Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
TITLE OF THE INVENTION
Methods for selecting and producing selective
pharmaceutical compounds and compositions using an established
genetically altered cell-based library responsive to transcription factors;
genetic constructs and library therefor.
FIELD OF THE INVENTION
This invention relates to a method for selecting and
producing selective pharmaceutical compounds, which include monitoring the
activity of compounds on transcriptional activity in a cell library expressing
a
construct comprising a transcription-factor responsive promoter element and
a reporter gene.
BACKGROUND OF THE INVENTION
The human genome is composed of roughly 30 to 40 000
genes, with roughly 5% of these are believed to encode regulat~rs that
include transcription factors and their associated proteins and cofactors
(International Human Genome Sequencing Consortium, 2001). The control
of gene expression is mostly regulated at the transcriptional level by these
regulators. Most of these regulatory factors are expressed in an histospecific
manner meaning that, for a given cell in the organism, a specific group of
regulatory proteins will be expressed to confer to that cell the pattern of
gene
expression appropriate to its nature and function. The level of expression of
such regulatory proteins as well as their activity is also tightly regulated
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
2
depending on cell identity and cell state. When this typical pattern is
disturbed,
the ensuing deregulation of gene expression may result in altered cell
behaviour or phenotype and in a pathological state. The regulators,
transcription factors in particular, bind to DNA on short and defined
sequences
in a specific manner according to a lock-and-key principle defined by the
factor's architecture and electrostatic interactions between the transcription
factor and DNA. Once tethered to DNA, transcription factors activate,
stabilize
(or does not alter), and/or repress gene expression. Because of the
specificity
of transcription factors for their DNA binding site and because of the
increasing knowledge of the consensus sequences of these sites, it is
possible to predict where on a fragment of DNA a given transcription factor
should bind.
The transcription factors are at the forefront of gene
regulation. They control genetic switches that lead to simultaneous expression
of genes in response to different stimuli. Drugs can have an effect on
transcription factors in many ways: they can bind to membrane receptors at
the surface of the cell and trigger signalling cascades which will ultimately
induce a chemical modification of a transcription factor molecule or one of
its
cofactors; they can enter the cell and directly contact a transcription factor
molecule to trigger an effect such as a conformational change. Such a change
can play many roles in the behaviour of the transcription factor: it can
modify
the affinity of the factor for DNA; it can change its affinity for co-
activator or
co-repressor partners; it can modify ifs activation domain so as to make it
more active or less active as an activator of transcription. The resulting
change in gene expression triggered by the effect of the drug on a particular
factor can have a major impact on cell viability, differentiation, response
and
apoptosis. Many studies have focused on the role certain drugs can play as
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
3
inducers or repressors of transcription factors, and on the therapeutic
consequences which can be derived therefrom (Smith and Birrer, 1996;
Lehmann et al., 1997; Henke et al., 1998; Brown et al., 1999; ; Kliewer et
al.,
2001; Oliver et al., 2001 ).
Numberous transcription factors have therefore been
proposed as therapeutic agents or targets. Among many possible examples,
let us mention a few ones. The transfer of gene coding for the wild-type form
of the p53 transcription factor using a retroviral vector in non-small cell
lung
cancer patients has been shown to induce tumor regression and tumor growth
stabilization (Roth et al., 1996). The administration of NFKB antisense
oligonucleotide in mice (NFKB being another transcription factor) has
eliminated induced colitis (Neurath et al., 1996). The NFAT protein, another
transcription factor, is known to regulate the expression of many immune
response modulators such as interleukins and interferons (Rao et al., 1997;
Chow et al., 1999). NFAT is found in its inactive and phosphorylated form in
the cytoplasm until the unmasking of its Nuclear Localization Signal by the
action of the phosphatase calcineurin allows it to migrate to the nucleus and
bind DNA. It is because the cyclosporin molecule inhibits calcineurin that it
can be used as an immunosupressant drug: it interferes with the action of
NFAT (Clipstone et al., 1992; Jain et al., 1993; Kubo et al., 1994; Nair et
al.,
1994). Steroidogenic factor-1 (SF-1), another transcription factor, activates
the aromatase p450 promoter by displacing the COUP-TF transcription factor
and, consequently, causes the conversion of esfirone into estradiol, which in
turn activates a set of genes involved in endometriosis (Zeitoun et al.,
1999).
Practical considerations.
The transcriptional adaptation of cells to the action of a
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
4
compound can be monitored in many ways, either directly or indirectly. The
use of fluorescent or luminescent reporter genes to monitor gene regulation
as been described in both academic and industrial literature (Riggs and
Chrispeels, 1987; Waterman et al., 1988; Nordeen, 1988; DiLella et al., 1988;
Baulcombe et al., 1995; Barthmaier and Fryberg, 1995; Marshall et al., 1995;
Yeh et al., 1995). Even more relevant to the current patent application is the
report of a stably transfected Jurkat cell line expressing as a reporter
marker
a recombinant protein, the green fluorescent protein or GFP, whose gene is
under the control of the NFAT transcription factor (Hooijberg et al., 2000).
This
publication does not teach however how to build a library of different cell
types
transformed with a plurality of transcription factors for the purpose of
evaluating or predicting which screened compound is selective for a factor
and/or a cell type, and which is a candidate as a selective therapeutic.
SUMMARY OF THE INVENTION
The basis of the current patent application is the
development and use of a system in which the activity of a compound is
tested not merely on one transcription factor and/or in one type of cell line,
but
on a multiplicity of factors and in multiple different cell lines in a
parallel study.
Such a system called hereinbelow "Cell-TRAP" allows the study of the effects
of a potential drug, for example, on the activity of as many different
transcription factors associated with a given pathology, and in as much cell
types also associated with said pathology as possible (if not all). This very
high-throughput system allows a global view of the effects of a compound on
transcription and is a distinct improvement over individual systems which
would be limited to certain aspects of gene activation. Furthermore, the
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
system can be used as a predictive tool to evaluate the possibility of
occurrence of side-effects of a compound (which in this case would be the
activation of undesirable transcription activation pathways in certain cell
types). The ultimate goal is to find a drug candidate which has no serious
side
5 effect, thus not affecting non-targeted TFs or TFREs. Since the
transcriptional
pathways studied with the present method and products mimick a natural
pathway, chances are greater to identify a compound which would be
selective in vivo, thus a valuable therapeutic.
The present invention relates to a construct to transform
cells of different types, a library of recombinant cells comprising the
construct,
methods of making thereof and methods of use thereof, the library expressing
a DNA construct comprising a known transcription factor responsive-element
(TFRE) operably linked to a minimal promoter and to a reporter gene. The
expression of the reporter gene governed by the promoter and the TFRE
which is activated, non-activated or repressed upon binding by a transcription
factor. Upon screening the library with a compound of interest, a cascade of
events triggers the synthesis of a transcription factor and its binding to a
TFRE. A difference in the expression of the reporter gene indicates that this
candidate compound has an effect on a known TFRE, and on an assorted TF.
