Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
Description
NOVEL FGF HOMOLOG ZFGF12
BACKGROUND OF THE INVENTION
The fibroblast growth factor (FGF) family consists of at least eighteen
distinct members (Basilico et al., Adv. Cancer Res. 59:115-165, 1992 and
Fernig et al.,
Prog. Growth Factor Res. x:353-377, 1994) which generally act as mitogens for
a
broad spectrum of cell types. For example, basic FGF (also known as FGF-2) is
mitogenic in vi tro for endothelial cells, vascular smooth muscle cells,
fibroblasts,
and generally for cells of mesoderm or neuroectoderm origin, including cardiac
and
skeletal myocytes (Gospodarowicz et al., J. Cell. Biol. 70:395-405, 1976;
Gospodarowicz et al., J. Cell. Biol. 89:568-578, 1981 and Kardami, J. Mol.
Cell.
Biochem. 92:124-134, 1990). In vi vo, bFGF has been shown to play a role in
avian
cardiac development (Sugi et al., Dev. Biol. 168:567-574, 1995 and Mima et
al., Proc.
Nat'1. Acad. Sci. 92:467-471, 1995), and to induce coronary collateral
development in
dogs (Lazarous et al., Circulation 94:1074-1082, 1996). In addition, non-
mitogenic
2 0 activities have been demonstrated for various members of the FGF family.
Non-
proliferative activities associated with acidic and/or basic FGF include:
increased
endothelial release of tissue plasminogen activator, stimulation of
extracellular matrix
synthesis, chemotaxis for endothelial cells, induced expression of fetal
contractile genes
in cardiomyocytes (Parker et al., J. Clin. Invest. 85:507-514, 1990), and
enhanced
pituitary hormonal responsiveness (Baud et al., J. Cellular Physiol. 5:101-
106, 1987.)
Several members of the FGF family do not have a signal sequence
(aFGF, bFGF and possibly FGF-9) and thus would not be expected to be secreted
in a
classical fashion. In addition, several of the FGF family members have the
ability to
migrate to the cell nucleus (Friesel et al., FASEB 9:919-925, 1995). All the
members
3 0 of the FGF family bind heparin based on structural similarities.
Structural homology
crosses species, suggesting a conservation of their structure/function
relationship
(Ornitz et al., J. Biol. Chem. 271(25):15292-15297, 1996.)
There are four known extracellular FGF receptors (FGFRs), and they are
all tyrosine kinases. In general, the FGF family members bind to all of the
known
3 5 FGFRs, however, specific FGFs bind to specific receptors with higher
degrees of
affinity. Another means for specificity within the FGF family is the spatial
and
temporal expression of the ligands and their receptors during embryogenesis.
Evidence
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
2
suggests that the FGFs most likely act only in autocrine and/or paracrine
manner, due to
their heparin binding affinity, which limits their diffusion from the site of
release
(Flaumenhaft et al., J. Cell. Biol. 111(4):1651-1659, 1990.) Basic FGF lacks a
signal
sequence, and is therefore restricted to paracrine or autocrine modes of
action. It has
been postulated that basic FGF is stored intracellularly and released upon
tissue
damage. Basic FGF has been shown to have two receptor binding regions that are
distinct from the heparin binding site (Abraham et al.,. EMBO J. 5(10):2523-
2528,
1986.)
Members of the FGF family have been shown to play important roles
developmentally and in adult tissue. The activities of the family members
appear to be
promiscuous in some tissues and have tissue-specificity in other cases. The
present
invention provides a novel member of the FGF family and the uses for these
polynucleotides and polypeptides should be apparent to those skilled in the
art from the
teachings herein.
DETAILED DESCRIPTION OF THE INVENTION
Prior to setting forth the invention in detail, it may be helpful to the
understanding thereof to define the following terms:
The term "affinity tag" is used herein to denote a polypeptide segment
that can be attached to a second polypeptide to provide for purification or
detection of
the second polypeptide or provide sites for attachment of the second
polypeptide to a
substrate. In principal, any peptide or protein for which an antibody or other
specific
binding agent is available can be used as an affinity tag. Affinity tags
include a poly-
histidine tract, protein A (Nilsson et al., EMBO J. 4:1075, 1985; Nilsson et
al., Methods
Enzymol. 198:3, 1991), glutathione S transferase (Smith and Johnson, Gene
67:31,
1988), Glu-Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA
82:7952-
4, 1985), substance P, FIagTM peptide (Hope et al., Biotechnoloay 6:1204-10,
1988),
streptavidin binding peptide, or other antigenic epitope or binding domain.
See, in
3 0 general, Ford et al., Protein Expression and Purification 2: 95-107, 1991.
DNAs
encoding affinity tags are available from commercial suppliers (e.g.,
Pharmacia
Biotech, Piscataway, NJ).
The term "allelic variant" is used herein to denote any of two or more
alternative forms of a gene occupying the same chromosomal locus. Allelic
variation
3 5 arises naturally through mutation, and may result in phenotypic
polymorphism within
populations. Gene mutations can be silent (no change in the encoded
polypeptide) or
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
3
may encode polypeptides having altered amino acid sequence. The term allelic
variant
is also used herein to denote a protein encoded by an allelic variant of a
gene.
The terms "amino-terminal" and "carboxyl-terminal" are used herein to
denote positions within polypeptides. Where the context allows, these terms
are used
with reference to a particular sequence or portion of a polypeptide to denote
proximity
or relative position. For example, a certain sequence positioned carboxyl-
terminal to a
reference sequence within a polypeptide is located proximal to the carboxyl
terminus of
the reference sequence, but is not necessarily at the carboxyl terminus of the
complete
polypeptide.
The term "complement/anti-complement pair" denotes non-identical
moieties that form a non-covalently associated, stable pair under appropriate
conditions.
For instance, biotin and avidin (or streptavidin) are prototypical members of
a
complement/anti-complement pair. Other exemplary complement/anti-complement
pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope)
pairs,
sense/antisense polynucleotide pairs, and the like. Where subsequent
dissociation of
the complement/anti-complement pair is desirable, the complementlanti-
complement
pair preferably has a binding affinity of <109 M-1.
The term "complements of a polynucleotide molecule" is a
polynucleotide molecule having a complementary base sequence and reverse
orientation
2 0 as compared to a reference sequence. For example, the sequence 5'
ATGCACGGG 3'
is complementary to 5' CCCGTGCAT 3'.
The term "degenerate nucleotide sequence" denotes a sequence of
nucleotides that includes one or more degenerate codons (as compared to a
reference
polynucleotide molecule that encodes a polypeptide). Degenerate codons contain
different triplets of nucleotides, but encode the same amino acid residue
(i.e., GAU and
GAC triplets each encode Asp).
The term "expression vector" is used to denote a DNA molecule, linear
or circular, that comprises a segment encoding a polypeptide of interest
operably linked
to additional segments that provide for its transcription. Such additional
segments
3 0 include promoter and terminator sequences, and may also include one or
more origins
of replication, one or more selectable markers, an enhancer, a polyadenylation
signal,
etc. Expression vectors are generally derived from plasmid or viral DNA, or
may
contain elements of both.
The term "isolated", when applied to a polynucleotide, denotes that the
3 5 polynucleotide has been removed from its natural genetic milieu and is
thus free of
other extraneous or unwanted coding sequences, and is in a form suitable for
use within
genetically engineered protein production systems. Such isolated molecules are
those
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
4
that are separated from their natural environment and include cDNA and genomic
clones. Isolated DNA molecules of the present invention are free of other
genes with
which they are ordinarily associated, but may include naturally occurring 5'
and 3'
untranslated regions such as promoters and terminators. The identification of
associated regions will be evident to one of ordinary skill in the art (see
for example,
Dynan and Tijan, Nature 316:774-78, 1985).
An "isolated" polypeptide or protein is a polypeptide or protein that is
found in a condition other than its native environment, such as apart from
blood and
animal tissue. In a preferred form, the isolated polypeptide is substantially
free of other
polypeptides, particularly other polypeptides of animal origin. It is
preferred to provide
the polypeptides in a highly purified form, i.e. greater than 95% pure, more
preferably
greater than 99% pure. When used in this context, the term "isolated" does not
exclude
the presence of the same polypeptide in alternative physical forms, such as
dimers or
alternatively glycosylated or derivatized forms.
The term "operably linked", when referring to DNA segments, indicates
that the segments are arranged so that they function in concert for their
intended
purposes, e.g., transcription initiates in the promoter and proceeds through
the coding
segment to the terminator.
The term "ortholog" denotes a polypeptide or protein obtained from one
2 0 species that is the functional counterpart of a polypeptide or protein
from a different
species. Sequence differences among orthologs are the result of speciation.
The term "ortholog" denotes a polypeptide or protein obtained from one
species that is the functional counterpart of a polypeptide or protein from a
different
species. Sequence differences among orthologs are the result of speciation.
A "polynucleotide" is a single- or double-stranded polymer of
deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources,
synthesized in vitro, or prepared from a combination of natural and synthetic
molecules.
Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"),
nucleotides
3 0 ("nt"), or kilobases ("kb"). Where the context allows, the latter two
terms may describe
polynucleotides that are single-stranded or double-stranded. When the term is
applied
to double-stranded molecules it is used to denote overall length and will be
understood
to be equivalent to the term "base pairs". It will be recognized by those
skilled in the
art that the two strands of a double-stranded polynucleotide may differ
slightly in length
3 5 and that the ends thereof may be staggered as a result of enzymatic
cleavage; thus all
nucleotides within a double-stranded polynucleotide molecule may not be
paired. Such
unpaired ends will in general not exceed 20 nt in length.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
A "polypeptide ' is a polymer of amino acid residues joined by peptide
bonds, whether produced naturally ~r synthetically. Polypeptides of less than
about 10
amino acid residues are commonly referred to as "peptides".
The term "promoter" is used herein for its art-recognized meaning to
5 denote a portion of a gene containing DNA sequences that provide for the
binding of
RNA polymerase and initiation of transcription. Promoter sequences are
commonly,
but not always, found in the 5' non-coding regions of genes.
A "protein" is a macromolecule comprising one or more polypeptide
chains. A protein may also comprise non-peptidic components, such as
carbohydrate
groups. Carbohydrates and other non-peptidic substituents may be added to a
protein
by the cell in which the protein is produced, and will vary with the type of
cell.
Proteins are defined herein in terms of their amino acid backbone structures;
substituents such as carbohydrate groups are generally not specified, but may
be present
nonetheless.
The term "receptor" denotes a cell-associated protein that binds to a
bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on
the cell.
Membrane-bound receptors are characterized by a multi-peptide structure
comprising
an extracellular ligand-binding domain and an intracellular effector domain
that is
typically involved in signal transduction. Binding of ligand to receptor
results in a
2 0 conformational change in the receptor that causes an interaction between
the effector
domain and other molecules) in the cell. This interaction in turn leads to an
alteration
in the metabolism of the cell. Metabolic events that are linked to receptor-
ligand
interactions include gene transcription, phosphorylation, dephosphorylation,
increases
in cyclic AMP production, mobilization of cellular calcium, mobilization of
membrane
2 5 lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids. In
general, receptors can be membrane bound, cytosolic or nuclear; monomeric
(e.g.,
thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric
(e.g.,
PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF
receptor; erythropoietin receptor and IL-6 receptor).
3 0 The term "secretory signal sequence" denotes a DNA sequence that
encodes a polypeptide (a "secretory peptide") that, as a component of a larger
polypeptide, directs the larger polypeptide through a secretory pathway of a
cell in
which it is synthesized. The larger polypeptide is commonly cleaved to remove
the
secretory peptide during transit through the secretory pathway.
3 5 The term "splice variant" is used herein to denote alternative forms of
RNA transcribed from a gene. Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA molecule, or less commonly
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
6
between separately transcribed RNA molecules, and may result in several mRNAs
transcribed from the same gene. Splice variants may encode polypeptides having
altered amino acid sequence. The term splice variant is also used herein to
denote a
protein encoded by a splice variant of an mRNA transcribed from a gene.
Molecular weights and lengths of polymers determined by imprecise
analytical methods (e.g., gel electrophoresis) will be understood to be
approximate
values. When such a value is expressed as "about" X or "approximately" X, the
stated
value of X will be understood to be accurate to ~10°Io.
All references cited herein are incorporated by reference in their entirety.
The present invention is based in part upon the discovery of a novel
DNA sequence that encodes a fibroblast growth factor (FGF) homolog polypeptide
having approximately 31 % homology to FGF-19 (Nishimura et al., Biochem. Bi
why.
Acta 1444:148-151, 1999). The FGF homolog polypeptide has been designated
zFGFl2.
The novel zFGFl2 polypeptides of the present invention contain a motif
known to occur in all known members of the FGF family, and is unique to these
proteins. The zFGFl2 homolog polypeptide encoded by DNA contains a variation
of
the motif formula: CXFXE, wherein X is any amino acid and X ( } is the number
of X
amino acids greater than one (SEQ ID NO: 5). This motif is highly conserved in
all
members of the FGF family, however, zFGFl2 appears to be unique in that the
conserved Glu is a His (residue 1 17) substituting a basic residue for an
acidic residue.
