Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
METHOD OF TREATING GASTROINTESTINAL TRACT
DISEASE WITH PURINERGIC RECEPTOR AGONISTS
INTRODUCTION
This application claims priority to U.S. Provisional Application Serial No.
60/171,710, filed December 22, 1999, which is hereby incorporated herein in
its entirety
by reference.
Technical Field
This invention relates to a method of regulating mucus secretions and fluid
transport in the gastrointestinal system of a patient by administering
purinergic receptor
agonists such as certain uridine, adenine, or cytidine 5'-di- and
triphosphates,
dinucleoside polyphosphates and their analogs thereof.
Background of the Invention
There are many situations where it is therapeutically desirable to increase
the
amount of mucin secretion, bicarbonate secretions, and/or degree of hydration
in
gastrointestinal systems. The gastrointestinal system operates principally to
extract
energy and metabolic building blocks from the nutrient materials presented to
it. The
digestive tract includes the buccal cavity (primary salivary glands),
esophagus, stomach,
small intestine, large intestine, rectum, and ancillary organs (pancreas,
liver and gall
bladder). When the mucosal barrier is impaired in the digestive tract, it
results in diseases
such as dry mouth, gastro-esophageal reflux disease, peptic ulcer,
inflammatory bowel
disease, etc. Abnormal fluid and electrolytic transport in the lower
gastrointestinal tract
results in disorders such as constipation and diarrhea.
Mucus is a viscous material that coats many epithelial surfaces and is
secreted into
fluids such as saliva. It is composed chiefly of mucins and inorganic salts
suspended in
water. Mucus adheres to many epithelial surfaces, where it serves as a
diffusion barrier
against contact with noxious substances (e.g. gastric acid, digestive enzymes
and bacteria)
and as a lubricant to minimize shear stresses. Such mucous coatings are
particularly
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
prominent on the epithelia of the gastrointestinal, respiratory and genital
tracts. Mucous
is also an abundant and important component of saliva, giving it virtually
unparalleled
lubricating properties. Mucus-secreting cells such as goblet cells are
abundant in the
epithelium of the gastrointestinal tracts. Numerous submucosal mucous glands
are
scattered along the esophagus and especially accumulated below the upper and
above the
lower esophageal sphincters. Many of the acinar epithelial cells in salivary
glands secrete
mucus. The major structural molecules of the mucus layer are mucins, which are
a family
of large, heavily glycosylated proteins. The dense "sugar coating" of mucins
gives them
considerable water-holding capacity and makes them resistant to proteolysis,
which may
be important in maintaining mucosal barriers.
Bicarbonate secretion plays an important role in the maintenance of mucosal
health in the gastrointestinal tract. The production of bicarbonate and mucus
by the
esophagus in response to local acidification provides an inherent mechanism
for resisting
acid-induced damage. The secretion of salivary protective factors, including
bicarbonate,
1 ~ as well as bicarbonate secreted from esophageal submucosal glands, are
important in
preventing esophageal mucosal injury associated with gastrointestinal reflux
disease.
Mucosal bicarbonate also provides an important mechanism for protection
against acid
damage in the proximal duodenum, in which adherent mucus provides a stable
protective
layer supporting surface neutralization of acid by mucosal bicarbonate.
Nucleotides
stimulate bicarbonate secretion in guinea pig pancreatic duct (Ishiguro et al.
1999, J.
Physiol. 519 Pt 2:551-558) and CFTR knockout mouse gall bladder epithelium
(Clarke et
al. 2000, Am. J. Physiol. Gastrointest. Liver Physiol. 279: 6132-138)J.
Proper regulation of fluid and electrolytic absorption and secretion at
appropriate
regions along the gastrointestinal system is required for normal digestive
function.
Impairment of fluid transport leads to a variety of disorders, including
constipation and
diarrhea. Constipation is associated with a delay in the transit of fecal
matter through the
large intestine. The increased resident time of feces in the large intestine
leads to
increased fluid absorption by-the colonic epithelium, and results in
dehydration of feces
and the subsequent production of dry, hard feces in the descending colon.
Conversely,
2
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
diarrhea results from rapid movement of fecal matter through the large
intestine, resulting
from either increased fluid secretion in the small intestine or by reduced
fluid absorption
in the colon.
Xerostomia, commonly known as dry mouth, results from the underproduction of
saliva. Dry mouth is caused by radiation treatment or diseases that damage
salivary
glands and decrease salivary flow. Gastroesophageal reflux disease is the
condition
where the degree of exposure of esophageal mucosa to gastric contents is
greater than
normal. The most common manifestation is heartburn. Pharmacological treatment
involves the use of H2 antagonists (e.g., Tagamet°, Zantac°,
Pepcid°, Axid°) and proton
pump inhibitors such as Prilosec° or Prevacid°, for treatment of
acute disease. Peptic
ulcer diseases include gastric ulcer, pyloric channel ulcer and duodenal
ulcer. Ulceration
results from a complex interplay of acid and chronic inflammation induced by
Helicobacter pylori infection. Patients with duodenal ulcers have high acid
secretion.
Increased acid secretion causes changes in the wall of the duodenum, setting
the stage for
invasion by H. pylori. Drugs for treating peptic ulcer diseases include
Histamine-2 (H2)
blockers (Tagamet°, Zantac°, Axid°, Pepcid°,
etc.), sucralfate, proton pump inhibitors,
and antacids. Inflammatory bowel disease is classified into two types:
ulcerative colitis
and Crohn's disease. Ulcerative colitis affects the colon/rectum and involves
the mucosa
or the innermost lining of the colon wall. Crohn's disease is a transmural
disease
involving all layers of the bowel and may involve any part of the gut, from
mouth to anus.
Medical treatment of inflammatory bowel disease includes aminosalicylates and
corticosteroids. Corticosteroids have substantial long-term toxicity. As an
alternative to
conventional therapies, medical researchers have sought to develop new
treatments for
gastrointestinal diseases.
The following references disclose the role of mucus integrity and mucin
secretion
in some diseases of the gastrointestinal tract. Rhodes et al. (Gut, 26:1312-
1318 (1985))
suggested that colonic mucus undergoes continual desulphation and desialation
in vivo as
a result of faecal enzyme activity; altered susceptibility of colonic mucus
may be
important in the pathogenesis of colonic disease. Somasundaram et al. (Clip.
Exp.
3
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
Pharmacol. Physiol., 14:309-318 (1987)) report that the integrity of the
gastric mucosa
and its ability to secrete mucus are essential for protection of gastric
mucosa against
ulceration induced by aggressive factors active in any stress situation. Desai
et al. (J.
Pharm. Pharmacol. 47:734-738 (1995)) showed that SKF 38393, a specific
dopamine
Dl-receptor agonist, was effective in preventing gastric and duodenal
ulceration in rats.
Sarosiek et al. (Digestion, 56 Suppl. 1:15-23 (1995)) reported that the rate
of secretion of
esophageal mucin, EGF and PGE2, under the impact of HC 1 /pepsin in patients
with
reflux esophagitis, was significantly impaired. Saitoh et al. (Dig. Dis. Sci.
41:1768-1774
(1996)) showed that compared with healthy subjects, the total yields of mucin
from
ulcerative colitis patients were low due to a deficiency of neutral mucin,
whereas those
from Crohn's disease patients were high due to high-molecular weight mucin.
Sarosiek et
al. (Gastroenterology, 110:675-681 (1996)) suggest that an increase in the
secretion rate
of inorganic and organic protective components in saliva may be useful to the
treatment
of gastroesophageal reflux disease. Zeeh (Gastroenterology, 110:1077-1083
(1996))
reported that administration of keratinocyte growth factor ameliorates mucosal
injury in
an experimental model of colitis in rats. Abbas et al. (Indian J. Exp. Biol.
36:182-186
(1998)) report that the antiulcerogenic effect of GABA and baclofen may be due
to their
predominant effects on mucosal defensive factors like enhanced mucin secretion
and
decreased cell shedding or mucosal damage. Nath et al. (Clip. Exp. Pharmacol.
Physiol.
25:564-567 (1998)) report that polyriboinosinic-polyribocytidylic acid had a
potent anti-
gastric ulcer effect on rats; polyriboinosinic-polyribocytidylic acid was
shown to cause a
decrease in free and total acid and pepsin and an increase in mucin content in
Shay rat.
Newton et al. (Gut, 43:470-475 (1998)) report that H. pylori in vivo causes
structural
changes in the adherent gastric mucus layer but the mucus barrier thickness is
not
compromised.
The following references disclose the compositions of purinergic receptor
agonists
and/or treatment of diseases. Uridine 5'-triphosphate has been shown to
increase both the
rate and total amount of mucin secretion by Goblet cells in vitro (Lethem et
al., Am. J.
Respir. Cell Mol. Biol., 9:315-322 (1993)). USPN 5,900,407 (Yerxa et al.)
discloses a
4
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
method for the stimulation of tear secretion in a subject in need of
treatment. The method
comprises administering to the ocular surfaces of the subject a purinergic
receptor agonist
such as uridine 5'-triphosphate, cytidine 5'-triphosphate, adenosine S'-
triphosphate, or
their analogs and derivatives, in an amount effective to stimulate tear fluid
secretion.
USPN 5,837,861 (Pendergast et al.) discloses P2Yz purinergic receptors of
dinucleotide
polyphosphates having structure of Formula I, wherein X is oxygen, methylene,
or
difluoromethylene; n=0 or 1; m=0 or 1; n+m=0, 1 or 2; and B and B' are each
independently a purine residue or a pyrimidine residue linked through the 9-
or 1-position.