The screening is conducted on different cell lines and on cell lines of
different
species such as human, rat, mouse, insect, plant, and monkey.
The screening allows screening of a wide range of
compounds either natural or synthetic and it allows the investigation of
transcriptional regulatory activity of a compound of interest, whereas the
compound is lipid, protein, deoxyrinonucleic acid, ribonucleic acid,
polycyclic
carbones, steroid, or else, and this, simultaneously on a diversity of cell
lines.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
6
The activity of the reporter gene is monitored by methods
using a fluorescent, or a luminescent reporter gene, or is monitored by
methods using immunological detection of an antigen, or is monitored by
methods using polymerase chain reaction specific DNA primers. The primers
could be directed against the reporter gene sequence itself or the flanking
sequences that would be co-expressed with the reporter gene. The primers
themselves would be labelled or a probe directed against the amplified
sequence could provide the label or a detection means member.
The screening allows the determination of the level of
pathway specificity of a given compound used as a potential activator or
repressor of transcriptional activity. The specificity of action of the
compound
on a given transcription factor is evaluated by comparing the activity of many
different transcription factors in genetically modified stable cell lines
of,similar
tissue origin.
Additionally or alternatively, the screening allows the
determination of how a given substance affects a particular transcriptional
activation or repression pathway in tissues of different origins.
Therefore, in accordance with the present invention is
provided a method for selecting and producing a therapeutic compound which
is presumed selective for one or a restricted set of given transcriptional
pathways and of given cell types, which comprises:
providing a construct which comprises a reporter gene, the
expression of which is driven in a host cell by a promoter
capable of directing transcription of the gene operably
linked thereto upon activation, which promoter comprises
a minimal promoter and, upstream to said minimal
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
7
promoter, a transcription factor-responsive element which
is capable of affecting the activity of the minimal promoter
upon binding by a transcription factor endogenously
produced, activated or inactivated by the host cell upon
contacting by the compound; the construct being provided
for a plurality of transcription-factor responsive elements for
a given cell line and for a plurality of cell lines
representative of different tissues;
- inserting each construct into the genome of the host cell of
each cell line, thereby obtaining a library of recombinant cell
lines;
- contacting the compound with the library of recombinant cell
lines;
- detecting a change in the expression of the reporter gene
occurring in one recombinant cell line or in a subset of
recombinant cell lines and not in other cell lines of the
library as an indication of a putative selective effect of said
compound on a cell type in vivo; and
- formulating the compound in a medication to be
administered to a patient or tested in a patient for its
capacity to treat a disease affecting a tissue represented by
the cell type.
The present invention permits to save on clinical trials by
screening properly the compounds which would have a lesser probability of
providing undesirable, even severe side effects. Further, in accordance with
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
the present invention is provided a repertory of recombinant constructs for
transforming a plurality of cell types representative of a plurality of
biological
tissues which comprises a reporter gene and, operably linked thereto, a
promoteur comprising a minimal promoter and, upstream to said minimal
promoter, a transcription factor-responsive element (TFRE) which can be
bound by a transcription factor of a host cell, the diversity of the repertory
being due to a plurality of TFREs.
It is further an object of this invention to provide a library of
recombinant cells transformed with the constructs of the repertory.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS OF THE INVENTION
Other objects, advantages and features of the present
invention will become more apparent upon reading of the following non
restrictive description of preferred embodiments thereof, given by way of
example only with reference to the accompanying drawings.
More specifically the present invention relates to
BRIEF DESCRIPTION OF THE DRAWINGS
In the appended drawings:
Figure 1 illustrates the principle of the Cell-TRAP library
described in this patent application. A common reporter gene, the activity of
which can be quantified, is built in a construct so as to be under the
expression control of a promoter responding to particular transcription
factors.
(A) The library can be used to assay factor specificity after treatment with a
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
9
compound. Reporters are made to respond to different factors (a to f in this
example) and are used to stably transfect cells from the same line in
parallel,
thus generating multiple transgenic cell lines ( six in this example, one for
each factors a to f) responding to different factors but in a common cellular
background. (B) The library can be used to validate the effect of a compound
on a particular transcription factor's activity in different cellular
backgrounds.
The same reporter construct is used to stably transfect different cell lines,
which can for example represent different tissues or different pathological
states. Each of them can then be assayed to evaluate the factor's activity in
its unique background. Another obvious application not shown here would be
to use the construction responding to one factor, transfect it in one cell
line,
and test the resulting stably transfected cell line against a multiplicity of
different compounds.
Figure 2 illustrates the expression of a reporter gene
requires the activation of the transcription factor to which its promoter was
made responsive. A construct containing the gene coding for GFP was built
with a minimal promoter containing repeated elements allowing the binding of
the estrogen receptor. GFP expression, which translates as a green
fluorescence occurred only in the cell line known to contain ER (the MCF-7
line) and only in the presence of estradiol, an ER activation ligand.
Figure 3 illustrates how the library can be built using
retroviruses. (A): A plasmid is first built with a selection marker gene (open
block), a reporter gene (dotted block) and a minimal promoter under the
control of a particular transcription factor (filled block). it is transiently
transfected into an appropriate packaging cell. (B): Virions are produced by
the packaging cell which provides the missing components for producing
infectious but replication-deficient retroviral particles using the plasmid as
a
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
template. The retroviral particles are then recovered in the cell culture
supernatant. Highlighted is the structure of the packaged retroviral genomic
RNA. Note that in a preferred embodiment of the technique, the 3'LTR carries
a deletion of its promoter sequences so as not to cause spurious enhancing
5 activities after the retroviral genome has been reverse transcribed and
integrated in the final target cell's own genome. (C): The retroviral
particles
recovered in (B) are used to infect and transform different target cells. The
retroviral genome (composed of RNA) is reverse transcribed into DNA and
integrated into the host's genome. (D) The infected cell lines are submitted
to
10 selective pressure to remove untransformed cells from the total population.
Figure 4 shows a parallel evaluation of the activity of many
transcription factors using the Cell-TRAP library. The cell line MCF-7,
derived
from a breast cancer tumor, was stably transformed with a construct
expressing GFP under the control of promoters responding to the transcription
factors PPAR, p53, NFKB, NFAT and ERE, respectively. A positive control
was also made, expressing GFP under the control of the strong CMV
promoter. In the absence of other stimuli, it is seen that p53 has a low basal
activity in this cellular context while ERE has a strong one (probably due to
the presence of estrogens in the culture media). The factors PPAR, NFKB
and NFAT seem silent in these conditions.
Figure 5 shows an example of induction. Different cell lines
(CEM and MCF-7 in this example) belonging to the Cell-TRAP library and
containing constructs responding to the activity of the transcription factors
NFKB, NFAT and ER respectively, were treated with compounds known to
activate these factors. The induction in each case translates into the
appearance of a green fluorescence.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
11
Figure 6 is a graphical demonstration of the type of global
information the library can provide. The library is used to assay the effects
of
a compound on the pathways activating different transcription factors in
different cellular contexts to validate the compound's specificity. The
library
allows the challenge of several pathways simultaneously in several different
cellular contexts. In this figure, gray squares indicate the activation of a
pathway by a compound; the degree of specificity or selectivity of the
compound for a factor decreases as its screening shows that there are more
and more positives along the Y axis while the tissular specificity or
selectivity
of the compound decreases as there are more and more positives along the
X axis.