A consensus amino acid sequence of the domain includes, for example, human
myocyte-activating factor (FGF-10; HSU76381, GENBANK identifier, NCBI), human
2 5 fibroblast growth factor homologous factor 4 (FHF-4; Smallwood et al.,
1996, ibid. ),
human fibroblast growth factor homologous factor 3 (FHF-3; Smallwood et al.,
1996,
ibid.), human FGF-4 (Basilico et al., Adv. Cancer Res. 59:115-165,1992), human
FGF-
6 (Basilico et al., 1992, ibid.), human FGF-2 (basic; Basilico et al., 1992,
ibid.), human
FGF-1 (acidic; Basilico et al., 1992, ibid.), human keratinocyte growth factor
precursor
3 0 (FGF-7; Basilico et al., 1992, ibid. ), human FGF-5 (Basilico et al.,
1992, ibid. ), human
FGF-9 (Miyamoto et al., Mol. Cell. Biol. 13:4251-4259, 1993), human FGF-3
(Basilico
et al., 1992, ibid.), human FGF-16 (Miyake et al., Biochem. Bi~hys. Res.
Commun.
243(1):148-152, 1998) and human FGF-12 (Kok et al., Biochem. Biophys. Res.
Commun. 255(3):717-721, 1999).
3 5 The DNA sequence as shown in SEQ ID NO. 1, has a genomic sequence
common to many members of the FGF family, that comprises three exons separated
by
two introns. The deduced amino acid sequence is shown in SEQ ID NO: 2 forms an
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
7
open reading frame encoding 251 amino acids (SEQ m NO: 2) comprising a mature
polypeptide of 227 amino acids (residue 25 to residue 251 of SEQ >D NO: 2)
with a
secretory signal sequence of 24 amino acids (residue 1 to 24 of SEQ ID NO: 2).
Multiple alignment of zFGFl2 with other known FGFs revealed a block of high
percent
identity corresponding to amino acid residue 82 to 131 of SEQ ID NO: 2. The
FGF
family motif, as shown in SEQ ID NO: 5, corresponds to amino acid residues 113
(Cys)
to 117 (His) of SEQ >D NO: 2. Several of the members of the FGF family do not
have
signal sequences.
Based on homology alignments with FGF-1 and FGF-2 crystal structures
(Eriksson et al., Prot. Sci. 2:1274, 1993), secondary structure predictions
for beta strand
structure of zFGFl2 includes the following regions of amino acid residues:
strand 2--
51 (Tyr)-56 (Lys); strand 3-59 (Gly)-64 (Ala); strand 4-71 (Ser)-77 (Ser);
strand 5-
81 (Gly)-88 (Val); strand 6-92 (Arg)-98 (Phe); strand 7-99 (Arg)-105 (Ser);
strand
8-113 (Cys)-120 (Leu); strand 9-123 (Gly)-130 (Phe); strand 10-134 (Phe)-140
(Arg); and strand 11-143 (Arg)-147 (Pro), as shown in SEQ ID NO: 2. Amino
acids
critical for zFGFl2 binding to receptors can be identified by site-directed
mutagenesis
of the entire zFGFl2 polypeptide. More specifically, they can be identified
using site-
directed mutagenesis of amino acids in the zFGFl2 polypeptide which correspond
to
amino acid residues in acidic FGF (FGF1) and basic FGF (FGF2) which have been
2 0 identified as critical for binding to their respective receptors (Blaber
et al., Biochem.
35:2086-2094, 1996). In zFGFl2 hydrophobic residues buried within the core of
the
protein will be relatively intolerant of substitution, particularly polar or
charged
residues. Residues critical to the beta-trefoil fold of the zFGFl2 include
residues 53
(Leu), 61 (Val), 73 (Leu), 75 (Ile), 83 (Val), 85 (Ile), 94 (Val), 102 (Leu),
115 (Phe),
2 5 127 (Tyr), and 136 (Val). One skilled in the art will recognize that other
members, in
whole or in part, of the FGF family may have structural or biochemical
similarities to
zFGFl2. Therefore, amino acid residues from another FGF family member can be
used
for substitutions at corresponding positions in zFGFl2 given the limitations
disclosed
herein. Those skilled in the art will recognize that predicted domain
boundaries are
3 0 somewhat imprecise and may vary by up to ~ 3 amino acid residues.
Polypeptides of the present invention comprise at least 6, at least 9, or at
least 15 contiguous amino acid residues of SEQ ID N0:2. Within certain
embodiments
of the invention, the polypeptides comprise 20, 30, 40, 50, 100, or more
contiguous
residues of SEQ >D N0:2, up to the entire predicted mature polypeptide
(residues 25 to
3 5 251 of SEQ >D N0:2) or the primary translation product (residues 1 to 251
of SEQ ID
N0:2). As disclosed in more detail below, these polypeptides can further
comprise
additional, non-zFGFl2, polypeptide sequence(s).
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
8
Within the polypeptides of the present invention are polypeptides that
comprise an epitope-bearing portion of a protein as shown in SEQ ID N0:2. An
"epitope" is a region of a protein to which an antibody can bind. See, for
example,
Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002, 1984. Epitopes can be
linear
or conformational, the latter being composed of discontinuous regions of the
protein
that form an epitope upon folding of the protein. Linear epitopes are
generally at least 6
amino acid residues in length. Relatively short synthetic peptides that mimic
part of a
protein sequence are routinely capable of eliciting an antiserum that reacts
with the
partially mimicked protein. See, Sutcliffe et al., Science 219:660-666, 1983.
Antibodies that recognize short, linear epitopes are particularly useful in
analytic and
diagnostic applications that employ denatured protein, such as Western
blotting (Tobin,
Proc. Natl. Acad. Sci. USA 76:4350-4356, 1979), or in the analysis of fixed
cells or
tissue samples. Antibodies to linear epitopes are also useful for detecting
fragments of
zFGFl2, such as might occur in body fluids or cell culture media.
Antigenic, epitope-bearing polypeptides of the present invention are
useful for raising antibodies, including monoclonal antibodies, that
specifically bind to
a zFGFl2 protein. Antigenic, epitope-bearing polypeptides contain a sequence
of at
least six, preferably at least nine, more preferably from 15 to about 30
contiguous
amino acid residues of a zFGFl2 protein (e.g., SEQ ID N0:2). Polypeptides
comprising a larger portion of a zFGFl2 protein, i.e. from 30 to 50 residues
up to the
entire sequence, are included. It is preferred that the amino acid sequence of
the
epitope-bearing polypeptide is selected to provide substantial solubility in
aqueous
solvents, that is the sequence includes relatively hydrophilic residues, and
hydrophobic
residues are substantially avoided. Specific, useful polypeptides in this
regard include
those comprising residues 182-187, 179-184, 175-180, 174-179, and 76-81 of SEQ
ID
N0:2.
Polypeptides of the present invention can be prepared with one or more
amino acid substitutions, deletions or additions as compared to SEQ ID N0:2.
These
changes are preferably of a minor nature, that is conservative amino acid
substitutions
3 0 and other changes that do not significantly affect the folding or activity
of the protein or
polypeptide as described herein. These changes include amino- or carboxyl-
terminal
extensions, such as an amino-terminal methionine residue, an amino or carboxyl-
terminal cysteine residue to facilitate subsequent linking to maleimide-
activated
keyhole limpet hemocyanin, a small linker peptide of up to about 20-25
residues, or an
3 5 extension that facilitates purification (an affinity tag) as disclosed
above. Two or more
affinity tags may be used in combination. Polypeptides comprising affinity
tags can
further comprise a polypeptide linker and/or a proteolytic cleavage site
between the
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
9
zFGFl2 polypeptide and the affinity tag. Preferred cleavage sites include
thrombin
cleavage sites and factor Xa clc;avag~ sites.
The present invention further provides a variety of other polypeptide
fusions. For example, a zFGFl2 polypeptide can be prepared as a fusion to a
dimerizing protein as disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584.
Preferred dimerizing proteins in this regard include immunoglobulin constant
region
domains. Immunoglobulin-zFGFl2 polypeptide fusions can be expressed in
genetically
engineered cells to produce a variety of multimeric zFGFl2 analogs. In
addition, a
zFGFl2 polypeptide can be joined to another bioactive molecule, such as a
cytokine, to
provide a multi-functional molecule. One or more helices of a zFGFl2
polypeptide can
be joined to another cytokine to enhance or otherwise modify its biological
properties.
Auxiliary domains can be fused to zFGFl2 polypeptides to target them to
specific cells,
tissues, or macromolecules (e.g., collagen). For example, a zFGFl2 polypeptide
or
protein can be targeted to a predetermined cell type by fusing a zFGFl2
polypeptide to
a ligand that specifically binds to a receptor on the surface of the target
cell. In this
way, polypeptides and proteins can be targeted for therapeutic or diagnostic
purposes.
A zFGFl2 polypeptide can be fused to two or more moieties, such as an affinity
tag for
purification and a targeting domain. Polypeptide fusions can also comprise one
or more
cleavage sites, particularly between domains. See, Tuan et al., Connective
Tissue
2 0 Research 34:1-9, 1996.
Polypeptide fusions of the present invention will generally contain not
more than about 1,500 amino acid residues, preferably not more than about
1,200
residues, more preferably not more than about 1,000 residues, and will in many
cases be
considerably smaller. For example, a zFGFl2 polypeptide of 227 residues
(residues 25-
251 of SEQ ID N0:2) can be fused to E. coli /~-galactosidase (1,021 residues;
see
Casadaban et al., J. Bacteriol. 143:971-980, 1980), a 10-residue spacer, and a
4-residue
factor Xa cleavage site to yield a polypeptide of 1262 residues. In a second
example,
residues 25-251 SEQ ID N0:2 can be fused to maltose binding protein
(approximately
370 residues), a 4-residue cleavage site, and a 6-residue polyhistidine tag.
3 0 As disclosed above, the polypeptides of the present invention comprise
at least 6 contiguous residues of SEQ ID N0:2. These polypeptides may further
comprise additional residues as shown in SEQ ID N0:2, a variant of SEQ ID
N0:2, or
another protein as disclosed herein. When variants of SEQ ID N0:2 are
employed, the
resulting polypeptide will be at least 80% to 90% or in other embodiments, at
least
3 5 95%, 96%, 97%, 98%, or 99% identical to the corresponding region of SEQ ID
N0:2.
Percent sequence identity is determined by conventional methods. See, for
example,
Altschul et al., Bull. Math. Bio. 48:603-616, 1986, and Henikoff and Henikoff,
Proc.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
Natl. Acad. Sci. US A 89:10915-10919, 1992. Briefly, two amino acid sequences
are
aligned to optimize the alignment scores using a gap opening penalty of 10, a
gap
extension penalty of l, and the "BLOSUM62" scoring matrix of Henikoff and
Henikoff
(ibid.) as shown in Table 1 (amino acids are indicated by the standard one-
letter codes).
5 The percent identity is then calculated as:
Total number of identical matches
x 100
[length of the longer sequence plus the
10 number of gaps introduced into the longer
sequence in order to align the two
sequences]
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
11
,'~ H N
M
r1I
N L(1N N
I O
I
U7 ~ r1 M N
I N
I
L~ L~ r-ir-IdlM
I I N
I
I
Cz-~ l0V~ N N f-IM
I I r1
I
LI1O N '-Ir-1r1ri
I I I I r1
I
e~.~ tnr-1M r-IO r--IM N
N
I I I I I I
I
H
s-~ cr N N O M N r1 N r1
r1
I I I I I I
H ~ N M r1 O M N o-IM r1
M
I I I I
I I
'
.. ~ M M r1N r-IN r-IN N N
~, I I I I I I I I I M
1
C~ l0N d'd' N M M N O N N M
I I I I I I I I I M
I
I
W tllN O M M e-1N M r1 O r1 M N
I I I I I I I I N
I
I
Ot lIlN N O M N riO M r1 O v-~IN r-I
I I I I I I I N
I
I
U alM d' M M r1r1 M v-iN M r1r1 N N
I I I I I I -II I I I I I r-i
I
I
l0 M O N r-1ri M dl r1M M r1 O r1 ~ M
I I I I I I I I I I I M
I
I
,'Z, lflri M O O O c-iM M O N M N r1O d~N
I I I I I I I M
I
I
(1,' L(1O N M r-1O N O M N N r-IM N rir~ M N
I I I I I I I I I I I M
I
I
VIr1 N N O r1 r-iO N r1r1 r1r-IN r-Ir-IO M N
I I I I I I I I I I I I I O
I
rx z r~ ~ a w ~ x H I-a~'~ C~fuelCl~E-~~ ~"I
L(1 O Ll1 O
ri r1 N
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
12
The level of identity between amino acid sequences can be determined
using the "FASTA" similarity search algorithm disclosed by Pearson and Lipman
(Proc.
Natl. Acad. Sci. USA 85:2444, 1988) and by Pearson (Meth. Enzymol. 183:63,
1990).
Briefly, FASTA first characterizes sequence similarity by identifying regions
shared by
the query sequence (e.g., SEQ ID N0:2) and a test sequence that have either
the highest
density of identities (if the ktup variable is 1 ) or pairs of identities (if
ktup=2), without
considering conservative amino acid substitutions, insertions, or deletions.
