Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
1
MODIFICATION OF POLYSACCHARIDE CONTA1N1NG MATERIALS
FIELD AND BACKGROUND OF THE INVENTION
The present invention relates to methods and compositions for altering the
structural, chemical, physical and mechanical properties of polysaccharide
materials
using biological crosslinking agents based on multimeric structures of
polysaccharide
binding domains fused or linked to a biological or chemical entity and the
resulting
biological compositions. The invention is exemplified by the use of a
cellulose
binding domain (CBD) fusion_protein containing two cellulose binding domains,
a
cellulose binding domain-Protein A-Ab complex or a S-peptide-cellulose binding
domain-S-protein fusion to enhance mechanical properties, such as wet
strength, of
tissue paper, filter paper and cotton yarn.
Polysaccharides are ubiquitous, stable structural components found in nature.
Many organisms use polysaccharides as structural material inside and outside
of their
cells to provide 3-dimensional shape and surface structure. The structural
integrity of
polysaccharides from natural sources is often retained after the isolation of
the
polysaccharide, allowing it to be used for a variety of commercial purposes.
Owing to
their desirable physical characteristics polysaccharides have also been
produced by
synthetic methods for commercial purposes. In either case, polysaccharides
such as
2 0 celluloses from either synthetic or non-synthetic sources comprise the raw
material for
a variety of commercially important products such as paper pulp, and textile
fibers.
The paper manufacturing process conventionally includes four main steps:
forming an aqueous suspension of cellulosic fibers, commonly known as pulp;
adding
various processing and paper enhancing materials, such as strengthening and/or
sizing
2 5 materials to the pulp slurry; sheeting the paper by pouring the resulting
suspension
over forming fabric which filters out most of the water and drying the fibers
to form a
desired cellulosic web; and post-treating the web after an initial drying of
the paper to
provide various desired characteristics to the resulting paper, including
surface
application of sizing materials to increase the dry strength of the paper.
Those
3 0 additives applied to the pulp in an aqueous slurry are known as wet-end
additives and
include retention aids to retain fines and fillers, for example, alum,
polyethylene
imine, cationic. starches and the like; drainage aids, such as polyethylene
imine;
defoamers; and pitch or additives such as microfibers and adsorbent f llers.
Other wet-
end additives include polymers such as, cationic polyarylamides and poly(amide
3 5 amine/epichlorohydrin) which are added to improve wet strength as well as
dry
strength of the paper. Starch, guar gums, and polyacrylamides are also added
to yield
dry strength improvements. Sizing agents are occasionally added to impart
hydrophobic character to the hydrophilic cellulosic fibers. These agents are
used in the
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
2
manufacture of paper for liquid containers, for example, milk or juice, paper
cups and
surfaces printed by aqueous inks where it is desired to prevent the ink from
spreading.
Such sizing agents include rosin sizes derived from pine trees, wax emulsions
and,
more recently, cellulose-reactive sizes. The application of additives to paper
after an
initial drying of the sheet by spraying, capillary sorption, immersion, roll-
coating and
the like, is often referred to as a dry-end addition. Polyvinyl alcohol),
acrylic or vinyl
acetate emulsions, starches, sizing agents, polyurethanes, and SBR latex are
commonly added at the dry end.
A major product of the paper industry is corrugating medium, the middle
fluting paper used in corrugated containers. Starch makes up 2-5% of the total
weight
of fluting paper. Various techniques have been used to improve the wet
strength of
corrugating medium, including the use of chemical crosslinkers, such as
formaldehyde
resins, or the application of hydrophobic materials, such as wax. However, the
addition to or treatment of paper with such compounds has been largely
discontinued
due to the negative impact of these compounds on recyclability of the treated
paper.
Other techniques used have employed more expensive raw materials such as
semichemical pulp in order to increase the weight and strength of the paper
per square
meter. This latter approach leads to increased cost of both starting materials
and the
manufacturing process itself.
2 0 The processing of cellulosic material, as for example cotton fiber into a
textile
fabric, like paper making, also involves several steps: spinning of the fiber
into a
yarn; construction of woven or knit fabric from the yarn and subsequent
preparation,
dyeing and finishing operations. Woven goods are the prevalent forms of
textile fabric
construction. The yarns generally are sized in a size box, then the water is
removed on
2 5 steam cans and the yarns formed into a sheet which is run across bust rods
to break the
sheet back into individual yarns. The yarns are then woven, which is done by
weaving
a filling yarn between a series of warp yarns. The sub-steps involved in
preparation are
desizing, scouring and bleaching. A one-step combined scour/bleach process is
also
used in the industry.
3 0 Various compounds are used as sizing agents for warp yarns to prevent
breakage of the yarn during weaving. A good yarn sizing agent is one which
forms a
film with sufficient strength to provide protection to the yarn being sized
but is not so
strong that the yarn will break under the size film. The sizing agents are
placed on the
warp yarns prior to weaving to provide strength and to protect the yarns from
3 5 abrasion. Traditional sizing agents for cotton-containing yarns have
generally included
film formers such as starch, derivatives of starch, polyvinyl alcohol,
polyester resins,
waxes, acrylic polymers and copolymers and their salts, wetting agents,
antistatic
agents, and combinations thereof. The conventional thermosetting resin
systems,
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
3
either postcured or precured, result in embrittlement and reduction of
mobility of the
microstructural units of cellulosic fibers to such an extent that abrasion
resistance,
breaking strength, and tearing strength often are seriously impaired. Abrasion
resistance is often reduced by 75-85%, breaking strength by 50-60%, and
tearing
strength by about 50%. Furthermore, if the cellulosic fiber-containing yarn is
sized by
the conventional methods described above, it is difficult to completely desize
the sized
yarn. Even if the sized yarn is completely desized, the desizing process is
complicated
or expensive.
Recently, it has become an increasingly important requirement that desizing be
effected in a simple process, without pollution. It therefore is of interest
to develop
additives for polysaccharide containing materials such as paper and textiles
which
decrease or avoid the use of potentially toxic chemical crosslinkers, and
which are
cost and time effective to use.
Relevant Literature:
Disruption of cellulose fibers by the binding domain of a bacterial cellulase
is
described by Din et al. (1991) BiolTechnology 9: 1096-1099. Kim et al. (1993,
Protein Science 2: 348-356) describe a recombinant fusion protein having a S-
peptide
carrier, an oligopeptide spacer having a protease recognition sequence, and a
galactosidase target. Expression of a fusion protein of heparinase I (ex
Flavobacterium
2 0 heparinum) fused to either the N- or C- terminal of the CBD of C.
cellulovorans was
described by Shpigel et al. (1999) Biotech. Bioeng. 65:17-23.
U.S. PAT. NO. 5,137,819 to Kilburn et al. discloses the preparation of fusion
proteins which include a cellulase substrate binding region and their use in
immobilization and purification of polypeptides. U.S. PAT. NO. 5,928,917 to
Kilburn
2 5 et al. discloses conjugates of a non-protein chemical moiety and a
polypeptide having
a cellulose binding region. Polysaccharide binding proteins and conjugates are
described in U.S. PAT. NO. 5,962,289 to Kilburn et al. U.S. PAT. N0..5,821,358
to
Gilkes et al. discloses methods and compositions for the modification of
polysaccharide structures, for example, cotton and ramie fibers, using binding
3 0 domains and/or catalytic domains from polysaccharidases.
U.S. PAT. NO. 5,837,814 to Shoseyov et al. discloses a CBD having a high
affinity for crystalline cellulose and chitin, together with fusion products
of the CBD
and a second protein. Applications for the CBD and the fusion products,
including:
drug delivery, affinity separations, and diagnostic techniques are also
disclosed. See
35 also, U.S. PAT. NO. 5,719,044; U.S. PAT. NO. 5,496,934; and U.S.5,856,201;
all to
Shoseyov et al., the contents of each of which are incorporated by reference
herein.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
4
A review of the utility of paper additives is given by B.B. Spence
Encyclopedia of Polymer Science and Technology, Second Edition, Wiley-
Interscience, Vol. 10, pgs. 761-786, New York (1987).
SUMMARY OF THE INVENTION
The present invention is directed to compositions and methods for cross-
linking and/or functionalizing polymeric or polysaccharide materials using
compositions comprising at least one polysaccharide binding domain.
Compositions
of the invention include polysaccharide binding domain (PBD) fusion proteins,
PBD
coupler units, PBD functional moieties and polysaccharides modified using
these
compositions. A PBD coupler unit of the invention includes one, two or more
PBDs,
each of which is capable of independently binding to a polysaccharide, and
optionally
one or more linker unit coupled between the PBDs. The method includes the step
of
contacting a polysaccharide structure with a sufficient amount of a PBD fusion
protein
under conditions and for a time sufficient to modify one or more
characteristic of a
polysaccharide material comprising a polysaccharide structure. The methods and
compositions find use in producing polysaccharide containing materials with
altered
mechanical, chemical, electrical and/or physical properties.
According to one aspect of the present invention there is provided a process
of
2 0 manufacturing a polysaccharide containing material having at least one
desired
structural, chemical, physical, electrical and/or mechanical property, the
method
comprising the step of contacting polysaccharide structures of the
polysaccharide
containing material with a polysaccharide binding domain containing
composition
before, during and/or after processing the polysaccharide structures into the
2 5 polysaccharide containing material, thereby manufacturing the
polysaccharide
containing material having the desired structural, chemical, physical,
electrical and/or
mechanical property.
According to another aspect of the present invention there is provided a
composition-of matter comprising a polysaccharide containing material
including
3 0 polysaccharide structures; and a polysaccharide binding domain containing
composition being bound to the polysaccharide structures of the polysaccharide
containing material, providing the polysaccharide containing material with at
least one
desired structural, chemical, physical, electrical and/or mechanical property.
According to further features in preferred embodiments of the invention
3 5 described below, contacting the polysaccharide structures of the
polysaccharide
containing material with the polysaccharide binding domain containing
composition is
effected before processing the polysaccharide structures into the
polysaccharide
containing material.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
According to still further features in the described preferred embodiments
contacting the polysaccharide structures of the polysaccharide containing
material
with the polysaccharide binding domain containing composition is effected
during
processing the polysaccharide structures into the polysaccharide containing
material.
5 According to still further features in the described preferred embodiments
contacting the polysaccharide structures of the polysaccharide containing
material
with the polysaccharide binding domain containing composition is effected
after
processing the polysaccharide structures into the polysaccharide containing
material.
According to still further features in the described preferred embodiments the
polysaccharide containing material is selected from the group consisting of a
paper, a
textile, a yarn and a fiber.
According to still further features in the described preferred embodiments the
structural property is selected from the group consisting of a predetermined
level of
cross-links between polysaccharide structures of the polysaccharide containing
material, a predtermined aggregation of the polysaccharide structures of the
polysaccharide containing material and a predetermined surface texture of the
polysaccharide containing material.
According to still further features in the described preferred embodiments the
chemical property is selected from the group consisting of a predetermined
2 0 hydrophobicity, a predetermined hydrophylicity, a predetermined wet-
ability, a
predetermined chemical reactivity, a predetermined photochemical reactivity, a
predetermined functionality and a predetermined surface tension.
According to still further features in the described preferred embodiments the
physical property is selected from the group consisting of a predetermined
Young's
2 5 modulus, a predetermined strain at maximum load, a predetermined energy to
break
point, a predetermined water absorbency, a predetermined swellability and a
predetermined toughness.
According to still further features in the described preferred embodiments the
electrical property is selected from the group consisting of a predetermined
surface
3 0 charge and a predetermined electrical conductivity.
According to still further features in the described preferred embodiments the
mechanical property is selected from the group consisting of a predetermined
tensile
strength, a predetermined resistance to shear, a predetermined abrasion
resistance, a
predetermined frictional coefficient, a predetermined elasticity and a
predetermined
3 5 wet strength.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
6
binding domain and at least one additional polysaccharide binding domain
covalently
coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and another protein covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a hydrophobic group covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a hydrophilic group covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a biological moiety covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and an enzyme covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
2 0 binding domain and an chemical reactive group covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and an chemical photoreactive group covalently coupled thereto.
According to still fizrther features in the described preferred embodiments
the
2 5 polysaccharide binding domain containing composition includes a
polysaccharide
binding domain and a lipase covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a lacase covalently coupled thereto.
3 0 According to still further features in the described preferred embodiments
the
polysaccharide' binding domain containing composition includes a
polysaccharide
binding domain and a protein A-antibody covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
3 5 binding domain and a peptide covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a polypeptide covalently coupled thereto.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
7
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a hydrocarbon or a hydrocarbon derivative covalently
coupled
thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a fatty acid derivative covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and an electrically charged moiety covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and an ionic moiety covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a silicon binding moiety covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a polymer binding moiety covalently coupled thereto.
2 0 According to still further features in the described preferred embodiments
the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a metal covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
2 5 binding domain and a metallothionein-like protein covalently coupled
thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and ferritin covalently coupled thereto.
According to still further features in the described preferred embodiments the
3 0 polysaccharide binding domain containing composition includes a
polysaccharide
binding domain and a metal binding moiety covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a bacterial siderophores covalently coupled thereto.
3 5 According to still further features in the described preferred embodiments
the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a metallothionein covalently coupled thereto.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
8
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a thiol group covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and an aldehyde covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a maleimide covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a hydrazide covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and an epoxide covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain and a carbodiimide covalently coupled thereto.
According to still further features in the described preferred embodiments the
2 0 polysaccharide binding domain containing composition includes a
polysaccharide
binding domain and a phenylazide covalently coupled thereto.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain which is a cellulose binding domain.
2 5 According to still further features in the described preferred embodiments
the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain which is a starch binding domain.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
3 0 binding domain capable of binding to cellulose.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain capable of binding to starch.
According to still further features in the described preferred embodiments the
35 polysaccharide binding domain containing composition includes a
polysaccharide
binding domain capable of binding to chitin.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
9
binding domain which is a glucan-binding domain, e.g., a (3-1,3-glucan-binding
domain.
According to still further features in the described preferred embodiments the
polysaccharide binding domain containing composition includes a polysaccharide
binding domain which includes streptococcal glucan-binding repeats.
According to yet another aspect of the present invention there is provided a
composition-of matter comprising a polysaccharide containing material
including
polysaccharide structures; and a polysaccharide binding domain containing
composition being bound to the polysaccharide structures of the polysaccharide
containing material, the polysaccharide binding domain containing composition
including at least two covalently coupled polysaccharide binding domains
forming a
polysaccharide binding domain coupler cross linking the polysaccharide
structures of
the polysaccharide containing material.
According to still another aspect of the present invention there is provided a
composition-of matter comprising a polysaccharide containing material
including
polysaccharide structures; and a polysaccharide binding domain containing
composition being bound to the polysaccharide structures of the polysaccharide
containing material, the polysaccharide binding domain containing composition
including at least one polysaccharide binding domain and a functionalizing
moiety
2 0 being covalently coupled thereto, the at least one polysaccharide binding
domain
attaching the functionalizing moiety to the polysaccharide structures of the
polysaccharide containing material.
According to an additional aspect of the present invention there is provided a
composition-of matter comprising a polysaccharide containing material
including
2 5 polysaccharide structures; and a polysaccharide binding domain containing
composition being bound to the polysaccharide structures of the polysaccharide
containing material, the polysaccharide binding domain containing composition
including at least one polysaccharide binding domain and a hydrophobic moiety
being
covalently coupled thereto, the at least one polysaccharide binding domain
attaching
3 0 the hydrophobic moiety to the polysaccharide structures of the
polysaccharide
containing material.
According to yet an additional aspect of the present invention there is
provided
a composition-of matter comprising a polysaccharide containing material
including
polysaccharide structures; and a polysaccharide binding domain containing
3 5 composition being bound to the polysaccharide structures of the
polysaccharide
containing material, the polysaccharide binding domain containing composition
including at least one polysaccharide binding domain and a hydrophilic moiety
being
covalently coupled thereto, the at least one polysaccharide binding domain
attaching
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
the hydrophilic moiety to the polysaccharide structures of the polysaccharide
containing material.
According to still an additional aspect of the present invention there is
provided a composition-of matter comprising a polysaccharide containing
material
5 including polysaccharide structures; and a polysaccharide binding domain
containing
composition being bound to the polysaccharide structures of the polysaccharide
containing material, the polysaccharide binding domain containing composition
including at least one polysaccharide binding domain and a chemical reactive
moiety
being covalently coupled thereto, the at least one polysaccharide binding
domain
10 attaching the chemical reactive moiety to the polysaccharide structures of
the
polysaccharide containing material.
According to a further aspect of the present invention there is provided a
composition-of matter comprising a polysaccharide containing material
including
polysaccharide structures; and a polysaccharide binding domain containing
composition being bound to the polysaccharide structures of the polysaccharide
containing material, the polysaccharide binding domain containing composition
including at least one polysaccharide binding domain and a photo-chemical
reactive
moiety being covalently coupled thereto, the at least one polysaccharide
binding
domain attaching the photo-chemical reactive moiety to the polysaccharide
structures
2 0 of the polysaccharide containing material.
According to yet a further aspect of the present invention there is provided a
composition-of matter comprising a polysaccharide binding domain coupler
including
at least two covalently coupled polysaccharide binding domains.
According to still a further aspect of the present invention there is provided
a
2 5 nucleic acid construct comprising a polynucleotide encoding a fusion
protein
including at least two polysaccharide binding domains. Preferably, the nucleic
acid
construct further comprising at least one additional polynucleotide encoding
at least
one linker peptide coupling the at least two polysaccharide binding domains.
According to a further aspect of the present invention there is provided a
3 0 process of manufacturing a polysaccharide containing material having at
least one
desired structural, chemical, physical, electrical and/or mechanical property,
the
method comprising the step of contacting polysaccharide structures of the
polysaccharide containing material with a polysaccharide binding domain,
during
and/or after processing the polysaccharide structures into the polysaccharide
3 5 containing material, and thereafter covalently coupling at least one
moiety or group to
the polysaccharide binding domain, thereby manufacturing the polysaccharide
containing material having the desired structural, chemical, physical,
electrical and/or
mechanical property.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
11
The present invention successfully addresses the shortcomings of the presently
known configurations by providing processes and reagents for manufacturing
superior
polysaccharide structures containing materials such as papers and textiles.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is herein described, by way of example only, with reference to
the accompanying drawings. With specific reference now to the drawings in
detail, it
is stressed that the particulars shown are by way of example and for purposes
of
illustrative discussion of the preferred embodiments of the present invention
only, and
are presented in the cause of providing what is believed to be the most useful
and
readily understood description of the principles and conceptual aspects of the
invention. In this regard, no attempt is made to show structural details of
the
invention in more detail than is necessary for a fundamental understanding of
the
invention, the description taken with the drawings making apparent to those
skilled in
the art how the several forms of the invention may be embodied in practice.
Fig. 1 A is a schematic representation of pET-CBD plasmid.
Figs.lB-C show the nucleotide sequence (SEQ ID NO:1) and the amino acid
sequence (SEQ ID N0:2) of CBDclos.
Fig. 1D is a schematic representation of pET-CBD-180.
2 0 Figs. 1 E-G show the nucleotide sequence (SEQ ID N0:3) and the amino acid
sequence (SEQ ID N0:4) of CBD-180 along with restriction endonuclease
recognition
sites.
Fig. 2A is a schematic representation of pET-CCP-180 containing one copy of
CBD-180 and one of CBD fused in frame thereto.
