° VA. Figure 20C has a peak potential of 0.190 V, a peak current of
2.046 X 10'' A, and a peak
area of 2.046 X 10-a VA. Figure 20d has a peak potential of 0.190 V, a peak
current of 3.552 X 10-8 A,
and a peak A of 3.568 X 10-9 VA. Figure 20E has a peak potential of 0.190 V, a
peak current of 2.3762
X 10'' A, and a peak area of 2.594 X 10-8 VA. Figure 20F has a peak potential
of 0.180 V, a peak
current of 2.992 X 10'8 A, and a peak area of 2.709 X 10-9 VA. Figure 20G has
a peak potential of
0.150 V, a peak current of 1.494 X 10-' A, and a peak area of 1.1 X 10'8 VA.
Figure 20H has a peak
potential of 0.160 V, a peak current of 1.967 X 10'8 A, and a peak area of
1.443 X 10-9 VA. Figure 201
has a peak potential of 0.150 V, a peak current of 8.031 X 10-e A, and a peak
area of 6.033 X 10-9 VA.
Figure 20J has a peak potential of 0.150 V, a peak current of 8.871X 10-9 A,
and a peak area of 5.51 X
10''° VA. Figure 20L has a peak potential of 0.140 V, a peak current of
2.449 X 10-e A, and a peak
area of 1.706 X 10-9 VA. Figure 20M has a peak potential of 0.150 V, a peak
current of 6.637 X 10-e A,
and a peak area of 7.335 X 109 VA. Figure 20N has a peak potential of 0.140 V,
a peak current of
2.877 X 10-9 A, and a peak area of 2.056 X 10''° VA.
Figure 21 depicts the ligation chain reaction (LCR) experiment of Example 13.
Figures 22A and 22B depicts the results of Example 12. The "hybrid code"
refers to the system
number; + and - refer to the presence or absence of the rRNA target.
Figures 23A, 23B, 23C, 23D, 23E and 23F depict the compositions and results of
Example 13.
Figures 24A and 24B depict the compositions and results from Example 13.
Figures 25A and 25B depict the set up of two of the experiments of Example 8.
Figure 26 shows the results of a PCR experiment as outlined in Example 9.
Figures 27A, 27B, 27C, 27D, 27E and 27F depict some "mechanism-1" detection
systems. Figure 27A
shows portions of target sequence 120 hybridized to detection probes 300
linked via conductive
oligomers 108 to electrode 105. The hybridization complex comprises an ETM 135
that can be
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
covalently linked either to the target sequence or the detection probe 300, or
non-covalently (i.e. a
hybridization indicator). The monolayer is depicted with insulators 107,
although as outlined herein,
any type of passivation agent may be used. Figure 27B depicts the use of
capture probe 100 linked
via attachment linker 106 to electrode 105, although as will be appreciated,
since the label probe 145
hybridizes to the detection probe 300 this can serve as a type of capture
probe. A label probe 145
comprising a first portion 141 that hybridizes to a portion of the target
sequence 120 and a second
portion 142 that hybridizes to the detection probe 300. Figure 27C depicts the
use of branched
amplifier probe 150 comprising a first portion 151 that hybridizes to the
target sequence 120 (although
label extender probes can be used as well) and amplification sequences 152
that hybridize directly to
the detection probes 300. The target sequence may be additionally attached to
the electrode using
capture probes as outlined in Figure 15. Figure 27D depicts the same thing
utilizing a linear
amplification probe 150. Figure 27E depicts a similar system, but uses label
probes 145 comprising a
first portion 141 that hybridizes to the amplification sequence 152 and a
second portion 142 that
hybridizes to a detection probe 300. Figure 27F depicts the same thing but
using a linear amplification
probe 150.
Figure 28 depicts an LCR embodiment of the invention. A first probe nucleic
acid 200 and a second
probe nucleic acid 210 are hybridized to a a first and second target domains
of a single-stranded
target sequence 120. The probes are attached, generally through ligation, to
form a ligated probe 220.
The first hybridization complex 225 is denatured, and the process is repeated,
to generate a pool of
ligated probes 220. The unligated probes 200 and 210 are removed as is known
in the art, and then
the ligated probes 220 are hybridized to detection probes 300 and detected as
outlined herein. As will
be appreciated by those in the art, the target domains depicted are directly
adjacent, i.e. contiguous,
but gaps that are then filled using nucleotides and polymerase can also be
used. In addition, the
probes are depicted with attached ETMs 135, although as will be appreciated,
non-covalently attached
ETMs may also be used.
Figure 29 depicts an alternate LCR embodiment of the invention. A first probe
nucleic acid 200 and a
second probe nucleic acid 210 are hybridized to a a first and second target
domains of a single-
stranded target sequence 120. A third probe nucleic acid 200 and a fourth
probe nucleic acid 210 are
hybridized to a third and fourth target domains of the complementary single-
stranded target sequence
125. The probes are attached, generally through ligation, to form ligated
probes 220 and 221. The
hybridization complexes 225 and 226 are denatured, and the process is repeated
to generate a pool of
ligated probes 220 and 221. The unligated probes 200, 201, 210 and 211 are
removed as is known in
the art, and then the ligated probes 220 and 221 are hybridized to detection
probes 300 and detected
as outlined herein. As will be appreciated by those in the art, the target
domains depicted are directly
adjacent, i.e. contiguous, but gaps that are then filled using nucleotides and
polymerase can also be
11
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
used. In addition, the probes are depicted with attached ETMs, although as
will be appreciated, non-
covalently attached ETMs may also be used.
Figure 30 depicts a preferred CPT embodiment of the invention; Figure 30
depicts a "mechanism-1"
system, but as will be appreciated by those in the art, "mechanism-2" systems
may be used as well. A
primary probe 1, comprising a first probe sequence 10, a scissile linkage 11,
and a second probe
sequence 12, with two covalently attached ETMs 13, is added to a target
sequence 120, to form a
hybridization complex, 6. While Figure 30 depicts two ETMs, only one of the
probe sequences may be
covalently labeled with an ETM. Furthermore, additional probe sequences, and
additional scissile
linkages, may also be used. Upon subjection to cleavage conditions, the
scissile linkage 11 is
cleaved, leaving the two probe sequences 10 and 12 hybridized to the target
sequence 120. These
probe sequences then disassociate, leaving the probe sequences 10 and 12, and
the target sequence
120. The target sequence is then free to hybridize with additional primary
probes 1, and the reaction is
repeated, generating a pool of probe sequences. The uncleaved primary probes
are removed as
outlined herein, and the pool of probe sequences is added to an electrode 105,
with an optional layer
of passivation agent 107, and detection probes 300 and 302 covalently attached
via conductive
oligomers 108. The detection probes and the probe sequences form a
hybridization complex, 30.
The detection probes may be mixed on the electrode, or may be at separate
addresses 101 and 102.
Additional ETMs in the form of hybridization indicators may optionally be
added. Electron transfer is
then initiated as is outlined herein. In addition, while this figure depicts a
soluble reaction, the primary
. probes may be bound to a solid support as is described herein.
Figure 31 depicts an additional CPT embodiment utilizing a single capture
sequence. A primary probe
1, comprising a first capture sequence 14, first probe sequence 10, a scissile
linkage 11, and a
second probe sequence 12, with a covalently attached ETM 135, is added to a
target sequence 124,
to form a hybridization complex, 6. Preferably, the capture sequence 14 does
not hybridize to the
target, although it can. While Figure 31 depicts only one covalently attached
ETM, the other probe
sequence 12 may be covalently labeled with an ETM. Furthermore, additional
probe sequences, and
additional scissile linkages, may also be used. Upon subjection to cleavage
conditions, the scissile
linkage 11 is cleaved, leaving the two probe sequences 10 and 12 hybridized to
the target sequence
120. These probe sequences then disassociate, leaving the probe sequences 14-
10 and 12, and the
target sequence 5. The target sequence is then free to hybridize with
additional primary probes 1, and
the reaction is repeated, generating a pool of probe sequences. The uncleaved
primary probes are
removed as outlined herein, and the pool of probe sequences is added to an
electrode 105, with an
optional layer of passivation agent 107, and a detection probe, comprising the
substantial complement
of the capture sequence 24 and the substantial complement of the first probe
sequence 20, covalently
attached via conductive oligomers 108. Also depicted are detection probes 304
that only comprise
probes for the capture sequence. The detection probes and the probe sequences
form a hybridization
12
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
complex, 30. Additional ETMs in the form of hybridization indicators may
optionally be added.
Electron transfer is then initiated as is outlined herein. In addition, while
this figure depicts a soluble
reaction, the primary probes may be bound to a solid support as is described
herein.
Figure 32 depicts the use of two capture sequences in a CPT aplication. A
primary probe 1,
comprising a first capture sequence 14, a first probe sequence 10, a scissile
linkage 11, a second
probe sequence 12, and a second capture sequence 15, with two covalently
attached ETMs 135, is
added to a target sequence 120, to form a hybridization complex, 6.
Preferably, the capture sequence
14 does not hybridize to the target, although it can. While Figure 32 depicts
two covalently attached
ETMs, there may be only one or none. Furthermore, additional probe sequences,
and additional
scissile linkages, may also be used. Upon subjection to cleavage conditions,
the scissile linkage 11 is
cleaved, leaving the two probe sequences with associated capture sequences, 14-
10 and 12-15
hybridized to the target sequence 120. These probe sequences then
disassociate, leaving the
probe/capture sequences 14-10 and 12-15, and the target sequence 120. The
target sequence is
then free to hybridize with additional primary probes 1, and the reaction is
repeated, generating a pool
of probe sequences. The uncleaved primary probes is neutralized by the
addition of a substantially
complementary neutralization probe 40, comprising sequences that are the
substantial complement of
the first capture sequence 24, the first probe sequence 20, the scissile
linkage 25, the second probe
sequence 22, and the second capture sequence 26. As will be appreciated by
those in the art, the
complementary scissile linkage 25 is only required in those embodiments that
utilize nucleic acid
scissile linkages. As is depicted, the neutralization probe 40 may also be
bound to the electrode. The
pool of probe sequences is added to an electrode 105, with an optional layer
of passivation agent 107,
and detection probes, comprising the substantial complement of the capture
sequence 24 and the
substantial complement of the first probe sequence 20, and the substantial
complement of the capture
sequence 22 and the substantial complement of the first probe sequence 26,
covalently attached via
conductive oligomers 108. The detection probes and the probe sequences form a
hybridization
complex, 30. Additional ETMs in the form of hybridization indicators may
optionally be added.
Electron transfer is then initiated as is outlined herein. In addition, while
this figure depicts a soluble
reaction, the primary probes may be bound to a solid support as is described
herein.
Figure 33 depicts a similar reaction, where a separation sequence 210 is used
to remove the
uncleaved scissile probe, in this case a primary probe 1. A primary probe 1,
comprising a first probe
sequence 10, a first scissile linkage 11, a separation sequence 210, a second
scissile linkage 11, and
a second probe sequence 12, with two covalently attached ETMs 13, is added to
a target sequence
120, to form a hybridization complex, 6. Other configurations include those
depicted. While Figure 33
depicts two ETMs, only one of the probe sequences may be covalently labeled
with an ETM.
Furthermore, additional probe sequences, and additional scissile linkages, may
also be used. Upon
subjection to cleavage conditions, the scissile linkage 11 is cleaved, leaving
the two probe sequences
13
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
and 12 and the separation sequence 210 hybridized to the target sequence 120.
In alternate
embodiments, the separation sequence does not hybridize to the target, for
example when it is at a
terminus of the probe; this may be preferred as it allows generic "separation
beads" to be used with
any target. These probe sequences then disassociate, leaving the probe
sequences 10 and 12, and
5 separation sequence 210, and the target sequence 120. The target sequence is
then free to
hybridize with additional primary probes 1, and the reaction is repeated,
generating a pool of probe
sequences. The uncleaved primary probes are removed by the addition of a solid
support bead 200,
with the substantial complement of the separation sequence 212 attached,
generally via a linker. This
bead then binds up the uncleaved probe 1 and the cleaved separation sequences
210, leaving only
10 cleaved probe sequences in solution. The pool of probe sequences is added
to an electrode 105, with
an optional layer of passivation agent 107, and detection probes 300 and 302
covalently attached via
conductive oligomers 108. The detection probes and the probe sequences form a
hybridization
complex, 30. The detection probes may be mixed on the electrode, or may be at
separate addresses
101 and 102. Additional ETMs in the form of hybridization indicators may
optionally be added.
Electron transfer is then initiated as is outlined herein.
Figure 34 depicts the use of solid-support bound primary scissile probes. A
solid support bead 200
with attached primary probes 1 is added to the target sequence 120, to form a
hybridization complex,
6. The primary probes may comprise an optional additional sequence 16 (which
may be used to
stabilize the first scissile linkage hybrid, if necessary), a first scissile
linkage 11, a first probe sequence
10, a second scissile linkage 11, and a second probe sequence 12. While Figure
34 does not utilize
covalently attached ETMs, one or more of the probe sequences may be so
labelled. Furthermore,
additional probe sequences, and additional scissile linkages, may also be
used. Upon subjection to
cleavage conditions, the scissile linkage 11 is cleaved, leaving the two probe
sequences 10 and 12
hybridized to the target sequence 120. These probe sequences then
disassociate, leaving the probe
sequences 10 and 12, and the target sequence 120. The target sequence is then
free to hybridize
with additional primary probes 1, and the reaction is repeated, generating a
pool of probe sequences.
The uncleaved primary probes are removed by removing the beads, and the pool
of probe sequences
is added to an electrode 105, with an optional layer of passivation agent 107,
and detection probes
300 and 302 covalently attached via conductive oligomers 108. The detection
probes and the probe
sequences form a hybridization complex, 30. The detection probes may be mixed
on the electrode, or
may be at separate addresses 101 and 102. ETMs in the form of hybridization
indicators are then
added, and electron transfer is then initiated as is outlined herein.
Figure 35 depicts the use of bead-bound primary and secondary probes. Two (or
more) types of
beads are used. The first type is a solid support bead 250 with attached
secondary scissile probes 2
comprising a first scissile linkage 11, a first secondary probe sequence 60, a
second scissile linkage
11, and a second secondary probe sequence 70. In addition, as depicted, a
second secondary
14
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
scissile probe may be preferably used, comprising a first scissile linkage 11,
a first secondary probe
sequence 80, a second scissile linkage 11, and a second secondary probe
sequence 90. These are
depicted in Figure 35 as being on the same bead, although two sets of beads
may be preferably used.
The primary probe beads 260 have attached primary probes 1 comprising a first
scissile linkage 11, a
first probe sequence 10, a second scissile linkage 11, and a second probe
sequence 12. As outlined
above, the probes may contain optional additional sequences (depicted herein
as 16), or additional
probe sequences or scissile linkages. The beads 250 and 260 are added to the
target sequence 120.
The primary probes form a hybridization complex, 6, with the target 120. While
Figure 35 does not
utilize covalently attached ETMs, any or all of the probe sequences may be so
labelled. Upon
subjection to cleavage conditions, the scissile linkages 11 are cleaved,
leaving-the two primary probe
sequences 10 and 12 hybridized to the target sequence 120. These probe
sequences then
disassociate, leaving the probe sequences 10 and 12, and the target sequence
120. The target
sequence is then free to hybridize with additional primary probes 1, and the
reaction is repeated,
generating a pool of probe sequences. The primary probe sequences are then
free to diffuse to the
secondary beads 250, where they may serve as the next "target", hybridizing to
the secondary probes
to form additional hybridization complexes, 7 and 8. Cleavage, followed by
secondary probe
sequence disassociation from the primary probe sequence "targets", generates a
pool of secondary
probe sequences which can be detected. The uncleaved probes are removed by
removing the beads,
and the pool of probe sequences is added to an electrode 105, with an optional
layer of passivation
agent 107, and detection probes 62, 72, 82, and 92 covalently attached via
conductive oligomers 108.
While Figure 35 does not show this, there may be detection probes for the
primary probe sequences
as well. The detection probes and the probe sequences form hybridization
complexes. The detection
probes may be mixed on the electrode, or may be at separate addresses. ETMs in
the form of
hybridization indicators are then added, and electron transfer is then
initiated as is outlined herein.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to compositions and methods useful in the
detection of nucleic acids
using a variety of amplification techniques, including both signal
amplification and target amplification.
Once amplification has occurred, detection proceeds based on electron
transfer, as is described
below and generally outlined in U.S. Patent Nos. 5,591,578, 5,824,473,
5,770,369, 5,705,348, and
5,780,234, and PCT application W098/20162, all of which are expressly
incorporated herein by
reference in their entirety.
Accordingly, in a preferred embodiment, the present invention provides methods
of detecting target
nucleic acids utilizing amplification. By "target nucleic acid" or "target
sequence" or grammatical
equivalents herein means a nucleic acid sequence on a single strand of nucleic
acid. The target
sequence may be a portion of a gene, a regulatory sequence, genomic DNA, cDNA,
RNA including
mRNA and rRNA, or others. It may be any length, with the understanding that
longer sequences are
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
more specific. In some embodiments, it may be desirable to fragment or cleave
the sample nucleic
acid into fragments of 100 to 10,000 basepairs, with fragments of roughly 500
basepairs being
preferred in some embodiments. As will be appreciated by those in the art, the
complementary target
sequence may take many forms. For example, it may be contained within a larger
nucleic acid
sequence, i.e. all or part of a gene or mRNA, a restriction fragment of a
plasmid or genomic DNA,
among others. The sample comprising the target sequence may be virtually any
tissue from any
organism, including blood, bone marrow, lymph, hard tissues (e.g. organs such
as liver, spleen,
kidney, heart, lung, etc.) saliva, vaginal and anal secretions, urine, feces,
perspiration, tears, and other
bodily fluids, as well as cell lysates of bacteria and pathogens, including
viruses.
In a preferred embodiment, particularly when detection of pathogens such as
bacteria is desired, the
target nucleic acid comprises all or a portion of rRNA. rRNA is a particularly
preferred target
sequence because of the high levels of rRNA in bacteria; accordingly, in many
embodiments, no
amplification reaction needs to be done. Suitable rRNA targets include, but
are not limited to, those
outlined in U.S. 4,851,330; 5,288,611; 5,723,597; 6,641,632; 5,738,987;
5,830,654; 5,763,163;
5,738,989; 5,738,988; 5,723,597; 5,714,324; 5,582,975; 5,747,252; 5,567,587;
5,558,990; 5,622,827;
5,514,551; 5,501,951; 5,656,427; 5.352.579; 5,683,870; 5,374,718; 5,292,874;
5,780,219; 5,030,557;
and 5,541,308, all of which are expressly incorporated by reference.
When rRNA is used as the target sequence, preferred embodiments utilize
"helper" sequences as
outlined in WO 89/04876, hereby incorporated by reference. As is known in the
art, rRNA takes on
specific secondary and tertiary structures that can hinder the formation of
hybridization complexes with
the probes of the invention. Accordingly, helper sequences bind to rRNA
sequences and impose
different secondary or tertiary structures and thus facilitate the binding of
the probes to the target
rRNA.
In some embodiments, for example when rRNA is used as the target sequence, it
may be desirable to
utilize a plurality of capture probes or capture probe extenders, to "tack
down" large targets
periodically. The use of a single type of capture probe with multiple capture
probe extenders, each
with a first portion that will hybridize to the capture probe and a second
portion that will hybridize to a
unique portion of the target sequence.
A particularly preferred embodiment of the invention is the formation of assay
complexes comprising
rRNA target sequences, capture probes and label probes.
As is outlined more fully below, probes (including primers) are made to
hybridize to target sequences
to determine the presence or absence of the target sequence in a sample.
Generally speaking, this
term will be understood by those skilled in the art.
16
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The target sequence may also be comprised of different target domains; for
example, in "sandwich"
type assays as outlined below, a first target domain of the sample target
sequence may hybridize to a
capture probe or a portion of capture extender probe, a second target domain
may hybridize to a
portion of an amplifier probe, a label probe, or a different capture or
capture extender probe, etc. In
addition, the target domains may be adjacent (i.e. contiguous) or separated.
For example, when LCR
techniques are used, a first primer may hybridize to a first target domain and
a second primer may
hybridize to a second target domain; either the domains are adjacent, or they
may be separated by
one or more nucleotides, coupled with the use of a polymerase and dNTPs, as is
more fully outlined
below.
Unless otherwise noted, the terms "first" and "second" are not meant to confer
an orientation of the
sequences with respect to the 5'-3' orientation of the target sequence. For
example, assuming a 5'-3'
orientation of the complementary target sequence, the first target domain may
be located either 5' to
the second domain, or 3' to the second domain.
If required, the target sequence is prepared using known techniques. For
example, the sample may
be treated to lyse the cells, using known lysis buffers, sonication,
electroporation, etc., with purification
occuring as needed, as will be appreciated by those in the art. In addition,
the reactions outlined
herein may be accomplished in a variety of ways, as will be appreciated by
those in the art.
Components of the reaction may be added simultaneously, or sequentially, in
any order, with preferred
embodiments outlined below. In addition, the reaction may include a variety of
other reagents may be
included in the assays. These include reagents like salts, buffers, neutral
proteins, e.g. albumin,
detergents, etc which may be used to facilitate optimal hybridization and
detection, and/or reduce non-
specific or background interactions. Also reagents that otherwise improve the
efficiency of the assay,
such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc.,
may be used, depending
on the sample preparation methods and purity of the target.
In addition, in most embodiments, double stranded target nucleic acids are
denatured to render them
single stranded so as to permit hybridization of the primers and other probes
of the invention. A
preferred embodiment utilizes a thermal step, generally by raising the
temperature of the reaction to
about 95'C, although pH changes and other techniques may also be used.
A primer nucleic acid is then contacted to the target sequence to form a
hybridization complex. By
"primer nucleic acid" herein is meant a probe nucleic acid that will hybridize
to some portion, i.e. a
domain, of the target sequence. Probes of the present invention are designed
to be complementary to
a target sequence (either the target sequence of the sample or to other probe
sequences, as is
described below), such that hybridization of the target sequence and the
probes of the present
invention occurs. As outlined below, this complementarity need not be perfect;
there may be any
number of base pair mismatches which will interfere with hybridization between
the target sequence
17
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
and the single stranded nucleic acids of the present invention. However, if
the number of mutations is
so great that no hybridization can occur under even the least stringent of
hybridization conditions, the
sequence is not a complementary target sequence. Thus, by "substantially
complementary' herein is
meant that the probes are sufficiently complementary to the target sequences
to hybridize under
normal reaction conditions.
A variety of hybridization conditions may be used in the present invention,
including high, moderate
and low stringency conditions; see for example Maniatis et al., Molecular
Cloning: A Laboratory
Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed.
Ausubel, et al, hereby
incorporated by reference. Stringent conditions are sequence-dependent and
will be different in
different circumstances. Longer sequences hybridize specifically at higher
temperatures. An
extensive guide to the hybridization of nucleic acids is found in Tijssen,
Techniques in Biochemistry
and Molecular Biology--Hybridization with Nucleic Acid Probes, "Overview of
principles of hybridization
and the strategy of nucleic acid assays" (1993). Generally, stringent
conditions are selected to be
about 5-10°C lower than the thermal melting point (Tm) for the specific
sequence at a defined ionic
strength pH. The Tm is the temperature (under defined ionic strength, pH and
nucleic acid
concentration) at which 50% of the probes complementary to the target
hybridize to the target
sequence at equilibrium (as the target sequences are present in excess, at Tm,
50% of the probes are
occupied at equilibrium). Stringent conditions will be those in which the salt
concentration is less than
about 1.0 sodium ion, typically about 0.01 to 1.0 M sodium ion concentration
(or other salts) at pH 7.0
to 8.3 and the temperature is at least about 30°C for short probes
(e.g. 10 to 50 nucleotides) and at
least about 60°C for long probes (e.g. greater than 50 nucleotides).
Stringent conditions may also be
achieved with the addition of destabilizing agents such as formamide. The
hybridization conditions
may also vary when a non-ionic backbone, i.e. PNA is used, as is known in the
art. In addition, cross-
linking agents may be added after target binding to cross-link, i.e.
covalently attach, the two strands of
the hybridization complex.
Thus, the assays are generally run under stringency conditions which allows
formation of the
hybridization complex only in the presence of target. Stringency can be
controlled by altering a step
parameter that is a thermodynamic variable, including, but not limited to,
temperature, formamide
concentration, salt concentration, chaotropic salt concentration pH, organic
solvent concentration, etc.
These parameters may also be used to control non-specific binding, as is
generally outlined in U.S.
Patent No. 5,681,697. Thus it may be desirable to perform certain steps at
higher stringency
conditions to reduce non-specific binding.
The probes (including primers) comprise nucleic acids. By "nucleic acid" or
"oligonucleotide" or
grammatical equivalents herein means at least two nucleotides covalently
linked together. A nucleic
acid of the present invention will generally contain phosphodiester bonds,
although in some cases, as
18
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
outlined below, nucleic acid analogs are included that may have alternate
backbones, comprising, for
example, phosphoramide (Beaucage et al., Tetrahedron 49(10):1925 (1993) and
references therein;
Letsinger, J. Org. Chem. 35:3800 (1970); Sprinzl et al., Eur. J. Biochem.
81:579 (1977); Letsinger et
al., Nucl. Acids Res. 14:3487 (1986); Sawai et al, Chem. Lett. 805 (1984),
Letsinger et al., J. Am.
Chem. Soc. 110:4470 (1988); and Pauwels et al., Chemica Scripta 26:141
91986)), phosphorothioate
(Mag et al., Nucleic Acids Res. 19:1437 (1991 ); and U.S. Patent No.
5,644,048), phosphorodithioate
(Briu et al., J. Am. Chem. Soc. 111:2321 (1989), O-methylphophoroamidite
linkages (see Eckstein,
Oligonucleotides and Analogues: A Practical Approach, Oxford University
Press), and peptide nucleic
acid backbones and linkages (see Egholm, J. Am. Chem. Soc. 114:1895 (1992);
Meier et al., Chem.
Int. Ed. Engl. 31:1008 (1992); Nielsen, Nature, 365:566 (1993); Carlsson et
al., Nature 380:207
(1996), all of which are incorporated by reference). Other analog nucleic
acids include those with
positive backbones (Denpcy et al., Proc. Natl. Acad. Sci. USA 92:6097 (1995);
non-ionic backbones
(U.S. Patent Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863;
Kiedrowshi et al.,
Angew. Chem. Intl. Ed. English 30:423 (1991 ); Letsinger et al., J. Am. Chem.
Soc. 110:4470 (1988);
Letsinger et al., Nucleoside & Nucleotide 13:1597 (1994); Chapters 2 and 3,
ASC Symposium Series
580, "Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and
P. Dan Cook;
Mesmaeker et al., Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et
al., J. Biomolecular NMR
34:17 (1994); Tetrahedron Lett. 37:743 (1996)) and non-ribose backbones,
including those described
in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC
Symposium Series 580,
"Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P.
Dan Cook. Nucleic
acids containing one or more carbocyclic sugars are also included within the
definition of nucleic acids
(see Jenkins et al., Chem. Soc. Rev. (1995) pp169-176). Several nucleic acid
analogs are described
in Rawls, C & E News June 2, 1997 page 35. All of these references are hereby
expressly
incorporated by reference. These modifications of the ribose-phosphate
backbone may be done to
facilitate the addition of ETMs, or to increase the stability and half-life of
such molecules in
physiological environments. In addition, it should be noted that the use of
the terms "DNA" and "RNA"
include nucleic acid analogs.
As will be appreciated by those in the art, all of these nucleic acid analogs
may find use in the present
invention. In addition, mixtures of naturally occurring nucleic acids and
analogs can be made; for
example, at the site of conductive oligomer or ETM attachment, an analog
structure may be used.
Alternatively, mixtures of different nucleic acid analogs, and mixtures of
naturally occuring nucleic
acids and analogs may be made.
Particularly preferred are peptide nucleic acids (PNA) which includes peptide
nucleic acid analogs.
These backbones are substantially non-ionic under neutral conditions, in
contrast to the highly
charged phosphodiester backbone of naturally occurring nucleic acids. This
results in two
advantages. First, the PNA backbone exhibits improved hybridization kinetics.
PNAs have larger
changes in the melting temperature (Tm) for mismatched versus perfectly
matched basepairs. DNA
19
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
and RNA typically exhibit a 2-4'C drop in Tm for an internal mismatch. With
the non-ionic PNA
backbone, the drop is closer to 7-9'C. This allows for better detection of
mismatches. Similarly, due
to their non-ionic nature, hybridization of the bases attached to these
backbones is relatively
insensitive to salt concentration. This is particularly advantageous in the
systems of the present
invention, as a reduced salt hybridization solution has a lower Faradaic
current than a physiological
salt solution (in the range of 150 mM).
The nucleic acids may be single stranded'or double stranded, as specified, or
contain portions of both
double stranded or single stranded sequence. The nucleic acid may be DNA, both
genomic and
cDNA, RNA or a hybrid, where the nucleic acid contains any combination of
deoxyribo- and ribo-
nucleotides, and any combination of bases, including uracil, adenine, thymine,
cytosine, guanine,
inosine, xathanine hypoxathanine, isocytosine, isoguanine, etc. A preferred
embodiment utilizes
isocytosine and isoguanine in nucleic acids designed to be complementary to
other probes, rather
than target sequences, as this reduces non-specific hybridization, as is
generally described in U.S.
Patent No. 5,681,702. As used herein, the term "nucleoside" includes
nucleotides as well as
nucleoside and nucleotide analogs, and modified nucleosides such as amino
modified nucleosides. In
addition, "nucleoside" includes non-naturally occuring analog structures. Thus
for example the
individual units of a peptide nucleic acid, each containing a base, are
referred to herein as a
nucleoside.
The size of the primer nucleic acid may vary, as will be appreciated by those
in the art, in general
varying from 5 to 500 nucleotides in length, with primers of between 10 and
100 being preferred,
between 15 and 50 being particularly preferred, and from 10 to 35 being
especially preferred,
depending on the use and amplification technique.
In addition, the different amplification techniques may have further
requirements of the primers, as is
more fully described below.
Once the hybridization complex between the primer and the target sequence has
been formed, an
enzyme, sometimes termed an "amplification enzyme", is used to modify the
primer. As for all the
methods outlined herein, the enzymes may be added at any point during the
assay, either prior to,
during, or after the addition of the primers. The identification of the enzyme
will depend on the
amplification technique used, as is more fully outlined below. Similarly, the
modification will depend on
the amplification technique, as outlined below, although generally the first
step of all the reactions
herein is an extension of the primer, that is, nucleotides are added to the
primer to extend its length.
Once the enzyme has modified the primer to form a modified primer, the
hybridization complex is
disassociated. Generally, the amplification steps are repeated for a period of
time to allow a number
of cycles, depending on the number of copies of the original target sequence
and the sensitivity of
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
detection, with cycles ranging from 1 to thousands, with from 10 to 100 cycles
being preferred and
from 20 to 50 cycles being especially preferred.
After a suitable time or amplification, the modified primer is incorporated
into an assay complex, as is
more fully outlined below. The assay complex is covalently attached to an
electrode, arid comprises at
least one electron transfer moiety (ETM), described below. Electron transfer
between the ETM and
the electrode is then detected to indicate the presence or absence of the
original target sequence, as
described below.
In a preferred embodiment, the amplification is target amplification. Target
amplification involves the
amplification (replication) of the target sequence to be detected, such that
the number of copies of the
target sequence is increased. Suitable target amplification techniques
include, but are not limited to,
the polymerase chain reaction (PCR), strand displacement amplification (SDA),
nucleic acid sequence
based amplification (NASBA), and transcription mediated amplification (TMA).
In a preferred embodiment, the target amplification technique is PCR. The
polymerase chain reaction
(PCR) is widely used and described, and involve the use of primer extension
combined with thermal
cycling to amplify a target sequence; see U.S. Patent Nos. 4,683,195 and
4,683,202, and PCR
Essential Data, J. W. Wiley & sons, Ed. C.R. Newton, 1995, all of which are
incorporated by reference.
In addition, there are a number of variations of PCR which also find use in
the invention, including
"quantitative competitive PCR" or "QC-PCR", "arbitrarily primed PCR" or "AP-
PCR" , "immuno-PCR",
"Alu-PCR", "PCR single strand conformational polymorphism" or "PCR-SSCP",
"reverse transcriptase
PCR" or "RT-PCR", "biotin capture PCR", "vectorette PCR". "panhandle PCR", and
"PCR select cDNA
subtration", among others. In one embodiment, the amplification technique is
not PCR.
In general, PCR may be briefly described as follows. A double stranded target
nucleic acid is
denatured, generally by raising the temperature, and then cooled in the
presence of an excess of a
PCR primer, which then hybridizes to the first target strand. A DNA polymerase
then acts to extend
the primer, resulting in the synthesis of a new strand forming a hybridization
complex. The sample is
then heated again, to disassociate the hybridization complex, and the process
is repeated. By using a
second PCR primer for the complementary target strand, rapid and exponential
amplification occurs.
Thus PCR steps are denaturation, annealing and extension. The particulars of
PCR are well known,
and include the use of a thermostabile polymerase such as Taq I polymerase and
thermal cycling.
Accordingly, the PCR reaction requires at least one PCR primer and a
polymerase.
In a preferred embodiment, the target amplification technique is SDA. Strand
displacement
amplification (SDA) is generally described in Walker et al., in Molecular
Methods for Virus Detection,
21
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Academic Press, Inc., 1995, and U.S. Patent Nos. 5,455,166 and 5,130,238, all
of which are hereby
expressly incorporated by reference in their entirety.
In general, SDA may be described as follows. A single stranded target nucleic
acid, usually a DNA
target sequence, is contacted with an SDA primer. An "SDA primer" generally
has a length of 25-100
nucleotides, with SDA primers of approximately 35 nucleotides being preferred.
An SDA primer is
substantially complementary to a region at the 3' end of the target sequence,
and the primer has a
sequence at its 5' end (outside of the region that is complementary to the
target) that is a recognition
sequence for a restriction endonuclease, sometimes referred to herein as a
"nicking enzyme" or a
"nicking endonuclease", as outlined below. The SDA primer then hybridizes to
the target sequence.
The SDA reaction mixture also contains a polymerise (an "SDA polymerise", as
outlined below) and
a mixture of all four deoxynucleoside-triphosphates (also called
deoxynucleotides or dNTPs, i.e.
dATP, dTTP, dCTP and dGTP), at least one species of which is a substituted or
modified dNTP; thus,
the SDA primer is modified, i.e. extended, to form a modified primer,
sometimes referred to herein as
a "newly synthesized strand". The substituted dNTP is modified such that it
will inhibit cleavage in the
strand containing the substituted dNTP but will not inhibit cleavage on the
other strand. Examples of
suitable substituted dNTPs include, but are not limited, 2'deoxyadenosine 5'-O-
(1-thiotriphosphate), 5-
methyldeoxycytidine 5'-triphosphate, 2'-deoxyuridine 5'-triphosphate, adn 7-
deaza-2'-deoxyguanosine
5'-triphosphate. In addition, the substitution of the dNTP may occur after
incorporation into a newly
synthesized strand; for example, a methylase may be used to add methyl groups
to the synthesized
strand. In addition, if all the nucleotides are substituted, the polymerise
may have 5'~3' exonuclease
activity. However, if less than all the nucleotides are substituted, the
polymerise preferably lacks 5'~3'
exonuclease activity.
As will be appreciated by those in the art, the recognition site/endonuclease
pair can be any of a wide
variety of known combinations. The endonuclease is chosen to cleave a strand
either at the
recognition site, or either 3' or 5' to it, without cleaving the complementary
sequence, either because
the enzyme only cleaves one strand or because of the incorporation of the
substituted nucleotides.
Suitable recognition site/endonuclease pairs are well known in the art;
suitable endonucleases include,
but are not limited to, Hincll, Hindll, Aval, Fnu4Hl, Tthllll, Ncll, BstXl,
Baml, etc. A chart depicting
suitable enzymes, and their corresponding recognition sites and the modified
dNTP to use is found in
U.S. Patent No. 5,455,166, hereby expressly incorporated by reference.
Once nicked, a polymerise (an "SDA polymerise") is used to extend the newly
nicked strand, 5'~3',
thereby creating another newly synthesized strand. The polymerise chosen
should be able to intiate
5'~3' polymerization at a nick site, should also displace the polymerized
strand downstream from the
nick, and should lack 5'~3' exonuclease activity (this may be additionally
accomplished by the addition
of a blocking agent). Thus, suitable polymerises in SDA include, but are not
limited to, the Klenow
22
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
fragment of DNA polymerase I, SEQUENASE 1.0 and SEQUENASE 2.0 (U.S.
Biochemical), T5 DNA
polymerase and Phi29 DNA polymerase.
Accordingly, the SDA reaction requires, in no particular order, an SDA primer,
an SDA polymerase, a
nicking endonuclease, and dNTPs, at least one species of which is modified.
In general, SDA does not require thermocycling. The temperature of the
reaction is generally set to be
high enough to prevent non-specific hybridization but low enough to allow
specific hybridization; this is
generally from about 37°C to about 42°C, depending on the
enzymes.
In a preferred embodiment, as for most of the amplification techniques
described herein, a second
amplification reaction can be done using the complementary target sequence,
resulting in a
substantial increase in amplification during a set period of time. That is, a
second primer nucleic acid
is hybridized to a second target sequence, that is substantially complementary
to the first target
sequence, to form a second hybridization complex. The addition of the enzyme,
followed by
disassociation of the second hybridization complex, results in the generation
of a number of newly
synthesized second strands.
In this way, a number of target molecules are made. As is more fully outlined
below, these reactions
(that is, the products of these reactions) can be detected in a number of
ways. In general, either direct
or indirect detection of the target products can be done. "Direct" detection
as used in this context, as
for the other amplification strategies outlined herein, requires the
incorporation of a label, in this case
an electron transfer moiety (ETM), into the target sequence, with detection
proceeding according to
either "mechanism-1" or "mechanism-2", outlined below. In this embodiment, the
ETM(s) may be
incorporated in three ways: (1 ) the primers comprise the ETM(s), for example
attached to the base, a
ribose, a phosphate, or to analogous structures in a nucleic acid analog; (2)
modified nucleosides are
used that are modified at either the base or the ribose (or to analogous
structures in a nucleic acid
analog) with the ETM(s); these ETM modified nucleosides are then converted to
the triphosphate form
and are incorporated into the newly synthesized strand by a polymerase; or (3)
a "tail" of ETMs can be
added, as outlined below. Either of these methods result in a newly
synthesized strand that comprises
ETMs, that can be directly detected as outlined below.
Alternatively, indirect detection proceeds as a sandwich assay, with the newly
synthesized strands
containing few or no ETMs. Detection then proceeds via the use of label probes
that comprise the
ETM(s); these label probes will hybridize either directly to the newly
synthesized strand or to
intermediate probes such as amplification probes, as is more fully outlined
below. In this case, it is the
ETMs on the label probes that are used for detection as outlined below.
23
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, the target amplification technique is nucleic acid
sequence based
amplification (NASBA). NASBA is generally described in U.S. Patent No.
5,409,818; Sooknanan et
al., Nucleic Acid Sequence-Based Amplification, Ch. 12 (pp. 261-285) of
Molecular Methods for Virus
Detection, Academic Press, 1995; and "Profiting from Gene-based Diagnostics",
CTB International
Publishing Inc., N.J., 1996, all of which are incorporated by reference. NASBA
is very similar to both
TMA and QBR. Transcription mediated amplification (TMA) is generally described
in U.S. Patent Nos.
5,399,491, 5,888,779, 5,705,365, 5,710,029, all of which are incorporated by
reference. The main
difference between NASBA and TMA is that NASBA utilizes the addition of RNAse
H to effect RNA
degradation, and TMA relies on inherent RNAse H activity of the reverse
transcriptase.
In general, these techniques may be described as follows. A single stranded
target nucleic acid,
usually an RNA target sequence (sometimes referred to herein as "the first
target sequence" or "the
first template"), is contacted with a first primer, generally referred to
herein as a "NASBA primer"
(although "TMA primer" is also suitable). Starting with a DNA target sequence
is described below.