The ten
regions with the highest density of identities are then rescored by comparing
the
similarity of all paired amino acids using an amino acid substitution matrix,
and the
ends of the regions are "trimmed" to include only those residues that
contribute to the
highest score. If there are several regions with scores greater than the
"cutoff' value
(calculated by a predetermined formula based upon the length of the sequence
and the
ktup value), then the trimmed initial regions are examined to determine
whether the
regions can be joined to form an approximate alignment with gaps. Finally, the
highest
scoring regions of the two amino acid sequences are aligned using a
modification of the
Needleman-Wunsch-Sellers algorithm (Needleman and Wunsch, J. Mol. Biol.
48:444,
1970; Sellers, SIAM J. Appl. Math. 26:787, 1974), which allows for amino acid
insertions and deletions. Preferred parameters for FASTA analysis are: ktup=l,
gap
opening penalty=10, gap extension penalty=1, and substitution matrix=BLOSUM62.
2 0 These parameters can be introduced into a FASTA program by modifying the
scoring
matrix file ("SMATRIX"), as explained in Appendix 2 of Pearson, 1-990 (ibid.).
FASTA can also be used to determine the sequence identity of nucleic
acid molecules using a ratio as disclosed above. For nucleotide sequence
comparisons,
the ktup value can range between one to six, preferably from three to six,
most
2 5 preferably three, with other parameters set as default.
The present invention includes polypeptides having one or more
conservative amino acid changes as compared with the amino acid sequence of
SEQ ID
N0:2. The BLOSUM62 matrix (Table 1 ) is an amino acid substitution matrix
derived
from about 2,000 local multiple alignmer_ts of protein sequence segments,
representing
3 0 highly conserved regions of more than 500 groups of related proteins
(Henikoff and
Henikoff, ibid.). Thus, the BLOSUM62 substitution frequencies can be used to
define
conservative amino acid substitutions that may be introduced into the amino
acid
sequences of the present invention. As used herein, the term "conservative
amino acid
substitution" refers to a substitution represented by a BLOSUM62 value of
greater than
35 -1. For example, an amino acid substitution is conservative if the
substitution is
characterized by a BLOSUM62 value of 0, 1, 2, or 3. Preferred conservative
amino
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
13
acid substitutions are charac .erized by a BLOSUM62 value of at least one 1
(e.g., 1, 2
or 3), while more preferred con_>e~~vative amino acid substitutions are
characterized by a
BLOSUM62 value of at least 2 (e.g., 2 or 3).
The proteins of the present invention can also comprise non-naturally
occuring amino acid residues. Non-naturally occuring amino acids include,
without
limitation, traps-3-methylproline, 2,4-methanoproline, ci.r-4-hydroxyproline,
traps-4
hydroxyproline, N-methylglycine, allo-threonine, methylthreonine,
hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine,
pipecolic acid, tert-leucine, norvaline, 2-azaphenylalanine, 3-
azaphenylalanine, 4
azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the
art for
incorporating non-naturally occuring amino acid residues into proteins. For
example,
an ifi vitro system can be employed wherein nonsense mutations are suppressed
using
chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino
acids
and aminoacylating tRNA are known in the art. Transcription and translation of
plasmids containing nonsense mutations is carried out in a cell-free system
comprising
an E. coli S30 extract and commercially available enzymes and other reagents.
Proteins
are purified by chromatography. See, for example, Robertson et al., J. Am.
Chem. Soc.
113:2722, 1991; Ellman et al., Methods Enzymol. 202:301, 1991; Chung et al.,
Science
259:806-809, 1993; and Chung et al., Proc. Natl. Acad. Sci. USA 90:10145-
10149,
1993). In a second method, translation is carried out in Xenopus oocytes by
microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs
(Turcatti et al., J. Biol. Chem. 271:19991-19998, 1996). Within a third
method, E. coli
cells are cultured in the absence of a natural amino acid that is to be
replaced (e.g.,
phenylalanine) and in the presence of the desired non-naturally occurring
amino acids)
2 5 (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-
fluorophenylalanine). The non-naturally occurring amino acid is incorporated
into the
protein in place of its natural counterpart. See, Koide et al., Biochem.
33:7470-7476,
1994. Naturally occurring amino acid residues can be converted to non-
naturally
occurring species by in vitro chemical modification. Chemical modification can
be
3 0 combined with site-directed mutagenesis to further expand the range of
substitutions
(Wynn and Richards, Protein Sci. 2:395-403, 1993).
Amino acid sequence changes are made in zFGFl2 polypeptides so as to
minimize disruption of higher order structure essential to biological activity
as
disclosed previously. Amino acid residues that are within regions or domains
that are
3 5 critical to maintaining structural integrity can be determined. Within
these regions one
can identify specific residues that will be more or less tolerant of change
and maintain
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
14
the overall tertiary structure of the molecule. Methods for analyzing sequence
structure
include, but are not limited to, alignment of multiple sequences with high
amino acid or
nucleotide identity, secondary structure propensities, binary patterns,
complementary
packing, and buried polar interactions (Barton, Current Opin. Struct. Biol.
5:372-376,
1995 and Cordes et al., Current Opin. Struct. Biol. 6:3-10, 1996). In general,
determination of structure will be accompanied by evaluation of activity of
modified
molecules. For example, changes in amino acid residues will be made so as not
to
disrupt the beta-trefoil fold structure of the protein family. The effects of
amino acid
sequence changes can be predicted by, for example, computer modeling using
available
software (e.g., the Insight II~ viewer and homology modeling tools; MSI, San
Diego,
CA) or determined by analysis of crystal structure (see, e.g., Lapthorn et al,
Nature
369:455-461, 1994; Lapthorn et al., Nat. Struct. Biol. 2:266-268, 1995).
Protein
folding can be measured by circular dichroism (CD). Measuring and comparing
the CD
spectra generated by a modified molecule and standard molecule are routine in
the art
(Johnson, Proteins 7:205-214, 1990). Crystallography is another well known and
accepted method for analyzing folding and structure. Nuclear magnetic
resonance
(NMR), digestive peptide mapping and epitope mapping are other known methods
for
analyzing folding and structural similarities between proteins and
polypeptides
(Schaanan et al., Science 257:961-964, 1992). Mass spectrometry and chemical
2 0 modification using reduction and alkylation can be used to identify
cysteine residues
that are associated with disulfide bonds or are free of such associations
(Bean et al.,
Anal. Biochem. 201:216-226, 1992; Gray, Protein Sci. 2:1732-1748, 1993; and
Patterson et al., Anal. Chem. 66:3727-3732, 1994). Alterations in disulfide
bonding
will be expected to affect protein folding. These techniques can be employed
2 5 individually or in combination to analyze and compare the structural
features that affect
folding of a variant protein or polypeptide to a standard molecule to
determine whether
such modifications would be significant.
Essential amino acids in the polypeptides of the present invention can be
identified experimentally according to procedures known in the art, such as
site
3 0 directed mutagenesis or alanine-scanning mutagenesis (Cunningham and
Wells,
Science 244, 1081-1085, 1989; Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-
4502,
1991). In the latter technique, single alanine mutations are introduced at
every residue
in the molecule, and the resultant mutant molecules are tested for biological
activity as
disclosed below to identify amino acid residues that are critical to the
activity of the
3 5 molecule.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
Multiple amino acid substitutions can be made and tested using known
methods of mutagenesis and screening, such as those disclosed by Reidhaar-
Olson and
Sauer (Science 241:53-57, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA
86:2152-2156, 1989). Briefly, these authors disclose methods for
simultaneously
5 randomizing two or more positions in a polypeptide, selecting for functional
polypeptide, and then sequencing the mutagenized polypeptides to determine the
spectrum of allowable substitutions at each position. Other methods that can
be used
include phage display (e.g., Lowman et al., Biochem. 30:10832-10837, 1991;
Ladner et
al., U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and region-
10 directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA
7:127,
1988).
Variants of the disclosed zFGFl2 DNA and polypeptide sequences can
be generated through DNA shuffling as disclosed by Stemmer, Nature 370:389-
391,
1994 and Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-10751, 1994. Briefly,
variant
15 genes are generated by in vitro homologous recombination by random
fragmentation of
a parent gene followed by reassembly using PCR, resulting in randomly
introduced
point mutations. This technique can be modified by using a family of parent
genes,
such as allelic variants or genes from different species, to introduce
additional
variability into the process. Selection or screening for the desired activity,
followed by
2 0 additional iterations of mutagenesis and assay provides for rapid
"evolution" of
sequences by selecting for desirable mutations while simultaneously selecting
against
detrimental changes.
In many cases, the structure of the final polypeptide product will result
from processing of the nascent polypeptide chain by the host cell, thus the
final
sequence of a zFGFl2 polypeptide produced by a host cell will not always
correspond
to the full sequence encoded by the expressed polynucleotide. For example,
expressing
the complete zFGFl2 sequence in a cultured mammalian cell is expected to
result in
removal of at least the secretory peptide, while the same polypeptide produced
in a
prokaryotic host would not be expected to be cleaved. Differential processing
of
3 0 individual chains may result in heterogeneity of expressed polypeptides.
SEQ ~ NO: 3 is a degenerate polynucleotide sequence that
encompasses all polynucleotides that could encode the zFGFl2 polypeptide of
SEQ ID
NO: 2 (amino acids 1 or 25 to 251 ). Thus, zFGFl2 polypeptide-encoding
polynucleotides ranging from nucleotide 1 or 72 to nucleotide 753 of SEQ >D
NO: 3 are
3 5 contemplated by the present invention. Also contemplated by the present
invention are
fragments and fusions as described above with respect to SEQ m NO: l, which
are
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
16
formed from analogous regions of SEQ ID NO: 3, wherein nucleotides 1 or 72 to
753 of
SEQ ID NO: 3 correspond to nucleotides 115 or 187 to 870 of SEQ ID NO: 1, for
the
encoding a mature zFGFl2 molecule.
The symbols in SEQ ID NO: 3 are summarized in Table 1 below.
TABLE 1
Nucleotide Resolutions Complement Resolutions
A A T T
C C G G
G G C C
T T A A
R A~G Y CST
Y CST R A~G
M ABC K GET
K GET M ABC
S CMG S CMG
CMG ACT W ACT
H A~C~T D A~G~T
B C~G~T U A~C~G
U A~C~G B C~G~T
D A~G~T H A~C~T
N A~C~G~T N A~C~G~T
The degenerate codons used in SEQ ID NO: 3, encompassing all
possible codons for a given amino acid, are set forth in Table 2.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
17
TARI F ~
Amino Letter Colons Degenerate
Acid Colon
Cys C TGC TGT TGY
Ser S AGC AGTTCA TCC TCG TCT WSN
Thr T ACA ACCACG ACT ACN
Pro P CCA CCCCCG CCT CCN
Ala A GCA GCCGCG GCT GCN
Gly G GGA GGCGGG GGT GGN
Asn N AAC AAT AAY
Asp D GAC GAT GAY
Glu E GAA GAG GAR
Gln Q CAA CAG CAR
His H CAC CAT CAY
Arg R AGA AGGCGA CGC CGG CGT MGN
Lys K AAA AAG AAR
Met M ATG ATG
Ile I ATA ATCATT ATH
Leu L CTA CTCCTG CTT TTA TTG YTN
Val V GTA GTCGTG GTT GTN
Phe F TTC TTT TTY
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAGTGA TRR
Asn~Asp B RAY
Glu~Gln Z SAR
Any X NNN
Gap - ---
One of ordinary skill in the art will appreciate that some ambiguity is
introduced in determining a degenerate colon, representative of all possible
colons
encoding each amino acid. For example, the degenerate colon for serine (WSN)
can, in
some circumstances, encode arginine (AGR), and the degenerate colon for
arginine
(MGN) can, in some circumstances, encode serine (AGY). A similar relationship
exists
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
18
between codons encoding phenylalanine and leucine. Thus, some polynucleotides
encompassed by the degenerate sequence may have some variant amino acids, but
one
of ordinary skill in the art can easily identify such variant sequences by
reference to the
amino acid sequence of SEQ ID NO: 2. Variant sequences can be readily tested
for
functionality as described herein.
One of ordinary skill in the art will also appreciate that different species
can exhibit "preferential codon usage." In general, see, Grantham, et al.,
Nuc. Acids
Res. 8:1893-912, 1980; Haas, et al. Curr. Biol. 6:315-24, 1996; Wain-Hobson,
et al.,
Gene 13:355-64, 1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm, Nuc.
Acids
Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol. 158:573-97, 1982. As used
herein, the
term "preferential codon usage" or "preferential codons" is a term of art
referring to
protein translation codons that are most frequently used in cells of a certain
species,
thus favoring one or a few representatives of the possible codons encoding
each amino
acid (See Table 2). For example, the amino acid Threonine (Thr) may be encoded
by
ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the most commonly used
codon; in other species, for example, insect cells, yeast, viruses or
bacteria, different
Thr codons may be preferential. Preferential codons for a particular species
can be
introduced into the polynucleotides of the present invention by a variety of
methods
known in the art. Introduction of preferential codon sequences into
recombinant DNA
2 0 can, for example, enhance production of the protein by making protein
translation more
efficient within a particular cell type or species. Therefore, the degenerate
codon
sequence disclosed in SEQ ID NO: 3 serves as a template for optimizing
expression of
polynucleotides in various cell types and species commonly used in the art and
disclosed herein. Sequences containing preferential codons can be tested and
optimized
for expression in various species, and tested for functionality as disclosed
herein.