2 5 Figs. 2B-E show the nucleotide sequence (SEQ ID NO:S) and the amino acid
sequence (SEQ ID N0:6) of CCP (cellulose cross linking protein) along with
restriction endonuclease recognition sites.
Fig. 3A is a schematic representation of pET-ProtA-CBD.
Figs. 3B-G show the nucleotide sequence (SEQ ID N0:7) and the amino acid
3 0 sequence (SEQ ID N0:8) of ProtA-CBD.
Fig. 4A is a schematic representation of pET29-Spep-CBD-Sprot.
Figs. 4B-G show the nucleotide sequence (SEQ ID N0:9) and the amino acid
sequence (SEQ ID NO:10) of Spep-CBD-Sprot.
Fig. 5A schematically represents a cellulose cross-linking protein having two
3 5 domains for cellulose binding per molecule.
Fig. 5B schematically represents the cellulose cross-linking protein of Fig.
5A,
wherein one cellulose binding domain is bound to a first polymeric structural
unit, and
a second cellulose binding domain is bound to a second polymeric structural
unit.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
12
Fig. 6 schematically represents a generic CBD coupler unit.
Figs. 7A-C each schematically represent various embodiments of a CBD
coupler unit. Fig. 7A shows a CBD coupler unit having a pair of terminal CBDs
linked by a linker unit which includes a pair of starch binding domains each
coupled
to a CBD, and a starch moiety coupled to both starch binding domains. Fig. 7B
shows
a CBD coupler unit having a pair of terminal CBDs linked by a linker unit
which
includes a plurality of CBDs, each of which is coupled to an adjacent CBD via
a
JUN/FOS bridge. Fig. 7C shows a CBD coupler unit having a pair of terminal
CBDs
linked by a large protein moiety.
Fig. 8 schematically represents a CBD functional moiety (CBDC) having at
least one CBD and a functional moiety (FM) attached thereto.
Figs. 9A-C schematically represent various ways in which a CBD coupler unit
can interact with, and bind to, a polymeric structural unit.
Figs. l0A-D are bar graphs of Young's modulus, strain at maximum load,
energy to break point and toughness, respectively, for control, CBD-treated,
and CCP-
treated paper strips.
Fig. 11 schematically represents a yarn coating apparatus used for treating
the
yarn with test formulations.
Figs. 12A-B are bar graphs of Young's modulus and strain at maximum load,
2 0 respectively, for control, CCP-treated, ProtA-CBD treated, and Ab-ProtA-
CBD
treated yarn.
Fig. 13 shows a photograph of the results of expression of S-protein-CBD-S-
peptide (SCS) in Ecoli. Protein marker (lane 1), total E.coli proteins before
induction
with IPTG (lane 2) total E.coli proteins after induction with IPTG (lane 3)
and
2 5 inclusion bodies containing the SCS protein (lane 4).
Fig. 14 shows a Young's modulus map of the results of treating Whatman
papers with CBD, CCP, or SCS. All measurements were taken at 23 °C, 65
% relative
humidity.
Fig. 15 shows the energy to break points of CBD, CCP, and SCS treated
3 0 Whatman papers. All measurements were taken at 23 °C, 65 % relative
humidity.
Fig. 16 shows the results of a toughness test of CBD, CCP, and SCS treated
Whatman papers. All measurements were taken at 23 °C, 65 % relative
humidity.
Fig. 17 shows the stress at maximum load of CBD, CCP, and SCS treated
Whatman papers. All measurements were taken at 23 °C, 65 % relative
humidity.
3 5 Fig. 18 shows typical stress versus strain curves of preformed Whatman
papers
treated with CBD or CCP. All measurements were taken at 23°C, 65%
relative
humidity and at a constant deformation rate of 20 mm/min. Squers - Control;
Circles
- 2.5 mg/ml CBD; triangles - 2.5 mg/ml CCP.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
13
Fig. 19 shows water-absorption time of preformed Whatman papers treated
with CBD or CCP at different concentrations. All measurements were taken at
23°C .
Distilled water ( 10 ~l) was pipetted onto treated papers and the time to full
absorption
was measured in seconds (control - solid bar; CBD - stippled bars; CCP - open
bars).
Fig. 20 shows time-lapse photograps of water absorption on preformed
Whatman pape treated with CCP. Water droplets (20 p,1 each) were dripped onto
CCP-treated paper, and pictures were taken every 25 ms. The first frame (A)
was
taken before the water made contact with the paper. Frames B to E ware taken
after 2,
4, 6, and 8 minutes, respectively. The last frame (F) was taken on non-treated
paper
25 ms after water came in contact with the paper. Water absorption was
visualized
using an optical contact angle meter.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
In accordance with the subject invention, methods and compositions are
provided for altering surface, chemical, electrical, and mechanical properties
of
polysaccharide materials.
Before explaining at least one embodiment of the invention in detail, it is to
be
understood that the invention is not limited in its application to the details
set forth in
the following description or exemplified by the Examples. The invention is
capable
2 0 of other embodiments or of being practiced or carned out in various ways.
Also, it is
to be understood that the phraseology and terminology employed herein is for
the
purpose of description and should not be regarded as limiting.
Polysaccharide structures such as fibers and filaments are treated with PBD
containing compositions during or after processing of the structures into
2 5 polysaccharide containing materials, thereby cross-linking and/or
ftmctionalizing the
polysaccharide structures and/or their products such as textiles and paper.
The PBD-
containing compositions function as versatile biological crosslinkers, the
structure of
which can be varied to accommodate a desired result such as increased
elasticity or
hydrophobicity of a polysaccharide containing end product. The biological
3 0 crosslinkers are multimeric proteins containing at least one PBD, such as
a cellulose
binding domain fused or linked ("fused or linked" = covalently coupled) to one
or
more biological or chemical entity ranging in size from hundreds to several
millions
of Daltons. Generally the biological entity is one or more second protein. The
second
protein can be another PBD, such as a cellulose binding domain or a starch
binding
3 5 domain or a functionalized PBD, such as a PBD bound to a hydrophobic group
or an
enzyme, particularly an enzyme which can improve and/or accelerate processing
of the
polysaccharide structures and/or the characteristics of the polysaccharide
containing
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
14
end product such as a lipase or a laccase. Alternatively, the second protein
can be a
non-PBD protein such as a protein A-antibody complex.
For preparing a modified polysaccharide-containing material, a polysaccharide
structure is contacted during or after processing into a polysaccharide
material with a
sufficient amount of a biological crosslinker under conditions and for a time
sufficient
to modify one or more characteristic of a polysaccharide material containing
the
polysaccharide structure. As an example, instead of or in conjunction with the
traditional sizing step during processing of cellulose fibers into paper or
cotton into
yarn, the PBD fusion proteins can be used to aggregate polysaccharide
structures
and/or crosslink polysaccharide structures such as polysaccharide fibers and
filaments
so as to increase the wet strength of the structures themselves during
processing
and/or the polysaccharide containing material produced. Preferably the
treatment with
PBD fusion proteins is in lieu of the traditional sizing step. However, in
some
applications it can be useful to combine the two procedures, for example, with
a starch
size and PBD fusion proteins containing starch binding proteins to crosslink
the starch
and the fibers. In addition, PBDs comprising functional moieties can be used
to
functionalize a polysaccharide containing material, such as a cellulose
matrix, with for
example a hydrophobic moiety such as a fatty acid derivative or a hydrophobic
amino
acid sequence to decrease the wetability of a polysaccharide containing
material such
2 0 as paper.
The subject invention offers several advantages over existing methods of
treating polysaccharide structures as for example are used in commercial paper
and
textile processes. By treating a suitable polysaccharide containing material,
such as
cellulose fibers, with a biological crosslinker, a product with improved
mechanical
2 5 properties (for example, increased strength and durability) as compared
with untreated
materials and/or materials treated using enhancing materials other than PBD
fusion
proteins can be obtained. In addition, in the manufacture of fluting paper,
the PBD
reagent can be applied in either the forming stage or before or after the
sizing stage to
increase the wet strength of the paper. If applied in the forming stage, it
provides
3 0 sufficient wet strength so that the sizing step can be eliminated. This
not only saves
time, but it also significantly lowers the cost of preparing the paper,
because about one
third of the machine used to process the paper can be eliminated. The use of
biological
crosslinkers as opposed to chemical crosslinkers and hydrophobic materials
also
improves the recyclability of paper products made using this process.
35 Another advantage of the subject invention is that in the forming step of
paper
making, many fine fibers are lost because they pass through the forming
fabric. The
PBD reagent maintains them in the paper slurry, resulting in a better recovery
of raw
materials. Additionally, in the final processing step of producing corrugated
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
containers, an alkaline glue is used to bind the fluting paper to the
wallboard. PBD
molecules are eluted by strong alkaline conditions, which enhances the ability
of the
alkaline glue to penetrate the paper.
The multimeric PBD fusion proteins of the subject invention have two basic
5 building blocks, a PBD and a second protein, wherein the second protein may
or may
not be a PBD. A PBD can be a protein or a peptide that comprises an amino acid
sequence that binds to a polysaccharide such as cellulose or a polymer which
contains
the basic structural units of the polysaccharide substrate to which the PBD
binds,
including either backbone sugars and/or terminal sugars and sugars themselves,
10 including monosaccharides and disaccharides. Included within the definition
of a PBD
are mutants, variants and the like of naturally occurring PBDs, the only
requirement
being that they bind to a polysaccharide containing substrate. PBDs can bind
to a
substrate polysaccharide either reversibly or irreversibly, and the substrate
can be
natural or synthetic. A PBD fusion protein can be a protein molecule having
multiple
15 polysaccharide binding domains that may be derived from the same or
different
polysaccharidases or scaffolding proteins and that may bind to the same or
different
polysaccharides. When multiple PBDs are present, they preferably occupy
separate
domains within the PBD fusion protein, and may function independently of each
other. The term CBD refers to either a domain obtainable from a native protein
which
2 0 is involved in cellulose binding, or to an isolated amino acid sequence or
fragment of
the native protein which itself binds to cellulose (see, for example,
Goldstein et al.
(1993) J. Bacteriol. 175:5762-5768 and Gilkes et al. (1988) J. Biol. Chem.
263:10401-10407, the contents of both of which are incorporated herein by
reference).
PBDs and CBDs can be natural, synthetic, or partially synthetic.
2 5 The polysaccharide binding domains, including both catalytically competent
and incompetent polysaccharidases comprising polysaccharide binding domains,
can
be obtained by any of a variety of techniques, including biochemical and/or
genetic
engineering techniques. Thus, they can be obtained by proteolysis (see, for
example,
Gilkes et al., J. Biol Chem (1988) 213: 10401-10407) or by gene manipulation
using
3 0 techniques known to those skilled in the art, such as random mutation,
site-directed
mutagenesis or DNA shuffling. Using site-directed mutagenesis, specific amino
acids
relating to the catalytic activity of the polysaccharidase can be mutagenized
and
replaced by amino acids that inhibit or block catalytic activity, but do not
interfere
with the binding of polysaccharide. For example, in CenA, aspartate at
position 283
3 5 could be replaced. Such an approach effectively generates an amino acid
sequence
quite similar to the original polysaccharidase sequence, but the functional
domain
containing the catalytic activity is rendered incompetent by mutagenesis or
biochemical modification; only the binding domain remains functional. One or
more
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
16
predetermined amino acid residues may be substituted, inserted in, or deleted
from the
amino acid sequence of various PBDs to provide variant or mutated PBDs. Amino
acid substitutions in a PBD protein or polypeptide sequence can be made in a
rational
manner based, for example, on similarity or differences in polarity, charge,
hydrophobicity, hydrophilicity, and the like of targeted amino acid
residue(s).
Characteristics such as polarity and hydrophobicity of all amino acids
commonly
found in proteins are well known in the art, as are techniques for
specifically changing
(mutating) amino acid sequences. The resulting variant or mutated PBDs are
deemed
to be within the scope of the instant invention. Substitutions, insertions
and/or
deletions can be made to provide a variant PBD having more desirable
attributes, for
example, for cross-linking or functionalization of particular polysaccharide-
containing
materials.
Amino acid sequences corresponding only to the polysaccharide binding
domain can be used rather than the entire polysaccharidase sequence with
specific
mutations or modifications. In this case, PBD is obtained by cleaving the
polysaccharidase into functional domains. For example, an isolated
polysaccharidase
is subjected to protease treatment that cleaves the protein into two or more
fragments
consisting of functional domains. On occasion, the polysaccharidase contains a
specific protease site. For example, C. fini endoglucanase A (CenA) contains a
PT box
2 0 that is cleaved by conformation-specific C. fini protease. The products of
that reaction
are a polysaccharide binding domain with a PT sequence and a polysaccharidase
catalytic domain. If the polysaccharidase is not cleaved by highly sequence
specific
proteases it will be subject to less specific proteases, and the active
fragments can be
isolated by chromatography and other peptide purification techniques known to
those
2 5 skilled in the art.
Other techniques that can be used to obtain a binding domain include use of
amino acid sequence information to generate probes for the cloning of DNA
sequences encoding polysaccharidases or polysaccharide binding proteins. These
cloned sequences can be used to generate deletion mutants encoding only the
3 0 polysaccharide binding domains. Conversely, if the cDNA sequence of a
polysaccharidase or polysaccharide binding protein is known, then a DNA
sequence
can be specifically constructed that corresponds to the polysaccharide binding
domain
by using biochemical, amino acid, and DNA sequence data to predict the
location of
the polysaccharide binding domain based on sequences homologies to other
3 5 polysaccharidases. The techniques used in isolating polysaccharidase genes
and
polysaccharide binding proteins are known in the art, including synthesis,
isolation
from genomic DNA, preparation from cDNA or combinations thereof. Other
techniques that can be used to obtain polysaccharide binding domains include
gene
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
17
fusion, phage display, DNA shuffling and random or site specific mutagenesis.
Various techniques for manipulation of genes are well known, and include
restriction,
digestion, resection, ligation, in vitro mutagenesis, primer repair, employing
linkers
and adapters, and the like (see Molecular Cloning: A Laboratory Manual 2nd
edition
Sambrook et al. (eds.), Cold Spring Harbor Laboratory Press, NY, (1989), which
is
incorporated herein by reference). The nucleic acid encoding a PBD protein of
the
invention may be obtained from isolated and purified RNA or by genomic
cloning.
Either cDNA or genomic libraries may be prepared using techniques well known
in
the art, and may be screened for a particular PBD ennucleotide sequence with
probes
that are substantially complementary to any portion of the coding sequence.
Alternatively, cDNA or genomic DNA may be used as templates for PCR cloning
using suitable oligonucleotide primers. Full length clones, i.e., those
containing the
entire coding sequence of the desired PBD protein may be selected for
constructing
expression vectors, or overlapping cDNAs can be ligated together to form a
complete
coding sequence or desired portion thereof, such as the binding domain.
Alternatively,
DNAs that encode a PBD can be synthesized, in whole or in part, by chemical
synthesis using solid-phase techniques well known in the art.
The PBP can be obtained from a variety of sources, including enzymes which
bind to oligosaccharides which find use in the subject invention. In Table 5
below are
2 0 listed those binding domains which bind to one or more soluble/insoluble
polysaccharides including all binding domains with affinity for soluble
glucans a, (3,
and/or mixed linkages. The N1 cellulose-binding domain from endoglucanase CenC
of C. frmi binds to soluble cellosaccharides and one of a small set of
proteins which
are known to bind any soluble polysaccharides. Also, listed in Tables 1 to 4
are
2 5 examples of proteins containing putative (3-1,3-glucan-binding domains
(Table 1);
proteins containing Streptococcal glucan-binding repeats (Cpl superfamily)
(Table 2);
enzymes with chitin-binding domains (Table 3), and starch-binding domains
(Table
4). Scaffolding proteins which include a cellulose binding domain protein such
as that
produced by Clostridium cellulovorans (Shoseyov et al., PCT/US94/04132) can
also
3 0 be used for preparing a PBP. Several fungi, including Trichodenma species
and
others, also produce polysacchanrdases from which PBP can be isolated.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
18
Table 1
Overview of proteins containing putative X1,3 glucan-binding domains
10
Source (strain) Protein accession No. Refl l
Type I
B. circulans (WL-12) GLCA1 P23903/M34503/JQ0420 1
B. circulans (IAM 1165) BgIH JN0772/D17519/S67033 2
Type II
Actinomadura sp. (FC7) XynII U08894 3
Arthrobacter sp. (YCWD3) GLCI D23668 9
O. xanthineolytica GLC P22222/M60826/A39094
4
R. faecitabidus (YLM-50) RP I Q05308/A45053/D10753
5a,b
R. communis Ricin A12892 6
S. lividans (1326) XInA P26514/M64551/JS07986
7
T. tridentatus FactorGa D16622 8
B. : Bacillus, O. : Oerskovia, R. faecitabidus : Rarobacter faecitabidus, R.
communis: Ricinus
communis, S : Streptomyces, T. : Tachypleus (Horseshoe Crab)
lReferences:
1) Yahata et al. (1990) Gene 86, 113-117
2) Yamamoto et al. (1993) Biosci. Biotechnol. Biochem. 57, 1518-1525
3) Harpin et al. (1994) EMBL Data Library
4) Shen et al. (1991) J. Biol. Chem. 266, 1058-1063
3 0 5a) Shimoi et al. (1992) J. Biol. Chem. 267, 25189-25195
5b) Shimoi et al. (1992) J. Biochem 110, 608-613
6) Horn et al. (1989) Patent A12892
7) Shareck et al. ( 1991 ) Gene 107, 75-82
8) Seki et al. (1994) J. Biol. Chem. 269, 1370-1374
3 5 9) Watanabe et al. (1993) EMBL Data Library
Table 2
Overview of proteins containing Streptococcal glucan-binding repeats (Cpl
superfamily)
Source Protein Accession No. Ref.2
S. downei (sobrinus) GTF-I D13858 1
(OMZ176)
4 5 S. downei (sobrinus) GTF-I P11001/M17391 2
(MFe28)
S. downei (sobrinus) GTF-S P29336/M30943/A414833
(MFe28)
S. downei (sobrinus) GTF-I P27470/D90216/A381754
(6715)
S. downei (sobrinus) DEI L34406 5
5 0 S. mutants (Ingbritt)GBP M30945/A37184 6
S. mutants (GS-5) GTF-B A33128 7
S. mutants (GS-5) GTF-B P08987/M17361B331358
S. mutants GTF-B3~-D~P05427/C33135 8
S. mutants (GS-5) GTF-C P13470/M17361/M220549
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
19
S. mutants (GS-5) GTF-C not available 10
S. mutants (GS-5) GTF-D M29296/A45866 I
1
_
S. salivarius GTF-J A44811/S22726/528809 12
Z 11873/M64111
S. salivarius GTF-K 522737/S22727/211872 13
S. salivarius (ATCC25975) GTF-L L35495 14
S salivarius (ATCC25975) GTF-M L35928 14
S pneumoniae R6 LytA P06653/A25634/M13812 15
S. pneumoniae PspA A41971/M74122 16
Phage HB-3 HBL P32762/M34652 17
Phage Cp-1 CPL-1 P15057/J03586/A31086 18
Phage Cp-9 CPL-9 P19386/M34780/JQ0438 19
Phage EJ-I EJL A42936 20
C. di~cile (VPI 10463) ToxA P16154/A37052/M30307 21
X51797/S08638
2 0 C. di~cile (BARTS WI) ToxA A60991/X17194 22
C. docile (VPI 10463) ToxB P18177/X53138/X60984 23,24
510317
C docile (1470) ToxB S44271/Z23277 25,26
2 5 C. novyi a-toxin 544272/223280 27
C. novyi a-toxin 248636 28
C. acetobutylicum (NCIB8052) CspA 549255/237723 29
C. acetobutylicum (NCIB8052) CspB 250008 30
30 C. acetobutylicum (NCIB8052) CspC 250033 30
C. acetobutylicum (NCIB8052) CspD 250009 30
2References:
3 5 1) Sato et al. (1993) DNA seguence 4, 19-27
2) Ferreti et al. (1987) J. Bacteriol. 169, 4271-4278
3) Gilmore et al. (1990) J. Infect. Immun. 58,
2452-2458
4) Abo et al. (1991) J. Bacteriol. 173, 989-996
5) Sun et al. (1994) J. Bacteriol. 176, 7213-7222
4 0 6) Banas et al. (1990) J. Infect. Immun. 58, 667-673
7) Shiroza et al. (1990) Protein Seguence Database
8) Shiroza et al. (1987) J. Bacteriol. 169, 4263-4270
9) Ueda et al. (1988) Gene 69, 101-109
10) Russel (1990) Arch. Oral. Biol. 35, 53-58
4 5 11) Honda et al. (1990) J. Gen. Microbiol. 136,
2099-2105
12) Giffard et al. (1991) J. Gen. Microbiol. 137,
2577-2593
13) Jacques (1992) EMBL Data Library
14) Simpson et al. (1995) J. Infect. Immun. 63,
609-621
15) Gargia et al. (1986) Gene 43, 265-272
5 0 16) Yother et al. (1992) J. Bacteriol. 174, 601-609
17) Romero et al. (1990) J. Bacteriol. 172, 5064-5070
18) Garcia et al. (1988) Proc. Natl. Acad Sci,
USA 85, 914-918
19) Garcia et al. (1990) Gene 86, 81-88
20) Diaz et al. (1992) J. Bacteriol. 174, 5516-5525
55 21) Dove et al. (1990) J. Infect. Immun. 58, 480-488
22) Wren et al. (1990) FEMS Microbiol. Lett. 70,
1-6
23) Barroso et a. (1990) Nucleic Acids Res. 18,
4004-4004
24) von Eichel-Streiber et al. (1992) Mol. Gen.