These primers generally have a length of 25-100 nucleotides, with NASBA
primers of approximately
50-75 nucleotides being preferred. The first primer is preferably a DNA primer
that has at its 3' end a
sequence that is substantially complementary to the 3' end of the first
template. The first primer also
has an RNA polymerase promoter at its 5' end (or its complement (antisense),
depending on the
configuration of the system). The first primer is then hybridized to the first
template to form a first
hybridization complex. The reaction mixture also includes a reverse
transcriptase enzyme (an
"NASBA reverse transcriptase") and a mixture of the four dNTPs, such that the
first NASBA primer is
modified, i.e. extended, to form a modified first primer, comprising a
hybridization complex of RNA
(the first template) and DNA (the newly synthesized strand).
By "reverse transcriptase" or "RNA-directed DNA polymerase" herein is meant an
enzyme capable of
synthesizing DNA from a DNA primer and an RNA template. Suitable RNA-directed
DNA
polymerases include, but are not limited to, avian myloblastosis virus reverse
transcriptase ("AMV
RT") and the Moloney murine leukemia virus RT. When the amplification reaction
is TMA, the
reverse transcriptase enzyme further comprises a RNA degrading activity as
outlined below.
In addition to the components listed above, the NASBA reaction also includes
an RNA degrading
enzyme, also sometimes referred to herein as a ribonuclease, that will
hydrolyze RNA of an RNA:DNA
hybrid without hydrolyzing single- or double-stranded RNA or DNA. Suitable
ribonucleases include,
but are not limited to, RNase H from E. coli and calf thymus.
The ribonuclease activity degrades the first RNA template in the hybridization
complex, resulting in a
disassociation of the hybridization complex leaving a first single stranded
newly synthesized DNA
strand, sometimes referred to herein as "the second template".
24
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In addition, the NASBA reaction also includes a second NASBA primer, generally
comprising DNA
(although as for all the probes herein, including primers, nucleic acid
analogs may also be used). This
second NASBA primer has a sequence at its 3' end that is substantially
complementary to the 3' end
of the second template, and also contains an antisense sequence for a
functional promoter and the
antisense sequence of a transcription initiation site. Thus, this primer
sequence, when used as a
template for synthesis of the third DNA template, contains sufficient
information to allow specific and
efficient binding of an RNA polymerase and initiation of transcription at the
desired site. Preferred
embodiments utilizes the antisense promoter and transcription initiation site
are that of the T7 RNA
polymerase, although other RNA polymerase promoters and initiation sites can
be used as well, as
outlined below.
The second primer hybridizes to the second template, and a DNA polymerase,
also termed a "DNA-
directed DNA polymerase", also present in the reaction, synthesizes a third
template (a second newly
synthesized DNA strand), resulting in second hybridization complex comprising
two newly synthesized
DNA strands.
Finally, the inclusion of an RNA polymerase and the required four
ribonucleoside triphosphates
(ribonucleotides or NTPs) results in the synthesis of an RNA strand (a third
newly synthesized strand
that is essentially the same as the first template). The RNA polymerase,
sometimes referred to herein
as a "DNA-directed RNA polymerase", recognizes the promoter and specifically
initiates RNA
synthesis at the initiation site. In addition, the RNA polymerase preferably
synthesizes several copies
of RNA per DNA duplex. Preferred RNA polymerases include, but are not limited
to, T7 RNA
polymerase, and other bacteriophage RNA polymerases including those of phage
T3, phage III,
Salmonella phage sp6, or Pseudomonase phage gh-1.
In some embodiments, TMA and NASBA are used with starting DNA target
sequences. In this
embodiment, it is necessary to utilize the first primer comprising the RNA
polymerase promoter and a
DNA polymerase enzyme to generate a double stranded DNA hybrid with the newly
synthesized strand
comprising the promoter sequence. The hybrid is then denatured and the second
primer added.
Accordingly, the NASBA reaction requires, in no particular order, a first
NASBA primer, a second
NASBA primer comprising an antisense sequence of an RNA polymerase promoter,
an RNA
polymerase that recognizes the promoter, a reverse transcriptase, a DNA
polymerase, an RNA
degrading enzyme, NTPs and dNTPs, in addition to the detection components
outlined below.
These components result in a single starting RNA template generating a single
DNA duplex; however,
since this DNA duplex results in the creation of multiple RNA strands, which
can then be used to
initiate the reaction again, amplification proceeds rapidly.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Accordingly, the TMA reaction requires, in no particular order, a first TMA
primer, a second TMA
primer comprising an antisense sequence of an RNA polymerise promoter, an RNA
polymerise that
recognizes the promoter, a reverse transcriptase with RNA degrading activity,
a DNA polymerise,
NTPs and dNTPs, in addition to the detection components outlined below.
These components result in a single starting RNA template generating a single
DNA duplex; however,
since this DNA duplex results in the creation of multiple RNA strands, which
can then be used to
initiate the reaction again, amplification proceeds rapidly.
As outlined herein, the detection of the newly synthesized strands can proceed
in several ways. Direct
detection can be done when the newly synthesized strands comprise ETM labels,
either by
incorporation into the primers or by incorporation of modified labelled
nucleotides into the growing
strand. Alternatively, as is more fully outlined below, indirect detection of
unlabelled strands (which
now serve as "targets" in the detection mode) can occur using a variety of
sandwich assay
configurations. As will be appreciated by those in the art, any of the newly
synthesized strands can
serve as the "target" for form an assay complex on a surface with a capture
probe. In NASBA and
TMA, it is preferable to utilize the newly formed RNA strands as the target,
as this is where significant
amplification occurs.
In a preferred embodiment, the amplification technique is signal
amplification. Signal amplification
involves the use of limited number of target molecules as templates to either
generate multiple
signalling probes or allow the use of multiple signalling probes. Signal
amplification strategies include
LCR, CPT, InvaderTT", and they se of amplification probes in sandwich assays.
In a preferred embodiment, the signal amplification technique is LCR, as is
generally depicted in
Figures 21, 28 and 29. The method can be run in two different ways; in a first
embodiment, only one
strand of a target sequence is used as a template for ligation (Figure 28);
alternatively, both strands
may be used (Figure 29). See generally U.S. Patent Nos. 5,185,243 and
5,573,907; EP 0 320 308 B1;
EP 0 336 731 B1; EP 0 439 182 B1; WO 90/01069; WO 89/12696; and WO 89/09835,
and U.S.S.N.s
60/078,102 and 60/073,011, all of which are incorporated by reference.
In a preferred embodiment, the single-stranded target sequence comprises a
first target domain and a
second target domain, and a first LCR primer and a second LCR primer nucleic
acids are added, that
are substantially complementary to its respective target domain and thus will
hybridize to the target
domains. These target domains may be directly adjacent, i.e. contiguous, or
separated by a number
of nucleotides. If they are non-contiguous, nucleotides are added along with
means to join
nucleotides, such as a polymerise, that will add the nucleotides to one of the
primers. The two LCR
primers are then covalently attached, for example using a ligase enzyme such
as is known in the art.
This forms a first hybridization complex comprising the ligated probe and the
target sequence. This
26
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
hybridization complex is then denatured (disassociated), and the process is
repeated to generate a
pool of ligated probes. In addition, it may be desirable to have the detection
probes, described below,
comprise a mismatch at the probe junction site, such that the detection probe
cannot be used as a
template for ligation.
In a preferred embodiment, LCR is done for two strands of a double-stranded
target sequence. The
target sequence is denatured, and two sets of probes are added: one set as
outlined above for one
strand of the target, and a separate set (i.e. third and fourth primer robe
nucleic acids) for the other
strand of the target. In a preferred embodiment, the first and third probes
will hybridize, and the
second and fourth probes will hybridize, such that amplification can occur.
That is, when the first and
second probes have been attached, the ligated probe can now be used as a
template, in addition to
the second target sequence, for the attachment of the third and fourth probes.
Similarly, the ligated
third and fourth probes will serve as a template for the attachment of the
first and second probes, in
addition to the first target strand. In this way, an exponential, rather than
just a linear, amplification
can occur.
Again, as outlined above, the detection of the LCR reaction can occur
directly, in the case where one
or both of the primers comprises at least one ETM, or indirectly, using
sandwich assays, through the
use of additional probes; that is, the ligated probes can serve as target
sequences, and detection may
utilize amplification probes, capture probes, capture extender probes, label
probes, and label extender
probes, etc.
A variation of LCR utilizes a "chemical ligation" of sorts, as is generally
outlined in U.S. Patent Nos.
5,616,464 and 5,767,259, both of which are hereby expressly incorporated by
reference in their
entirety. In this embodiment, similar to LCR, a pair of primers are utilized,
wherein the first primer is
substantially complementary to a first domain of the target and the second
primer is substantially
complementary to an adjacent second domain of the target (although, as for
LCR, if a "gap" exists, a
polymerase and dNTPs may be added to "fill in" the gap). Each primer has a
portion that acts as a
"side chain" that does not bind the target sequence and acts one half of a
stem structure that interacts
non-covalently through hydrogen bonding, salt bridges, van der Waal's forces,
etc. Preferred
embodiments utilize substantially complementary nucleic acids as the side
chains. Thus, upon
hybridization of the primers to the target sequence, the side chains of the
primers are brought into
spatial proximity, and, if the side chains comprise nucleic acids as well, can
also form side chain
hybridization complexes.
At least one of the side chains of the primers comprises an activatable cross-
linking agent, generally
covalently attached to the side chain, that upon activation, results in a
chemical cross-link or chemical
ligation. The activatible group may comprise any moiety that will allow cross-
linking of the side chains,
and include groups activated chemically, photonically and thermally, with
photoactivatable groups
27
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
being preferred. In some embodiments a single activatable group on one of the
side chains is enough
to result in cross-linking via interaction to a functional group on the other
side chain; in alternate
embodiments, activatable groups are required on each side chain.
Once the hybridization complex is formed, and the cross-linking agent has been
activated such that
the primers have been covalently attached, the reaction is subjected to
conditions to allow for the
disassocation of the hybridization complex, thus freeing up the target to
serve as a template for the
next ligation or cross-linking. In this way, signal amplification occurs, and
can be detected as outlined
herein.
In a preferred embodiment the signal amplification technique is RCA. Rolling-
circle amplification is
generally described in Baner et al. (1998) Nuc. Acids Res. 26:5073-5078;
Barany, F. (1991 ) Proc.
NatL Acad. Sci. USA 88:189-193; Lizardi et al. (1998) Nat. Genet. 19:225-232;
Zhang et al., Gene
211:277 (1998); and Daubendiek et al., Nature Biotech. 15:273 (1997); all of
which are incorporated
by reference in their entirety.
In general, RCA may be described as follows. First, as is outlined in more
detail below, a single RCA
probe is hybridized with a target nucleic acid. Each terminus of the probe
hybridizes adjacently on the
target nucleic acid (or alternatively, there are intervening nucleotides that
can be "filled in" using a
polymerase and dNTPs, as outlined below) and the OLA assay as described above
occurs. When
ligated, the probe is circularized while hybridized to the target nucleic
acid. Addition of a primer, a
polymerase and dNTPs results in extension of the circular probe. However,
since the probe has no
terminus, the polymerase continues to extend the probe repeatedly. Thus
results in amplification of
the circular probe. This very large concatemer can be detected intact, as
described below, or can be
cleaved in a variety of ways to form smaller amplicons for detection as
outlined herein.
Accordingly, in an preferred embodiment, a single oligonucleotide is used both
for OLA and as the
circular template for RCA (referred to herein as a "padlock probe" or a "RCA
probe"). That is, each
terminus of the oligonucleotide contains sequence complementary to the target
nucleic acid and
functions as an OLA primer as described above. That is, the first end of the
RCA probe is
substantially complementary to a first target domain, and the second end of
the RCA probe is
substantially complementary to a second target domain, adjacent (either
directly or indirectly, as
outlined herein) to the first domain. Hybridization of the probe to the target
nucleic acid results in the
formation of a hybridization complex. Ligation of the "primers" (which are the
discrete ends of a single
oligonucleotide, the RCA probe) results in the formation of a modified
hybridization complex containing
a circular probe i.e. an RCA template complex. That is, the oligonucleotide is
circularized while still
hybridized with the target nucleic acid. This serves as a circular template
for RCA. Addition of a
primer, a polymerase and the required dNTPs to the RCA template complex
results in the formation
of an amplified product nucleic acid. Following RCA, the amplified product
nucleic acid is detected as
28
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
outlined herein. This can be accomplished in a variety of ways; for example,
the polymerase may
incorporate labelled nucleotides; a labeled primer may be used, or
alternatively, a label probe is used
that is substantially complementary to a portion of the RCA probe and
comprises at least one label is
used.
Accordingly, the present invention provides RCA probes (sometimes referred to
herein as "rolling
circle probes (RCPs) or "padlock probes" (PPs)). The RCPs may comprise any
number of elements,
including a first and second ligation sequence, a cleavage site, a priming
site, a capture sequence,
nucleotide analogs, and a label sequence.
In a preferred embodiment, the RCP comprises first and second ligation
sequences. As outlined
above for OLA, the ligation sequences are substantially complementary to
adjacent domains of the
target sequence. The domains may be directly adjacent (i.e. with no
intervening bases between the 3'
end of the first and the 5' of the second) or indirectly adjacent, with from 1
to 100 or more bases in
between.
In a preferred embodiment, the RCPs comprise a cleavage site, such that either
after or during the
rolling circle amplification, the RCP concatamer may be cleaved into
amplicons. In some
embodiments, this facilitates the detection, since the amplicons are generally
smaller and exhibit
favorable hybridization kinetics on the surface. As will be appreciated by
those in the art, the cleavage
site can take on a number of forms, including, but not limited to, the use of
restriction sites in the
probe, the use of ribozyme sequences, or through the use or incorporation of
nucleic acid cleavage
moieties.
In a preferred embodiment, the padlock probe contains a restriction site. The
restriction endonuclease
site allows for cleavage of the long concatamers that are typically the result
of RCA into smaller
individual units that hybridize either more efficiently or faster to surface
bound capture probes. Thus,
following RCA (or in some cases, during the reaction), the product nucleic
acid is contacted with the
appropriate restriction endonuclease. This results in cleavage of the product
nucleic acid into smaller
fragments. The fragments are then hybridized with the capture probe that is
immobilized resulting in a
concentration of product fragments onto the detection electrode. Again, as
outlined herein, these
fragments can be detected in one of two ways: either labelled nucleotides are
incorporated during the
replication step, for example either as labeled individual dNTPs or through
the use of a labeled primer,
or an additional label probe is added.
In a preferred embodiment, the restriction site is a single-stranded
restriction site chosen such that its
complement occurs only once in the RCP.
29
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, the cleavage site is a ribozyme cleavage site as is
generally described in
Daubendiek et al., Nature Biotech. 15:273 (1997), hereby expressly
incorporated by reference. In this
embodiment, by using RCPs that encode catalytic RNAs, NTPs and an RNA
polymerase, the resulting
concatamer can self cleave, ultimately forming monomeric amplicons.
In a preferred embodiment, the cleavage site comprises one or more labile
bases such as UTP or
dUTP, and cleavage is effected either chemically (e.g. using basic conditions)
or enzymatically. For
example, uracil-N-glycosylase cleaves at uracil groups; similarly, RNAse H
cleaves ribose-containing
bases in RNA/DNA hybrids.
In a preferred embodiment, cleavage is accomplished using DNA cleavage
reagents. For example, as
is known in the art, there are a number of intercalating moieties that can
effect cleavage, for example
using light.
In a preferred embodiment, the RCPs do not comprise a cleavage site. Instead,
the size of the RCP is
designed such that it may hybridize "smoothly" to many capture probes on a
surface. Alternatively, the
reaction may be cycled such that very long concatamers are not formed.
In a preferred embodiment, the RCPs comprise a priming site, to allow the
binding of a DNA
polymerase primer. As is known in the art, many DNA polymerases require double
stranded nucleic
acid and a free terminus to allow nucleic acid synthesis. However, in some
cases, for example when
RNA polymerases are used, a primer may not be required (see Daubendiek,
supra). Similarly,
depending on the size and orientation of the target strand, it is possible
that a free end of the target
sequence can serve as the primer; see Baner et al., supra.
Thus, in a preferred embodiment, the padlock probe also contains a priming
site for priming the RCA
reaction. That is, each padlock probe comprises a sequence to which a primer
nucleic acid hybridizes
forming a template for the polymerase. The primer can be found in any portion
of the circular probe.
In a preferred embodiment, the primer is located at a discrete site in the
probe. In this embodiment,
the primer site in each distinct padlock probe is identical, although this is
not required. Advantages of
using primer sites with identical sequences include the ability to use only a
single primer
oligonucleotide to prime the RCA assay with a plurality of different
hybridization complexes. That is,
the padlock probe hybridizes uniquely to the target nucleic acid to which it
is designed. A single primer
hybridizes to all of the unique hybridization complexes forming a priming site
for the polymerase. RCA
then proceeds from an identical locus within each unique padlock probe of the
hybridization
complexes.
In an alternative embodiment, the primer site can overlap, encompass, or
reside within any of the
above-described elements of the padlock probe. That is, the primer can be
found, for example,
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
overlapping or within the restriction site or the identifier sequence. In this
embodiment, it is necessary
that the primer nucleic acid is designed to base pair with the chosen primer
site.
In a preferred embodiment, a primer is used that hybridizes both to a portion
of the target sequence
and to a priming site on the RCP. This may be done to increase the specificity
of the system, and
allows the use of higher hybridization temperatures.
In a preferred embodiment, the primer may comprise the covalently attached
ETMs.
In a preferred embodiment, the RCPs comprise a capture sequence. A capture
sequence, as is
outlined herein, is substantially complementary to a capture probe, as
outlined herein.
In a preferred embodiment, the RCPs comprise a label sequence; i.e. a sequence
that can be used to
bind label probes and is substantially complementary to a label probe. In one
embodiment, it is
possible to use the same label sequence and label probe for all padlock probes
on an array;
alternatively, each padlock probe can have a different label sequence.
In a preferred embodiment, the RCPs comprise nucleotide analogs. For example,
since it may be
desirable to incorporate ETMs at specific locations within the amplicon (for
example, at a cluster of 8-
10 ETMs in a 20-30 basepair stretch, to allow optimal signaling and
configuration of the detection
hybridization complex), unique bases may be incorporated into the RCP. As is
known in the art,
isocytosine is a nucleoside analog that will only basepair with isoguanine, as
is generally described in
U.S. Patent No. 5,681,702, hereby incorporated by reference in its entirety.
By utilizing either isoC or
isoG in the RCP, deoxy-isoC or deoxy-isoG labeled with an ETM can be added to
the pool of
nucleotides, resulting in the incorporation of ETMs at predetermined, specific
locations.
In a preferred embodiment, the RCP/primer sets are designed to allow an
additional level of
amplification, sometimes referred to as "hyperbranching" or "cascade
amplification". As described in
Zhang et al., supra, by using several priming sequences and primers, a first
concatamer can serve as
the template for additional concatamers. In this embodiment, a polymerase that
has high
displacement activity is preferably used. In this embodiment, a first
antisense primer is used, followed
by the use of sense primers, to generate large numbers of concatamers and
amplicons, when
cleavage is used.
Thus, the invention provides for methods of detecting using RCPs as described
herein. Once the
ligation sequences of the RCP have hybridized to the target, forming a first
hybridization complex, the
ends of the RCP are ligated together as outlined above for OLA. The RCP primer
is added, if
necessary, along with a polymerase and dNTPs (or NTPs, if necessary).
31
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The polymerase can be any polymerase as outlined herein, but is preferably one
lacking 3'
exonuclease activity (3' exo ). Examples of suitable polymerase include but
are not limited to
exonuclease minus DNA Polymerase I large (Klenow) Fragment, Phi29 DNA
polymerase, Taq DNA
Polymerase and the like. In addition, in some embodiments, a polymerase that
will replicate single-
stranded DNA (i.e. without a primer forming a double stranded section) can be
used.
Thus, in a preferred embodiment the OLA/RCA is performed in solution followed
by restriction
endonuclease cleavage of the RCA product. The cleaved product is then applied
to an array as
described herein. The incorporation of an endonuclease site allows the
generation of short, easily
hybridizable sequences. Furthermore, the unique capture sequence in each
rolling circle padlock
probe sequence allows diverse sets of nucleic acid sequences to be analyzed in
parallel on an array,
since each sequence is resolved on the basis of hybridization specificity.
Again, these copies are subsequently detected by one of two methods; either
hybridizing a label probe
comprising ETMs which is complementary to the circular target or via the
incorporation of ETM-
labeled nucleotides in the amplification reaction. The label is detected a
described herein.
In a preferred embodiment, the polymerase creates more than 100 copies of the
circular DNA. In
more preferred embodiments the polymerase creates more than 1000 copies of the
circular DNA;
while in a most preferred embodiment the polymerase creates more than 10,000
copies or more than
50,000 copies of the template.
The amplified circular DNA sequence is then detected by methods known in the
art and as described
herein. Detection is accomplished by hybridizing with a labeled probe. The
probe is labeled directly or
indirectly. Alternatively, labeled nucleotides are incorporated into the
amplified circular DNA product.
The nucleotides can be labeled directly, or indirectly as is further described
herein.
The RCA as described herein finds use in allowing highly specific and highly
sensitive detection of
nucleic acid target sequences. In particular, the method finds use in
improving the multiplexing ability
of DNA arrays and eliminating costly sample or target preparation. As an
example, a substantial
savings in cost can be realized by directly analyzing genomic DNA on an array,
rather than employing
an intermediate PCR amplification step. The method finds use in examining
genomic DNA and other
samples including mRNA.
In addition the RCA finds use in allowing rolling circle amplification
products to be easily detected by
hybridization to probes in a solid-phase format. An additional advantage of
the RCA is that it provides "
the capability of multiplex analysis so that large numbers of sequences can be
analyzed in parallel. By
combining the sensitivity of RCA and parallel detection on arrays, many
sequences can be analyzed
directly from genomic DNA.
32
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, the signal amplification technique is CPT. CPT
technology is described in
a number of patents and patent applications, including U.S. Patent Nos.
5,011,769, 5,403,711,
5,660,988, and 4,876,187, and PCT published applications WO 95/05480, WO
95/1416, and WO
95/00667, and U.S.S.N. 09/014,304, all of which are expressly incorporated by
reference in their
entirety.
Generally, CPT may be described as follows. A CPT primer (also sometimes
referred to herein as a
"scissile primer"), comprises two probe sequences separated by a scissile
linkage. The CPT primer is
substantially complementary to the target sequence and thus will hybridize to
it to form a hybridization
complex. The scissile linkage is cleaved, without cleaving the target
sequence, resulting in the two
probe sequences being separated. The two probe sequences can thus be more
easily disassociated
from the target, and the reaction can be repeated any number of times. The
cleaved primer is then
detected as outlined herein.
By "scissile linkage" herein is meant a linkage within the scissile probe that
can be cleaved when the
probe is part of a hybridization complex, that is, when a double-stranded
complex is formed. It is
important that the scissile linkage cleave only the scissile probe and not the
sequence to which it is
hybridized (i.e. either the target sequence or a probe sequence), such that
the target sequence may
be reused in the reaction for amplification of the signal. As used herein, the
scissile linkage, is any
connecting chemical structure which joins two probe sequences and which is
capable of being
selectively cleaved without cleavage of either the probe sequences or the
sequence to which the
scissile probe is hybridized. The scissile linkage may be a single bond, or a
multiple unit sequence.
As will be appreciated by those in the art, a number of possible scissile
linkages may be used.
In a preferred embodiment, the scissile linkage comprises RNA. This system,
previously described in
as outlined above, is based on the fact that certain double-stranded
nucleases, particularly
ribonucleases, will nick or excise RNA nucleosides from a RNA:DNA
hybridization complex. Of
particular use in this embodiment is RNAseH, Exo III, and reverse
transcriptase.
In one embodiment, the entire scissile probe is made of RNA, the nicking is
facilitated especially when
carried out with a double-stranded ribonuclease, such as RNAseH or Exo III.
RNA probes made
entirely of RNA sequences are particularly useful because first, they can be
more easily produced
enzymatically, and second, they have more cleavage sites which are accessible
to nicking or cleaving
by a nicking agent, such as the ribonucleases. Thus, scissile probes made
entirely of RNA do not rely
on a scissile linkage since the scissile linkage is inherent in the probe.
In a preferred embodiment, when the scissile linkage is a nucleic acid such as
RNA, the methods of
the invention may be used to detect mismatches, as is generally described in
U.S. Patent Nos.
33
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
5,660,988, and WO 95/14106, hereby expressly incorporated by reference. These
mismatch
detection methods are based on the fact that RNAseH may not bind to and/or
cleave an RNA:DNA
duplex if there are mismatches present in the sequence. Thus, in the NA,-R-NAZ
embodiments, NA,
and NAz are non-RNA nucleic acids, preferably DNA. Preferably, the mismatch is
within the RNA:DNA
duplex, but in some embodiments the mismatch is present in an adjacent
sequence very close to the
desired sequence, close enough to affect the RNAseH (generally within one or
two bases). Thus, in
this embodiment, the nucleic acid scissile linkage is designed such that the
sequence of the scissile
linkage reflects the particular sequence to be detected, i.e. the area of the
putative mismatch.
In some embodiments of mismatch detection, the rate of generation of the
released fragments is such
that the methods provide, essentially, a yes/no result, whereby the detection
of the virtually any
released fragment indicates the presence of the desired target sequence.
Typically, however, when
there is only a minimal mismatch (for example, a 1-, 2- or 3-base mismatch, or
a 3-base detection),
there is some generation of cleaved sequences even though the target sequence
is not present.
Thus, the rate of generation of cleaved fragments, and/or the final amount of
cleaved fragments, is
quantified to indicate the presence or absence of the target. In addition, the
use of secondary and
tertiary scissile probes may be particularly useful in this embodiment, as
this can amplify the
differences between a perfect match and a mismatch. These methods may be
particularly useful in
the determination of homozygotic or heterozygotic states of a patient.
In this embodiment, it is an important feature of the scissile linkage that
its length is determined by the
suspected difference between the target and the probe. In particular, this
means that the scissile
linkage must be of sufficient length to encompass the suspected difference,
yet short enough the
scissile linkage cannot inappropriately "specifically hybridize" to the
selected nucleic acid molecule
when the suspected difference is present; such inappropriate hybridization
would permit excision and
thus cleavage of scissile linkages even though the selected nucleic acid
molecule was not fully
complementary to the nucleic acid probe. Thus in a preferred embodiment, the
scissile linkage is
between 3 to 5 nucleotides in length, such that a suspected nucleotide
difference from 1 nucleotide to
3 nucleotides is encompassed by the scissile linkage, and 0, 1 or 2
nucleotides are on either side of
the difference.
Thus, when the scissile linkage is nucleic acid, preferred embodiments utilize
from 1 to about 100
nucleotides, with from about 2 to about 20 being preferred and from about 5 to
about 10 being
particularly preferred.
CPT may be done enzymatically or chemically. That is, in addition to RNAseH,
there are several other
cleaving agents which may be useful in cleaving RNA (or other nucleic acid)
scissile bonds. For
example, several chemical nucleases have been reported; see for example Sigman
et al., Annu. Rev.
Biochem. 1990, 59, 207-236; Sigman et al., Chem. Rev. 1993, 93, 2295-2316;
Bashkin et al., J. Org.
34
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Chem. 1990, 55, 5125-5132; and Sigman et al., Nucleic Acids and Molecular
Biology, vol. 3, F.
Eckstein and D.M.J. Lilley (Eds), Springer-Verlag, Heidelberg 1989, pp. 13-27;
all of which are hereby
expressly incorporated by reference.
Specific RNA hydrolysis is also an active area; see for example Chin, Acc.
Chem. Res. 1991, 24, 145-
152; Breslow et al., Tetrahedron, 1991, 47, 2365-2376; Anslyn et al., Angew.
Chem. Int. Ed. Engl.,
1997, 36, 432-450; and references therein, all of which are expressly
incorporated by reference.
Reactive phosphate centers are also of interest in developing scissile
linkages, see Hendry et al.,
Prog. Inorg. Chem. : Bioinorganic Chem. 1990, 31, 201-258 also expressly
incorporated by reference.
Current approaches to site-directed RNA hydrolysis include the conjugation of
a reactive moiety
capable of cleaving phosphodiester bonds to a recognition element capable of
sequence-specifically
hybridizing to RNA. In most cases, a metal complex is covalently attached to a
DNA strand which
forms a stable heteroduplex. Upon hybridization, a Lewis acid is placed in
close proximity to the RNA
backbone to effect hydrolysis; see Magda et al., J. Am. Chem. Soc. 1994, 116,
7439; Hall et al.,
Chem. Biology 1994, 1, 185-190; Bashkin et al., J. Am. Chem. Soc. 1994, 116,
5981-5982; Hall et al.,
Nucleic Acids Res. 1996, 24, 3522; Magda et al., J. Am. Chem. Soc. 1997, 119,
2293; and Magda et
al., J. Am. Chem. Soc. 1997, 119, 6947, all of which are expressly
incorporated by reference.
In a similar fashion, DNA-polyamine conjugates have been demonstrated to
induce site-directed RNA
strand scission; see for example, Yoshinari et al., J. Am. Chem. Soc. 1991,
113, 5899-5901; Endo et
al., J. Org. Chem. 1997, 62, 846; and Barbier et al., J. Am. Chem. Soc. 1992,
114, 3511-3515, all of
which are expressly incorporated by reference.
In a preferred embodiment, the scissile linkage is not necessarily RNA. For
example, chemical
cleavage moieties may be used to cleave basic sites in nucleic acids; see
Belmont, et aL,New J.
Chem. 1997, 21, 47-54; and references therein, all of which are expressly
incorporated herein by
reference. Similarly, photocleavable moieties, for example, using transition
metals, may be used; see
Moucheron, et al., Inorg. Chem. 1997, 36, 584-592, hereby expressly by
reference.
Other approaches rely on chemical moieties or enzymes; see for example Keck et
al., Biochemistry
1995, 34, 12029-12037; Kirk et al., Chem. Commun. 1998, in press; cleavage of
G-U basepairs by
metal complexes; see Biochemistry, 1992, 31, 5423-5429; diamine complexes for
cleavage of RNA;
Komiyama, et al., J. Org. Chem. 1997, 62, 2155-2160; and Chow et al., Chem.
Rev. 1997, 97, 1489-
1513, and references therein, all of which are expressly incorporated herein
by reference.
The first step of the CPT method requires hybridizing a primary scissile
primer (also called a primary
scissile probe) obe to the target. This is preferably done at a temperature
that allows both the binding
of the longer primary probe and disassociation of the shorter cleaved portions
of the primary probe, as
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
will be appreciated by those in the art. As outlined herein, this may be done
in solution, or either the
target or one or more of the scissile probes may be attached to a solid
support. For example, it is
possible to utilize "anchor probes" on a solid support or the electrode which
are substantially
complementary to a portion of the target sequence, preferably a sequence that
is not the same
sequence to which a scissile probe will bind.
Similarly, as outlined herein, a preferred embodiment has one or more of the
scissile probes attached
to a solid support such as a bead. In this embodiment, the soluble target
diffuses to allow the
formation of the hybridization complex between the soluble target sequence and
the support-bound
scissile probe. In this embodiment, it may be desirable to include additional
scissile linkages in the
scissile probes to allow the release of two or more probe sequences, such that
more than one probe
sequence per scissile probe may be detected, as is outlined below, in the
interests of maximizing the
signal. Such embodiments are generally depicted in Figures 34 and 35.
In this embodiment (and in other amplification techniques herein), preferred
methods utilize cutting or
shearing techniques to cut the nucleic acid sample containing the target
sequence into a size that will
allow sufficient diffusion of the target sequence to the surface of a bead.
This may be accomplished
by shearing the nucleic acid through mechanical forces (e.g. sonication) or by
cleaving the nucleic acid
using restriction endonucleases. Alternatively, a fragment containing the
target may be generated
using polymerase, primers and the sample as a template, as in polymerase chain
reaction (PCR). In
addition, amplification of the target using PCR or t_CR or related methods may
also be done; this may
be particularly useful when the target sequence is present in the sample at
extremely low copy
numbers. Similarly, numerous techniques are known in the art to increase the
rate of mixing and
hybridization including agitation, heating, techniques that increase the
overall concentration such as
precipitation, drying, dialysis, centrifugation, electrophoresis, magnetic
bead concentration, etc.
In general, the scissile probes are introduced in a molar excess to their
targets (including both the
target sequence or other scissile probes, for example when secondary or
tertiary scissile probes are
used), with ratios of scissile probeaarget of at least about 100:1 being
preferred, at least about 1000:1
being particularly preferred, and at least about 10,000:1 being especially
preferred. In some
embodiments the excess of probeaarget will be much greater. In addition,
ratios such as these may
be used for all the amplification techniques outlined herein.
Once the hybridization complex between the primary scissile probe and the
target has been formed,
the complex is subjected to cleavage conditions. As will be appreciated, this
depends on the
composition of the scissile probe; if it is RNA, RNAseH is introduced. It
should be noted that under
certain circumstances, such as is generally outlined in WO 95/00666 and WO
95/00667, hereby
incorporated by reference, the use of a double-stranded binding agent such as
RNAseH may allow the
reaction to proceed even at temperatures above the Tm of the primary
probeaarget hybridization
36
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
complex. Accordingly, the addition of scissile probe to the target can be done
either first, and then the
cleavage agent or cleavage conditions introduced, or the probes may be added
in the presence of the
cleavage agent or conditions.
The cleavage conditions result in the separation of the two (or more) probe
sequences of the primary
scissile probe. As a result, the shorter probe sequences will no longer remain
hybridized to the target
sequence, and thus the hybridization complex will disassociate, leaving the
target sequence intact.
The optimal temperature for carrying out the CPT reactions is generally from
about 5°C to about 25°C
below the melting temperatures of the probeaarget hybridization complex. This
provides for a rapid
rate of hybridization and high degree of specificity for the target sequence.
The Tm of any particular
hybridization complex depends on salt concentration, G-C content, and length
of the complex, as is
known in the art.
During the reaction, as for the other amplification techniques herein, it may
be necessary to suppress
cleavage of the probe, as well as the target sequence, by nonspecific
nucleases. Such nucleases are
generally removed from the sample during the isolation of the DNA by heating
or extraction
procedures. A number of inhibitors of single-stranded nucleases such as
vanadate, inhibitors it-ACE
and RNAsin, a placental protein, do not affect the activity of RNAseH. This
may not be necessary
depending on the purity of the RNAseH and/or the target sample.
These steps are repeated by allowing the reaction to proceed for a period of
time. The reaction is
usually carried out for about 15 minutes to about 1 hour. Generally, each
molecule of the target
sequence will turnover between 100 and 1000 times in this period, depending on
the length and
sequence of the probe, the specific reaction conditions, and the cleavage
method. For example, for
each copy of the target sequence present in the test sample 100 to 1000
molecules will be cleaved by
RNAseH. Higher levels of amplification can be obtained by allowing the
reaction to proceed longer, or
using secondary, tertiary, or quaternary probes, as is outlined herein.
Upon completion of the reaction, generally determined by time or amount of
cleavage, the uncleaved
scissile probes must be removed or neutralized prior to detection, such that
the uncleaved probe does
not bind to a detection probe, causing false positive signals. This may be
done in a variety of ways, as
is generally described below.
In a preferred embodiment, the separation is facilitated by the use of beads
containing the primary
probe. Thus, when the scissile probes are attached to beads, removal of the
beads by filtration,
centrifugation, the application of a magnetic field, electrostatic
interactions for charged beads,
adhesion, etc., results in the removal of the uncleaved probes.
37
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, the separation is based on gel electrophoresis of
the reaction products to
separate the longer uncleaved probe from the shorter cleaved probe sequences
as is known in the art.
In a preferred embodiment, the separation is based on strong acid
precipitation. This is useful to
separate long (generally greater than 50 nucleotides) from smaller fragments
(generally about 10
nucleotides). The introduction of a strong acid such as trichloroacetic acid
into the solution causes the
longer probe to precipitate, while the smaller cleaved fragments remain in
solution. The solution can
be centrifuged or filtered to remove the precipitate, and the cleaved probe
sequences can be
quantitated.
In a preferred embodiment, the scissile probe contains both an ETM and an
affinity binding ligand or
moiety, such that an affinity support is used to carry out the separation. In
this embodiment, it is
important that the ETM used for detection is not on the same probe sequence
that contains the affinity
moiety, such that removal of the uncleaved probe, and the cleaved probe
containing the affinity
moiety, does not remove all the detectable ETMs. Alternatively, the scissile
probe may not contain a
covalently attached ETM, but just an affinity label. Suitable affinity
moieties include, but are not limited
to, biotin, avidin, streptavidin, lectins, haptens, antibodies, etc. The
binding partner of the affinity
moiety is attached to a solid support such as glass beads, latex beads,
dextrans, etc. and used to pull
out the uncleaved probes, as is known in the art. The cleaved probe sequences,
which do not contain
the affinity moiety, remain in solution and then can be detected as outlined
below.
In a preferred embodiment, similar to the above embodiment, a separation
sequence of nucleic acid is
included in the scissile probe, which is not cleaved during the reaction. A
nucleic acid complementary
to the separation sequence is attached to a solid support such as a bead and
serves as a catcher
sequence. Preferably, the separation sequence is added to the scissile probes,
and is not recognized
by the target sequence, such that a generalized catcher sequence may be
utilized in a variety of
assays.
In a preferred embodiment, the uncleaved probe is neutralized by the addition
of a substantially
complementary neutralization nucleic acid, as is generally depicted in Figure
32. This is particularly
useful in embodiments utilizing capture sequences, separation sequences, and
one-step systems, as
the complement to a probe containing capture sequences forms hybridization
complexes that are
more stable due to its length than the cleaved probe sequence:detection probe
complex. As will be
appreciated by those in the art, complete removal of the uncleaved probe is
not required, since
detection is based on electron transfer through nucleic acid; rather, what is
important is that the
uncleaved probe is not available for binding to a detection electrode probe
specific for cleaved
sequences. Thus, in one embodiment, the neutralization nucleic acid is a
detection probe on the
surface of the electrode, at a separate "address", such that the signal from
the neutralization
hybridization complex does not contribute to the signal of the cleaved
fragments. Alternatively, the
38
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
neutralization nucleic acid may be attached to a bead; the neutralization
beads are added to quench
the reaction, and then removed prior to detection.
After removal or neutralization of the uncleaved probe, detection proceeds via
the addition of the
cleaved probe sequences to the detection compositions, as outlined below,
which can utilize either
"mechanism-1" or "mechanism-2" systems. A mechanism-1 system can be described
as follows; the
cleaved probe sequences hybridize to a first detection single-stranded probe
covalently attached via a
conductive oligomer to an electrode, that thus forms a second hybridization
complex. The second
hybridization complex, comprising detection probe:probe sequence, contains at
least a first ETM. As
outlined herein, this ETM may be covalently attached to either the probe
(primer) sequence or the
detection probe, or it may be added non-covalently as a hybridization
indicator, or both. As outlined
above, preferred embodiments utilize more than one ETM per hybridization
complex for detection.
In a preferred embodiment, no higher order probes are used, and detection is
based on the probe
sequences) of the primary primer. Thus, in a preferred embodiment, the
electrode comprises at least
a first detection probe which is substantially complementary to all or part of
a cleaved portion of the
primary scissile probe. In one embodiment, only one type of detection probe is
utilized, which can be
substantially complementary to all or part of any probe sequence of the
primary probe. In a preferred
embodiment, more than one type of detection probe is utilized, with each
detection probe being
substantially complementary to all or part of each probe sequence of the
primary probe. Thus, when
the primary probe comprises two probe sequences, two detection probes are
used; three probe
sequences utilizes three detection probes. This may require the use of
additional scissile linkages
when the probes are bound to beads, as is described herein. The,detection
probes and the primary
probe sequences then form hybridization complexes, which either contain
covalently bound ETMs or
ETMs in the form of hybridization indicators are added to the system (or
both), which are then
detected as is outlined herein. In a preferred embodiment, when hybridization
indicators are used,
they are only added to the system after the reaction is complete, to avoid the
association of
hybridization indicators to the probeaarget complexes, although in some
embodiments it may be
possible to have the hybridization indicators present during the reaction.
In a preferred embodiment, the detection probes are mixed on the surface of
the electrode, such that
the signal from each is combined. This may be particularly preferred when the
target sequence is
present in low copy number. Alternatively, the detection probes may each be at
a different "address"
on the surface. While this reduces the possible signal from the system, it
serves as an internal control
in that the signal from each should be equal, all other parameters being
equal. In addition, different
addresses can have different densities of probes creating addresses with
various sensitivities to target
sequences. Systems utilizing two detection probes, each to a probe sequence of
the primary probe,
that is bound to a bead, are generally depicted in Figure 30, utilizing bound
ETMs.