The highly conserved amino acids in zFGFl2 can be used as a tool to
identify new family members. To identify new family members in EST databases,
the
conserved CXFXE motif (SEQ ID NO: 5) can be used. In another method using
polynucleotide probes and hybridization methods, RNA obtained from a variety
of
3 0 tissue sources can be used to generate eDNA libraries and probe these
libraries for new
family members. In particular, reverse transcription-polymerise chain reaction
(RT-
PCR) can be used to amplify sequences encoding highly degenerate DNA primers
designed from the sequences corresponding to amino acid residue 113 (Cys) to
amino
acid residue 117 (His) of SEQ ID NO: 2.
The zFGFl2 gene has been derived chromosome 12, and located to
12p.1.3 (Genome Catalog, Oakridge National Laboratory, Oakridge, TN). Thus,
the
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
19
present invention provides methods for using zFGFl2 polynucleotides and
polypeptides
to identify chromosomal disorders associated with abnormal expression of the
zFGFl2
protein. Detectable chromosomal mutations at the zFGFl2 gene locus include,
but are
not limited to, aneuploidy, gene copy number changes, insertions, deletions,
translocations, restriction site changes and rearrangements. Such aberrations
can be
identified by employing molecular genetic techniques, such as restriction
fragment
length polymorphism (RFLPj analysis, short tandem repeat (STR) analysis
employing
PCR techniques, and other genetic linkage analysis techniques known in the art
(Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor
Laboratory
Press, Cold Spring Harbor, NY, 1989, and Ausubel et al., eds., Current
Protocols in
Molecular Biology, John Wiley and Sons, Inc., NY, 1987; A.J. Marian, Chest
108:255-
65, 1995). Analyses of DNA samples can detect deletions and insertions by
changes in
size in amplified DNA products by comparing a sample DNA to a normal zFGFl2
DNA standard. Mismatches in duplex DNA can be detected by RNase digestion or
differences in melting temperature. Other methods for detecting differences in
sequences include changes in electrophoretic motility, Southern analysis, and
direct
DNA sequencing. Recently, techniques for accessing genetic information with
high-
density arrays have been available (Chee et al., Science 274:610-614, 1996),
and can
analyze large fragments of genomic DNA with high resolution.
Analysis of chromosomal DNA using the zFGFl2 polynucleotide
sequence is useful for correlating disease with mutations localized to the
chromosome
where the zFGFl2 gene resides. Studies of the DNA sequences, cDNA and/or
genomic
DNA, of individuals presenting disease that correlates with a mutation in the
sequence
of the zFGFl2 gene, wherein such mutation is not present in normal
individuals, can
2 5 provide strong evidence for the mutation as causative factor of the
disease. In one
embodiment, the methods of the present invention provide a method of detecting
a
zFGFl2 chromosomal abnormality in sample from an individual comprising: (a)
obtaining a zFGFl2 RNA from the sample; (b) generating zFGFl2 cDNA by
polymerase chain reaction; and (c) comparing the nucleic acid sequence of the
zFGFl2
3 0 cDNA to the nucleic acid sequence as shown in SEQ ID NO: 1. In further
embodiments, the difference between the sequence of the zFGFl2 cDNA or zFGFl2
gene in the sample and the zFGFl2 sequence as shown in SEQ ID NO: 1 is
indicative
of a zFGFl2 chromosomal mutation. In other embodiments, introns, splice
acceptor or
splice donor abnormalities can be detected by comparison of genomic sequences
from a
3 5 patient to a standard genomic sequence.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
The present invention also contemplates kits for performing a diagnostic
assay for ZFGFl2 gene expression or to analyze the ZFGF12 locus of a subject.
Such
kits comprise nucleic acid probes, such as double-stranded nucleic acid
molecules
comprising the nucleotide sequence of SEQ ID NOS:1, or a fragment thereof, as
well as
5 single-stranded nucleic acid molecules having the complement of the
nucleotide
sequence of SEQ ID NOS:1, or a fragment thereof. Probe molecules may be DNA,
RNA, oligonucleotides, and the like. Kits may comprise nucleic acid primers
for
performing PCR.
Such a kit can contain all the necessary elements to perform a nucleic
10 acid diagnostic assay described above. A kit will comprise at least one
container
comprising a ZFGF12 probe or primer. The kit may also comprise a second
container
comprising one or more reagents capable of indicating the presence of ZFGF12
sequences. Examples of such indicator reagents include detectable labels such
as
radioactive labels, fluorochromes, chemiluminescent agents, and the like. A
kit may
15 also comprise a means for conveying to the user that the ZFGF12 probes and
primers
are used to detect ZFGFl2 gene expression. For example, written instructions
may state
that the enclosed nucleic acid molecules can be used to detect either a
nucleic acid
molecule that encodes ZFGF12, or a nucleic acid molecule having a nucleotide
sequence that is complementary to a ZFGF12-encoding nucleotide sequence, or to
2 0 analyze chromosomal sequences associated with the ZFGFl2 locus. The
written
material can be applied directly to a container, or the written material can
be provided
in the form of a packaging insert.
Within preferred embodiments of the invention, the isolated nucleic acid
molecules can hybridize under stringent conditions to nucleic acid molecules
having at
2 5 least a portion of the nucleotide sequence of SEQ ID NOs: l or 3 or to
nucleic acid
molecules having a nucleotide sequence complementary to those sequences. A
pair of
nucleic acid molecules, such as DNA-DNA, RNA-RNA and DNA-RNA, can hybridize
if the nucleotide sequences have some degree of complementarity. Hybrids can
tolerate
mismatched base pairs in the double helix, but the stability of the hybrid is
influenced
3 0 by the degree of mismatch. The Tm of the mismatched hybrid decreases by 1
°C for
every 1-1.5% base pair mismatch. Varying the stringency of the hybridization
conditions allows control over the degree of mismatch that will be present in
the hybrid.
The degree of stringency increases as the hybridization temperature increases
and the
ionic strength of the hybridization buffer decreases. Stringent hybridization
conditions
3 5 encompass temperatures of about 5-25°C below the Tm of the hybrid
and a
hybridization buffer having up to 1 M Na+. Higher degrees of stringency at
lower
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
21
temperatures can be achieved with the addition of formamide which reduces the
Tm of
the hybrid about 1 °C for each 1 ~o formamide in the buffer solution.
Generally, such
stringent conditions include temperatures of 20-70°C and a
hybridization buffer
containing up to 6xSSC and 0-50% formamide. A higher degree of stringency can
be
achieved at temperatures of from 40-70°C with a hybridization buffer
having up to
4xSSC and from 0-50% formamide. Highly stringent conditions typically
encompass
temperatures of 42-70°C with a hybridization buffer having up to IxSSC
and 0-50%
formamide. Different degrees of stringency can be used during hybridization
and
washing to achieve maximum specific binding to the target sequence. Typically,
the
washes following hybridization are performed at increasing degrees of
stringency to
remove non-hybridized polynucleotide probes from hybridized complexes.
The above conditions are meant to serve as a guide and it is well within
the abilities of one skilled in the art to adapt these conditions for use with
a particular
polypeptide hybrid. The Tm for a specific target sequence is the temperature
(under
defined conditions) at which 50% of the target sequence will hybridize to a
perfectly
matched probe sequence. Those conditions which influence the T~, include, the
size
and base pair content of the polynucleotide probe, the ionic strength of the
hybridization
solution, and the presence of destabilizing agents in the hybridization
solution.
Numerous equations for calculating T", are known in the art, and are specific
for DNA,
2 0 RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying
length
(see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual,
Second
Edition (Cold Spring Harbor Press 1989); Ausubel et al., (eds.), Current
Protocols in
Molecular Biology (John Wiley and Sons, Inc. 1987); Berger and Kimmel (eds.),
Guide to Molecular Cloning Techniques, (Academic Press, Inc. 1987); and
Wetmur,
Crit. Rev. Biochem. Mol. Biol. 26:227 (1990)). Sequence analysis software,
such as
OLIGO 6.0 (LSR; Long Lake, MN) and Primer Premier 4.0 (Premier Biosoft
International; Palo Alto, CA), as well as sites on the Internet, are available
tools for
analyzing a given sequence and calculating Tm based on user defined criteria.
Such
programs can also analyze a given sequence under defined conditions and
identify
3 0 suitable probe sequences. Typically, hybridization of longer
polynucleotide sequences,
>50 base pairs, is performed at temperatures of about 20-25°C below the
calculated T",.
For smaller probes, <50 base pairs, hybridization is typically carried out at
the Tm or 5-
10°C below. This allows for the maximum rate of hybridization for DNA-
DNA and
DNA-RNA hybrids.
3 5 The length of the polynucleotide sequence influences the rate and
stability of hybrid formation. Smaller probe sequences, <50 base pairs, reach
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
22
equilibrium with complementary sequences rapidly, but may form less stable
hybrids.
Incubation times of anywhere from minutes to hours can be used to achieve
hybrid
formation. Longer probe sequences come to equilibrium more slowly, but form
more
stable complexes even at lower temperatures. Incubations are allowed to
proceed
overnight or longer. Generally, incubations are carried out for a period equal
to three
times the calculated Cot time. Cot time, the time it takes for the
polynucleotide
sequences to reassociate, can be calculated for a particular sequence by
methods known
in the art.
The base pair composition of polynucleotide sequence will effect the
thermal stability of the hybrid complex, thereby influencing the choice of
hybridization
temperature and the ionic strength of the hybridization buffer. A-T pairs are
less stable
than G-C pairs in aqueous solutions containing sodium chloride. Therefore, the
higher
the G-C content, the more stable the hybrid. Even distribution of G and C
residues
within the sequence also contribute positively to hybrid stability. In
addition, the base
pair composition can be manipulated to alter the T", of a given sequence. For
example,
5-methyldeoxycytidine can be substituted for deoxycytidine and 5-
bromodeoxuridine
can be substituted for thymidine to increase the T",, whereas 7-deazz-2'-
deoxyguanosine
can be substituted for guanosine to reduce dependence on T", .
The ionic concentration of the hybridization buffer also affects the
2 0 stability of the hybrid. Hybridization buffers general 1y contain blocking
agents such as
Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.), denatured salmon
sperm
DNA, tRNA, milk powders (BLOTTO), heparin or SDS, and a Na+ source, such as
SSC
(lx SSC: 0.15 M sodium chloride, 15 mM sodium citrate) or SSPE (lx SSPE: 1.8 M
NaCI, 10 mM NaH~POa, 1 mM EDTA, pH 7.7). By decreasing the ionic concentration
of the buffer, the stability of the hybrid is increased. Typically,
hybridization buffers
contain from between 10 mM - 1 M Na+. The addition of destabilizing or
denaturing
agents such as formamide, tetralkylammonium salts, guanidinium canons or
thiocyanate canons to the hybridization solution will alter the T", of a
hybrid.
Typically, formamide is used at a concentration of up to 50% to allow
incubations to be
3 0 carried out at more convenient and lower temperatures. Formamide also acts
to reduce
non-specific background when using RNA probes.
As previously noted, the isolated polynucleotides of the present
invention include DNA and RNA. Methods for preparing DNA and RNA are well
known in the art. In general, RNA is isolated from a tissue or cell that
produces large
amounts of zFGFl2 RNA. Such tissues and cells are identified by Northern
blotting
(Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980), and include pancreas and
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
23
prostate. Total RNA can be prepared using guanidinium isothiocyanate
extraction
followed by isolation by centrifugation in a CsCI gradient (Chirgwin et al.,
Biochemistry 18:52-94, 1979). Poly (A)+ RNA is prepared from total RNA using
the
method of Aviv and Leder (Proc. Natl. Acad. Sci. USA 69:1408-1412, 1972).
Complementary DNA (cDNA) is prepared from poly(A)+ RNA using known methods.
Polynucleotides encoding zFGFl2 polypeptides are then identified and isolated
by, for
example, hybridization or PCR.
A full-length clone encoding zFGFl2 can be obtained by conventional
cloning procedures. Complementary DNA (cDNA) clones are preferred, although
for
some applications (e.g., expression in transgenic animals) it may be
preferable to use a
genomic clone, or to modify a eDNA clone to include at least one genomic
intron.
Methods for preparing cDNA and genomic clones are well known and within the
level
of ordinary skill in the art, and include the use of the sequence disclosed
herein, or parts
thereof, for probing or priming a library. Expression libraries can be probed
with
antibodies to zFGFl2, receptor fragments, or other specific binding partners.
The present invention further provides counterpart polypeptides and
polynucleotides from other species (orthologs). Of particular interest are
zFGFl2
polypeptides from other mammalian species, including murine, rat, porcine,
ovine,
bovine, canine, feline, equine and other primate proteins.