The compounds are useful in the treatment of chronic obstructive pulmonary
diseases,
bronchitis, certain pneumonias, cystic fibrosis, sinusitis, and otitis media.
USPN
5,763,447 (Jacobus et al.) discloses a method of promoting drainage of mucous
secretions in the congested airway of an immobilized patient. The method
comprises
administering to the airway of the patient a uridine phosphate such as uridine
5'-
triphosphate (UTP), or P,'P4 -di(uridine-5')tetraphosphate, in an amount
effective to
promote drainage of fluid in the congested airway, including sinuses, by
hydrating
mucous secretions or by stimulating ciliary beat frequency in the airway. USPN
5,789,391, 5,981,506, 5,972,904 and 5,958,897 are directed to a method of
promoting
drainage of congested mucous secretions in the sinuses of a subject in need.
The method
comprises administering to the sinuses of the subject a uridine phosphate such
as uridine
5'-triphosphate (UTP) or P', P4~li(uridine-5') tetraphosphate, an analog of
UTP, or any
other analog, in an amount effective to promote drainage of congested fluid in
the sinuses
by hydrating mucous secretions or by stimulating ciliary beat frequency in the
sinuses.
USPN 5,968,913 is directed to a pharmaceutical compositions of UTP for use in
promoting increased mucociliary clearance of retained mucous secretions of the
human
airways, middle/inner ears or sinuses. USPN 5,763,447 is directed to a method
of
preventing or treating pneumonia, including ventilator-associated pneumonia,
in a
bedridden or immobilized subject in need of such treatment. The method
comprises
administering to the airways of the patient a uridine phosphate such as
uridine 5'-
triphosphate (UTP), P', P4 -di(uridine-5')tetraphosphate, or their analogs, in
an amount
5
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
effective to promote drainage of fluid in the congested airways. WO 99/09998
discloses a
method of using uridine 5'-diphosphate and analogs thereof to treat lung
disease. The
compounds described in the above references ('391, '506, '904, '897, '913 and
'447
Patent and WO 99/09998), which have purinergic receptor activity, are
incorporated
herein by reference. USPN 5,733,916 (Neely) discloses a method of preventing
or
treating ischemia-reperfusion injury or endotoxin-related lung injury by
administration of
a composition containing a selective A, adenosine receptor antagonist and/or a
PZX
purinoceptor antagonist. Somers et al. (Laboratory Investigation, 78:1375-1383
(1998))
report that P2Y6 receptor was highly expressed in the T cells infiltrating
active
inflammatory bowel disease, whereas P2Y6 expression was absent from the T
cells of
unaffected bowel. Boyer et al., (Br. J. Pharmacol. 118:1959 (1996))
synthesized and
tested a series of chain-extended 2-thioether derivatives of adenosine
monophosphate
(AMP) as agonsists for activation of the phospholipase C-linked P2Y-
purinoceptor of
turkey erythrocyte membranes, the adenylyl cyclase-linked P2Y-purinoceptor of
C6 rat
glioma cells, and the cloned human P2U-receptor stably expressed in 1321N1
human
astrocytoma cells.
Specific dinucleotide phosphate compounds known in other prior art are listed
in
Table I, along with their corresponding references. These compounds have not
been used
in the prior art to increase the mucus secretion or to correct for fluid and
electrolytic
imbalance in the gastrointestinal tract, and Applicants intend to include them
in this
invention.
6
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
TABLE I
DINUCLEOTIDE PHOSPHATE COMPOUNDS IN THE LITERATURE
Gp2G Ap2TAD Ap3A m'Gp3G Ap4A Ap4C
m'Gpzm'G ApzC-NAD Xp3X mzz~'Gp3G CpaC ApaG
UpzU ApzC-PAD rn'Gp3m'G mz''Gp3G GpaG GpaU
(5-Br~Pi(5-Br~Ap~BAD Gp3G Ap3U XpaX GpaC
'
~ m GpzG (5-BrU)Ps(5-BrU)Ap3(5-BrU)DpaD UPaC
(~Z7Pz(~
(5-FU)pz(S-FU)ApzG Cp3C Up3(5-BrU)eApaeA ApaT
IPzI APzU IPsI Gp3A m'Gpam'G m'GpaG
APz(5-Br~ AP-CHz-PPA GP3C (5-Br~Po(5-BrU)mz~'GpaG
Upz(5-BrU)Ap-CFz_ppA Gp3Gm dApadA mz'z''GPaG
(~~Pz(S-FU) GP3~ 3'-~Pa3'-~ (S-BrU)PaA
APzT m'Gp3m6Am dGpadG (5-BrU)paU
m'AP3~ AP APa
H $-
PsA A)
2dGp P3 I A
A y. X
Pa Pa
2 G Ap C ~ pPa~
Ap A
C
2 m Z A
p
Ip3A DpzCHzpzD Apad(5-FU)
IP3G DPzCFzPzD ApaaraA
2'dGp3A ApzCHzpzU
2'dGp3-2'dG ApzCHzpzG
m'Gp3Am Ap3CH,pT
Gp3 U ahaAp,A
GP ahaAPaG
3
m'G
Um
p
m'Gp3G
APP-CHz-pT
Ps Ps Ps P6
APSH 'yPs l AP6A AP61
UpSU ApSU Up6U Ap6U
(5-BrU)ps(5-BrU)Aps(5-BrU) (5-BrU)pb(5-BrU)Upb(5-BrU)
GpSG Ups(5-BrU) GPeG Apb(5-BrU)
2'dGp52'dG
IpSI
A = Adenosine eA = Ethenoadenosine
U = Uridine m'G = 7-Methylguanosine
G = Guanosine mz~'G = 2,7-Dimethylguanosine
T = Thymidine m2z~'G = 2,2,7-Trimethylguanosine
X = Xanthosine NAD = nicotinamide riboside
TAD = Tiazofurin C-NAD = C-nicotinamide riboside
BAD = Benzamide riboside C-PAD = C-picolinamide riboside
D = 2,6-Diaminopurine - N = Nucleoside
Gm = 2'-O-methylguanosine Am = 2'-O-methyladenosine
Um = 2'-O-methylundme m6Am = N6-methyl-2'-O-methyladenosine
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
Cm = 2'-O-methylcytidine aha = 8-(6-aminohexyl)
X= Xanthosine AZT =Thymine-3'-azido2',3'-dideoxy-D-riboside
5-BrU = 5-bromouridine 5-FU = 5-fluorouridine
(1) M.A.G. Sillero et al., Eur. J. Biochem., 76, 331
(1977)
(2) C.G. Vallejo et al., Biochim. Biophys. Acta, 483,
304 (1976)
(3) H. Coste et al., J. Biol. Chem., 262, 12096 (1987)
(4) K.E. Ng et al., Nucleic Acid Res., 15, 3573 (1987)
(5) J. Stepinski et al., Nucleosides & Nucleotides,
14, 71711995)
(6) A. Zatorski et al., J. Med. Chem., 39, 2422 (1996)
(7) P. Rotilan et al., FEBS, 280, 371 (1991)
(8) P.C. Zamecnik et al., Proc. Natl. Acad. Sci., 89,
2370 (1992)
(9) J. Walker et al., Biochemistry, 32, 14009 (1993)
(10) R.H. Hiderman et al., J. Biol. Chem., 266, 6915
(1991)
(11) J. Luthje et al., Eur. J. Biochem., 173, 241 (1988)
(12) R.H. Silverman et al., Microbiological Rev., 43,
27 (1979)
(13) C.D. Lobaton et al., Eur. J. Biochem., 50, 495
(1975)
(14) G. Lowe et al., Nucleosides & Nucleotides, 10,
181 (1991)
(15) G.M. Blackburn et al., Nucleosides & Nucleotides,
10, 549 (1991)
(16) J.C. Baker et al., Mutation Res., 208, 87 (1988)
(17) G. Klein et al., Biochemistry, 27, 1897 (1988)
(18) E. Castro et al., Br. J. Pharmacol., 100, 360 (1990)
(19) D.R. Elmaleh et al., Proc. Natl. Acad. Sci., 81,
918 (1984)
(20) R. Bone et al., J. Biol. Chem., 261, 16410 (1986)
(21) Fed. Amer. Soc. Exper. Bio., Abstr. Part I, no.