Genet. 233, 260-268
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
25) Sartinger et al. (1993) EMBL Data Library
26) von Eichel-Streiber et al. (1995) Mol. Microbiol. In Press
27) Hofmann et al. (1993) EMBL Data Library
28) Hofmann et al. (1995) Mol. Ger. Genet. In Press
5 29) Sanchez et al. (1994) EMBL Data Library
30) Sanchez et al. ( 1995) EMBL Data Library
New PBPs with interesting binding characteristics and specificities can be
identified and screened for in a of ways including spectroscopic (titration)
methods
10 such as: NMR spectroscopy (Zhu et al. (1995) Biochemistry 34:, Gehring et
al. (1991)
Biochemistry 30:5524-5531), UV difference spectroscopy (Beishaw et al. (1993)
Eur.
J. Biochem. 211:717-724), fluorescence (titration) spectroscopy (Miller et al.
(1983) J.
Biol. Chem. 258:13665-13672), UV or fluorescence stopped flow analysis (De
Boeck
et al. (1985) Eur. J. Biochem. 149:141-415), affinity methods such as affinity
15 electrophoresis (Mimura et al. (1992) J. Chronmatography 597:345-350) or
affinity
chromatography on immobilized mono or oligosaccharides, precipitation or
agglutination analysis including turbidimetric or nephelometric analysis
(Knibbs et al.
(1993) J. Biol. Chem. 14940-14947), competitive inhibition assays (with or
without
quantitative IC50 determination) and various physical or physico-chemical
methods
2 0 including differential scanning or isothermal titration calorimetry
(Sigurskjold et al.
(1992) J. Biol. Chem. 267:8371-8376; Sigurskjold et al. (1994) Eur. J. Biol.
225:133-
141 ) or comparative protein stability assays (melts) in the absence or
presence of
oligosaccharides using thermal CD or fluorescence spectroscopy.
Generally, the Ka for binding of the PBP to oligosaccharide is at least in the
2 5 range of weak antibody-antigen extractions, i.e., 10 3, preferably 10 4,
most
preferably 10 6. If the binding of the PBP to the oligosaccharide is
exothermic or
endothermic, then binding increases or decreases, respectively, at lower
temperatures,
providing a means for temperature modulation during polysaccharide structure
processing.
35
Table 3
Overview of enzymes with chitin-binding domains
Source (strain) Enzyme Accession No. Ref.3
Bacterial enzymes
Type I
Aeromonas sp. (NolOS-24) Chi D31818 1
Bacillus circulars (WL-12) ChiAl P20533/M57601/A38368 2
Bacillus circulars (WL-12) Chip P27050/D10594 3
Janthinobacterium lividum Chi69 U07025 4
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
21
Streptomyces griseus Protease C A53669 5
Type IIII
Aeromonas cavia (K1) Chi U09139 6
Alteromonas sp (0-7) Chi85 A40633/P32823/D13762 7
Autographa californica (C6) NPH-128a P41684/L22858 8
Serratia marcescens ChiA A25090/X03657/L01455/P07254 9
Tune III
Rhizopus oligosporus (1F08631) Chil P29026/A47022/D10157/527418 10
Rhizopus oligosporus (IF08631) Chi2 P29027B47022/D10158/S27419 10
Saccharomyces cerevisiae Chi S50371/LJ17243 11
Saccharomyces cerevisiae Chil P29028/M74069 12
(DBY939)
Saccharomyces cerevisiae Chi2 P29029/M7407B41035 12
(DBY918)
Plant enzymes
Hevein superfamily
2 Allium sativum Chi M94105 13
5
Amaranthus caudatus AMP-lb P27275/A40240 14,
15
Amaranthus caudatus AMP-2b S37381/A40240 14,
15
Arabidopsis thalianaChill P19171/M38240/B45511 16
(cv. Colombia)
3 Arabidopsis thalianaPHPc U01880 17
0
Brassica napus Chi U21848 18
Brassica napus Chi2 Q09023/M95835 19
Hevea brasiliensis Hevld P02877/M36986/A03770/A3828820,
21
Hordeum vulgare Chi33 L34211 22
35 Lycopersicon esculentumChi9 Q05538/Z15140/S37344 23
Nicotiana tabacum CBP20e S72424 24
Nicotiana tabacum Chi A21091 25
Nicotiana tabacum Chi A29074/M15173/S20981/51985526
(cv. Havana)
Nicotiana tabacum Chi JQ0993/50828 27
(FB7-I)
4 Nicotiana tabacum Chi A16119 28
0 (cv. Samsun)
Nicotiana tabacum Chi P08252/X16939/S08627 27
(cv. Havana)
Nicotiana tabacum Chi P24091/X51599lX64519//S1332226,27,29
(cv. BY4)
Nicotiana tabacum Chi P29059lX64518/S20982 26
(cv. Havana)
Oryza sativum (IR36)ChiA L37289 30
4 Oryza sativum Chill JC2253/542829/Z29962 31
5
Oryza sativum Chi S39979/540414/X56787 32
Oryza sativum (cv. Chi X56063 33
Japonicum)
Oryza sativum (cv. Chil P24626/X54367/S 14948 34
Japonicum)
Oryzasativum Chit P25765/S15997 35
5 Oryza sativum (cv. Chi3 D16223
0 Japonicum)
Oryza sativum ChiA JC2252/S42828 30
Oryza sativum Chil D16221 32
Oryza sativum (IR58)Chi U02286 36
Oryza sativum Chi X87109 37
5 Pisum sativum (cv. Chi P36907/X63899 38
5 Birte)
Pisum sativum (cv. Chi2 L37876 39
Alcan)
Populus trichocarpa Chi S 18750/S 18751/X59995/P2903240
Populus trichocarpa Chi U01660 41
(H11-11)
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
22
Phaseolus vulgaris Chi A24215/543926/Jq0965/P3636142
(cv. Saxa)
Phaseolus vulgaris Chi P06215/M13968/M19052/A2589843,44,45
(cv. Saxa)
Sambucus nigra PR-3f 246948 46
Secale cereale Chi JC2071 47
Solanum tuberosum ChiBl 002605 48
Solanum tuberosum ChiB2 002606 48
Solanum tuberosum ChiB3 002607/543317 48
Solanum tuberosum ChiB4 002608 48
Solanum tuberosum WIN-lg P09761/X13497/S04926 49
(cv. Maris Piper)
Solanum tuberosum WIN-2g P09762/X13497/504927 49
(cv. Maris Piper)
Triticum aestivum Chi S386701X76041 50
Triticum aestivum WGA-1~ P10968/M25536/509623/S0728951,52
Triticum aestivum WGA-2h P02876/M25537/509624 51,53
Triticum aestivum WGA-3 P10969/J02961/510045/A2840154
Ulmus americana (NPS3-487)Chi L22032 55
Urtica dioica AGL~ M87302 56
Vigna unguiculata Chil X88800 57
2 (cv. Red caloona)
0
aNHP : nuclear polyhedrosis virus endochitinase like sequence; Chi :
chitinase, banti-microbial peptide,
cpre-hevein like protein, dhevein, echitin-binding protein, fpathogenesis
related protein, gwound-
induced protein, hwheat germ agglutinin, lagglutinin (lectin).
3References:
1) Udea et al. (1994) J. Ferment. Bioeng. 78, 205-211
2) Watanabe et al. (1990) J. Biol. Chem. 265, 15659-16565
3 0 3) Watanabe et al. (1992) J. Bacteriol. 174, 408-414
4) Gleave et al. (1994) EMBL Data Library
5) Sidhu et al. (1994) J. Biol. Chem. 269, 20167-20171
6) Jones et al. (1986) EMBO J. 5, 467-473
7) Sitrit et al. (1994) EMBL Data Library
3 5 8) Genbank entry only
9) Tsujibo et al. (1993) J. Bacteriol. 175, 176-181
10) Yanai et al. (1992) J. Bacteriol. 174, 7398-7406
11 ) Pauley ( 1994) EMBL Data Library
12) Kuranda et al. (1991) J. Biol. Chem. 266, 19758-19767
4 0 13) van Damme et al. (1992) EMBL Data Library
14) Broekaert et al. (1992) Biochemistry 31, 4308-4314
15) de Bolle et al. (1993) PlantMol. Physiol. 22, 1187-1190
16) Samac et al. (1990) Plant Physiol. 93, 907-914
17) Potter et al. (1993) Mol. Plant Microbe Interact. 6, 680-685
4 5 18) Buchanan-Wollaston (1995) EMBL Data Library
19) Hamel et al. (1993) Plant Physiol. 101, 1403-1403
20) Broekaert et al. (1990) Proc. Natl. Acad Sci. USA 87, 7633-7637
21) Lee et al. (1991) J. Biol. Chem. 266, 15944-15948
22) Leah et al. (1994) Plant Physiol. 6, 579-589
5 0 23) Danhash et al. (1993) Plant Mol. Biol. 22 1017-1029
24) Ponstein et al. (1994) Plant Physiol. 104, 109-118
25) Meins et al. (1991) Patent EP0418695-A1
26) van Buuren et al. (1992) Mol. Gen. Genet. 232, 460-469
27) Shinshi et al. (1990) Plant Mol. Biol. 14, 357-368
55 28) Cornellisen et al. (1991) Patent EP0440304-A2
29) Fukuda et al. (1991) Plant Mol. Biol. 16, 1-10
30) Yun et al. (1994) EMBL Data Library
31) Kim et al. (1994) Biosci. Biotechnol. Biochem. 58, 1164-1166
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
23
32) Nishizawa et al. (1993) Mol. Ger. Genet. 241, 1-10
33) Nishizawa et al. (1991) Plant Sci 76, 211-218
34) Huang et al. (1991) Plant Mol. Biol. 16, 479-480
35) Zhu et al. (1991) Mol. Ger. Genet. 226, 289-296
36) Muthukrishhnan et al. (1993) EMBL Data Library
37) Xu ( 1995) EMBL Data Library
38) Vad et al. (1993) Plant Sci 92, 69-79
39) Chang et al. (1994) EMBL Data Library
40) Davis et al. (1991) Plant Mol. Biol. 17, 631-639
41) Clarke et al. (1994) Plant Mol. Biol 25, 799-815
42) Brogue et al. (1989) Plant Cell 1, 599-607
43) Broglie et al. (1986) Proc. Natl. acad. Sci. USA 83, 6820-6824
44) Lucas et al. (1985) FEBSLett. 193, 208-210
45) Hedrick et al. (1988) Plant Physiol. 86, 182-186
46) Roberts et al ( 1994) EMBL Data Libraryl
47) Vamagami et al. (1994) Biosci. Biotechnol. Biochem. 58, 322-329
48) Beerhues et al. (1994) Plant Mol. Biol. 24, 353-367
49) Stanford et al. (1989) Mol. Gen. Genet. 215, 200-208
50) Liao et al. (1993) EMBL Data Library
2 0 51 ) Smith et al. ( 1989) Plant Mol. Biol 13, 601-603
52) Wright et al. (1989) J. Mol. Evol. 28, 327-336
53) Wright et al. (1984) Biochemistry 23, 280-287
54) Raikhel et al. ( 1987) Proc. Natl. acad Sci. USA 84, 6745-6749
55) Hajela et al. (1993) EMBL Data Library
2 5 56) Lerner et al. (1992) J. Biol. Chem. 267, 11085-11091
57) Vo et al. ( 1995) EMBL Data Library
Table 4
Overview of enzymes containing starch-binding domains
Source (strain) Enzyme Accession No. Ref.4
A. awarori (var. AMYG P23176/D00427/JT0479 1,
kawachi) 2
A. niger (T21) AMYG S73370 3
A. niger-A. awamoriAMYG1/G2 P04064/A90986/A291661X00712/
X00548 4,5,6
K02465 7,8,9
A. oryzae AMYG (GLAA) P36914/JQ1346/D01035/575274/
4 DO 1108 10,
0 11
A. Shirousamii AMYG (GLA) P22832/JQ0607/D10460 12
Bacillus sp. (B1018)AMYa P17692/M33302/D90112/S0919613
Bacillus sp. (TS-23)a-AMY U22045 14
Bacillus sp. (1-1) CGT P31746/526399 15
4 Bacillus sp. (6.63)CGT P31747/X66106/S21532 16
5
Bacillus sp. (17-1)CGT P30921/M28053/A37208 17
Bacillus sp. (38-2)CGT P09121/M19880/D00129/S2419318,
19
Bacillus sp. (1011)CGT P05618/A26678/M17366 20
Bacillus sp. (DSM5850)CGT A18991 21
50 Bacillus sp. (KC CGT D13068 15,
201) 22
B. cereus (SPOII) [3-AMY A48961/P36924/S54911 23
B. circulars (8) CGT P30920/X68326/523674 24
B. circulars (251) CGT X78145 25
B. Licheniformis CGTA P14014/X15752/515920 26
55 B. macerans (IFO CGTM (CDG1) P04830/X5904/S31281 27
3490)
B. macerans (IAM CGT M12777 28
1243)
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
24
B. macerans CGT (CDG2)P31835/S26589 29
B. ohbensis CGT P27036/D90243 30
B. stearothermophilusAMYMb P19531/M36539/S28784 31
B. stearothermophilusCGT P31797/X59042/526588/X59043/
(N02)
X59404/S31284 32
C. rolfsii (AHU 9627)AMYG2 D49448 33
D. discoideum ORF S15693/X51947 34
H. grisea (var. thermoidea)GLAI M89475 35
H. resinae (ATCC20495)GAMP Q03045/X68143/X67708/531422/
S33908 36-38
K pneumoniae (M5A1) CGT P08704/M15264/A29023 39
N. crassa (74-OR23-IA)GLA-1 P14804/X67291/S13711/S13710/
S36364 40,
41
P. saccharophila (IAM1504)MTAc P22963/X16732/505667 42
15Pseudomonas sp. (KO-8940)AMF-ld D10769/JS0631/D01143 43
P. stutzeri (MO-19) AMYPc P13507/M24516/A32803 44
S. griseus (IMRU 3570)AMY P30270/X57568/514063 45
S. limosus (S.albidoflavus)AML P09794/ M18244B28391 46
S. violaceus (S. venezuela)AML P22998/M25263/JS0101 47
20(ATCC15068)
Th. curvata (CCM 3352)TAMe P29750/X59159/JH0638 48
Th. thermosulfurogenesAMYA P26827/X54654/X54982/
f
(DSM3 896/EM 1 ) S 17298/537706 49
Th. thermosulfurogenesAMYB P19584/M22471/A31389 50
2 (ATCC 33743)
5
aRaw-starch digesting amylase, nMaltogenic a-amylase, cMaltotetraose-forming
amylase
(1,4-a-maltotetrahydrolase), dMaltopentaose-forming amylase, ethermostable a-
amylase, (formerly
Clostridium thermosulfurogenes. AMYG, GAM and GLA: glucoamylase, AMY or AML:
3 0 alpha-amylase, CGT: (3-cyclodextrin glycosyltransferase or
cyclomaltodextrin glucanotransferase, ORF:
open reading frame. A.: Aspergillus, B.: Bacillus, C.: Corticium, D.:
Dictiostelium, H. grisea: Humicola
grisea, H. resinea: Hormoconis resinae (Amorphotheca resinae), K.: Klebsiella,
N.: Neurospora, S.:
Streptomyces, Th. curvata: Thermomonospora curvata, Th.: Thermoanaerobacter.
3 5 4References:
1) Hayashida et al. (1989) Agric. Biol. Chem. 53, 135-141
2) Hayashida et al. (1989) Agric. Biol. Chem. 53,923-929
3) Zhong et al. (1994) Wei Sheng Wu Hseuh Pao 34, 184-190
4 0 4) Boel et al. (1984) EMBO J. 3, 1097-1102
5) Boel et al. (1984) EMBO J. 3, 1581-1583
6) Svensson et al. (1986) Eur. J. Biochem. 154, 497-502
7) Svensson et al. (1983) CarlsbergRes. Commun.. 48, 529-544
8) Nunberg et al. (1984) Mol. Cell. Biol. 4, 2306-2315
4 5 9) Flwer et al. (1990) Curr. Genet. 18, 537-545
10) Hata et al. (1991) Agric. biol. Chem. 55, 941-949
11) Hata et al. (1991) Gene 108, 145-150
12) Shibuya et al. (1990) Agric. Biol. Chem. 54, 1905-1914
13) Itkor et al. (1990) Biochem. Biophys. res. Commun. 166, 630-636
5 0 14) Lin et al. (1995) EMBL Data Library
I S) Schimd et al. ( 1988) Proceedings of the fourth International
symposium on cyclodextrins. Huber, O. and Szejtli, J. Eds. pp71-76.
Kluwer, Academic Publishers.