2 0 Orthologs of the human proteins can be cloned using information and
compositions provided by the present invention in combination with
conventional
cloning techniques. For example, a cDNA can be cloned using mRNA obtained from
a
tissue or cell type that expresses the protein. Suitable sources of mRNA can
be
identified by probing Northern blots with probes designed from the sequences
disclosed
2 5 herein. A library is then prepared from mRNA of a positive tissue or cell
line. A
zFGFl2-encoding cDNA can then be isolated by a variety of methods, such as by
probing with a complete or partial human cDNA or with one or more sets of
degenerate
probes based on the disclosed sequences. A cDNA can also be cloned using the
polymerase chain reaction, or PCR (Mullis, U.S. Patent 4,683,202), using
primers
3 0 designed from the sequences disclosed herein. Within an additional method,
the cDNA
library can be used to transform or transfect host cells, and expression of
the cDNA of
interest can be detected with an antibody to zFGFl2. Similar techniques can
also be
applied to the isolation of genomic clones.
Those skilled in the art will recognize that the sequences disclosed in
35 SEQ m NO: 1 and SEQ m NO: 2 represent a single allele of the human zFGFl2
gene
and polypeptide, respectively, and that allelic variation and alternative
splicing are
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
24
expected to occur. Allelic variants can be cloned by probing cDNA or genomic
libraries from different individuals according to standard procedures. Allelic
variants
of the DNA sequence shown in SEQ ID NO: 1, including those containing silent
mutations and those in which mutations result in amino acid sequence changes,
are
within the scope of the present invention, as are proteins which are allelic
variants of
SEQ ID NO: 2.
Mutagenesis methods as disclosed above can be combined with high-
throughput, automated screening methods to detect activity of cloned,
mutagenized
polypeptides in host cells. Mutagenized DNA molecules that encode active
polypeptides (e.g., cell proliferation) can be recovered from the host cells
and rapidly
sequenced using modern equipment. These methods allow the rapid determination
of
the importance of individual amino acid residues in a polypeptide of interest,
and can be
applied to polypeptides of unknown structure.
Using the methods discussed above, one of ordinary skill in the art can
identify and/or prepare a variety of polypeptides that are substantially
homologous to
residues 25 (Tyr) to 251 (Ile) or residues I (Met) to 251 (Ile) of SEQ ID NO:
2, allelic
variants thereof, or biologically active fragments thereof, and retain the
proliferative
properties of the wild-type protein. Such polypeptides may also include
additional
polypeptide segments as generally disclosed above.
2 0 The polypeptides of the present invention, including full-length proteins,
fragments thereof and fusion proteins, can be produced in genetically
engineered host
cells according to conventional techniques. Suitable host cells are those cell
types that
can be transformed or transfected with exogenous DNA and grown in culture, and
include bacteria, fungal cells, and cultured higher eukaryotic cells.
Eukaryotic cells,
2 5 particularly cultured cells of multicellular organisms, are preferred.
Techniques for
manipulating cloned DNA molecules and introducing exogenous DNA into a variety
of
host cells are disclosed by Sambrook et al., Molecular Cloning: A Laboratory
Manual,
2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989,
and
Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley and
Sons,
3 0 Inc., NY, 1987, which are incorporated herein by reference.
In general, a DNA sequence encoding a zFGFl2 polypeptide of the
present invention is operably linked to other genetic elements required for
its
expression, generally including a transcription promoter and terminator within
an
expression vector. The vector will also commonly contain one or more
selectable
3 5 markers and one or more origins of replication, although those skilled in
the art will
recognize that within certain systems selectable markers may be provided on
separate
CA 02396401 2002-07-03
WO 01/49740 PCT/USOI/00238
vectors, and replication of thc; exogenous DNA may be provided by integration
into the
host cell genome. Selection of promoters, terminators, selectable markers,
vectors and
other elements is a matter of routine design within the level of ordinary
skill in the art.
Many such elements are described in the literature and are available through
5 commercial suppliers. Alternative markers that introduce an altered
phenotype, such as
green fluorescent protein, or cell surface proteins such as CD4, CDB, Class I
MHC,
placental alkaline phosphatase may be used to sort transfected cells from
untransfected
cells by such means as FACS sorting or magnetic bead separation technology.
To direct a zFGFl2 polypeptide into the secretory pathway of a host cell,
10 a secretory signal sequence (also known as a leader sequence, prepro
sequence or pre
sequence) is provided in the expression vector. The secretory signal sequence
may be
the native sequence, or a chimera comprising a signal sequence derived from
another
secreted protein (e.g., t-PA and a-pre-pro secretory leader) or synthesized de
novo. The
secretory signal sequence is joined to the zFGFl2 DNA sequence in the correct
reading
15 frame. Secretory signal sequences are commonly positioned 5' to the DNA
sequence
encoding the polypeptide of interest, although certain signal sequences may be
positioned elsewhere in the DNA sequence of interest (see, e.g., Welch et al.,
U.S.
Patent No. 5,037,743; Holland et al., U.S. Patent No. 5,143,830).
Alternatively, the secretory signal sequence contained in the
2 0 polypeptides of the present invention is used to direct other polypeptides
into the
secretory pathway. The present invention provides for such fusion
polypeptides. A
signal fusion polypeptide can be made wherein a secretory signal sequence
derived
from amino acid residues 1-24 of SEQ ID N0:2 is be operably linked to another
polypeptide using methods known in the art and disclosed herein. The secretory
signal
2 5 sequence contained in the fusion polypeptides of the present invention is
preferably
fused amino-terminally to an additional peptide to direct the additional
peptide into the
secretory pathway. Such constructs have numerous applications known in the
art. For
example, these novel secretory signal sequence fusion constructs can direct
the
secretion of an active component of a normally non-secreted protein. Such
fusions may
3 0 be used in vivo or in vitro to direct peptides through the secretory
pathway.publication
WO 94/06463. Insect cells can be infected with recombinant baculovirus,
commonly
derived from Autographa californica nuclear polyhedrosis virus (AcNPV). See,
King;
L.A. and Possee, R.D., The Baculovirus Expression System: A Laboratory Guide,
London, Chapman & Hall; O'Reilly, D.R. et al., Baculovirus Expression Vectors:
A
3 5 Laboratory Manual, New York, Oxford University Press., 1994; and,
Richardson, C. D.,
Ed., Baculovirus Expression Protocols. Methods in Molecular Biology, Totowa,
NJ,
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
26
Humana Press, 1995. A second method of making recombinant zFGFl2 baculovirus
utilizes a transposon-based system described by Luckow (Luckow, V.A, et al., J
Virol
67:4566-79, 1993). This system, which utilizes transfer vectors, is sold in
the Bac-to-
BacTM kit (Life Technologies, Rockville, MD). This system utilizes a transfer
vector,
pFastBaclT"~ (Life Technologies) containing a Tn7 transposon to move the DNA
encoding the zFGFl2 polypeptide into a baculovirus genome maintained in E.
coli as a
large plasmid called a "bacmid." See, Hill-Perkins, M.S. and Possee, R.D., J
Gen Virol
71:971-6, 1990; Bonning, B.C. et al., J Gen Virol 75:1551-6, 1994; and,
Chazenbalk,
G.D., and Rapoport, B., J Biol Chem 270:1543-9, 1995. In addition, transfer
vectors
can include an in-frame fusion with DNA encoding an epitope tag at the C- or N-
terminus of the expressed zFGFl2 polypeptide, for example, a Glu-Glu epitope
tag
(Grussenmeyer, T. et al., Proc. Natl. Acad. Sci. 82:7952-4, 1985). Using a
technique
known in the art, a transfer vector containing zFGFl2 is transformed into E.
coli, and
screened for bacmids which contain an interrupted lacZ gene indicative of
recombinant
baculovirus. The bacmid DNA containing the recombinant baculovirus genome is
isolated, using common techniques, and used to transfect Spodoptera frugiperda
cells,
e.g. Sf9 cells. Recombinant virus that expresses zFGFl2 is subsequently
produced.
Recombinant viral stocks are made by methods commonly used the art.
The recombinant virus is used to infect host cells, typically a cell line
2 0 derived from the fall armyworm, Spodoptera frugiperda. See, in general,
Glick and
Pasternak, Molecular Biotechnology: Principles and Applications of Recombinant
DNA, ASM Press, Washington, D.C., 1994. Another suitable cell line is the High
FiveOT"~ cell line (Invitrogen) derived from Trichoplusia ni (U.S. Patent No.
5,300,435).
Commercially available serum-free media are used to grow and maintain the
cells.
Suitable media are Sf900 IIr"~ (Life Technologies) or ESF 921T"~ (Expression
Systems)
for the Sf9 cells; and Ex-ce110405T"" (JRH Biosciences, Lenexa, KS) or Express
FiveOT"" (Life Technologies) for the T. ni cells. The cells are grown up from
an
inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x 106
cells at
which time a recombinant viral stock is added at a multiplicity of infection
(MOI) of
3 0 0.1 to 10, more typically near 3. Procedures used are generally described
in available
laboratory manuals (King, L. A. and Possee, R.D., ibid.; O'Reilly, D.R. et
al., ibid.;
Richardson, C. D., ibid.). Subsequent purification of the zFGFl2 polypeptide
from the
supernatant can be achieved using methods described herein.
Fungal cells, including yeast cells, can also be used within the present
3 5 invention. Yeast species of particular interest in this regard include
Saccharomyces
cerevisiae, Pichia pastoris, and Pichia methanolica. Methods for transforming
S.
CA 02396401 2002-07-03
WO 01/49740 PCT/iJS01/00238
27
cerevisiae cells with exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311;
Kawasaki et al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008;
Welch et
al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075.
Transformed cells are selected by phenotype determined by the selectable
marker,
commonly drug resistance or the ability to grow in the absence of a particular
nutrient
(e.g., leucine). A preferred vector system for use in Saccharomyces cerevisiae
is the
POT1 vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373),
which
allows transformed cells to be selected by growth in glucose-containing media.
Suitable promoters and terminators for use in yeast include those from
glycolytic
enzymes (Cregg, U.S. Patent No. 4,882,279.) Aspergillus cells may be utilized
according to the methods of McKnight et al., U.S. Patent No. 4,935,349.
Methods for
transforming Acremonium chrysogenum are disclosed by Sumino et al., U.S.
Patent No.
5,162,228. Methods for transforming Neurospora are disclosed by Lambowitz,
U.S.
Patent No. 4,486,533.
The use of Pichia methanolica as host for the production of recombinant
proteins is disclosed in WIPO Publications WO 97/17450, WO 97/17451, WO
98/02536, and WO 98/02565. DNA molecules for use in transforming P.
methanolica
will commonly be prepared as double-stranded, circular plasmids, which are
preferably
2 0 linearized prior to transformation. For polypeptide production in P.
methanolica, it is
preferred that the promoter and terminator in the plasmid be that of a P.
methanolica
gene, such as a P. methanolica alcohol utilization gene (AUG1 or AUG2). Other
useful
promoters include those of the dihydroxyacetone synthase (DHAS), formate
dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of
the DNA
2 5 into the host chromosome, it is preferred to have the entire expression
segment of the
plasmid flanked at both ends by host DNA sequences. A preferred selectable
marker
for use in Pichia methanolica is a P. methanolica ADE2 gene, which encodes
phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21 ), which allows
ade2 host cells to grow in the absence of adenine. For large-scale, industrial
processes
3 0 where it is desirable to minimize the use of methanol, it is preferred to
use host cells in
which both methanol utilization genes (AUG 1 and AUG2) are deleted. For
production
of secreted proteins, host cells deficient in vacuolar protease genes (PEP4
and PRB 1 )
are preferred. Electroporation is used to facilitate the introduction of a
plasmid
containing DNA encoding a polypeptide of interest into P. metlaanolica cells.
It is
3 5 preferred to transform P. methareolica cells by electroporation using an
exponentially
decaying, pulsed electric field having a field strength of from 2.5 to 4.5
kV/cm,
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
28
preferably about 3.75 kV/cm, and a time constant (t) of from 1 to 40
milliseconds, most
preferably about 20 milliseconds.
Cultured mammalian cells are suitable hosts within the present
invention. Methods for introducing exogenous DNA into mammalian host cells
include
calcium phosphate-mediated transfection (Wigler et al., Cell 14:725, 1978;
Corsaro and
Pearson, Somatic Cell Genetics 7:603, 1981: Graham and Van der Eb, Viroloøy
52:456,
1973), electroporation (Neumann et al., EMBO J. 1:841-5, 1982), DEAE-dextran
mediated transfection (Ausubel et al., ibid.), and liposome-mediated
transfection
(Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80, 1993,
and
viral vectors (Miller and Rosman, BioTechniques 7:980-90, 1989; Wang and
Finer,
Nature Med. 2:714-6, 1996). The production of recombinant polypeptides in
cultured
mammalian cells is disclosed, for example, by Levinson et al., U.S. Patent No.
4,713,339; Hagen et al., U.S. Patent No. 4,784,950; Palmiter et al., U.S.
Patent No.
4,579,821; and Ringold, U.S. Patent No. 4,656,134. Suitable cultured mammalian
cells
include the COS-1 (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651 ), BHK
(ATCC No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and Chinese hamster ovary
(e.g.