1878 (1991)
(22) M.T. Miras-Portugal et al., Ann. NY Acad. Sci.,
603, 523 (1990)
(23) A. Guranowski et al., Biochemistry, 27, 2959 (1988)
(24) F. Grummt et al., Plant Mol. Bio., 2, 41 (1983)
(25) A.G. McLennan et al., Nucleic Acid Res., 12, 1609
(1984)
(26) P. Zamecnik et al., Analytical Biochem., 134, 1
(1983)
(27) E. Rapaport et al., Proc. Natl. Acad. Sci., 78,
838 (1981)
(28) T. Kimura et al., Biol. Pharm. Bull., 18, 1556
(1995)
(29) E. Schulze-Lohoff et al., Hypertension, 26, 899
(1995)
(30) B.K. Kim et al., Proc. Natl. Acad. Sci., 89, 11056
(1992)
(31) P.C. Zamecnik et al., Proc. Natl. Acad. Sci., 89,
2370 (1992)
(32) H. Morii et al., Eur. J. Biochem., 205, 979 (1992)
(33) E. Castro et al., Pflugers Arch., 426, 524 (1994)
(34) H. Schluter et al., Nature, 367, 186 (1994)
(35) E. Castro et al., Br. J. Pharmacol., 206, 833 (1992)
(36) T. Casillas et al., Biochemistry, 32, 14203 (1993)
(37) J. Pintor et al., J. Neurochem., 64, 670 (1995)
(38) E. Castro et al., J. Biol. Chem., 270, 5098 (1995)
(39) V.A. Panchenko et al., Neuroscience, 70, 353 (1996)
(40) E. Castro et al., Br. J. Pharmacol., 100, 360 (1990)
(41) J. Pintor et al., Gen. Pharmac., 26, 229 (1995)
(42) J. Pintor et al., Br. J. Phamacol., 115, 895 (
1995)
(43) A. Kanavarioti et al., Tett. Lett., 32, 6065 (1991)
(44) Stutts, M. J., III, et al. WO 96/40059
(45) Theoclitou, et al. J. Chem. Soc. Perkin Trans I,
2009-2019 (1996)
(46) Guranowski, A., et al. Nucleosides and Nucleotides,
14, 731-734 (1995)
(47) De Flora, A., et al. WO 96/02554A1
(48) Visscher, J. et al. Nucleic Acids Research, 20
, 5749-5752 (1992)
(49) Holler, E.; Holmquist, B, et al. Biochemistry,
22, 4924-4933 (1983)
(50) Orr, R. M.; et al. Bioehem. Pharmacol. 673-677
(1988)
(51) Plateau, P., Fromant, et al. Biochemistfy, 24,
914-922 (1985)
(52) Hagmeier, E., et al. Journal of Chromatography,
237, 174-177 (1982)
(53) Scheffzek, K, et al. Biochemistry, 35, 9716-9727
(1996)
8
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
(54) Stridh, S., et al. Antiviral Research, 97-105 (1981)
(55) Tarusova, N. B., et al. Zh. Org. Khim., 24(7), 1474-1480 (Russian);
through
Chem. Abs. 110:154770 (1988)
(56) Hata, T., et al. Chem. Lett., 987-990 (1976)
(57) Huhn, G. F., et al. Separation Science and Technology, 28, 1959-1970
(1993)
(58) Tumanov, Yu. V., et al. Bioorg. Khim., 13, 921-927 (Russian); through
Chem
Abs., 109:6867d (1987)
(59) Devash, Y. US Patent No. 4,855,304
(60) Pintor, J., et al. Molecular Pharmacology 51, 277-284 (1997)
(61) Stutts et al. US Patent No. 5,635,160.
(62) Thiermermann, C., et al. WO 98/55494
(63) Zamechik, P.C., et al. US Patent No. 5,049,550
(64) Pankiewicz, K.W., et al. W098/15563
(65) Kim, B.K., et al. U.S. Patent No. 5,681,823
(66) Stuffs, et al., U.S. Patent No. 5,935,555
P2Y purinergic receptors are purine and pyrimidine nucleotide receptors that
couple to G proteins; they are 308 to 377 amino acid proteins with molecular
weights of
41 to 53 kDa after glycosylation. P2Y receptors such as P2Y,, P2Y2 and P2Y6
receptors
are present in the gastrointestinal tract (Ralevic et al., Pharm. Rev. 50:415-
492 (1998)).
Because of the demonstrated ability of purinergic receptor agonists to
stimulate
mucus/mucin secretion in and around the eye (USPN 5,900,407), and in lung and
sinuses
(USPN 5,837,861 ), Applicants were motivated to investigate whether P2Y
purinergic
receptor ligands could affect mucus and/or mucin secretion, and to correct
abnormal fluid
transport in the gastrointestinal tract, and thus be effective in treating
diseases and
disorders of the upper and lower gastrointestinal tract.
Applicants have discovered that all P2Y receptors, including P2Y~ and P2Y" are
present in gastrointestinal tissues. Applicants also discover that mucus and
mucin
secretion, bicarbonate secretion and fluid transport in these tissues can be
regulated via
P2Y purinergic receptor-mediated mechanisms. P2Y purinergic receptor ligands,
administered orally or systemically, provide a novel method of treating
gastrointestinal
disorders.
9
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
SUMMARY OF THE INVENTION
The invention provides a method of regulating mucus/mucin secretions, and
fluid
transport in the gastrointestinal tract. The invention provides a method for
treating
gastrointestinal disease in which the mucosal barrier of the gastrointestinal
system is
impaired. The invention additionally provides a method for correcting
disorders of fluid
secretion or absorption in the gastrointestinal tract resulting in either
diarrhea or
constipation. The method comprises administering to a patient a pharmaceutical
composition comprising a purinergic P2Y receptor ligand, in an amount
effective to
regulate mucus/mucin and bicarbonate secretions and fluid transport in the
gastrointestinal tract. Methods of administering include oral and systemic
administration.
The diseases treated include diseases and disorders of the buccal cavity,
esophagus,
stomach, small intestine, large intestine, rectum, and ancillary organs such
as pancreas,
liver and gall bladder.
The pharmaceutical composition used in this invention comprises a P2Y
purinergic receptor agonist. P2Y agonists increase secretion of water,
bicarbonate and
mucin in the mucosal epithelia of the gastrointestinal tract. P2Y agonists
include uridine
5'- di-and triphosphate (UDP, UTP) and their analogs (Formulae Ia and Ib),
adenosine 5'-
monophosphate (AMP) and its analogs, adenosine 5'- di-and triphosphate (ADP,
ATP)
and their analogs (Formulae IIa and IIb), cytidine 5'- di-and triphosphate
(CDP, CTP) and
their analogs. (Formulae IIIa and IIIb), and dinucleotide polyphosphate
compounds
(general Formula IV).
BRIEF DESCRIPTION OF THE FIGURES
The file of this patent contains at least one drawing executed in color.
Copies of
this patent with color drawings) will be provided by the Patent and Trademark
Office
upon request and payment of the necessary fee.
Figure 1 shows the P2Y~ receptor in situ hybridization results of stomach
tissues
(gastric epithelia) with (a) control sense probe and (b) antisense probe.
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
Figure 2 shows the P2YZ receptor in situ hybridization results of esophagus
epithelia with (a) control sense probe and (b) antisense probe.
Figure 3 shows the P2Yz receptor in situ hybridization results of the large
intestine
(colon) epithelia with (a) sense probe and (b) antisense probe.
Figure 4 shows the P2Yz receptor in situ hybridization results of the small
intestine (jejunum) epithelia with (a) sense probe and (b) antisense probe.
Figure 5 shows calcium mobilization induced by P2Y receptor agonists in human
colonic epithial cells.
Figure 6 shows calcium mobilization induced by P2Y receptor agonists in HT-29
human colonic epithelial cells.
DETAILED DESCRIPTION OF THE INVENTION
The invention provides a method of regulating mucous secretions, bicarbonate
secretion, and fluid transport in the gastrointestinal tract. The invention
also provides a
method of treating gastrointestinal disease in which the mucosal barrier of
the organ is
impaired, or in which an imbalance of fluid absorption rf secretion occurs in
the small and
large intestine. The method comprises administering to a mammal a
pharmaceutical
composition comprising a purinergic P2Y receptor ligand, in an amount
effective to
regulate mucus or mucin secretions, bicarbonate secretion, or fluid transport
in the
gastrointestinal tract. The method enhances the mucin release, pH and
hydration, or
regulates the fluid transport in the gastrointestinal tract.
Gastrointestinal diseases suitable for treatment by this invention include
diseases
or disorders affecting the buccal cavity (primary salivary), esophagus,
stomach, small
intestine, large intestine, rectum and ancillary organs such as pancreas.
liver and gall
bladder. For example, dry mouth, mouth ulcer, gum disease, esophageal reflux
disease,
peptic ulcer, inflammatory bowel disease (ulcerative colitis and Crohn's
disease),
mycositis, diarrhea and constipation can be treated by the present method. In
addition,
gastrointestinal problems associated with cystic fibrosis diseases such as dry
mucin and
decreased absorption of nutrient by epithelial cells in the gastrointestinal
tract can also be
11
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
treated by the present method. In addition, gastrointestinal problems caused
by cancer
and chemotherapy can also be treated by this method.
Mucin has been shown to be important in protecting mucosal surfaces from
environmental exposure; it acts as an acid barner and has been found to bind
to
pathogens. Mucin is thus a part of the natural mucosal defense system in the
body, and
stimulation of its secretion may lead to protection of the mucosal surface
epithelium. The
method of the present invention is to increase the mucous secretions in
gastrointestinal
tracts, such as stomach and esophagus, thus strengthening the natural defense
system.
The epithelial lining of the human esophagus consists of squamous epithelium
and
submucosal glands that serve as a natural barrier between the lumen and blood
and act as
protective lining against the physical perturbations of the infested food and
against the
acidic gastric juices from the stomach. The esophageal submucosal glands
contain
mucous, serous, and myoepithelial cell types. Submucosal glands in the airways
and
conjunctiva contain P2Yz receptors in mucosal epithelia of the esophagus.
Activation of
P2Y2 receptors by natural and synthetic agonists increases mucus secretion
into and
hydration of the mucosal layer of the esophagus.
A variety of pathophysiological conditions lead to the erosion of the
protective
mucosal barrier of the esophagus, resulting in gastroesophageal reflux disease
(GERD).
The symptoms of GERD include mild to severe heartburn, esophageal inflammation
(esophagitis), regurgitation, dysfunctional swallowing, and chest pain. GERD
is caused
by a variety of factors, including abnormal function of the lower esophageal
sphincter
(which allows reflux of gastric juices into the lower esophagus), delayed
stomach
emptying, reduced rates of esophageal clearance, and diminished salivation.