39
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, at least one, and preferably more, secondary probes
(also referred to
herein as secondary primers) are used. The secondary scissile probes may be
added to the reaction
in several ways. It is important that the secondary scissile probes be
prevented from hybridizing to the
uncleaved primary probes, as this results in the generation of false positive
signal. These methods
may be described in several ways, depending on whether bead-bound probes are
used.
In a preferred embodiment, the primary and secondary probes are bound to solid
supports. In a
preferred embodiment, the primary and secondary probes are added together,
since generally the
support-bound secondary probes will be unable to bind to the uncleaved primary
probes on the
surface of a bead. It is only upon hybridization of the primary probes with
the target, resulting in
cleavage and release of primary probe sequences from the bead, that the now
diffusible primary probe
sequences may bind to the secondary probes. In turn, the primary probe
sequences serve as targets
for the secondary scissile probes, resulting in cleavage and release of
secondary probe sequences.
In an alternate embodiment, the beads containing the primary probes are added,
the reaction is
allowed to proceed for some period of time, and then the beads containing the
secondary probes are
added, either with removal of the primary beads or not. Alternatively, the
beads containing the primary
probes are removed and soluble secondary scissile probes are added.
In an alternate embodiment, the complete reaction is done in solution. In this
embodiment, the
primary probes are added, the reaction is allowed to proceed for some period
of time, and the
uncleaved primary scissile probes are removed, as outlined above. The
secondary probes are then
added, and the reaction proceeds. The secondary uncleaved probes are then
removed, and the
cleaved sequences are detected as is generally outlined herein.
As above, it is generally preferred to detect as many secondary probe
sequences as possible, and the
primary probe sequences may be additionally detected as well. Thus, preferred
embodiments utilize
detection probes that are substantially complementary to all or part of each
probe sequence of a
scissile probe. Alternatively, only detection probes for "higher order" probe
sequences are used.
Furthermore, in some embodiments, detection probes for only one of the probe
sequences of any
scissile probe may be used. Furthermore, as outlined above, in these
embodiments, as for the
others, the detection probes may be separated by sequence, or mixed, depending
on the desired
results.
In a preferred embodiment, at least one, and preferably more, tertiary probes
are used. The tertiary
scissile probes may be added to the reaction in several ways. It is important
that the tertiary scissile
probes be prevented from hybridizing to the uncleaved secondary probes, as
this results in the
generation of false positive signal. These methods may be described in several
ways, depending on
whether bead-bound probes are used.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, the primary, secondary and tertiary probes are
bound to solid supports. In
a preferred embodiment, the primary, secondary and tertiary probes are added
together, since
generally the support-bound secondary probes will be unable to bind to the
uncleaved primary probes
on the surface of a bead and the support-bound tertiary probes will be unable
to bind to the uncleaved
secondary probes on the surface of a bead. It is only upon hybridization of
the scissile probe with its
target (i.e. either the target sequences of the sample for the primary probes,
or probe sequences for
each of the secondary and tertiary probes), that results in cleavage and
release of probe sequences
from the bead, that the now diffusable probe sequences may bind to the higher
order probes.
In alternate embodiments, combinations of beads and solution probes are used,
with any combination
being possible: primary probe beads, soluble secondary probes, tertiary beads;
soluble primary
probes, soluble secondary probes, tertiary beads; primary probe beads,
secondary probe beads,
soluble tertiary probes; etc. What is important is that if soluble probes are
used, they must be
removed prior to the addition of the next higher order probe.
In an alternate embodiment, the complete reaction is done in solution. In this
embodiment, the
primary probes are added, the reaction is allowed to proceed for some period
of time, and the
uncleaved primary scissile probes are removed, as outlined above. The
secondary probes are then
added, and the reaction proceeds. The secondary uncleaved probes are then
removed, and the
tertiary probes are added, and the reaction proceeds. The uncleaved tertiary
probes are then
removed and the cleaved sequences are detected as is generally outlined
herein.
As above, it is generally preferred to detect as many tertiary probe sequences
as possible, and the
secondary and primary probe sequences may be additionally detected as well.
Thus, preferred
embodiments utilize detection probes that are substantially complementary to
all or part of each probe
sequence of a scissile probe. Again, the detection sequences may be separated
on the electrode, or
mixed, to allow the greatest signal amplification.
In a preferred embodiment, at least one, and preferably more, quaternary
probes are used. This
proceeds as outlined above for tertiary probes.
Thus, CPT requires, again in no particular order, a first CPT primer
comprising a first probe sequence,
a scissile linkage and a second probe sequence; and a cleavage agent.
In this manner, CPT results in the generation of a large amount of cleaved
primers, which then can be
detected as outlined below.
41
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, InvaderT"~ technology is used. InvaderT""
technology is based on
structure-specific polymerases that cleave nucleic acids in a site-specific
manner. Two probes are
used: an "invader" probe and a "signalling" probe, that adjacently hybridize
to a target sequence with a
non-complementary overlap. The enzyme cleaves at the overlap due to its
recognition of the "tail",
and releases the "tail" . This can then be detected. The InvaderT"" technology
is described in U.S.
Patent Nos. 5,846,717; 5,614,402; 5,719,028; 5,541,311; and 5,843,669, all of
which are hereby
incorporated by reference.
Accordingly, the invention provides a first primer, sometimes referred to
herein as an "invader primer",
that hybridizes to a first domain of a target sequence, and a second primer,
sometimes referred to
herein as the signalling primer, that hybridizes to a second domain of the
target sequence. The first
and second target domains are adjacent. The signalling primer further
comprises an overlap
sequence, comprising at least one nucleotide, that is perfectly complementary
to at least one
nucleotide of the first target domain, and a non-complementary "tail" region.
The cleavage enzyme
recognizes the overlap structure and the noncomplementary tail, and cleaves
the tail from the second
primer. Suitable cleavage enzymes are described in the Patents outlined above,
and include, but are
not limited to, 5' thermostable nucleases from Thermus species, including
Thermus aquaticus,
Thermus flavus and Thermus thermophilus. The entire reaction is done
isothermally at a temperature
such that upon cleavage, the invader probe and the cleaved signalling probe
come off the target
stand, and new primers can bind. In this way large amounts of cleaved
signalling probe (i.e. "tails")
are made. The uncleaved signalling probes are removed (for example by binding
to a solid support
such as a bead, either on the basis of the sequence or through the use of a
binding ligand attached to
the portion of the signalling probe that hybridizes to the target). The
cleaved signalling probes are
then detected by forming an assay complex on an electrode comprising the
cleaved probe ("tail") as
the target, a capture probe and at least one ETM. The ETM may be covalently
attached to the tail, or
to a label probe which hybridizes either directly or indirectly (e.g. through
the use of an amplifier probe)
to the assay complex.
In a preferred embodiment, the signal amplification technique is a "sandwich"
assay, as is generally
described in U.S.S.N. 60/073,011 and in U.S. Patent Nos. 5,681,702, 5,597,909,
5,545,730,
5,594,117, 5,591,584, 5,571,670, 5,580,731, 5,571,670, 5,591,584, 5,624,802,
5,635,352, 5,594,118,
5,359,100, 5,124,246 and 5,681,697, all of which are hereby incorporated by
reference. Although
sandwich assays do not result in the alteration of primers, sandwich assays
can be considered signal
amplification techniques since multiple signals (i.e. label probes) are bound
to a single target, resulting
in the amplification of the signal. Sandwich assays are used when the target
sequence comprises
little or no ETM labels; that is, when a secondary probe, comprising the ETM
labels, is used to
generate the signal.
42
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
As discussed herein, it should be noted that the sandwich assays can be used
for the detection of
primary target sequences (e.g. from a patient sample), or as a method to
detect the product of an
amplification reaction as outlined above; thus for example, any of the newly
synthesized strands
outlined above, for example using PCR, LCR, NASBA, SDA, etc., may be used as
the "target
sequence" in a sandwich assay.
Generally, sandwich signal amplification techniques may be described as
follows. In preferred
embodiments, although it is not required, the target sequences are immobilized
on the electrode
surface. This is preferably done using capture probes and optionally one or
more capture extender
probes; see Figure 15. When only capture probes are utilized, it is necessary
to have unique capture
probes for each target sequence; that is, the surface must be customized to
contain unique capture
probes. Alternatively, capture extender probes may be used, that allow a
"universal" surface, i.e. a
surface containing a single type of capture probe that can be used to detect
any target sequence.
"Capture extender" probes are generally depicted in Figure 15, and other
figures, and have a first
portion that will hybridize to all or part of the capture probe, and a second
portion that will hybridize to a
first portion of the target sequence. This then allows the generation of
customized soluble probes,
which as will be appreciated by those in the art is generally simpler and less
costly. As shown herein,
two capture extender probes may be used. This has generally been done to
stabilize assay
complexes (for example when the target sequence is large, or when large
amplifier probes
(particularly branched or dendrimer amplifier probes) are used.
In a preferred embodiment, the nucleic acids are added after the formation of
the SAM, discussed
below. This may be done in a variety of ways, as will be appreciated by those
in the art. In one
embodiment, conductive oligomers with terminal functional groups are made,
with preferred
embodiments utilizing activated carboxylates and isothiocyanates, that will
react with primary amines
that are put onto the nucleic acid, as is generally depicted in Figure 6 using
an activated carboxylate.
These two reagents have the advantage of being stable in aqueous solution, yet
react with primary
alkylamines. However, the primary aromatic amines and secondary and tertiary
amines of the bases
should not react, thus allowing site specific addition of nucleic acids to the
surface. This allows the
spotting of probes (either capture or detection probes, or both) using known
methods (ink jet, spotting,
etc.) onto the surface.
In addition, there are a number of non-nucleic acid methods that can be used
to immobilize a nucleic
acid on a surface. For example, binding partner pairs can be utilized; i.e.
one binding partner is
attached to the terminus of an attachment linker, described below, and the
other to the end of the
nucleic acid. This may also be done without using a nucleic acid capture
probe; that is, one binding
partner serves as the capture probe and the other is attached to either the
target sequence or a
capture extender probe. That is, either the target sequence comprises the
binding partner, or a
capture extender probe that will hybridize to the target sequence comprises
the binding partner.
43
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Suitable binding partner pairs include, but are not limited to, hapten pairs
such as biotin/streptavidin;
antigens/antibodies; NTA/histidine tags; etc. In general, smaller binding
partners are preferred, such
that the electrons can pass from the nucleic acid into the conductive oligomer
to allow detection.
In a preferred embodiment, when the target sequence itself is modified to
contain a binding partner,
the binding partner is attached via a modified nucleotide that can be
enzymatically attached to the
target sequence, for example during a PCR target amplification step.
Alternatively, the binding partner
should be easily attached to the target sequence.
Alternatively, a capture extender probe may be utilized that has a nucleic
acid portion for hybridization
to the target as well as a binding partner (for example, the capture extender
probe may comprise a
non-nucleic acid portion such as an alkyl linker that is used to attach a
binding partner). In this
embodiment, it may be desirable to cross-link the double-stranded nucleic acid
of the target and
capture extender probe for stability, for example using psoralen as is known
in the art.
In one embodiment, the target is not bound to the electrode surface using
capture probes. In this
embodiment, what is important, as for all the assays herein, is that excess
label probes be removed
prior to detection and that the assay complex be in proximity to the surface.
As will be appreciated by
those in the art, this may be accomplished in other ways. For example, the
assay complex comprising
the ETMs may be present on beads that are added to the electrode comprising
the monolayer, and
then the beads brought into proximity of the electrode surface using
techniques well known in the art,
including gravity settling of the beads on the surface, electrostatic or
magnetic interactions between
bead components and the surface, using binding partner attachment as outlined
above. Alternatively,
after the removal of excess reagents such as excess label probes, the assay
complex may be driven
down to the surface, for example by pulsing the system with a voltage
sufficient to drive the assay
complex to the surface.
However, preferred embodiments utilize assay complexes attached via nucleic
acid capture probes.
Once the target sequence has preferably been anchored to the electrode, an
amplifier probe is
hybridized to the target sequence, either directly, or through the use of one
or more label extender
probes, which serves to allow "generic" amplifier probes to be made.
Preferably, the amplifier probe
contains a multiplicity of amplification sequences, although in some
embodiments, as described
below, the amplifier probe may contain only a single amplification sequence,
or at least two
amplification sequences. The amplifier probe may take on a number of different
forms; either a
branched conformation, a dendrimer conformation, or a linear "string" of
amplification sequences.
Label probes comprising ETMs then hybridize to the amplification sequences (or
in some cases the
label probes hybridize directly to the target sequence), and the ETMs are
detected using the electrode,
as is more fully outlined below.
44
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
As will be appreciated by those in the art, the systems of the invention may
take on a large number of
different configurations, as is generally depicted in Figures 15, 16, 27, etc.
In general, there are three
types of systems that can be used: (1 ) "non-sandwich" systems (also referred
to herein as "direct"
detection) in which the target sequence itself is labeled with ETMs (again,
either because the primers
comprise ETMs or due to the incorporation of ETMs into the newly synthesized
strand); (2) systems in
which label probes directly bind to the target analytes; and (3) systems in
which label probes are
indirectly bound to the target sequences, for example through the use of
amplifier probes.
Accordingly, the present invention provides compositions comprising an
amplifier probe. By "amplifier
probe" or "nucleic acid multimer" or "amplification multimer" or grammatical
equivalents herein is
meant a nucleic acid probe that is used to facilitate signal amplification.
Amplifier probes comprise at
least a first single-stranded nucleic acid probe sequence, as defined below,
and at least one single-
stranded nucleic acid amplification sequence, with a multiplicity of
amplification sequences being
preferred.
Amplifier probes comprise a first probe sequence that is used, either directly
or indirectly, to hybridize
to the target sequence. That is, the amplifier probe itself may have a first
probe sequence that is
substantially complementary to the target sequence, or it has a first probe
sequence that is
substantially complementary to a portion of an additional probe, in this case
called a label extender
probe, that has a first portion that is substantially complementary to the
target sequence. In a
preferred embodiment, the first probe sequence of the amplifier probe is
substantially complementary
to the target sequence.
In general, as for all the probes herein, the first probe sequence is of a
length sufficient to give
specificity and stability. Thus generally, the probe sequences of the
invention that are designed to
hybridize to another nucleic acid (i.e. probe sequences, amplification
sequences, portions or domains
of larger probes) are at least about 5 nucleosides long, with at least about
10 being preferred and at
least about 15 being especially preferred.
In a preferred embodiment, as is depicted in Figure 18, the amplifier probes,
or any of the other
probes of the invention, may form hairpin stem-loop structures in the absence
of their target. The
length of the stem double-stranded sequence will be selected such that the
hairpin structure is not
favored in the presence of target. The use of these type of probes, in the
systems of the invention or
in any nucleic acid detection systems, can result in a significant decrease in
non-specific binding and
thus an increase in the signal to noise ratio.
Generally, these hairpin structures comprise four components. The first
component is a target binding
sequence, i.e. a region complementary to the target (which may be the sample
target sequence or
another probe sequence to which binding is desired), that is about 10
nucleosides long, with about 15
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
being preferred. The second component is a loop sequence, that can facilitate
the formation of
nucleic acid loops. Particularly preferred in this regard are repeats of GTC,
which has been identified
in Fragile X Syndrome as forming turns. (When PNA analogs are used, turns
comprising proline
residues may be preferred). Generally, from three to five repeats are used,
with four to five being
preferred. The third component is a self-complementary region, which has a
first portion that is
complementary to a portion of the target sequence region and a second portion
that comprises a first
portion of the label probe binding sequence. The fourth component is
substantially complementary to
a label probe (or other probe, as the case may be). The fourth component
further comprises a "sticky
end", that is, a portion that does not hybridize to any other portion of the
probe, and preferably
contains most, if not all, of the ETMs. The general structure is depicted in
Figure 18. As will be
appreciated by those in the art, the any or all of the probes described herein
may be configured to
form hairpins in the absence of their targets, including the amplifier,
capture, capture extender, label
and label extender probes.
In a preferred embodiment, several different amplifier probes are used, each
with first probe
sequences that will hybridize to a different portion of the target sequence.
That is, there is more than
one level of amplification; the amplifier probe provides an amplification of
signal due to a multiplicity of
labelling events, and several different amplifier probes, each with this
multiplicity of labels, for each
target sequence is used. Thus, preferred embodiments utilize at least two
different pools of amplifier
probes, each pool having a different probe sequence for hybridization to
different portions of the target
sequence; the only real limitation on the number of different amplifier probes
will be the length of the
original target sequence. In addition, it is also possible that the different
amplifier probes contain
different amplification sequences, although this is generally not preferred.
In a preferred embodiment, the amplifier probe does not hybridize to the
sample target sequence
directly, but instead hybridizes to a first portion of a label extender probe.
This is particularly useful to
allow the use of "generic" amplifier probes, that is, amplifier probes that
can be used with a variety of
different targets. This may be desirable since several of the amplifier probes
require special synthesis
techniques. Thus, the addition of a relatively short probe as a label extender
probe is preferred.
Thus, the first probe sequence of the amplifier probe is substantially
complementary to a first portion
or domain of a first label extender single-stranded nucleic acid probe. The
label extender probe also
contains a second portion or domain that is substantially complementary to a
portion of the target
sequence. Both of these portions are preferably at least about 10 to about 50
nucleotides in length,
with a range of about 15 to about 30 being preferred. The terms "first" and
"second" are not meant to
confer an orientation of the sequences with respect to the 5'-3' orientation
of the target or probe
sequences. For example, assuming a 5'-3' orientation of the complementary
target sequence, the first
portion may be located either 5' to the second portion, or 3' to the second
portion. For convenience
herein, the order of probe sequences are generally shown from left to right.
46
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, more than one label extender probe-amplifier probe
pair may be used,
that is, n is more than 1. That is, a plurality of label extender probes may
be used, each with a portion
that is substantially complementary to a different portion of the target
sequence; this can serve as
another level of amplification. Thus, a preferred embodiment utilizes pools of
at least two label
extender probes, with the upper limit being set by the length of the target
sequence.
In a preferred embodiment, more than one label extender probe is used with a
single amplifier probe
to reduce non-specific binding, as is generally outlined in U.S. Patent No.
5,681,697, incorporated by
reference herein. In this embodiment, a first portion of the first label
extender probe hybridizes to a
first portion of the target sequence, and the second portion of the first
label extender probe hybridizes
to a first probe sequence of the amplifier probe. A first portion of the
second label extender probe
hybridizes to a second portion of the target sequence, and the second portion
of the second label
extender probe hybridizes to a second probe sequence of the amplifier probe.
These form structures
sometimes referred to as "cruciform" structures or configurations, and are
generally done to confer
stability when large branched or dendrimeric amplifier probes are used.
In addition, as will be appreciated by those in the art, the label extender
probes may interact with a
preamplifier probe, described below, rather than the amplifier probe directly.
Similarly, as outlined above, a preferred embodiment utilizes several
different amplifier probes, each
with first probe sequences that will hybridize to a different portion of the
label extender probe. In
addition, as outlined above, it is also possible that the different amplifier
probes contain different
amplification sequences, although this is generally not preferred.
In addition to the first probe sequence, the amplifier probe also comprises at
least one amplification
sequence. An "amplification sequence" or "amplification segment" or
grammatical equivalents herein
is meant a sequence that is used, either directly or indirectly, to bind to a
first portion of a label probe
as is more fully described below (although in some cases the amplification
sequence may bind to a
detection probe; see Figure 27C). Preferably, the amplifier probe comprises a
multiplicity of
amplification sequences, with from about 3 to about 1000 being preferred, from
about 10 to about 100
being particularly preferred, and about 50 being especially preferred. In some
cases, for example
when linear amplifier probes are used, from 1 to about 20 is preferred with
from about 5 to about 10
being particularly preferred.
The amplification sequences may be linked to each other in a variety of ways,
as will be appreciated
by those in the art. They may be covalently linked directly to each other, or
to intervening sequences
or chemical moieties, through nucleic acid linkages such as phosphodiester
bonds, PNA bonds, etc.,
or through interposed linking agents such amino acid, carbohydrate or polyol
bridges, or through other
cross-linking agents or binding partners. The sites) of linkage may be at the
ends of a segment,
47
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
and/or at one or more internal nucleotides in the strand. In a preferred
embodiment, the amplification
sequences are attached via nucleic acid linkages.
In a preferred embodiment, branched amplifier probes are used, as are
generally described in U.S.
Patent No. 5,124,246, hereby incorporated by reference. Branched amplifier
probes may take on
"fork-like" or "comb-like" conformations. "Fork-like" branched amplifier
probes generally have three or
more oligonucleotide segments emanating from a point of origin to form a
branched structure. The
point of origin may be another nucleotide segment or a multifunctional
molecule to whcih at least three
segments can be covalently or tightly bound. "Comb-like" branched amplifier
probes have a linear
backbone with a multiplicity of sidechain oligonucleotides extending from the
backbone. In either
conformation, the pendant segments will normally depend from a modified
nucleotide or other organic
moiety having the appropriate functional groups for attachment of
oligonucleotides. Furthermore, in
either conformation, a large number of amplification sequences are available
for binding, either directly
or indirectly, to detection probes. In general, these structures are made as
is known in the art, using
modified multifunctional nucleotides, as is described in U.S. Patent Nos.
5,635,352 and 5,124,246,
among others.
In a preferred embodiment, dendrimer amplifier probes are used, as are
generally described in U.S.
Patent No. 5,175,270, hereby expressly incorporated by reference. Dendrimeric
amplifier probes have
amplification sequences that are attached via hybridization, and thus have
portions of double-stranded
nucleic acid as a component of their structure. The outer surface of the
dendrimer amplifier probe has
a multiplicity of amplification sequences.
In a preferred embodiment, linear amplifier probes are used, that have
individual amplification
sequences linked end-to-end either directly or with short intervening
sequences to form a polymer. As
with the other amplifier configurations, there may be additional sequences or
moieties between the
amplification sequences. In addition, as outlined herein, linear amplification
probes may form hairpin
stem-loop structures, as is depicted in Figure 18.
In one embodiment, the linear amplifier probe has a single amplification
sequence. This may be
useful when cycles of hybridization/disassociation occurs, forming a pool of
amplifier probe that was
hybridized to the target and then removed to allow more probes to bind, or
when large numbers of
ETMs are used for each label probe. However, in a preferred embodiment, linear
amplifier probes
comprise a multiplicity of amplification sequences.
In addition, the amplifier probe may be totally linear, totally branched,
totally dendrimeric, or any
combination thereof.
48
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The amplification sequences of the amplifier probe are used, either directly
or indirectly, to bind to a
label probe to allow detection. In a preferred embodiment, the amplification
sequences of the
amplifier probe are substantially complementary to a first portion of a label
probe. Alternatively,
amplifier extender probes are used, that have a first portion that binds to
the amplification sequence
and a second portion that binds to the first portion of the label probe.
In addition, the compositions of the invention may include "preamplifier"
molecules, which serves a
bridging moiety between the label extender molecules and the amplifier probes.
In this way, more
amplifier and thus more ETMs are ultimately bound to the detection probes.
Preamplifier molecules
may be either linear or branched, and typically contain in the range of about
30-3000 nucleotides.
Thus, label probes are either substantially complementary to an amplification
sequence or to a portion
of the target sequence. Accordingly, the label probes can be configured in a
variety of ways, as is
generally described herein, depending on whether a "mechanism-1" or "mechanism-
2" detection
system is utilized, as described below.
Detection of the amplification reactions of the invention, including the
direct detection of amplification
products and indirect detection utilizing label probes (i.e. sandwich assays),
is done by detecting assay
complexes comprising ETMs, which can be attached to the assay complex in a
variety of ways, as is
more fully described below. In general, there are two basic detection
mechanisms. In a preferred
embodiment, detection of an ETM is based on electron transfer through the
stacked rr-orbitals of
double stranded nucleic acid. This basic mechanism is described in U.S. Patent
Nos. 5,591,578,
5,770,369, 5,705,348, 5,824,473 and 5,780,234 and W098/20162, all of which are
expressly
incorporated by reference, and is termed "mechanism-1" herein. Briefly,
previous work has shown that
electron transfer can proceed rapidly through the stacked rr-orbitals of
double stranded nucleic acid,
and significantly more slowly through single-stranded nucleic acid.
Accordingly, this can serve as the
basis of an assay. Thus, by adding ETMs (either covalently to one of the
strands or non-covalently to
the hybridization complex through the use of hybridization indicators,
described below) to a nucleic
acid that is attached to a detection electrode via a conductive oligomer,
electron transfer between the
ETM and the electrode, through the nucleic acid and conductive oligomer, may
be detected. This
general idea is depicted in Figure 27.
Alternatively, the ETM can be detected, not necessarily via electron transfer
through nucleic acid, but
rather can be directly detected on the surface of the electrode. As above, in
this embodiment, the
detection electrode preferably comprises a self-assembled monolayer (SAM) that
serves to shield the
electrode from redox-active species in the sample. In this embodiment, the
presence of ETMs on the
surface of a SAM, that has been formulated to comprise slight "defects"
(sometimes referred to herein
as "microconduits", "nanoconduits" or "electroconduits") can be directly
detected. This basic idea is
termed "mechanism-2" herein. Essentially, the electroconduits allow particular
ETMs access to the
49
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
surface. Without being bound by theory, it should be noted that the
configuration of the electroconduit
depends in part on the ETM chosen. For example, the use of relatively
hydrophobic ETMs allows the
use of hydrophobic electroconduit forming species, which effectively exclude
hydrophilic or charged
ETMs. Similarly, the use of more hydrophilic or charged species in the SAM may
serve to exclude
hydrophobic ETMs.
It should be noted that these defects are to be distinguished from "holes"
that allow direct contact of
sample components with the detection electrode. As is more fully outlined
below, the electroconduits
can be generated in several general ways, including but not limited to the use
of rough electrode
surfaces, such as gold electrodes formulated on PC circuit boards; or the
inclusion of at least two
different species in the monolayer, i.e. using a "mixed monolayer", at least
one of which is a
electroconduit-forming species (EFS). Thus, upon binding of a target analyte,
a soluble binding ligand
comprising an ETM is brought to the surface, and detection of the ETM can
proceed, putatively
through the "electroconduits" to the electrode. Essentially, the role of the
SAM comprising the defects
is to allow contact of the ETM with the electronic surface of the electrode,
while still providing the
benefits of shielding the electrode from solution components and reducing the
amount of non-specific
binding to the electrodes. Viewed differently, the role of the binding ligand
is to provide specificity for a
recruitment of ETMs to the surface, where they can be directly detected.
Thus, the present invention is directed to the formation of assay complexes on
electrodes, generally
comprising SAMs. Once the assay complexes are formed, the presence or absence
of the ETMs are
detected as is described below and in U.S. Patent Nos. 5,591,578; 5,824,473;
5,770,369; 5,705,348
and 5,780,234; U.S.S.N.s 08/911,589; 09/135,183; 09/306,653; 09/134,058;
09/295,691; 09/238,351;
09/245,105 and 09/338,726; and PCT applications W098/20162; PCT US99/01705;
PCT
US99/01703; PCT US99/10104, all of which are expressly incorporated herein by
reference in their
entirety.
Thus, in either embodiment, an assay complex is formed that contains an ETM,
which is then detected
using the detection electrode. The invention thus provides assay complexes
that minimally comprise
a target sequence. "Assay complex" herein is meant the collection of
hybridization complexes
comprising nucleic acids, including probes and targets, that contains at least
one ETM and thus allows
detection. The composition of the assay complex depends on the use of the
different probe
components outlined herein. Thus, in Figures 16A and 16B, the assay complex
comprises the
capture probe and the target sequence. The assay complexes may also include
label probes, capture
extender probes, label extender probes, and amplifier probes, as outlined
herein, depending on the
configuration used.
The assay complexes comprise at least one ETM, which can either be covalently
attached to a
component of the assay complex as described herein or a "hybridization
indicator", described below.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The terms "electron donor moiety", "electron acceptor moiety", and "ETMs"
(ETMs) or grammatical
equivalents herein refers to molecules capable of electron transfer under
certain conditions. It is to be
understood that electron donor and acceptor capabilities are relative; that
is, a molecule which can
lose an electron under certain experimental conditions will be able to accept
an electron under
different experimental conditions. It is to be understood that the number of
possible electron donor
moieties and electron acceptor moieties is very large, and that one skilled in
the art of electron transfer
compounds will be able to utilize a number of compounds in the present
invention. Preferred ETMs
include, but are not limited to, transition metal complexes, organic ETMs, and
electrodes.
In a preferred embodiment, the ETMs are transition metal complexes. Transition
metals are those
whose atoms have a partial or complete d shell of.electrons. Suitable
transition metals for use in the
invention include, but are not limited to, cadmium (Cd), copper (Cu), cobalt
(Co), palladium (Pd), zinc
(Zn), iron (Fe), ruthenium (Ru), rhodium (Rh), osmium (Os), rhenium (Re),
platinium (Pt), scandium
(Sc), titanium (Ti), Vanadium (V), chromium (Cr), manganese (Mn), nickel (Ni),
Molybdenum (Mo),
technetium (Tc), tungsten (W), and iridium (1r). That is, the first series of
transition metals, the
platinum metals (Ru, Rh, Pd, Os, Ir and Pt), along with Fe, Re, W, Mo and Tc,
are preferred.
Particularly preferred are ruthenium, rhenium, osmium, platinium, cobalt and
iron.
The transition metals are complexed with a variety of ligands, to form
suitable transition metal
complexes, as is well known in the art. L are the co-ligands, that provide the
coordination atoms for
the binding of the metal ion. As will be appreciated by those in the art, the
number and nature of the
co-ligands will depend on the coordination number of the metal ion. Mono-, di-
or polydentate co-
ligands may be used at any position.
As will be appreciated in the art, the co-ligands can be the same or
different. Suitable ligands fall into
two categories: ligands which use nitrogen, oxygen, sulfur, carbon or
phosphorus atoms (depending
on the metal ion) as the coordination atoms (generally referred to in the
literature as sigma (~) donors)
. and organometallic ligands such as metallocene ligands (generally referred
to in the literature as pi (rr)
donors, and depicted herein as Lm). Suitable nitrogen donating ligands are
well known in the art and
include, but are not limited to, NHz; NHR; NRR'; pyridine; pyrazine;
isonicotinamide; imidazole;
bipyridine and substituted derivatives of bipyridine; terpyridine and
substituted derivatives;
phenanthrolines, particularly 1,10-phenanthroline (abbreviated phen) and
substituted derivatives of
phenanthrolines such as 4,7-dimethylphenanthroline and dipyridol[3,2-a:2',3'-
c]phenazine (abbreviated
dppz); dipyridophenazine; 1,4,5,8,9,12-hexaazatriphenylene (abbreviated hat);
9,10-
phenanthrenequinone diimine (abbreviated phi); 1,4,5,8-tetraazaphenanthrene
(abbreviated tap);
1,4,8,11-tetra-azacyclotetradecane (abbreviated cyclam), EDTA, EGTA and
isocyanide. Substituted
derivatives, including fused derivatives, may also be used. In some
embodiments, porphyrins and
substituted derivatives of the porphyrin family may be used. See for example,
Comprehensive
51
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Coordination Chemistry, Ed. Wilkinson et al., Pergammon Press, 1987, Chapters
13.2 (pp73-98), 21.1
(pp. 813-898) and 21.3 (pp 915-957), all of which are hereby expressly
incorporated by reference.
Suitable sigma donating ligands using carbon, oxygen, sulfur and phosphorus
are known in the art.
For example, suitable sigma carbon donors are found in Cotton and Wilkenson,
Advanced Organic
Chemistry, 5th Edition, John Wiley & Sons, 1988, hereby incorporated by
reference; see page 38, for
example. Similarly, suitable oxygen ligands include crown ethers, water and
others known in the art.
Phosphines and substituted phosphines are also suitable; see page 38 of Cotton
and Wilkenson.
The oxygen, sulfur, phosphorus and nitrogen-donating ligands are attached in
such a manner as to
allow the heteroatoms to serve as coordination atoms.
In a preferred embodiment, organometallic ligands are used. In addition to
purely organic compounds
for use as redox moieties, and various transition metal coordination complexes
with b-bonded organic
ligand with donor atoms as heterocyclic or exocyclic substituents, there is
available a wide variety of
transition metal organometallic compounds with r1-bonded organic ligands (see
Advanced Inorganic
Chemistry, 5th Ed., Cotton & Wilkinson, John Wiley & Sons, 1988, chapter 26;
Organometallics, A
Concise Introduction, Elschenbroich et al., 2nd Ed., 1992, VCH; and
Comprehensive Organometallic
Chemistry II, A Review of the Literature 1982-1994, Abel et al. Ed., Vol. 7,
chapters 7, 8, 10 & 11,
Pergamon Press, hereby expressly incorporated by reference). Such
organometallic ligands include
cyclic aromatic compounds such as the cyclopentadienide ion [CSHS(-1 )] and
various ring substituted
and ring fused derivatives, such as the indenylide (-1 ) ion, that yield a
class of bis(cyclopentadieyl)
metal compounds, (i.e. the metallocenes); see for example Robins et al., J.
Am. Chem. Soc.
104:1882-1893 (1982); and Gassman et al., J. Am. Chem. Soc. 108:4228-4229
(1986),
incorporated by reference. Of these, ferrocene [(CSHS)ZFe] and its derivatives
are prototypical
examples which have been used in a wide variety of chemical (Connelly et al.,
Chem. Rev. 96:877-
910 (1996), incorporated by reference) and electrochemical (Geiger et al.,
Advances in
Organometallic Chemistry 23:1-93; and Geiger et al., Advances in
Organometallic Chemistry 24:87,
incorporated by reference) electron transfer or "redox" reactions. Metallocene
derivatives of a variety
of the first, second and third row transition metals are potential candidates
as redox moieties that are
covalently attached to the nucleic acid. Other potentially suitable
organometallic ligands include cyclic
arenes such as benzene, to yield bis(arene)metal compounds and their ring
substituted and ring fused
derivatives, of which bis(benzene)chromium is a prototypical example, Other
acyclic rr-bonded
ligands such as the allyl(-1 ) ion, or butadiene yield potentially suitable
organometallic compounds, and
all such ligands, in conjuction with other rr-bonded and a-bonded ligands
constitute the general class
of organometallic compounds in which there is a metal to carbon bond.
Electrochemical studies of
various dimers and oligomers of such compounds with bridging organic ligands,
and additional non-
bridging ligands, as well as with and without metal-metal bonds are potential
candidate redox moieties
in nucleic acid analysis.
52
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
When one or more of the co-ligands is an organometallic ligand, the ligand is
generally attached via
one of the carbon atoms of the organometallic ligand, although attachment may
be via other atoms for
heterocyclic ligands. Preferred organometallic ligands include metallocene
ligands, including
substituted derivatives and the metalloceneophanes (see page 1174 of Cotton
and Wilkenson, supra).
For example, derivatives of metallocene ligands such as
methylcyclopentadienyl, with multiple methyl
groups being preferred, such as pentamethylcyclopentadienyl, can be used to
increase the stability of
the metallocene. In a preferred embodiment, only one of the two metallocene
ligands of a
metallocene are derivatized.
As described herein, any combination of ligands may be used. Preferred
combinations include: a) all
ligands are nitrogen donating ligands; b) all ligands are organometallic
ligands; and c) one ligand is a
metallocene ligand and another is a nitrogen donating ligand, with the other
ligands, if needed, are
either nitrogen donating ligands or metallocene ligands, or a mixture.
In addition to transition metal complexes, other organic electron donors and
acceptors may be
covalently attached to the nucleic acid for use in the invention. These
organic molecules include, but
are not limited to, riboflavin, xanthene dyes, azine dyes, acridine orange,
N,M-dimethyl-2,7-
diazapyrenium dichloride (DAPz'), methylviologen, ethidium bromide, quinones
such as N,N'-
dimethylanthra(2,1,9-def6,5,10-d'e'f~diisoquinoline dichloride (ADIQz+);
porphyrins ([meso-tetrakis(N-
methyl-x-pyridinium)porphyrin tetrachloride], varlamine blue B hydrochloride,
Bindschedler's green;
2,6-dichloroindophenol, 2,6-dibromophenolindophenol; Brilliant crest blue (3-
amino-9-dimethyl-amino-
10-methylphenoxyazine chloride), methylene blue; Nile blue A
(aminoaphthodiethylaminophenoxazine
sulfate), indigo-5,5',7,7'-tetrasulfonic acid, indigo-5,5',7-trisulfonic acid;
phenosafranine, indigo-5-
monosulfonic acid; safranine T; bis(dimethylglyoximato)-iron(II) chloride;
induline scarlet, neutral red,
_ anthracene, coronene, pyrene, 9-phenylanthracene, rubrene, binaphthyl, DPA,
phenothiazene,
fluoranthene, phenanthrene, chrysene, 1,8-diphenyl-1,3,5,7-octatetracene,
naphthalene,
acenaphthalene, perylene, TMPD and analogs and subsitituted derivatives of
these compounds.
In one embodiment, the electron donors and acceptors are redox proteins as are
known in the art.
However, redox proteins in many embodiments are not preferred.
The choice of the specific ETMs will be influenced by the type of electron
transfer detection used, as is
generally outlined below. Preferred ETMs are metallocenes, with ferrocene
being particularly
preferred.
Without being bound by theory, it appears that in "mechanism-2" systems,
electron transfer is
facilitated when the ETM is able to penetrate ("snuggle") into the monolayer
to some degree. That is,
in general, it appears that hydrophobic ETMs used with hydrophobic SAMs give
rise to better (greater)
signals than ETMs that are charged or more hydrophilic. Thus, for example,
ferrocene in solution can
53
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
penetrate the monolayers of the examples and give a signal when
electroconduits are present, while
ferrocyanide in solution gives little or no signal. Thus, in general,
hydrophobic ETMs are preferred in
mechanism-2 systems; however, transition metal complexes, although charged,
with one or more
hydrophobic ligands, such as Ru and Os complexes, also give rise to good
signals. Similarly, electron
transfer between the ETM and the electrode is facilitated by the use of
linkers or spacers that allow the
ETM some flexibility to penetrate into the monolayer; thus the N6 compositions
of the invention have a
four carbon linker attaching the ETM to the nucleic acid.
In a preferred embodiment, a plurality of ETMs are used. The use of multiple
ETMs provides signal
amplification and thus allows more sensitive detection limits. While the use
of multiple ETMs on
nucleic acids that hybridize to complementary strands (i.e. mechanism-1
systems) can cause
decreases in Tms of the hybridization complexes depending on the number, site
of attachment and
spacing between the multiple ETMs, this is not a factor when the ETMs are on
the recruitment linker,
since this does not hybridize to a complementary sequence. Accordingly,
pluralities of ETMs are
preferred, with at least about 2 ETMs per assay complex being preferred, and
at least about 10 being
particularly preferred, and at least about 20 to 50 being .especially
preferred. In some instances, very
large numbers of ETMs (100 to 10000 or greater) can be used.
Attachment of the ETM to the assay complex can be done in a wide variety of
ways, and depends on
the mechanism of detection and whether direct or indirect detection is done.
In general, methods and
compositions outlined in W098/20162, expressly incorporated by reference in
its entirety, can be
used.
In a preferred embodiment, it is a label probe that comprises the ETMs. In a
preferred embodiment,
the label probe is used in a mechanism-2 detection system. Thus, as will be
appreciated by those in
the art, the portion of the label probe (or target, in some embodiments) that
comprises the ETMs
(termed herein a "recruitment linker" or "signal carrier") can be nucleic
acid, or it can be a non-nucleic
acid linker that links the first hybridizable portion of the label probe to
the ETMs. That is, since this
portion of the label probe is not required for hybridization if a mechanism-2
system is used, it need not
be nucleic acid, although this may be done for ease of synthesis. In some
embodiments, as is more
fully outlined below, the recruitment linker may comprise double-stranded
portions.
Thus, as will be appreciated by those in the art, there are a variety of
configurations that can be used.