CHO-Kl; ATCC No. CCL 61 or DG44) cell lines. Additional suitable cell lines
are
known in the art and available from public depositories such as the American
Type
2 0 Culture Collection, Rockville, Maryland. In general, strong transcription
promoters are
preferred, such as promoters from SV-40 or cytomegalovirus. See, e.g., U.S.
Patent No.
4,956,288. Other suitable promoters include those from metallothionein genes
(U.S.
Patent Nos. 4,579;821 and 4,601,978)and the adenovirus major late promoter.
Drug selection is generally used to select for cultured mammalian cells
2 5 into which foreign DNA has been inserted. Such cells are commonly referred
to as
"transfectants". Cells that have been cultured in the presence of the
selective agent and
are able to pass the gene of interest to their progeny are referred to as
"stable
transfectants." A preferred selectable marker is a gene encoding resistance to
the
antibiotic neomycin. Selection is carried out in the presence of a neomycin-
type drug,
3 0 such as G-418 or the like. Selection systems can also be used to increase
the expression
level of the gene of interest, a process referred to as "amplification."
Amplification is
carried out by culturing transfectants in the presence of a low level of the
selective
agent and then increasing the amount of selective agent to select for cells
that produce
high levels of the products of the introduced genes. A preferred amplifiable
selectable
3 5 marker is dihydrofolate reductase, which confers resistance to
methotrexate. Other
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
29
drug resistance genes (e.g. hygromycin resistance, mufti-drug resistance,
puromycin
acetyltransferase) can also be used.
Other higher eukaryotic cells can also be used as hosts, including plant
cells, insect cells and avian cells. The use of Agrobacterium rhizogenes as a
vector for
expressing genes in plant cells has been reviewed by Sinkar et al., J. Biosci.
(Ban~alore)
11:47-58, 1987. Transformation of insect cells and production of foreign
polypeptides
therein is disclosed by Guarino et al., U.S. Patent No. 5,162,222 and WIPO
Transformed or transfected host cells are cultured according to
conventional procedures in a culture medium containing nutrients and other
components required for the growth of the chosen host cells. A variety of
suitable
media, including defined media and complex media, are known in the art and
generally
include a carbon source, a nitrogen source, essential amino acids, vitamins
and
minerals. Media may also contain such components as growth factors or serum,
as
required. The growth medium will generally select for cells containing the
exogenously
added DNA by, for example, drug selection or deficiency in an essential
nutrient which
is complemented by the selectable marker carried on the expression vector or
co-
transfected into the host cell. P. methanolica cells are cultured in a medium
comprising
adequate sources of carbon, nitrogen and trace nutrients at a temperature of
about 25°C
to 35°C. Liquid cultures are provided with sufficient aeration by
conventional means,
2 0 such as shaking of small flasks or sparging of fermentors. A preferred
culture medium
for P. metlZanolica is YEPD (2% D-glucose, 2% BactoT"'' Peptone (Difco
Laboratories,
Detroit, MI), 1 % BactoTM yeast extract (Difco Laboratories), 0.004% adenine
and
0.006% L-leucine).
It is preferred to purify the polypeptides of the present invention to
>_80% purity, more preferably to >_90% purity, even more preferably >_95%
purity, and
particularly preferred is a pharmaceutically pure state, that is greater than
99.9% pure
with respect to contaminating macromolecules, particularly other proteins and
nucleic
acids, and free of infectious and pyrogenic agents. Preferably, a purified
polypeptide is
substantially free of other polypeptides, particularly other polypeptides of
animal origin.
3 0 Expressed recombinant zFGFl2 polypeptides (or chimeric zFGFl2
polypeptides) can be purified using fractionation and/or conventional
purification
methods and media. Ammonium sulfate precipitation and acid or chaotrope
extraction
may be used for fractionation of samples. Exemplary purification steps may
include
hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid
3 5 chromatography. Suitable anion exchange media include derivatized
dextrans, agarose,
cellulose, polyacrylamide, specialty silicas, and the like. PEI, DEAE, QAE and
Q
CA 02396401 2002-07-03
WO 01/49740 PCT/USOI/00238
derivatives are preferred, with DEAF Fast-Flow Sepharose (Pharmacia,
Piscataway,
NJ) being particularly preferred. Exemplary chromatographic media include
those
media derivatized with phenyl, butyl, or octyl groups, such as Phenyl-
Sepharose FF
(Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-
Sepharose
5 (Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71
(Toro
Haas) and the like. Suitable solid supports include glass beads, silica-based
resins,
cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene
beads, cross-
linked polyacrylamide resins and the like that are insoluble under the
conditions in
which they are to be used. These supports may be modified with reactive groups
that
10 allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl
groups,
hydroxyl groups and/or carbohydrate moieties. Examples of coupling chemistries
include cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide
activation, sulfhydryl activation, hydrazide activation, and carboxyl and
amino
derivatives for carbodiimide coupling chemistries. These and other solid media
are
15 well known and widely used in the art, and are available from commercial
suppliers.
Methods for binding receptor polypeptides to support media are well known in
the art.
Selection of a particular method is a matter of routine design and is
determined in part
by the properties of the chosen support. See, for example, Affinity
Chromatography:
Principles & Methods, Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988.
2 0 The polypeptides of the present invention can also be isolated by
exploitation of their heparin binding properties. For a review, see, Burgess
et al., Ann.
Rev. of Biochem. 58:575-606, 1989. Members of the FGF family can be purified
to
apparent homogeneity by heparin-Sepharose affinity chromatography
(Gospodarowicz
et al., Proc. Natl. Acad. Sci. 81:6963-6967, 1984) and eluted using linear
step gradients
2 5 of NaCI (Ron et al., J. Biol. Chem. 268(4):2984-2988, 1993;
Chromatoara~hy:
Principles & Methods, pp. 77-80, Pharmacia LKB Biotechnology, Uppsala, Sweden,
1993; in "Immobilized Affinity Ligand Techniques", Hermanson et al., eds., pp.
165-
167, Academic Press, San Diego, 1992; Kjellen et al., Ann. Rev. Biochem.Ann.
Rev.
Biochem. 60:443-474, 1991; and Ke et al., Protein Expr. Purif. x:497-507,
1992.)
3 0 Other purification methods include using immobilized metal ion
adsorption (IMAC) chromatography to purify histidine-rich proteins. Briefly, a
gel is
first charged with divalent metal ions to form a chelate (E. Sulkowski, Trends
in
Biochem. 3:1-7, 1985). Histidine-rich proteins will be adsorbed to this matrix
with
differing affinities, depending upon the metal ion used, and will be eluted by
3 5 competitive elution, lowering the pH, or use of strong chelating agents.
Other methods
of purification include purification of glycosylated proteins by lectin
affinity
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
31
chromatography and ion exchange chromatography (Methods in Enzymol., Vol. 182,
"Guide to Protein Purification", M. Deutscher, (ed.), Acad. Press, San Diego,
1990,
pp.529-39). Alternatively, a fusion of the polypeptide of interest and an
affinity tag
(e.g., polyhistidine, maltose-binding protein, an immunoglobulin domain) may
be
constructed to facilitate purification.
Protein refolding (and optionally reoxidation) procedures may be
advantageously used. It is preferred to purify the protein to >80% purity,
more
preferably to >90% purity, even more preferably >95%, and particularly
preferred is a
pharmaceutically pure state, that is greater than 99.9% pure with respect to
contaminating macromolecules, particularly other proteins and nucleic acids,
and free
of infectious and pyrogenic agents. Preferably, a purified protein is
substantially free of
other proteins, particularly other proteins of animal origin.
zFGFl2 polypeptides or fragments thereof may also be prepared through
chemical synthesis. zFGFl2 polypeptides may be monomers or multimers;
glycosylated
or non-glycosylated; pegylated or non-pegylated; and may or may not include an
initial
methionine amino acid residue.
An in viva approach for assaying proteins of the present invention
involves viral delivery systems. Exemplary viruses for this purpose include
adenovirus,
herpesvirus, vaccinia virus and adeno-associated virus (AAV). Adenovirus, a
double-
t 0 stranded DNA virus, is currently the best studied gene transfer vector for
delivery of
heterologous nucleic acid (for a review, see T.C. Becker et al., Meth. Cell
Biol. 43:161-
89, 1994; and J.T. Douglas and D.T. Curiel, Science & Medicine 4:44-53, 1997).
The
adenovirus system offers several advantages: adenovirus can (i) accommodate
relatively large DNA inserts; (ii) be grown to high-titer; (iii) infect a
broad range of
2 5 mammalian cell types; and (iv) be used with a large number of available
vectors
containing different promoters. Also, because adenoviruses are stable in the
bloodstream, they can be administered by intravenous injection.
By deleting portions of the adenovirus genome, larger inserts (up to 7
kb) of heterologous DNA can be accommodated. These inserts can be incorporated
3 0 into the viral DNA by direct ligation or by homologous recombination with
a co
transfected plasmid. In an exemplary system, the essential E 1 gene has been
deleted
from the viral vector, and the virus will not replicate unless the El gene is
provided by
the host cell (the human 293 cell line is exemplary). When intravenously
administered
to intact animals, adenovirus primarily targets the liver. If the adenoviral
delivery
3 5 system has an E 1 gene deletion, the virus cannot replicate in the host
cells. However,
the host's tissue (e.g., liver) will express and process (and, if a secretory
signal
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
32
sequence is present, secrete) the heterologous protein. Secreted proteins will
enter the
circulation in the highly vascularized liver, and effects on the infected
animal can be
determined.
The adenovirus system can also be used for protein production in vitro.
By culturing adenovirus-infected non-293 cells under conditions where the
cells are not
rapidly dividing, the cells can produce proteins for extended periods of time.
For
instance, BHK cells are grown to confluence in cell factories, then exposed to
the
adenoviral vector encoding the secreted protein of interest. The cells are
then grown
under serum-free conditions, which allows infected cells to survive for
several weeks
without significant cell division. Alternatively, adenovirus vector infected
293 cells can
be grown as adherent cells or in suspension culture at relatively high cell
density to
produce significant amounts of protein (see Gamier et al., Cytotechnol. 15:145-
55,
1994). With either protocol, an expressed, secreted heterologous protein can
be
repeatedly isolated from the cell culture supernatant. Within the infected
293S cell
production protocol, non-secreted proteins may also be effectively obtained.
The activity of molecules of the present invention can be measured using
a variety of assays that, for example, measure neogenesis or hyperplasia
(i.e.,
proliferation) of neuronal, prostatic, renal, or pancreatic cells based on the
tissue
specificity. Moreover, tissue analysis supports that zFGFl2 promotes growth
and/or
2 0 differentiation of hematopoietic cells or stromal cells supporting growth
of
hematopoietic cells. Additional activities likely associated with the
polypeptides of the
present invention include proliferation of endothelial cells, fibroblasts,
cardiac and
skeletal myocytes, epithelial cells and keratinocytes, directly or indirectly
through other
growth factors; action as a chemotaxic factor for endothelial cells,
fibroblasts and/or
2 5 phagocytic cells; osteogenic factor; and factor for expanding mesenchymal
stem cell
and precursor populations.
Proliferation can be measured using cultured cardiac cells or in vivo by
administering molecules of the claimed invention to the appropriate animal
model.
Generally, proliferative effects are seen as an increase in cell number and
therefore,
3 0 may include inhibition of apoptosis, as well as mitogenesis. Cultured
cells include
fibroblasts, skeletal myocytes, human umbilical vein endothelial cells from
primary
cultures. Established cell lines include: NIH 3T3 fibroblast (ATCC No. CRL-
1658),
CHH-1 chum heart cells (ATCC No. CRL-1680), H9c2 rat heart myoblasts (ATCC No.
CRL-1446), Shionogi mammary carcinoma cells (Tanaka et al., Proc. Natl. Acad.
Sci.
35 89:8928-8932, 1992) and LNCap.FGC adenocarcinoma cells (ATCC No. CRL-1740.)
Assays measuring cell proliferation are well known in the art. For example,
assays
CA 02396401 2002-07-03
WO 01/49740 PCT/~JSO1/00238
33
measuring proliferation incl.~de such assays as chemosensitivity to neutral
red dye
(Cavanaugh et al., Investigataor:al New Drugs 8:347-354, 1990, incorporated
herein by
reference), incorporation of radiolabelled nucleotides (Cook et al.,
Analytical Biochem.
179:1- 7, 1989, incorporated herein by reference), incorporation of 5-bromo-2'-
deoxyuridine (BrdU) in the DNA of proliferating cells (Porstmann et al., J.
Immunol.
Methods 82:169-179, 1985, incorporated herein by reference), and use of
tetrazolium
salts (Mosmann, J. Immunol. Methods 65:55-63, 1983; Alley et al., Cancer Res.
48:589-601, 1988; Marshall et al., Growth Rea. 5:69-84, 1995; and Scudiero et
al.,
Cancer Res. 48:4827-4833, 1988; all incorporated herein by reference).
Differentiation is a progressive and dynamic process, beginning with
pluripotent stem cells and ending with terminally differentiated cells.
Pluripotent stem
cells that can regenerate without commitment to a lineage express a set of
differentiation markers that are lost when commitment to a cell lineage is
made.