The present method is designed to evaluate the effect of
any soluble molecule exerting a specific effect on the regulation of gene
expression by particular transcription factors. Each cell line used in the
assay
is genetically modified in order to allow the quantitative evaluation of the
level
of activation of a specific transcriptional pathway when the cell responds to
the compound. The originality of this method lies on the concomitant analysis
of a compound action on different DNA regulatory elements and in different
cellular contexts, while preserving the transcriptive pathways in its natural
intracellular form, to any possible extent.
The final step in a transcription regulation pathway is the
interaction of a gene promoter with an activated initiation complex inducing
the gene transcription by a RNA polymerase. What occurs before this final
step can vary depending on the nature of the signal to which the gene
promoter responds: it may be that a membrane receptor was activated at the
level of the cell surface, triggering a cascade of signalling events that
ultimately led to an effect on a transcription factor capable of initiating
the
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
12
formation of an initiation complex. It could also be that such a signalling
cascade reached a pre-formed complex and gave it the final signal to begin
gene transcription. It could as well be that a small soluble molecule made it
passed the barriers of the plasma and nuclear membranes and managed to
contact an inactive transcription factor to induce in it a conformational
change
conferring to it the ability to induce transcription by an RNA polymerase. It
could also very well be that one of these scenarios occurred, caused the
synthesis of a novel transcription factor, which in turn triggered the
expression
of a gene of interest. All of these scenarios, as far as the ability for a
given
substance to act on transcription genes, are covered by the technology
described in this patent: the final result which is being measured, is the
expression of a reporter gene under the control of a specific transcription
factor-binding DNA sequence.
At the core of the library designed for this project stands the
common architecture of a reporter gene under the control of a minimal
promoter containing repeated elements recognized and bound by specific
transcription factors (elements like the sequences GGTTCANNNGGTTCA,
recognized by a dimer of the transcription factors RXR and VDR;
AGGGCANAGGTCA, recognized by a dimer of the factors PPAR and RXR,
or AGGTCANNNTGACCT, recognized by a homodimer of the factor ER)
(Stunnenberg, 1993). The minimal promoter, being composed of little more
than a TATA box, would not by itself induce a high level of transcription of
the
reporter gene. When being made receptive to the induction activity of a
transcription factor by having the tatter's DNA-binding site being added to
it,
it becomes a promoter capable of driving gene expression -but only if the
transcription factor in question is both present and made to provide an
activation signal. If the factor binding site is present but the factor in
question
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
13
does not receive an appropriate activation signal, it is possible that a weak
expression of the reporter gene may ensue; that weak signal, however, would
be made much more obvious following an induction signal to the transcription
factor. Conversely, if the factor receives not an activation signal but a
repression one, the weak signal caused by the promoter on its own would
likely diminish, providing a useful tool for the evaluation of a drug as a
transcription antagonist.
The combination of transgenic cell lines constitute the cell-
based library. In the patent number US5863733, Foulkes et al. claims to have
invented "a method of determining whether a chemical not previously known
to be a modulator of protein biosynthesis specifically transcriptionally
modulates the expression of a gene-of interest (...)". The present inventors
do not agree that the method reported in this patent is specific. In order to
do
so, one has to evaluate (1) the other transcriptional pathways potentially
submitted to the influence of the compound of interest (2) the transcriptional
activation of the pathway in other cell types. The present strategy is
carefully
taking these points into consideration by using a multi-cellular assay in
which
library of transgenic cells is simultaneously monitored instead of using one
construct at the time. In this system, several pathways were monitored as well
as one peculiar pathway in several tissue origins, as schematized in Figure
1 a) and b). It is believed that multiparameter analysis is much more likely
to
give a set of data capable to addressing the problem of specificity or
selectivity of action. The multiparameter analysis tool presented in the
present
patent is also a very good tool to evaluate the potential transcriptional
"side
effects" of a compound.
Figure 2 shows how the expression of a reporter gene (in
this case Green Fluorescent Protein (GFP)) can be made dependent of a
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
14
particular transcription factor (in this case the estrogen receptor ER) in a
ligand-specific way. Two cell lines are shown in this example: C2C12 is a
myoblast-derived cell line and is not known for its great ER activity; the MCF-
7
cell line, on the other hand, is derived from a breast carcinoma and harbors
ER activity. Both cell lines were stably transfected with a construct in which
GFP expression is under the control of a minimal promoter containing
repeated elements to which ER can bind. The construct also contains a
selection marker which confers resistance to the antibiotic geneticin (G-418,
Roche Molecular Biochemicals) so that transfected cells could be separated
from non-transformed ones. As would be expected, no signal (a green
fluorescence) can be seen in either cell line when no ligand is used (ER will
induce gene transcription only when it is activated by an estrogen such as
estradiol). When estradiol is added, only the cell line containing endogenous
ER (the MCF-7 line) can respond to the ligand and induce gene expression.
This demonstrates that it can be shown that a compound can induce the
activity of a transcription factor and that this will occur in particular cell
lines.
To allow the study of the effect of a compound on the
activity of many transcription factors, we had to design a variety of reporter
constructs, each of which making the GFP reporter gene responsive to a
different transcription factor or family thereof. A common framework was
adopted, in which a GFP gene was built immediately downstream of a minimal
promoter. Downstream of the GFP, a selection marker was introduced to
confer resistance to the antibiotic Geneticin. A site shortly upstream of the
TATA box of the minimal promoter was reserved for the introduction of
repeated DNA-binding sites for the different transcription factors to be
studied.
These latter sites were first synthesized as double-stranded oligonucleotides
carrying sequences known to be specifically recognized by certain
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
transcription factors or families thereof (See appendix I). They were then di-
or multimerized, when desirable, by ligation and sub-cloned into a shuttle
vector, in which they were sequenced to ascertain their actual sequence. The
number of copies (normally from 2 to 10 copies) depends on the factor
5 studied. Different types of multimers were produced and the best ones were
selected; in most cases, a single repeat was sufficient (e.g. the p53
construct
seen in the different figures has only one repeat). The monomeric or
multimerized DNA-binding sites were freed of the vector and introduced in
front of the TATA box of the minimal promoter of the reporter construct. This
10 provided a collection of reporter genes, each under the transcriptional
control
of a different transcription factor or family thereof.
Each one of these constructs was then used to generate
multiple transgenic or recombinant cell lines, so that the factor represented
by
each construction could be studied in different cellular contexts. This was
15 achieved in two ways (although more could be used and still reflect the
same
idea of generating stably-transformed libraries): stable transfection followed
by selection with the antibiotic was the first; integration using a retroviral
vector was the second. For the latter operation, the reporter construct was
assembled in a murine retroviral backbone (MoMLV) modified in certain ways.