16)Akhmetzjanov (1992) EMBL Data Library
5 5 17) Kaneko et al. (1989) J. Gen. Microbiol. 135, 3447-3457
18) Kaneko et al. (1988) J. Gen. Microbiol. 134, 97-105
19) Hamamoto et al. (1987) Agric. Biol. Chem. 51, 2019-2022
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
20) Kimura et al. (1987) J. Bacteriol. 169, 4399-4402
21) Patent W09114770-A1
22) Kitamoto et al. (1992) J. Ferment. Bioeng. 74, 345-351
23) Nanmori et al. (1993) Appl. Environ. Microbiol. 59, 623-627
5 24) Nitschke et al. (1990) Appl. Microbial. Biotechnol. 33, 542-546
25) Lawson et al. (1994) J. Mol. Biol. 236, 590-560
26) Hill et al. (1990) Nucleids Acids Res. 18, 199-199
27) Fujiwara et al. (1992) Appl. Environ. Microbiol. 58, 4016-4025
28) Takano et al. (1986) J. B$cteriol. 166, 1118-1122
10 29) Sugimoto et al. Patent N LTK2169902
30) Sin et al. (1991) Appl. Microbiol. Biotechnol. 35, 600-605
31) Didericksen et al. (1988) FEMS Microbiol. Lett. 56, 53-60
32) Fujiwara et al. (1992) Appl. Environ. Microbiol. 58, 4016-4025
33) Nagasaka et al. (1995) EMBL Data Library
15 34) Maniak et al. (1990) Nucleic Acids Res. 18, 3211-3217
35) Berka et al. (1992) EMBL Data Library
36) Joutsjoki et al. (1992) FEMSMicrobiol. Lett. 78, 237-244
37) Vainio et al. (1993) Curr. Genet. 24, 38-44
38) Fagerstrom et al. (1990) J. Gen. Microbiol. 136, 913-920
2 0 39) Binder et al. (1986) Gene 47, 269-277
40) Stone et al. (1989) Curr. Genet. 24, 205-211
41) Koh-Laur et al. (1989) Enrym. Microb. Technol. 11, 692-695
42) Zhoe et al. (1989) FEBSLett. 255, 37-41
43) Shida et al. (1991) Biosci. Biotechnol. Biochem. 56, 76-80
2 5 44)Fujita et al. (1989) J. Bacteriol. 171, 1333-1339
45) Vigal et al. (1991) Mol. Gen. Genet. 225, 278-288
46) Long et al. (1987) J. Bacteriol. 169, 5745-5754
47) Virolle et al. (1988) Gene 74, 321-334
48) Petricek et al. (1992) Gene 112, 77-83
3 0 49) Bahl et al. (1991) Appl. Environ. Microbiol. 57, 1554-1559
50) Kitamoto et al. (1988) J. Bacteriol. 170, 5848-5854
Table 5
Sources of polysaccharide binding domains
Binding Domain Proteins Where Binding
Domain is Found
Cellulose Binding ~i-glucanases (avicelases, CMCases,
Domains 1 cellodextrinases)
exoglucanses or cellobiohydrolases
cellulose binding proteins
4 5 xylanases
mixed xylanases/glucanases
esterases
chitinases
(3-1,3-glucanases
5 0 (3-1,3-((3-1,4)-glucanases
((3-)mannanases
(3-glucosidases/galactosidases
cellulose synthases (unconfumed)
5 5 Starch/Maltodextrin a-amylases2~3
Binding Domains (3-amylases4~5
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
26
pullulanases
glucoamylases6,7
cyclodextrin glucotransferases8-10
(cyclomaltodextrin glucanotransferases)
maltodextrin binding proteins 11
Dextran Binding Domains (Streptococcal) glycosyl transferasesl2
dextran sucrases (unconfirmed)
Clostridial toxins13,14
glucoamylases6
dextran binding proteins
(3-Glucan Binding Domains (3-1,3-glucanases15,16
(3-1,3-((3-1,4)-glucanases (ung~nfnmed)
~i-1,3-glucan binding protein
Chitin Binding Domains chitinases
chitobiases
chitin binding proteins
2 0 (see also cellulose binding domains)
Heivein
lGilkes et al., Adv. Microbiol Reviews, (1991) 303-315.
2 5 2S?gaard et al., J. Biol. Chem. ( 1993) 268:22480.
3Weselake et al., Cereal Chem. (1983) 60:98.
4Svensson et al., J. (1989) 264:309.
SJespersen et al., J. (1991) 280:51.
6Belshaw et al., Eur. J. Biochem. (1993) 211:717.
30 7Sigurskjold et al., Eur. J. Biochem. (1994) 225:133.
BVillette et al., Biotechnol. Appl. Biochem. (1992) 16:57.
9Fukada et al., Biosci. Biotechnol. Biochem. (1992) 56:556.
lOLawson et al., J. Mol. Biol. (1994) 236:590.
l4von Eichel-Streiber et al., Mol. Gen. Genet. (1992) 233:260.
35 lSKleb1 et al., J. Bacteriol. (1989) 171:6259.
l6Watanabe et al., J. Bacteriol. (1992) 174:186.
l7Duvic et al., J. Biol. Chem. (1990) :9327.
Numerous CBDs are known and are classified into at least 12 Families, any of
4 0 which can serve as a source of CBDs depending upon the intended use of the
CBD.
Family I contains only CBDs of fungal enzymes. The vast majority of CBDs in
the
remaining 11 Families are of bacterial origin. The best understood CBDs are
those
belonging to Families I, II, III, and IV, the CBDs of which are on average 36,
105,
150, and 150 amino acids in length, respectively. Some CBDs of Families I, II,
III, and
4 5 IV have been characterized as comprising a plurality of anti-parallel (3-
sheets folded
into jelly rolls CBDs of families I, II, and III bind to both amorphous and
crystalline
cellulose, whereas CBDs of family IV bind to amorphous cellulose, but not to
crystalline cellulose. Only CBDs of family IV bind to solublcellulose
derivatives and
cellooligosacharides. CBDs that bind to crystalline cellulose and chitin do so
with
5 0 similar affinities, having binding constants in the micromolar range.
Family I CBDs
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
27
bind reversibly to cellulose, whereas Family II and III CBDs appear to bind
irreversibly under non-denaturing conditions. Preferred CBDs include those
obtainable from strains belonging to the species of Cellulomonas firm,
Trichoderma
reesei and M. Bispora (N.R. Gilkes et al., (1988) J. Biol. Chem. 263: 10401-
10407;
N.R Gilkes et al., (1991), Microbiol. Rev. 55: 303-315); cellulase genes from
Cellulomonas frmi (Whittle et al. (1982) Gene 17: 139-145; Gilkes et al.
(1984) J.
Gen. Microbiol. 130: 1377-1384); an exoglucanase (Cex) and an endoglucanase
(CenA) from C. firm and sequences of their genes, cex and cenA (along et al.
(1986)
Gene 44: 315-324; O'Neill et al. (1986) Gene 44: 325-330); a 17 KD (peptide)
CBD
derived from Clostridium cellulovorans described by Shoseyov et al. (1992)
(Proc.
Natl. Acad. Sci. 89: 3483-3487). Recombinant forms of this CBD exhibit strong
affinity for cellulose and chitin (Goldstein et al. (1993) J. Bacteriol.
175:5762-5768).
The PBD protein also can be prepared by transforming into a host cell a DNA
construct comprising DNA encoding at least a functional portion of the
polysaccharide
binding region of a polysaccharidase or a polysaccharide binding protein. The
PBD
DNA sequence can be expressed in a host cell, either a eukaryotic or a
prokaryotic
cell. Expressed and isolated PBD's then can be conjugated to other PBDs and/or
one
or more functionating protein.
In any of these cases, the isolated polysaccharide binding domain generally is
2 0 sufficiently pure to exclude catalytic polysaccharidase activity unless
this is a desired
feature of the intended fusion protein. Preferably, the catalytic activity of
such
preparation is less than that of crude extracts from cells expressing the
polysaccharidase. More preferably, the catalytic activity will reflect a
stoichiometry of
less than 1 functional catalytic domain per 1000 functional binding domains.
To test
2 5 the activity of a desired expression product, the binding activity of a
PBD can be
determined, for example, by binding to microcrystalline cellulose such as
Avicel
(microcyrstalline cellulose) and showing that the putative binding domain is
removed
from solution. A polypeptide having the desired activity is readily isolated
in highly
purified form from the cellulose. Binding to Avicel has been used for
purification of
30 both native (Gilkes et al., J. Biol. Chem. (1984) 259:10455-10459) and
recombinant
cellulases (Owolabi et al., Appl. Environ. Microbiol. (1988) 54:518-523).
The second basic building block of the multimeric PBD fusion protein is a
protein which can be a second PBD which can be the same as, or different from,
the
PBD which is the first building block. Thus the multimeric fusion protein can
be a
3 5 dimeric PBD fusion protein encoded by a pair of nucleotide sequences, each
encoding
a PBD, ligated in frame as is well known in the art (see, for example, U.S.
PAT. NO.
5, 856,201 and U.S. PAT. NO. 5,837,814 both to Shoseyov, et al., both of which
are
incorporated by reference herein in their entirety). Shown in Fig. 5A is an
example of
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
28
a PBD fusion protein in which both the first and the second proteins are CBDs,
thus
forming a dimeric CBD, wherein the CBDs may be the same (homodimeric-CBDs) or
different (heterodimeric-CBDs)). Shown in Fig. 5B is the use of the cellulose
cross-
linking protein of Fig. 5A, wherein one cellulose binding domain is bound to a
first
polymeric structural unit, and a second cellulose binding domain is bound to a
second
polymeric structural unit. Fig. 6 schematically represents a generic CBD
coupler unit
including a pair of CBDs linked via a linker unit.
Alternatively, the second building block can be a PBD that optionally includes
one or more functionating group. By a functionating group is intended a
functional
group that can modify one or more property of a polysaccharide containing
material.
Generally the functionating group is a protein or a peptide such as a silicon
binding
peptide, polymer binding peptide or a metal binding peptide (Ljungquist et al,
(1989)
Eur. J. Biochem. 86: 563-569; Spanner et al, ((1995) Bone 17: 161-165; Slice
et al
(1990) J. Biol. Chem. 265: 256-263; Pessi et al (1993) Nature 362: 367-369).
Other
examples of functionating polypeptides include a starch binding domain which
provides a means for crosslinking of polysaccharide fibers and starch
molecules; the
starch can be an endogenous component of the fibers, or can be applied as a
size.
Starch binding domains can be obtained, for example, from Aspergillus
glucoamylase
(Chen et al. (1991), Gene 99:121-126). Likewise, polysaccharide and gluten
2 0 molecules can be crosslinked by using as a second polypeptide a matrix
protein such
as high molecular weight glutinin (HMWG). For particular applications the
functionating group also can include chemical groups such as one or more thiol
group,
chromophore, dye, a reactive group such as an aldehyde, a maleimide, a
hydrazide, an
epoxy, a carbodiimide, or a photo reactive group such as phenyl azide bound to
a
2 5 PBD. Methods for conjugating various chemical entities to a PBD are
described in
U.S. PAT. NO. 5,962,289, which is incorporated herein by reference herein in
its
entirety.
The first building block of the PBD fusion protein can optionally be linked to
the second building block via a linker unit. The linker unit of a PBD coupler
unit can
3 0 include various natural or synthetic molecules, including biological
polymers such as
a protein, a polypeptide, or a polysaccharide, and synthetic polymers such as
acrylic
polymers and the matrix protein High Molecular Weight Glutinin. Examples of
peptide or protein components of a linker unit include JUN protein and FOS
protein
(see, for example, Gentz et al., (1989) Science 243: 1695-1699); starch
binding
35 domain (SBD) (see, for example, Chen et al. (1991) Gene 99: 121-126), and S-
peptide
or S-protein (see, for example, Kim et al. (1993) Protein Science 2: 348-356).
The
first and the second polypeptides (or multiple first and/or second
polypeptides) in the
fusion protein can be joined directly via a peptide bond, or a larger linker
unit,
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
29
depending in part upon the intended use of the fusion protein. Fig. 8 shows
schematically a CBD coupler unit (designated CU in the figure) having a first
CBD, a
second CBD, and a linker unit (LU) linking the first and second CBDs. Although
the
first and second CBDs are depicted in Fig. 8 as being terminal, and as being
located at
opposite poles of the linker unit, other numbers and arrangements of CBDs and
linker
units) are contemplated and are within the scope of the invention. The linker
unit can
be attached to each PBD of a PBD coupler unit by one or a combination of
various
means, including covalent bonding, ionic bonding, hydrophobic bonding,
hydrogen
bonding, protein translation, and protein expression.
A polysaccharide component of a linker unit can be a polysaccharide which is
not bound, or bound with low affinity, by a PBD. An example of such a
polysaccharide is starch. In addition, a linker unit of a PBD coupler unit can
be one or
more polysaccharide binding domains other than a PBD. As an example, Fig. 7A
shows a CBD coupler unit having a pair of terminal CBDs linked by a coupler
unit
which includes a first starch binding domain coupled to a first CBD, a second
starch
binding domain coupled to a second CBD, and a starch moiety coupled to both
the
first starch binding domain and the second starch binding domain.
A linker unit of a PBD coupler unit also can include one or more PBDs. As an
example, Fig. 7B shows a CBD coupler unit having a pair of terminal CBDs
linked by
2 0 a coupler unit which includes a plurality of CBDs, wherein each CBD of the
linker
unit is coupled to an adjacent CBD via a JUN/FOS bridge (see, for example,
Gentz et
al., (1989) Science 243: 1695-1699). Fig. 7C shows a CBD coupler unit having a
pair
of terminal CBDs linked by a coupler unit which includes a peptide or protein
moiety
which does not bind, or binds with only low affinity, to cellulose or related
polymers.
2 5 A peptide or protein component of a coupler unit, for example, a linker
protein, may
vary in size from a few hundred Daltons to more than 1 MegaDaltons. As an
example,
the linker unit represented in Fig. 7C can be a short peptide of a few amino
acids, or a
relatively large linker protein, such as HMWG.
The multimeric PBD fusion protein can be made chemically or recombinantly.
3 0 For example, the polysaccharide binding region or multiples thereof can be
produced
on its own, purified and then chemically linked to a second protein with or
without a
functionating group using techniques known to those skilled in the art.
Methods of
protein conjugation include in vitro conjugation chemical reactions to modify
the
polysaccharide binding domain which can be carried out while the domain is
either
3 5 bound to a polysaccharide matrix or free from the polysaccharide matrix.
Examples
include the use of gluteraldehyde conjugation as described by Reichlin in
Methods of
Enzymology (1980) 70:159-165. When the polysaccharide binding domain is bound
to
the matrix, it offers the advantage of protecting the site that actually binds
to the
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
matrix while leaving other residues to react with the second moiety, either a
second
PBD or a functionating protein. If bonding of the chemical moiety to the
polysaccharide binding domain results in a diminished capacity to bind the
polysaccharide substrate, a reaction procedure requiring the presence of the
5 polysaccharide matrix is preferred to retain the binding characteristics of
the domain.
Alternatively the multimeric PBD fusion protein can be made recombinantly.
To make a PBD fusion protein recombinantly, nucleotide sequences encoding the
components of the PBD fusion protein are used to construct recombinant
expression
vectors capable of expressing PBD fusion proteins. In general, a nucleic acid
construct
10 is capable of expressing a protein if it contains nucleotide sequences
containing
transcriptional and translational regulatory information which are operably
linked to
nucleotide coding sequences for the protein. "Operably linked" refers to a
linkage in
which the regulatory DNA sequences and the DNA sequence to be expressed are
connected in such a way as to permit transcription and translation. The
polysaccharide
15 binding domain encoding fragment and the DNA encoding the second
polysaccharide
binding domain or functionating polypeptide are ligated so that the nucleic
acid
encoding the PBD is joined to the nucleic acid encoding the second protein
such that
the combined open reading frame of the PBD and the second protein is intact,
allowing translation of the entire PBD fusion protein to occur. If the PBD
fusion
2 0 protein has a protein coupler unit, the nucleotide sequences are operably
inserted into
the expression construct, between the PBD encoding sequence and the sequence
encoding the second protein. The resulting ligated DNA can then be manipulated
in a
variety of ways to provide for expression.
Vectors for both nucleic acid amplification and for nucleic acid expression
are
2 5 well known in the art. Selection of an appropriate vector depends on
various
parameters including, the intended function (e.g., amplification or
expression), the
size of the DNA insert, and the particular host cell to be transformed with
the vector.
Various expression vector/host systems may be utilized by the skilled artisan
for the
recombinant expression of PBD proteins and PBD fusion proteins. Such systems
3 0 include microorganisms such as bacteria transformed with recombinant
bacteriophage
DNA, plasmid DNA or cosmid DNA expression vectors containing the desired PBD
coding sequence; yeast transformed with recombinant yeast expression vectors
containing the desired PBD coding sequence; insect cell systems infected with
recombinant virus expression vectors (for example, baculovirus) containing the
3 5 desired PBD coding sequence; plant cell systems infected with recombinant
virus
expression vectors (for example, cauliflower mosaic virus (CaMV); tobacco
mosaic
virus, (TMV)) or transformed with recombinant plasmid expression vectors (for
example, the Ti plasmid) containing the desired PBD coding sequence; or animal
cell
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
31
systems infected with recombinant virus expression vectors (for example,
adenovirus
or vaccinia virus) including cell lines engineered to contain multiple copies
of the
PBD nucleic acid either stably amplified (for example, CHO/dhfr, CHO/glutamine
synthetase) or unstably amplified in double-minute chromosomes (for example,
marine cell lines).
Construction of suitable vectors containing one or more of the above listed
components and including the desired coding and control sequences employs
standard
ligation techniques. Isolated plasmids or nucleic acid fragments are cleaved,
tailored,
and re-ligated in the form desired to generate the plasmids required (see,
Current
Protocols in Molecular Biology, Volumes I-III Ausubel, R. M., ed. (1994)). In
order to
confirm the correct sequences in DNA constructs (for example, plasmids),
ligation
mixtures are used to transform E. coli strains Xl-l and DH52 and successful
transformants are selected by antibiotic (for example ampicillin) resistance,
as
appropriate. Plasmids from the transformants are prepared, and analyzed by
restriction
and/or sequenced (see, for example, Messing et al., Nucleic Acids Res. 9: 309
(1981);
Maxam et al., Methods in Enzymology 65: 499 (1980)). In general, expression
vectors
are capable of replicating efficiently in a host cell, such that the host cell
accumulates
many copies of the expression vector and, in turn, synthesizes high levels of
the
protein of interest. The expression cassette can be included within a
replication system
2 0 for episomal maintenance in an appropriate cellular host or can be
provided without a
replication system, where it can become integrated into the host genome.
Once the DNA encoding a PBD fusion protein has been obtained, it is placed
in a vector capable of replication in a host cell, or is propagated in vitro
by means of
techniques such as PCR or long PCR. Replicating vectors can include plasmids,
2 5 phage, viruses, cosmids, artificial chromosomes and the like. Desirable
vectors
include those useful for mutagenesis of the gene of interest or for expression
of the
gene of interest in host cells. The technique of long PCR has made in vitro
propagation of large constructs possible, so that modifications to the gene of
interest,
such as mutagenesis or addition of expression signals, and propagation of the
resulting
3 0 constructs can occur entirely in vitro without the use of a replicating
vector or a host
cell.
For expression of a PBD fusion protein, functional transcriptional and
translational initiation and termination regions are operably linked to the
DNA
encoding the PBD fusion protein. Expression of the fusion protein coding
region can
3 5 take place in vitro or in a host cell. Transcriptional and translational
initiation and
termination regions are derived from a variety of nonexclusive sources,
including the
DNA to be expressed, genes known or suspected to be capable of expression in
the
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
32
desired system, expression vectors, chemical synthesis, or from an endogenous
locus
in a host cell.
In vitro expression can be accomplished, for example, by placing the coding
region for the PBD fusion protein in an expression vector designed for in
vitro use and
adding rabbit reticulocyte lysate and cofactors; labeled amino acids can be
incorporated if desired. Such in vitro expression vectors may provide some or
all of
the expression signals necessary in the system used. These methods are well
known in
the art and the components of the system are commercially available. The
reaction
mixture can then be assayed directly for the fusion protein, for example by
determining its binding activity, or the synthesized fusion protein can be
purified and
then assayed.