In a preferred embodiment, the recruitment linker is nucleic acid (including
analogs), and attachment
of the ETMs can be via (1 ) a base; (2) the backbone, including the ribose,
the phosphate, or
comparable structures in nucleic acid analogs; (3) nucleoside replacement,
described below; or (4)
metallocene polymers, as described below. In a preferred embodiment, the
linker is non-nucleic acid,
and can be either a metallocene polymer or an alkyl-type polymer (including
heteroalkyl, as is more
54
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
fully described below) containing ETM substitution groups. These options are
generally depicted in
the Figures.
When a mechanism-1 detection system is used to detect the label probes, the
ETMs are generally
attached via either (1 ) or (2) above, since hybridization of the label probe
to a detection probe, as
outlined herein, requires the formation of a hybridization complex.
In a preferred embodiment, the recruitment linker is a nucleic acid, and
comprises covalently attached
ETMs. The ETMs may be attached to nucleosides within the nucleic acid in a
variety of positions.
Preferred embodiments include, but are not limited to, (1 ) attachment to the
base of the nucleoside,
(2) attachment of the ETM as a base replacement, (3) attachment to the
backbone of the nucleic acid,
including either to a ribose of the ribose-phosphate backbone or to a
phosphate moiety, or to
analogous structures in nucleic acid analogs, and (4) attachment via
metallocene polymers, with the
latter being preferred.
In addition, as is described below, when the recruitment linker is nucleic
acid, it may be desirable to
use secondary label probes, that have a first portion that will hybridize to a
portion of the primary label
probes and a second portion comprising a recruitment linker as is defined
herein. This is generally
depicted in Figure 16H; this is similar to. the use of an amplifier probe,
except that both the primary and
the secondary label probes comprise ETMs.
In a preferred embodiment, the ETM is attached to the base of a nucleoside as
is generally outlined in
WO 98/20162, incorporated by reference, for attachment of conductive
oligomers. Attachment can be
to an internal nucleoside or a terminal nucleoside.
The covalent attachment to the base will depend in part on the ETM chosen, but
in general is similar
to the attachment of conductive oligomers to bases, as outlined in WO
98/20162. Attachment may
generally be done to any position of the base. In a preferred embodiment, the
ETM is a transition
metal complex, and thus attachment of a suitable metal ligand to the base
leads to the covalent
attachment of the ETM. Alternatively, similar types of linkages may be used
for the attachment of
organic ETMs, as will be appreciated by those in the art.
In one embodiment, the C4 attached amino group of cytosine, the C6 attached
amino group of
adenine, or the C2 attached amino group of guanine may be used as a transition
metal ligand.
Ligands containing aromatic groups can be attached via acetylene linkages as
is known in the art (see
Comprehensive Organic Synthesis, Trost et al., Ed., Pergamon Press, Chapter
2.4: Coupling
Reactions Between spz and sp Carbon Centers, Sonogashira, pp521-549, and pp950-
953, hereby
incorporated by reference). Structure 1 depicts a representative structure in
the presence of the metal
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
ion and any other necessary ligands; Structure 1 depicts uridine, although as
for all the structures
herein, any other base may also be used.
Structure 1
0
~M
~~4
La is a ligand, which may include nitrogen, oxygen, sulfur or phosphorus
donating ligands or
organometallic ligands such as metallocene ligands. Suitable La ligands
include, but not limited to,
phenanthroline, imidazole, bpy and terpy. L~ and M are as defined above.
Again, it will be appreciated
by those in the art, a linker ("Z") may be included between the nucleoside and
the ETM.
Similarly, as for the conductive oligomers, the linkage may be done using a
linker, which may utilize an
amide linkage (see generally Telser et al., J. Am. Chem. Soc. 111:7221-7226
(1989); Telser et al., J.
Am. Chem. Soc. 111:7226-7232 (1989), both of which are expressly incorporated
by reference).
These structures are generally depicted below in Structure 2, which again uses
uridine as the base,
although as above, the other bases may also be used:
Structure 2
0
z
HN ~ \L'
M
o o N :.4
In this embodiment, L is a ligand as defined above, with L~ and M as defined
above as well.
Preferably, L is amino, phen, byp and terpy.
In a preferred embodiment, the ETM attached to a nucleoside is a metallocene;
i.e. the L and L~ of
Structure 2 are both metallocene ligands, Lm, as described above. Structure 3
depicts a preferred
embodiment wherein the metallocene is ferrocene, and the base is uridine,
although other bases may
be used:
56
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Preliminary data suggest that Structure 3 may cyclize, with the second
acetylene carbon atom
attacking the carbonyl oxygen, forming a furan-like structure. Preferred
metallocenes include
ferrocene, cobaltocene and osmiumocene.
In a preferred embodiment, the ETM is attached to a ribose at any position of
the ribose-phosphate
backbone of the nucleic acid, i.e. either the 5' or 3' terminus or any
internal nucleoside. Ribose in this
case can include ribose analogs. As is known in the art, nucleosides that are
modified at either the 2'
or 3' position of the ribose can be made, with nitrogen, oxygen, sulfur and
phosphorus-containing
modifications possible. Amino-modified and oxygen-modified ribose is
preferred. See generally WO
95/15971 and WO 98/20162, incorporated herein by reference. These modification
groups may be
used as a transition metal ligand, or as a chemically functional moiety for
attachment of other
transition metal ligands and organometallic ligands, or organic electron donor
moieties as will be
appreciated by those in the art. In this embodiment, a linker such as depicted
herein for "Z" may be
used as well, or a conductive oligomer between the ribose and the ETM.
Preferred embodiments
utilize attachment at the 2' or 3' position of the ribose, with the 2'
position being preferred. Thus for
example, the conductive oligomers depicted in Structure 13, 14 and 15 of
W098/20162 may be
replaced by ETMs; alternatively, the ETMs may be added to the free terminus of
the conductive
oligomer.
In a preferred embodiment, a metallocene serves as the ETM, and is attached
via an amide bond as
depicted below in Structure 4. The examples outline the synthesis of a
preferred compound when the
metallocene is ferrocene.
Structure 4
base
0
NH
O
:M
~m
In a preferred embodiment, amine linkages are used, as is generally depicted
in Structure 5.
57
Structure 3
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Structure 5
BASE
O
NH
()
ETM
Z is a linker, as defined herein, with 1-16 atoms being preferred, and 2-4
atoms being particularly
preferred, and t is either one or zero.
In a preferred embodiment, oxo linkages are used, as is generally depicted in
Structure 6.
Structure 6
BASE
O
O
(1
ETM
In Structure 6, Z is a linker, as defined herein, and t is either one or zero.
Preferred Z linkers include
alkyl groups including heteroalkyl groups such as (CHZ)n and (CHzCHzO)n, with
n from 1 to 10 being
preferred, and n = 1 to 4 being especially preferred, and n=4 being
particularly preferred.
Linkages utilizing other heteroatoms are also possible; a variety of linkages
of ETMs to nucleosides
are shown in Figure 1.
In a preferred embodiment, an ETM is attached to a phosphate at any position
of the ribose-
phosphate backbone of the nucleic acid. This may be done in a variety of ways.
In one embodiment,
phosphodiester bond analogs such as phosphoramide or phosphoramidite linkages
may be
incorporated into a nucleic acid, where the heteroatom (i.e. nitrogen) serves
as a transition metal
ligand (see PCT publication WO 95/15971 and WO 98/20162, incorporated by
reference).
Alternatively, the conductive oligomers depicted in Structures 23 and 24 of
W098/20162 may be
replaced by ETMs. In a preferred embodiment, the composition has the structure
shown in Structure
7.
BASE
O
O
Structure 7 O- -O-(Z)~-ETM
O
58
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In Structure 7, the ETM is attached via a phosphate linkage, generally through
the use of a linker, Z.
Preferred Z linkers include alkyl groups, including heteroalkyl groups such as
(CHz)~, (CHZCH20)~, with
n from 1 to 10 being preferred, and n = 1 to 4 being especially preferred, and
n=4 being particularly
preferred.
When the ETM is.attached to the base or the backbone of the nucleoside, it is
possible to attach the
ETMs via "dendrimer" structures, as is more fully outlined below. As is
generally depicted in the
Figures, alkyl-based linkers can be used to create multiple branching
structures comprising one or
more ETMs at the terminus of each branch. Generally, this is done by creating
branch points
containing multiple hydroxy groups, which optionally can then be used to add
additional branch points.
The terminal hydroxy groups can then be used in phosphoramidite reactions to
add ETMs, as is
generally done below for the nucleoside replacement and metallocene polymer
reactions.
In a preferred embodiment, an ETM such as a metallocene is used as a
"nucleoside replacement",
serving as an ETM. For example, the distance between the two cyclopentadiene
rings of ferrocene is
similar to the orthongonal distance between two bases in a double stranded
nucleic acid. Other
metallocenes in addition to ferrocene may be used, for example, air stable
metallocenes such as
those containing cobalt or ruthenium. Thus, metallocene moieties may be
incorporated into the
backbone of a nucleic acid, as is generally depicted in Structure 8 (nucleic
acid with a ribose-
phosphate backbone) and Structure 9 (peptide nucleic acid backbone).
Structures 8 and 9 depict
ferrocene, although as will be appreciated by those in the art, other
metallocenes may be used as well.
In general, air stable metallocenes are preferred, including metallocenes
BASE
utilizing ruthenium and cobalt as the metal.
0
0
O-P=O
-Z
Fe
Z
-
O-P-O
Structure 8
0
I-i~ BASE
O
59
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In Structure 8, Z is a linker as defined above, with generally short, alkyl
groups, including heteroatoms
such as oxygen being preferred. Generally, what is important is the length of
the linker, such that
minimal perturbations of a double stranded nucleic acid is effected, as is
more fully described below.
Thus, methylene, ethylene, ethylene glycols, propylene and butylene are all
preferred, with ethylene
and ethylene glycol being particularly preferred. In addition, each Z linker
may be the same or
different. Structure 8 depicts a ribose-phosphate backbone, although as will
be appreciated by those
in the art, nucleic acid analogs may also be used, including ribose analogs
and phosphate bond
analogs.
Structure 9
=o
HN
O
/I I~BASE
.N
c/\~ =O
HN-2-
//~~Fe
C
/ \0~
HN
O
~II~9ASE
/N
/C=O
HN
In Structure 9, preferred Z groups are as listed above, and again, each Z
linker can be the same or
different. As above, other nucleic acid analogs may be used as well.
In addition, although the structures and discussion above depicts
metallocenes, and particularly
ferrocene, this same general idea can be used to add ETMs in addition to
metallocenes, as
nucleoside replacements or in polymer embodiments, described below. Thus, for
example, when the
ETM is a transition metal complex other than a metallocene, comprising one,
two or three (or more)
ligands, the ligands can be functionalized as depicted for the ferrocene to
allow the addition of
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
phosphoramidite groups. Particularly preferred in this embodiment are
complexes comprising at least
two ring (for example, aryl and substituted aryl) ligands, where each of the
ligands comprises
functional groups for attachment via phosphoramidite chemistry. As will be
appreciated by those in
the art, this type of reaction, creating polymers of ETMs either as a portion
of the backbone of the
nucleic acid or as "side groups" of the nucleic acids, to allow amplification
of the signals generated
herein, can be done with virtually any ETM that can be functionalized to
contain the correct chemical
groups.
Thus, by inserting a metallocene such as ferrocene (or other ETM) into the
backbone of a nucleic
acid, nucleic acid analogs are made; that is, the invention provides nucleic
acids having a backbone
comprising at least one metallocene. This is distinguished from nucleic acids
having metallocenes
attached to the backbone, i.e. via a ribose, a phosphate, etc. That is, two
nucleic acids each made up
of a traditional nucleic acid or analog (nucleic acids in this case including
a single nucleoside), may be
covalently attached to each other via a metallocene. Viewed differently, a
metallocene derivative or
substituted metallocene is provided, wherein each of the two aromatic rings of
the metallocene has a
nucleic acid substitutent group.
In addition, as is more fully outlined below, it is possible to incorporate
more than one metallocene into
the backbone, either with nucleotides in between and/or with adjacent
metallocenes. When adjacent
metallocenes are added to the backbone, this is similar to the process
described below as
"metallocene polymers"; that is, there are areas of metallocene polymers
within the backbone.
In addition to the nucleic acid substitutent groups, it is also desirable in
some instances to add
additional substituent groups to one or both of the aromatic rings of the
metallocene (or ETM). For
example, as these nucleoside replacements are generally part of probe
sequences to be hybridized
with a substantially complementary nucleic acid, for example a target sequence
or another probe
sequence, it is possible to add substitutent groups to the metallocene rings
to facilitate hydrogen
bonding to the base or bases on the opposite strand. These may be added to any
position on the
metallocene rings. Suitable substitutent groups include, but are not limited
to, amide groups, amine
groups, carboxylic acids, and alcohols, including substituted alcohols. In
addition, these substitutent
groups can be attached via linkers as well, although in general this is not
preferred.
In addition, substituent groups on an ETM, particularly metallocenes such as
ferrocene, may be added
to alter the redox properties of the ETM. Thus, for example, in some
embodiments, as is more fully
described below, it may be desirable to have different ETMs attached in
different ways (i.e. base or
ribose attachment), on different probes, or for different purposes (for
example, calibration or as an
internal standard). Thus, the addition of substituent groups on the
metallocene may allow two different
ETMs to be distinguished.
61
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In order to generate these metallocene-backbone nucleic acid analogs, the
intermediate components
are also provided. Thus, in a preferred embodiment, the invention provides
phosphoramidite
metallocenes, as generally depicted in Structure 10:
Structure 10
PG-O
Z -AROMATIC
RING
I
M
Z -AROMATIC
RING
O
CH
3
-
NCHZCH2C-P -CH
~
CH
CH3
\
~
\
H3C CH3
In Structure 10, PG is a protecting group, generally suitable for use in
nucleic acid synthesis, with
DMT, MMT and TMT all being preferred. The aromatic rings can either be the
rings of the
metallocene, or aromatic rings of ligands for transition metal complexes or
other organic ETMs. The
aromatic rings may be the same or different, and may be substituted as
discussed herein.
Structure 11 depicts the ferrocene derivative:
Structure 11
PG-O
Z-
Fe
Z
0
NCHZCH2C- ~ -N~CH/CH3
CH CH3
H3C/ \CH3
These phosphoramidite analogs can be added to standard oligonucleotide
syntheses as is known in
the art.
Structure 12 depicts the ferrocene peptide nucleic acid (PNA) monomer, that
can be added to PNA
synthesis as is known in the art and depicted within the Figures and Examples:
62
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Structure 12
PG-NH
Z-~~
Fe
Z
O=C\
OH
In Structure 12, the PG protecting group is suitable for use in peptide
nucleic acid synthesis, with
MMT, boc and Fmoc being preferred.
These same intermediate compounds can be used to form ETM or metallocene
polymers, which are
added to the nucleic acids, rather than as backbone replacements, as is more
fully described below.
In a preferred embodiment, the ETMs are attached as polymers, for example as
metallocene
polymers, in a "branched" configuration similar to the "branched DNA"
embodiments herein and as
outlined in U.S. Patent No. 5,124,246, using modified functionalized
nucleotides. The general idea is
as follows. A modified phosphoramidite nucleotide is generated that can
ultimately contain a free
hydroxy group that can be used in the attachment of phosphoramidite ETMs such
as metallocenes.
This free hydroxy group could be on the base or the backbone, such as the
ribose or the phosphate
(although as will be appreciated by those in the art, nucleic acid analogs
containing other structures
can also be used). The modified nucleotide is incorporated into a nucleic
acid, and any hydroxy
protecting groups are removed, thus leaving the free hydroxyl. Upon the
addition of a
phosphoramidite ETM such as a metallocene, as described above in structures 10
and 1, ETMs, such
as metallocene ETMs, are added. Additional phosphoramidite ETMs such as
metallocenes can be
added, to form "ETM polymers", including "metallocene polymers" as depicted
herein, particularly for
ferrocene. In addition, in some embodiments, it is desirable to increase the
solubility of the polymers
by adding a "capping" group to the terminal ETM in the polymer, for example a
final phosphate group
to the metallocene as is generally depicted in Figure 12. Other suitable
solubility enhancing "capping"
groups will be appreciated by those in the art. It should be noted that these
solubility enhancing groups
can be added to the polymers in other places, including to the ligand rings,
for example on the
metallocenes as discussed herein
A preferred embodiment of this general idea is outlined in the Figures. In
this embodiment, the 2'
position of a ribose of a phosphoramidite nucleotide is first functionalized
to contain a protected
hydroxy group, in this case via an oxo-linkage, although any number of linkers
can be used, as is
generally described herein for Z linkers. The protected modified nucleotide is
then incorporated via
standard phosphoramidite chemistry into a growing nucleic acid. The protecting
group is removed,
and the free hydroxy group is used, again using standard phosphoramidite
chemistry to add a
63
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
phosphoramidite metallocene such as ferrocene. A similar reaction is possible
for nucleic acid
analogs. For example, using peptide nucleic acids and the metallocene monomer
shown in Structure
12, peptide nucleic acid structures containing metallocene polymers could be
generated.
Thus, the present invention provides recruitment linkers of nucleic acids
comprising "branches" of
metallocene polymers as is generally depicted in Figures 12 and 13. Preferred
embodiments also
utilize metallocene polymers from one to about 50 metallocenes in length, with
from about 5 to about
20 being preferred and from about 5 to about 10 being especially preferred.
In addition, when the recruitment linker is nucleic acid, any combination of
ETM attachments may be
done.
In a preferred embodiment, the recruitment linker is not nucleic acid, and
instead may be any sort of
linker or polymer. As will be appreciated by those in the art, generally any
linker or polymer that can be
modified to contain ETMs can be used. In general, the polymers or linkers
should be reasonably
soluble and contain suitable functional groups for the addition of ETMs.
As used herein, a "recruitment polymer" comprises at least two or three
subunits, which are covalently
attached. At least some portion of the monomeric subunits contain functional
groups for the covalent
attachment of ETMs. In some embodiments coupling moieties are used to
covalently link the subunits
with the ETMs. Preferred functional groups for attachment are amino groups,
carboxy groups, oxo
groups and thiol groups, with amino groups being particularly preferred. As
will be appreciated by
those in the art, a wide variety of recruitment polymers are possible.
Suitable linkers include, but are not limited to, alkyl linkers (including
heteroalkyl (including
(poly)ethylene glycol-type structures), substituted alkyl, aryalkyl linkers,
etc. As above for the
polymers, the linkers will comprise one or more functional groups for the
attachment of ETMs, which
will be done as will be appreciated by those in the art, for example through
the use homo-or hetero-
bifunctional linkers as are well known (see 1994 Pierce Chemical Company
catalog, technical section
on cross-linkers, pages 155-200, incorporated herein by reference).
Suitable recruitment polymers include, but are not limited to, functionalized
styrenes, such as amino
styrene, functionalized dextrans, and polyamino acids. Preferred polymers are
polyamino acids (both
poly-D-amino acids and poly-L-amino acids), such as polylysine, and polymers
containing lysine and
other amino acids being particularly preferred. Other suitable polyamino acids
are polyglutamic acid,
polyaspartic acid, co-polymers of lysine and glutamic or aspartic acid, co-
polymers of lysine with
alanine, tyrosine, phenylalanine, serine, tryptophan, and/or proline.
64
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In a preferred embodiment, the recruitment linker comprises a metallocene
polymer, as is described
above.
The attachment of the recruitment linkers to the first portion of the label
probe will depend on the
composition of the recruitment linker, as will be appreciated by those in the
art. When the recruitment
linker is nucleic acid, it is generally formed during the synthesis of the
first portion of the label probe,
with incorporation of nucleosides containing ETMs as required. Alternatively,
the first portion of the
label probe and the recruitment linker may be made separately, and then
attached. For example,
there may be an overlapping section of complementarity, forming a section of
double stranded nucleic
acid that can then be chemically crosslinked, for example by using psoralen as
is known in the art.
When non-nucleic acid recruitment linkers are used, attachment of the
linker/polymer of the
recruitment linker will be done generally using standard chemical techniques,
such as will be
appreciated by those in the art. For example, when alkyl-based linkers are
used, attachment can be
similar to the attachment of insulators to nucleic acids.
In addition, it is possible to have recruitment linkers that are mixtures of
nucleic acids and non-nucleic
acids, either in a linear form (i.e. nucleic acid segments linked together
with alkyl linkers) or in
branched forms (nucleic acids with alkyl "branches" that may contain ETMs and
may be additionally
branched).
In a preferred embodiment, the ETM is attached to the target sequence, either
by incorporation into a
primer, or by incorporation into the newly synthesized portion of the target
sequence. Target
sequences comprising covalently attached ETMs can be directly detected using
either a mechanism-1
or mechanism-2 system, as is shown in the figures.
In this embodiment, it is the target sequence itself that carries the ETMs,
rather than the recruitment
linker of a label probe. As discussed herein, this may be done using target
sequences that have
ETMs incorporated at any number of positions, including either within a primer
or within the newly
synthesized strand, and can be attached to the nucleic acid in a variety of
positions, as outlined herein.
In this embodiment, as for the others of the system, the 3'-5' orientation of
the probes and targets is
chosen to get the ETM-containing structures (i.e. label probes, recruitment
linkers or target
sequences) as close to the surface of the monolayer as possible, and in the
correct orientation. This
may be done using attachment via insulators or conductive oligomers as is
generally shown in the
Figures, and may depend on which mechanism is used. In addition, as will be
appreciated by those in
the art, multiple capture probes can be utilized, either in a configuration
wherein the 5'-3' orientation of
the capture probes is different, or where "loops" of target form when
multiples of capture probes are
used.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Labelling of the target sequence with ETMs can also occur during synthesis of
the new target strand.
For example, as is described herein, it is possible to enzymatically add
triphosphate nucleotides
comprising the ETMs of the invention to a growing nucleic acid, for example
during the previously
described amplification techniques. As will be recognized by those in the art,
while several enzymes
have been shown to generally tolerate modified nucleotides, some of the
modified nucleotides of the
invention, for example the "nucleoside replacement" embodiments and putatively
some of the
phosphate attachments, may or may not be recognized by the enzymes to allow
incorporation into a
growing nucleic acid. Therefore, preferred attachments in this embodiment are
to the base or ribose
of the nucleotide.
Alternatively, it is possible to enzymatically add nucleotides comprising ETMs
to the terminus of a
nucleic acid, for example a target nucleic acid, as is more fully outlined
below. In this embodiment, an
effective "recruitment linker" is added to the terminus of the target
sequence, that can then be used for
detection. Thus the invention provides compositions utilizing electrodes
comprising monolayers of
conductive oligomers and capture probes, and target sequences that comprises a
first portion that is
capable of hybridizing to a component of an assay complex, and a second
portion that does not
hybridize to a component of an assay complex and comprises at least one
covalently attached
electron transfer moiety. Similarly, methods utilizing these compositions are
also provided.
It is also possible to have ETMs connected to probe sequences, i.e. sequences
designed to hybridize
to complementary sequences. Thus, ETMs may be added to non-recruitment linkers
as well. For
example, there may be ETMs added to sections of label probes that do hybridize
to components of the
assay complex, for example the first portion, or to the target sequence as
outlined above. These
ETMs may be used for electron transfer detection in some embodiments, or they
may not, depending
on the location and system. For example, in some embodiments, when for example
the target
sequence containing randomly incorporated ETMs is hybridized directly to the
capture probe, as is
depicted in Figure 16A, there may be ETMs in the portion hybridizing to the
capture probe. If the
capture probe is attached to the electrode using a conductive oligomer, these
ETMs can be used to
detect electron transfer as has been previously described. Alternatively,
these ETMs may not be
specifically detected.
Similarly, in some embodiments, when the recruitment linker is nucleic acid,
it may be desirable in
some instances to have some or all of the recruitment linker be double
stranded. In one embodiment,
there may be a second recruitment linker, substantially complementary to the
first recruitment linker,
that can hybridize to the first recruitment linker. In a preferred embodiment,
the first recruitment linker
comprises the covalently attached ETMs. In an alternative embodiment, the
second recruitment linker
contains the ETMs, and the first recruitment linker does not, and the ETMs are
recruited to the surface
by hybridization of the second recruitment linker to the first. In yet another
embodiment, both the first
66
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
and second recruitment linkers comprise ETMs. It should be noted, as discussed
above, that nucleic
acids comprising a large number of ETMs may not hybridize as well, i.e. the Tm
may be decreased,
depending on the site of attachment and the characteristics of the ETM. Thus,
in general, when
multiple ETMs are used on hybridizing strands, generally there are less than
about 5, with less than
about 3 being preferred, or alternatively the ETMs should be spaced
sufficiently far apart that the
intervening nucleotides can sufficiently hybridize to allow good kinetics.
In one embodiment, non-covalently attached ETMs may be used. In one
embodiment, the ETM is a
hybridization indicator. Hybridization indicators serve as an ETM that will
preferentially associate with
double stranded nucleic acid is added, usually reversibly, similar to the
method of Millan et al., Anal.
Chem. 65:2317-2323 (1993); Millan et al., Anal. Chem. 662943-2948 (1994), both
of which are hereby
expressly incorporated by reference. In this embodiment, increases in the
local concentration of
ETMs, due to the association of the ETM hybridization indicator with double
stranded nucleic acid at
the surface, can be monitored using the monolayers comprising the conductive
oligomers.
Hybridization indicators include intercalators and minor and/or major groove
binding moieties. In a
preferred embodiment, intercalators may be used; since intercalation generally
only occurs in the
presence of double stranded nucleic acid, only in the presence of double
stranded nucleic acid will the
ETMs concentrate. Intercalating transition metal complex ETMs are known in the
art. Similarly, major
or minor groove binding moieties, such as methylene blue, may also be used in
this embodiment.
Similarly, the systems of the invention may utilize non-covalently attached
ETMs, as is generally
described in Napier et al., Bioconj. Chem. 8:906 (1997), hereby expressly
incorporated by reference.
In this embodiment, changes in the redox state of certain molecules as a
result of the presence of
DNA (i.e. guanine oxidation by ruthenium complexes) can be detected using the
SAMs comprising
conductive oligomers as well.
Again, the configuration of the system will depend on the mechanism used for
detection. A variety of
mechanism-1 systems are depicted in Figure 27, which shows direct detection
(i.e. target sequence
comprising the ETM), and indirect detection (using label probes).
A variety of mechanism-2 systems are depicted in Figure 16, again showing
direct detection (i.e.
target sequence comprising the ETM), and indirect detection (using label
probes).
In a preferred embodiment, the label probes directly hybridize to the target
sequences, as is generally
depicted in the figures. In these embodiments, the target sequence is
preferably, but not required to
be, immobilized on the surface using capture probes, including capture
extender probes. Label
probes are then used to bring the ETMs into proximity of the surface of the
monolayer comprising
conductive oligomers. In a preferred embodiment, multiple label probes are
used; that is, label probes
are designed such that the portion that hybridizes to the target sequence can
be different for a number
67
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
of different label probes, such that amplification of the signal occurs, since
multiple label probes can
bind for every target sequence. Thus, as depicted in the figures, n is an
integer of at least one.
Depending on the sensitivity desired, the length of the target sequence, the
number of ETMs per label
probe, etc., preferred ranges of n are from 1 to 50, with from about 1 to
about 20 being particularly
preferred, and from about 2 to about 5 being especially preferred. In
addition, if "generic" label
probes are desired, label extender probes can be used as generally described
below for use with
amplifier probes.
As above, generally in this embodiment the configuration of the system and the
label probes are
designed to recruit the ETMs as close as possible to the monolayer surface.
In a preferred embodiment, the label probes are hybridized to the target
sequence indirectly. That is,
the present invention finds use in novel combinations of signal amplification
technologies and electron
transfer detection on electrodes, which may be particularly useful in sandwich
hybridization assays, as
generally depicted in the Figures. In these embodiments, the amplifier probes
of the invention are
bound to the target sequence in a sample either directly or indirectly. Since
the amplifier probes
preferably contain a relatively large number of amplification sequences that
are available for binding of
label probes, the detectable signal is significantly increased, and allows the
detection limits of the
target to be significantly improved. These label and amplifier probes, and the
detection methods
described herein, may be used in essentially any known nucleic acid
hybridization formats, such as
those in which the target is bound directly to a solid phase or in sandwich
hybridization assays in which
the target is bound to one or more nucleic acids that are in turn bound to the
solid phase.
The assay complexes of the invention are detected using electrodes.
By "electrode" herein is meant a composition, which, when connected to an
electronic device, is able
to sense a current or charge and convert it to a signal. Alternatively an
electrode can be defined as a
composition which can apply a potential to and/or pass electrons to or from
species in the solution.
Thus, an electrode is an ETM as described herein. Preferred electodes are
known in the art and
include, but are not limited to, certain metals and their oxides, including
gold; platinum; palladium;
silicon; aluminum; metal oxide electrodes including platinum oxide, titanium
oxide, tin oxide, indium tin
oxide, palladium oxide, silicon oxide, aluminum oxide, molybdenum oxide
(Moz06), tungsten oxide
(W03) and ruthenium oxides; and carbon (including glassy carbon electrodes,
graphite and carbon
paste). Preferred electrodes include gold, silicon, platinum, carbon and metal
oxide electrodes, with
gold being particularly preferred.
The electrodes described herein are depicted as a flat surface, which is only
one of the possible
conformations of the electrode and is for schematic purposes only. The
conformation of the electrode
will vary with the detection method used. For example, flat planar electrodes
may be preferred for
68
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
optical detection methods, or when arrays of nucleic acids are made, thus
requiring addressable
locations for both synthesis and detection. Alternatively, for single probe
analysis, the electrode may
be in the form of a tube, with the SAMs comprising conductive oligomers and
nucleic acids bound to
the inner surface. Electrode coils may be preferred in some embodiments as
well. This allows a
maximum of surface area containing the nucleic acids to be exposed to a small
volume of sample.
In a preferred embodiment, the detection electrodes are formed on a substrate.
In addition, the
discussion herein is generally directed to the formation of gold electrodes,
but as will be appreciated
by those in the art, other electrodes can be used as well. The substrate can
comprise a wide variety
of materials, as will be appreciated by those in the art, with printed circuit
board (PCB) materials being
particularly preferred. Thus, in general, the suitable substrates include, but
are not limited to,
fiberglass, teflon, ceramics, glass, silicon, mica, plastic (including
acrylics, polystyrene and copolymers
of styrene and other materials, polypropylene, polyethylene, polybutylene,
polycarbonate,
polyurethanes, TefIon~T", and derivatives thereof, etc.), GETEK (a blend of
polypropylene oxide and
fiberglass), etc.
In general, preferred materials include printed circuit board materials.
Circuit board materials are
those that comprise an insulating substrate that is coated with a conducting
layer and processed using
lithography techniques, particularly photolithography techniques, to form the
patterns of electrodes and
interconnects (sometimes referred to in the art as interconnections or leads).
The insulating substrate
is generally, but not always, a polymer. As is known in the art, one or a
plurality of layers may be used,
to make either "two dimensional" (e.g. all electrodes and interconnections in
a plane) or "three
dimensional" (wherein the electrodes are on one surface and the interconnects
may go through the
board to the other side) boards. Three dimensional systems frequently rely on
the use of drilling or
etching, followed by electroplating with a metal such as copper, such that the
"through board"
interconnections are made. Circuit board materials are often provided with a
foil already attached to
the substrate, such as a copper foil, with additional copper added as needed
(for example for
interconnections), for example by electroplating. The copper surface may then
need to be roughened,
for example through etching, to allow attachment of the adhesion layer.
In some embodiments, glass may not be preferred as a substrate.
Accordingly, in a preferred embodiment, the present invention provides
biochips (sometimes referred
to herein "chips") that comprise substrates comprising a plurality of
electrodes, preferably gold
electrodes. The number of electrodes is as outlined for arrays. Each electrode
preferably comprises
a self-assembled monolayer as outlined herein. In a preferred embodiment, one
of the monolayer-
forming species comprises a capture ligand as outlined herein. In addition,
each electrode has an
interconnection, that is attached to the electrode at one end and is
ultimately attached to a device that
can control the electrode. That is, each electrode is independently
addressable.
69
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The substrates can be part of a larger device comprising a detection chamber
that exposes a given
volume of sample to the detection electrode. Generally, the detection chamber
ranges from about 1
nL to 1 ml, with about 10 NL to 500 uL being preferred. As will be appreciated
by those in the art,
depending on the experimental conditions and assay, smaller or larger volumes
may be used.
In some embodiments, the detection chamber and electrode are part of a
cartridge that can be placed
into a device comprising electronic components (an AC/DC voltage source, an
ammeter, a processor,
a read-out display, temperature controller, light source, etc.). In this
embodiment, the interconnections
from each electrode are positioned such that upon insertion of the cartridge
into the device,
connections between the electrodes and the electronic components are
established.
Detection electrodes on circuit board material (or other substrates) are
generally prepared in a wide
variety of ways. In general, high purity gold is used, and it may be deposited
on a surface via vacuum
deposition processes (sputtering and evaporation) or solution deposition
(electroplating or electroless
processes). When electroplating is done, the substrate must initially comprise
a conductive material;
fiberglass circuit boards are frequently provided with copper foil.
Frequently, depending on the
substrate, an adhesion layer between the substrate and the gold in order to
insure good mechanical
stability is used. Thus, preferred embodiments utilize a deposition layer of
an adhesion metal such as
chromium, titanium, titanium/tungsten, tantalum, nickel or palladium, which
can be deposited as above
for the gold. When electroplated metal (either the adhesion metal or the
electrode metal) is used,
grain refining additives, frequently referred to in the trade as brighteners,
can optionally be added to
alter surface deposition properties. Preferred brighteners are mixtures of
organic and inorganic
species, with cobalt and nickel being preferred.
In general, the adhesion layer is from about 100 A thick to about 25 microns
(1000 microinches). The
If the adhesion metal is electrochemically active, the electrode metal must be
coated at a thickness
that prevents "bleed-through"; if the adhesion metal is not electrochemically
active, the electrode metal
may be thinner. Generally, the electrode metal (preferably gold) is deposited
at thicknesses ranging
from about 500 A to about 5 microns (200 microinches), with from about 30
microinches to about 50
microinches being preferred. In general,-the gold is deposited to make
electrodes ranging in size from
about 5 microns to about 5 mm in diameter, with about 100 to 250 microns being
preferred. The
detection electrodes thus formed are then preferably cleaned and SAMs added,
as is discussed
below.
Thus, the present invention provides methods of making a substrate comprising
a plurality of gold
electrodes. The methods first comprise coating an adhesion metal, such as
nickel or palladium
(optionally with brightener), onto the substrate. Electroplating is preferred.
The electrode metal,
preferably gold, is then coated (again, with electroplating preferred) onto
the adhesion metal. Then
the patterns of the device, comprising the electrodes and their associated
interconnections are made
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
using lithographic techniques, particularly photolithographic techniques as
are known in the art, and
wet chemical etching. Frequently, a non-conductive chemically resistive
insulating material such as
solder mask or plastic is laid down using these photolithographic techniques,
leaving only the
electrodes and a connection point to the leads exposed; the leads themselves
are generally coated.
The methods continue with the addition of SAMs as are described below. In a
preferred embodiment,
drop deposition techniques are used to add the required chemistry, i.e. the
monolayer forming
species, one of which is preferably a capture ligand comprising species. Drop
deposition techniques
are well known for making "spot" arrays. This is done to add a different
composition to each
electrode, i.e. to make an array comprising different capture ligands.
Alternatively, the SAM species
may be identical for each electrode, and this may be accomplished using a drop
deposition technique
or the immersion of the entire substrate or a surface of the substrate into
the solution.
Thus, in a preferred embodiment, the electrode comprises a monolayer,
comprising electroconduit
forming species (EFS). As outlined herein, the efficiency of target analyte
binding (for example,
oligonucleotide hybridization) may increase when the analyte is at a distance
from the electrode.
Similarly, non-specific binding of biomolecules, including the target
analytes, to an electrode is
generally reduced when a monolayer is present. Thus, a monolayer facilitates
the maintenance of the
analyte away from the electrode surface. In addition, a monolayer serves to
keep charged species
away from the surface of the electrode. Thus, this layer helps to prevent
electrical contact between
the electrodes and the ETMs, or between the electrode and charged species
within the solvent. Such
contact can result in a direct "short circuit" or an indirect short circuit
via charged species which may
be present in the sample. Accordingly, the monolayer is preferably tightly
packed in a uniform layer on
the electrode surface, such that a minimum of "holes" exist. The monolayer
thus serves as a physical
barrier to block solvent accesibility to the electrode.
The detection electrode comprises a self-assembled monolayer (SAM) comprising
conductive
oligomers. By "monolayer" or "self-assembled monolaye~" or "SAM" herein is
meant a relatively
ordered assembly of molecules spontaneously chemisorbed on a surface, in which
the molecules are
oriented approximately parallel to each other and roughly perpendicular to the
surface. Each of the
molecules includes a functional group that adheres to the surface, and a
portion that interacts with
neighboring molecules in the monolayer to form the relatively ordered array. A
"mixed" monolayer
comprises a heterogeneous monolayer, that is, where at feast two different
molecules make up the
monolayer. The SAM may comprise conductive oligomers alone, or a mixture of
conductive oligomers
and insulators. As outlined herein, the efficiency of oligonucleotide
hybridization may increase when
the analyte is at a distance from the electrode. Similarly, non-specific
binding of biomolecules,
including the target analytes, to an electrode is generally reduced when a
monolayer is present. Thus,
a monolayer facilitates the maintenance of the nucleic acid away from the
electrode surface. In
addition, a monolayer serves to keep charged species away from the surface of
the electrode. Thus,
71
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
this layer helps to prevent electrical contact between the electrodes and the
ETMs, or between the
electrode and charged species within the solvent. Such contact can result in a
direct "short circuit" or
an indirect short circuit via charged species which may be present in the
sample. Accordingly, the
monolayer is preferably tightly packed in a uniform layer on the electrode
surface, such that a
minimum of "holes" exist. The monolayer thus serves as a physical barrier to
block solvent accesibility
to the electrode.
In general, the SAMs of the invention can be generated in a number of ways and
comprise a number
of different components, depending on the electrode surface and the system
used. For "mechanism-
1" embodiments, preferred embodiments utilize two monolayer forming species: a
monolayer forming
species (including insulators or conductive oligomers) and a conductive
oligomer species comprising
the capture binding ligand, although as will be appreciated by those in the
art, additional monolayer
forming species can be included as well. For "mechanism-2" systems, the
composition of the SAM
depends on the detection electrode surface. In general, two basic "mechanism-
2" systems are
described; detection electrodes comprising "smooth" surfaces, such as gold
ball electrodes, and those
comprising "rough" surfaces, such as those that are made using commercial
processes on PC circuit
boards. In general, without being bound by theory, it appears that monolayers
made on imperfect
surfaces, i.e. "rough" surfaces, spontaneously form monolayers containing
enough electroconduits
even in the absence of EFS, probably due to the fact that the formation of a
uniform monolayer on a
rough surface is difficult. "Smoother" surfaces, however, may require the
inclusion of sufficient
numbers of EFS to generate the electroconduits, as the uniform surfaces allow
a more uniform
monolayer to form. Again, without being bound by theory, the inclusion of
species that disturb the
uniformity of the monolayer, for example by including a rigid molecule in a
background of more flexible
ones, causes electroconduits. Thus "smooth" surfaces comprise monolayers
comprising three
components: an insulator species, a EFS, and a species comprising the capture
ligand, although in
some circumstances, for example when the capture ligand species is included at
high density, the
capture ligand species can serve as the EFS. "Smoothness" in this context is
not measured physically
but rather as a function of an increase in the measured signal when EFS are
included. That is, the
signal from a detection electrode coated with monolayer forming species is
compared to a signal from
a detection electrode coated with monolayer forming species including a EFS.
An increase indicates
that the surface is relatively smooth, since the inclusion of a EFS served to
facilitate the access of the
ETM to the electrode. It should also be noted that while the discussion herein
is mainly directed to
gold electrodes and thiol-containing monolayer forming species, other types of
electrodes and
monolayer-forming species can be used.
It should be noted that the "electroconduits" of mechanism-2 systems do not
result in direct contact of
sample components with the electrode surface; that is, the electroconduits are
not large pores or
holes that allow physical access to the electrode. Rather, without being bound
by theory, it appears
that the electroconduits allow certain types of ETMs, particularly hydrophobic
ETMs, to penetrate
72
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
sufficiently into the monolayer to allow detection. However, other types of
redox active species,
including some hydrophilic species, do not penentrate into the monolayer, even
with electroconduits
present. Thus, in general, redox active species that may be present in the
sample do not give
substantial signals as a result of the electroconduits. While the exact system
will vary with the
composition of the SAM and the choice of the ETM, in general, the test for a
suitable SAM to reduce
non-specific binding that also has sufficient electroconduits for ETM
detection is to add either
ferrocene or ferrocyanide to the SAM; the former should give a signal and the
latter should not.