First, the retroviral backbone has been made inapt to replication by deletion
of the genes gag, env and pol. Second, its 3' long terminal repeat (or LTR)
region has been mutated so that its natural strong promoter activity is
missing.
The latter maneuver is made necessary because of the risk that upon
integration, an unhindered 3'LTR (whose sequence would end up upstream
of the inserted reporter construct) could drive the expression of the reporter
gene independently of the minimal promoter or of the transcription factor
under study. Once the different reporter constructs have been introduced in
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
16
such a retroviral backbone, they can be transfected in a packaging cell line
such as the Fred Hutchison Cancer Research Center's line PT67 (Miller,
1998). This line has been modified to carry the genes missing for a proper
retroviral replication; furthermore it carries surface markers which confers
to
any virus being produced in it a very wide spectrum of infectivity tissue-
wise.
To help matters further, it is possible to co-transfect the packaging cell
line
with an expression vector for the vesicular stomatitis virus protein G, which
helps make the virus even more readily integrated by target cells because of
a membrane fusion mechanism rather than one proceeding through
membrane receptors. Viral particles will bud from the packaging cell line,
each
capable of infecting a wide variety of cell lines and tissues, in the genome
of
which the appropriate reporter constructs will stably integrate. (Once
integrated, the retroviral genomes will no longer produce retroviruses, of
course).
The transgenes, be they transferred to the target cells by
transfection, retroviral infection, or any other technique, will integrate in
different locations in the host's genome. This could lead to epigenetic
modulation effects on gene expression. Such a problem can be circumvented
in two ways. First, insulators could be used to flank the reporter constructs,
thus keeping the latter safe from interference by their chromosomal
surroundings (Pikaart, 1998; Udvardy, 1999). Second, the random integration
of the transgene and subsequent selection for antibiotic resistance will
generate a polyclonal population in which integration in unfavorable sites
(where silencing can occur) should be compensated by integration in
stimulating sites (close to strong enhancer elements). Furthermore, should the
general background level of activation be too weak, it is always possible to
enrich the population in more active cells by FACS separation.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
17
It is noted that the activity of a transcription factor in the
activity of a putative therapeutic compound can be confirmed by interfering
with its binding to the responsive promoter element in a cell under study. The
same constructs could then be made for this purpose, replacing the functional
responsive-elements with mutated ones that is no longer bound by its
assigned factor (See appendix I, "mut" oligos).
Detailed Protocols
Retroviral expression vector construction strategy
Construction of the vector was performed according to
standard practices in the field. A retroviral vector previously described in
the
literature (Hooijberg et al., 2000) was obtained under licence from its
developers and used as starting material for this purpose. First, the GFP
reporter gene from this retrovector was changed to a different version of GFP
(coding for a protein whose excitation wavelength is at around 400 nm rather
than 490 nm). The promoter driving the expression of the protein was also
changed to a deleted version of the CMV promoter retaining little beyond the
TATA box. Upstream of this promoter, a unique Nru I site was inserted to
allow the introduction of DNA-binding sites for different transcription
factors.
A cassette coding for G-41 ~ resistance, under the control of the PGK
promoter, was added 3' of the GFP gene in order to serve as a selection
marker in transfected cells.
DNA-binding sites such as those listed in appendix 1 were
first synthesized as complementary oligonucleotides and then annealed. Each
oligonucleotide synthesized carried the sequence of two DNA-binding sites for
the same factor arranged in tandem. The annealed oligonucleotides were then
ligated in concatemers and cloned in a shuttle vector. The resulting plasmids
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
18
were transformed in E.coli and cultured separately, and a few clones for each
construct had its DNA purified and sequenced. The appropriate tandem arrays
of each transcription factor DNA-binding site were then cut out of the shuttle
vector using restriction enzymes, and introduced into the unique Nru I site of
the retroviral vector.
The final retroviral constructions are represented in figure
3.
Stable transfection
A cell library such as the one described in the present
patent application can be produced by stable transfection. This was
demonstrated by recovering from the above retroviral construction the
relevant DNA fragment (from a position downstream of, and excluding, the
viral 5'LTR and packaging signal, and down to, and including, the mutated
3'LTR). Such as DNA fragment was then introduced into final target cells by
a variety of means known to those knowledgeable in the art, and adapted to
each cell type. These means included, for example, electroporation, calcium
phosphate co-precipitation, and use of commercial transfection reagents such
as Qiagen's superfect (Qiagen Inc.). The transfected cells were then
submitted to a selective pressure by treatment with increasing concentrations
of geneticin (Roche biochemicals). Since only stably transfected cells
expressing the resistance gene would survive for many generations to the
treatment, there was a polyclonal amplification of the transformed cells to
the
detriment of the untransformed ones, which died in the process. Each stably
transfected cell line, after polyclonal expansion, was kept as a frozen stock
for
later use.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
19
Retroviral stock production
Retroviral vectors were transiently transfected into
packaging cell line PT67 (Miller, 1998) according to protocols well-known in
the field. A successful transfection was made apparent after 48 hours, as a
very large part of the transfected PT67 cells expressed GFP and could be
seen to generate an intense green fluorescence under the excitating light of
a laser producing light at a wavelength of 405 nm. The cells were allowed to
produce viral particles for a few days as the culture's virus-rich supernatant
is recovered after 48, 72 and 96 hours. The viral stocks can be concentrated
by a variety of methods, such as centrifugation on commercially available
concentration columns or ultracentrifugation at 50 OOOg for two hours. The
viral stocks can be frozen at any time.
Mammalian cell infection
Viral particles produced from the PT67 the packaging cell
line can infect a very wide spectrum of mammalian cells (see Figures 3a) to
c)). The recovered supernatant, fresh or from a thawed frozen stock, is added
to the culture medium of the final target cells and allowed to infect them.
Infection is monitored using fluorescent microscopy which detects the
expression of GFP. Antibiotic selection then allows the elimination of
untransformed cells (Figure 3d).
Use of cell library and activation of specific transcriptional pathways
Lead optimisation is one of the major area in drug
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
development. Our method can be used to compare the specific pathways
induced by a parental compound and its derivatives. Synthetic derivatives of
a compound can exert more potent action than the parental product. In a
similar manner, these derivatives can also induce undesired secondary
5 effects. The cell library can be used to delineate the more potent and more
specific compounds among a list of structurally related products and help to
focus the next round of compound synthesis.
The utilization of a particular vector for transformation of
several cell lines of different origin will allow to investigate the effect of
a
10 compound upon activation of a specific transcription factor family in
different
tissue origin context and permit the profiling of response among different
cell
lineage. Tissue specificity of action can be a strong guideline for
hierachization of several structurally related compounds inducing variable set
of responses.
15 The transcriptional activation of a gene constitute the end
of a biological cascade originating from extracellular activators such as
cytokines, steroids hormones, peptidic hormones, prostaglandins, chemicals,
which upon interacting with a cellular component modify the intracellular
phosphorylation state, leading to genomic expression changes in the nucleus.