Expression in a host cell can be accomplished in a transient or stable
fashion.
Transient expression can occur from introduced constructs which contain
expression
signals functional in the host cell, but which constructs do not replicate and
rarely
integrate in the host cell, or where the host cell is not proliferating.
Transient
expression also can be accomplished by inducing the activity of a regulatable
promoter operably linked to the gene of interest, although such inducible
systems
frequently exhibit a low basal level of expression. Stable expression can be
achieved
by introduction of a construct that can integrate into the host genome or that
2 0 autonomously replicates in the host cell. Stable expression of the gene of
interest can
be selected for through the use of a selectable marker located on or
transfected with
the expression construct, followed by selection for cells expressing the
marker. When
stable expression results from integration, integration of constructs can
occur
randomly within the host genome or can be targeted through the use of
constructs
2 5 containing regions of homology with the host genome sufficient to target
recombination with the host locus. Where constructs are targeted to an
endogenous
locus, all or some of the transcriptional and translational regulatory regions
can be
provided by the endogenous locus.
When increased expression of the PBD fusion protein in the source organism
3 0 is desired, several methods can be employed. Additional genes encoding the
PBD
fusion protein can be introduced into the host organism. Expression also can
be
increased, for example, by using a stronger promoter by removing destabilizing
sequences from either the mRNA or the encoded protein by deleting that
information
from the host genome, or by adding stabilizing sequences to the mRNA (U.S.
Pat. No.
35 4,910,141).
Expression and cloning vectors usually contain a promoter that is recognized
by the host organism and is operably linked to the nucleic acid encoding the
polypeptide or protein of interest. Promoters are untranslated sequences which
are
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
33
located upstream (5') to the start codon of a structural gene (generally
within about
100 to 1000 by of the start codon) and control the transcription and
translation of a
particular nucleic acid sequence, such as that encoding a PBD fusion protein,
to which
they are operably linked.
Promoters typically fall into two classes: inducible and constitutive.
Inducible
promoters are promoters that initiate increased levels of transcription from
nucleic
acid under their control in response to some change in culture conditions, for
example,
the presence or absence of a nutrient or a change in temperature. A large
number of
promoters recognized by a variety of potential host cells are well known in
the art. The
promoter is operably linked to the nucleic acid encoding the fusion protein by
removing the promoter from a source nucleic acid by restriction enzyme
digestion and
inserting the isolated promoter sequence into a vector together with the
coding
sequence for the fusion protein. The promoter can be synthetic, semisynthetic,
a native
(to the host cell) promoter sequence or a heterologous (to the host cell)
promoter can
be used to direct amplification and/or expression of the fusion protein.
Promoters
suitable for use with prokaryotic hosts are well known in the art (see, for
example,
Chang et al. (1978) Nature 275:615; Goeddel et al.(1979) Nature 281:544;
Goeddel
(1980) Nucleic Acids Res. 8:4057; EPO Appln. Publ. No. 36,776; and H. de Boer
et
al. (1983) Proc. Natl. Acad. Sci. 80: 21-25). The nucleotide, sequences of
such
2 0 promoters are generally known, thereby enabling the skilled artisan to
operably ligate
them to a fusion protein-encoding nucleotide sequence (see Siebenlist et al.,
(1980)
Cell 20: 269), using linkers or adapters to supply any required restriction
sites.
Promoters for use in bacterial systems also contain a Shine-Dalgarno (S.D.)
sequence operably linked to the PBD-encoding nucleic acid. Illustrative
transcriptional
2 5 regulatory regions or promoters include, for bacteria, the lac promoter
lambda left and
right promoters, trp and lac promoters, tac promoter, and the like. The
transcriptional
regulatory region may additionally include regulatory sequences which allow
the time
of expression of the fused gene to be modulated, for example the presence or
absence
of nutrients or expression products in the growth medium, temperature, etc.
For
3 0 example, expression of the fusion gene can be regulated by temperature
using a
regulatory sequence comprising the bacteriophage lambda PL promoter, the
bacteriophage lambda OL operator and a temperature sensitive repressor.
Regulation
of the promoter is achieved through interaction between the repressor and the
operator. Expression vectors used in prokaryotic host cells also contain
sequences
3 5 necessary for the termination of transcription and for stabilizing the
mRNA.
Expression from certain promoters can be elevated in the presence of certain
inducers
(for example, zinc and cadmium ions for metallothionein promoters). In this
manner,
expression of the PBD fusion protein can be controlled. The ability to control
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
34
expression can be important, for example, if the PBD fusion protein is lethal
to a host
cell.
Where the host cell is a yeast, transcriptional and translational regions
functional in yeast cells are provided, particularly from the host species.
The
transcriptional initiation regulatory regions can be obtained, for example
from genes
in the glycolytic pathway, such as alcohol dehydrogenase, glyceraldehyde-3-
phosphate
dehydrogenase (GPD), phosphoglucoisomerase, phosphoglycerate kinase, etc. or
regulatable genes such as acid phosphatase, lactase, metallothionein,
glucoamylase,
etc. Any one of a number of regulatory sequences can be used in a particular
situation,
depending upon whether constitutive or induced transcription is desired, the
particular
efficiency of the promoter in conjunction with the open-reading frame of
interest, the
ability to join a strong promoter with a control region from a different
promoter which
allows for inducible transcription, ease of construction, and the like. Of
particular
interest are promoters which are activated in the presence of galactose.
Galactose-
inducible promoters (GALL, GAL7, and GAL10) have been extensively utilized for
high level and regulated expression of protein in yeast (Lue et al., Mol.
Cell. Biol. Vol.
7, p. 3446, 1987; Johnston, Microbiol. Rev. Vol. 51, p. 458, 1987).
Transcription from
the GAL promoters is activated by the GAL4 protein, which binds to the
promoter
region and activates transcription when galactose is present. In the absence
of
2 0 galactose, the antagonist GAL80 binds to GAL4 and prevents GAL4 from
activating
transcription. Addition of galactose prevents GAL80 from inhibiting activation
by
GAL4.
Nucleotide sequences surrounding the translational initiation codon ATG have
been found to affect expression in yeast cells. If the desired polypeptide is
poorly
2 5 expressed in yeast, the nucleotide sequences of exogenous genes can be
modified to
include an efficient yeast translation initiation sequence to obtain optimal
gene
expression. For expression in Saccharomyces, this can be done by site-directed
mutagenesis of an inefficiently expressed gene by fusing it in-frame to an
endogenous
Saccharomyces gene, preferably a highly expressed gene, such as the lactase
gene.
3 0 The termination region can be derived from the 3' region of the gene from
which the
initiation region was obtained or from a different gene. A large number of
termination
regions are known to and have been found to be satisfactory in a variety of
hosts from
the same and different genera and species. The termination region usually is
selected
more as a matter of convenience rather than because of any particular
property.
3 5 Preferably, the termination region is derived from a yeast gene;
particularly
Saccharomyces, Schizosaccharomyces, Candida or Kluyveromyces. The 3' regions
of
two mammalian genes, x interferon and a 2 interferon, are also known to
function in
yeast.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
In some instances, it can be desirable to provide for a signal sequence
(secretory leader) upstream from and in reading frame with the structural
gene, which
provides for secretion of the fused gene. Illustrative secretory leaders
include the
secretory leaders of penicillinase, immunoglobulins, T-cell receptors, outer
membrane
5 proteins, and the like. By fusion in proper reading frame the chimeric
polypeptide can
be secreted into the medium.
Constructs comprising the coding sequences for the fusion protein can be
introduced into a host cell by standard techniques. These techniques include
transformation, protoplast fusion, lipofection, transfection, transduction,
conjugation,
10 infection, biolistic impact, electroporation, microinjection, scraping, or
any other
method which introduces the gof interest into the host cell. Methods of
transformation
which are used include lithium acetate transformation (Methods in Enzymology,
Vol.
194, p. 186-187, 1991). Various methods for genetic transformation of
prokaryotic
and eukaryotic organisms or cells are well known in the art (see, for example,
Cohen
15 et al. (1972) Proc. Natl. Acad. Sci. (USA) 69: 2110; and Current Protocols
in
Molecular Biology, supra). Host cells may be transfected, or more preferably
transformed, with the above-described expression or cloning vectors of the
invention,
and the transformed cells may be cultured in conventional nutrient media which
may
be modified as appropriate for inducing promoters, selecting transformants, or
2 0 amplifying the genes) encoding the desired PBD or PBD fusion protein. By
"transformation" is meant the introduction of a nucleic acid into an organism
such that
the nucleic acid is replicable, either as an extra-chromosomal element or by
integration into the genome of the host organism.
The subject host will have at least one copy of the expression construct and
2 5 may have two or more, depending upon whether the gene is integrated into
the
genome, amplified, or is present on an extrachromosomal element having
multiple
copy numbers. Where the subject host is a yeast, four principal types of yeast
plasmid
vectors can be used: Yeast Integrating plasmids (YIps), Yeast Replicating
plasmids
(YRps), Yeast Centromere plasmids (YCps), and Yeast Episomal plasmids (YEps).
3 0 YIps lack a yeast replication origin and must be propagated as integrated
elements in
the yeast genome. YRps have a chromosomally derived autonomously replicating
sequence and are propagated as medium copy number (20 to 40), autonomously
replicating, unstably segregating plasmids. YCps have both a replication
origin and a
centromere sequence and propagate as low copy number (10-20), autonomously
3 5 replicating, stably segregating plasmids. YEps have an origin of
replication from the
yeast 2 ~, plasmid and are propagated as high copy number, autonomously
replicating,
irregularly segregating plasmids. The presence of the plasmids in yeast can be
ensured
by maintaining selection for a marker on the plasmid. Of particular interest
are the
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
36
yeast vectors pYES2 (a YEp plasmid available from Invitrogen, confers uracil
prototrophy and a GAL1 galactose-inducible promoter for expression), pRS425-
pGl
(a YEp plasmid obtained from Dr. T. H. Chang, Ass. Professor of Molecular
Genetics,
Ohio State University, containing a constitutive GPD promoter and conferring
leucine
prototrophy), and pYX424 (a YEp plasmid having a constitutive TP 1 promoter
and
conferring leucine prototrophy; Alber and Kawasaki (1982). J. Mol. & Appl.
Genetics
1: 419).
The transformed host cell can be identified by selection for a marker
contained
on the introduced construct. Alternatively, a separate marker construct may be
introduced with the desired construct, as many transformation techniques
introduce
many DNA molecules into host cells. Typically, transformed hosts are selected
for
their ability to grow on selective media. Selective media may incorporate an
antibiotic
or lack a factor necessary for growth of the untransformed host, such as a
nutrient or
growth factor. An introduced marker gene therefor may confer antibiotic
resistance, or
encode an essential growth factor or enzyme, and permit growth on selective
media
when expressed in the transformed host. Selection of a transformed host also
can
occur when the expressed marker protein can be detected, either directly or
indirectly.
The marker protein may be expressed alone or as a fusion to another protein.
The
marker protein can be detected by its enzymatic activity; for example ~3
galactosidase
2 0 can convert the substrate X-gal to a colored product, and luciferase can
convert
luciferin to a light-emitting product. The marker protein can be detected by
its light-
producing or modifying characteristics; for example, the green fluorescent
protein
(GFP) of Aequorea victoria fluoresces when illuminated with blue light.
Antibodies
can be used to detect the marker protein or a molecular tag on, for example, a
protein
2 5 of interest. Cells expressing the marker protein or tag can be selected,
for example,
visually, or by techniques such as FACS or panning using antibodies. For
selection of
yeast transformants, any marker that functions in yeast may be used.
Desirably,
resistance to kanamycin and the amino glycoside 6418 are of interest, as well
as
ability to grow on media lacking uracil, leucine, lysine or tryptophan.
3 0 Once the fused gene has been introduced into an appropriate host, the host
can
be grown to express the fused gene in conventional nutrient media (modified as
appropriate) for inducing promoters, selecting transformants or amplifying
genes.
Prokaryotic cells used to produce polypeptide or proteins of the instant
invention may
be cultured in suitable media as described generally in Sambrook et al. (1989)
35 Bacterial Media in Molecular Cloning (Nolan, C. ed.), Cold Spring Harbor
Laboratory Press, NY, pp. A.1-4, which is incorporated herein by reference.
Where
the product is secreted, the nutrient medium can be collected and the product
isolated
by binding to a polysaccharide matrix. Where the product is retained in the
host cell,
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
37
the cells are harvested, lysed and the product isolated and purified by
binding to a
polysaccharide substrate. To produce an active protein it can be necessary to
allow the
protein to refold. A host cell strain is chosen that modulates expression of
the inserted
sequences, or modifies and processes the gene product in the specific fashion
desired.
The term "host cell" may be defined as those cells capable of expressing a PBD
protein or PBD fusion protein of interest. Host cells can include prokaryotic
cells
(bacterial) and eukaryotic cells (mammalian, yeast, insect, plant, etc.).
Modifications
(for example, phosphorylation) and processing (for example, cleavage) of
protein
products may be important for the function of the protein. Different host
cells often
have characteristic or specific mechanisms for the post-translational
processing of an
expressed protein. Appropriate cell lines or host systems may be chosen to
ensure the
correct modification and processing of the PBD protein or PBD fusion protein
expressed. As an example, the recombinant products can be glycosylated or non-
glycosylated, having the wild-type or other glycosylation. The amount of
glycosylation
depends in part upon the sequence of the particular peptide, as well as the
organism in
which it is produced. Thus expression of the product in E.coli cells results
in an
unglycosylated product, and expression of the product in insect cells
generally results
in less glycosylation than expression of the product in mammalian cells.
Expression in
yeast can result in hyperglycosylation. Preferably, the host cell should
secrete minimal
2 0 amounts of proteolytic enzymes. In the event that expression is to be
performed in a
eukaryotic host (for example, plants or mammals), it is preferred that none of
the
constructs contain potential glycosylation sites.
Production of PBD fusion proteins can be performed in either prokaryotic or
eukaryotic host cells. Prokaryotic cells of interest include Eschericia,
Bacillus,
2 5 Lactobacillus, cyanobacteria and the like. A prokaryotic cell of
particular interest for
cloning and expression of PBD fusion proteins is E. coli strain BL2(DE3)PLYS.
Eukaryotic cells include mammalian cells such as those of lactating animals,
avian
cells such as of chickens, and other cells amenable to genetic manipulation
including
insect, fungal, plant and algae cells. The cells may be cultured or formed as
part or all
30 of a host organism including an animal. Viruses and bacteriophage also may
be used
with the cells in the production of PBD fusion proteins, particularly for gene
transfer,
cellular targeting and selection. Examples of host animals include mice, rats,
rabbits,
chickens, quail, turkeys, bovines, sheep, pigs, goats, yaks, etc., which are
amenable to
genetic manipulation and cloning for rapid expansion of the transgene
expressing
3 5 population. For animals, the PBD fusion protein coding sequence can be
adapted for
expression in target organelles, tissues and body fluids, such as the breast
milk of the
host animal, through modification of the gene regulatory regions.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
38
Examples of host microorganisms include Saccharomyces cerevisiae,
Saccharomyces
carlsbergensis, or other yeast such as Candida, Kluyveromyces or other fungi,
for
example, filamentous fungi such as Aspergillus, Neurospora, Penicillium, etc.
Desirable characteristics of a host microorganism are, for example, that it is
genetically well characterized, and can be used for high level expression of
the
product using ultra-high density fermentation.
For producing PBD fusion proteins in avian species and cells, such as
chickens, turkeys, quail and ducks, gene transfer can be performed by
introducing a
nucleic acid sequence encoding a PBD fusion protein into the cells following
procedures known in the art. If a transgenic animal is desired, pluripotent
stem cells of
embryos can be provided with a vector carrying a PBD fusion protein encoding
transgene and developed into an adult animal (U.S. Pat. No. 5,162,215; Ono et
al.
(1996) Comparative Biochemistry and Physiology A 113(3):287-292; WO 9612793;
WO 9606160). In most cases, the transgene is modified to express high levels
of the
PBD fusion protein. The transgene can be modified, for example, by providing
transcriptional and/or translational regulatory regions that function in avian
cells, such
as promoters which direct expression in particular tissues and egg parts such
as yolk.
The gene regulatory regions can be obtained from a variety of sources,
including
chicken anemia or avian leukosis viruses or avian genes such as a chicken
ovalbumin
2 0 gene.
Production of PBD fusion proteins in insect cells can be conducted using
baculovirus expression vectors harboring a PBD fusion protein transgene.
Baculovirus
expression vectors are available from several commercial sources such as
Clonetech.
As with the other expression systems described above, the timing, extent of
2 5 expression and activity of the PBD fusion protein transgene can be
regulated by fitting
the polypeptide coding sequence with the appropriate transcriptional and
translational
regulatory regions selected for a particular use. Of particular interest are
promoter
regions which can be induced under preselected growth conditions. For example,
introduction of temperature sensitive and/or metabolite responsive mutations
into the
3 0 transgene coding sequences, its regulatory regions, and/or the genome of
cells into
which the transgene is introduced can be used for this purpose.
The transformed host cell is grown under appropriate conditions adapted for a
desired end result. For host cells grown in culture, the conditions are
typically
optimized to produce the greatest or most economical yield of PBD fusion
proteins.
3 5 Media conditions which may be optimized include: carbon source, nitrogen
source,
addition of substrate, final concentration of added substrate, form of
substrate added,
aerobic or anaerobic growth, growth temperature, inducing agent, induction
temperature, growth phase at induction, growth phase at harvest, pH, density,
and
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
39
maintenance of selection. Microorganisms such as yeast, for example, are
preferably
grown using selected media of interest, which include yeast peptone broth
(YPD) and
minimal media (contains amino acids, yeast nitrogen base, and ammonium
sulfate,
and lacks a component for selection, for example uracil). Desirably,
substrates to be
added are first dissolved in ethanol. Where necessary, expression of the
polypeptide of
interest may be induced, for example by including or adding galactose to
induce
expression from a GAL promoter.
Expression in cells of a host animal can likewise be accomplished in a
transient or stable manner. Transient expression can be accomplished via known
methods, for example infection or lipofection, and can be repeated in order to
maintain desired expression levels of the introduced construct (see Ebert, PCT
publication WO 94/05782). Stable expression can be accomplished via
integration of
a construct into the host genome, resulting in a transgenic animal. The
construct can
be introduced, for example, by microinjection of the construct into the
pronuclei of a
fertilized egg, or by transfection, retroviral infection or other techniques
whereby the
construct is introduced into a cell line which may form or be incorporated
into an
adult animal (U.S. Pat. No. 4,873,191; U.S. Pat. No. 5,530,177; U.S. Pat. No.
5,565,362; U.S. Pat. No. 5,366,894; Wilmut et al. (1997) Nature 385:810). The
recombinant eggs or embryos are transferred to a surrogate mother (U.S. Pat.
No.
4,873,191; U.S. Pat. No. 5,530,177; U.S. Pat. No. 5,565,362; U.S. Pat. No.
5,366,894;
Wilmut et al. (supra)).
After birth, transgenic animals are identified, for example, by the presence
of
an introduced marker gene, such as for coat color, or by PCR or Southern
blotting
from a blood, milk or tissue sample to detect the introduced construct, or by
an
2 5 immunological or enzymological assay to detect the expressed protein or
the products
produced therefrom (U.S. Pat. No. 4,873,191; U.S. Pat. No. 5,530,177; U.S.