When the
esophagus is exposed to high acid content during gastric reflux, it results in
a breakdown
of the protective mucus layer. The present invention discloses that in an
animal model of
esophagitis, P2Yz receptor agonists can restore the integrity of the disrupted
esophageal
mucosal layer by naturally stimulating mucin, bicarbonate, and fluid
production by
squamous epithelia and/or submucosal glands.
12
CA 02395108 2002-06-19
WO 01/45691 PCT/I1S00/35439
Gastric ulcers and gastric reflux are conditions characterized in part by a
breakdown in the mucosal defense barrier of the upper gastrointestinal
epithelium.
Excessive acid secretion in the stomach can lead to a breakdown in the natural
mucus
layer that protects the epithelial cells from acid damage. Gastric ulcer is
associated with,
but not limited to stress, diet, H. pylori infection, chemotherapy or
radiotherapy, other
autoimmune diseases such as Sjogren's syndrome, etc., surgery, psychosomatic
disorders,
stress, anxiety, and pharmacological drug-related side effects.
The crypts of Lieberkuhn along the small intestine play a principal role in
mediating fluid secretion into the lumen of the small intestine. Chloride
efflux across
apical membrane chloride channels at the apical membrane of epithelial cells
along these
crypts provide the driving force for osmotically obliged fluid secretion in
the small
intestine. Constipation and diarrhea result from abnormal fluid transport
(absorption
verses secretion) across the small and large intestines. The present invention
discloses a
method to correct for imbalance of fluid transport leading to either
constipation or
diarrhea by targeting activation of P2Y receptors along the small and large
intestines. In
pathological conditions, such as exposure to cholera toxin, the apical
chloride channels
are constitutively active, thus leading to uncontrolled fluid secretion into
the small
intestine, extreme diarrhea, and mortal bodily dehydration. This observation
has provided
a scientific rationale for treating constipation and diarrhea.
The activation of chloride and fluid secretion across the small intestines is
known
to provide additional fluid to chyme before it becomes fecal matter in the
large intestine.
This addition of fluid to the chyme will thus offset the hyper-absorption of
fluid in the
large intestine leading to constipation. The present invention discloses that
activation of
P2Y receptors by agonists provide a mechanism for providing such increase in
chloride
and fluid secretion into the small intestine and can be used therapeutically
to treat
constipation.
The colonic epithelia of the large intestine normally absorb fluid and
function to
remove excessive fluid from the entering chyme from the small intestine and
convert it
into feces. Diarrhea results from excessive fluid in the entering chyme, or
malabsorption
13
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
of fluid across the colon. Fluid absorption along the colonic epithelia is
mediated by
sodium absorption via apical membrane sodium channels and basolateral membrane
sodium potassium transporters. The fluid absorption properties of this
epithelium can be
modulated electrogenically by calcium-activated potassium channels at the
basolateral
membrane. Increase in basolateral membrane potassium conductance
hyperpolarizes the
apical and basolateral membranes and thus increases the electrogenic driving
force for
sodium influx across the apical membrane. This results in a concomitant
increase in
sodium and potassium absorption by the epithelium, and increases ion-coupled
fluid
absorption. The present invention discloses that activation of P2Y
purinoceptors by
agonists increases basolateral membrane potassium conductance and facilitates
fluid
removal from feces. Therefore direct administration of P2Y receptor agonists
can be used
therapeutically to treat diarrhea.
The present method comprises administering to a patient a pharmaceutical
composition that regulates mucus/mucin secretion, hydration and fluid
transport in the
gastrointestinal tract. The present method has advantages over other commonly
used
treatments. The method regulates a patient's own production and secretion of
mucus as
well as the levels of mucosal hydration. Thus the method maintains the natural
protective
and lubricant characteristics of mucosa of gastro-intestinal system and
directly addresses
the problem resulting from mucus impairment. The present invention is
concerned
primarily with the treatment of human subjects, but may also be employed for
the
treatment of other mammalian subjects, such as dogs and cats, for veterinary
purposes.
Applicants have discovered that (a) many purinergic P2Y receptors (P2Y,, P2YZ,
P2Y4,
P2Y6, and P2Y") are present in gastrointestinal tissues such as salivary
glands,
esophagus, stomach, small intestine, colon, duodenum, and rectum; (b) a potent
purinergic receptor agonist increases the secretion of mucin, and regulates
fluid transport
in the mucosal epithelia of the gastrointestinal tract.
P2Y agonists include nucleotide mono-, di-, and triphosphates and dinucleotide
polyphosphates. Nucleotide monophosphates useful in this invention include
adenosine
5'-monophosphate (AMP) and its derivatives such as 2-thioether-substituted
AMP, e.g.,
14
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
2-hexylthio AMP (Br. J. Pharmacol. 118:1959 (1996)). Nucleotide di-and
triphosphates
useful in this application include uridine 5'-di- and triphosphate (UDP and
UTP) and their
analogs of general formulae Ia and Ib; adenosine 5'-di- and triphosphate (ADP
and ATP)
and their analogs of general formulae IIa and IIb; and cytosine 5'-di- and
triphosphate
(CDP and CTP) and their analogs of general formulae IIIa and IIIb.
UDP and its analogs are depicted by general formula Ia:
Formula Ia
R3 N .. . R2
O~N
O O
HO-~-R1-~-O-CH2 O
H
H
H
wherein:
~2
~3 a,
X,, and X, are each independently either O- or S-;
Y is H or OH;
R, is selected from the group consisting of O, imido, methylene, and
dihalomethylene (e.g., dichloromethylene, difluoromethylene);
R, is selected from the group consisting of H, halo, alkyl, substituted alkyl,
alkoxyl, nitro and azido;
R3 is selected from the group consisting of nothing, H, alkyl, acyl (including
arylacyl), and arylalkyl; and
R4 is selected from the group consisting of -OR', -SR', NR', and NR'R",
wherein
R' and R" are independently selected from the group consisting of H, alkyl,
substituted
alkyl, aryl, substituted aryl, arylalkyl, alkoxyl, and aryloxyl, and with the
proviso that R'
is absent when R4 is double bonded from an oxygen or sulfur atom to the carbon
at the 4-
position of the pyrimidine ring.
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
As used herein, the term"alkyl" refers to C,_,o inclusive, linear, branched,
or
cyclic, saturated or unsaturated (i.e., alkenyl and alkynyl) hydrocarbon
chains, including
for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl,
pentyl, hexyl,
octyl, ethenyl, propenyl, butenyl, pentenyl, hexenyl, octenyl, butadienyl,
propynyl,
butynyl, pentynyl, hexynyl, heptynyl, allenyl and optionally substituted
arylalkenyl and
arylalkyny groups. As used herein, the term "acyl" refers to an organic acid
group
wherein the -OH of the carboxyl group has been replaced with another
substituent (i.e., as
represented by RCO-, wherein R is an alkyl or an aryl group). As such, the
term "acyl"
specifically includes arylacyl groups. Specific examples of acyl groups
include acetyl and
benzoyl. As used herein, the term "aryl" refers to 5 and 6-membered
hydrocarbon and
heterocyclic aromatic rings. Specific examples of aryl groups include but are
not limited
to cyclopentadienyl, phenyl, furan, thiophene, pyrrole, pyran, pyridine,
imidazole,
isothiazole, isoxazole, pyrazole, pyrazine, pyrimidine, and the like. The term
"alkoxyl" as
used herein refers to C~_,o inclusive, linear, branched, or cyclic, saturated
or unsaturated
oxo-hydrocarbon chains, including for example methoxy, ethoxy, propoxy,
isopropoxy,
butoxy, t-butoxy, and pentoxy. The term "aryloxyl" as used herein refers to
aryloxy such
as phenyloxyl, and alkyl, halo, or alkoxyl substituted aryloxyl. As used
herein, the terms
"substituted alkyl" and "substituted aryl" include alkyl and aryl groups, as
defined herein,
in which one or more atoms or functional groups of the aryl or alkyl group are
replaced
with another atom or functional group, including for example, halogen, aryl,
alkyl,
alkoxy, hydroxy, nitro, amino, alkylamino, dialkylamino, sulfate, and
mercapto. The
terms "halo," "halide," or "halogen" as used herein refer to fluoro, chloro,
bromo, and
iodo groups.
Compounds illustrative of the compounds of Formula (Ia) include those
disclosed
in WO 99/09998; the reference is incorporated herein by reference. Formula Ia
compounds, for example, include: uridine 5'-diphosphate (UDP); uridine 5'-O-(2-
thiodiphosphate)(UDP13S); 5-bromouridine 5'-diphosphate (5-BrUDP); 5-(1-
phenylethynyl)-uridine 5'-diphosphate (5-(1-phenylethynyl)UDP); 5-
methyluridine 5'-
diphosphate (5-methylUDP); 4-hexylthiouridine 5'-diphosphate (4-hexylthioUDP);
4-
16
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
mercaptouridine 5'-diphosphate (4-mercaptoUDP); 4-methoxyuridine 5'-
diphosphate ( 4-
methoxyUDP); 4-(N-morpholino)uridine 5'-diphosphate ( 4-(N-morpholino)UDP; 4-
hexyloxyuridine 5'-diphosphate ( 4-hexyloxyUDP); N,N-dimethylcytidine 5'-
diphosphate ( N,N-dimethylCDP); N-hexylcytidine 5'-diphosphate ( N-hexylCDP);
and
N-cyclopentylcytidine 5'-diphosphate ( N-cyclopentylCDP).
Preferred compounds of Formula Ia include UDP and UDP(3S and 4-thio UDP.