20 Figure 4 shows the difFerential expression of transcription factors as
evaluated
by the present invention, taking as an example MCF-7 cells grown in the
presence of estradiol. The factor p53 show a low basal activity while ERE
factor has a strong activity under these conditions. As shown in Figure 5, the
activation of NFkB or NFAT cascade is different from activation of estradiol
receptor cascade. Thus, the fact that a compound leading accumulation of
GFP in a cell line transformed with NFkB/GFP or NFAT/GFP reporter gene
while doing nothing in ER/GFP cell lines would indicate that potential targets
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
21
have been hit along the NFkB or NFAT transcriptional cascade. By
comparison of activation profiles along the cell library, one could determine
the potential targets involved in reporter gene activation by the compound and
orient further research for elucidation of the mechanism of action of the
compound of interest and its effector targets.
Cell library can be used to screen compounds in a wide
variety of platforms. Biological processes occurring in living cells have been
demonstrated in microplate, nanoplate, microchip, membrane and gel matrix
environments. Accordingly, our cell library could take advantage of every
cultivating system that allow a mid to large scale screening process to take
place.
The pharmaceutical industry have generated thousands of
compounds in the search of therapeutic leading agents in order to treat and
cure diseases. However the process of screening the compound candidates
to detect potential agent is difficult, takes a considerable amount of time
and
requires major capital investments. Reducing the time for drug discovery is
becoming a paramount for the pharmaceutical industry. A specific gene
regulatory agent constitutes a major lead for therapeutic purposes. Screening
compounds on the basis of its specificity of transcriptional activity profile
confer to the present procedure the capacity of preventing million dollars
expenses on possible wrong compound and save a tremendous amount of
time and a money for the industry.
Figure 6 shows that it is possible to obtain an activation
profile for a given compound for a given transcription facotr and for a given
cell. The lesser the number of filled boxes in the X and Y axis, the more
selective is a compound for a given transcription factor and a given target
cell
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
22
type, respectively.
Let's imagine a real situation case: estrogens, for example,
are intended to be used for inhibiting restenosis (which involves vascular
smooth cell proliferation) occurring upon angioplasty. One wants to select the
proper estrogen(s) for such therapeutic effect. Cell lines representative of
the
in vivo target tissues or cells (e.g. of common tissue origin) are included in
the
screening assay. For instance, a primary smooth muscle cell line would be
transformed with constructs that would comprise at least a ER construct. A
plurality of estrogen-like compounds are used to screen the library which
would comprise also other cell types susceptible to respond to estrogens
(breast cell lines, for example). Since estrogens activate at least two types
of
receptors (estrogen receptors a and Vii) and since these receptors may be
coupled to different transcription pathways, one may see a different
transcription profile for estrogens, providing the user with a selection of
one
or more estrogens that are preferred over others because of their selectivity
for the type of receptors that is estrogen-responsive in vascular smooth
muscle cells. If the candidate compound shows the best potential of activity
but lacks selectivity, the information on the profile of the compound may
indicate or suggest which route of administration should be favored (ex.: an
in situ treatment).
In the above example, the compounds are known, but it is
contemplated that unknown compounds can be screened to obtain a
selectivity profile leading to the judicious choice and study of a therapeutic
compound.
Although the present invention has been described
hereinabove by way of preferred embodiments thereof, it can be modified,
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
23
without departing from the spirit and nature of the subject invention as
defined
in the appended claims.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
24
APPENDIX I
FACTOR SEQUENCE ~'r~~~ )
AML. .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. S'-
GCAGCTGCATGTCCCAACCACAGCATCC
-3'
AML . mut. . . . . . . . . . . . . . . . S'-GCAGCTGCATGTCCCAATGGTAGCATCC
. . . -3' .
. . .
. . .
.
AML-3 . . . . . . . . . . . . . . . . . . S'-
. . . . CCCGTATTAACCACAATAAAACTCG -3'
. . . .
. . . .
AML-3 mut. . . . . . . . . . . . . . . . . .
. . . S'- CCCGTATTAATGGCAATAAAACTCG -3'
. . .
. . .
AP-I . . . . . . . . . . . . . . . . . . . .
. . . . S'- CGCTTGATGAGTCAGCCGGAA-3'
. . . .
. . . .
.
AP-I . mut. . . . . . . . . . . . . . . . . .
. . . . . S'- CGCTTGATGACCCAGCCGGAA -3'
. . .
. . .
.
AP-2. . . . . . . . . . . . . . . . . . . S'-
. . . . CCACAAACGACCGCCCGCGGGCGGT -3'
. . . .
. . .
. .
AP-2 . mut. . . . . . . . . . . . . . . . . S'-
. . . CCACAAACGACCGATTGCGGGCGGT -3'
. . .
. . .
.
ATF/CREB.. . . . . . . . . . . . . . . . . . .
. . . . . S'- GATTCAATGACATCACGGCTGTG -3'.
. . . .
ATF/CREB mut. . . . . . . . . . . . : . . . . .
. . . . S'- GATTCAAGAACATAGCGGCTGTG -3'.
. . .
C/EBP . . . . . . . . . . . . . . . . . . .
. . . . S'- CTAGGGCTTGCGCAATCTATATTCG -3'
. . . .
. . .
.
C/EBP mut. . . . . . . . . . . . . _ . . . .
. . . S'- CTAGGGCTTGCTACCCCTATATTCG -3'
. . .
. . .
.
E2F . . . . . . . . . . . . . . . . . . S'-
. . . . GGTTTGTGTTTAGGCGCGAAAACTGAA -3'
. . . .
. . .
. .
E2F . mut. . . . . . . . . . . . . . . . S'-
. . . GGTTTGTGTTTAGGTACGAAAACTGAA -3' .
. . .
. . .
. .
Egr-I . . . . . . . . . . . . . . S'- GGATCCAGCGGGGGCGAGCGGGGGCGAACG
. . . . -3'
. . . .
. . . .
. .
Egr-I mut. . . . . . . . . . . . . : S'- GGATCCAGCGGGTACGAGCGGGTACGAACG
. . . -3'
. . .
. . .
. .
ER . . .
. . . .
. . . .
. . . .
. . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
S'-
TAATAGGTCACAGTGACCTGATTCC
-3'
ER . . mut. . . . . . . . . . . . . . . . . .
. . . S'- TAATACCGCACAGTGAAATGATTCC -3'
. . .
. . .
. .
GATA . . . . . . . . . . . . . . . . . . . .
. . . . S'- GGCAGTGCCTTATCTCTGCGGCG -3'
. . . .
. . . .
GATA . mut. . . . . . . . . . . . . . . . . .
. . . S'- GGCAGTGCCACCTCTCTGCGGCG -3'
. . .
. . .
HNF-I . . . . . . . . . . . . . . . . . . .
. . . . . S'- CCAGTTAATGATTAACCACTGGC -3'.
. . . .
. . .
.
HNF-I mut. . . . . . . . . . . . . . . . . .