Pat. No.
5,565,362; U.S. Pat. No. 5,366,894; Wilmut et al. (supra)). The resulting
transgenic
animals may be entirely transgenic or may be mosaics, having the transgenes in
only a
subset of their cells. The advent of mammalian cloning, accomplished by fusing
a
3 0 nucleated cell with an enucleated egg, followed by transfer into a
surrogate mother,
presents the possibility of rapid, large-scale production upon obtaining a
"founder"
animal or cell comprising the introduced construct; prior to this, it was
necessary for
the transgene to be present in the germ line of the animal for propagation
(Wilmut et
al. (supra)).
3 5 Expression in a host animal presents certain efficiencies, particularly
where the
host is a domesticated animal. For production of PBD fusion proteins in a
fluid readily
obtainable from the host animal, such as milk, the transgene can be expressed
in
mammary cells from a female host. The transgene can be adapted for expression
so
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
that it is retained in the mammary cells, or secreted into milk, to form the
PBD fusion
proteins localized to the milk (PCT publication WO 95/24488). Expression can
be
targeted for expression in mammary tissue using specific regulatory sequences,
such
as those of bovine a-lactalbumin, a.-casein, (3-casein, x-casein, x-casein, ~3-
5 lactoglobulin, or whey acidic protein, and may optionally include one or
more introns
and/or secretory signal sequences (U.5. Pat. No. 5,530,177; Rosen, U.S. Pat.
No.
5,565,362; Clark et al., U.S. Pat. No. 5,366,894; Garner et al., PCT
publication WO
95/23868). If purification is necessary, the PBD fusion proteins are readily
purified by
affinity chromatography using a substrate polysaccharide.
10 In using the subject invention, polysaccharide structures are modified
using
PBD fusion proteins by contacting a polysaccharide structure with a su~cient
amount
of the PBD fusion protein for a time sufficient to achieve a desired
modification under
appropriate conditions of reagents, temperature and the like. Conditions of
modification generally are optimized to provide for Km, Vmax, and kcat and
other
15 biochemical parameters such as pH optima of the PBD. The interaction of the
PBD
with substrate generally is extremely rapid. To achieve a desired effect, it
therefore is
necessary to evaluate various concentrations of PBD fusion protein, and/or
time
and/or temperature of treatment to achieve a desired effect. The conditions
used are
determined empirically and are based upon the requirements of the PBD fusion
2 0 protein used and the desired end result. As an example, typical conditions
for PBD
fusion proteins comprising a PBD derived from an endoglucanase include mM
phosphate, pH 7.0, a concentration of PBD generally of about 0.1-10 mg/ml per
25 mg
of cellulose fiber such as cotton. The temperature is generally about 20-37
°C,
preferably about 25 °C. The time of treatment varies from 5 minutes to
up to 12 hours,
2 5 although longer treatments may be used so long as the polysaccharide
structures are
not damaged. Generally as appropriate, the mixture is gently agitated to
facilitate
uniform treatment of the structures. Following treatment of the structures,
the
structures are dried and then used for preparation of an end product such as
paper or
textile. Alternatively or additionally, an end product such as paper or
textile is treated
3 0 by PBD, taking into account considerations similar to those listed above.
An assay of the progress of modification or the rate of reaction can be used
for
the detection of inhibitory end products that might be formed during the
modification
treatment and for the detection of intermediate or final desirable properties
that are
produced during treatment. For example, it may be desirable not to fully
crosslink the
3 5 fibers. Rather, it may be preferable to stop the reaction at an
intermediate point to
obtain polysaccharide structures having desirable properties that are present
due to
incomplete crosslinking of the structure, for example to obtain a less rigid
yarn for
weaving. A number of objective tests are known to those of skill in the art
for
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
41
evaluating the PBD treatment, including Young's modulus, strain at maximum
load,
energy to break point, and toughness.
The type of modification of the polysaccharide structure that is achieved
depends at least in part upon the nature of the protein that is fused to the
binding
domain. Modification by a PBD is defined as an observable (detectable) change
in the
structure of the polysaccharide. This includes aggregation of the
polysaccharide
structure leading to observable modifications such as increased wet strength,
change
in surface properties such as hydrophobicity, hydrophilicity, wetability,
surface texture
and the like. Electrical properties of a polysaccharide containing material
that can be
changed include surface charge (positive or negative) and electrical
conductivity.
Chemical properties of a polysaccharide containing material that can be
changed
include the introduction of various chemically and photochemically reactive
chemical
groups to at least the surface of the polysaccharide containing material.
Mechanical
properties of a polysaccharide containing material that can be changed include
tensile
strength, resistance to shear, abrasion resistance, frictional coefficient,
and elasticity.
As an example, when the polysaccharide structure is a cellulose, a reagent or
composition having two or more CBDs per molecule can be used to cross-link
cellulose fibers. Figs. 9A-C schematically represent some of the ways in which
a CBD
coupler unit of the invention can interact with and bind to a polymeric
structural unit
2 0 of a polysaccharide. Fig. 9A schematically represents a CBD coupler unit
having a
first CBD bound to a first polymeric structural unit, and a second CBD bound
to a
second polymeric structural unit. It is to be expected that, at least in the
case of a
linker unit having a high degree of flexibility is used, both a first and a
second CBD of
a CBD coupler unit can bind to the same polymeric structural unit. Fig. 9B
shows a
2 5 CBD coupler unit having a flexible linker unit, wherein both the first and
second
CBDs are bound to a single polymeric structural unit. Fig. 9C schematically
represents
how a plurality of polymeric structural units can be cross-linked by a
plurality of CBD
coupler units to form a three dimensional network of polymeric material. In
this
manner, aggregates of filamentous polysaccharide, for example, cellulose
filaments,
3 0 can be formed. Materials constructed from cellulosic materials, such as
paper, cotton
yarn and cotton fabric (both woven and non-woven), which are cross-linked via
CBD
coupler units have altered mechanical properties, such as Young's modulus.
Cross-
linking of cellulosic materials can be performed at various stages in
manufacture of a
cellulose-containing material. For example, in the case of paper products,
cross-
3 5 linking can be performed by treating cellulose fibers with a CBD coupler
unit
composition at various stages in the paper making process, or a formed paper
product
can be treated with a CBD coupler unit. Similarly, cotton yarn or cotton
fabric can be
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
42
cross-linked with a CBD coupler unit composition to provide yarn or cotton
fabric
having improved surface and/or mechanical properties.
By treating a polysaccharide structure or a polysaccharide containing material
with a PBD fusion protein comprising a functional moiety, novel materials with
a
variety of novel physical, electrical, chemical, and mechanical properties can
be
obtained. Fig. 8 schematically represents a CBD functionating moiety that
includes at
least one CBD and a functional moiety (FM) attached thereto. The functional
moiety
can be any of numerous chemical species, including: a hydrophobic moiety, such
as a
hydrophobic amino acid sequence or peptide or a fatty acid derivative; to
decrease
wet-ability and to provide increased tolerance of the material to moisture and
water, a
hydrophilic moiety; an electrically charged or ionic moiety; a silicon binding
moiety; a
polymer binding moiety; a metal or metal binding moiety to provide for binding
to a
metal substrate (examples of metal binding proteins include bacterial
siderophores,
metallothioneins and metallothionein-like proteins (Slice et al. (1990) J.
Biol. Chem.
265: 256-263), ferritin (Spanner et al. (1995) Bone 17: 161-165), and designed
metal-
binding proteins (for example, Pessi et al. (1993) Nature 362: 367-369)); a
chemically
reactive group; a photo-chemically reactive group; or a thiol group. A
chemically
reactive group of the invention can include, for example, an aldehyde, a
maleimide, a
hydrazide, an epoxide, or a carbodiimide. A photo-chemically reactive group of
the
2 0 invention can include a phenylazide.
Similarly, a composition having a hydrophobic moiety, for example, a
hydrophobic polypeptide, a long chain hydrocarbon or hydrocarbon derivative,
can be
used to confer hydrophobicity to cellulose fibers or products made from
cellulose
fibers. Hydrophobicity leads to decreased wet-ability of a material
constructed from
2 5 the modified cellulose fibers, and indirectly results in increased
durability of the
material in the presence of water. On the other hand, cross-linking of
cellulose fibers
directly leads to increased wet strength of the material. For the sake of
simplicity,
herein reference to strength of paper or other cellulose containing materials
is used
nonspecifically to include wet strength of such materials.
30 The types of polysaccharide materials that can be modified using the
subject
process are varied. Examples include wood products, paper products derived
from
cellulose fibers, and products derived from cotton or ramie, such as yarn and
fabric.
The term "paper" includes sheet-like masses and molded products made from
fibrous
cellulosic materials and combinations of cellulosic materials and synthetic
materials.
3 5 Examples of paper include tissue paper, office paper, newsprint, fluting
paper, paper
towel, laminated paper, and paperboard. The term "polysaccharide material" or
"polysaccharide-containing material" refers to a material that comprises at
least one
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
43
polysaccharide, generally a substantial amount of least one polysaccharide,
such as
cellulose, or chitin.
CBD-containing compositions can also find applications in paper making
processes. According to the invention, a CBD-containing composition can be
used to
treat cellulosic material at different stages of a paper making process. For
example,
treatment may be performed at the forming stage, or at the sizing stage.
Treatment at
the forming stage of paper making may be performed by adding a CBD cross-
linking
composition (for example, a CBD coupler unit composition or a cellulose cross-
linking (fusion) protein (CCP)) to a suspension of cellulose fibers.
Preferably,
treatment of cellulosic material with a CBD-containing composition occurs at,
or
before, the forming stage. A functional moiety cawbe attached, conjugated, or
coupled
to a CBD according to methods described hereinabove for attachment of a linker
unit
to a CBD to form a CBD coupler unit (Figs. 4A-G, SA-B) (see also, for example,
U.S.
PAT. NO. 5,962,289).
Additional objects, advantages, and novel features of the present invention
will
become apparent to one ordinarily skilled in the art upon examination of the
following
examples, which are not intended to be limiting. Additionally, each of the
various
embodiments and aspects of the present invention as delineated hereinabove and
as
2 0 claimed in the claims section below finds experimental support in the
following
examples.
EXAMPLES
Reference is now made to the following examples, which together with the
2 5 above descriptions, illustrate the invention in a non limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized
in the present invention include molecular, biochemical, microbiological and
recombinant DNA techniques. Such techniques are thoroughly explained in the
literature. See, for example, "Molecular Cloning: A laboratory Manual"
Sambrook et
30 al., (1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M.,
ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John
Wiley and
Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular
Cloning",
John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA",
Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory
35 Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York
(1998);
methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531;
5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III
Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic
Technique" by
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
44
Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in
Immunology"
Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and
Clinical
Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and
Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and
Co.,
New York (1980); available immunoassays are extensively described in the
patent and
scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153;
3,850,752;
3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533;
3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521;
"Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid
Hybridization"
Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation"
Hames,
B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. L,
ed.
(1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide
to
Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317,
Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic
Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein
Purification and
Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which
are
incorpotaed by reference as if fully set forth herein. Other general
references are
provided throughout this document. The procedures therein are believed to be
well
known in the art and are provided for the convenience of the reader. All the
2 0 information contained therein is incorporated herein by reference.
Deposit of Biological Materials
E coli pET-CBD was deposited with the American Type Culture Collection
(ATCC), 10801 University Boulevard, M, VA 20110-2209 on Apr. 12 1993, and has
2 5 been assigned the accession number 75444.
Example 1
Construction and Expression of CBDs and CBD Fusion Proteins
The contents of the following U.S. patents, which disclose the construction
and
3 0 expression of various CBDs and CBD fusion proteins, are incorporated by
reference
herein: U.S. PAT. NO. 5,496,934; U.S. PAT. NO. 5,670,623., U.S. PAT. NO.
5,719,044. ; U.S. PAT. NO. 5,738,984; U.S. PAT. NO. 5,837,814; and U.S. PAT.
NO.
5,856,201 all to Shoseyov et al.; U.S. PAT. NO. 5,137,819; U.S. PAT. NO.
5,202,247; U.S. PAT. NO. 5,340,731; U.S. PAT. NO. 5,928,917; and U.S. PAT. NO.
3 5 5,962,289 all to Kilburn et al.; and U.S. PAT. NO. 5,821,358 to Gilkes et
al.
1.1 Construction and expression of the cellulose binding domain of C.
cellulovorans (CBDclos):
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
Construction and over-expression of the cellulose binding domain of Cellulose
Binding Protein A of C. cellulovorans in E. coli BL12 (DE3) harboring the pET-
CBD
plasmid (see Figs. lA-C) has been described by M.A.Goldstein et al., (1993)
(J.
Bacteriol. 175: 5762-5768). Also see U.S. PAT. NO. 5,496,934 and U.S. PAT. NO.
5 5,719,044, both of which are incorporated herein by reference in their
entirety.
1.2 Construction and expression of CCR180:
pET-CCP-180 (Figs. 2A-E) was constructed from pET-CBD (Figs. lA-C,
M.A. Goldstein et al. (1993) J. Bacteriol. 175: 5762-5768) and pET-CBD-180
(Figs.
1D-G, E. Shpigel et al. (1999) Biotech. Bioeng. 65: 17-23 [pET-CBD and pET-CBD-
10 180 were digested with NcoI and BamHI and the resulting DNA fragments
separated
on 1.2 % and 0.6 % agarose gels, respectively. The 500 by fragment of pET-CBD
and
the 5 Kb fragment of pET-CBD-180 were extracted from the gel using a Qiaex DNA
gel extraction kit (Qiagen, Inc, California), and the two fragments were
ligated. The
ligation mixture was transformed into E.coli XL1-blue competent cells,
followed by
15 transformation into the expression host E.coli BL21 (DE3). The positive
clone
containing two CBDs fused in frame was designated pET-CCP-180 and confirmed by
sequencing. Expression of CCP-180 was conducted as described by M.A. Goldstein
et
al. (1993) J. Bacteriol. 175: 5762-5768 for CBDclos
1.3 Cloning and Expression of Protein A-CBD:
20 CBD was PCR amplified using the cbpA gene (Shoseyov et al., (1992) Proc.
Natl. Acad. Sci. USA 89: 3483-3487) as a template: primer A (N-terminal
primer): 5'-
GGGGGAATTCCATGGCAGCGACAT-3' (SEQ ID NO:11 ) containing an EcoRI
site, and primer B (C-terminal primer): 5'-GGGGGATCCTATGGTGCT-3' (SEQ ID
N0:12) containing a stop codon followed by a BamHI site. The primers were
designed
2 5 to enable EcoRIlBamHI force cloning of the 500 by DNA fragment of into the
plasmid
pRIT2, fused in frame to the C-terminal of the Protein A gene. PCR conditions
were as
described in Innis et al., PCR Protocols: A Guide to Methods & Applications.
Innis et
al. Ed., Academic Press, San Diego, 1990) with the following modifications: 2
ng of
template DNA and 1mM MgCl2 were used in the reaction mixture. The reaction was
3 0 conducted using a programmable thermal controller (M&J Research, Inc.,).
Standard
DNA manipulations were conducted according to Sambrook et al., Eds. (1989)
Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press.
The PCR amplified product was digested with EcoRI and BamHI, and the
expected 500 by DNA fragment was isolated from 1.5 % agarose gel using a Qiaex
gel
3 5 extraction kit (Qiagen, Inc.). The EcoRIlBamHI fragment was ligated into
EcoRI/BamHI-predigested pRIT2 using T4 ligase. The ligation mixture was used
to
transform E. coli strain 2097 competent cells, and transformed colonies were
selected
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
46
on LB agar plates containing 100 mg/L ampicillin. The successful construct
containing
the DNA insert of interest was designated pRIT2-CBD.
Prot A-CBD was cloned into the T7 mediated over-expression vector pET3d
(F. Studies et al., (1986) J. Mol. Biol. 189: 113-130). The Prot A-CBD was PCR
amplified using pRIT2-CBD as a template using the following primers: C-
terminal: as
described above (i.e., 5'-GGGGGGATCCTATGGTGCT-3' SEQ ID N0:12); and N-
terminal: 5'-GGGGGGTACCATGGAACAACGC-3' (SEQ ID N0:13), containing an
initiation site within the NcoI site. The PCR product was partially digested
with NcoI.
The recovered DNA was digested with BamHI, and the 1.3 Kb DNA fragment was
cloned into pET3d. The ligation mixture was used to transform E coli XL,1-Blue
competent cells, and transformed colonies were selected on LB agar plates
containing
100 mg/L ampicillin. The successful construct containing the DNA insert was
designated pET-ProtA-CBD (Figs. 3A-G). pET-ProtA-CBD was transformed into E.
coli BL21 (DE3) competent cells. Expression of the fusion protein was
conducted as
described by Nilsson et al, (1985), EMBO J. 4: 1075-1080. All the cells were
grown in
shake flasks at 250 rpm in a volume of 40 ml of LB, supplemented with 50 mg/L
ampicillin, inoculated with 400 p1 of an overnight culture of E coli 2097
containing
pRIT2-CBD. The culture was grown at a temperature of 30 °C until it
attained an
O.D.6oo nm of 0.4. The temperature was then raised to 42 °C for 45
minutes, and then
2 0 decreased to 37 °C for an additional 2 hours.
Over-expression of ProtA-CBD was obtained in E coli BL21 (DE3) harboring
pET-ProtA-CBD. Inoculum was prepared by growing the cells overnight in M9
minimal medium (0.65 NaZHP04, 0.3 % KH2PO4, 0.255 NaCI, 0.5 % NH4C1, 20
glucose, 2mM MgS04, 0.1 mM CaClz and 1 mM thiamine-HCl) containing SO ~g/ml
2 5 ampicillin. After diluting the inoculum 1:50 in TB medium (1.2 % bacto-
tryptone, 2.4
bacto-yeast extract, 0.4 % (v/v) glycerol, 0.17 M KH2P04, and 0.72 M K2HP04)
containing 100 ~g/ml ampicillin, cells were grown at 37 °C to an O.D.
600 nm of 1.5,
after which 0.5 mM isopropyl (3-D-thiogalactopyranoside (IPTG) was added. The
cells
were grown for an additional 4 hours at 37 °C. The cells were harvested
by
3 0 centrifugation at 2,000 g for 10 minutes.
1.4 Purification of ProtA-CBD:
Cells were suspended at a concentration of 0.1 g/ml in 50 mM Tris/HCI, 10
mM EDTA, pH 8, and were disrupted by a RANNIE high pressure laboratory
homogenizes (MINI/LAB Type 8.30 H). The suspension was centrifuged, and 1
liter of
3 5 supernatant at a protein concentration of 5 mg/ml was applied to a
cellulose (Avicel
200 Sigma) column (2.6 x 32 cm). The column was equilibrated with PBS (15 mM
phosphate buffer, 150 mM NaCI, 3 mM KCI, pH 7.4). The column was washed at a
flow rate of 5 ml/min until the absorbancy at 280 nm was less than 0.05. ProtA-
CBD
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
47
was eluted with 50 mM Tris/NaOH solution, pH 12.5. The eluted ProtA-CBD was
immediately titrated to pH 8 with HCl and lyophilized. Total E. coli protein
(before
application to the cellulose column) and the peak (ProtA-CBD) eluted from the
cellulose column were analyzed on 12.5 % SDS-PAGE according to Laemmli (U.K.
Laemmli (1970) Nature 227:680-685). The ProtA-CBD peak showed a single band at
about 45 kD.