Accordingly, in mechanism-1 systems, the monolayer comprises a first species
comprising a
conductive oligomer comprising the capture binding ligand, as is more fully
outlined below, and a
second species comprising a monolayer forming species, including either or
both insulators or
conductive oligomers.
In a preferred embodiment, the monolayer comprises electroconduit-forming
species. By
"electroconduit-forming species" or "EFS" herein is meant a molecule that is
capable of generating
sufficient electroconduits in a monolayer, generally of insulators such as
alkyl groups, to allow
detection of ETMs at the surface. In general, EFS have one or more of the
following qualities: they
may be relatively rigid molecules, for example as compared to an alkyl chain;
they may attach to the
electrode surface with a geometry different from the other monolayer forming
species (for example,
alkyl chains attached to gold surfaces with thiol groups are thought to attach
at roughly 45° angles,
and phenyl-acetylene chains attached to gold via thiols are thought to go down
at 90° angles); they
may have a structure that sterically interferes or interrupts the formation of
a tightly packed monolayer,
for example through the inclusion of branching groups such as alkyl groups, or
the inclusion of highly
flexible species, such as polyethylene glycol units; or they may be capable of
being activated to form
electroconduits; for example, photoactivatible species that can be selectively
removed from the
surface upon photoactivation, leaving electroconduits.
Preferred EFS include conductive oligomers, as defined below, and phenyl-
acetylene-polyethylene
glycol species. However, in some embodiments, the EFS is not a conductive
oligomer.
In a preferred embodiment, the monolayer comprises conductive oligomers. By
"conductive oligomer"
herein is meant a substantially conducting oligomer, preferably linear, some
embodiments of which
are referred to in the literature as "molecular wires". By "substantially
conducting" herein is meant that
the oligomer is capable of transfering electrons at 100 Hz. Generally, the
conductive oligomer has
substantially overlapping rr-orbitals, i.e. conjugated rr-orbitals, as between
the monomeric units of the
conductive oligomer, although the conductive oligomer may also contain one or
more sigma (a)
bonds. Additionally, a conductive oligomer may be defined functionally by its
ability to inject or receive
electrons into or from an associated ETM. Furthermore, the conductive oligomer
is more conductive
73
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
than the insulators as defined herein. Additionally, the conductive oligomers
of the invention are to be
distinguished from electroactive polymers, that themselves may donate or
accept electrons.
In a preferred embodiment, the conductive oligomers have a conductivity, S, of
from between about
10-6 to about 104 f2-'cm-', with from about 10'5 to about 103 S2-'cm-' being
preferred, with these S
values being calculated for molecules ranging from about 20A to about 200A. As
described below,
insulators have a conductivity S of about 10-' f2-'cm-' or lower, with less
than about 10-8 ~2~'cm-' being
preferred. See generally Gardner et al., Sensors and Actuators A 51 (1995) 57-
66, incorporated
herein by reference.
Desired characteristics of a conductive oligomer include high conductivity,
sufficient solubility in
organic solvents and/or water for synthesis and use of the compositions of the
invention, and
preferably chemical resistance to reactions that occur i) during binding
ligand synthesis (i.e. nucleic
acid synthesis, such that nucleosides containing the conductive oligomers may
be added to a nucleic
acid synthesizer during the synthesis of the compositions of the invention,
ii) during the attachment of
the conductive oligomer to an electrode, or iii) during binding assays. In
addition, conductive
oligomers that will promote the formation of self-assembled monolayers are
preferred.
The oligomers of the invention comprise at least two monomeric subunits, as
described herein. As is
described more fully below, oligomers include homo- and hetero-oligomers, and
include polymers.
In a preferred embodiment, the conductive oligomer has the structure depicted
in Structure 13:
Structure 13
~Y~B~D Y
a
n m
As will be understood by those in the art, all of the structures depicted
herein may have additional
atoms or structures; i.e. the conductive oligomer of Structure 1 may be
attached to ETMs, such as
electrodes, transition metal complexes, organic ETMs, and metallocenes, and to
binding ligands such
as nucleic acids, or to several of these. Unless otherwise noted, the
conductive oligomers depicted
herein will be attached at the left side to an electrode; that is, as depicted
in Structure 1, the left "Y" is
connected to the electrode as described herein. If the conductive oligomer is
to be attached to a
binding ligand, the right "Y", if present, is attached to the binding ligand
such as a nucleic acid, either
directly or through the use of a linker, as is described herein.
In this embodiment, Y is an aromatic group, n is an integer from 1 to 50, g is
either 1 or zero, a is an
integer from zero to 10, and m is zero or 1. When g is 1, B-D is a bond able
to conjugate with
neighboring bonds (herein referred to as a Aconjugated bond@), preferably
selected from acetylene,
alkene, substituted alkene, amide, azo, -C=N- (including -N=C-, -CR=N- and -
N=CR-), -Si=Si-, and -
74
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Si=C- (including -C=Si-, -Si=CR- and -CR=Si-). When g is zero, a is preferably
1, D is preferably
carbonyl, or a heteroatom moiety, wherein the heteroatom is selected from
oxygen, sulfur, nitrogen,
silicon or phosphorus. Thus, suitable heteroatom moieties include, but are not
limited to, -NH and -
NR, wherein R is as defined herein; substituted sulfur; sulfonyl (-SOz )
sulfoxide (-SO-); phosphine
oxide (-PO- and -RPO- ); and thiophosphine (-PS- and -RPS-). However, when the
conductive
oligomer is to be attached to a gold electrode, as outlined below, sulfur
derivatives are not preferred.
By "aromatic group" or grammatical equivalents herein is meant an aromatic
monocyclic or polycyclic
hydrocarbon moiety generally containing 5 to 14 carbon atoms (although larger
polycyclic rings
structures may be made) and any carbocylic ketone or thioketone derivative
thereof, wherein the
carbon atom with the free valence is a member of an aromatic ring. Aromatic
groups include arylene
groups and aromatic groups with more than two atoms removed. For the purposes
of this application
aromatic includes heterocycle. "Heterocycle" or "heteroaryl" means an aromatic
group wherein 1 to 5
of the indicated carbon atoms are replaced by a heteroatom chosen from
nitrogen, oxygen, sulfur,
phosphorus, boron and silicon wherein the atom with the free valence is a
member of an aromatic
ring, and any heterocyclic ketone and thioketone derivative thereof. Thus,
heterocycle includes
thienyl, furyl, pyrrolyl, pyrimidinyl, oxalyl, indolyl, purinyl, quinolyl,
isoquinolyl, thiazolyl, imidozyl, etc.
Importantly, the Y aromatic groups of the conductive oligomer may be
different, i.e. the conductive
oligomer may be a heterooligomer. That is, a conductive oligomer may comprise
a oligomer of a
single type of Y groups, or of multiple types of Y groups.
The aromatic group may be substituted with a substitution group, generally
depicted herein as R. R
groups may be added as necessary to affect the packing of the conductive
oligomers, i.e. R groups
may be used to alter the association of the oligomers in the monolayer. R
groups may also be added
to 1 ) alter the solubility of the oligomer or of compositions containing the
oligomers; 2) alter the
conjugation or electrochemical potential of the system; and 3) alter the
charge or characteristics at the
surface of the monolayer.
In a preferred embodiment, 'when the conductive oligomer is greater than three
subunits, R groups are
preferred to increase solubility when solution synthesis is done. However, the
R groups, and their
positions, are chosen to minimally effect the packing of the conductive
oligomers on a surface,
particularly within a monolayer, as described below. In general, only small R
groups are used within
the monolayer, with larger R groups generally above the surface of the
monolayer. Thus for example
the attachment of methyl groups to the portion of the conductive oligomer
within the monolayer to
increase solubility is preferred, with attachment of longer alkoxy groups, for
example, C3 to C10, is
preferably done above the monolayer surface. In general, for the systems
described herein, this
generally means that attachment of sterically significant R groups is not done
on any of the first two or
three oligomer subunits, depending on the average length of the molecules
making up the monolayer.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Suitable R groups include, but are not limited to, hydrogen, alkyl,,alcohol,
aromatic, amino, amido,
nitro, ethers, esters, aldehydes, sulfonyl, silicon moieties, halogens, sulfur
containing moieties,
phosphorus containing moieties, and ethylene glycols. In the structures
depicted herein, R is
hydrogen when the position is unsubstituted. It should be noted that some
positions may allow two
substitution groups, R and R', in which case the R and R' groups may be either
the same or different.
By "alkyl group" or grammatical equivalents herein is meant a straight or
branched chain alkyl group,
with straight chain alkyl groups being preferred. If branched, it may be
branched at one or more
positions, and unless specified, at any position. The alkyl group may range
from about 1 to about 30
carbon atoms (C1 -C30), with a preferred embodiment utilizing from about 1 to
about 20 carbon atoms
(C1 -C20), with about C1 through about C12 to about C15 being preferred, and
C1 to C5 being
particularly preferred, although in some embodiments the alkyl group may be
much larger. Also
included within the definition of an alkyl group are cycloalkyl groups such as
C5 and C6 rings, and
heterocyclic rings with nitrogen, oxygen, sulfur or phosphorus. Alkyl also
includes heteroalkyl, with
heteroatoms of sulfur, oxygen, nitrogen, and silicone being preferred. Alkyl
includes substituted alkyl
groups. By "substituted alkyl group" herein is meant an alkyl group further
comprising one or more
substitution moieties "R", as defined above.
By "amino groups" or grammatical equivalents herein is meant -NHz, -NHR and -
NRz groups, with R
being as defined herein.
By "vitro group" herein is meant an -NOZ group.
By "sulfur containing moieties" herein is meant compounds containing sulfur
atoms, including but not
limited to, thia-, thio- and sulfo- compounds, thiols (-SH and -SR), and
sulfides (-RSR-). By
"phosphorus containing moieties" herein is meant compounds containing
phosphorus, including, but
not limited to, phosphines and phosphates. By "silicon containing moieties"
herein is meant
compounds containing silicon.
By "ether" herein is meant an -O-R group. Preferred ethers include alkoxy
groups, with -O-(CHZ)ZCH3
and -O-(CHZ)4CH3 being preferred.
By "ester" herein is meant a -COOR group.
By "halogen" herein is meant bromine, iodine, chlorine, or fluorine. Preferred
substituted alkyls are
partially or fully halogenated alkyls such as CF3, etc.
By "aldehyde" herein is meant -RCHO groups.
76
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
By "alcohol" herein is meant -OH groups, and alkyl alcohols -ROH.
By "amido" herein is meant -RCONH- or RCONR- groups.
By "ethylene glycol" or "(poly)ethylene glycol" herein is meant a -(O-CHZ
CHZ)~ group, although each
carbon atom of the ethylene group may also be singly or doubly substituted,
i.e. -(O-CRz CRZ)~-, with
R as described above. Ethylene glycol derivatives with other heteroatoms in
place of oxygen (i.e. -(N-
CHZ-CHz)~- or -(S-CHz CHZ)~-, or with substitution groups) are also preferred.
Preferred substitution groups include, but are not limited to, methyl, ethyl,
propyl, alkoxy groups such
as -O-(CHZ)2CH3 and -O-(CHZ)4CH3 and ethylene glycol and derivatives thereof.
Preferred aromatic groups include, but are not limited to, phenyl, naphthyl,
naphthalene, anthracene,
phenanthroline, pyrole, pyridine, thiophene, porphyrins, and substituted
derivatives of each of these,
included fused ring derivatives.
In the conductive oligomers depicted herein, when g is 1, B-D is a bond
linking two atoms or chemical
moieties. In a preferred embodiment, B-D is a conjugated bond, containing
overlapping or conjugated
rr-orbitals.
Preferred B-D bonds are selected from acetylene (-C C-, also called alkyne or
ethyne), alkene (-
CH=CH-, also called ethylene), substituted alkene (-CR=CR-, -CH=CR- and -CR=CH-
), amide (-NH-
CO- and -NR-CO- or -CO-NH- and -CO-NR-), azo (-N=N-), esters and thioesters (-
CO-O-, -O-CO-, -
CS-O- and -O-CS-) and other conjugated bonds such as (-CH=N-, -CR=N-, -N=CH-
and -N=CR-), (-
SiH=SiH-, -SiR=SiH-, -SiR=SiH-, and -SiR=SiR-), (-SiH=CH-, -SiR=CH-, -SiH=CR-,
-SiR=CR-,
CH=SiH-, -CR=SiH-, -CH=SiR-, and -CR=SiR-). Particularly preferred B-D bonds
are acetylene,
alkene, amide, and substituted derivatives of these three, and azo. Especially
preferred B-D bonds
are acetylene, alkene and amide. The oligomer components attached to double
bonds may be in the
trans or cis conformation, or mixtures. Thus, either B or D may include
carbon, nitrogen or silicon.
The substitution groups are as defined as above for R.
When g=0 in the Structure 1 conductive oligomer, a is preferably 1 and the D
moiety may be carbonyl
or a heteroatom moiety as defined above.
As above for the Y rings, within any single conductive oligomer, the B-D bonds
(or D moieties, when
g=0) may be all the same, or at least one may be different. For example, when
m is zero, the
terminal B-D bond may be an amide bond, and the rest of the B-D bonds may be
acetylene bonds.
Generally, when amide bonds are present, as few amide bonds as possible are
preferable, but in
some embodiments all the B-D bonds are amide bonds. Thus, as outlined above
for the Y rings, one
77
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
type of B-D bond may be present in the conductive oligomer within a monolayer
as described below,
and another type above the monolayer level, for example to give greater
flexibility for nucleic acid
hybridization when the nucleic acid is attached via a conductive oligomer.
In the structures depicted herein, n is an integer from 1 to 50, although
longer oligomers may also be
used (see for example Schumm et al., Angew. Chem. Int. Ed. Engl. 1994
33(13):1360). Without
being bound by theory, it appears that for efficient hybridization of nucleic
acids on a surface, the
hybridization should occur at a distance from the surface, i.e. the kinetics
of hybridization increase as
a function of the distance from the surface, particularly for long
oligonucleotides of 200 to 300
basepairs. Accordingly, when a nucleic acid is attached via a conductive
oligomer, as is more fully
described below, the length of the conductive oligomer is such that the
closest nucleotide of the
nucleic acid is positioned from about 6A to about 100A (although distances of
up to 500A may be
used) from the electrode surface, with from about 15A to about 60A being
preferred and from about
25A to about 60A also being preferred. Accordingly, n will depend on the size
of the aromatic group,
but generally will be from about 1 to about 20, with from about 2 to about 15
being preferred and from
about 3 to about 10 being especially preferred.
In the structures depicted herein, m is either 0 or 1. That is, when m is 0,
the conductive oligomer
may terminate in the B-D bond or D moiety, i.e. the D atom is attached to the
nucleic acid either
directly or via a linker. In some embodiments, for example when the conductive
oligomer is attached
to a phosphate of the ribose-phosphate backbone of a nucleic acid, there may
be additional atoms,
such as a linker, attached between the conductive oligomer and the nucleic
acid. Additionally, as
outlined below, the D atom may be the nitrogen atom of the amino-modified
ribose. Alternatively,
when m is 1, the conductive oligomer may terminate in Y, an aromatic group,
i.e. the aromatic group is
attached to the nucleic acid or linker.
As will be appreciated by those in the art, a large number of possible
conductive oligomers may be
utilized. These include conductive oligomers falling within the Structure 1
and Structure 8 formulas, as
well as other conductive oligomers, as are generally known in the art,
including for example,
compounds comprising fused aromatic rings or Teflon-like oligomers, such as -
(CFZ)~-, -(CHF)~ and
-(CFR)~-. See for example, Schumm et al., Angew. Chem. Intl. Ed. Engl. 33:1361
(1994);Grosshenny
et al., Platinum Metals Rev. 40(1 ):26-35 (1996); Tour, Chem. Rev. 96:537-553
(1996); Hsung et al.,
Organometallics 14:4808-4815 (1995; and references cited therein, all of which
are expressly
incorporated by reference.
Particularly preferred conductive oligomers of this embodiment are depicted
below:
Structure 14
~Y~B-D Y
a
n m
78
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Structure 14 is Structure 13 when g is 1. Preferred embodiments of Structure
14 include: a is zero, Y
is pyrole or substituted pyrole; a is zero, Y is thiophene or substituted
thiophene; a is zero, Y is furan or
substituted furan; a is zero, Y is phenyl or substituted phenyl; a is zero, Y
is pyridine or substituted
pyridine; a is 1, B-D is acetylene and Y is phenyl or substituted phenyl (see
Structure 16 below). A
preferred embodiment of Structure 14 is also when a is one, depicted as
Structure 15 below:
Structure 15
--1---Y-B-D Y
n m
Preferred embodiments of Structure 15 are: Y is phenyl or substituted phenyl
and B-D is azo; Y is
phenyl or substituted phenyl and B-D is acetylene; Y is phenyl or substituted
phenyl and B-D is alkene;
Y is pyridine or substituted pyridine and B-D is acetylene; Y is thiophene or
substituted thiophene and
B-D is acetylene; Y is furan or substituted furan and B-D is acetylene; Y is
thiophene or furan (or
substituted thiophene or furan) and B-D are alternating alkene and acetylene
bonds.
Most of the structures depicted herein utilize a Structure 15 conductive
oligomer. However, any
Structure 15 oligomers may be substituted with any of the other structures
depicted herein, i.e.
Structure 13 or 20 oligomer, or other conducting oligomer, and the use of such
Structure 15 depiction
is not meant to limit the scope of the invention.
Particularly preferred embodiments of Structure 15 include Structures 16, 17,
18 and 19, depicted
below:
Structure 16
R R
R R a a R "~
Particularly preferred embodiments of Structure 16 include: n is two, m is
one, and R is hydrogen; n is
three, m is zero, and R is hydrogen; and the use of R groups to increase
solubility.
Structure 17
a a a a
R R o ~ R~R
When the B-D bond is an amide bond, as in Structure 17, the conductive
oligomers are pseudopeptide
oligomers. Although the amide bond in Structure 17 is depicted with the
carbonyl to the left, i.e. -
CONH-, the reverse may also be used, i.e. -NHCO-. Particularly preferred
embodiments of Structure
17 include: n is two, m is one, and R is hydrogen; n is three, m is zero, and
R is hydrogen (in this
embodiment, the terminal nitrogen (the D atom) may be the nitrogen of the
amino-modified ribose);
and the use of R groups to increase solubility.
Structure 18
79
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
R R R R R R
O
/ \ ~ \ p / \
R~R n ~ R~R n \ R~R /m
Preferred embodiments of Structure 18 include the first n is two, second n is
one, m is zero, and all R
groups are hydrogen, or the use of R groups to increase solubility.
Structure 19
R R R R
/ \ -
R~R ~ n
Preferred embodiments of Structure 19 include: the first n is three, the
second n is from 1-3, with m
being either 0 or 1, and the use of R groups to increase solubility.
In a preferred embodiment, the conductive oligomer has the structure depicted
in Structure 20:
Structure 20
~C-G-C J
n m
In this embodiment, C are carbon atoms, n is an integer from 1 to 50, m is 0
or 1, J is a heteroatom
selected from the group consisting of oxygen, nitrogen, silicon, phosphorus,
sulfur, carbonyl or
sulfoxide, and G is a bond selected from alkane, alkene or acetylene, such
that together with the two
carbon atoms the C-G-C group is an alkene (-CH=CH-), substituted alkene (-
CR=CR-) or mixtures
thereof (-CH=CR- or -CR=CH-), acetylene (-C C-), or alkane (-CRZ-CRZ , with R
being either
hydrogen or a substitution group as described herein). The G bond of each
subunit may be the same
or different than the G bonds of other subunits; that is, alternating
oligomers of alkene and acetylene
bonds could be used, etc. However, when G is an alkane bond, the number of
alkane bonds in the
oligomer should be kept to a minimum, with about six or less sigma bonds per
conductive oligomer
being preferred. Alkene bonds are preferred, and are generally depicted
herein, although alkane and
acetylene bonds may be substituted in any structure or embodiment described
herein as will be
appreciated by those in the art.
In some embodiments, for example when ETMs are not present, if m=0 then at
least one of the G
bonds is not an alkane bond.
In a preferred embodiment, the m of Structure 20 is zero. In a particularly
preferred embodiment, m is
zero and G is an alkene bond, as is depicted in Structure 21:
Structure 21
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
R
Y
n m
R
The alkene oligomer of structure 21, and others depicted herein, are generally
depicted in the
preferred traps configuration, although oligomers of cis or mixtures of traps
and cis may also be used.
As above, R groups may be added to alter the packing of the compositions on an
electrode, the
hydrophilicity or hydrophobicity of the oligomer, and the flexibility, i.e.
the rotational, torsional or
longitudinal flexibility of the oligomer. n is as defined above.
In a preferred embodiment, R is hydrogen, although R may be also alkyl groups
and polyethylene
glycols or derivatives.
In an alternative embodiment, the conductive oligomer may be a mixture of
different types of
oligomers, for example of structures 13 and 20.
In addition, particularly for use with mechanism-2 systems, the monolayer
comprises conductive
oligomers, and the terminus of at least some of the conductive oligomers in
the monolayer are
electronically exposed. By "electronically exposed" herein is meant that upon
the placement of an
ETM in close proximity to the terminus, and after initiation with the
appropriate signal, a signal
dependent on the presence of the ETM may be detected. The conductive oligomers
may or may not
have terminal groups. Thus, in a preferred embodiment, there is no additional
terminal group, and the
conductive oligomer terminates with one of the groups depicted in the
structures; for example, a B-D
bond such as an acetylene bond. Alternatively, in a preferred embodiment, a
terminal group is added,
sometimes depicted herein as "Q". A terminal group may be used for several
reasons; for example, to
contribute to the electronic availability of the conductive oligomer for
detection of ETMs, or to alter the
surface of the SAM for other reasons, for example to prevent non-specific
binding. For example,
when the target analyte is a nucleic acid, there may be negatively charged
groups on the terminus to
form a negatively charged surface such that when the nucleic acid is DNA or
RNA the nucleic acid is
repelled or prevented from lying down on the surface, to facilitate
hybridization. Preferred terminal
groups include -NH2, -OH, -COOH, and alkyl groups such as -CH3, and
(poly)alkyloxides such as
(poly)ethylene glycol, with -OCHZCHzOH, -(OCHZCHzO)2H, -(OCHZCH20)3H, and -
(OCHzCHzO)4H
being preferred.
In one embodiment, it is possible to use mixtures of conductive oligomers with
different types of
terminal groups. Thus, for example, some of the terminal groups may facilitate
detection, and some
may prevent non-specific binding.
81
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
It will be appreciated that the monolayer may comprise different conductive
oligomer species, although
preferably the different species are chosen such that a reasonably uniform SAM
can be formed.
Thus, for example, when capture binding ligands such as nucleic acids are
covalently attached to the
electrode using conductive oligomers, it is possible to have one type of
conductive oligomer used to
attach the nucleic acid, and another type functioning to detect the ETM.
Similarly, it may be desirable
to have mixtures of different lengths of conductive oligomers in the
monolayer, to help reduce non-
specific signals. Thus, for example, preferred embodiments utilize conductive
oligomers that
terminate below the surface of the rest of the monolayer, i.e. below the
insulator layer, if used, or
below some fraction of the other conductive oligomers. Similarly, the use of
different conductive
oligomers may be done to facilitate monolayer formation, or to make monolayers
with altered
properties.
In a preferred embodiment, the monolayer may further comprise insulator
moieties. By "insulator"
herein is meant a substantially nonconducting oligomer, preferably linear. By
"substantially
nonconducting" herein is meant that the insulator will not transfer electrons
at 100 Hz. The rate of
electron transfer through the insulator is preferrably slower than the rate
through the conductive
oligomers described herein.
In a preferred embodiment, the insulators have a conductivity, S, of about
10'' f2-'cm-' or lower, with
less than about 10'8 ~-'cm-' being preferred. See generally Gardner et al.,
supra.
Generally, insulators are alkyl or heteroalkyl oligomers or moieties with
sigma bonds, although any
particular insulator molecule may contain aromatic groups or one or more
conjugated bonds. By
"heteroalkyl" herein is meant an alkyl group that has at least one heteroatom,
i.e. nitrogen, oxygen,
sulfur, phosphorus, silicon or boron included in the chain. Alternatively, the
insulator may be quite
similar to a conductive oligomer with the addition of one or more heteroatoms
or bonds that serve to
inhibit or slow, preferably substantially, electron transfer.
Suitable insulators are known in the art, and include, but are not limited to,
-(CHz)~-, -(CRH)~ , and
(CRZ)n-, ethylene glycol or derivatives using other heteroatoms in place of
oxygen, i.e. nitrogen or
sulfur (sulfur derivatives are not preferred when the electrode is gold).
As for the conductive oligomers, the insulators may be substituted with R
groups as defined herein to
alter the packing of the moieties or conductive oligomers on an electrode, the
hydrophilicity or
hydrophobicity of the insulator, and the flexibility, i.e. the rotational,
torsional or longitudinal flexibility of
the insulator. For example, branched alkyl groups may be used. Similarly, the
insulators may contain
terminal groups, as outlined above, particularly to influence the surface of
the monolayer.
82
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The length of the species making up the monolayer will vary as needed. As
outlined above, it appears
that binding of target analytes (for example, hybridization of nucleic acids)
is more efficient at a
distance from the surface. The species to which capture binding ligands are
attached (as outlined
below, these can be either insulators or conductive oligomers) may be
basically the same length as
the monolayer forming species or longer than them, resulting in the capture
binding ligands being
more accessible to the solvent for hybridization. In some embodiments, the
conductive oligomers to
which the capture binding ligands are attached may be shorter than the
monolayer.
As will be appreciated by those in the art, the actual combinations and ratios
of the different species
making up the monolayer can vary widely, and will depend on whether mechanism-
1 or -2 is used.
Generally, three component systems are preferred for mechanism-2 systems, with
the first species
comprising a capture binding ligand containing species (termed a capture probe
when the target
analyte is a nucleic acid), attached to the electrode via either an insulator
or a conductive oligomer.
The second species are the conductive oligomers, and the third species are
insulators. In this
embodiment, the first species can comprise from about 90% to about 1 %, with
from about 20% to
about 40% being preferred. When the target analytes are nucleic acids, from
about 30% to about
40% is especially preferred for short oligonucleotide targets and from about
10% to about 20% is
preferred for longer targets. The second species can comprise from about 1 %
to about 90%, with
from about 20% to about 90% being preferred, and from about 40% to about 60%
being especially
preferred. The third species can comprise from about 1 % to about 90%, with
from about 20% to
about 40% being preferred, and from about 15% to about 30% being especially
preferred. Preferred
ratios of firstaecondahird species are 2:2:1 for short targets, 1:3:1 for
longer targets, with total thiol
concentration (when used to attach these species, as is more fully outlined
below) in the 500 uM to 1
mM range, and 833 pM being preferred.
Alternatively, two component systems can be used. In one embodiment, for use
in either mechanism-
1 or mechanism-2 systems, the two components are the first and second species.
In this
embodiment, the first species can comprise from about 1 % to about 90%, with
from about 1 % to about
40% being preferred, and from about 10% to about 40% being especially
preferred. The second
species can comprise from about 1 % to about 90%, with from about 10% to about
60% being
preferred, and from about 20% to about 40% being especially preferred.
Alternatively, for
mechanism-1 systems, the two components are the first and the third species.
In this embodiment,
the first species can comprise from about 1 % to about 90%, with from about 1
% to about 40% being
preferred, and from about 10% to about 40% being especially preferred. The
second species can
comprise from about 1 % to about 90%, with from about 10% to about 60% being
preferred, and from
about 20% to about 40% being especially preferred.
The covalent attachment of the conductive oligomers and insulators to the
electrode may be
accomplished in a variety of ways, depending on the electrode and the
composition of the insulators
83
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
and conductive oligomers used. The attachment linkers (which can comprise
insulators and
conductive oligomers), which are used to covalently attach nucleic acid
species (capture and detection
probes) to the electrode, are attached in a similar manner. Thus, one end or
terminus of the
attachment linker is attached to the nucleoside or nucleic acid, and the other
is attached to an
electrode. In some embodiments it may be desirable to have the attachment
linker attached at a
position other than a terminus, or even to have a branched attachment linker
that is attached to an
electrode at one terminus and to two or more nucleosides at other termini,
although this is not
preferred. Similarly, the attachment linker may be attached at two sites to
the electrode, as is generally
depicted in Structures 23-25. Generally, some type of linker is used, as
depicted below as "A" in
Structure 22, where "X" is the conductive oligomer, "I" is an insulator and
the hatched surface is the
electrode:
Structure 22
A X
A I
In this embodiment, A is a linker or atom. The choice of "A" will depend in
part on the characteristics
of the electrode. Thus, for example, A may be a sulfur moiety when a gold
electrode is used.
Alternatively, when metal oxide electrodes are used, A may be a silicon
(silane) moiety attached to the
oxygen of the oxide (see for example Chen et al., Langmuir 10:3332-3337
(1994); Lenhard et al., J.
Electroanal. Chem. 78:195-201 (1977), both of which are expressly incorporated
by reference). When
carbon based electrodes are used, A may be an amino moiety (preferably a
primary amine; see for
example Deinhammer et al., Langmuir 10:1306-1313 (1994)). Thus, preferred A
moieties include, but
are not limited to, silane moieties, sulfur moieties (including alkyl sulfur
moieties), and amino moieties.
In a preferred embodiment, epoxide type linkages with redox polymers such as
are known in the art
are not used.
Although depicted herein as a single moiety, the insulators and conductive
oligomers may be attached
to the electrode with more than one "A" moiety; the "A" moieties may be the
same or different. Thus,
for example, when the electrode is a gold electrode, and "A" is a sulfur atom
or moiety, multiple sulfur
atoms may be used to attach the conductive oligomer to the electrode, such as
is generally depicted
below in Structures 23, 24 and 25. As will be appreciated by those in the art,
other such structures
can be made. In Structures 23, 24 and 25, the A moiety is just a sulfur atom,
but substituted sulfur
moieties may also be used.
84
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Structure 23
s
-s ~ X orb
Structure 24
S R
-S X orl
Structure 25
" R
S/~\Xorl
I
It should also be noted that similar to Structure 25, it may be possible to
have a a conductive oligomer
5 terminating in a single carbon atom with three sulfur moities attached to
the electrode. Additionally,
although not always depicted herein, the conductive oligomers and insulators
may also comprise a "Q"
terminal group.
In a preferred embodiment, the electrode is a gold electrode, and attachment
is via a sulfur linkage as
is well known in the art, i.e. the A moiety is a sulfur atom or moiety.
Although the exact characteristics
of the gold-sulfur attachment are not known, this linkage is considered
covalent for the purposes of
this invention. A representative structure is depicted in Structure 26, using
the Structure 15 conductive
oligomer, although as for all the structures depicted herein, any of the
conductive oligomers, or
combinations of conductive oligomers, may be used. Similarly, any of the
conductive oligomers or
insulators may also comprise terminal groups as described herein. Structure 26
depicts the "A" linker
as comprising just a sulfur atom, although additional atoms may be present
(i.e. linkers from the sulfur
to the conductive oligomer or substitution groups). In addition, Structure 26
shows the sulfur atom
attached to the Y aromatic group, but as will be appreciated by those in the
art, it may be attached to
the B-D group (i.e. an acetylene) as well.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Structure 26
S~Y-B-D~Y
~n ~ ~m
In general, thiol linkages are preferred when either two sets of electrodes
are used (i.e. the detection
electrodes comprising the SAMs are not used at high electrophoretic voltages
(i.e. greater than 800 or
900 mV), that can cause oxidation of the thiol linkage and thus loss of the
SAM), or, if one set of
0
electrodes is used, lower electrophoretic voltages are used as is generally
described below.
In a preferred embodiment, the electrode is a carbon electrode, i.e. a glassy
carbon electrode, and
attachment is via a nitrogen of an amine group. A representative structure is
depicted in Structure 27.
Again, additional atoms may be present, i.e. Z type linkers and/or terminal
groups.
Structure 27
H~Y B D Y
n m
Structure 28
O-Si-/-Y-B-D~Y
~n ~ /m
In Structure 28, the oxygen atom is from the oxide of the metal oxide
electrode. The Si atom may also
contain other atoms, i.e. be a silicon moiety containing substitution groups.
Other attachments for
SAMs to other electrodes are known in the art; see for example Napier et al.,
Langmuir, 1997, for
attachment to indium tin oxide electrodes, and also the chemisorption of
phosphates to an indium tin
oxide electrode (talk by H. Holden Thorpe, CHI conference, May 4-5, 1998).
In a preferred embodiment, the electrode comprises either capture probes to
anchor the assay
complexes to the electrode (used in either mechanism-1 or mechanism-2
systems), or detection
probes (for mechanism-1 systems). Since the capture probes are not used for
detection, the capture
probes may be attached using attachment linkers, which may include either
conductive oligomers or
insulators, as described below. Detection probes used in mechanism-1 systems
are attached using
conductive oligomers.
86
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The capture probe nucleic acid is covalently attached to the electrode, via an
"attachment linker", that
can be either a conductive oligomer (required for mechanism-1 systems) or an
insulator. By
"covalently attached" herein is meant that two moieties are attached by at
least one bond, including
sigma bonds, pi bonds and coordination bonds.
Thus, one end of the attachment linker is attached to a nucleic acid (or other
binding ligand), and the
other end (although as will be appreciated by those in the art, it need not be
the exact terminus for
either) is attached to the electrode. Thus, any of structures depicted herein
may further comprise a
nucleic acid effectively as a terminal group. Thus, the present invention
provides compositions
comprising nucleic acids covalently attached to electrodes as is generally
depicted below in Structure
29:
Structure 29
F,-(X or I) -F2-nucleic acid
In Structure 29, the hatched marks on the left represent an electrode. X is a
conductive oligomer and
I is an insulator as defined herein. F, is a linkage that allows the covalent
attachment of the electrode
and the conductive oligomer or insulator, including bonds, atoms or linkers
such as is described
herein, for example as "A", defined below. F2 is a linkage that allows the
covalent attachment of the
conductive oligomer or insulator to the nucleic acid, and may be a bond, an
atom or a linkage as is
herein described. F2 may be part of the conductive oligomer, part of the
insulator, part of the nucleic
acid, or exogeneous to both, for example, as defined herein for "Z".
The SAMs of the invention can be made in a variety of ways, including
deposition out of organic
solutions and deposition out of aqueous solutions. The methods outlined herein
use a gold electrode
as the example, although as will be appreciated by those in the art, other
metals and methods may be
used as well. In one preferred embodiment, indium-tin-oxide (1T0) is used as
the electrode.
In a preferred embodiment, a gold surface is first cleaned. A variety of
cleaning procedures may be
employed, including, but not limited to, chemical cleaning or etchants
(including Piranha solution
(hydrogen peroxide/sulfuric acid) or aqua regia (hydrochloric acid/nitric
acid), electrochemical
methods, flame treatment, plasma treatment or combinations thereof.
Following cleaning, the gold substrate is exposed to the SAM species. When the
electrode is ITO, the
SAM species are phosphonate-containing species. This can also be done in a
variety of ways,
including, but not limited to, solution deposition, gas phase deposition,
microcontact printing, spray
deposition, deposition using neat components, etc. A preferred embodiment
utilizes a deposition
87
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
solution comprising a mixture of various SAM species in solution, generally
thiol-containing species.
Mixed monolayers that contain nucleic acids are usually prepared using a two
step procedure. The
thiolated nucleic acid is deposited during the first deposition step
(generally in the presence of at least
one other monolayer-forming species) and the mixed monolayer formation is
completed during the
second step in which a second thiol solution minus nucleic acid is added. The
second step frequently
involves mild heating to promote monolayer reorganization.
In a preferred embodiment, the deposition solution is an organic deposition
solution. In this
embodiment, a clean gold surface is placed into a clean vial. A binding ligand
deposition solution in
organic solvent is prepared in which the total thiol concentration is between
micromolar to saturation;
preferred ranges include from about 1 NM to 10 mM, with from about 400 uM to
about 1.0 mM being
especially preferred. In a preferred embodiment, the deposition solution
contains thiol modified DNA
(i.e. nucleic acid attached to an attachment linker) and thiol diluent
molecules (either conductive
oligomers or insulators, with the latter being preferred). The ratio of
nucleic acid to diluent (if present)
is usually between 1000:1 to 1:1000, with from about 10:1 to about 1:10 being
preferred and 1:1 being
especially preferred. The preferred solvents are tetrahydrofuran (THF),
acetonitrile, dimethylforamide
(DMF), ethanol, or mixtures thereof; generally any solvent of sufficient
polarity to dissolve the capture
ligand can be used, as long as the solvent is devoid of functional groups that
will react with the
surface. Sufficient nucleic acid deposition solution is added to the vial so
as to completely cover the
electrode surface. The gold substrate is allowed to incubate at ambient
temperature or slightly above
ambient temperature for a period of time ranging from seconds to hours, with 5-
30 minutes being
preferred. After the initial incubation, the deposition solution is removed
and a solution of diluent
molecule only (from about 1 NM to 10 mM, with from about 100 uM to about 1.0
mM being preferred)
in organic solvent is added. The gold substrate is allowed to incubate at room
temperature or above
room temperature for a period of time (seconds to days, with from about 10
minutes to about 24 hours
being preferred). The gold sample is removed from the solution, rinsed in
clean solvent and used.
In a preferred embodiment, an aqueous deposition solution is used. As above, a
clean gold surface is
placed into a clean vial. A nucleic acid deposition solution in water is
prepared in which the total thiol
concentration is between about 1 uM and 10 mM, with from about 1 NM to about
200 uM being
preferred. The aqueous solution frequently has salt present (up to saturation,
with approximately 1 M
being preferred), however pure water can be used. The deposition solution
contains thiol modified
nucleic acid and often a thiol diluent molecule. The ratio of nucleic acid to
diluent is usually between
between 1000:1 to 1:1000, with from about 10:1 to about 1:10 being preferred
and 1:1 being especially
preferred. The nucleic acid deposition solution is added to the vial in such a
volume so as to
completely cover the electrode surface. The gold substrate is allowed to
incubate at ambient
temperature or slightly above ambient temperature for 1-30 minutes with 5
minutes usually being
sufficient. After the initial incubation, the deposition solution is removed
and a solution of diluent
molecule only (10 uM -1.0 mM) in either water or organic solvent is added. The
gold substrate is
88
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
allowed to incubate at room temperature or above room temperature until a
complete monolayer is
formed (10 minutes-24 hours). The gold sample is removed from the solution,
rinsed in clean solvent
and used.
In a preferred embodiment, as outlined herein, a circuit board is used as the
substrate for the gold
electrodes. Formation of the SAMs on the gold surface is generally done by
first cleaning the boards,
for example in a 10% sulfuric acid solution for 30 seconds, detergent
solutions, aqua regia, plasma,
etc., as outlined herein. Following the sulfuric acid treatment, the boards
are washed, for example via
immersion in two Milli-Q water baths for 1 minute each. The boards are then
dried, for example under
a stream of nitrogen. Spotting of the deposition solution onto the boards is
done using any number of
known spotting systems, generally by placing the boards on an X-Y table,
preferably in a humidity
chamber. The size of the spotting drop will vary with the size of the
electrodes on the boards and the
equipment used for delivery of the solution; for example, for 250 NM size
electrodes, a 30 nanoliter
drop is used. The volume should be sufficient to cover the electrode surface
completely. The drop is
incubated at room temperature for a period of time (sec to overnight, with 5
minutes preferred) and
then the drop is removed by rinsing in a Milli-Q water bath. The boards are
then preferably treated
with a second deposition solution, generally comprising insulator in organic
solvent, preferably
acetonitrile, by immersion in a 45°C bath. After 30 minutes, the boards
are removed and immersed in
an acetonitrile bath for 30 seconds followed by a milli-Q water bath for 30
seconds. The boards are
dried under a stream of nitrogen.