. . . 5'- CCAGGCGATGAGCGACCACTGGC -3'
. . .
. . .
.
HNF-3 . . . . . . . . . . . . . . . . . .
. . . . . S'- GCCCATTGTTTGTTTTAAGCC -3'
. . .
. . .
. . .
.
HNF-3 mut. . . . . . . . . . . . . . . . . .
. . . . . S'- GCCCATTGGGCCATTTAAGCC -3'
. . .
. . .
.
HNF-4 . . . . . . . . . . . . . . . . . . .
. . . . S'- GGAAAGGTCCAAAGGGCGCCTTG -3'
. . . .
. . .
.
HNF-4 mut. . . . . . . . . . . . . . . . . .
. . . 5'- GGAAAATACCAAAGGGCGCCTTG -3'
. . .
. . .
.
HSF . . . . . . . . . . . . . . . . . . . 5'-
. . . . GGACCCTGGAATATTCCCGATGCGG -3'
. . .
. . .
. .
HSF. . mut. . . . . . . . . . . . . . . . . S'-
. . . GGACCCTGGTITAAACCCGATGCGG -3'
. . .
. . .
.
IRF-I . . . . . . . . . . . . . . . . . . S'-
. . . . TCTCCTTGTTTTGCTTTCGATCTGG -3'
. . . .
. . . .
. .
IRF-I I11UC. . . . . . . . . . . . . . . . . S'-
. . . TCTCCTTGACTTGCGCCCGATCTGG -3'
. . .
. . .
. .
MyoD . .
. . . .
. . . .
. . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
S'-
CCCCAACACCTGCTGCCTGAG
-3'
MyoD . mut. . . . . . . . . . . . . . . . . .
. . . . . S'- CCCCAATCCCGACTGCCTGAG -3'
. . .
. . .
NF-i . . . . . . . . . . . . . S'- GGCACCTGTTTCAATTTGGCACGGAGCCAACAG
. . . -3'
. . .
. . .
. . .
.
NF-I . mut. . . . . . . . . . . . S'- GGCACCTGTTTCAATTTGTTACGGATTCAACAG
. . . -3'
. . .
. . .
.
NF-Y . . . . . . . . . . . . . . . . . . . .
. . . . . . S'- ATTTTTCTGATTGGTTAAAAGT -3'.
. . . .
. . .
.
NF-Y . mut. . . . . . . . . . . . . . . . . .
. . . . . S'- ATTTTTCTGATTZ"('TTAAAAGT -3'
. . .
. . .
.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
FACTOR SEQUENCE
NFkB . . . . . .
. . . . . . . .
. . . . . . . .
. . . . . . . .
. 5'- GCCATGGGGGGATCCCCGAAGTCC
-3'
I~FkB. . . . . . . . . . . . . . S'- GCCATGGGCCGATCCCCGAAGTCC
. . . . . mut . -3'
. . . . . . . .
.
Oct . . . . . . . . . . . . . . 5'- CCTCTTGGATTTGCATATGGGCTC
. . . . . . . . -3'
. . . . . . . .
. . . .
Oct. . . . . . . . . . . . . . . . 5'- CCTCTTGGATGATTATATGGGCTC-3'
. . . . . . mut
. . . . . . . .
. .
p53 . . . . . . . . . . . . . 5'- AGCTGGACATGCCCGGGCATGTCC
. . . . . . . . -3'
. . . . . . . .
. . . . .
p53 . . . . . . . . . . . . . . 5'- AGCTGGATCGCCCCGGGCATGTCC
. . . . . . mut -3'
. . . . . . . .
. .
Pax-3. . . . . . . . . . . . . . 5'- GGCCGTCGTCACGCTTCAGGGCC
. . . . . . . . -3'
. . . . . . . .
. . .
Pax-3 . . . . . . . . . . . . . 5'- GGCCGAACGCACGCTTCAGGGCC
. . . . . . mut -3'
. . . . . . . .
. .
Pax-5 . . . . . . . . . . . 5'- CGTGACGCAGCGGTGGGTGACGACC
. . . . . . . . -3'
. . . . . . . .
. . . .
Pax-5 . . . . . . . . . . . . 5'- CGTGACGAAGCGGTGGGTGACGACC
. . . . . . mut -3' .
. . . . . . . .
. .
Pit-1 . . . . . . . . . . . . . 5'- CCTGATTATATATATATTCATGAA-3'
.'. . . . . . .
. . . . .. . .
. . . . .
Pit-1. . . . . . . . . . . . . . 5'- CCTGATGCGGTATCTGGTCATGAA
. . . . . . mut -3'
. . . . . . . .
. .
PPAR . . . . . . . . . . . . . 5'- GGAACTAGGTCAAAGGTCATCCCCT
. . . . . . . . -3' .
. . . . . . . .
. .
PPAR. . . .. . .. . . . . . .. 5'-GGAACTAGAACAAAGAACATCCCCT-3'
... mut .. . ...
.. . .
PU.1. . . . . . .. . . . . . . 5'- CCAATCAGGGAGGAAGTAGATTCG
. . . . . . . . -3'
. . . . . . . .
. . . .
PU.1 . . . . . . . . . . . . . . 5'- CCAATCAGGGAGTTCGTAGATTCG
. . . . ..mut . -3'
. . . . . . . .
.
RAR/RXR (DR-2) . . . . . . . . 5'- GGTAAGGTCAAGAGGTCACTCGCC
. . . . . . . . -3'
. . . . . .
RAR/RXR (DR-2) . . . . . . . . 5'- GGTAAGAACAAGAGAACACTCGCC
mut . . . . . . -3'
. . . .
RAR/RXR (DR-5) .
. . . . . . . .
. . . . . . . .
. . . . 5'- GTAAGGTCAAGGAGAGGTCACTCGC
-3'
RAR/RXR (DR-5) . . . . . . . 5'- GTAAGAACAAGGAGAGAACACTCGC
mut. . . . . . -3'
. . . . .
Rel . . . . . . . . . . . . . . . . 5'- AGCTTGGGGTATTTCCAGCCG
. . . . . . . . -3"
. . . . . . . .
. . . .
Rel. . . . . . . . . . . . . . . . . 5'- AGCTTGGCATAGGTCCAGCCG
. . . . . . mut -3"
. . . . . . . .
. .
RXR/RXR (DR-1) . . . . . . . . 5'- GGTAAAGGTCAAAGGTCAATCGGC
. . . . . . . . -3'
. . . . . .
RXR/RXR (DR-1) . . . . . . . . 5'- GGTAAAGAACAAAGAACAATCGGC
mut. . . . . . -3'
. . . . .
SF-1 . . . . . . . . . . . . . . . 5'- GGCTCTTGACCTTGAGCTTCCT
. . . . . . . . -3'
. . . . . . . .
. . .
SF-1. . . . . . . . . . . . . . . 5'-~GGCTCTTGTGTTTGAGCTTCCT
. . . . . . mut -3'
. . . . . . . .
. .
SIE . . . . . . . . . . . . . 5'- GTCGACATTTCCCGTAAATCGTCGA
. . . . , . . . -3'
. . . . . . . .