Example 2
Measurement of Mechanical Properties of Treated
(CBD-Modified) and Untreated Materials
Mechanical properties were measured using a universal testing machine (Fig.
11, Instron, High Wycombe, UK) Interface type: 1011 series. Sample rate: 10
pts/sec.
Crosshead speed: 5 mm/min. All measurements were taken at 23 °C and 65
% relative
humidity.
2.1 Young's Modulus:
Tensile elastic modulus, or Young's modulus, is an important property of
materials. Young's modulus may be loosely defined as the force required to
elongate a
material in the elastic regime using relatively small forces that do not
irreversibly
stretch the material.
2 0 2.2 Paper Treatments:
Rectangular strips of tissue paper (dimensions: 45 mm x 10 mm x 0.1 mm)
were treated by immersion for 10 minutes in solutions of CBDclos ,CCP, Prot-A-
CBD, Ab-ProtA-CBD- at a concentration of 2.5 mg/ml and 2.0 mg/ml,
respectively, in
mM Tris base, pH 7. Control treatment consisted of immersion in a solution of
20
2 5 mM Tris base, pH 7, also for 10 minutes. After immersion the treated and
control
strips were removed from the liquids and dried for 2 days under vacuum.
2.3 Results of Paper Treatment:
2.3.1 Young's modulus:
Young's modulus values for control, CBDclos-treated and CCP-180-treated
3 0 samples of paper are given in Fig. 1 OA. The paper treated with CBD had a
Young's
modulus significantly greater than that of the control (untreated) paper. The
paper
treated with CCP had a Young's modulus even greater than that of the CBD
treated
paper. These results indicthat treatment of paper with a CBD or with a CCP
alter at
least one mechanical property of the paper. More specifically, treatment of
paper with
3 5 either CBD or CCP resulted in increased tensile strength (as determined by
Young's
modulus values) of the treated paper as compared with the untreated paper.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
48
2.3.2 Strain at Maximum Load:
Results showing strain at maximum load for CBDclos treatment and CCP-180
treatment of paper samples are shown in Fig. 10B. Neither CBD treatment nor
CCP
treatment resulted in substantial change in strain at maximum load, as
compared with
the control value. These results indicate that treatment of the paper with CBD
or CCP
did not significantly affect its elasticity.
2.3.3 Energy to Brake Point:
Results showing energy to brake point for paper samples treated with CBD or
CCP-180 are shown in Fig. 10C. Energy to breake point of the CBD treated paper
was
substantially the same as that of the control. However, the paper treated with
the
crosslinking protein, CCP-180 showed significantly increased energy to brake
point as
compared with the control.
2.3.4 Toughness:
Results showing toughness for paper samples treated with CBD and CCP are
shown in Fig. l OD. Toughness of the CBD treated paper was substantially the
same as
that of the control. However, the paper treated with CCP again showed
significantly
increased toughness as compared to the control.
2.4 Yarn Treatments:
The cotton yarn used in this study was 100 % gray cotton double yarn fiber
2 0 (34/2) with low T.P.U. (turns per inch). Yarn diameter was 0.5 mm and the
weight
per length was 0.8 mg/cm. In each treatment, the yarn samples were immersed in
protein solutions employing a purpose-built yarn treatment apparatus (YTA) of
the
type known in the art. The yarn treatment apparatus is schematically
represented in
Fig. 11. The apparatus includes a feeder wheel, a collecting wheel, a first
bath A, a
2 5 second bath B, and an engine engaged with the collecting wheel. The feeder
wheel
and collecting wheel may be interchanged, thereby allowing yarn to be re-
passed
through baths A and B. The engine can be operated at various selected speeds,
thereby
allowing the immersion time of a yarn sample to be determined. Lengths of yarn
may
be connected between the feeder wheel and the collecting wheel, and the yarn
may be
3 0 moved from the feeder wheel to the collecting wheel by passing the yarn
through
liquids) contained within bath A and bath B. In this way, yarn may be immersed
in a
single liquid (present in both baths) or in two different liquids for a
particular time
period.
Lengths of cotton yarn (3-4 meters) were wound onto the feeder wheel of the
3 5 YTA, one end of the yarn was connected to the collecting wheel, and the
yarn was
advanced through bath A and bath B by means of the engine. Dipping duration of
the
yarn was approximately 45 seconds.
Treatments of the cotton yarn described above were as follows:
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
49
(i) Treatment with CCP-180: yarn fibers were immersed (bath A) in a
solution of CCP-180 (lmg/ml in 20mM Tris base, pH 8).
(ii) Treatment with Protein A-CBD (CBD-PA yarn fibers were immersed
(bath A) in CBD-PA solution (0.75 mg/ml in 20mM Tris base, pH 8) and then
washed
(bath B) in 1XTBS (45 seconds dipping time).
(iii) Dual treatment with Protein A CBD and antibodies: yarn fibers were
immersed (bath A) in CBD-PA solution (0.75 mg/ml in 20 mM Tris base, pH 8) and
washed (bath B) in 1X TBS (45 seconds immersion time). The collecting wheel
was
then switched with the feeder wheel, and the yarn was immersed (bath A) in
antiserum
solution (0.75 mg IgG/ml) and washed (bath B) in 1X TBS.
(iv) Control: yarn fibers were immersed (bath A) in 20 mM Tris base, pH 8
for 45 seconds.
After treatment, all three treated samples and the control were dried for
several
hours at room temperature.
2.5 Results of Yarn Treatment:
2.5.1 Young's modulus:
Young's modulus values for control, CCP-180-treated, ProteinA-CBD-treated
and Ab-ProteinA-CBD-treated samples of yarn are given in Fig. 12A. The yarn
treated
with CCP-180 and Ab-ProteinA-CBD had Young's modulus values significantly
2 0 greater than that of the control (untreated) yarn. These data indicate
that treatment of
yarn with Ab-ProteinA-CBD and CCP resulted in increased tensile strength (as
determined by Young's modulus values) of the treated yarn, as compared with
the
control. Interestingly, the yarn treated with CBD-PA had a Young's modulus
value
much lower than that of the control yarn. While not intending to be limited by
theory, a
2 5 possible explanation for the decreased Young's modulus for CBD-PA-treated
yarn is
loosening of cellulose fibers by CBD-PA (see, for example, U.S. PAT. NO.
5,821,358
the contents of which are incorporated by reference herein).
2.5.2 Strain at Maximum Load:
Results showing strain at maximum load for yarn samples treated with CCP-
3 0 180, CBD-PA, and CBD-PA-Ab are shown in Fig. 12B. Yarn treated with either
CCP-
180 or CBD-PA-Ab had lower values of strain at maximum load as compared with
the
control, thus indicating that these treatments rendered the yarn less elastic
as compared
with the control. The yarn treated with CBD-PA had a strain at maximum load
similar
to that of the control.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
Example 3
Functionalization of materials
3.1 Functionalization of a filter medium for removal of heavy metal species
from a liquid:
5 A CBD functional moiety (see, for example, Figs. 9A-C) is prepared by
coupling a CBD to a functional moiety having affinity for a heavy metal, such
as a
metal-binding protein. A substrate comprising cellulosic material, such as
cotton
fibers, is treated with the CBD functional moiety under conditions (pH,
temperature,
ionic concentration, etc.) such that the CBD component of the CBD functional
moiety
10 binds to the substrate, whereby the substrate is functionalized by the
metal-binding
functional moiety to provide a metal binding substrate or filter medium. A
stream of
liquid containing an excessive level of a heavy metal is passed over the metal
binding
filter medium, whereby the concentration of the heavy metal in the liquid
stream is
greatly decreased to a non-toxic level.
15 3.2 Functionalization of cellulose fibers for making packaging paper
product
with decreased wet ability:
A CBD functional moiety is prepared by coupling a CBD to a hydrophobic
functional moiety. Cellulose fibers suitable for paper making are treated with
the CBD
hydrophobic functional moiety under conditions (pH, temperature, ionic
concentration)
2 0 such that the CBD component of the CBD functional moiety binds to the
cellulose
fibers to provide cellulose fibers having a hydrophobic moiety attached
thereto. Paper
produced from the treated cellulose fibers is hydrophobic and resistant to
water.
In an alternative example, paper produced from untreated (non-functionalized)
cellulose fibers is functionalized with a CBD-linked hydrophobic moiety,
either before
2 5 or after drying the paper. Paper treated with the CBD hydrophobic
functional moiety is
hydrophobic and resistant to water.
3.3 Functionalization of cellulose fibers for making tissue paper having
increased wet ability:
A CBD functional moiety is prepared by coupling a CBD to a hydrophilic
3 0 functional moiety. Tissue paper is treated (functionalized) with the CBD
hydrophilic
functional moiety, either before or after the first or second drying stages of
a paper
making process. Tissue paper treated with the CBD hydrophilic functional
moiety is
hydrophilic and shows increased absorption of water and aqueous liquids.
3 5 Example 4
Expressing S protein-CBD-S peptide (SSC)
Fig. 13 shows the results of expression of SCS in E.coli.. E.coli proteins
before
induction with IPTG are shown in lane 2, total E.coli proteins after induction
with
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
51
IPTG are shown in lane 3, whereas and inclusion bodies containing the SCS
protein
are shown in lane 4.
Example S
Treatment of preformed paper by CBD, CCP or SCS
Fig. 14 shows a Young's modulus map of the results of treating Whatman
papers with CBD, CCP, or SCS. Note that treatment of Whatman papers with CBD
or
CCP in all concentrations tested resulted in increased Young's modulus.
Fig. 15 shows the energy to break points of CBD, CCP, and SCS treated
Whatman papers. Note that use of CCP in the concentration of 2.5 mg/ml
resulted in
about 30 % increase in the energy to break point. In addition, treatment with
SCS at
all concentrations tested resulted in increased energy to break point.
Fig. 16 shows the results of a toughness test of CBD, CCP, and SCS treated
Whatman papers. Note that use of CCP in the concentration of 2.5 mg/ml
resulted in
about 40 % increase in toughness. In addition, treatment with SCS at all
concentrations tested resulted in increased toughness.
Fig. 17 shows the stress at maximum load of CBD, CCP, and SCS treated
Whatman papers. Note that all the treatments tested resulted in increased
stress at
maximum load. The most significant effect was obtained with CCP in the
2 0 concentration of 2.5 mg/ml. The increase in the stress at maximum load
demonstrates
an increase of paper strength.
In another set of experiments the effects of CBD and CCP on pre-formed
Whatman papers were determined.
Rectangular pieces of Whatman paper No. 1, 40 x 10 mm and 0.18 mm thick
2 5 (Whatman, Maidstone, England) were immersed for 10 min in a solution (20
mM Tris
base, pH 7) containing 2.5 mg/ml CBD or CCP. The samples were then dried for
24
hours in 65 % relative humidity at 23 °C. The final water content in
the papers was
3.2 %. Mechanical properties were evaluated according to the international
standard
testing method for paper and board tensile properties (ISO 1924-2). Tensile
testing of
3 0 the treated papers was carned out using an Instron Universal Testing
Machine (UTM)
Model 1011 (High Wycombe, UK) in tensile mode. The rectangular papers were
inserted into the upper and lower tensile grips (screw-action grips, Instron
Corp.,
Canton, MA) to enable a proper grip during the tension experiments. All
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
52
measurements were taken at 23 °C, 65 % relative humidity and a constant
deformation
rate of 20 mm/min. The tensile properties measured included stress at failure,
strain at
failure, stretch at break point and energy absorption. All calculations were
performed
according to Hayden, W., Moffatt, W.G. & Wulff, J. Mechanical Behavior. 1-22
(Johan Wiley & Sons, Inc., NY; 1956) and Dufresne, A., Cavaille, J.Y. &
Vignon,
M.R. Mechanical behavior of sheets prepared from sugar beet cellulose
microfibrils.
J. Appl. Polym. Sci. 64, 1185-1194 (1996).
The stress (a-) was calculated according to equation 1:
~=FlS (1)
where F is the applied load and S is the cross section. S is determined by
assuming
that the total volume of the sample remains constant, such that:
S = So x ldl (2)
where So is the cross section at zero time. The strain (E) can be determined
by:
s = ln(lllo) (3)
where l and to are the length during the test and the length at zero time,
respectively.
The data allow the plotting of stress versus strain curves, and the
calculation of
Young's modulus (E):
E=d~lds (4)
The values reported below are averages of at least 15 measurements.
2 0 Fig. 18 shows typical stress versus strain curves of pre-formed Whatman
papers treated with CBD or CCP. The deformation behavior of the treated paper
under an applied load could be deduced from the stress-strain curve. Up to
0.02
strain, a linear relationship between stress and strain was observed. However,
at
strains higher than 0.02, a nonlinear relationship was found. It is evident
from Fig. 18
2 5 that the tensile stress increases from control to CBD and to CCP,
respectively. The
tensile strength value of the CCP-treated paper was about 40 % higher than the
non-
treated paper and 14 % higher than the CBD-treated paper. The CBD-treated
paper
strength was about 25 % higher than that of the non-treated paper. In both
treatments,
the differences were statistically significant (Table 6).
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
53
Table 6
control CBD . CCP
2.5 mg/ml 2.5 mg/ml
Stress at failure (MPa) 7.4 9.2 10.5a
Strain at failure (%) 10.4b 11.7ab lS.Sa
Young's Modulus (MPa)* 183.3b 197.2a6 214.5a
Energy at failure (103J/m3)0.208 0.254b 0.418a
* Young's modulus was calculated at 3 % deformation. Values in a
row followed by a different letter superscript differ significantly at p =
0.01.
The changes in paper-failure strain are also significant. In paper treated
with
CCP, the strain to failure was increased by about 50 % relative to the non-
treated
paper. The effect of CBD was less significant and resulted in only a 12 %
increase.
Treating paper with CBD or CCP produced a less brittle paper. The Young's
modulus
of treated paper, derived from the initial slope of the stress-strain curve
(linear until 3
deformation), is summarized in Table 1. Treating papers with CCP resulted in a
17
increase in their Young's modulus while CBD treatment resulted in only a 7.5
increase. Energy absorption is determined by calculating the area under the
stress-
strain curve and the results are summarized in Table 6. The trend observed in
the data
for tensile strength applied for the energy absorption; however, the magnitude
was
bigger. The energy absorption of the CCP-treated paper was about 100 % higher
than
that of the control while that of the CBD treated paper was only 23 % higher.
The
value for CCP treated paper was about 64 % higher than that for its CBD-
treated
2 0 counterpart. In all tested parameters the effect of CCP was statistically
significant,
whereas treatment with CBD resulted in statistical significance only for
stress at
failure and energy absorption (Table 6).
Fig. 19 shows water-absorption time of pre-formed Whatman papers treated
with CBD or CCP at different concentrations. Fig. 20 shows time-lapse
photographs
2 5 of water absorption on pre-formed Whatman paper treated with CCP.
Distilled water
(10 p.1) was pipetted onto the treated papers and the time to full absorption
was
measured in seconds. Water absorption was also visualized using an optical
contact
angle meter, CAM2000 (KSV Instruments, Helsinki, Finland). One drop of water
was
dripped onto paper samples and pictures were taken with time lapses of 20 ms.
The
3 0 first frame was taken 25 ms after the water had come into contact with the
paper. In
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
54
non-treated paper, absorption time was less than a second. Water absorption
time of
CBD- and CCP-treated papers increased with increasing protein amount. When CCP
was applied at a concentration of 2.5 mg/ml, water absorption time was two
orders of
magnitude higher than with paper treated with CBD at the same concentration
(580
seconds for CCP versus S seconds for CBD) and at least four orders of
magnitude
higher then the non-treated paper (580 seconds for CCP versus less than a
second for
the control).
Optical contact angle meter (CAM) was used to visualize the dynamics of
water dropped onto CCP-treated paper. Fig. 20 (photograph F) illustrates the
contact
of the water droplet with non-treated paper after 25 ms. It is clear that
water absorbs
into the paper immediately after contact. Fig. 20 (photographs A to E)
fizrther
illustrates the absorption of a water droplet by CCP-treated paper versus
lapsed time.
In the first 2 minutes, no absorption could be detected, and the contact angle
remained
at > 90 °. Only after 4 min was absorption into the paper observed.
Even after 8 min,
the water was not completely absorbed by the paper. Full absorption into the
paper
was observed only after 10 min (Fig. 19).
Example 6
Cross-linking of fine cellulose fibers prior to the forming step of a
2 0 paper making process
A CBD coupler unit composition or reagent is prepared by linking at least two
CBDs with a linker unit. A suspension of cellulose fibers, which includes a
substantial
amount of fine cellulose fibers capable of passing through the forming fabric
(filter),
are treated with the CBD coupler unit composition prior to passing the
suspension
2 5 through the forming fabric. CBD coupler units of the CBD coupler unit
composition
crosslink with the fine cellulose fibers to form a plurality of three-
dimensional
aggregates of cellulose fibers. After passage of the treated suspension
through the
forming fabric, the three-daggregates of cellulose fibers are retained by the
filter,
thereby allowing for greatly enhanced recovery of raw material (cellulose
fibers).
The above results demonstrate that PBD fusion proteins that include a dual or
dimeric PBD (e.g., a fusion product of two CBDs, for example, cellulose cross-
linking
protein (CCP)), a fusion product of a CBD with Protein A, and a Speptide-CBD-
Sprotein fusion can be prepared and used to modify polysaccharide structures.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
It is appreciated that certain features of the invention, which are, for
clarity,
described in the context of separate embodiments, may also be provided in
combination in a single embodiment. Conversely, various features of the
invention,
which are, for brevity, described in the context of a single embodiment, may
also be
5 provided separately or in any suitable subcombination.
Although the invention has been described in conjunction with specific
embodiments thereof, it is evident that many alternatives, modifications and
variations
will be apparent to those skilled in the art. Accordingly, it is intended to
embrace all
such alternatives, modifications and variations that fall within the spirit
and broad
scope of the appended claims. All publications, patents and patent
applications
mentioned in this specification are herein incorporated in their entirety by
reference
into the specification, to the same extent as if each individual publication,
patent or
patent application was specifically and individually indicated to be
incorporated herein
by reference. In addition, citation or identification of any reference in this
application
shall not be construed as an admission that such reference is available as
prior art to
the present invention.