Certain compounds of Formula Ia (e.g., UDP, dUDP, UDP(3S, and 4-mercaptoUDP)
are
known and may be made in accordance with known procedures or variations
thereof,
which will be apparent to those skilled in the art. For example, the
identification and
preparation of certain thiophosphate analogues of nucleoside diphosphates
(such as UTP-
(3-S) are set forth in U.S. Patent No. 3,846,402 (Eckstein et al.), and in
R.S. Goody and F.
Eckstein, J. Am. Chem. Soc. 93: 6252-6257 (1971). Alternatively, UDP, and
other
analogs thereof are also commercially available from vendors such as Sigma
(St. Louis,
MO) and Pharmacia (Uppsala, Sweden).
UTP and its analogs are depicted by general formula Ib;
Formula Ib
R4
R3 N RZ
O O O O~ N
HO-H-R~-H-O-~-O
X~ X2 X3
wherein:
X,, XZ and X3 are each independently either O- or S-,
Y is H or OH;
R~, RZ, R3 and R4 are defined as in Formula Ia.
Preferably, XZ and X~ are O-, R, is oxygen or imido, and RZ is H.
Particularly preferred compounds of Formula Ib include uridine 5'-triphosphate
(UTP)
and uridine 5'-O-(3-thiotriphosphate) (UTPyS).
17
CA 02395108 2002-06-19
WO 01/45691 PCT/C1S00/35439
ADP and its analogs are depicted by general Formula IIa:
Formula IIa
N R3R4
N ~ N R2
~r I J
O O N N ~Z
HO-~-R~-~-O
X~ X2
wherein:
R,, X,, Xz and Y are defined as in Formula Ia;
Z is H, C1, or SR, wherein R is alkyl (C,-CZO, saturated or unsaturated);
R3 and R4 are H while RZ is nothing and there is a double bond between N-1
1 S and C-6 (adenine), or
R3 and R4 are H while RZ is nothing and Z is SR, or
R3 and R4 are H while R, is O and there is a double bond between N-1 and C-6
(adenine 1-oxide), or
R3, R4, and RZ taken together are -CH=CH-, forming a ring from N-6 to N-1
with a double bond between N-6 and C-6 (1,N6-ethenoadenine).
Particularly preferred compounds of Formula IIa include 5'-adenosine
diphosphate (ADP) and 2-methyl-SADP.
18
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
ATP and its analogs are depicted by general Formula IIb:
Formula IIb
N R3R4
'
N '. NR2
N N' \ Z
O O O
HO-I~-R~-~-O-~-O
X~ X2 X3
wherein:
R,, X,, X2, X3 and Y are defined as in Formula Ib, and
RZ, R3, R4 and Z are defined as in Formula IIa.
Preferred compounds of Formula IIb include 5'-adenosine triphosphate (ATP)
CDP and its analogs are depicted by general Formula IIIa:
Formula IIIa
R5 'N~Rs
R
~~ N ,.
~
O O O' ' N
HO-~-R~-~-O
X~ X2
wherein:
R,, X,, X~ and Y are defined as in Formula Ia;
R5 and R6 are H while R, is nothing and there is a double bond between N-3
and C-4 (cytosine), or
R5, R6 and R, taken together are -CH=CH-, forming a ring from N-3 to N-4
with a double bond between N-4 and C-4 (3,N4-ethenocytosine), optionally the
hydrogen
19
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
of the 4- or 5-position of the etheno ring is substituted with alkyl,
substituted alkyl, aryl,
substituted aryl (heteroaryl, etc.), alkoxyl, nitro, halo, or azido.
CTP and its analogs are depicted by general Formula IIIb:
$ Formula IIIb
Rs wN~Rs
R
7wN ,.
~ S
0i 'N
O O O
HO_~_Rt_~!_O_~!_
X~ X2 X3
wherein:
R,, X,, X2, X3 and Y are defined as in Formula Ib, and
R5, R6 and R, are defined as in Formula IIIa.
Preferred compounds of Formula IIIb include cytidine 5'-triphosphate (CTP) and
4-nitrophenyl ethenocytidine 5'-triphosphate.
For simplicity, Formulas I, II, and III, herein illustrate the active
compounds in the
naturally occurring D-configuration, but the present invention also
encompasses
compounds in the L-configuration, and mixtures of compounds in the D- and
L-configurations, unless otherwise specified. The naturally occurring D-
configuration is
preferred.
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
P2Y agonists also include dinucleotide phosphates of general Formula (IV):
Fnrm»la TV
O O O O
g O O P-O P-X-P O-P B'
O H O- O- O
Y Z n -
wherein:
X is oxygen, methylene, difluoromethylene, or imido;
n = 0, 1 or 2;
m=0, 1 or2;
n + m=0,1, 2, 3, or 4;
Z = OH or H;
Z' = OH or H;
Y = H or OH;
Y' = H or OH.
The sugar moieties are as depicted in the D-configuration, but may be L-, or D-
and L-. The D-configuration is preferred. The nucleoside residue can be in the
alpha- or
beta- and D- or L-configurations, but most preferably the beta-D-
configuration.
B and B' are each independently a purine residue or a pyrimidine residue, as
defined in Formula V and VI, respectively, linked through the 9- or 1-
position,
respectively.
21
CA 02395108 2002-06-19
WO 01/45691 PCT/LTS00/35439
Formula V
R2
R
7 ' X
N 6 N ,,
R d/g 5 1
2
~9 4
H N .... R1
3
wherein:
R~ is hydrogen, chlorine, amino, monosubstituted amino, disubstita.ited amino,
alkylthio, arylthio, or aralkylthio, wherein the substituent on sulfur
contains up to a
maximum of 20 carbon atoms, with or without unsaturation;
RZ is hydroxy, amino, mercapto, alkylthio, arylthio, aralkylthio, acylthio,
alkyloxy, aryloxy, aralkyloxy, acyloxy, monosubstituted alkylamino,
heterocyclic,
monosubstituted cycloalkylamino, monosubstituted aralkylamino, monosubstituted
arylamino, diaralkylamino, diarylamino, dialkylamino (wherein alkyl groups are
optionally linked to N~ to form a substitute ring), acylamino, diacylamino, or
NHRY;
RX is O (adenine 1-oxide derivatives), or is absent (adenine derivatives);
provided that when Rz is NHRY, RY and RX may be taken together form a 5-
membered fused imidazole ring (1, N6-ethenoadenine derivatives), optionally
substituted
on the 4- or S-positions of the etheno moiety with alkyl, aryl or aralkyl
moieties as
defined below;
R3 is hydrogen, azido, alkoxy, aryloxy, aralkyloxy, alkylthio, arylthio, or
aralkylthio as defined below; or w-A(C,_balkyl)OCONH (C,_balkyl)B- wherein A
and B
are independently amino, mercapto, hydroxy or carboxyl; or pharmaceutically
acceptable
esters, amides or salts thereof; or absent.
Thus, the substituted derivatives of adenine include adenine 1-oxide; 1,N6-(4-
or
5-substituted etheno) adenine; 6-substituted adenine; or 8-substituted
aminoadenine,
where R' of the 6- or 8-HNR' groups are chosen from among: arylalkyl (C,_6)
groups
22
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
with the aryl moiety optionally functionalized as described below; alkyl; and
alkyl groups
with functional groups therein, such as: ([6-aminohexyl]carbamoylmethyl)-, and
w-
acylated- amino(hydroxy, thiol and carboxy)alkyl(Cz_,o)- and their w-acylated-
amino
(hydroxy, thiol and carboxy) derivatives where the acyl group is chosen from
among, but
not limited to, acetyl, trifluoroacetyl, benzoyl, substituted-benzoyl, etc.,
or the carboxylic
moiety is present as its ester or amide derivative, for example, the ethyl or
methyl ester or
its methyl, ethyl or benzamido derivative. The w-amino(hydroxy, thiol) moiety
may be
alkylated with a C,~ alkyl group.
J is carbon or nitrogen, with the provision that when J is nitrogen, R3 is not
present;
wherein the alkyls are straight-chain, branched or cyclic;
wherein the aryl groups are optionally substituted with lower alkyl, amino,
alkylamino, NO2, N3, carboxylic, amido, sulfonamido, or halo groups; and
B and B', can also be a pyrimidine with the general formula of Formula VI,
linked
5 through the 1- position to ribosyl residue:
Formula VI
,Rs
R~ .4. /R5
~ 5 3.N
g 2;
Rs N . R4
wherein:
R4 is hydrogen, hydroxy, oxo, mercapto, amino, cyano, C~_,Zarylalkoxy, C,_6
alkylthio, C,_6 alkoxy, C,_6 alkylamino, or diC,~alkylamino, wherein the alkyl
groups are
optionally linked to form a heterocycle;
R5 is hydrogen, oxo, acetyl, benzoyl, C,_6 alkyl, C,_5 alkanoyl, or aroyl;
R5 is hydroxy, oxo, mercapto, C,_4alkoxy, C,_,Zarylalkoxy, C,_balkylthio,
amino, S-
phenyl, C,_5 disubstituted amino, triazolyl, C,_balkylamino, or di-
C,~alkylamino, wherein
23
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
said dialkyl groups are optionally linked to form a heterocycle or linked to
N' to form a
substituted ring; or
RS and R6 taken together form a 5-membered fused imidazole ring between
positions 3 and 4 of the pyrimidine ring and form a 3,N4-ethenocytosine
derivative,
wherein said etheno moiety is optionally substituted on the 4- or 5-positions
with C,~,
alkyl, phenyl or phenyloxy; wherein at least one hydrogen of said C,_4 alkyl,
phenyl or
phenyloxy is optionally substituted with a moiety selected from the group
consisting of:
halogen, hydroxy, C,_4 alkoxy, C,_4 alkyl, C6_,o aryl, C,_,2 arylalkyl,
carboxy, cyano, vitro,
sulfonamido, sulfonate, phosphate, sulfonic acid, amino, C,~ alkylamino, and
di- C,_4
alkylamino, wherein said dialkyl groups are optionally linked to form a
heterocycle;
R, is selected from the group consisting of: hydrogen, hydroxy, cyano, vitro,
and
CZ_8 alkenyl; wherein said alkenyl moiety is optionally linked through an
oxygen to form a
ring, wherein at least one hydrogen of said alkenyl moiety on the carbon
adjacent to said
oxygen is optionally substituted with a substituent selected from the group
consisting of:
C,_6 alkyl or phenyl; substituted CZ_g alky nyl, halogen, substituted C,~
alkyl, CF;, C,_3
alkenyl, CZ_3 alkynyl, allylamino, bromovinyl, ethyl propenoate, or propenoic
acid; or
R6 and R~ together form a 5 or 6-membered saturated or unsaturated ring bonded
through N or O or S at R6, such ring optionally contains substituents that
themselves
contain functionalities; provided that when R8 is amino or substituted amino,
R, is
hydrogen; and
R8 is selected from the group consisting of: hydrogen, amino or di-C,_
4alkylamino, C,.~alkoxy, C,_,2arylalkoxy, C,_4alkylthio, C,_,Zarylalkylthio,
carboxamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy, and
phenylthio.