. . . .
SIE . . . . . . . . . . . . . 5'- GTCGACATATAGCGTAAATCGTCGA
. . . . . . mut. -3'
. . . . . . . .
. .
Spl . . . . . . . . . . 5'- CCCTTGGTGGGGGCGGGGCCTAAGCTGCG
. . . . . . . . -3'
. . . . . . . .
. . . .
Spl . . . . . . . . . . 5'- CCCTTGGTGGGTTGGGGGCCTAAGCTGCG
. . . . . . mut. -3'.
. . . . . . . .
. .
SRF . . . . . . . . . . . . . 5'- CCTTTCCTTATATGGACAAGGCGTC
. . . . . . . . -3'
. . . . . . . .
. . . .
SRF . . . . . . . . . . . . . . 5'- CCTTTGATTATATTTACAAGGCGTC
. . . . . . mut -3' .
. . . . . . . .
. .
Tal-1. . . . . . . . . . . . . . . . 5'- ACCTGAACAGATGGTCGGCT
. . . . . . . . -3'
. . . . . . . .
. . .
Tal-1 . . . . . . . . . . . . . . . 5'- ACCTGAATTGATGGTCGGCT
. . . . . . mut. -3'
. . . . . . . .
. .
TR/RXR (DR-4) . . . . . . . . 5'- GTAAGGTCACAGGAGGTCACTCGC
. . . . . . . . -3'
. . . . . . .
TR/RXR (DR-4) . . . . . . . . 5'- GTAAGAACACAGGAGAACACTCGC
. mut . . . . . -3'
. . . . .
TR (IR). . . . . . . . . . . . . 5'- ACAATCAGGTCATGACCTGATTCG
. . , . . . . . -3'
. . . . . . . .
. .
TR (IR) . . . . . . . . . . . . 5'- ACAATCAGAACATGTTCTGATTCG
. . . . . mut . -3'
. . . . . . . .
.
USF . . . . . . . . . . . . . . . S'- GGCCAGACCACGTGGTCTGTTC
. . . . . . . . -3'
. . . . . . . .
. . .
USF. . . . . . . . . . . . . . . . 5'- GGCCAGACACAGTGGTCTGTTC
. . . . . mut . -3' .
. . . . . . . .
.
VDR/R.XR (DR-3) . . . . . . . . . 5'- GGCAGGTCATGGAGGTCAGTTC
. . . . . . . . -3'
. . . . . .
VDR/RXR (DR-3)..mut. . . . - . . . . 5'- GGCAGAACATGGAGAACAGTTC
. . . . . . . . -3' .
. .
YY 1 . . . . . . 5'- GGGGATCAGGGTCTCCATTTTGAAGCGGGATCTCCC
. . . . . . . . -3'
. . . . . . . .
. . .
YY1. . . . . . . 5'- GGGGATCAGGGTCTTTGTTTTGAAGCGGGATCTCCC
. . . . . mut . -3'
. . . . . . . .
.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
26
References
Baulcombe DC, Chapman S, Santa Cruz S. 1995. Jellyfish
green fluorescent protein as a reporter for virus infections. Plant J 7:1045-
53.
Barthmaier P, Fyrberg E. 1995. Monitoring development
and pathology of Drosophila indirect flight muscles using green fluorescent
protein. Dev Biol. 169:770-4.
Brown PJ, Winegar DA, Plunket KD, Moore LB, Lewis MC,
Wilson JG, Sundseth SS, Koble CS, Wu Z, Chapman JM, Lehmann JM,
Kliewer SA, Willson TM. 1999. A ureido-thioisobutyric acid (GW9578) is a
subtype-selective PPARalpha agonist with potent lipid-lowering activity. J Med
Chem. 42:3785-8.
Burns JC, Friedmann T, Driever W, Burrascano M, and Yee
JK. 1993 Vesicular stomatitis virus G glycoprotein pseudotyped retroviral
vectors: concentration to very high titer and efficient gene transfer into
mammalian and nonmammalian cells. Proc Natl Acad Sci U S A 90:8033-
8037
Chen Y, Hughes-Fulford M. 2000. Prostaglandin E2 and the
protein kinase A pathway mediate acid induction of c-fos in human prostate
cancer cells. Br J Cancer 82:2000-2006
Chow CW, Rincon M, Davis RJ. 1999. Repuirement for
transcription factor NFAT in interleukin-2 expression. Mol Cell Biol. 19:2300-
2307.
Clipstone NA, Crabtree GR. 1992. Identification of
calcineurin as a key signalling enzyme in T-lymphocyte activation. Nature
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
27
357:695-7.
Croston GE, Cao Z, and Goeddel DV. 1995. NF-kappa B
activation by interleukin-1 (IL-1) requires an IL-1 receptor-associated
protein
kinase activity. J Biol Chem 270:16514-16517.
Danforth DN Jr and Sgagias MK. 1991 Interleukin 1 alpha
blocks estradiol-stimulated growth and down-regulates the estrogen receptor
in MCF-7 breast cancer cells in vitro. Cancer Res. 51:1488-1493
DiLella AG, Hope DA, Chen H, Trumbauer M, Schwartz RJ,
Smith RG. 1988. Utility of firefly luciferase as a reporter gene for promoter
activity in transgenic mice. Nucleic Acids Res. 16:4159.
Dong Z, Huang C, Brown RE, Ma WY. 1997 Inhibition of
activator protein 1 activity and neoplastic transformation by aspirin. J Biol
Chem 272:9962-9970.
Fitzgerald J, Dietz TJ, Hughes-Fulford M.. 2000.
Prostaglandin E2-induced up-regulation of c-fos messenger ribonucleic acid
is primarily mediated by 3',5'-cyclic adenosine monophosphate in MC3T3-E1
osteoblasts. Endocrinology. 141:291-8.
Geneka Biotechnology Inc. Catalog, 2000.
www.geneka.com.
Henke BR, Blanchard SG, Brackeen MF, Brown KK, Cobb
JE, Collins JL, Harrington WW Jr, Hashim MA, Hull-Ryde EA, Kaldor I,
Kliewer SA, Lake DH, Leesnitzer LM, Lehmann JM, Lenhard JM, Orband-
Miller LA, Miller JF, Mook RA Jr, Noble SA, Oliver W Jr, Parks DJ, Plunket
KD, Szewczyk JR, Willson TM. 1998. N-(2-Benzoylphenyl)-L-tyrosine
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
28
PPARgamma agonists. 1. Discovery of a novel series of potent
antihyperglycemic and antihyperlipidemic agents. J Med Chem. 41:5020-36.
Hooijberg E, Bakker AQ, Ruizendaal JJ, Spits H. 2000.
NFAT-controlled expression of GFP permits visualization and isolation of
antigen-stimulated primary human T cells. Blood. 96:459-466.
International Human Genome Sequencing Consortium.
2001. Initial sequencing and analysis of the human genome. Nature 409: 860-
921.