Progenitor cells express a set of differentiation markers that may or may not
continue to
be expressed as the cells progress down the cell lineage pathway toward
maturation.
Differentiation markers that are expressed exclusively by mature cells are
usually
functional properties such as cell products, enzymes to produce cell products
and
receptors. The stage of a cell population's differentiation is monitored by
identification
of markers present in the cell population. Myocytes, osteoblasts, adipocytes,
2 0 chrondrocytes, fibroblasts and reticular cells are believed to originate
from a common
mesenchymal stem cell (Owen et al., Ciba Fdn. Sym~ 136:42-46, 1988). Markers
for
mesenchymal stem cells have not been well identified (Owen et al., J. of Cell
Sci.
87:731-738, 1987), so identification is usually made at the progenitor and
mature cell
stages. The novel polypeptides of the present invention are useful for studies
to isolate
mesenchymal stem cells and myocyte progenitor cells, both in vivo and ex vivo.
There is evidence to suggest that factors that stimulate specific cell types
down a pathway towards terminal differentiation or dedifferentiation, affects
the entire
cell population originating from a common precursor or stem cell. Thus, the
present
invention includes stimulation, inhibition, or proliferation of myocytes,
smooth muscle
3 0 cells, osteoblasts, adipocytes, chondrocytes, neural tube-derived stem
cells, neural crest
stem cells, and neuronal progenitors, pancreatic cells, prostate-derived cells
and
endothelial cells. Molecules of the present invention may, while stimulating
proliferation or differentiation of cardiac myocytes, inhibit proliferation or
differentiation of adipocytes, by virtue of the affect on their common
precursor/stem
3 5 cells. Thus molecules of the present invention, have use in inhibiting
chondrosarcomas,
atherosclerosis, restenosis and obesity.
CA 02396401 2002-07-03
WO 01/49740 PCT/iJS01/00238
34
Assays measuring differentiation include, for example, measuring cell
surface markers associated with stage-specific expression of a tissue,
enzymatic
activity, functional activity or morphological changes (Watt, FASEB, 5:281-
284, 1991;
Francis, Differentiation 57:63-75, 1994; Raes, Adv. Anim. Cell Biol. Technol.
Bioprocesses, 161-171, 1989; all incorporated herein by reference).
In vivo assays for evaluating neogenesis or hyperplasia include cellular
proliferation assays (Stern et al., Proc. Natl. Acad. Sci. 87:6808-6812, 1990,
Lok et al.,
Nature 369:565-568, 1994), stimulation of the proliferation of neuronal and-
filial
progenitors isolated from the septum and striatum (Palmer et al., Mol. Cell.
Neurosci.
6:474-486, 1995), and stimulation of differentiation of neurons from neural
crest
progenitors (Vaisman et al., Development 115:1059-1069, 1992).
In vivo assays for measuring changes in bone formation rates include
performing bone histology (see, Recker, R., eds. Bone Histomorphometry:
Techniques
and Interpretation. Boca Raton: CRC Press, Inc., 1983) and quantitative
computed
tomography (QCT; Ferretti,J. Bone 17:353S-364S, 1995; Orphanoludakis et al.,
Investia. Radiol. 14:122-130" 1979 and Durand et al., Medical Physics 19:569-
573,
1992). An ex vivo assay for measuring changes in bone formation would be, for
example, a calavarial assay (Gowen et al., J. Immunol. 136:2478-2482, 1986).
With regard to modulating energy balance, particularly as it relates to
adipocyte metabolism, proliferation and differentiation, zFGFl2 polypeptides
may
modulate effects on metabolic reactions. Such metabolic reactions include
adipogenesis, gluconeogenesis, glycogenolysis, lipogenesis, glucose uptake,
protein
synthesis, thermogenesis, oxygen utilization and the like. Among other methods
known
in the art or described herein, mammalian energy balance may be evaluated by
2 5 monitoring one or more of the aforementioned metabolic functions. These
metabolic
functions are monitored by techniques (assays or animal models) known to one
of
ordinary skill in the art, as is more fully set forth below. For example, the
glucoregulatory effects of insulin are predominantly exerted in the liver,
skeletal muscle
and adipose tissue. In skeletal muscle and adipose tissue, insulin acts to
stimulate the
3 0 uptake, storage and utilization of glucose.
Art-recognized methods exist for monitoring all of the metabolic
functions recited above. Thus, one of ordinary skill in the art is able to
evaluate
zFGFl2 polypeptides, fragments, fusion proteins, antibodies, agonists and
antagonists
for metabolic modulating functions. Exemplary modulating techniques are set
forth
3 5 below.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
Insulin-stimulated lipogenesis, for example, may be monitored by
measuring the incorporation of 14C-acetate into triglyceride (Mackall et al.
J. Biol.
Chem. 251:6462-6464, 1976) or triglyceride accumulation (Kletzien et al., Mol.
Pharmacol. 41:393-398, 1992).
5 zFGFl2-stimulated uptake may be evaluated, for example, in an assay
for insulin-stimulated glucose transport. Primary adipocytes or NIH 3T3 L1
cells
(ATCC No. CCL-92.1 ) are placed in DMEM containing 1 g/1 glucose, 0.5 or 1.0%
BSA, 20 mM Hepes, and 2 mM glutamine. After two to five hours of culture, the
medium is replaced with fresh, glucose-free DMEM containing 0.5 or 1.0% BSA,
20
10 mM Hepes, 1 mM pyruvate, and 2 mM glutamine. Appropriate concentrations of
zFGFl2, insulin or IGF-1, or a dilution series of the test substance, are
added, and the
cells are incubated for 20-30 minutes. 3H or 14C-labeled deoxyglucose is added
to =50
~M final concentration, and the cells are incubated for approximately 10-30
minutes.
The cells are then quickly rinsed with cold buffer (e.g. PBS), then lysed with
a suitable
15 lysing agent (e.g. 1 % SDS or 1 N NaOH). The cell lysate is then evaluated
by counting
in a scintillation counter. Cell-associated radioactivity is taken as a
measure of glucose
transport after subtracting non-specific binding as determined by incubating
cells in the
presence of cytochalasin b, an inhibitor of glucose transport. Other methods
include
those described by, for example, Manchester et al., Am. J. Physiol. 266
(Endocrinol.
2 0 Metab. 29):E326-E333, 1994 (insulin-stimulated glucose transport).
Protein synthesis may be evaluated, for example, by comparing
precipitation of 35S-methionine-labeled proteins following incubation of the
test cells
with ;SS-methionine and 35S-methionine and a putative modulator of protein
synthesis.
Thermogenesis may be evaluated as described by B. Stanley in The
2 5 Biology of Neuropeptide Y and Related Peptides, W. Colmers and C.
Wahlestedt (eds.),
Humana Press, Ottawa, 1993, pp. 457-509; C. Billington et al., Am. J. Physiol.
260:8321, 1991; N. Zarjevski et al., Endocrinolo~y 133:1753, 1993; C.
Billington et
al., Am. J. Physiol. 266:81765, 1994; Heller et al., Am. J. Physiol. 252(4 Pt
2): 8661-7,
1987; and Heller et al., Am. J. Physiol. 245(3): 8321-8, 1983. Also, metabolic
rate,
3 0 which may be measured by a variety of techniques, is an indirect
measurement of
thermogenesis.
Oxygen utilization may be evaluated as described by Heller et al.,
Pflu~ers Arch. 369(1): 55-9, 1977. This method also involved an analysis of
hypothalmic temperature and metabolic heat production. Oxygen utilization and
3 5 thermoregulation have also been evaluated in humans as described by
Haskell et al., J.
Appl. Physiol. 51 (4): 948-54, 1981.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
36
zFGFl2 polypeptides can also be used to prepare antibodies that
specifically bind to zFGFl2 epitopes, peptides or polypeptides. Methods for
preparing
polyclonal and monoclonal antibodies are well known in the art (see, for
example,
Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold
Spring Harbor, NY, 1989; and Hurrell, J. G. R., Ed., Monoclonal Hybridoma
Antibodies: Techniques and Applications, CRC Press, Inc., Boca Raton, FL,
1982,
which are incorporated herein by reference). As would be evident to one of
ordinary
skill in the art, polyclonal antibodies can be generated from a variety of
warm-blooded
animals, such as horses, cows, goats, sheep, dogs, chickens, rabbits, mice,
and rats.
The immunogenicity of a zFGFl2 polypeptide may be increased through
the use of an adjuvant, such as alum (aluminum hydroxide) or Freund's complete
or
incomplete adjuvant. Polypeptides useful for immunization also include fusion
polypeptides, such as fusions of zFGFl2 or a portion thereof with an
immunoglobulin
polypeptide or with maltose binding protein. The polypeptide immunogen may be
a
full-length molecule or a portion thereof. If the polypeptide portion is
"hapten-like",
such portion may be advantageously joined or linked to a macromolecular
carrier (such
as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus
toxoid)
for immunization.
As used herein, the term "antibodies" includes polyclonal antibodies,
2 0 affinity-purified polyclonal antibodies, monoclonal antibodies, and
antigen-binding
fragments, such as F(ab')2 and Fab proteolytic fragments. Genetically
engineered intact
antibodies or fragments, such as chimeric antibodies, Fv fragments, single
chain
antibodies and the like, as well as synthetic antigen-binding peptides and
polypeptides,
are also included. Non-human antibodies may be humanized by grafting only non-
2 5 human CDRs onto human framework and constant regions, or by incorporating
the
entire non-human variable domains (optionally "cloaking" them with a human-
like
surface by replacement of exposed residues, wherein the result is a "veneered"
antibody). In some instances, humanized antibodies may retain non-human
residues
within the human variable region framework domains to enhance proper binding
3 0 characteristics. Through humanizing antibodies, biological half-life may
be increased,
and the potential for adverse immune reactions upon administration to humans
is
reduced. Alternative techniques for generating or selecting antibodies useful
herein
include in vitro exposure of lymphocytes to zFGFl2 protein or peptide, and
selection of
antibody display libraries in phage or similar vectors (for instance, through
use of
3 5 immobilized or labeled zFGFl2 protein or peptide).
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
37
Antibodies are defined to be specifically binding if they bind to a
zFGFl2 polypeptide with a binding affinity (Ka) of 106 M-I or greater,
preferably 107
M-~ or greater, more preferably 108 M-~ or greater, and most preferably 10~ M-
~ or
greater. The binding affinity of an antibody can be readily determined by one
of
ordinary skill in the art (for example, by Scatchard analysis).
A variety of assays known to those skilled in the art can be utilized to
detect antibodies which specifically bind to zFGFl2 proteins or peptides.
Exemplary
assays are described in detail in Antibodies: A Laboratory Manual, Harlow and
Lane
(Eds.), Cold Spring Harbor Laboratory Press, 1988. Representative examples of
such
assays include: concurrent immunoelectrophoresis, radioimmunoassay,
radioimmuno-
precipitation, enzyme-linked immunosorbent assay (ELISA), dot blot or Western
blot
assay, inhibition or competition assay, and sandwich assay. In addition,
antibodies can
be screened for binding to wild-type versus mutant zFGFl2 protein or peptide.
Antibodies to zFGFl2 may be used for tagging cells that express
zFGFl2; to target another protein, small molecule or chemical to heart tissue;
for
isolating zFGFl2 by affinity purification; for diagnostic assays for
determining
circulating levels of zFGFl2 polypeptides; for detecting or quantitating
soluble zFGFl2
as marker of underlying pathology or disease; in analytical methods employing
FACS;
for screening expression libraries; for generating anti-idiotypic antibodies;
and as
neutralizing antibodies or as antagonists to block zFGFl2 mediated
proliferation in
vitro and in vivo. Suitable direct tags or labels include radionuclides,
enzymes,
substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent
markers,
magnetic particles and the like; indirect tags or labels may feature use of
biotin-avidin
or other complement/anti-complement pairs as intermediates. Antibodies herein
may
2 5 also be directly or indirectly conjugated to drugs, toxins, radionuclides
and the like, and
these conjugates used for in vivo diagnostic or therapeutic applications.
Molecules of the present invention can be used to identify and isolate
receptors involved in neuronal or pancreatic cell proliferation. For example,
proteins
and peptides of the present invention can be immobilized on a column and
membrane
preparations run over the column (Immobilized Affinity Li~and Techniques,
Hermanson et al., eds., Academic Press, San Diego, CA, 1992, pp.195-202).
Proteins
and peptides can also be radiolabeled (Methods in Enzymol., vol. 182, "Guide
to
Protein Purification", M. Deutscher, ed., Acad. Press, San Diego, 1990, 721-
737) or
photoaffinity labeled (Brunner et al., Ann. Rev. Biochem. 62:483-514, 1993 and
Fedan
et al., Biochem. Pharmacol. 33:1167-1180, 1984) and specific cell-surface
proteins can
be identified.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
38
Antagonists will be useful for inhibiting the proliferative activities of
zFGFl2 molecules, in cell types such as neuronal, pancreatic, epithelial
cells,
keratinocytes, and prostatic cells, including fibroblasts and endothelial
cells. For
example, antagonists to zFGFl2 will be useful for inhibitions of disorders
associated
with kidney epithelium, such as glomerulonephritis. Disorders associated with
keratinocytes, such as psoriasis may be inhibited by zFGFl2 antagonists. Genes
encoding zFGFl2 polypeptide binding domains can be obtained by screening
random
peptide libraries displayed on phage (phage display) or on bacteria, such as
E. coli.
Nucleotide sequences encoding the polypeptides can be obtained in a number of
ways,
such as through random mutagenesis and random polynucleotide synthesis. These
random peptide display libraries can be used to screen for peptides which
interact with
a known target which can be a protein or polypeptide, such as a ligand or
receptor, a
biological or synthetic macromolecule, or organic or inorganic substances.