In the general structure of Formulae I-III above, the dotted lines in the 2-
to 6-
positions are intended to indicate the presence of single or double bonds in
these
positions; the relative positions of the double or single bonds being
determined by
whether the R4, RS and R6 substituents are capable of keto-enol tautomerism.
In the general structures of Formula I-III above, the acyl groups comprise
alkanoyl
or aroyl groups. The alkyl groups contain 1 to 8 carbon atoms, particularly 1
to 4 carbon
24
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
atoms optionally substituted by one or more appropriate substituents, as
described below.
The aryl groups including the aryl moieties of such groups as aryloxy are
preferably
phenyl groups optionally substituted by one or more appropriate substituents,
as described
below. The above-mentioned alkenyl and alkynyl groups contain 2 to 8 carbon
atoms,
particularly 2 to 6 carbon atoms, e.g., ethenyl or ethynyl, optionally
substituted by one or
more appropriate substituents as described below.
Appropriate substituents on the above-mentioned alkyl, alkenyl, alkynyl, and
aryl
groups are selected from halogen, hydroxy, C,_4 alkoxy, C~_4 alkyl, C6_,z
aryl, C6_,z
arylalkoxy, carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate,
sulfonic, amino and
substituted amino wherein the amino is singly or doubly substituted by a C,~
alkyl, and
when doubly substituted, the alkyl groups optionally being linked to form a
heterocycle.
The invention further provides novel pharmaceutical compositions comprising
compounds of general Formula IV, which newly feature: (1) a novel dinucleotide
with a
sugar moiety selected from the group consisting of: arabinofuranosyl, 3'-
deoxyribofuranosyl, xylofuranosyl, and lyxofuranosyl; (2) a novel dinucleotide
with an
azapurine base; and (3) a novel dinucleotide with a 6-substituted purine. In
the first type
of novel composition, when the sugar moiety is 3'-deoxyribofuranosyl, Z and Z'
are H. In
the second type of novel composition with an azapurine base, J is nitrogen and
R3 is
absent. In the third type of novel composition with the 6-substituted purine,
the 6-
monosubstituted amino purine base is excluded.
Preferred dinucleotide polyphosphate compounds useful in this invention are
P',
P4-di (urdine-5')-tetraphosphate, dUP4U, UZP3, UzPs, dCP4U, CP4U, IPSI, AP4A,
CP3U,
UP3A and AzP3.
Some compounds of Formula I, II and III can be made by methods known those
skilled in the art; some compounds are commercially available, for example,
from Sigma
Chemical Co. (St. Louis, MO 63178). Compounds of Formulae Ia (UDP and its
analogs)
can be prepared according to WO 99/09998. Compounds of Formulae Ib, IIb and
IIIb
(UTP, ATP, CTP and their analogs) can be prepared according to USPN 5,763,447.
Compounds of Formula IV can be made in accordance with known procedures
described
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
by Zamecnik, et al., Proc. Natl. Acad. Sci. USA 89, 838-42 (1981); and Ng and
Orgel,
Nucleic Acids Res. 15:3572-80 (1987), Pendergast et al.; USPN 5,837,861, or
variations
thereof.
The compounds of the present invention also encompass their non-toxic
pharmaceutically acceptable salts, such as, but not limited to, an alkali
metal salt such as
sodium or potassium; an alkaline earth metal salt such as manganese, magnesium
or
calcium; or an ammonium or tetraalkyl ammonium salt, i.e., NX4+ (wherein X is
C,~).
Pharmaceutically acceptable salts are salts that retain the desired biological
activity of the
parent compound and do not impart undesired toxicological effects. The present
invention also encompasses the acylated prodrugs of the compounds disclosed
herein.
Those skilled in the art will recognize various synthetic methodologies which
may be
employed to prepare non-toxic pharmaceutically acceptable salts and acylated
prodrugs of
the compounds.
The pharmaceutical utility of P2Y agonist compounds of this invention are
indicated by the irositol phosphate assay for P2Y activity. This widely used
assay, as
described in E. Lazarowski, et al., Brit. J. Pharm. 116, 1619-27 (1995),
relies on the
measurement of inositol phosphate formation as a measurement of activity of
compounds
activating receptors linked via G-proteins to phospholipase C.
In addition, the pharmaceutical utility of P2Y agonist compounds of this
invention
are indicated by the intracellular calcium mobilization assay for P2Y
activity. In this
assay, cultured cells are stimulated with the increasing concentrations of P2Y
receptor
agonists. Intracellular calcium levels are monitored by measuring the changes
in
fluorescence intensity of a calcium-sensitive dye using the FLIPR (Molecular
Devices
Corp., Sunnyvale, CA) or equivalent instrumentation.
P2Y agonist compounds increase mucus production in in vitro preparations of
esophageal, gastric mucosal, jujenum, proximal and distal colon epithelia.
Mucus
secretion can be assayed by a variety of techniques, including impression
cytology,
enzyme-linked immunosorbent assay (ELISA), and dot blots using mucin-specific
antibodies. (See Danjo et al., Invest. Ophthalmol. vis. Sci., 39: 2602-2609
(1988);
26
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
Jumblatt et. al., Invest. Ophthalmol. Vis. Sci. 40:43-49 (1999); and Jumblatt
et. al., Invest.
Ophthalmol. Vis. Sci. 39: 5803 (1988)). Our results show robust, prolonged,
and
significant increases in mucus production when P2Y receptor agonists following
administration to the luminal surface of epithelial preparations. Mucin
production can be
repeatedly increased by repetitive stimulation with agonists.
P2Y agonists significantly alter short circuit currents (Isc) in epithelial
preparations from the gastrointestinal system, including esophagous, jujenum
and
proximal and distal colon. The changes in ISO are consistent with increases in
transluminal chloride flux or transerosal potassium flux, and are thus
expected to mobilize
fluid absorption or secretion across the epithelia accordingly.
The effectiveness of P2Y agonists for amelioration of symptoms associated with
gastrointestinal disease can be shown in an animal model. For example,
Helicobacter
pylori infection by acetic acid administration to the antral mucosa of
cynomolgus
monkeys is a model for chronic gastritis; the model shows histological and
clinical
phenoty pe similar to those of human gastric ulcers. Oral administration of
P2Y receptor
agonists to monkeys with gastritis shows significant recovery of staining of
periodic acid-
Schiff positive substances and increases anti-mucin immunoreactivity, both of
which
reflect an increase in mucin secretion. Reduced histological incidents of
gastric
ulcerations are also an indication of the effectiveness of the P2Y receptor
agonists.
The desired compounds of the present invention may be administered orally,
systemtically, intra-operatively, or rectally, in dosage unit formulations
containing
conventional non-toxic pharmaceutically acceptable carriers, adjuvants and
vehicles. The
term systemic as used herein includes subcutaneous injections, intravenous,
intramuscular, intrasternal injection or infusion techniques.
The pharmaceutical formulation in this invention comprises a ligand compound
and a pharmaceutically acceptable carrier. One or more ligand compounds may be
present in association with one or more non-toxic pharmaceutically acceptable
carriers or
diluents or adjuvants and, if desired, other active ingredients. One such
carrier would be
sugars, where the compounds may be intimately incorporated in the matrix
through
27
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
glassification or simply admixed with the Garner (e.g., lactose, sucrose,
trehalose,
mannitol) or other acceptable excipients for oral or systemic delivery.
For oral use, the pharmaceutical composition is in a suitable form such as
tablets,
lozenges, aqueous or oily suspensions, viscous gels, chewable gums,
dispersible powders
or granules, emulsion, hard or soft capsules, syrups or elixirs. Compositions
intended for
oral use are prepared according to any method known to the art for the
manufacture of
pharmaceutical compositions. Such compositions may contain one or more agents
selected from the group consisting of sweetening agents, flavoring agents,
coloring agents
and preserving agents in order to provide pharmaceutically elegant and
palatable
preparations. Tablets usually contain the active ingredient in admixture with
non-toxic
pharmaceutically acceptable excipients suitable for the manufacture of
tablets. These
excipients include, for example, inert diluents, such as calcium carbonate,
sodium
carbonate, lactose, calcium phosphate or sodium phosphate; granulating and
disintegrating agents, for example, corn starch, or alginic acid; binding
agents, for
example, starch, gelatin or acacia; and lubricating agents, for example
magnesium
stearate, stearic acid or talc. The tablets may be uncoated or they may be
coated by
known techniques to provide a sustained action over a longer period. For
example, a time
delay material such as glyceryl monosterate or glyceryl distearate may be
employed.