Jain J, McCaffrey PG, Miner Z, Kerppola TK, Lambert JN,
Verdine GL, Curran T, Rao A. 1993. The T-cell transcription factor NFATp is
a substrate for calcineurin and interacts with Fos and Jun. Nature 365:352-5.
Kliewer SA, Xu HE, Lambert MH, Willson TM. 2001.
Peroxisome proliferator-activated receptors: from genes to physiology. Recent
Prog Horm Res. 56:239-63.
Kubo M, Kincaid RL, Ransom JT. 1994. Activation of the
interleukin-4 gene is controlled by the unique calcineurin-dependent
transcriptional factor NF(P). J Biol Chem 269:19441-6.
Lehmann JM, Lenhard JM, Oliver BB, Ringold GM, Kliewer
SA. 1997. Peroxisome proliferator-activated receptors alpha and gamma are
activated by indomethacin and other non-steroidal anti-inflammatory drugs.
J Biol Chem.272:3406-10.
Marshall J, Molloy R, Moss GW, Howe JR, Hughes TE.
1995. The jellyfish green fluorescent protein: a new tool for studying ion
channel expression and function. Neuron 14:211-5.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
29
Miller, A.D. 1998. 10A1 Retroviral packaging cells and uses
thereof . United States Patent #5,766,945. Assignee: Fred Hutchinson Cancer
Research Center (Seattle, WA)
Appl. No. 798000 Filed February 12, 1997
Miller AH, Pariante CM, Pearce BD. 1999. Effects of
cytokines on glucocorticoid receptor expression and function. Glucocorticoid
resistance and relevance to depression. Adv Exp Med Biol 461:107-116.
Murono S, Yoshizaki T, Sato H, Takeshita H, Furukawa M,
Pagano JS. 2000. Aspirin inhibits tumor cell invasiveness induced by Epstein-
Barr virus latent membrane protein 1 through suppression of matrix
metalloproteinase-9 expression. Cancer Res, 60:2555-2561.
Nair AP, Hahn S, Banholzer R, Hirsch HH, Moroni C. 1994.
Cyclosporin A inhibits growth of autocrine tumour cell lines by destabilizing
interleukin-3 mRNA. Nature 369:239-42.
Nalca A., and V.M. Rangnekar. 1998. The G1-phase
growth-arresting action of interleukin-1 is independant of p53 and p21/WAF1
function. J. Biol. Chem. 273: 30517-30523.
Neurath MF, Pettersson S, Meyer zum Buschenfelde KH,
Strober W. 1996. Local administration of antisense phosphorothioate
oligonucleotides to the p65 subunit of NF-kappa B abrogates established
experimental colitis in mice. Nat Med. 2:998-1004.
Nordeen SK. Luciferase reporter gene vectors for analysis
of promoters and enhancers. 1988. Biotechniques. 6:454-8.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
Oliver WR Jr, Shenk JL, Snaith MR, Russell CS, Plunket
KD, Bodkin NL, Lewis MC, Winegar DA, Sznaidman ML, Lambert MH, Xu HE,
Sternbach DD, Kliewer SA, Hansen BC, Willson TM. 2001. A selective
peroxisome proliferator-activated receptor delta agonist promotes reverse
5 cholesterol transport. Proc Natl Acad Sci U S A. 98:5306-11.
Pikaart MJ, Recillas-Targa F, Felsenfeld G. 1998. Loss of
transcriptional activity of a transgene is accompanied by DNA methylation and
histone deacetylation and is prevented by insulators. Genes Dev. 12:2852-62.
Rao A, Luo C, Hogan PG. 1997. Transcription factors of the
10 NFAT family: regulation and function. Annu Rev Immuno1.15:707-47.
Riggs CD, Chrispeels MJ. 1987. Luciferase reporter gene
cassettes for plant gene expression studies. Nucleic Acids Res. 15:8115.
Roth JA, Nguyen D, Lawrence DD, Kemp BL, Carrasco CH,
Ferson DZ, Hong WK, Komaki R, Lee JJ, Nesbitt JC, Pisters KM, Putnam JB,
15 Schea R, Shin DM, Walsh GL, Dolormente MM, Han CI, Martin FD, Yen N,
Xu K, Stephens LC, McDonnell TJ, Mukhopadhyay T, Cai D. 1996 Retrovirus-
mediated wild-type p53 gene transfer to tumors of patients with lung cancer.
Nat Med. 2:985-91.
Seegers JC, Joubert AM, Panzer A, Lottering ML, Jordan
20 CA, Joubert F, Maree JL, Bianchi P, de Kock M, Gelderblom WC. 2000.
Fumonisin B1 influenced the effects of arachidonic acid, prostaglandins E2
and A2 on cell cycle progression, apoptosis induction, tyrosine- and CDC2-
kinase activity in oesophageal cancer cells. Prostaglandins Leukot Essent
Fatty Acids 62:75-84
25 Shibasaki F, Price ER, Milan D, McKeon F. 1996. Role of
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
31
kinases and the phosphatase calcineurin in the nuclear shuttling of
transcription factorNF-AT4. Nature, 382:370-3.
Smith, LM.and MJ Birrer. 1996. Use of Transcription
Factors as Agents and Targets for Drug Development. Oncology 10:1532-
1542.
Stunnenberg, H.G. 1993. Mechanisms of transcription by
retinoic acid receptors. BioEssays 15: 309-315.
Tengku-Muhammad TS, Hughes TR, Foka P, Cryer A, and
Ramji DP. 2000. Cytokine-mediated differential regulation of macrophage
activator protein-1 genes. Cytokine 2000 Jun;12:720-726.
Udvardy, A. 1999. Dividing the empire: boundary chromatin
elements delimit the territory of enhancers. EMBO J 18: 1-8.
Waterman ML, Adler S, Nelson C, Greene GL, Evans RM,
Rosenfeld MG. 1988. A single domain of the estrogen receptor confers
deoxyribonucleic acid binding and transcriptional activation of the rat
prolactin
gene. Mol Endocrinol. 2:14-21.
Yeh E, Gustafson K, Boulianne GL. 1995. Green
fluorescent protein as a vital marker and reporter of gene expression in
Drosophila. Proc Natl Acad Sci U S A. 92:7036-40.
Zeitoun K, Takayama K, Michael MD, Bulun SE.. 1999
Stimulation of aromatase P450 promoter (II) activity in endometriosis and its
inhibition endometrium are regulated by competitive binding of steroidogenic
factor-1 and chickenovalbumin upstream promoter transcription factor to the
same cis-acting element. Mol Endocrinol. 13:239-53.
CA 02390399 2002-07-30
WO 02/052039 PCT/CA01/01861
32
U.S. PATENTS DOCUMENTS
Foulkes J.G., Leichtfreid F., Pieler C and J.R. Stephenson.
01/1999. Methods of transcriptionally modulating gene expression and of
discovering chemicals capable of functioning as gene expression modulators.
US5863733.
Miller, A.D. 02/1997. 10A1 Retroviral packaging cells and
uses thereof. US5766945.