In a preferred embodiment, the electrode comprising the monolayer including
conductive oligomers
further comprises a nucleic acid capture probe. The capture probe nucleic acid
is covalently attached
to the electrode. This attachment can be via a conductive oligomer or via an
insulator. By "capture .
probe" or "anchor probe" herein is meant a component of an assay complex as
defined herein that
allows the attachment of a target sequence to the electrode, for the purposes
of detection. As is more
fully outlined below, attachment of the target sequence to the capture probe
may be direct (i.e. the
target sequence hybridizes to the capture probe) or indirect (one or more
capture extender probes are
used). By "covalently attached" herein is meant that two moieties are attached
by at least one bond,
including sigma bonds, pi bonds and coordination bonds. In addition, as is
more fully outlined below,
the capture probes may have both nucleic and non-nucleic acid portions. Thus,
for example, flexible
linkers such as alkyl groups, including polyethylene glycol linkers, may be
used to get the nucleic acid
portion of the capture probe off the electrode surface. This may be
particularly useful when the target
sequences are large, for example when genomic DNA or rRNA is the target.
In a preferred embodiment, the capture probe nucleic acid is covalently
attached to the electrode via a
conductive oligomer. The covalent attachment of the nucleic acid and the
conductive oligomer may be
accomplished in several ways. In a preferred embodiment, the attachment is via
attachment to the
base of the nucleoside, via attachment to the backbone of the nucleic acid
(either the ribose, the
89
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
phosphate, or to an analogous group of a nucleic acid analog backbone), or via
a transition metal
ligand, as described below. The techniques outlined below are generally
described for naturally
occuring nucleic acids, although as will be appreciated by those in the art,
similar techniques may be
used with nucleic acid analogs, and in some cases with other binding ligands.
In a preferred embodiment, the conductive oligomer is attached to the base of
a nucleoside of the
nucleic acid. This may be done in several ways, depending on the oligomer, as
is described below. In
one embodiment, the oligomer is attached to a terminal nucleoside, i.e. either
the 3' or 5' nucleoside of
the nucleic acid. Alternatively, the conductive oligomer is attached to an
internal nucleoside.
The point of attachment to the base will vary with the base. Generally,
attachment at any position is
possible. In some embodiments, for example when the probe containing the ETMs
may be used for
hybridization (i.e. mechanism-1 systems) , it is preferred to attach at
positions not involved in hydrogen
bonding to the complementary base. Thus, for example, generally attachment is
to the 5 or 6 position
of pyrimidines such as uridine, cytosine and thymine. For purines such as
adenine and guanine, the
linkage is preferably via the 8 position. Attachment to non-standard bases is
preferably done at the
comparable positions.
In one embodiment, the attachment is direct; that is, there are no intervening
atoms between the
conductive oligomer and the base. In this embodiment, for example, conductive
oligomers with
terminal acetylene bonds are attached directly to the base. Structure 30 is an
example of this linkage,
using a Structure 15 conductive oligomer and uridine as the base, although
other bases and
conductive oligomers can be used as will be appreciated by those in the art:
Structure 30
0
~Y-B-D--r Y
1\ ~n \ NH
N ~O
O
It should be noted that the pentose structures depicted herein may have
hydrogen, hydroxy,
phosphates or other groups such as amino groups attached. In addition, the
pentose and nucleoside
structures depicted herein are depicted non-conventionally, as mirror images
of the normal rendering.
In addition, the pentose and nucleoside structures may also contain additional
groups, such as
protecting groups, at any position, for example as needed during synthesis.
In addition, the base may contain additional modifications as needed, i.e. the
carbonyl or amine
groups may be altered or protected.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In an alternative embodiment, the attachment is any number of different Z
linkers, including amide and
amine linkages, as is generally depicted in Structure 31 using uridine as the
base and a Structure 15
oligomer:
Structure 31:
NHZ
-1-Y-B-D-H-Y-1-
~n~ ~m ~ -N
N ~O
O
In this embodiment, Z is a linker. Preferably, Z is a short linker of about 1
to about 10 atoms, with
from 1 to 5 atoms being preferred, that may or may not contain alkene,
alkynyl, amine, amide, azo,
imine, etc., bonds. Linkers are known in the art; for example, homo-or hetero-
bifunctional linkers as
are well known (see 1994 Pierce Chemical Company catalog, technical section on
cross-linkers,
pages 155-200, incorporated herein by reference). Preferred Z linkers include,
but are not limited to,
alkyl groups (including substituted alkyl groups and alkyl groups containing
heteroatom moieties), with
short alkyl groups, esters, amide, amine, epoxy groups and ethylene glycol and
derivatives being
preferred, with propyl, acetylene, and CZ alkene being especially preferred. Z
may also be a sulfone
group, forming sulfonamide linkages as discussed below.
In a preferred embodiment, the attachment of the nucleic acid and the
conductive oligomer is done via
attachment to the backbone of the nucleic acid. This may be done in a number
of ways, including
attachment to a ribose of the ribose-phosphate backbone, or to the phosphate
of the backbone, or
other groups of analogous backbones.
As a preliminary matter, it should be understood that the site of attachment
in this embodiment may be
to a 3' or 5' terminal nucleotide, or to an internal nucleotide, as is more
fully described below.
In a preferred embodiment, the conductive oligomer is attached to the ribose
of the ribose-phosphate
backbone. This may be done in several ways. As is known in the art,
nucleosides that are modified at
either the 2' or 3' position of the ribose with amino groups, sulfur groups,
silicone groups, phosphorus
groups, or oxo groups can be made (Imazawa et al., J. Org. Chem., 44:2039
(1979); Hobbs et al., J.
Org. Chem. 42(4):714 (1977); Verheyden et al., J. Orrg. Chem. 36(2):250 (1971
); McGee et al., J.
Org. Chem. 61:781-785 (1996); Mikhailopulo et al., Liebigs. Ann. Chem. 513-519
(1993); McGee et
al., Nucleosides & Nucleotides 14(6):1329 (1995), all of which are
incorporated by reference). These
modified nucleosides are then used to add the conductive oligomers.
91
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
A preferred embodiment utilizes amino-modified nucleosides. These amino-
modified riboses can then
be used to form either amide or amine linkages to the conductive oligomers. In
a preferred
embodiment, the amino group is attached directly to the ribose, although as
will be appreciated by
those in the art, short linkers such as those described herein for "Z" may be
present between the
amino group and the ribose.
In a preferred embodiment, an amide linkage is used for attachment to the
ribose. Preferably, if the
conductive oligomer of Structures 13- 15 is used, m is zero and thus the
conductive oligomer
terminates in the amide bond. In this embodiment, the nitrogen of the amino
group of the amino-
modified ribose is the "D" atom of the conductive oligomer. Thus, a preferred
attachment of this
embodiment is depicted in Structure 32 (using the Structure 13 conductive
oligomer):
Structure 32
0
0
~Y-B-~Y-C-H-base
~n
As will be appreciated by those in the art, Structure 32 has the terminal bond
fixed as an amide bond.
In a preferred embodiment, a heteroatom linkage is used, i.e. oxo, amine,
sulfur, etc. A preferred
embodiment utilizes an amine linkage. Again, as outlined above for the amide
linkages, for amine
linkages, the nitrogen of the amino-modified ribose may be the "D" atom of the
conductive oligomer
when the Structure 3 conductive oligomer is used. Thus, for example,
Structures 33 and 34 depict
nucleosides with the Structures 13 and 21 conductive oligomers, respectively,
using the nitrogen as
the heteroatom, athough other heteroatoms can be used:
Structure 33
~ ~ ~~~ 0
--r Y- B- ~Y~ Z
~n t H base
In Structure 33, preferably both m and t are not zero. A preferred Z here is a
methylene group, or
other aliphatic alkyl linkers. One, two or three carbons in this position are
particularly useful for
synthetic reasons.
Structure 34
R \
~ ~ \O
~-~- Yi \ Z' ' N
/p \ m t H base
In Structure 34, Z is as defined above. Suitable linkers include methylene and
ethylene.
92
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In an alternative embodiment, the conductive oligomer is covalently attached
to the nucleic acid via the
phosphate of the ribose-phosphate backbone (or analog) of a nucleic acid. In
this embodiment, the
attachment is direct, utilizes a linker or via an amide bond. Structure 35
depicts a direct linkage, and
Structure 36 depicts linkage via an amide bond (both utilize the Structure 13
conductive oligomer,
although Structure 20 conductive oligomers are also possible). Structures 35
and 36 depict the
conductive oligomer in the 3' position, although the 5' position is also
possible. Furthermore, both
Structures 35 and 36 depict naturally occurring phosphodiester bonds, although
as those in the art will
appreciate, non-standard analogs of phosphodiester bonds may also be used.
Structure 35
base
O
O
Y-B-~Y~ Z~ ~ =0 or S
/n m~ ~t
O
In Structure 35, if the terminal Y is present (i.e. m=1 ), then preferably Z
is not present (i.e. t=0). If the
terminal Y is not present, then Z is preferably present.
Structure 36 depicts a preferred embodiment, wherein the terminal B-D bond is
an amide bond, the
terminal Y is not present, and Z is a linker, as defined herein.
Structure 36
base
O
O O
-/-V -B-D~ V-C -H-Z-P -O or 5
/n
O
In a preferred embodiment, the conductive oligomer is covalently attached to
the nucleic acid via a
transition metal ligand. In this embodiment, the conductive oligomer is
covalently attached to a ligand
which provides one or more of the coordination atoms for a transition metal.
In one embodiment, the
ligand to which the conductive oligomer is attached also has the nucleic acid
attached, as is generally
depicted below in Structure 37. Alternatively, the conductive oligomer is
attached to one ligand, and
the nucleic acid is attached to another ligand, as is generally depicted below
in Structure 38. Thus, in
the presence of the transition metal, the conductive oligomer is covalently
attached to the nucleic acid.
Both of these structures depict Structure 13 conductive oligomers, although
other oligomers may be
utilized. Structures 37 and 38 depict two representative structures:
Structure 37
93
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
nucleic acid
~Y-B-D t-r-Y-f-tZ t-L:'
~ ~°' ~ ~' ~~~IVI
Lr
Structure 38
nucleic acid
~Y-B-D~Y~Z~L., L
Lr
The use of metal ions to connect the nucleic acids can serve as an internal
control or calibration of the
system, to evaluate the number of available nucleic acids on the surface.
However, as will be
appreciated by those in the art, if metal ions are used to connect the nucleic
acids to the conductive
oligomers, it is generally desirable to have this metal ion complex have a
different redox potential than
that of the ETMs used in the rest of the system, as described below. This is
generally true so as to be
able to distinguish the presence of the capture probe from the presence of the
target sequence. This
may be useful for identification, calibration and/or quantification. Thus, the
amount of capture probe
on an electrode may be compared to the amount of hybridized double stranded
nucleic acid to quantify
the amount of target sequence in a sample. This is quite significant to serve
as an internal control of
the sensor or system. This allows a measurement either prior to the addition
of target or after, on the
same molecules that will be used for detection, rather than rely on a similar
but different control
system. Thus, the actual molecules that will be used for the detection can be
quantified prior to any
experiment. This is a significant advantage over prior methods.
In a preferred embodiment, the capture probe nucleic acids are covalently
attached to the electrode
via an insulator. The attachment of nucleic acids to insulators such as alkyl
groups is well known, and
can be done to the base or the backbone, including the ribose or phosphate for
backbones containing
these moieties, or to alternate backbones for nucleic acid analogs.
In a preferred embodiment, there may be one or more different capture probe
species on the surface.
In some embodiments, there may be one type of capture probe, or one type of
capture probe
extender, as is more fully described below. Alternatively, different capture
probes, or one capture
probes with a multiplicity of different capture extender probes can be used.
Similarly, it may be
desirable (particular in the case of nucleic acid analytes and binding ligands
in mechanism-2 systems)
to use auxiliary capture probes that comprise relatively short probe
sequences, that can be used to
"tack down" components of the system, for example the recruitment linkers, to
increase the
concentration of ETMs at the surface.
Thus the present invention provides substrates comprising at least one
detection electrode comprising
monolayers and capture and/or detection probes, useful in target analyte
detection systems.
94
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The compositions of the invention are generally synthesized as outlined below,
generally utilizing
techniques well known in the art. As will be appreciated by those in the art,
many of the techniques
outlined below are directed to nucleic acids containing a ribose-phosphate
backbone. However, as
outlined above, many alternate nucleic acid analogs may be utilized, some of
which may not contain
either ribose or phosphate in the backbone. In these embodiments, for
attachment at positions other
than the base, attachment is done as will be appreciated by those in the art,
depending on the
backbone. Thus, for example, attachment can be made at the carbon atoms of the
PNA backbone,
as is described below, or at either terminus of the PNA.
The compositions may be made in several ways. A preferred method first
synthesizes a conductive
oligomer attached to a nucleoside, with addition of additional nucleosides to
form the capture probe
followed by attachment to the electrode. Alternatively, the whole capture
probe may be made and
then the completed conductive oligomer added, followed by attachment to the
electrode. Alternatively,
a monolayer of conductive oligomer (some of which have functional groups for
attachment of capture
probes) is attached to the electrode first, followed by attachment of the
capture probe. The latter two
methods may be preferred when conductive oligomers are used which are not
stable in the solvents
and under the conditions used in traditional nucleic acid synthesis.
In a preferred embodiment, the compositions of the invention are made by first
forming the conductive
oligomer covalently attached to the nucleoside, followed by the addition of
additional nucleosides to
form a capture probe nucleic acid, with the last step comprising the addition
of the conductive
oligomer to the electrode.
The attachment of the conductive oligomer to the nucleoside may be done in
several ways. In a
preferred embodiment, all or part of the conductive oligomer is synthesized
first (generally with a
functional group on the end for attachment to the electrode), which is then
attached to the nucleoside.
Additional nucleosides are then added as required, with the last step
generally being attachment to the
electrode. Alternatively, oligomer units are added one at a time to the
nucleoside, with addition of
additional nucleosides and attachment to the electrode. A number of
representative syntheses are
shown in the Figures of W098/20162, expressly incorporated herein by
reference.
The conductive oligomer is then attached to a nucleoside that may contain one
(or more) of the
oligomer units, attached as depicted herein.
In a preferred embodiment, attachment is to a ribose of the ribose-phosphate
backbone. Thus,
attachment via amide and amine linkages are possible (see Figures 1 and 2 of
W098/20162). In a
preferred embodiment, there is at least a methylene group or other short
aliphatic alkyl groups (as a Z
group) between the nitrogen attached to the ribose and the aromatic ring of
the conductive oligomer.
A representative synthesis is shown in Figure 16 of W098/20162.
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Alternatively, attachment is via a phosphate of the ribose-phosphate backbone.
Examples of two
synthetic schemes are shown in Figure 4 and Figure 5 of W098/20162. Although
both Figures show
attachment at the 3' position of the ribose, attachment can also be made via
the 2' position. In Figure
5, Z is an ethylene linker, although other linkers may be used as well, as
will be appreciated by those
in the art.
In a preferred embodiment, attachment is via the base. A general scheme is
depicted in Figure 3 of
W098/20162, using uridine as the nucleoside and a phenylene-acetylene
conductive oligomer. As
will be appreciated in the art, amide linkages are also possible, using
techniques well known in the art.
In a preferred embodiment, protecting groups may be added to the base prior to
addition of the
conductive oligomers, as is generally outlined in Figures 10 and 11 of
W098/20162. In addition, the
palladium cross-coupling reactions may be altered to prevent dimerization
problems; i.e. two
conductive oligomers dimerizing, rather than coupling to the base.
Alternatively, attachment to the base may be done by making the nucleoside
with one unit of the
oligomer, followed by the addition of others.
Once the modified nucleosides are prepared, protected and activated, prior to
attachment to the
electrode, they may be incorporated into a growing oligonucleotide by standard
synthetic techniques
(Gait, Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, UK
1984; Eckstein) in
several ways.
In one embodiment, one or more modified nucleosides are converted to the
triphosphate form and
incorporated into a growing oligonucleotide chain by using standard molecular
biology techniques such
as with the use of the enzyme DNA polymerise I, T4 DNA polymerise, T7 DNA
polymerise, Taq
DNA polymerise, reverse transcriptase, and RNA polymerises. For the
incorporation of a 3' modified
nucleoside to a nucleic acid, terminal deoxynucleotidyltransferase may be
used. (Ratliff, Terminal
deoxynucleotidyltransferase. In The Enzymes, Vol 14A. P.D. Boyer ed. pp 105-
118. Academic Press,
San Diego, CA. 1981 ). Thus, the present invention provides
deoxyribonucleoside triphosphates
comprising a covalently attached ETM. Preferred embodiments utilize ETM
attachment to the base or
the backbone, such as the ribose (preferably in the 2' position), as is
generally depicted below in
Structures 40 and 41:
Structure 40
0 0 0
-o-P--o-P-o-~o
o- o- o
Cf~ base--Z-ETM
HO
96
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Structure 41
0
-0-P-O
0.
Thus, in some embodiments, it may be possible to generate the nucleic acids
comprising ETMs in
situ. For example, a target sequence can hybridize to a capture probe (for
example on the surface) in
such a way that the terminus of the target sequence is exposed, i.e.
unhybridized. The addition of
enzyme and triphosphate nucleotides labelled with ETMs allows the in situ
creation of the label.
Similarly, using labeled nucleotides recognized by polymerases can allow
simultaneous amplification
and detection; that is, the target sequences are generated in situ.
In a preferred embodiment, the modified nucleoside is converted to the
phosphoramidite or H-
phosphonate form, which are then used in solid-phase or solution syntheses of
oligonucleotides. In
this way the modified nucleoside, either for attachment at the ribose (i.e.
amino- or thiol-modified
nucleosides) or the base, is incorporated into the oligonucleotide at either
an internal position or the 5'
terminus. This is generally done in one of two ways. First, the 5' position of
the ribose is protected
with 4',4-dimethoxytrityl (DMT) followed by reaction with either 2-cyanoethoxy-
bis-
diisopropylaminophosphine in the presence of diisopropylammonium tetrazolide,
or by reaction with
chlorodiisopropylamino 2'-cyanoethyoxyphosphine, to give the phosphoramidite
as is known in the art;
although other techniques may be used as will be appreciated by those in the
art. See Gait, supra;
Caruthers, Science 230:281 (1985), both of which are expressly incorporated
herein by reference.
For attachment of a group to the 3' terminus, a preferred method utilizes the
attachment of the
modified nucleoside (or the nucleoside replacement) to controlled pore glass
(CPG) or other
oligomeric supports. In this embodiment, the modified nucleoside is protected
at the 5' end with DMT,
and then reacted with succinic anhydride with activation. The resulting
succinyl compound is attached
to CPG or other oligomeric supports as is known in the art. Further
phosphoramidite nucleosides are
added, either modified or not, to the 5' end after deprotection. Thus, the
present invention provides
conductive oligomers or insulators covalently attached to nucleosides attached
to solid oligomeric
supports such as CPG, and phosphoramidite derivatives of the nucleosides of
the invention.
The invention further provides methods of making label probes with recruitment
linkers comprising
ETMs. These synthetic reactions will depend on the character of the
recruitment linker and the
method of attachment of the ETM, as will be appreciated by those in the art.
For nucleic acid
recruitment linkers, the label probes are generally made as outlined herein
with the incorporation of
97
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
ETMs at one or more positions. When a transition metal complex is used as the
ETM, synthesis may
occur in several ways. In a preferred embodiment, the ligand(s) are added to a
nucleoside, followed
by the transition metal ion, and then the nucleoside with the transition metal
complex attached is
added to an oligonucleotide, i.e. by addition to the nucleic acid synthesizer.
Alternatively, the ligand(s)
may be attached, followed by incorportation into a growing oligonucleotide
chain, followed by the
addition of the metal ion.
In a preferred embodiment, ETMs are attached to a ribose of the ribose-
phosphate backbone. This is
generally done as is outlined herein for conductive oligomers, as described
herein, and in PCT
publication WO 95/15971, using amino-modified or oxo-modified nucleosides, at
either the 2' or 3'
position of the ribose. The amino group may then be used either as a ligand,
for example as a
transition metal ligand for attachment of the metal ion, or as a chemically
functional group that can be
used for attachment of other ligands or organic ETMs, for example via amide
linkages, as will be
appreciated by those in the art. For example, the examples describe the
synthesis of nucleosides with
a variety of ETMs attached via the ribose.
In a preferred embodiment, ETMs are attached to a phosphate of the ribose-
phosphate backbone. As
outlined herein, this may be done using phosphodiester analogs such as
phosphoramidite bonds, see
generally PCT publication WO 95/15971, or can be done in a similar manner to
that depicted in
Figures 4 and 5 of PCT US97/20014, where the conductive oligomer is replaced
by a transition metal
ligand or complex or an organic ETM, as well as is outlined in the Examples.
Attachment to alternate backbones, for example peptide nucleic acids or
alternate phosphate linkages
will be done as will be appreciated by those in the art.
In a preferred embodiment, ETMs are attached to a base of the nucleoside. This
may be done in a
variety of ways. In one embodiment, amino groups of the base, either naturally
occurring or added as
is described herein (see the fiigures, for example), are used either as
ligands for transition metal
complexes or as a chemically functional group that can be used to add other
ligands, for example via
an amide linkage, or organic ETMs. This is done as will be appreciated by
those in the art.
Alternatively, nucleosides containing halogen atoms attached to the
heterocyclic ring are commercially
available. Acetylene linked ligands may be added using the halogenated bases,
as is generally
known; see for example, Tzalis et al., Tetrahedron Lett. 36(34):6017-6020
(1995); Tzalis et al.,
Tetrahedron Lett. 36(2):3489-3490 (1995); and Tzalis et al., Chem.
Communications (in press) 1996,
all of which are hereby expressly incorporated by reference. See also the
figures and the examples,
which describes the synthesis of metallocenes (in this case, ferrocene)
attached via acetylene
linkages to the bases.
98
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In one embodiment, the nucleosides are made with transition metal ligands,
incorporated into a
nucleic acid, and then the transition metal ion and any remaining necessary
ligands are added as is
known in the art. In an alternative embodiment, the transition metal ion and
additional ligands are
added prior to incorporation into the nucleic acid.
Once the nucleic acids of the invention are made, with a covalently attached
attachment linker (i.e.
either an insulator or a conductive oligomer), the attachment linker is
attached to the electrode. The
method will vary depending on the type of electrode used. As is described
herein, the attachment
linkers are generally made with a terminal "A" linker to facilitate attachment
to the electrode. For the
purposes of this application, a sulfur-gold attachment is considered a
covalent attachment.
In a preferred embodiment, conductive oligomers, insulators, and attachment
linkers are covalently
attached via sulfur linkages to the electrode. However, surprisingly,
traditional protecting groups for
use of attaching molecules to gold electrodes are generally not ideal for use
in both synthesis of the
compositions described herein and inclusion in oligonucleotide synthetic
reactions. Accordingly, the
present invention provides novel methods for the attachment of conductive
oligomers to gold
electrodes, utilizing unusual protecting groups, including ethylpyridine, and
trimethylsilylethyl as is
depicted in the Figures. However, as will be appreciated by those in the art,
when the conductive
oligomers do not contain nucleic acids, traditional protecting groups such as
acetyl groups and others
may be used. See Greene et al., supra.
This may be done in several ways. In a preferred embodiment, the subunit of
the conductive oligomer
which contains the sulfur atom for attachment to the electrode is protected
with an ethyl-pyridine or
trimethylsilylethyl group. For the former, this is generally done by
contacting the subunit containing the
sulfur atom (preferably in the form of a sulfhydryl) with a vinyl pyridine
group or vinyl trimethylsilylethyl
group under conditions whereby an ethylpyridine group or trimethylsilylethyl
group is added to the
sulfur atom.
This subunit also generally contains a functional moiety for attachment of
additional subunits, and thus
additional subunits are attached to form the conductive oligomer. The
conductive oligomer is then
attached to a nucleoside, and additional nucleosides attached. The protecting
group is then removed
and the sulfur-gold covalent attachment is made. Alternatively, all or part of
the conductive oligomer is
made, and then either a subunit containing a protected sulfur atom is added,
or a sulfur atom is added
and then protected. The conductive oligomer is then attached to a nucleoside,
and additional
nucleosides attached. Alternatively, the conductive oligomer attached to a
nucleic acid is made, and
then either a subunit containing a protected sulfur atom is added, or a sulfur
atom is added and then
protected. Alternatively, the ethyl pyridine protecting group may be used as
above, but removed after
one or more steps and replaced with a standard protecting group like a
disulfide. Thus, the ethyl
99
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
pyridine or trimethylsilylethyl group may serve as the protecting group for
some of the synthetic
reactions, and then removed and replaced with a traditional protecting group.
By "subunit" of a conductive polymer herein is meant at least the moiety of
the conductive oligomer to
which the sulfur atom is attached, although additional atoms may be present,
including either
functional groups which allow the addition of additional components of the
conductive oligomer, or
additional components of the conductive oligomer. Thus, for example, when
Structure 13 oligomers
are used, a subunit comprises at least the first Y group.
A preferred method comprises 1 ) adding an ethyl pyridine or
trimethylsilylethyl protecting group to a
sulfur atom attached to a first subunit of a conductive oligomer, generally
done by adding a vinyl
pyridine or trimethylsilylethyl group to a sulfhydryl; 2) adding additional
subunits to form the conductive
oligomer; 3) adding at least a first nucleoside to the conductive oligomer; 4)
adding additional
nucleosides to the first nucleoside to form a nucleic acid; 5) attaching the
conductive oligomer to the
gold electrode. This may also be done in the absence of nucleosides, as is
described in the
Examples.
The above method may also be used to attach insulator molecules to a gold
electrode.
In a preferred embodiment, a monolayer comprising conductive oligomers (and
optionally insulators) is
added to the electrode. Generally, the chemistry of addition is similar to or
the same as the addition of
conductive oligomers to the electrode, i.e. using a sulfur atom for attachment
to a gold electrode, etc.
Compositions comprising monolayers in addition to the conductive oligomers
covalently attached to
nucleic acids may be made in at least one of five ways: (1 ) addition of the
monolayer, followed by
subsequent addition of the attachment linker-nucleic acid complex; (2)
addition of theattachment
linker-nucleic acid complex followed by addition of the monolayer; (3)
simultaneous addition of the
monolayer and attachment linker-nucleic acid complex; (4) formation of a
monolayer (using any of 1, 2
or 3) which includes attachment linkers which terminate in a functional moiety
suitable for attachment
of a completed nucleic acid; or (5) formation of a monolayer which includes
attachment linkers which
terminate in a functional moiety suitable for nucleic acid synthesis, i.e. the
nucleic acid is synthesized
on the surface of the monolayer as is known in the art. Such suitable
functional moieties include, but
are not limited to, nucleosides, amino groups, carboxyl groups, protected
sulfur moieties, or hydroxyl
groups for phosphoramidite additions. The examples describe the formation of a
monolayer on a gold
electrode using the preferred method (1 ).
In a preferred embodiment, the nucleic acid is a peptide nucleic acid or
analog. In this embodiment,
the invention provides peptide nucleic acids with at least one covalently
attached ETM or attachment
linker. In a preferred embodiment, these moieties are covalently attached to
an monomeric subunit of
the PNA. By "monomeric subunit of PNA" herein is meant the -NH-CHzCH2-N(COCHz-
Base)-CHZ-CO-
100
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
monomer, or derivatives (herein included within the definition of
"nucleoside") of PNA. For example,
the number of carbon atoms in the PNA backbone may be altered; see generally
Nielsen et al., Chem.
Soc. Rev. 1997 page 73, which discloses a number of PNA derivatives, herein
expressly incorporated
by reference. Similarly, the amide bond linking the base to the backbone may
be altered;
phosphoramide and sulfuramide bonds may be used. Alternatively, the moieties
are attached to an
internal monomeric subunit. By "internal" herein is meant that the monomeric
subunit is not either the
N-terminal monomeric subunit or the C-terminal monomeric subunit. In this
embodiment, the moieties
can be attached either to a base or to the backbone of the monomeric subunit.
Attachment to the
base is done as outlined herein or known in the literature. In general, the
moieties are added to a
base which is then incorporated into a PNA as outlined herein. The base may be
either protected, as
required for incorporation into the PNA synthetic reaction, or derivatized, to
allow incorporation, either
prior to the addition of the chemical substituent or afterwards. Protection
and derivatization of the
bases is shown in Figures 24-27 of W098/20162. The bases can then be
incorporated into
monomeric subunits as shown in Figure 28 of W098/20162. Figures 29 and 30 of
W098/20162 depict
two different chemical substituents, an ETM and a conductive oligomer,
attached at a base. Figure 29
depicts a representative synthesis of a PNA monomeric subunit with a ferrocene
attached to a uracil
base. Figure 30 depicts the synthesis of a three unit conductive oligomer
attached to a uracil base.
In a preferred embodiment, the moieties are covalently attached to the
backbone of the PNA
monomer. The attachment is generally to one of the unsubstituted carbon atoms
of the monomeric
subunit, preferably the a-carbon of the backbone, although attachment at
either of the carbon 1 or 2
positions, or the a-carbon of the amide bond linking the base to the backbone
may be done. In the
case of PNA analogs, other carbons or atoms may be substituted as well. In a
preferred embodiment,
moieties are added at the a-carbon atoms, either to a terminal monomeric
subunit or an internal one.
In this embodiment, a modified monomeric subunit is synthesized with an ETM or
an attachment
linker, or a functional group for its attachment, and then the base is added
and the modified monomer
can be incorporated into a growing PNA chain. Figure 31 of W098/20162 depicts
the synthesis of a
conductive oligomer covalently attached to the backbone of a PNA monomeric
subunit, and Figure 32
of W098/20162 depicts the synthesis of a ferrocene attached to the backbone of
a monomeric
subunit.
Once generated, the monomeric subunits with covalently attached moieties are
incorporated into a
PNA using the techniques outlined in Will et al., Tetrahedron 51(44):12069-
12082 (1995), and
Vanderlaan et al., Tett. Let. 38:2249-2252 (1997), both of which are hereby
expressly incorporated in
their entirety. These procedures allow the addition of chemical substituents
to peptide nucleic acids
without destroying the chemical substituents.
101
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
As will be appreciated by those in the art, electrodes may be made that have
any combination of
nucleic acids, conductive oligomers and insulators.
The compositions of the invention may additionally contain one or more labels
at any position. By
"label" herein is meant an element (e.g. an isotope) or chemical compound that
is attached to enable
the detection of the compound. Preferred labels are radioactive isotopic
labels, and colored or
fluorescent dyes. The labels may be incorporated into the compound at any
position. In addition, the
compositions of the invention may also contain other moieties such as cross-
linking agents to facilitate
cross-linking of the target-probe complex. See for example, Lukhtanov et al.,
Nucl. Acids. Res.
24(4):683 (1996) and Tabone et al., Biochem. 33:375 (1994), both of which are
expressly incorporated
by reference.
When mechanism-1 systems are used, detection probes are covalently attached to
the electrode, as
above for capture probes. The detection probes are either substantially
complementary to a portion of
the target sequence (direct detection), or to a portion of a label probe
(sandwich assay), as is depicted
in the Figures.
As for all of the methods outlined herein, it may be necessary to either
remove unreacted primers or
configure the detection systems such that unreacted primers are not detected,
depending on the
method used. For example, for all of the systems, the removal of unreacted
primers based on size
differences can be done, or in some cases, by binding to a solid support such
as a bead, using a
separation tag. In addition, for PCR, SDA and NASBA, detection specificity
will utilize portions of the
non-primer newly synthesized strands, such that unextended primers will not be
bound by capture
probes on an electrode, for example. Alternatively, for example, in CPT, the
first probe sequence may
comprise a separation tag (e.g. biotin) or sequence (e.g. a unique sequence),
that allow the binding of
the unreacted primers and the cleaved first probe sequences; the use of labels
in the second probe
sequence (for direct detection) or the use of the second probe sequence for
the basis of the capture
onto an electrode or binding to a detection probe ensures that unreacted
probes are not detected.
Similarly, in LCR, the use of one primer for capture and the other for either
label incorporation (direct
detection) or detection specificity allows that detection will only proceed
for the modified primers.
Once made, the compositions find use in a number of applications, as described
herein. In particular,
the compositions of the invention find use in hybridization assays. As will be
appreciated by those in
the art, electrodes can be made that have a single species of nucleic acid,
i.e. a single nucleic acid
sequence, or multiple nucleic acid species.
In addition, as outlined herein, the use of a solid support such as an
electrode enables the use of
these gene probes in an array form. The use of oligonucleotide arrays are well
known in the art. In
addition, techniques are known for "addressing" locations within an electrode
and for the surface
102
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
modification of electrodes. Thus, in a preferred embodiment, arrays of
different nucleic acids are laid
down on the electrode, each of which are covalently attached to the electrode
via a conductive linker.
In this embodiment, the number of different probe species of oligonucleotides
may vary widely, from
one to thousands, with from about 4 to about 100,000 being preferred, and from
about 10 to about
10,000 being particularly preferred.
Once the assay complexes of the invention are made, that minimally comprise a
target sequence and
an ETM, detection proceeds with electronic initiation. Without being limited
by the mechanism or
theory, detection is based on the transfer of electrons from the ETM to the
electrode.
Detection of electron transfer, i.e. the presence of the ETMs, is generally
initiated electronically, with
voltage being preferred. A potential is applied to the assay complex. Precise
control and variations in
the applied potential can be via a potentiostat and either a three electrode
system (one reference, one
sample (or working) and one counter electrode) or a two electrode system (one
sample and one
counter electrode). This allows matching of applied potential to peak
potential of the system which
depends in part on the choice of ETMs and in part on the conductive oligomer
used, the composition
and integrity of the monolayer, and what type of reference electrode is used.
As described herein,
ferrocene is a preferred ETM.
In a preferred embodiment, a co-reductant or co-oxidant (collectively, co-
redoxant) is used, as an
additional electron source or sink. See generally Sato et al., Bull. Chem.
Soc. Jpn 66:1032 (1993);
Uosaki et al., Electrochimica Acta 36:1799 (1991 ); and Alleman et al., J.
Phys. Chem 100:17050
(1996); all of which are incorporated by reference.
In a preferred embodiment, an input electron source in solution is used in the
initiation of electron
transfer, preferably when initiation and detection are being done using DC
current or at AC
frequencies where diffusion is not limiting. In general, as will be
appreciated by those in the art,
preferred embodiments utilize monolayers that contain a minimum of "holes",
such that short-circuiting
of the system is avoided. This may be done in several general ways. In a
preferred embodiment, an
input electron source is used that has a lower or similar redox potential than
the ETM of the label
probe. Thus, at voltages above the redox potential of the input electron
source, both the ETM and the
input electron source are oxidized and can thus donate electrons; the ETM
donates an electron to the
electrode and the input source donates to the ETM. For example, ferrocene, as
a ETM attached to
the compositions of the invention as described in the examples, has a redox
potential of roughly 200
mV in aqueous solution (which can change significantly depending on what the
ferrocene is bound to,
the manner of the linkage and the presence of any substitution groups).
Ferrocyanide, an electron
source, has a redox potential of roughly 200 mV as well (in aqueous solution).
Accordingly, at or
above voltages of roughly 200 mV, ferrocene is converted to ferricenium, which
then transfers an
electron to the electrode. Now the ferricyanide can be oxidized to transfer an
electron to the ETM. In
103
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
this way, the electron source (or co-reductant) serves to amplify the signal
generated in the system, as
the electron source molecules rapidly and repeatedly donate electrons to the
ETM attached to the
nucleic acid. The rate of electron donation or acceptance will be limited by
the rate of diffusion of the
co-reductant, the electron transfer between the co-reductant and the ETM,
which in turn is affected by
the concentration and size, etc.
Alternatively, input electron sources that have lower redox potentials than
the ETM are used. At
voltages less than the redox potential of the ETM, but higher than the redox
potential of the electron
source, the input source such as ferrocyanide is unable to be oxided and thus
is unable to donate an
electron to the ETM; i.e. no electron transfer occurs. Once ferrocene is
oxidized, then there is a
pathway for electron transfer.
In an alternate preferred embodiment, an input electron source is used that
has a higher redox
potential than the ETM of the label probe. For example, luminol, an electron
source, has a redox
potential of roughly 720 mV. At voltages higher than the redox potential of
the ETM, but lower than
the redox potential of the electron source, i.e. 200 - 720 mV, the ferrocene
is oxided, and transfers a
single electron to the electrode via the conductive oligomer. However, the ETM
is unable to accept
any electrons from the luminol electron source, since the voltages are less
than the redox potential of
the luminol. However, at or above the redox potential of luminol, the luminol
then transfers an
electron to the ETM, allowing rapid and repeated electron transfer. In this
way, the electron source (or
co-reductant) serves to amplify the signal generated in the system, as the
electron source molecules
rapidly and repeatedly donate electrons to the ETM of the label probe.
Luminol has the added benefit of becoming a chemiluminiscent species upon
oxidation (see Jirka et
al., Analytica Chimica Acta 284:345 (1993)), thus allowing photo-detection of
electron transfer from the
ETM to the electrode. Thus, as long as the luminol is unable to contact the
electrode directly, i.e. in
the presence of the SAM such that there is no efficient electron transfer
pathway to the electrode,
luminol can only be oxidized by transferring an electron to the ETM on the
label probe. When the ETM
is not present, i.e. when the target sequence is not hybridized to the
composition of the invention,
luminol is not significantly oxidized, resulting in a low photon emission and
thus a low (if any) signal
from the luminol. In the presence of the target, a much larger signal is
generated. Thus, the measure
of luminol oxidation by photon emission is an indirect measurement of the
ability of the ETM to donate
electrons to the electrode. Furthermore, since photon detection is generally
more sensitive than
electronic detection, the sensitivity of the system may be increased. Initial
results suggest that
luminescence may depend on hydrogen peroxide concentration, pH, and luminol
concentration, the
latter of which appears to be non-linear.
Suitable electron source molecules are well known in the art, and include, but
are not limited to,
ferricyanide, and luminol.
104
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Alternatively, output electron acceptors or sinks could be used, i.e. the
above reactions could be run in
reverse, with the ETM such as a metallocene receiving an electron from the
electrode, converting it to
the metallicenium, with the output electron acceptor then accepting the
electron rapidly and
repeatedly. In this embodiment, cobalticenium is the preferred ETM.
The presence of the ETMs at the surface of the monolayer can be detected in a
variety of ways. A
variety of detection methods may be used, including, but not limited to,
optical detection (as a result of
spectral changes upon changes in redox states), which includes fluorescence,
phosphorescence,
luminiscence, chemiluminescence, electrochemiluminescence, and refractive
index; and electronic
detection, including, but not limited to, amperommetry, voltammetry,
capacitance and impedence.
These methods include time or frequency dependent methods based on AC or DC
currents, pulsed
methods, lock-in techniques, filtering (high pass, low pass, band pass), and
time-resolved techniques
including time-resolved fluoroscence. .
In one embodiment, the efficient transfer of electrons from the ETM to the
electrode results in
stereotyped changes in the redox state of the ETM. With many ETMs including
the complexes of
ruthenium containing bipyridine, pyridine and imidazole rings, these changes
in redox state are
associated with changes in spectral properties. Significant differences in
absorbance are observed
between reduced and oxidized states for these molecules. See for example
Fabbrizzi et al., Chem.
Soc. Rev. 1995 pp197-202). These differences can be monitored using a
spectrophotometer or
simple photomultiplier tube device.
In this embodiment, possible electron donors and acceptors include all the
derivatives listed above for
photoactivation or initiation. Preferred electron donors and acceptors have
characteristically large
spectral changes upon oxidation and reduction resulting in highly sensitive
monitoring of electron
transfer. Such examples include Ru(NH3)4py and Ru(bpy)zim as preferred
examples. It should be
understood that only the donor or acceptor that is being monitored by
absorbance need have ideal
spectral characteristics.
In a preferred embodiment, the electron transfer is detected fluorometrically.
Numerous transition
metal complexes, including those of ruthenium, have distinct fluorescence
properties. Therefore, the
change in redox state of the electron donors and electron acceptors attached
to the nucleic acid can
be monitored very sensitively using fluorescence, for example with Ru(4,7-
biphenylz-phenanthroline)32+
. The production of this compound can be easily measured using standard
fluorescence assay
techniques. For example, laser induced fluorescence can be recorded in a
standard single cell
fluorimeter, a flow through "on-line" fluorimeter (such as those attached to a
chromatography system)
or a multi-sample "plate-reader" similar to those marketed for 96-well immuno
assays.