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
1
SEQUENCE LISTING
<110> Levy
, Ilan
Shoseyo.v,
Oded
Nussinovitch,
Amos
<120> MODIFICATION
OF POLYSACCHARIDE
CONTAINING
MATERIALS
<130> 00/20910
<190> 60/166,38960/164,140
and
<141> 1999-11-181999-11-O8
and
<160> 13
<170> PatentIn
version 3.0
<210> 1
<211> 507
<212> DNA
<213> Clostridium
cellulovorans
<900> 1
ccatggcagc atgtcagttgaattttacaa ctctaacaaa 60
gacatcatca tcagcacaaa
caaactcaat atcaaaattactaacacatc tgacagtgat 120
tacaccaata ttaaatttaa
atgacgtaaa tattacacaagtgatggtac acaaggacaa 180
agttagatat actttctggt
gtqaccatgc ttaggaaatagctatgttga taacactagc 240
tggtgcatta aaagtgacag
caaacttcgt gcaagcccaacatcaaccta tgatacatat 300
taaagaaaca gttgaatttg
gatttgcaag actcttaaaaaaggacaatt tataactatt 360
cggacgagct caaggaagaa
taacaaaatc aactacactcaaacaaatga ctattcattt 920
agactggtca gatgcaagta
gttcaacacc ccaaaagttacaggatatat aggtggagct 980
agttgtaaat aaagtacttg
gtacagcacc gatgtac 507
ataggatcca
<210> 2
<211> 163
<212> PRT
<213> Clostridium cellulovorans
<900> 2
Met Ala Ala Thr Ser Ser Met Ser Val Glu Phe Tyr Asn Ser Asn Lys
1 5 10 15
Ser Ala Gln Thr Asn Ser Ile Thr Pro Ile Ile Lys Ile Thr Asn Thr
20 25 30
Ser Asp Ser Asp Leu Asn Leu Asn Asp Val Lys Val Arg Tyr Tyr Tyr
35 40 95
Thr Ser Asp Gly Thr Gln Gly Gln Thr Phe Trp Cys Asp His Ala Gly
50 55 60
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
2
Ala Leu Leu Gly Asn Ser Tyr Val Asp Asn Thr Ser Lys Val Thr Ala
65 70 75 80
Asn Phe Val Lys Glu Thr Ala Ser Pro Thr Ser Thr Tyr Asp Thr Tyr
85 90 95
Val Glu Phe Gly Phe Ala Ser Gly Arg Ala Thr Leu Lys Lys Gly Gln
100 105 110
Phe Ile Thr Ile Gln Gly Arg Ile Thr Lys Ser Asp Trp Ser Asn Tyr
115 120 125
Thr Gln Thr Asn Asp Tyr Ser Phe Asp Ala Ser Ser Ser Thr Pro Val
130 135 190
Val Asn Pro Lys Val Thr Gly Tyr Ile Gly Gly Ala Lys Val Leu Gly
195 150 155 160
Thr Ala Pro
<210> 3
<211> 573
<212> DNA
<213> Clostridium cellulovorans
<900> 3
ccatgtcagttgaattctacaactctaacaaatcagcacaaacaaactcaattacaccaa60
taatcaaaattactaacacatctgacagtgatttaaatttaaatgacgtaaaagttagat120
attattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcat180
tattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaa290
cagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaagcggacgag300
ctactcttaaaaaaggacaatttataactattcaaggaagaataacaaaatcagactggt360
caaactacactcaaacaaatgactattcatttgatgcaagtagttcaacaccagttgtaa420
atccaaaagttacaggatatataggtggagctaaagtacttggtacagcaccaggtccag980
atgtaccatcttcaataattaatcctacttctgcaacatttgatcccggtaccatggcta540
gcatgactggtggacagcaaatgggtcggatcc 573
<210> 4 -
<211> 190
<212> PRT
<213> Clostridium cellulovorans
<400> 4
Met Ser Val Glu Phe Tyr Asn Ser Asn Lys Ser Ala Gln Thr Asn Ser
1 5 10 15
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
3
Ile Thr Pro Ile Ile Lys Ile Thr Asn Thr Ser Asp Ser Asp Leu Asn
20 25 30
Leu Asn Asp Val Lys Val Arg Tyr Tyr Tyr Thr Ser Asp Gly Thr Gln
35 40 95
Gly Gln Thr Phe Trp Cys Asp His Ala Gly Ala Leu Leu Gly Asn Ser
50 55 60
Tyr Val Asp Asn Thr Ser Lys Val Thr Ala Asn Phe Val Lys Glu Thr
65 70 75 80
Ala Ser Pro Thr Ser Thr Tyr Asp Thr Tyr Val Glu Phe Gly Phe Ala
85 90 95
Ser Gly Arg Ala Thr Leu Lys Lys Gly Gln Phe Ile Thr Ile Gln Gly
100 105 110
Arg Ile Thr Lys Ser Asp Trp Ser Asn Tyr Thr Gln Thr Asn Asp Tyr
115 120 125
Ser Phe Asp Ala Ser Ser Ser Thr Pro Val Val Asn Pro Lys Val Thr
130 135 190
Gly Tyr Ile Gly Gly Ala Lys Val Leu Gly Thr Ala Pro Gly Pro Asp
145 150 155 160
Val Pro Ser Ser Ile Ile Asn Pro Thr Ser Ala Thr Phe Asp Pro Gly
165 170 175
Thr Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Ile
180 185 190
<210> 5
<211> 1030
<212> DNA
<213> Clostridium cellulovorans
<400> 5
ccatgtcagttgaattctacaactctaacaaatcagcacaaacaaactcaattacaccaa60
taatcaaaattactaacacatctgacagtgatttaaatttaaatgacgtaaaagttagat120
attattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcat180
tattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaa290
cagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaagcggacgag300
ctactcttaaaaaaggacaatttataactattcaaggaagaataacaaaatcagactggt360
caaactacactcaaacaaatgactattcatttgatgcaagtagttcaacaccagttgtaa420
atccaaaagttacaggatatataggtggagctaaagtacttggtacagcaccaggtccag480
atgtaccatcttcaataattaatcctacttctgcaacatttgatcccggtaccatggcag540
cgacatcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaa600
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
4
ttacaccaataatcaaaattactaacacatctgacagtgatttaaatttaaatgacgtaa660
aagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatg720
ctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcg780
ttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaa890
gcggacgagctactcttaaaaaaggacaatttataactattcaaggaagaataacaaaat900
cagactggtcaaactacactcaaacaaatgactattcatttgatgcaagtagttcaacac960
cagttgtaaatccaaaagttacaggatatataggtggagctaaagtacttggtacagcac1020
cataggatcc 1030
<210> 6
<211> 340
<212> PRT
<213> Clostridium cellulovorans
<900> 6
Met Ser Val Glu Phe Tyr Asn Ser Asn Lys Ser Ala Gln Thr Asn Ser
1 5 10 15
Ile Thr Pro Ile Ile Lys Ile Thr Asn Thr Ser Asp Ser Asp Leu Asn
20 25 30
Leu Asn Asp Val Lys Val Arg Tyr Tyr Tyr Thr Ser Asp Gly Thr Gln
35 90 95
Gly Gln Thr Phe Trp Cys Asp His Ala Gly Ala Leu Leu Gly Asn Ser
50 55 60
Tyr Val Asp Asn Thr Ser Lys Val Thr Ala Asn Phe Val Lys Glu Thr
65 70 75 80
Ala Ser Pro Thr Ser Thr Tyr Asp Thr Tyr Val Glu Phe Gly Phe Ala
85 90 95
Ser Gly Arg Ala Thr Leu Lys Lys Gly Gln Phe Ile Thr Ile Gln Gly
100 105 110
Arg Ile Thr Lys Ser Asp. Trp Ser Asn Tyr Thr Gln Thr Asn Asp Tyr
115 120 125
Ser Phe Asp Ala Ser Ser Ser Thr Pro Val Val Asn Pro Lys Val Thr
130 135 140
Gly Tyr Ile Gly Gly Ala Lys Val Leu Gly Thr Ala Pro Gly Pro Asp
145 150 155 160
Val Pro Ser Ser Ile Ile Asn Pro Thr Ser Ala Thr Phe Asp Pro Gly
165 170 175
Thr Met Ala Ala Thr Ser Ser Met Ser Val Glu Phe Tyr Asn Ser Asn
180 185 190
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
Lys Ser Ala Gln Thr Asn Ser Ile Thr Pro Ile Ile Lys Ile Thr Asn
195 200 205
Thr Ser Asp Ser Asp Leu Asn Leu Asn Asp Val Lys Val Arg Tyr Tyr
210 215 220
Tyr Thr Ser Asp Gly Thr Gln Gly Gln Thr Phe Trp Cys Asp His Ala
225 230 235 240
Gly Ala Leu Leu Gly Asn Ser Tyr Val Asp Asn Thr Ser Lys Val Thr
245 250 255
Ala Asn Phe Val Lys Glu Thr Ala Ser Pro Thr Ser Thr Tyr Asp Thr
260 265 270
Tyr Val Glu Phe Gly Phe Ala Ser Gly Arg Ala Thr Leu Lys Lys Gly
275 280 285
Gln Phe Ile Thr Ile Gln Gly Arg Ile Thr Lys Ser Asp Trp Ser Asn
290 295 300
Tyr Thr Gln Thr Asn Asp Tyr Ser Phe Asp Ala Ser Ser Ser Thr Pro
305 310 315 320
Val Val Asn Pro Lys Val Thr Gly Tyr Ile Gly Gly Ala Lys Val Leu
325 330 335
Gly Thr Ala Pro
340
<210> 7
<211> 1288
<212> DNA
<213> recombinant nucleotide sequence
<220>
<221> misc feature
<222> (3)..(791)
<223> pRIT2T cloning vector
<220>
<221> misc feature
<222> (795)..(1280)
<223> from cbpA gene
<400> 7
ccatggaaca acgcataacc ctgaaagaag cttgggatca acgcaatggt tttatccaaa 60
gccttaaaga tgatccaagc caaagtgcta acgttttagg tgaagctcaa aaacttaatg 120
actctcaagc tccaaaagct gatgcgcaac aaaataactt caacaaagat caacaaagcg 180
ccttctatga aatcttgaac atgcctaact taaacgaagc gcaacgtaac ggcttcattc 240
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
6
aaagtcttaa agacgaccca agccaaagca ctaacgtttt aggtgaagct aaaaaattaa 300
acgaatctca agcaccgaaa gctgataaca atttcaacaa agaacaacaa aatgctttct 360
atgaaatctt gaatatgcct aacttaaacg aagaacaacg caatggtttc atccaaagct 420
taaaagatga cccaagccaa agtgctaacc tattgtcaga agctaaaaag ttaaatgaat 480
ctcaagcacc gaaagcggat aacaaattca acaaagaaca acaaaatgct ttctatgaaa 540
tcttacattt acctaactta aacgaagaac aacgcaatgg tttcatccaa agcctaaaag 600
atgacccaag ccaaagcgct aaccttttag cagaagctaa aaagctaaat gatgctcaag 660
caccaaaagc tgacaacaaa ttcaacaaag aacaacaaaa tgctttctat gaaattttac 720
atttacctaa cttaactgaa gaacaacgta acggcttcat ccaaagcctt aaagacgatc 780
cggggaattc catggcagcg acatcatcaa tgtcagttga attttacaac tctaacaaat 840
cagcacaaac aaactcaatt acaccaataa tcaaaattac taacacatct gacagtgatt 900
taaatttaaa tgacgtaaaa gttagatatt attacacaag tgatggtaca caaggacaaa 960
ctttctggtg tgaccatgct ggtgcattat taggaaatag ctatgttgat aacactagca 1020
aagtgacagc aaacttcgtt aaagaaacag caagcccaac atcaacctat gatacatatg 1080
ttgaatttgg atttgcaagc ggacgagcta ctcttaaaaa aggacaattt ataactattc 1190
aaggaagaat aacaaaatca gactggtcaa actacactca aacaaatgac tattcatttg 1200
atgcaagtag ttcaacacca gttgtaaatc caaaagttac aggatatata ggtggagcta 1260
aagtacttgg tacagcacca taggatcc 1288
<210> 8
<211> 926
<212> PRT
<213> recombinant protein sequence
<220>
<221> misc feature
<222> (1)..(263)
<223> protein A from cloning vector
<220>
<221> misc feature
<222> (265)..(426)
<223> CBPA
<400> 8
Met Glu Gln Arg Ile Thr Leu Lys Glu Ala Trp Asp Gln Arg Asn Gly
1 5 10 15
Phe Ile Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn Val Leu
20 25 30
Gly Glu Ala Gln Lys Leu Asn Asp Ser Gln Ala Pro Lys Ala Asp Ala
35 40 45
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
7
Gln Gln Asn Asn Phe Asn Lys Asp Gln Gln Ser Ala Phe Tyr Glu Ile
50 55 60
Leu Asn Met Pro Asn Leu Asn Glu Ala Gln Arg Asn Gly Phe Ile Gln
65 70 75 80
Ser Leu Lys Asp Asp Pro Ser Gln Ser Thr Asn Val Leu Gly Glu Ala
85 90 95
Lys Lys Leu Asn Glu Ser Gln Ala Pro Lys Ala Asp Asn Asn Phe Asn
100 105 110
Lys Glu Gln Gln Asn Ala Phe Tyr Glu Ile Leu Asn Met Pro Asn Leu
115 120 125
Asn Glu Glu Gln Arg Asn Gly Phe Ile Gln Ser Leu Lys Asp Asp Pro
130 135 140
Ser Gln Ser Ala Asn Leu Leu Ser Glu Ala Lys Lys Leu Asn Glu Ser
145 150 155 160
Gln Ala Pro Lys Ala Asp' Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala
165 170 175
Phe Tyr Glu Ile Leu His Leu Pro Asn Leu Asn Glu Glu Gln Arg Asn
180 185 190
Gly Phe Ile Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu
195 200 205
Leu Ala Glu Ala Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys Ala Asp
210 215 220
Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala Phe Tyr Glu Ile Leu His
225 230 235 290
Leu Pro Asn Leu Thr Glu Glu Gln Arg Asn Gly Phe Ile Gln Ser Leu
245 250 255
Lys Asp Asp Pro Gly Asn Ser Met.Ala Ala Thr Ser Ser Met Ser Val
260 265 270
Glu Phe Tyr Asn Ser Asn Lys Ser Ala Gln Thr Asn Ser Ile Thr Pro
275 280 285
Ile Ile Lys Ile Thr Asn Thr Ser Asp Ser Asp Leu Asn Leu Asn Asp
290 295 300
Val Lys Val Arg Tyr Tyr Tyr Thr Ser Asp Gly Thr Gln Gly Gln Thr
305 310 315 320
Phe Trp Cys Asp His Ala Gly Ala Leu Leu Gly Asn Ser Tyr Val Asp
325 330 335
Asn Thr Ser Lys Val Thr Ala Asn Phe Val Lys Glu Thr Ala Ser Pro
340 345 350
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
8
Thr Ser Thr Tyr Asp Thr Tyr Val Glu Phe Gly Phe Ala Ser Gly Arg
355 360 365
Ala Thr Leu Lys Lys Gly Gln Phe Ile Thr Ile Gln Gly Arg Ile Thr
370 375 380
Lys Ser Asp Trp Ser Asn Tyr Thr Gln Thr Asn Asp Tyr Ser Phe Asp
385 390 395 400
Ala Ser Ser Ser Thr Pro Val Val Asn Pro Lys Val Thr Gly Tyr Ile
405 410 915
Gly Gly Ala Lys Val Leu Gly Thr Ala Pro
420 425
<210>
9
<211>
984
<212>
DNA
<213>
recombinant
nucleotide
sequence
<220>
<221>
mist
feature
<222>
(68)..(624)
<223>
taken
from
Clostridium
cellulovorans
<220>
<221>
mist
feature
<222>
(652)..(981)
<223>
taken
from
bovine
<400>
9
catatgaaagaaaccgctgctgctaaattcgaacgccagcacatggacag cccagatctg60
ggtaccctggtgccacgcggttccatggcagcgacatcatcaatgtcagt tgaattttac120
aactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaat tactaacaca180
tctgacagtgatttaaatttaaatgacgtaaaagttagatattattacac aagtgatggt240
acacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaa tagctatgtt300
gataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagccc aacatcaacc360
tatgatacatatgttgaatttggatttgcaagcggacgagctactcttaa aaaaggacaa420
tttataactattcaaggaagaataacaaaatcagactggtcaaactacac tcaaacaaat480
gactattcatttgatgcaagtagttcaacaccagttgtaaatccaaaagt tacaggatat590
ataggtggagctaaagtacttggtacagcaccaggtccagatgtaccatc ttcaataatt600
aatcctacttctgcaacatttgatcccggtaccatgggtcctcctcctgg aagcacttcc660
gctgccagcagctccaactattgcaaccagatgatgaagagccggaacct gaccaaagat720
cgatgcaagccagtgaacacctttgtgcacgagtccctggctgatgtcca ggccgtgtgc780
tcccagaaaaatgttgcctgcaagaatgggcagaccaattgctaccagag ctactccacc840
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
9
atgagcatca ccgactgccg tgagaccggc agctccaagt accccaactg tgcctacaag 900
accacccagg cgaataaaca catcattgtg gcttgtgagg gaaacccgta cgtgccagtc 960
cacttcgacg cttcagtgta gatc 984
<210> 10
<211> 326
<212> PRT
<213> recombinant protein sequence
<220>
<221> mist feature
<222> (30)..(208)
<223> taken from Clostridium cellulovorans
<220>
<221> mist feature
<222> (226)..(326)
<223> taken from bovine
<400> 10
His Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His Met Asp
1 5 10 15
Ser Pro Asp Leu Gly Thr Leu Val Pro Arg Gly Ser Met Ala Ala Thr
20 25 30
Ser Ser Met Ser Val Glu Phe Tyr Asn Ser Asn Lys Ser Ala Gln Thr
35 40 45
Asn Ser Ile Thr Pro Ile Ile Lys Ile Thr Asn Thr Ser Asp Ser Asp
50 55 60
Leu Asn Leu Asn Asp Val Lys Val Arg Tyr Tyr Tyr Thr Ser Asp Gly
65 70 75 80
Thr Gln Gly Gln Thr Phe Trp Cys Asp His Ala Gly Ala Leu Leu Gly
85 90 95
Asn Ser Tyr Val Asp Asn Thr Ser Lys Val Thr Ala Asn Phe Val Lys
100 105 110
Glu Thr Ala Ser Pro Thr Ser Thr Tyr Asp Thr Tyr Val Glu Phe Gly
115 120 125
Phe Ala Ser Gly Arg Ala Thr Leu Lys Lys Gly Gln Phe Ile Thr Ile
130 135 140
Gln Gly Arg Ile Thr Lys Ser Asp Trp Ser Asn Tyr Thr Gln Thr Asn
145 150 155 160
Asp Tyr Ser Phe Asp Ala Ser Ser Ser Thr Pro Va1 Val Asn Pro Lys
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
165 170 175
Val Thr Gly Tyr Ile Gly Gly Ala Lys Val Leu Gly Thr Ala Pro Gly
180 185 190
Pro Asp Val Pro Ser Ser Ile Ile Asn Pro Thr Ser Ala Thr Phe Asp
195 200 205
Pro Gly Thr Met Gly Pro Pro Pro Gly Ser Thr Ser Ala Ala Ser Ser
210 215 220
Ser Asn Tyr Cys Asn Gln Met Met Lys Ser Arg Asn Leu Thr Lys Asp
225 230 235 240
Arg Cys Lys Pro Val Asn Thr Phe Val His Glu Ser Leu Ala Asp Val
245 250 255
Gln Ala Val Cys Ser Gln Lys Asn Val Ala Cys Lys Asn Gly Gln Thr
260 265 270
Asn Cys Tyr Gln Ser Tyr Ser Thr Met Ser Ile Thr Asp Cys Arg Glu
275 280 285
Thr Gly Ser Ser Lys Tyr Pro Asn Cys Ala Tyr Lys Thr Thr Gln Ala
290 295 300
Asn Lys His Ile Ile Val Ala Cys Glu Gly Asn Pro Tyr Val Pro Val
305 310 315 320
His Phe Asp Ala Ser Val
325
<210> 11
<211> 29
<212> DNA
<213> Synthetic Oligonucleotide;
<900> 11
gggggaattc catggcagcg acat 24
<210> 12
<211> 18
<212> DNA
<213> Synthetic Oligonucleotide;
<400> 12
gggggatcct atggtgct 1g
<210> 13
<211> 22
CA 02390568 2002-05-08
WO 01/34091 PCT/IL00/00708
11
<212> DNA
<213> Synthetic Oligonucleotide;
<400> 13
ggggggtacc atggaacaac gc 22