For oral use, hard gelatin capsules are prepared by mixing the active
ingredient
with an inert solid diluent, for example, calcium carbonate, calcium phosphate
or kaolin.
Soft gelatin capsules are prepared by mixing the active ingredient with water
or an oil
medium, for example, peanut oil, liquid paraffin or olive oil.
For oral use, chewable gums are prepared by embedding the active ingredient in
gums; the active ingredient is slowly released upon chewing. This form is
suitable for
treating mouth ulcers.
For oral use, an aqueous suspension is prepared by addition of water to
dispersible
powders and granules with a dispersing or wetting agent, suspending agent and
one or
more preservatives. Suspending agents include, for example, sodium
carboxymethylcellulose, methylcellulose and sodium alginate. Dispersing or
wetting
28
CA 02395108 2002-06-19
WO 01/45691 PCT/fJS00/35439
agents include naturally-occurring phosphatides, condensation products of an
allylene
oxide with fatty acids, condensation products of ethylene oxide with long
chain aliphatic
alcohols, condensation products of ethylene oxide with partial esters from
fatty acids and
a hexitol, and condensation products of ethylene oxide with partial esters
derived from
fatty acids and hexitol anydrides. Preservatives include, for example, ethyl,
and n-propyl
p-hydroxybenzoate. An aqueous suspension may also contain one or more coloring
agents, one or more flavoring agents, and one or more sweetening agents, such
as sucrose
or saccharin. Those skilled in the art will recognize the many specific
excipients and
wetting agents encompassed by the general description above.
For systemic administration, the pharmaceutical formulation is prepared in a
sterile medium. The active ingredient, depending on the vehicle and
concentration used,
can either be suspended or dissolved in the vehicle. Adjuvants such as local
anaesthetics,
preservatives and buffering agents can also be dissolved in the vehicle. The
sterile
injectable preparation may be a sterile injectable solution or suspension in a
non-toxic
acceptable diluent or solvent. Among the acceptable vehicles and solvents that
may be
employed are sterile water, saline solution, or Ringer's solution.
The pharmaceutical application may also be administered in the form of
suppositories for rectal administration. These compositions can be prepared by
mixing
the active ingredient with a suitable non-irritating excipient which is solid
at ordinary
temperatures but liquid at the rectal temperature and will therefore melt in
the rectum to
release the compound. Such excipients include cocoa butter and polyethylene
glycols.
Dosage levels of the order of from about 10-2000 mg of active ingredients are
useful in the treatment of the above-indicated conditions. Preferred doses are
about 50-
1000 mg, and more preferred doses are about 75-850 mg of active ingredients.
These
doses can be given several times a day as needed. The amount of active
ingredient that
may be combined with the carrier materials to produce a single dosage form
will vary
depending upon the host treated and the particular mode of administration. It
will be
understood, however, that the specific dose level for any particular patient
will depend
upon a variety of factors including the activity of the specific compound
employed, the
29
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
age, body weight, general health, sex, diet, time of administration, route of
administration,
and rate of excretion, drug combination and the severity of the particular
disease
undergoing therapy.
The invention is illustrated further by the following examples which are not
to be
construed as limiting the invention in scope or spirit to the specific
procedures described
in them.
EXAMPLES
Example 1. Identification of P2Y Receptor in Human Tissues
The presence of P2Y,, P2Y2, P2Y4, P2Y6 and P2Y,~ purinergic receptors in
gastrointestinal tissues was determined in vitro using RT-PCR techniques of
human RNA
purchased from a commercial sources. Human normal stomach poly A+ mRNA was
purchased from Clontech (Palo Alto, CA). First strand cDNA was synthesized
(Advantage RT-for PCR kit; Clontech, Palo Alto, CA) from 100ng of stomach
polyA+
mRNA using an oligo (dT)18 primer and MMLV reverse transcriptase (60 min,
42°C).
Control reactions in the absence of reverse transcriptase were also carried
out. Human
normal esophagus, rectum, duodenum and salivary gland cDNA were purchased from
Invitrogen (Carlsbad, CA). First strand cDNAs for normal human colon, liver,
and small
intestine were from Clontech's multiple tissue cDNA panels. RT-PCR was
performed
with stomach tissues and PCR was performed with other tissues.
Sequence specific primers for P2Y~, P2Yz, P2Y4, P2Y6 and P2Y" genes are listed
as follows:
P2Y, (accession number U42029)
forward 5' CGATCTGTATCAGCGTGCTGGTGTG 3',
reverse S' TCTAGAAGCTTTCCTTGTGGCTCGG 3';
P2Y2 (accession number S74902)
forward 5' AGGAGATGTGTTGGGCAGCAGTGAGGAC 3';
reverse 5' ACCAGGGTTTTCTGGCCAACCTGTGACT 3';
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
P2Y4 (accession number X91852)
forward 5' ATGCAACGGCCACCTACATGTTCC 3';
reverse 5' GTACTCGGCAGTCAGCTTCCAACA 3';
P2Y6 (accession number U52464)
forward 5' ATGGCATGGCTCTCACTGTCATCG 3';
reverse 5' TTGGTGAGCTTCTGGGTCCTGTGAG 3';
P2Y" (accession number AF030335)
forward 5' ATACTGGTGGTTGAGTTCCTGG 3';
reverse 5' ACCAGGCTATACGCTCTGTAGG 3'.
PCR was performed on 3~1 of the cDNA of all tissues listed above using the
forward and reverse primer sets (1 ~ lof each primer) designed to amplify each
P2Y (P2Y,,
P2Yz, P2Y4, P2Y6, P2Y") partial cDNA. The reaction also contained 400mM of
each
deoxy nucleotide triphosphate, 3.SmM MgCl2 and 1 ~l of the Advantage cDNA
polymerase mix (Clontech, Palo Alto, CA). The reaction conditions were:
initial 2.5 min
at 94°C and then 30 sec at 94°C, 30 sec at either 60°C
(P2Y4, P2Y") or 65°C (P2Y,, P2Y2,
P2Y6), 1 min at 72°C for 35 cycles and finally, 10 min at 72°C.
Some of the PCR
products were cloned into the pCR 2.1-TOPO vector (TOPO TA Cloning kit;
Invitrogen,
Carlsbad, CA) and sequenced completely using an automated DNA sequencer.
All tissues tested were positive for P2Y receptors. The results are summarized
in
Table 2.
31
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
Table 2.
Identification of P2Y receptor in human tissues.
Human P2Y,Human P2Y2 Human P2Y4Human P2Y6Human P2Y"
Stomach + + + + +
Salivary + + + + +
Gland
Esophagus + + + + +
Duodenum + + + + +
Small Intestine+ + + + +
Colon + + + + +
Rectum + + + + +
Liver + + + + +
Pancreas + + + + +
Example 2. Cellular Localization of P2Y Nucleotide Receptor Gene Expression in
Monkey Gastrointestical Epithelial Tissues by Nonisotopic In Situ
Hybridization
Tissues. Study tissues were obtained from Pathology Associates International,
Frederick, MD. Tissues included in this study were stomach, esophagus, small
intestine
(jejunum), and large intestine (colon). Tissues were removed from a 3.25 year
old Indian
Rhesus Macaque immediately following euthanasia and snap frozen in O.C.T.
embedding
medium. Frozen tissues were stored at -80°C prior to cryosectioning.
Tissues were cut in
5 ~m sections and mounted on microscope slides for hematoxylin & eosin (H&E)
staining, and in situ hybridization (ISH).
Assessment of Tissue Sections. H&E-stained tissue sections were prepared to
evaluate the quality and orientation of study tissues. Examination of H&E
slides
indicated that all tissues were suitable for ISH.
Riboprobe Synthesis. A PCR product containing nucleotides 253-651 from a
human P2Y~-R cDNA was obtained from a sponsor. P2Y,-R nucleotides 272-627 were
32
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
reamplified with P2Y2 primers (forward primer sequence:
5'AGGAGATGTGTTGGGCAGCAGTGAGGAC 3' reverse primer sequence: reverse
5'ACCAGGGTTTTCTGGCCAACCTGTGACT 3') designed to incorporate either an
upstream T3 promotor or a downstream T7 promotor. The resulting PCR products
were
used to synthesize digoxigenin-labeled riboprobes by in vitro transcription
(IVT).
Antisense and sense riboprobes were synthesized using T7 and T3 RNA
polymerases,
respectively, in the presence of digoxigenin-11-UTP (Roche Molecular) using a
MEGAscript IVT kit (Ambion) according to the manufacturer. Following IVT,
template
DNA was degraded with DNase-1, and unincorporated digoxigenin was removed by
ultrafiltration. Riboprobe integrity was assessed by electrophoresis through a
denaturing
polyacrylamide gel. Apparent molecular size was estimated by comparison with
the
electrophoretic mobility of a 100-1000 base pair RNA ladder (Ambion). Probe
yield and
labeling was evaluated by blot immunochemistry. Riboprobes were dispensed in 5
~L
aliquots and stored at -80°C until used for ISH.