105
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Alternatively, fluorescence can be measured using fiber optic sensors with
nucleic acid probes in
solution or attached to the fiber optic. Fluorescence is monitored using a
photomultiplier tube or other
light detection instrument attached to the fiber optic. The advantage of this
system is the extremely
small volumes of sample that can be assayed.
In addition, scanning fluorescence detectors such as the Fluorlmager sold by
Molecular Dynamics are
ideally suited to monitoring the fluorescence of modified nucleic acid
molecules arrayed on solid
surfaces. The advantage of this system is the large number of electron
transfer probes that can be
scanned at once using chips covered with thousands of distinct nucleic acid
probes.
Many transition metal complexes display fluorescence with large Stokes shifts.
Suitable examples
include bis- and trisphenanthroline complexes and bis- and trisbipyridyl
complexes of transition metals
such as ruthenium (see Juris, A., Balzani, V., et. al. Coord. Chem. Rev., V.
84, p. 85-277, 1988).
Preferred examples display efficient fluorescence (reasonably high quantum
yields) as well as low
reorganization energies. These include Ru(4,7-biphenyl2-phenanthroline)32',
Ru(4,4'-diphenyl-2,2'-
bipyridine)32' and platinum complexes (see Cummings et al., J. Am. Chem. Soc.
118:1949-1960
(1996), incorporated by reference). Alternatively, a reduction in fluorescence
associated with
hybridization can be measured using these systems.
In a further embodiment, electrochemiluminescence is used as the basis of the
electron transfer
detection. With some ETMs such as Ruz+(bpy)3, direct luminescence accompanies
excited state
decay. Changes in this property are associated with nucleic acid hybridization
and can be monitored
with a simple photomultiplier tube arrangement (see Blackburn, G. F. Clin.
Chem. 37: 1534-1539
(1991 ); and Juris et al., supra.
In a preferred embodiment, electronic detection is used, including
amperommetry, voltammetry,
capacitance, and impedence. Suitable techniques include, but are not limited
to, electrogravimetry;
coulometry (including controlled potential coulometry and constant current
coulometry); voltametry
(cyclic voltametry, pulse voltametry (normal pulse voltametry, square wave
voltametry, differential
pulse voltametry, Osteryoung square wave voltametry, and coulostatic pulse
techniques); stripping
analysis (aniodic stripping analysis, cathiodic stripping analysis, square
wave stripping voltammetry);
conductance measurements (electrolytic conductance, direct analysis); time-
dependent
electrochemical analyses (chronoamperometry, chronopotentiometry, cyclic
chronopotentiometry and
amperometry, AC polography, chronogalvametry, and chronocoulometry); AC
impedance
measurement; capacitance measurement; AC voltametry; and
photoelectrochemistry.
In a preferred embodiment, monitoring electron transfer is via amperometric
detection. This method
of detection involves applying a potential (as compared to a separate
reference electrode) between
the nucleic acid-conjugated electrode and a reference (counter) electrode in
the sample containing
106
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
target genes of interest. Electron transfer of differing efficiencies is
induced in samples in the
presence or absence of target nucleic acid; that is, the presence or absence
of the target nucleic acid,
and thus the label probe, can result in different currents.
The device for measuring electron transfer amperometrically involves sensitive
current detection and
includes a means of controlling the voltage potential, usually a potentiostat.
This voltage is optimized
with reference to the potential of the electron donating complex on the label
probe. Possible electron
donating complexes include those previously mentioned with complexes of iron,
osmium, platinum,
cobalt, rhenium and ruthenium being preferred and complexes of iron being most
preferred.
In a preferred embodiment, alternative electron detection modes are utilized.
For example,
potentiometric (or voltammetric) measurements involve non-faradaic (no net
current flow) processes
and are utilized traditionally in pH and other ion detectors. Similar sensors
are used to monitor
electron transfer between the ETM and the electrode. In addition, other
properties of insulators (such
as resistance) and of conductors (such as conductivity, impedance and
capicitance) could be used to
monitor electron transfer between ETM and the electrode. Finally, any system
that generates a
current (such as electron transfer) also generates a small magnetic field,
which may be monitored in
some embodiments.
It should be understood that one benefit of the fast rates of electron
transfer observed in the
compositions of the invention is that time resolution can greatly enhance the
signal-to-noise results of
monitors based on absorbance, fluorescence and electronic current. The fast
rates of electron
transfer of the present invention result both in high signals and stereotyped
delays between electron
transfer initiation and completion. By amplifying signals of particular
delays, such as through the use
of pulsed initiation of electron transfer and "lock-in" amplifiers of
detection, and Fourier transforms.
In a preferred embodiment, electron transfer is initiated using alternating
current (AC) methods.
W ithout being bound by theory, it appears that ETMs, bound to an electrode,
generally respond.
similarly to an AC voltage across a circuit containing resistors and
capacitors. Basically, any methods
which enable the determination of the nature of these complexes, which act as
a resistor and
capacitor, can be used as the basis of detection. Surprisingly, traditional
electrochemical theory, such
as exemplified in Laviron et al., J. Electroanal. Chem. 97:135 (1979) and
Laviron et al., J. Electroanal.
Chem. 105:35 (1979), both of which are incorporated by reference, do not
accurately model the
systems described herein, except for very small EAR (less than 10 mV) and
relatively large numbers of
molecules. That is, the AC current (I) is not accurately described by
Laviron's equation. This may be
due in part to the fact that this theory assumes an unlimited source and sink
of electrons, which is not
true in the present systems. '
107
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The AC voltametry theory that models these systems well is outlined in
O'Connor et al., J. Electroanal.
Chem. 466(2):197-202 (1999), hereby expressly incorporated by reference. The
equation that
predicts these systems is shown below as Equation 1:
Equation 1
sinh[ RT.Eac1
ie~A=2nfFNr~r~
cosh[ RT~Eac~+~sh[ RT(Eoc-Eo)1
In Equation 1, n is the number of electrons oxidized or reduced per redox
molecule, f is the applied
frequency, F is Faraday's constant, N~ota~ is the total number of redox
molecules, Eo is the formal
potential of the redox molecule, R is the gas constant, T is the temperature
in degrees Kelvin, and Epc
is the electrode potential. The model fits the experimental data very well. In
some cases the current
is smaller than predicted, however this has been shown to be caused by
ferrocene degradation which
may be remedied in a number of ways.
In addition, the faradaic current can also be expressed as a function of time,
as shown in Equation 2:
Equation 2
If( t) = qeNtotalnF ~ dV( t)
2RT(cosh[RT(V(t)-Eo)]+1) dt
IF is the Faradaic current and qe is the elementary charge.
However, Equation 1 does not incorporate the effect of electron transfer rate
nor of instrument factors.
Electron transfer rate is important when the rate is close to or lower than
the applied frequency. Thus,
the true iAC should be a function of all three, as depicted in Equation 3.
Equation 3
iAC = f(Nernst factors)f(kET)f(instrument factors)
These equations can be used to model and predict the expected AC currents in
systems which use
input signals comprising both AC and DC components. As outlined above,
traditional theory
surprisingly does not model these systems at all, except for very low
voltages.
In general, non-specifically bound label probes/ETMs show differences in
impedance (i.e. higher
impedances) than when the label probes containing the ETMs are specifically
bound in the correct
orientation. In a preferred embodiment, the non-specifically bound material is
washed away, resulting
in an effective impedance of infinity. Thus, AC detection gives several
advantages as is generally
discussed below, including an increase in sensitivity, and the ability to
"filter out" background noise. In
108
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
particular, changes in impedance (including, for example, bulk impedance) as
between non-specific
binding of ETM-containing probes and target-specific assay complex formation
may be monitored.
Accordingly, when using AC initiation and detection methods, the frequency
response of the system
changes as a result of the presence of the ETM. By "frequency response" herein
is meant a
modification of signals as a result of electron transfer between the electrode
and the ETM. This
modification is different depending on signal frequency. A frequency response
includes AC currents at
one or more frequencies, phase shifts, DC offset voltages, faradaic impedance,
etc.
Once the assay complex including the target sequence and the ETM is made, a
first input electrical
signal is then applied to the system, preferably via at least the sample
electrode (containing the
complexes of the invention) and the counter electrode, to initiate electron
transfer between the
electrode and the ETM. Three electrode systems may also be used, with the
voltage applied to the
reference and working electrodes. The first input signal comprises at least an
AC component. The AC
component may be of variable amplitude and frequency. Generally, for use in
the present methods,
the AC amplitude ranges from about 1 mV to about 1.1 V, with from about 10 mV
to about 800 mV
being preferred, and from about 10 mV to about 500 mV being especially
preferred. The AC
frequency ranges from about 0.01 Hz to about 100 MHz, with from about 10 Hz to
about 10 MHz being
preferred, and from about 100 Hz to about 20 MHz being especially preferred.
The use of combinations of AC and DC signals gives a variety of advantages,
including surprising
sensitivity and signal maximization.
In a preferred embodiment, the first input signal comprises a DC component and
an AC component.
That is, a DC offset voltage between the sample and counter electrodes is
swept through the
electrochemical potential of the ETM (for example, when ferrocene is used, the
sweep is generally
from 0 to 500 mV) (or alternatively, the working electrode is grounded and the
reference electrode is
swept from 0 to -500 mV). The sweep is used to identify the DC voltage at
which the maximum
response of the system is seen. This is generally at or about the
electrochemical potential of the ETM.
Once this voltage is determined, either a sweep or one or more uniform DC
offset voltages may be
used. DC offset voltages of from about -1 V to about +1.1 V are preferred,
with from about -500 mV to
about +800 mV being especially preferred, and from about -300 mV to about 500
mV being particularly
preferred. In a preferred embodiment, the DC offset voltage is not zero. On
top of the DC offset
voltage, an AC signal component of variable amplitude and frequency is
applied. If the ETM is
present, and can respond to the AC perturbation, an AC current will be
produced due to electron
transfer between the electrode and the ETM.
For defined systems, it may be sufficient to apply a single input signal to
differentiate between the
presence and absence of the ETM (i.e. the presence of the target sequence)
nucleic acid.
109
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Alternatively, a plurality of input signals are applied. As outlined herein,
this may take a variety of
forms, including using multiple frequencies, multiple DC offset voltages, or
multiple AC amplitudes, or
combinations of any or all of these.
Thus, in a preferred embodiment, multiple DC offset voltages are used,
although as outlined above,
DC voltage sweeps are preferred. This may be done at a single frequency, or at
two or more
frequencies .
In a preferred embodiment, the AC amplitude is varied. Without being bound by
theory, it appears that
increasing the amplitude increases the driving force. Thus, higher amplitudes,
which result in higher
overpotentials give faster rates of electron transfer. Thus, generally, the
same system gives an
improved response (i.e. higher output signals) at any single frequency through
the use of higher
overpotentials at that frequency. Thus, the amplitude may be increased at high
frequencies to
increase the rate of electron transfer through the system, resulting in
greater sensitivity. In addition,
this may be used, for example, to induce responses in slower systems such as
those that do not
possess optimal spacing configurations.
In a preferred embodiment, measurements of the system are taken at at least
two separate
amplitudes or overpotentials, with measurements at a plurality of amplitudes
being preferred. As
noted above, changes in response as a result of changes in amplitude may form
the basis of
identification, calibration and quantification of the system. In addition, one
or more AC frequencies
can be used as well.
In a preferred embodiment, the AC frequency is varied. At different
frequencies, different molecules
respond in different ways. As will be appreciated by those in the art,
increasing the frequency
generally increases the output current. However, when the frequency is greater
than the rate at which
electrons may travel between the electrode and the ETM, higher frequencies
result in a loss or
decrease of output signal. At some point, the frequency will be greater than
the rate of electron
transfer between the ETM and the electrode, and then the output signal will
also drop.
In one embodiment, detection utilizes a single measurement of output signal at
a single frequency.
That is, the frequency response of the system in the absence of target
sequence, and thus the
absence of label probe containing ETMs, can be previously determined to be
very low at a particular
high frequency. Using this information, any response at a particular
frequency, will show the presence
of the assay complex. That is, any response at a particular frequency is
characteristic of the assay
complex. Thus, it may only be necessary to use a single input high frequency,
and any changes in
frequency response is an indication that the ETM is present, and thus that the
target sequence is
present.
110
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In addition, the use of AC techniques allows the significant reduction of
background signals at any
single frequency due to entities other than the ETMs, i.e. "locking out" or
"filtering" unwanted signals.
That is, the frequency response of a charge carrier or redox active molecule
in solution will be limited
by its diffusion coefficient and charge transfer coefficient. Accordingly, at
high frequencies, a charge
carrier may not diffuse rapidly enough to transfer its charge to the
electrode, and/or the charge
transfer kinetics may not be fast enough. This is particularly significant in
embodiments that do not
have good monolayers, i.e. have partial or insufficient monolayers, i.e. where
the solvent is accessible
to the electrode. As outlined above, in DC techniques, the presence of "holes"
where the electrode is
accessible to the solvent can result in solvent charge carriers "short
circuiting" the system, i.e. the
reach the electrode and generate background signal. However, using the present
AC techniques, one
or more.frequencies can be chosen that prevent a frequency response of one or
more charge carriers
in solution, whether or not a monolayer is present. This is particularly
significant since many biological
fluids such as blood contain significant amounts of redox active molecules
which can interfere with
amperometric detection methods.
In a preferred embodiment, measurements of the system are taken at at least
two separate
frequencies, with measurements at a plurality of frequencies being preferred.
A plurality of
frequencies includes a scan. For example, measuring the output signal, e.g.,
the AC current, at a low
input frequency such as 1 - 20 Hz, and comparing the response to the output
signal at high frequency
such as 10 - 100 kHz will show a frequency response difference between the
presence and absence
of the ETM. In a preferred embodiment, the frequency response is determined at
at least two,
preferably at least about five, and more preferably at least about ten
frequencies.
After transmitting the input signal to initiate electron transfer, an output
signal is received or detected.
The presence and magnitude of the output signal will depend on a number of
factors, including the
overpotential/amplitude of the input signal; the frequency of the input AC
signal; the composition of the
intervening medium; the DC offset; the environment of the system; the nature
of the ETM; the solvent;
and the type and concentration of salt. At a given input signal, the presence
and magnitude of the
output signal will depend in general on the presence or absence of the ETM,
the placement and
distance of the ETM from the surface of the monolayer and the character of the
input signal. In some
embodiments, it may be possible to distinguish between non-specific binding of
label probes and the
formation of target specific assay complexes containing label probes, on the
basis of impedance.
In a.preferred embodiment, the output signal comprises an AC current. As
outlined above, the
magnitude of the output current will depend on a number of parameters. By
varying these
parameters, the system may be optimized in a number of ways.
111
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
In general, AC currents generated in the present invention range from about 1
femptoamp to about 1
milliamp, with currents from about 50 femptoamps to about 100 microamps being
preferred, and from
about 1 picoamp to about 1 microamp being especially preferred.
In a preferred embodiment, the output signal is phase shifted in the AC
component relative to the input
signal. Without being bound by theory, it appears that the systems of the
present invention may be
sufficiently uniform to allow phase-shifting based detection. That is, the
complex biomolecules of the
invention through which electron transfer occurs react to the AC input in a
homogeneous manner,
similar to standard electronic components, such that a phase shift can be
determined. This may serve
as the basis of detection between the presence and absence of the ETM, and/or
differences between
the presence of target-specific assay complexes comprising label probes and
non-specific binding of
the label probes to the system components.
The output signal is characteristic of the presence of the ETM; that is, the
output signal is
characteristic of the presence of the target-specific assay complex comprising
label probes and ETMs.
In a preferred embodiment, the basis of the detection is a difference in the
faradaic impedance of the
system as a result of the formation of the assay complex. Faradaic impedance
is the impedance of
the system between the electrode and the ETM. Faradaic impedance is quite
different from the bulk
or dielectric impedance, which is the impedance of the bulk solution between
the electrodes. Many
factors may change the faradaic impedance which may not effect the bulk
impedance, and vice versa.
Thus, the assay complexes comprising the nucleic acids in this system have a
certain faradaic
impedance, that will depend on the distance between the ETM and the electrode,
their electronic
properties, and the composition of the intervening medium, among other things.
Of importance in the
methods of the invention is that the faradaic impedance between the ETM and
the electrode is
signficantly different depending on whether the label probes containing the
ETMs are specifically or
non-specifically bound to the electrode.
Accordingly, the present invention further provides apparatus for the
detection of nucleic acids using
AC detection methods. The apparatus includes a test chamber which has at least
a first measuring or
sample electrode, and a second measuring or counter electrode. Three electrode
systems are also
useful. The first and second measuring electrodes are in contact with a test
sample receiving region,
such that in the presence of a liquid test sample, the two electrodes may be
in electrical contact.
In a preferred embodiment, the first measuring electrode comprises a single
stranded nucleic acid
capture probe covalently attached via an attachment linker, and a monolayer
comprising conductive
oligomers, such as are described herein.
112
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
The apparatus further comprises an AC voltage source electrically connected to
the test chamber; that
is, to the measuring electrodes. Preferably, the AC voltage source is capable
of delivering DC offset
voltage as well.
In a preferred embodiment, the apparatus further comprises a processor capable
of comparing the
input signal and the output signal. The processor is coupled to the electrodes
and configured to
receive an output signal, and thus detect the presence of the target nucleic
acid.
Thus, the compositions of the present invention may be used in a variety of
research, clinical, quality
control, or field testing settings.
In a preferred embodiment, the probes are used in genetic diagnosis. For
example, probes can be
made using the techniques disclosed herein to detect target sequences such as
the gene for
nonpolyposis colon cancer, the BRCA1 breast cancer gene, P53, which is a gene
associated with a
variety of cancers, the Apo E4 gene that indicates a greater risk of
Alzheimer's disease, allowing for
easy presymptomatic screening of patients, mutations in the cystic fibrosis
gene, or any of the others
well known in the art.
In an additional embodiment, viral and bacterial detection is done using the
complexes of the
invention. In this embodiment, probes are designed to detect target sequences
from a variety of
bacteria and viruses. For example, current blood-screening techniques rely on
the detection of anti-
HIV antibodies. The methods disclosed herein allow for direct screening of
clinical samples to detect
HIV nucleic acid sequences, particularly highly conserved HIV sequences. In
addition, this allows
direct monitoring of circulating virus within a patient as an improved method
of assessing the efficacy
of anti-viral therapies. Similarly, viruses associated with leukemia, HTLV-I
and HTLV-II, may be
detected in this way. Bacterial infections such as tuberculosis, clymidia and
other sexually transmitted
diseases, may also be detected, for example using ribosomal RNA (rRNA) as the
target sequences.
In a preferred embodiment, the nucleic acids of the invention find use as
probes for toxic bacteria in
the screening of water and food samples. For example, samples may be treated
to lyse the bacteria
to release its nucleic acid (particularly rRNA), and then probes designed to
recognize bacterial strains,
including, but not limited to, such pathogenic strains as, Salmonella,
Campylobacter, Vibrio cholerae,
Leishmania, enterotoxic strains of E. coli, and Legionnaire's disease
bacteria. Similarly,
bioremediation strategies may be evaluated using the compositions of the
invention.
In a further embodiment, the probes are used for forensic "DNA fingerprinting"
to match crime-scene
DNA against samples taken from victims and suspects.
In an additional embodiment, the probes in an array are used for sequencing by
hybridization.
113
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Thus, the present invention provides for extremely specific and sensitive
probes, which may, in some
embodiments, detect target sequences without removal of unhybridized probe.
This will be useful in
the generation of automated gene probe assays.
Alternatively, the compositions of the invention are useful to detect
successful gene amplification in
PCR, thus allowing successful PCR reactions to be an indication of the
presence or absence of a
target sequence. PCR may be used in this manner in several ways. For example,
in one
embodiment, the PCR reaction is done as is known in the art, and then added to
a composition of the
invention comprising the target nucleic acid with a ETM, covalently attached
to an electrode via a
conductive oligomer with subsequent detection of the target sequence.
Alternatively, PCR is done
using nucleotides labelled with a ETM, either in the presence of, or with
subsequent addition to, an
electrode with a conductive oligomer and a target nucleic acid. Binding of the
PCR product containing
ETMs to the'-'electrode composition will allow detection via electron
transfer. Finally, the nucleic acid
attached to the electrode via a conductive polymer may be one PCR primer, with
addition of a second
primer labelled with an ETM. Elongation results in double stranded nucleic
acid with a ETM
and electrode covalently attached. In this way, the present invention is used
for PCR detection of
target sequences.
In a preferred embodiment, the arrays are used for mRNA detection. A preferred
embodiment utilizes
either capture probes or capture extender probes that hybridize close to the
3' polyadenylation tail of
the mRNAs. This allows the use of one species of target binding probe for
detection, i.e. the probe .
contains a poly-T portion that will bind to the poly-A tail of the mRNA
target. Generally, the probe will
contain a second portion, preferably non-poly-T, that will bind to the
detection probe (or other probe).
This allows one target-binding probe to be made, and thus decreases the amount
of different probe
synthesis that is done.
In a preferred embodiment, the use of restriction enzymes and ligation methods
allows the creation of
"universal" arrays. In this embodiment, monolayers comprising capture probes
that comprise
restriction endonuclease ends, as is generally depicted in Figure 7. By
utilizing complementary
portions of nucleic acid, while leaving "sticky ends", an array comprising any
number of restriction
endonuclease sites is made. Treating a target sample with one or more of these
restriction
endonucleases allows the targets to bind to the array. This can be done
without knowing the
sequence of the target. The target sequences can be ligated, as desired, using
standard methods
such as ligases, and the target sequence detected, using either standard
labels or the methods of the
invention.
The present invention provides methods which can result in sensitive detection
of nucleic acids. In a
preferred embodiment, less than about 10 X 106 molecules are detected, with
less than about 10 X
105 being preferred, less than 10 X 104 being particularly preferred, less
than about 10 X 103 being
114
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
especially preferred, and less than about 10 X 102 being most preferred. As
will be appreciated by
those in the art, this assumes a 1:1 correlation between target sequences and
reporter molecules; if
more than one reporter molecule (i.e. electron transfer moeity) is used for
each target sequence, the
sensitivity will go up.
While the limits of detection are currently being evaluated, based on the
published electron transfer
rate through DNA, which is roughly 1 X 106 electrons/sec/duplex for an 8 base
pair separation (see
Meade et al., Angw. Chem. Eng. Ed., 34:352 (1995)) and high driving forces, AC
frequencies of about
100 kHz should be possible. As the preliminary results show, electron transfer
through these systems
is quite efficient, resulting in nearly 100 X 103 electrons/sec, resulting in
potential femptoamp
sensitivity for very few molecules.
In addition to the methods outlined herein, the invention further provides
compositions, generally kits,
useful in the practice of the invention. The kits include the compositions
including the primers and
enzymes, along with any number of reagents or buffers, including additional
enzymes and primers,
dNTPs and/or NTPs (including substituted nucleotides), buffers, salts,
inhibitors, etc. The kits can
optionally include instructions for the use of the kits.
The following examples serve to more fully describe the manner of using the
above-described
invention, as well as to set forth the best modes contemplated for carrying
out various aspects of the
invention. It is understood that these examples in no way serve to limit the
true scope of this invention,
but rather are presented for illustrative purposes. All references cited
herein are incorporated by
reference in their entirety.
EXAMPLES
Example 1
Synthesis of nucleoside modified with ferrocene at the 2' position
The preparation of N6 is described.
Compound N1. Ferrocene (20 g, 108 mmol) and 4-bromobutyl chloride (20 g, 108
mmol) were
dissolved in 450 mL dichloromethane followed by the addition of AICI3
anhydrous (14.7 g, 11 mmol).
The reaction mixture was stirred at room temperature for 1 hour and 40
minutes, then was quenched
by addition of 600 mL ice. The organic layer was separated and was washed with
water until the
aqueous layer was close to neutral (pH = 5). The organic layer was dried with
NazS04 and
concentrated. The crude product was purified by flash chromatography eluting
with 50/50
hexane/dichloromethane and later 30/70 hexane/dichloromethane on 300 g silica
gel to afford 26.4
gm (73%) of the title product.
115
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Compound N2. Compound N1 (6 g, 18 mmol) was dissolved in 120 mL toluene in a
round bottom
flask. zinc (35.9 g, 55 mmol), mercuric chloride (3.3g, 12 mmol) and water
(100 mL) were added
successively. Then HCI solution (12 M, 80 mL) was added dropwise. The reaction
mixture was
stirred at room temperature for 16 hours. The organic layer was separated, and
washed with water (2
x 100 mL) and concentrated. Further purification by flash chromatography
(hexane) on 270 gm of
silica gel provided the desired product as a brown solid (3.3 g, 58%).
Compound N3. A mixture of 13.6 gm (51 mmol) of adenosine in 400 mL dry DMF was
cooled in a
ice-water bath for 10 minutes before the addition of 3.0 gm (76 mmol) of NaH
(60%) . The reaction
mixture was stirred at 0 °C for one hour before addition of Compound N2
(16.4 g, 51 mmol). Then
the temperature was slowly raised to 30 °C, and the reaction mixture
was kept at this temperature for
4 hours before being quenched by 100 mL ice. The solvents were removed in
vacuo. The resultant
gum was dissolved in 300 mL water and 300 mL ethyl acetate. The aqueous layer
was extracted
thoroughly (3 x 300 mL ethyl acetate). The combined organic extracts were
concentrated, and the
crude product was purified by flash chromatography on 270 g silica gel. The
column was eluted with
20%ethyl acetate/dichloromethane, 50 % ethyl acetate/dichloromethane, 70 %
ethyl
acetate/dichloromethane, ethyl acetate, 1 % methanol/ethyl acetate, 3 %
methanol/ethyl acetate, and
5 % methanol/ethyl acetate. The concentration of the desired fractions provide
the final product (6.5
g, 25%).
Compound N4. Compound N3 (6.5 g, 12.8 mmol) was dissolved in 150 mL dry
pyridine, followed by
adding TMSCI (5.6 g, 51.2 mmol) . The reaction mixture was stirred at room
temperature for 1.5
hours. Then phenoxyacetyl chloride (3.3 g, 19.2 mmol) was added at 0
°C. The reaction was then
stirred at room temperature for 4 hours and was quenched by the addition of
100 mL water at 0 °C.
The solvents were removed under reduced pressure, and the crude gum was
further purified by flash
chromatography on 90 g of silica gel (1 % methanol/dichloromethane) (2.3 g,
28%).
Compound N5. Compound N4 (2.2 g, 3.4 mmol) and DMAP (200 mg, 1.6 mmol) were
dissolved in
150 mL dry pyridine, followed by the addition of DMTCI (1.4 g, 4.1 mmol). The
reaction was stirred
under argon at room temperature overnight. The solvent was removed under
reduced pressure, and
the residue was dissolved in 250 mL dichloromethane. The organic solution was
washed by 5%
NaHC03 solution (3 x 250 mL) , dried over Na2S04, and concentrated. Further
purification by flash
chromatography on 55 g of silica gel (1 % TEA/50% hexane/dichloromethane )
provided the desired
product (1.3 g, 41 %).
Compound N6. To a solution of N5 ( 3.30 gm, 3.50 mmol) in 150 mL
dichloromethane.
Diisopropylethylamine (4.87 mL, 8.0 eq.) and catalytic amount of DMAP (200 mg)
were added. The
mixture was kept at 0 °C, and N, N-diisopropylamino cyanoethyl
phosphonamidic chloride (2.34 mL,
10.48 mmol) was added. The reaction mixture was warmed up and stirred at room
temperature
116
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
overnight. After dilution by adding 150 mL of dichloromethane and 250 mL of 5
% NaHC03 aqueous
solution, the organic layer was separated, washed with 5% NaHC03 (250 mL),
dried over Na2S04,
and concentrated. The crude product was purified on a flash column of 66 g of
silica gel packed with
1 % TEA in hexane. The eluting solvents were 1 % TEA in hexane (500 mL), 1 %
TEA and 10%
~ dichloromethane in hexane (500 mL), 1 % TEA and 20% dichloromethane in
hexane (500 mL). 1
TEA and 50% dichloromethane in hexane (500 mL). Fractions containing the
desired products were
collected and concentrated to afford the final product (3 gm, 75%).
Example 2
Synthesis of "Branched" nucleoside
The synthesis of N17 is described, as depicted in Figure 11A.
Synthesis of N14. To a solution of Tent-butyldimethylsily chloride (33.38 g,
0.22 mol) in 300 mL of
dichloromethane was added imidazole (37.69 g, 0.55 mol) . Immediately, large
amount of precipitate
was formed. 2-Bromoethanol (27.68 g, 0.22 mol,.) was added slowly at room
temperature. The
reaction mixture was stirred at this temperature for 3 hours. The organic
layer was washed with water
(200 mL), 5% NaHC03 (2 x 250 mL), and water (200 mL). The removal of solvent
afforded 52.52 g of
the title product (99%).
Synthesis of N15. To a suspension of adenosine (40 g, 0.15 mol) in 1.0 L of
DMF at 0 °C, was
added NaH (8.98 gm of 60% in mineral oil, 0.22 mol). The mixture was stirred
at 0 °C for 1 hour, and
N14 (35.79 gm, 0.15mo1) was added. The reaction was stirred at 30 °C
overnight. It was quenched
by 100 mL ice-water. The solvents were removed under high vaccum. The
resultant foam was
dissolved in a mixture of 800 mL of ethyl acetate and 700 mL of water. The
aqueous layer was further
extracted by ethyl acetate ( 3 x 200 mL). The combined organic layer was dried
over Na2S04 and
concentrated. The crude product was further purified on a flash column of 300
g of silica gel packed
with 1% TEA in dichloromethane. The eluting solvents were dichloromethane (500
mL), 3% MeOH in
dichloromethane (500 mL), 5% MeOH in dichloromethane (500 mL), and 8% MeOH in
dichloromethane (2000 mL). The desired fractions were collected and
concentrated to afford 11.70 g
of the title product (19%).
Synthesis of N16. To a solution of N15 (11.50 gm, 27.17 mmol) in 300 mL dry
pyridine cooled at
0'C, was added trimethylsily chloride (13.71 mL, 0.11 mol, 4.0). The mixture
was stirred at 0 °C for 40
min. Phenoxyacetyl chloride (9.38 mL, 67.93 mmol) was added. The reaction was
stirred at 0 °C for
2.5 h. The mixture was then transferred to a mixture of 700 mL of
dichloromethane and 500 mL
water. The mixture was shaken well and organic layer was separated. After
washing twice with 5%
NaHC03 (2 x 300 mL), dichloromethane was removed on a rotovapor. Into the
residue was added
200 mL of water, the resulting pyridine mixture was stirred at room
temperature for 2 hours. The
117
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
solvents were then removed under high vacuum. The gum product was co-
evaporated with 100 mL of
pyridine. The residue was dissolved in 250 mL of dry pyridine at 0 °C,
and 4, 4'-dimethoxytrityl
chloride (11.02 gm, 32.60 mmol) was added. The reaction was stirred at room
temperature overnight.
The solution was transferred to a mixture of 700 mL of dichloromethane and 500
mL of 5% NaHC03.
After shaking well, the organic layer was separated, further washed with 5%
NaHC03 (2 x 200 mL),
and then concentrated. The crude product was purified on a flash column of 270
gm of silica gel
packed with 1 % TEA/30% CHZCIZ/Hexane. The eluting solvents were 1 % TEA/ 50%
CHZCIZ/Hexane
(1000 mL), and 1 % TEA /CHzCl2 (2000 mL). The fractions containing the desired
product were
collected and concentrated to afford 10.0 g of the title product (43%).
Synthesis of N17. To asolution of N16 (10.0 gm, 11.60 mmol) in 300 mL
dichloromethane.
Diisopropylethylamine (16.2 mL) and catalytic amount of N, N-
dimethylaminopyridine(200 mg) were
added. The mixture was cooled in an ice-water bath, and N, N-diisopropylamino
cyanoethyl
phosphonamidic chloride (7.78 mL, 34.82 mmol) was added. The reaction was
stirred at room
temperature overnight. The reaction mixture was diluted by adding 250 mL of
dichloromethane and
250 mL of 5% NaHC03. After shaking well, the organic layer was separated and
washed once more
with the same amount of 5 % NaHC03 aqueous solution, dried over Na2S04, and
concentrated. The
crude product was purified on a flash column of 120 gm of silica gel packed
with 1 % TEA and 10%
dichloromethane in hexane. The eluting solvents were 1 % TEA and 10%
dichloromethane in hexane
(500 mL), 1 % TEA and 20% dichloromethane in hexane (500 mL), and 1 % TEA and
40%
dichloromethane in hexane (1500 mL). The right fractions were collected and
concentrated to afford
the final product (7.37gm, 60%).
The syntheses for two other nucleotides used for branching are shown in
Figures 11 B and 11 C, with
the Lev protecting group. These branching nucleotides branch from the
phosphate, rather than the
ribose (N17), and appear to give somewhat better results.
Example 3
Synthesis of triphosphate nucleotide containing an ETM
The synthesis of AFTP is described.
N3 (1.00 g,1.97 mmol) was dissolved in 15 mL of methyl phosphate, followed by
adding
diisopropylethylamine (0.69 mL, 3.9 mmol). While the mixture was kept at 0
°C, and phospherous
oxychloride (0.45g, 2.93 mmol) was added. The reaction mixture was stirred at
0 °C for 4 hours, then
at 4 °C overnight. Bis(tributyl)ammonium phosphate (3.24 g, 5.91 mmol.)
was added, and the reaction
mixture was stirred at 0 °C for six hours, and at 4 °C
overnight. The white precipitate produced in the
reaction was removed by filtration. The filtrate was treated with water (20
mL), and yellow precipitate
118
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
was formed. The precipitate was filtrated and was dried under high vacuum to
afford 0.63 g of the title
product as yellow solid.
Example 4
Synthesis of nucleoside with ferrocene attached via a phosphate
The synthesis of Y63 is described.
Synthesis of C102_ A reaction mixture consisting of 10.5gm (32.7 mmol) of N2,
16gm of potassium
acetate and 350 ml of DMF was stirred at 100°C for 2.5hrs. The reaction
mixture was allowed to cool
to room temperature and then poured into a mixture of 400m1 of ether and 800m1
of water. The
mixture was shaken and the organic layer was separated. The aqueous layer was
extracted twice
with ether. The combined ether extracts were dried over sodium sulfate and
then concentrated for
column chromatography. Silica gel(160 gm) was packed with 1 % TEA/Hexane. The
crude was loaded
and the column was eluted with 1 % TEA/0-100 % CH2C12/Hexane. Fractions
containing desired
product were collected and concentrated to afford 5.8g (59.1 %) of C102.
~mthesis of Y61: To a flask containing 5.1gm (17.0 mmol) of C102 was added
30m1 of Dioxane. To
this solution, small aliquots of 1 M NaOH was added over a period of 2.5 hours
or until hydrolysis was
complete. After hydrolysis the product was extracted using hexane. The
combined extracts were
dried over sodium sulfate and concentrated for chromatography. Silica gel (100
gm) was packed in
10% EtOAc/ Hexane. The crude product solution was loaded and the column was
eluted with 10% to
50% EtOAc in hexane. The fractions containing desired product were pooled and
concentrated to
afford 4.20 gm (96.1 %) of Y61.
Synthesis of Y62: To a flask containing 4.10 gm (15.9 mmol) of Y61 was added
200m1 of
dichloromethane and 7.72 ml of DIPEA and 4.24 gm (15.9 mmol) of
bis(diisopropylamino)
chlorophosphine. This reaction mixture was stirred under the presence of argon
overnight. After the
reaction mixture was concentrated to 1/3 of its original volume, 200m1 of
hexane was added and then
the reaction mixture was again concentrated to 1/3 is original volume. This
procedure was repeated
once more. The precipitated salts were filtered off and the solution was
concentrated to afford 8.24gm
of crude Y62. Without further purification, the product was used for next
step.
Synthesis of Y63: A reaction mixture of 1.0 gm (1.45 mmol) of N-PAC deoxy-
adenosine, 1.77g of the
crude Y62, and 125mg of N, N-diisopropylammonium tetrazolide, and 100 ml of
dichloromethane.
The reaction mixture was stirred at room~temperature overnight. The reaction
mixture was then
diluted by adding 100m1 of CH2CIz and 100 mL of 5% NaHC03 solution. The
organic phase was
separated and dried over sodium sulfate. The solution was then concentrated
for column
chromatography. Silica gel (35 gm) was packed with 1 % TEA /Hexane. The crude
material was
119
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
eluted with 1 % TEA /10-40% CHZCIz / Hexane. The fractions containing product
were pooled and
concentrated to afford 0.25 gm of the title product.
Example 5
Synthesis of Ethylene Glycol Terminated Wire W71
S~mthesis of W55: To a flask was added 7.5 gm (27.3 mmol) of tent-
butyldiphenylchlorosilane, 25.0
gm (166.5 mmol) of tri(ethylene glycol) and 50 ml of dry DMF under argon. The
mixture was stirred
and cooled in an ice-water bath. To the flask was added dropwise a clear
solution of 5.1 gm (30.0
mmol) of AgN03 in 80 mL of DMF through an additional funnel. After the
completeness of addition,
the mixture was allowed to warm up to room temperature and was stirred for
additional 30 min. Brown
AgCI precipitate was filtered out and washed with DMF(3 x 10 mL). The removal
of solvent under
reduced pressure resulted in formation of thick syrup-like liquid product that
was dissolved in about 80
ml of CHZCIz. The solution was washed with water (6 x 100 mL) in order to
remove unreacted starting
material, ie, tris (ethylene glycol), then dried over Na2S04. Removal of
CH2CI2 afforded - 10.5 g crude
product, which was purified on a column containing 104 g of silica gel packed
with 50
CHZCIz/hexane. The column was eluted with 3-5% MeOH/ CHZCIZ. The fractions
containing the
desired product were pooled and concentrated to afford 8.01 gm (75.5 %) of the
pure title product.
Synthesis of W68: To a flask containing 8.01 gm (20.6.0 mmol) of W55 was added
8.56 gm (25.8
mmol) of CBr4 and 60 ml of CHZCI2. The mixture was stirred in an ice-water
bath. To the solution was
slowly added 8.11 gm (31.0 mmol) of PPh3 in 15 ml CHzCIz. The mixture was
stirred for about 35 min.
at 0 °C , and allowed to warm to room temperature. The volume of the
mixture was reduced to about
10.0 ml and 75 ml of ether was added. The precipitate was filtered out and
washed with 2x75 of
ether. Removal of ether gave about 15 gm of crude product that was used for
purification. Silica gel
(105 gm) was packed with hexane. Upon loading the sample solution, the column
was eluted with 50
CHZCIz/hexane and then CHzCIz. The desired fractions were pooled and
concentrated to give
8.56gm (72.0 %) of pure title product.
Synthesis of W69: A solution of 5.2 gm (23.6 mmol)of 4-iodophenol in 50 ml of
dry DMF was cooled
in an ice-water bath under Ar. To the mixture was added 1.0 gm of NaH (60% in
mineral oil, 25.0
mmol) portion by portion. The mixture was stirred at the same temperature for
about 35 min. and at
room temperature for 30 min. A solution of 8.68 gm (19.2 mmol) of W68 in 20 ml
of DMF was added
to the flask under argon. The mixture was stirred at 50 °C for 12 hr
with the flask covered with
aluminum foil. DMF was removed under reduced pressure. The residue was
dissolved in 300 ml of
ethyl acetate, and the solution was washed with Hz0 (6 x 50 mL). Ethyl acetate
was removed under
reduced pressure and the residue was loaded into a 100 g silica gel column
packed with 30
CHzCl2/hexane for the purification. The column was eluted with 30-100%
CHzCl2/hexane. The
120
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
fractions containing the desired product were pooled and concentrated to
afford 9.5 gm (84.0 %) of
the title product.
Synthesis of W70: To a 100 ml round bottom flask containing 6.89 gm (11.6
mmol) of W69 was
added 30 ml of 1 M TBAF THF solution. The solution was stirred at room
temperature for 5h. THF
was removed and the residue was dissolved 150 ml of CHZCI2. The solution was
washed with Hz0 (4 x
25 mL). Removal of solvent gave 10.5 gm of semi-solid. Silica gel (65 gm) was
packed with 50
CHzCl2/hexane, upon loading the sample solution, the column was eluted with 0-
3 % CH30H/CHZCIz.
The fractions were identified by TLC (CH30H : CHzCIz = 5 : 95). The fractions
containing the desired
product were collected and concentrated to afford 4.10 gm (99.0% ) of the
title product.
~mthesis of W71: To a flask was added 1.12 gm (3.18 mmol) of W70, 0.23 g (0.88
mmol) of PPh3,
110 mg (0.19 mmol) of Pd(dba)2, 110 mg (0.57 mmol) of Cul and 0.75g (3.2 mmol)
of Y4 (one unit
wire). The flask was flushed with argon and then 65 ml of dry DMF was
introduced, followed by 25 ml
of diisopropylamine. The mixture was stirred at 55 °C for 2.5 h. All
tsolvents were removed under
reduced pressure. The residue was dissolved in 100 ml of CH2CI2, and the
solution was thoroughly
washed with the saturated EDTA solution (2 x 100 mL). The Removal of CHZCIZ
gave 2.3 g of crude
product. Silica gel (30 gm) was packed with 50 % CH2C12/hexane, upon loading
the sample solution,
the column was eluted with 10 % ethyl acetate/CHZCIZ. The concentration of the
fractions containing
the desired product gavel .35 gm (2.94 mmol) of the title product, which was
further purified by
recrystallization from hot hexane solution as colorless crystals.
Example 6
Synthesis of nucleoside attached to an insulator
Synthesis of C108: To a flask was added 2.Ogm (3.67 mmol) of 2'-amino-5'-O-DMT
uridine, 1.63gm
(3.81 mmol) of C44, 5m1 of TEA and 100m1 of dichloromethane. This reaction
mixture was stirred at
room temperature over for 72hrs. The solvent was removed and dissolved in a
small volume of
CHzCl2_ Silica gel (35 gm) was packed with 2% CH30H/1 % TEA/CHZCI2, upon
loading the sample
solution, the column was eluted with the same solvent system. The fractions
containing the desired
product were pooled and concentrated to afford 2.5gm ( 80.4 %) of the title
product.
Synthesis of C109: To a flask was added 2.4gm ( 2.80 mmol) of C108, 4m1 of
diisopropylethylamine
and 80m1 of CHZCIz under presence of argon. The reaction mixture was cooled in
an ice-water bath.
Once cooled, 2.10 gm (8.83 mmol) of 2-cyanoethyl diisopropylchloro-
phosphoramidite was added.
The mixture was then stirred overnight. The reaction mixture was diluted by
adding 10m1 of methanol
and 150m1 of CHzCl2. This mixture was washed with a 5% NaHC03 solution, dried
over sodium
sulfate and then concentrated for column chromatography. A 65gm-silica gel
column was packed in
1 % TEA and Hexane. The crude product was loaded and the column was eluted
with 1 % TEA/ 0-20
121
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
CHZCIZ/Hexane. The fractions containing the desired product were pooled and
concentrated to
afford 2.69gm (90.9 %) of the title product.
Example 7
Comparison of Different ETM Attachments
A variety of different ETM attachments as depicted in Figure 1 were compared.
As shown in Table 1,
a detection probe was attached to the electrode surface (the sequence
containing the wire in the
table). Positive (i.e. probes complementary to the detection probe) and
negative (i.e. probes not
complementary to the detection probe) control label probes were added.
Electrodes containing the different compositions of the invention were made
and used in AC detection
methods. The experiments were run as follows. A DC offset voltage between the
working (sample)
electrode and the reference electrode was swept through the electrochemical
potential of the
ferrocene, typically from 0 to 500 mV. On top of the DC offset, an AC signal
of variable amplitude and
frequency was applied. The AC current at the excitation frequency was plotted
versus the DC offset.
The results are shown in Table 2, with the Y63, VI and IV compounds showing
the best results.
Metal Redox 10 Hz 100 Hz 1,000 Hz 10,000 Hz
Complexes Potential
(mV)
I 400 Not clear Not clear Not clear Not clear
II 350 0.15 NA 0.01 NA 0.005 NA ND
III (+ 360 0.025 NA 0.085 NA 0.034 uA ND
control)
III (- 360 0.022 NA 0.080 NA 0.090 NA ND
control)
IV 140 0.34 NA 3.0 NA 13.0 NA 35 NA
V 400 0.02 NA ND 0.15 NA ND
VI(1 ) 140 0.22 NA 1.4 NA 4.4 NA 8.8 NA
VI(2) 140 0.22 NA 0.78 NA 5.1 NA 44 NA
VII 320 0.04 NA ND 0.45 NA No Peak
VIII(not 360 0.047 NA ND ND No Peak
purified)
Y63 160 .25 NA ND 36 NA 130 NA
Not clear: There is no difference between positive control and negative
control.
ND: Not determined
Table of the Oligonucleotides Containing Different Metal Complexes
122
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Metal Positive Control Sequence Negative Control Sequence Containing
Containing
Complexes Metal Complexes and NumberingMetal Complexes and Numbering
I 5'-A(I)C (I)GA GTC CAT GGT-3'5'-A(I)G (I)CC TAG CTG GTG-3'
#D199 1 #D200 1
II 5'-A(II)C (II)GA GTC CAT 5'-A(II)G (II)CC TAG CTG GTG-3'
GGT-3'
#D211 _1,2 #D212 1
III 5'-AAC AGA GTC CAT GGT-3' 5'-ATG TCC TAG CTG GTG-3'
#D214 1 #D57 1
IV 5'-A(IV)C (IV)GA GTC CAT 5'-A(IV)G (IV)CC TAG CTG GTG-3'
GGT-3'
#D215 1 #D216 1
V 5'-A(V)C (V)GA GTC CAT GGT-3'S'-A(V)G (V)CC TAG CTG GTG-3'
#D203 1 #D204 1
VI 5'-A(VI)C AGA GTC CAT GGT-3'5'-A(VI)G TCC TAG CTG GTG-3'
#D205 1 #D206 1
VI 5'-A(VI)* AGA GTC CAT GGT-3'5'A(VI)* TCC TAG CTG GTG-3'
#D207 1 #D208 1
VII 5'-A(VII)C (VII)GA GTC CAT 5'-A(VII)G (VII)CC TAG CTG GTG-3'
GGT-3'
#D158 3 #D101 2
VIII 5'-A(VIII)C (VIII)GA GTC 5'-A(VIII)G (VIII)CC TAG CTG
CAT GGT-3' GTG-3'
#D217 1,2,3 #D218 1
Metal Sequence Containing Wire
On G
Complexes Surface and Numbering
I 5'-ACC ATG GAC TCT GT(UW)-3'
#D201 1,2
II 5-'ACC ATG GAC TCT GT(UW)-3'
#D201 1,2
III 5'-ACC ATG GAC TCT GT(UW)-3'
#D201 _1,2
IV 5'-ACC ATG GAC TCT GT(UW)-3'
#D201 _1,2
V 5'-ACC ATG GAC TCA GA(UW)-3'
#D83 17,18
VI 5'-ACC ATG GAC TCT GT(UW)-3'
#D201 1,2
VI 5'-ACC ATG GAC TCT GT(UW)-3'
#D201 1,2
VII 5'-ACC ATG GAC TCA GA(UW)-3'
#D83 17,18
VIII 5'-ACC ATG GAC TCA GA(UW)-3'
#D83 17,18
123
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Example 8
Preferred Embodiments of the Invention
A variety of systems have been run and shown to work well, as outlined below.
All compounds are referenced
in Figure 19. Generally, the systems were run as follows. The surfaces were
made, comprising the electrode,
the capture probe attached via an attachment linker, the conductive oligomers,
and the insulators, as outlined
above. The other components of the system, including the target sequences, the
capture extender probes,
and the label probes, were mixed and generally annealed at 90°C for 5
minutes, and allowed to cool to room
temperature for an hour. The mixtures were then added to the electrodes, and
AC detection was done.
Use of a capture probe a capture extender probe, an unlabeled target seguence
and a label probe:
A capture probe D112, comprising a 25 base sequence, was mixed with the Y5
conductive oligomer and the
M44 insulator at a ratio of 2:2:1 using the methods of Example 16. A capture
extender probe D179,
comprising a 24 base sequence perfectly complementary to the D112 capture
probe, and a 24 base sequence
perfectly complementary to the 2tar target, separated by a single base, was
added, with the 2tar target. The
D179 molecule carries a ferrocene (using a C15 linkage to the base) at the end
that is closest to the electrode.
When the attachment linkers are conductive oligomers, the use of an ETM at or
near this position allows
verification that the D179 molecule is present. A ferrocene at this position
has a different redox potential than
the ETMs used for detection. A label probe D309 (dendrimer) was added,
comprising a 18 base sequence
perfectly complementary to a portion of the target sequence, a 13 base
sequence linker and four ferrocenes
attached using a branching configuration. A representative scan is shown in
Figure 20A. When the 2tar
target was not added, a representative scan is shown in Figure 20B.
Use of a capture probe and a labeled target seguence:
Example A: A capture probe D94 was added with the Y5 and M44 conductive
oligomer at a 2:2:1 ratio with the
total thiol concentration being 833 NM on the electrode surface, as outlined
above. A target sequence (D336)
comprising a 15 base sequence perfectly complementary to the D94 capture
probe, a 14 base linker
sequence, and 6 ferrocenes linked via the N6 compound was used. A
representative scan is shown in Figure
20C. The use of a different capture probe, D109, that does not have homology
with the target sequence,
served as the negative control; a representative scan is shown in Figure 20D.
Example B: A capture probe D94 was added with the Y5 and M44 conductive
oligomer at a 2:2:1 ratio with the
total thiol concentration being 833 uM on the electrode surface, as outlined
above. A target sequence (D429)
comprising a 15 base sequence perfectly complementary to the D94 capture
probe, a C131 ethylene glycol
linker hooked to 6 ferrocenes linked via the N6 compound was used. A
representative scan is shown in
Figure 20E. The use of a different capture probe, D109, that does not have
homology with the target
sequence, served as the negative control; a representative scan is shown in
Figure 20F.
124
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Use of a capture probe a capture extender probe an unlabeled target seguence
and two label probes with
long linkers between the target binding seguence and the ETMs:
The capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture
extender probe D179 were
as outlined above. Two label probes were added: D295 comprising an 18 base
sequence perfectly
complementary to a portion of the target sequence, a 15 base sequence linker
and six ferrocenes attached
using the N6 linkage depicted in Figure 23. D297 is the same, except that it's
18 base sequence hybridizes to
a different portion of the target~sequence. A representative scan is shown in
Figure 20G. When the 2tar
target was not added, a representative scan is shown in Figure 20H.
Use of a capture probe a capture extender probe an unlabeled tar4et seguence
and two label probes with
short linkers between the target binding se4uence and the ETMs:
The capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture
extender probe D179 were
as outlined above. Two label probes were added: D296 comprising an 18 base
sequence perfectly
complementary to a portion of the target sequence, a 5 base sequence linker
and six ferrocenes attached
using the N6 linkage depicted in Figure 23. D298 is the same, except that it's
18 base sequence hybridizes to
a different portion of the target sequence. A representative scan is shown in
Figure 201. When the 2tar target
was not added, a representative scan is shown in Figure 20J.
Use of two capture probes two capture capture extender probes an unlabeled
large target sepuence and two
label probes with long linkers between the target binding seguence and the
ETMs:
This test was directed to the detection of rRNA. The Y5 conductive oligomer,
the M44 insulator, and one
surface probe D350 that was complementary to 2 capture sequences D417 and EU1
were used as outlined
herein. The D350, Y5 and M44 was added at a 0.5:4.5:1 ratio. Two capture
extender probes were used;
D417 that has 16 bases complementary to the D350 capture probe and 21 bases
complementary to the target
sequence, and EU1 that has 16 bases complementary to the D350 capture probe
and 23 bases
complementary to a different portion of the target sequence. Two label probes
were added: D468 comprising
a 30 base sequence perfectly complementary to a portion of the target
sequence, a linker comprising three
glen linkers as shown in Figure 19 (comprising polyethylene glycol) and six
ferrocenes attached using N6.
D449 is the same, except that it's 28 base sequence hybridizes to a different
portion of the target sequence,
and the polyethylene glycol linker used (C131) is shorter. A representative
scan is shown in Figure 20K.
Use of a capture probe, an unlabeled target, and a label probe:
Example A: A capture probe D112, Y5 conductive oligomer and the M44 insulator
were put on the electrode at
2:2:1 ratio with the total thiol concentration being 833 NM. A target sequence
MT1 was added, that comprises
a sequence complementary to D112 and a 20 base sequence complementary to the
label probe D358 were
combined; in this case, the label probe D358 was added to the target sequence
prior to the introduction to the
electrode. The label probe contains six ferrocenes attached using the N6
linkages depicted in Figure 23. A
125
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
representative scan is shown in Figure 20L. The replacment of MT1 with NC112
which is not complementary
to the capture probe resulted in no signal; similarly, the removal of MT1
resulted in no signal.
Example B: A capture probe D334, Y5 conductive oligomer and the M44 insulator
were put on the electrode
at 2:2:1 ratio with the total thiol concentration being 833 uM. A target
sequence LP280 was added, that
comprises a sequence complementary to the capture probe and a 20 base sequence
complementary to the
label probe D335 were combined; in this case, the label probe D335 was added
to the target prior to
introduction to the electrode. The label probe contains six ferrocenes
attached using the N6 linkages depicted
in Figure 23. A representative scan is shown in Figure 20M. Replacing LP280
with the LN280 probe (which
is complementary to the label probe but not the capture probe) resulted in no
signal.
Example 9
Monitoring of PCR reactions using the invention
Monitoring of PCR reactions was done using an HIV sequence as the target
sequence. Multiple reactions
were run and stopped at 0 to 30 or 50 cycles. In this case, the sense primer
contained the ETMs (using the
N6 linkage described herein), although as will be appreciated by those in the
art, triphosphate nucleotides
containing ETMs could be used to label non-primer sequences. The surface probe
was designed to hybridize
to 16 nucleotides of non-primer sequences, immediately adjacent to the primer
sequence; that is, the labeled
primer sequence will not bind to the surface probe. Thus, only if
amplification has occured, such that the
amplified sequence will bind to the surface probe, will the detection of the
adjacent ETMs proceed.
The target sequence in this case was the plasmid pBKBH10S (NIH AIDS Research
and Reference Reagent
program - McKesson Bioservices, Rockville MD) which contains an 8.9 kb Sstl
fragment of pBH10-R3 dervied
from the HXB2 clone which contains the entire HIV-1 genome and has the Genbank
accession code K03455
or M38432) inserted into the Sstl site on pBluescript II-KS(+). The insert is
oriented such that transcription
from the T7 promoter produces sense RNA.
The "sense" primer, D353, was as follows: 5'-(N6)A(N6)AGGGCTGTTGGAAATGTGG-3'.
The "antisense"
primer, D351, was as follows: 5'-TGTTGGCTCTGGTCTGCTCTGA-3'. The following is
the expected PCR
product of the reaction, comprising 140 bp:
5'-(N6)A(N6)AGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAGATTGTACTGAGAGACAGGCT
3'-TTTTTCCCGACAACCTTTACACCTTTCCTTCCTGTGGTTTACTTTCTAACATGACTCTCTGTCCGA
AATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAG
C
TTAAAAAATCCCTTCTAGACCGGAAGGATGTTCCCTTCCGGTCCCTTAAAAGAAGTCTCGTCTGGTCTCG
CAACA-3'
126
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
GTTTG-5'
The surface capture probe (without any overlap to the sense primer) D459 was
as follows: 5'-
TTGGTGTCCTTCCTTU-4 unit wire(C11 )-3'.
PCR reaction conditions were standard: TAQ polymerase at TAQ 10X buffer. 1 ~M
of the primers was added
to either 6 X 103, 6X 106 or 6 X 10' molecules of template. The reaction
conditions were 90°C for 30 sec, 57°C
for 30 sec, and 70°C for 1 minute.
The electrodes were prepared by melting 0.127 mm diamter pure gold wire on one
end to form a ball. The
electrodes were dipped in aqua regia for 20 seconds and tehn rinse with water.
The SAM was deposited by
dipping the electrode into a deposition solution of 1.3:4.0:7 D459:H6:M44 in
37:39:24 THF:ACN:water at 1 mM
total thiol which was heated at 50°C for five minutes prior to the
introduction of the electrodes. The electrodes
were added and then removed immediately to room temperature to sit for 15
minutes. Electrodes were then
transferred to M44 (in 37:39:24 THF:ACN:water at 400 NM total thiol
concentration). The electrodes sat in
M44 at room tem for 5 minutes, then the following heat cycling was applied:
70°C for 1 minute, followed by
55°C for 30 sec, repeating this cycle 2 more times followed by a 0.3
°C ramp down to RT with soaking at RT
for 10 minutes. The electrodes were taken out of M44 solution, rinsed in
2XSSC, and hybridized as follows.
The PCR products were adjusted to 6XSSC (no FCS). The control was also
adjusted to 6XSSC.
Hybridization was carried out at RT after rinsing twice in 6XSSC for at least
1.5 hours. ACV conditions were
as follows: Ag/AgCI reference electrode and Pt auxiliary electrodes were used,
and NaCl04 was used as the
electrolyte solution. ACV measurements were carried out as follows: v=10 Hz,
e=25 mV, scan range -100 mV
to 500 mV. The data is shown in Figure 26.
Example 10
Ligation on an Electrode Surface
The design of the experiment is shown in Figure 21, for the detection of an
HIV sequence. Basically, a surface
probe D368 (5'-(H2)CCTTCCTTTCCACAU-4 unit wire(C11 )-3') was attached to an
electrode comprising M44
and H6 (H6 is a two unit wire terminating in an acetylene bond) at a ratio of
D368:H6:M44 of 1:4:1 with a total
thiol concentration of 833 NM. A ligation probe HIVLIG (5'-CCACCAGATCTTCCCTAA
AAAATTAGCCTGTCTCTCAGTACAATCTTTCATTTGGTGT-3') and the target sequence HIVCOMP
(5'-
ATGTGGAAAGAAAGGACACCAATTGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTG
G-3') was added, with ligase and the reaction allowed to proceed. The reaction
conditions were as follows: 10
~M of HIVLIG annealed to HIVCOMP were hybridized to the electrode surface (in
6XSSC) for 80 min. The
surface was rinsed in ligase buffer. The ligase (T4) and buffer were added and
incubated for 2 hours at RT.
Triton X at 10~ M was added at 70°C to allow the denaturation of the
newly formed hybridization complex,
resulting in the newly formed long surface probe (comprising D368 ligated to
the HIVLIG probe). The addition
of the D456 signalling probe (5'-
(N6)G(N6)CT(N60C(N60G(N6)C(N6)TTCTGCACCGTAAGCCA
127
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
TCAAAGATTGTACTGAG-3') allowed detection (results not shown). The D456 probe
was designed such that
it hybridizes to the HIVLIG probe; that is, a surface probe that was not
ligated would not allow detection.
Example 11
Use of capture probes comprising ethylene glycol linkers
The capture probe for a rRNA assay containing 0, 4 and 8 ethylene glycol units
was tested on four separate
electrode surfaces. Surface 1 contained 2:1 ratio of H6:M44, with a total
thiol concentration of 500 NM.
Surface 2 contained a 2:2:1 ratio of D5681H6/M44 with a total thiol
concentration of 833 uM. Surface 3
contained a 2:2:1 ratio of D570/H6/M44 with a total thiol concentration of 833
uM. D568 was a capture probe
comprising 5'-GTC AAT GAG CAA AGG TAT TAA (P282)-3'. P282 was a thiol. D569
was a capture probe
comprising 4 ethylene glycol units: 5'-GTC AAT GAG CAA AGG TAT TAA (C131 )
(P282)-3'. D570 was a
capture probe comprising 8 ethylene glycol units: 5'-GTC AAT GAG CAA AGG TAT
TAA (C131 ) (C131 )
(P282)-3'. The H6 (in the protected form) was as follows: (CH3)3Si-(CHZ)2 S-
(C6H5)-C C-(C6H5)-C-CH. M44
is the same as M43 and was as follows: HS-(CHZ)"-(OCHzCH3)3 OH. The D483 label
probe hybridizes to a
second portion of the rRNA target, and was as follows: 5'-(N6)C(N6) G(N6C
(N6)GG CCT (N6)C(N6) G(N6)C
(N6)(C131 )(C131 ) (C131 )(C131 )T TAA TAC CTT TGC TC-3'. The D495 is a
negative control and was as
follows: 5'-GAC CAG CTA GGG ATC GTC GCC TAG GTGAG(C131 ) (C131 )(C131 )(C131 )
(N6)G(N6) CT(N6)
C(N6)G (N6)C(N6)-3'. The results were as follows:
Surface 1: D483 ~0 (no capture probe present)
D495 0
Surface 2: D483 126 nA
D495 1.29 nA
Surface 3: D483 19.39 nA
D495 1.51 nA
Surface 4: D483 84 nA
D495 1.97 nA
As is shown, the system is working well.
Example 12
Detection of rRNA and a Comparison of Different Amounts of ETMs
The most sensitive rRNA detection to date used D350/H6/M44 surfaces mixed in a
ration of 1:3.5:1.5
deposited at a 833 NM total thiol concentration. D350 is a 4 unit wire with a
15mer DNA; H6 is a 2 unit wire;
and M44 is an ethylene glycol terminated alkane chain. Better detection
limites are seen when the target
molecule is tethered to the sensor surface at more than one place. To date,
two tether points have been used.
A D417 tether sequence (42mer) and a EU1 capture sequence (62mer) bound the
16S rRNA to the D350 on
128
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
the surface. A series of 9 label probes (D449, D469, D489, D490, D491, D476,
D475 and D477) pre-
annealed to the rRNA gave the electrochemical signal. These label probes
(signalling molecules) have 6 or 8
N6 or Y63 type ferrocenes. The label probes that flank the tack-down regions
were replaced (one end at a
time) with label probes containing either 20 or 40 ferrocenes. Additionally, a
label probe that binds to a region
in the middle of the tack-down regions was replaced with label probes
containing either 20 or 40 ferrocenes.
When 2 6-ferrocene containing label probes were replaced by 2 40-ferrocene
containing label probes, there
was a 12-fold increase in the positive signal. The non-specific signal went up
as well, exhibiting a 1.5 increase
in the signal to noise ratio. Currently the best system utilizes tacking down
the rRNA in two places and used a
40-ferrocene label probe to flank the 3' tack down point and bind the
remaining face of the rRNA molecule with
6-ferrocene containing label probes. Additional tack down points, and a
plurality of label probes, is
contemplated.
A typical experimental protocol is as follows:
Surface derivatization: 20 NL of deposition solution (1:3.5:1.5 of D350:H6:M44
at total thiol concentration of
833 ~M in 43.2% THF, 45.9% ACN, 10.9 ~% H20) was heated in a closed half
milliliter eppendorf tube at 50'C
for 5 minutes. A melted gold ball electrode was inserted into the solution and
then moved immediately to room
temperature to incubate for 15 minutes. The electrode was then transferred
into ~200 uL of 400 NM M44 in
37% TH, 39% ACN, 24% H20, where it incubated for 5 minutes at room
temperature, 2 minutes at 40'C, 2
minutes at 30'C, and then an additional 15 minutes at room temperature. The
electrode was then briefly
dipped in 2X SSC (aqueous buffered salt solution) and hybridized as below.
Hybridization solutions were annealed by heating at 70°C for 30 seconds
and then cooling to 22°C over - 38
seconds. The molecules were all in 4X SSC at twice the targeted
concentrations, with the rRNA at 35 U.S.C.
~ uM, the capture sequence at 1.0 NM, and the label probes at 3 uM. After
annealing, the solution was diluted
1:1 with fetal calf serum, halving the concentrations and changing the solvent
to 2X SSC with 50% FCS. It
should be noted that a recent experiment with model compounds suggest that a
dilution by 1.2 with bovine
serum albumin may be desirable: the reduction in non-specific binding was the
same, but the sample
concentration is not diluted and the positive signal was enhanced by a factor
of 1.5. This was not done using
the rRNA target, however. Solutions were aliquotted into 20 NL volumes for
hybridization.
Hybridization was done as follows: After the 2X SSC dip described above, the
derivatized electrode was
placed into an eppendorf tube with 20 NL hybridization solution. It was
allowed to hybridize at room
temperature for 10 minutes.
Immediately before measurement, the electrode was briefly dipped in room
temperature 2X SSC. It was then
transferred into the 1 M NaCl04 electrolyte and an alternating current
voltammogram was taken with an
applied alternating current of 10 Hz frequency and a 25 mV center-to-peak
amplitude.
129
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
basic experiments were run (system components in parentheses):
System 1. rRNA is tacked down at only one point (D449 + D417(EU2) + D468
System 2. rRNA is tacked down at two points
System 3. two point tack down plus two label probes comprising 20 ferrocenes
each directed to a flanking
5 region of the second tack down point
System 4. two point tack down plus two label probes comprising 40 ferrocenes
each directed to a flanking
region of the second tack down point
System 5. two point tack down plus two label probes comprising 20 ferrocenes
each directed to a flanking
region of the first tack down point
10 System 6. two point tack down plus two label probes comprising 40
ferrocenes each directed to a flanking
region of the first tack down point
System 7. two point tack down plus a label probe comprising 25 bases that
binds to the middle region (i.e. the
region between the two tack down points) containing 20 ferrocenes.
System 8. two point tack down plus a label probe comprising 25 bases that
binds to the middle region (i.e. the
region between the two tack down points) containing 40 ferrocenes.
System 9. two point tack down plus a label probe comprising 40 bases that
binds to the middle region (i.e. the
region between the two tack down points) containing 20 ferrocenes.
System 10. two point tack down plus a label probe comprising 40 bases that
binds to the middle region (i.e.
the region between the two tack down points) containing 40 ferrocenes.
The results are shown in Figure 22. It is clear from the results that
multipoint tethering of large targets is better
than single point tethering. More ETMs give larger signals, but require more
binding energy; 35 bases of
recognition to the target.
Example 13
Direct Comparison of Different Configurations of Ferrocenes
A comparison of different configurations of ferrocene was done, as is
generally depicted in Figure 23. Figures
23A, 23B, 23C and 23D schematically depict the orientation of several label
probes. D94 was as follows: 5'-
130
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
ACC ATG CAC ACA GA(C11 )-3'. D109 was as follows: 5'-CTG CGG TTA TTA AC(C11 )-
3'. The "+" surface
was a 2:2:1 ratio of D94:H6:M44, with a total thiol concentration of 833 NM.
The "=' surface was a 2:2:1 ratio
of D109:H6:M44, with a total thiol concentration of 833 NM. The D548 structure
was as follows: 5'-
(N38)(N38)(N38) (N38)(N38)(N38) (N38)(N38)(N38) ATC TGT GTC CAT GGT-3'. On
each N38 was a 5'-
(H2)(C23)-3'. The D549 structure was as follows: 5'-(N38)(N38)(N38)
(N38)(N38)(N38) (N38)(N38)(N38) ATC
TGT GTC CAT GGT-3'. On each N38 was a 5'-(H2)(C23)(C23)-3'.
The D550 structure was as follows: 5'-(N38)(N38)(N38) (N38) AT CTG TGT CCA TGG
T-3'. On each N38
was a 5'-(H2)(C23)(C23)-3'. The D551 structure was as follows: 5'-
(n38)(N38)(N38) (N38)ATCTG TGT CAA
TGG T-3'. On each N38 was a 5'-(H2)(C23)(C23)(C23)(C23)-3'. A 5' N38 has two
sites for secondary
modification. A representative schematic is shown in Figure 23E.
The results, shown in the figures, show that the D551 label probes gave the
highest signals, with excellent
signal-to-noise ratios.
Example 17
Ferrocene polymers as both recruitment linker and ETM
This system is shown in Figure 25. D405 has the structure: 5'-(C23)(C23)(C23)
(C23)(C23)(C23)
(C23)(C23)(C23) (C23)AT CTG TGT CCA TGG T-3'. The system was run with two
surfaces: the "+" surface
was a 2:2:1 ratio of D94:H6:M44, with a total thiol concentration of 833 ~M.
The "=' surface was a 2:2:1 ratio
of D109:H6:M44, with a total thiol concentration of 833 NM. The results, shown
in Figure 25B, show that the
system gave a good signal in the presence of a complementary capture probe.
Example 18
Detection of rRNA
The objective was to develop methods for the detection of rRNA from a
bacterial pathogen. Initially, purified
RNA was used to optimize the strategy. Subsequently, crude lysates were
analyzed. E. coli served as a non-
infectious model bacterium target in this study.
Introduction: The high abundance of rRNA in a cell make it an appealing target
for electronic detection.
However, rRNA is characterized by highly defined secondary and tertiary
structure that makes capturing a
specific sequence within the structure difficult. The 16S rRNA transcript of
E. Coli is 1542 bases in length, and
is present at 2X104 copies/cell. Helper sequences have been characterized that
act to specifically unfold
portions of the rRNA and facilitate hybridization of probes to adjacent
regions. We designed three surface
capture probes and two signaling probes. Two of the capture probes were
designed access sequences
exposed by helper probes while a third was targeted to the 5' and of the
mature transcript.
Materials and Methods:
131
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
Surface Probe Sequences:
D1218 5'- ATG ATC AAA CTC TTC AAT TTA A (P282) -3' (SPA)
D1219 5'- CAA CCC GAA GGC CTT CTT CAT A (P282) -3' (SPB)
D1220 5'- GGC TGC TGG CAC GGA GTT AGC C (P282) -3' (SPC)
Signaling Oligos
D1216 5'-(N6)C(N6) G(N6)C (N6)GC TTA (N6)C(N6) G(N6)C (N6)G(C131 ) CAC GCG GCA
TGG
CTG AAT CAG G- 3' (SB)
D1217 5'-(N6)C(N6) G(N6)C (N6)GC TTA (N6)C(N6) G(N6)C (N6)G(C131 ) GGT GCT TCT
TCT GCG GGT
AAC GTC AAT GAG- 3' (SC)
Helper Sequences:
D1221 5' - CGA CTT GCA TGT GTT AGG CCT GCC GCC.AGC GTT CAA TCT GAG CC - 3'
(HA)
D1222 5' -CCT CCC CGC TGA AAG TAC TTT A- 3' (HB)
Total RNA was isolated and purified from a 50mL overnight culture of E. coli
using the Qiagen RNeasy midikit.
The concentration of 16S rRNA in these samples was estimated in two ways. The
optical density of the total
RNA sample at 260 nanometer was determined and a fraction of that was
attributed to 16S RNA. Second, the
sample was analyzed by formaldehyde gel electrophoresis and subsequent
staining with ethidium bromide
alongside standards of known composition and mass. The abundance of the 16S
rRNA was estimated from
its staining intensity relative to the standard. The two estimates were in
general agreement. 50nM and 10nM
rRNA solutions were heated to 70°C in the presence of helper sequences
A and B (2.5uM), and signaling
probes B and C (125nM), in 1 M NaCl04 and lysed blood for 3 minutes. After
cooling, the solution was added
to small cartridge chips and hybridized for 4 hours. The chips were deposited
with capture probe/H6/M44
(2:2:1 ) in 0.9%TEA/6XSSC in the following pattern.
Capture probe A acts as an additional tack down point only, there is no
signaling molecule directly adjacent to
its position as there is associated with capture probes B and C. The following
graph displays the peak heights
of signals generated from the 50nM and 10nM rRNA solutions after 4 hours with
both signaling B and C added
at 125nM. Purified rRNA was clearly detected at both 50nM and 10nM, while
control surfaces, containing a
randomer capture probe (R), yielded no detectable signals. Electrodes bearing
triple capture probes (A, B,
and C) gave rise to the largest signals, and on average, pads bearing double
capture probes gave larger
signals than the pads with only a single capture probe. Although there is no
signaling molecule adjacent to
capture probe A, the extra tack-down point in close proximity to signaling
moieties B and C allows, in some
cases, increased signaling (compare C alone to AC).
In an attempt to demonstrate the specificity of the system for detecting 16S
rRNA, a solution of 50nM total
human heart RNA in 1 M NaC104/Lysed blood with signaling probes B and C
(125nM) and helper probes A and
132
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
B (2.5uM) was placed in cartridges over the electrodes. The following overlay
of voltammograms presents the
output from each electrode from the array challenged with human RNA. There is
no signal from any pad.
An attempt was made to directly detect E. Coli rRNA in cell lysates without
the extra steps of RNA purification.
The cell lysate was made according to Qiagen RNeasy protocol. A 50mL overnight
culture.was centrifuged
and the pellet was resuspended in 500uL of 1 mg/ml lysozyme in a Tris-EDTA
buffer and incubated at room
temperature for 5 minutes. 1.9mL of the guanadium isothiocynate based lysis
buffer, buffer RLT, with 0.145M
Beta mercaptoethanol (B-Me, to inactivate RNase ) was added. For each chip, 6%
of the original 50mL
culture (141 uL of cell lysate) was added to 159uL of whole blood
(89%)/Proteanase K solution (11 %), and
heated at 70C for 10 minutes. The lysed blood/E. Coli solution above was then
added to 2M NaCl04 with
50nM signaling probes B and C and 1uM helper sequences A and B. The solution
was then heated to 70oC
for 3 minutes to aid in the disruption of secondary and tertiary structure and
facilitate hybridization of helper
and signaling sequences. Samples prepared in the manner above were compared to
another hybridization
solution using guandinium hydrochloride in place of guandinium isothiocynate
also with 0.145 B-Me added.
After cooling, the samples were added to the arrays and hybridized overnight.
Chips hybridized with either type of hybridization solutions, guandinium
isothiocynate or guanadinium
hydrochloride, yielded immeasurable signals and voltammograms indicative of
pad or monolayer
disintegration.
Since we have used guanadinium hydrochloride based solutions routinely in the
past, we suspected that B-Me
was detrimental to electronic detection on the CMS sensor. To test this
theory, the standard NaCl04/Lysed
blood hybridization buffer was used, incorporating either lysis buffer
RBT(guanadinium isothiocynate) or lysis
buffer AL (guanadinium hydrochloride) to make the lysed blood with and without
the addition of B-Me. The
standard protocol was followed, with the addition of 5nM purified E. coli RNA.
Arrays were hybridized
overnight. All arrays containing B-Me or containing guanadinium isothiocynate
lysis buffer (buffer RBT) gave
immeasurable signals, while the arrays hybridized in guanadinium hydrochloride
lysis buffer (buffer AL),
without B-Me gave rise to standard size peaks.
Above is a scan from an array hybridized in a buffer containing lysis buffer
AL (guanadinium hydrochloride)
without B-Me. Peaks are seen on pads containing E. Coli rRNA capture probes,
while no peaks are seen on
negative control pads containing random capture probe: There is no sign of pad
degradation as was seen in
the scans from arrays hybridized in buffers containing B-Me or buffer RLT
(guanadinium isothiocynate).
Next, we tested the possibility that there is a concentration dependence to B-
Me inhibition of electronic
detection. We used the HIV model oligo target and the DEMO materials to test
for B-Me inhibition. 50nM
target and 125nM signaling probe were hybridized over a DEMO array. B-Me was
titrated into hybridization
buffer and the electrochemical signal was measured after 1 hour and then again
after 4 hours of hybridization.
Both a concentration and a time dependence were observed. At 34mM, the
concentration found in the Qiagen
133
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
lysis buffer, specific binding could not be detected. At 17mM, a weak positive
signal was detected after one
hour that was lost by four hours. The consequence of extended incubation in B-
Me is more evident in the
8.5mM solution. A half-maximal signal is observed after 1 hour that is 1/10
maximal after four hours.
However, the 4.25mM solution gave a strong signal after 1 hour that increased
slightly by four hours. The
latter observation suggests that 1 mM B-Me may be tolerated by the sensor.
Efforts to test that hypothesis with
low target concentration and extended hybridization times are underway.
In order to test the detection limit of rRNA in E. coli crude lysates, arrays
were hybridized in the presence of
bacterial lysate such that the lysate comprised from 6% down to 0.1875% of the
final solution. A 50mL
overnight E. coli culture, lysed in buffer AL without the addition of B-Me
(guanidinium hydrochloride) was
prepared in the manner described above. Another set of arrays were hybridized
in a NaCl04/lysed blood
solution containing purified RNA in amounts that correspond to that found in
the range of lysates tested, 6% to
0.1875%. Peaks were detectable on arrays with 6% crude lysate and with 6%
purified RNA after 2 hours
hybridization without a significant size difference between crude and
purified. Peaks were also detectable on
0.75% and 0.375% of a 50mL culture after overnight hybridization, and barely
detectable with 0.1875% of a
50mL culture.
In the arrays hybridized with purified RNA, the inconsistency of 0.75% of the
culture giving rise to larger signals
than 6% of the culture may be explained by the variability from chip to chip.
Each bar graph represents only
two chips in this experiment. With a finite number of replicates, an outlier
pad, or a chip with extremely high or
low performance can drastically change a trend. The two designated columns
above each had one extremely
large outlier removed to decrease standard deviation which brought the peak
sizes from 0.75% solution much
closer to 6% solution than they were when all data was included in the graph.
The representation above is a
repeat experiment preformed because the first attempt yielded signal sizes
from 1.5% solution that were more
than one-third larger than the signals from 3.0% solution, also the result of
large outliers.
The E. coli cell concentration in the culture used to prepare purified RNA and
crude lysates was determined to
be 4.7x108/mL by a plating dilution series. Therefore 0.1875% of a 50mL
culture corresponds to 4x107 E. Coli
cells. Assuming 1X104 16S rRNA molecules per cell, we detected 4.4x10" 16S
rRNA molecules. That
corresponds to a 200pM concentration in our large cartridges. Thus, our
detection limit for 16SrRNA from
pure RNA or crude lysates is close to our current detection limit for well-
studied oligos and isolated RNA (e.g.
HIV 840).
Conclusions: Throughout this experimental investigation, the largest peaks
with rRNA target were seen
consistently on the surfaces with the triple capture probes. The signal on
pads with triple capture probes A, B,
and C is much higher than on the pads with the double capture probes, B and C,
even though there is no
signaling molecule associated with capture probe A, (only with B and C). The
additional tack-down point at the
position adjacent to capture probe A may increase the signal size by holding
signaling oligos in a favorable
position. Alternatively, the three capture probes might increase the rate at
which target molecules are
134
CA 02379693 2002-O1-17
WO 01/06016 PCT/US00/19889
captured on the electrode surface. At low target concentration, the pads
baring the triple capture probe, A, B,
and C were the only pads to give measurable signals, while double and single
capture probes on the surface
gave signals equivalent to the negative pads (too small to measure). Thus, the
incorporation of multiple
capture and signaling sequences on a long target, such as rRNA, increases
signal size and lowers the
detection limit.
Following standard protocols, Beta mercaptoethanol was added to both lysis
buffers to inactivate RNase and
thereby protect RNA from degradation after cell lysis. The concentration
recommended by this protocol,
34mM, resulted in complete inhibition of electrochemical signaling. Beta
mercaptoethanol added at
concentrations as low as 8.5mM yielded signal size degradation over time.
However, when B-Me is omitted,
lysis buffer alone provides adequate protection from RNase in cell lysate to
allow detection of RNA. The
tolerable amount of B-Me will be established and used when assaying crude
lysates.
Guanadinium isothiocynate in buffer RLT also causes inhibition of
electrochemical signaling on the CMS
sensor. Buffer RLT is recommended by Qiagen for use in the RNeasy Kit because
guanadinium isothiocynate
is a harsh denaturant and effectively inactivates RNase. This buffer is
incompatible with our current system
as it causes pad or signal disintegration. Whole blood lysis buffer AL,
currently used as the hybridization
buffer standard, uses guanadinium hydrochloride to lyse cells. It is not as
stringent as guanadinium
isothiocynate, but it is still effective enough in inactivating RNase as to
allow detection of 93.75 uL of a 50 mL
overnight culture of E. coli. It is possible that detection limits could be
increased by more effectively
inactivating RNase present in cell lysate.
The problems associated with large variability within and between experiments
prevents both quantitative and
qualitative analysis of data. Arrays that give rise to peaks that are
significantly larger than the average of the
same condition, as well as arrays that give rise to peaks that are
significantly smaller than the average of the
same condition (array to array variation) are fairly common. Some pads also
occasionally give extremely large
or small peaks compared to the replicates on the same array (pad to pad
variation). These problems
associated with variability prevent accurate analysis of results.
135