In Situ hybridization. Frozen tissues were cut into 5 ~m sections, mounted on
SuperFrost Plus slides (Fisher Scientific), and post-fixed for 15 minutes in
4%
paraformaldehyde in PBS at pH 7.4. Tissue sections were then treated for 30
minutes
with 0.1% active diethylpyrocarbonate in PBS at pH 7.4. Sections were
prehybridized in
the absence of probe, then incubated overnight in hybridization buffer
containing 400
ng/mL of either antisense or sense probe. Following hybridization, slides were
subjected
to a series of post-hybridization stringency washes to reduce nonspecific
staining.
Hybridization was visualized by immunohistochemistry using alkaline
phosphatase-
conjugated anti-digoxigenin Fab and nitroblue tetrazolium chloride-
bromochloroindolyl
phosphate (Roche Molecular) according to the manufacturer. Tissue sections
were
counter stained with nuclear fast red. Negative controls included stomach and
esophagus
tissues stained with the sense P2Y2-R probe.
Results. The results from in situ hybridization experiments are shown for the
sense
probe (negative control) and antisense probe for the stomach (Figure 1 ),
esophagus
(Figure 2), colon (Figure 3), and jejunum (Figure 4). All tissues show
positive staining in
33
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
the mucosal epithelium, indicative of P2Y2 receptor gene expression, with the
antisense
probe (Figures 1b, 2b, 3b, and 4b), whereas no staining was observed with the
control
sense probe (Figures la, 2a, 3a, and 4a). More specifically, P2Y2 gene
expression was
noted in the epithelium of the gastric pit and in the neck and base of the
gastric gland in
the stomach; in the stratified squamous epithelium of the esophagus; in
absorptive
enterocytes and mucus-secreting goblet cells of villus epithelium and
secretory crypt
epithelium of the jejunum; and in columnar absorptive cells, mucus-secreting
goblet cells,
and secretory enteroendocrine crypt cells of the colon. The demonstration of
P2Yz
receptor gene expression in gastrointestinal epithelium, including both
secretory and
absorptive cell types, supports a role for P2Y2 receptors in gastrointestinal
mucosal
physiology, and as a target for the treatment of gatrointestinal diseases in
which enhanced
mucus secretion and/or fluid secretion are therapeutic.
Example 3: Measurement of intracellular calcium mobilization in cultured
epithelial cells
from the gastrointestinal tract.
A conventional technique is used to detect intracellular calcium mobilization
induced by P2Y receptor agonists. The technique is familiar to those well
versed in the
art. Cells are seeded in 96-well plates and used for calcium mobilization
assays. On the
day of the assay, the growth medium is aspirated and replaced with a solution
of Fluo-3
AM (2.5 ~.M final concentration) in an assay buffer consisting of (mM): KCl
(10.0), NaCI
(118), CaCl2(2.5), MgClz (1.0), HEPES (20), glucose (10), pH 7.4. Probenecid
(Sigma
Chemical Co.) is added to the dye load and dye wash medium at a working
concentration
of 2.SmM to increase dye retention in the cells. After a 60 minute incubation
with Fluo-3
AM at 25°C, cells are washed free of dye (Columbus Plate Washer, TECAN
U.S., Inc.,
Research Triangle Park, N.C.) and are stimulated with increasing
concentrations of P2Y
receptor agonists. Intracellular calcium levels are simultaneously monitored
in each well
by measuring the changes in fluorescence intensity using the FLIPR (Molecular
Devices
Corp., Sunnyvale, CA).
T84 cells, a human colonic epithelial cell line, were subjected to the calcium
mobilization assay described above. The results show that the P2Y receptor
agonists ATP
34
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
and UTP are stimulate calcium mobilization in these cells, consistent with
activation of
the P2Yz receptors (Figure 5). 2-methylthioADP, a P2Y, receptor-selective
agonist, did
not simulate calcium mobilization, indicating the lack of P2Y~ receptors in
these cells.
Similarly, human colonic HT-29 cells exhibit a robust P2Y response to ATP and
UTP,
consistent with P2Yz receptor activation (Figure 6). The activation of
intracellular
calcium mobilization by ATP and UTP in T84 and HT-29 cells indicate the
pharmaceutical utility of P2Y receptor agonists in the gastrointestinal tract.
~UTP-
stimulated calcium mobilization has been reported in HT 29 cells: Otero et al.
Mol Cell
Biochem 2000 Feb; 205(1-2): 1l S-23J.
Example 4: Measurement of gastrointestinal epithelial mucus production,
bicarbonate
secretion, and short circuit current in epithelial cultures and explants.
Conventional techniques are used for investigating epithelial electrical
responses
mediated by agonists of P2Yz and P2Y4 purinoceptors. The techniques are
familiar to
those well versed in the art. Native explants and cultured mucosal epithelial
cells from
the esophagus, stomach, jujenum and colon epithelia are isolated or grown as
monolayers,
where the integrity of functional complexes separating apical (mucosal) and
basolateral
(serosal) membranes remains intact. Epithelial tissues or monolayers are
mounted in a
modified Ussing chamber that allows for maintenance of epithelial polarity and
affords
the ability to separately perfuse Ringer's solution to apical and basolateral
surfaces.
Short-circuit currents and total transepithelial resistances are continuously
measured using
conventional electrophysiological techniques. Bicarbonate secretion is
measured by
monitoring pH using a pH-stat system. Changes in these parameters that are
consistent
with chloride ion secretion, bicarbonate secretion, or alteration of the
transmembrane flux
of other ions indicate that P2Y receptor agonists modify secretion,
absorption, and/or
mucosal hydration in the gastrointestinal tract.
Mucus production by goblet cells residing in epithelial glands is assayed by a
variety of techniques familiar to those well versed in the art. Native explant
and cultured
monolayers of esophageal and gastric mucosal epithelia are assayed for mucin
production
by impression cytology, which consists of exposing fixed surface area of
epithelium with
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
polyvinylidene difluoreide (PVDF) membrane and staining PVDF membrane with
periodic-acid and Schiffs (PAS) reagent. The amount of PAS-positive staining
is
inversely proportional to mucin secretion. In esophageal and gastric mucosal
epithelia,
agonists of P2Y2 and P2Y4 perinoceptors are shown to decrease PAS staining,
which is
consistent with an increase mucus secretion. P2Y purinoceptor-induced
increases in
mucus secretion are verified by enzyme-linked immunosorbent assay (ELISA), and
immunoblots using mucin-specific antibodies. Positive results indicate robust,
prolonged,
and significant increases in mucus production when purinoceptor agonists
following
administered to luminal surface of epithelial preparation. Mucin production
can be
repeatedly increased by repetitive stimulation with purinoceptor agonists.
Example 5: Purinoceptor agonists for amelioration of symptoms associated with
ulcerative colitis.
Helicobacter pylori infection by acetic acid administration to the antral
mucosa of
cynomolgus monkeys is a model for chronic gastritis, and shows histological
and clinical
phenotype similar to these of human gastric ulcers. Oral administration of P2Y
receptor
agonists to monkeys with gastritis shows significant recovery of staining of
periodic acid-
Schiff positive substances and increases in anti-mucin immunoreactivity, both
of which
reflect an increase in mucin secretion. Reduced histological incidents of
gastric
ulcerations are also an indication of the effectiveness of the P2Y receptor
agonists.
A human subject, suffering from ulcerative colitis or chronic gastritis, is
treated by
a method in the present invention. The patient is given an endoscopy, followed
with a
biopsy of the gastric mucosa. Ulcerative colitis is diagnosed following
confirmation of
mucosal inflammation and erosion of the gastric mucosal layer. The present
invention
treats the patient by an oral administration of a suitable formulation of the
P2Y-receptor
agonist, which coats the esophageal and gastric mucosal layer and stimulates
mucous
production under the gastric mucosa. The composition is administered as a slow-
release
oral form, preferable in the form of chewing gum or lozenges, and is
administered
multiple times during the day as needed. Disease activity is monitored on the
basis of the
Clinical Activity Index, Endoscopic Index, Histological Index, and Global
Efficacy
36
CA 02395108 2002-06-19
WO 01/45691 PCT/US00/35439
Assessments by the clinical investigator. Improvements in one or more of these
parameters indicate that P2Y agonists ameliorate the symptoms of ulcerative
colitis.
Example 6: Purinoceptor agonists for altering fluid absorption by the small
intestine and
distal colon and for amelioration of symptoms associated with diarrhea or
constipation.
A human subject, suffering from either constipation of diarrhea, is treated by
methods in the present invention as follows. The patient presenting either
diarrhea or
constipatory symptoms is given an oral formulation of compound, said compound
formulated as tablet that can discharge the active compound in an amount
therapeutically
and specifically into the small intestine (for constipation) or large
intestine (for diarrhea).
The activate compound specifically agonizes P2Y receptors in respective tissue
and
promotes fluid secretion in small intestine and fluid absorption in large
intestine. 48 hour
stool output, measured in grams, and the duration of diarrhea or constipation,
as assessed
by patient questionnaire and/or clinical observation, are determined following
treatment.
Positive results indicate that P2Y agonists are effective in the treatment of
diarrhea and/or
constipation.
The invention, and the manner and process of making and using it, are now
described in such full, clear, concise and exact terms as to enable any person
skilled in the
art to which it pertains, to make and use the same. It is to be understood
that the
foregoing describes preferred embodiments of the present invention and that
modifications may be made therein without departing from the spirit or scope
of the
present invention as set forth in the claims. To particularly point out and
distinctly claim
the subject matter regarded as invention, the following claims conclude this
specification.
37