Techniques
for creating and screening such random peptide display libraries are known in
the art
(Ladner et al., US Patent N0:5,223,409; Ladner et al., US Patent N0:4,946,778;
Ladner
et al., US Patent N0:5,403,484 and Ladner et al., US Patent N0:5,571,698) and
random
peptide display libraries and kits for screening such libraries are available
commercially, for instance from Clontech (Palo Alto, CA), Invitrogen Inc. (San
Diego,
CA), New England Biolabs, Inc. (Beverly, I~IA) and Pharmacia LKB Biotechnology
2 0 Inc. (Piscataway, NJ). Random peptide display libraries can be screened
using the
zFGFl2 sequences disclosed herein to identify proteins which bind to zFGFl2.
These
"binding proteins" which interact with zFGFl2 polypeptides may be used for
tagging
cells; for isolating homolog polypeptides by affinity purification; they can
be directly or
indirectly conjugated to drugs, toxins, radionuclides and the like. These
binding
2 5 proteins can also be used in analytical methods such as for screening
expression
libraries and neutralizing activity. The binding proteins can also be used for
diagnostic
assays for determining circulating levels of polypeptides; for detecting or
quantitating
soluble polypeptides as marker of underlying pathology or disease. These
binding
proteins can also act as zFGFl2 "antagonists" to block zFGFl2 binding and
signal
3 0 transduction ire vitro and in vivo. These anti-zFGFl2 binding proteins
would be useful
for inhibiting expression of genes which result in proliferation or
differentiation. Such
anti-zFGFl2 binding proteins can be used for treatment, for example, in
neuroblastoma,
glioblastoma, prostatic hypertrophy, prostatic carcinoma, pancreatic
carcinoma, and
spinal cord injury, alone or combination with other therapies.
3 5 The molecules of the present invention will be useful for proliferation of
neuronal, prostatic and pancreatic tissue cells, such as pancreatic islets,
pancreatic
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
39
acinar cells, neuroectoderm, neurons of the central nervous systems, and
sympathetic
neurons in vitro. Molecules of the present invention will be useful for growth
and
differentiation of hematopoietic cells directly or by the means of stimulating
stromal
cells that support hematopoietic cells proliferation and differentiation. For
example,
molecules of the present invention are useful as components of defined cell
culture
media, and may be used alone or in combination with other cytokines and
hormones to
replace serum that is commonly used in cell culture. Molecules of the present
invention
are particularly useful in specifically promoting the growth and/or
development of
pancreatic islets, prostate cells (e.g., PZ-HPV-7 human prostate epithelium
cells ATCC
l0 Number: CRL-2221 and rat YPEN-1 normal prostate cells, ATCC Number: CRL-
2222); neuronal cells (e.g., mouse CATH.a brain neuronal cells ATCC Number:
CRL-
11179, human HCN-lA neuronal cells, ATCC Number: CRL-10442) in culture, and
may also prove useful in the study of hyperplasia and regeneration. Other
types of cells
for which zFGFl2 molecules will be useful for establishing and maintaining
cell
cultures include epithelial cells and keratinocytes. Epithelial cells can be
isolated from,
for example, prostate, cornea, lung, mammary or kidney tissues.
The polypeptides, nucleic acid and/or antibodies of the present invention
may be used in treatment of disorders associated with diabetes mellitus,
neural cell
development or degeneration, amyotrophic lateral sclerosis, cerebrovascular
stroke,
2 0 neurophathy associated with lack of maintenance of neuronal
differentiation, and
congenital disorders of the nervous system or lack of neuronal development.
Molecules
of the present invention may also be useful for promoting angiogenesis and
wound
healing, for revascularization in the eye, for complications related to poor
circulation
such as diabetic foot ulcers, for stroke, following coronary reperfusion using
2 5 pharmacologic methods and other indications where angiogenesis is of
benefit, such as
vascular diseases of the extremities. Molecules of the present invention may
be useful
for improving cardiac function, either by inducing cardiac myocyte neogenesis
and/or
hyperplasia, by inducing coronary collateral formation, or by inducing
remodeling of
necrotic myocardial area.
30 ZFGF12 will be useful for promoting wound healing of the epidermis.
The molecules of the present invention can be used to protect and promote
recovery of
the epithelial cells in the gastrointestinal tract, small intestine and oral
muscosa after
treat with chemotherapy and/or radiation. Stimulation of lung epithelial cells
lining the
air space can promote recovery from lung injury and complications associated
with
3 5 premature birth in neonates. ZFGF12 may also modulate surfactant
production in the
lung epithelium. Other epithelial cells are found in prostate, cornea, mammary
and
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
kidney tissue, and the proliferation and specialized cell functions of these
cells can be
modulated by zFGFl2.
An ischemic event is the disruption of blood flow to an organ, resulting
in necrosis or infarct of the non-perfused region. Ischemia-reperfusion is the
5 interruption of blood flow to an organ, such as the heart or brain, and
subsequent
restoration (often abrupt) of blood flow. While restoration of blood flow is
essential to
preserve functional tissue, the reperfusion itself is known to be deleterious.
In fact,
there is evidence that reperfusion of an ischemic area compromises endothelium-
dependent vessel relaxation resulting in vasospasms, and in the heart
compromised
10 coronary vasodilation, that is not seen in an ischemic event without
reperfusion (Cuevas
et al., Growth Factors 15:29-40, 1997). Both ischemia and reperfusion are
important
contributors to tissue necrosis, such as a myocardial infarct or stroke. The
molecules of
the present invention will have therapeutic value to reduce damage to the
tissues caused
by ischemia or ischemia-reperfusion events, particularly in the heart or
brain.
15 Other therapeutic uses for the present invention include induction of
skeletal muscle neogenesis and/or hyperplasia, kidney regeneration and/or for
treatment
of systemic and pulmonary hypertension.
ZFGF12 induced coronary collateral development is measured in rabbits,
dogs or pigs using models of chronic coronary occlusion (Landau et al., Amer.
Heart J.
20 29:924-931, 1995; Sellke et al., Surgery 120(2):182-188, 1996 and Lazarous
et al.,
1996, ibid.) zFGFl2 benefits for treating stroke is tested i'z vivo in rats
utilizing
bilateral carotid artery occlusion and measuring histological changes, as well
as maze
performance (Gage et al., Neurobiol. A~in~ 9:645-655, 1988). ZFGF12 efficacy
in
hypertension is tested in vivo utilizing spontaneously hypertensive rats (SHR)
for
25 systemic hypertension (Marche et al., Clin. Exp. Pharmacol. Physiol. Suppl.
1:S114-
116, 1995).
Molecules of the present invention can be used to target the delivery of
agents or drugs to the cells and/or tissues derived from the neuroectoderm,
the
developing central nervous systems, the developing peripheral nervous system,
the
3 0 developing spinal cord, prostate and pancreas. For example, the molecules
of the
present invention will be useful limiting expression to the neural tissue, by
virtue of the
tissue specific expression directed by the zFGFl2 promoter. For example,
neural
tissue-specific expression can be achieved using a zFGFl2-adenoviral
discistronic
construct (Rothmann et al., Gene Therapy 3:919-926, 1996). In addition, the
zFGFl2
3 5 polypeptides can be used to restrict other agents or drugs to neural
tissue by linking
zFGFl2 polypeptides to another protein (Franz et al., Circ. Res. 73:629-638,
1993) by
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
41
linking a first molecule that is comprised of a zFGFl2 homolog polypeptide
with a
second agent or drug to forrr~ a chimera. Proteins, for instance antibodies,
can be used
to form chimeras with zFGFl2 molecules of the present invention (Narula et
al., J.
Nucl. Cardiol. 2:26-34, 1995). Examples of agents or drugs include, but are
not limited
to, bioactive-polypeptides, genes, toxins, radionuclides, small molecule
pharmaceuticals and the like. Linking may be direct or indirect (e.g.,
liposomes), and
may occur by recombinant means, chemical linkage, strong non-covalent
interaction
and the like.
For pharmaceutical use, the proteins of the present invention are
formulated for parenteral, particularly intravenous or subcutaneous,
administration
according to conventional methods. Intravenous administration will be by bolus
injection or infusion over a typical period of one to several hours. In
general,
pharmaceutical formulations will include a zFGFl2 protein in combination with
a
pharmaceutically acceptable vehicle, such as saline, buffered saline, 5%
dextrose in
water or the like. Formulations may further include one or more excipients,
preservatives, solubilizers, buffering agents, albumin to prevent protein loss
on vial
surfaces, etc. Methods of formulation are well known in the art and are
disclosed, for
example, in ReminQton's Pharmaceutical Sciences, Gennaro, ed., Mack Publishing
Co.,
Easton PA, 1990, which is incorporated herein by reference. Therapeutic doses
will
2 0 generally be in the range of 0.1 to 100 pg/kg of patient weight per day,
preferably 0.5-
pg/kg per day, with the exact dose determined by the clinician according to
accepted
standards, taking into account the nature and severity of the condition to be
treated,
patient traits, etc. Determination of dose is within the level of ordinary
skill in the art.
The proteins may be administered for acute treatment, over one week or less,
often over
2 5 a period of one to three days or may be used in chronic treatment, over
several months
or years. In general, a therapeutically effective amount of zFGFl2 is an
amount
sufficient to produce a clinically significant change in proliferation, or
increases in
specific cell types associated with mesenchymal stem cells and progenitors.
ZFGF12 polypeptides can also be used to teach analytical skills such as
3 0 mass spectrometry, circular dichroism, to determine conformation,
especially of the
four alpha helices, x-ray crystallography to determine the three-dimensional
structure in
atomic detail, nuclear magnetic resonance spectroscopy to reveal the structure
of
proteins in solution. For example, a kit containing the ZFGF12 can be given to
the
student to analyze. Since the amino acid sequence would be known by the
instructor,
3 5 the protein can be given to the student as a test to determine the skills
or develop the
skills of the student, the instructor would then know whether or not the
student has
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
42
correctly analyzed the polypeptide. Since every polypeptide is unique, the
educational
utility of ZFGF12 would be unique unto itself.
The antibodies which bind specifically to ZFGF12 can be used as a
teaching aid to instruct students how to prepare affinity chromatography
columns to
purify ZFGF12, cloning and sequencing the polynucleotide that encodes an
antibody
and thus as a practicum for teaching a student how to design humanized
antibodies. The
ZFGF12 gene, polypeptide, or antibody would then be packaged by reagent
companies
and sold to educational institutions so that the students gain skill in art of
molecular
biology. Because each gene and protein is unique, each gene and protein
creates unique
challenges and learning experiences for students in a lab practicum. Such
educational
kits containing the ZFGFl2 gene, polypeptide, or antibody are considered
within the
scope of the present invention. The invention is further illustrated by the
following
non-limiting examples.
In summary, the present invention provides isolated polypeptides
comprising a sequence of amino acid residues that is at least 95% identical to
the
sequence as shown in SEQ ID NO: 2 from residue 25 to residue 251. In further
embodiments, the polypeptides of the present invention will be 95% identical
with a
cysteine at position 113, a phenylaline at position 115, and a histidine at
position 1 17.
2 0 In another embodiment, the polypeptides with further comprise a leucine at
positions
53, 73, and 102; a valine at positions 61, 83, 94, and 136; an isoleucine at
positions 75
and 85; a cysteine at position 113, a phenylalanine at position 115, a
tyrosine at position
127, as shown in SEQ ID NO: 2. The present invention also provides
polypeptides that
comprise the sequence of SEQ ID NO: 2 as shown from amino acid residue 25 to
amino
acid residue 251, and as shown from amino acid residue 1 to amino acid residue
251.
The present invention provides for expression vectors that comprise a
transcriptional promoter, a DNA segment encoding the polypeptides described
herein,
and a transcriptional terminator. In other aspects, the present invention
includes
cultured cells expressing the polypeptides described herein, as well as
methods for
3 0 making and recovering those polypeptides and the proteins that comprise
those
polypeptides.
In other aspects, the present invention provides antibodies that
specifically bind the polypeptides described herein and proteins that comprise
those
polypeptides.
3 5 The present invention provides polynucleotides comprising nucleotide
sequences that encode for the polypeptides described herein, and those shown
in SEQ
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
43
>D NO: 1 from nucleotide 187 to nucleotide 870 and shown in SEQ ID NO: 3 from
nucleotide 72 to nucleotide 753.
In another aspect, the present invention will provide for fusion proteins
that comprise at two polypeptides, of which at least one of those polypeptides
will
comprise a sequence of amino acid residues as shown in SEQ ID NO: 2 from
residue 25
to residue 251, or some other polypeptide described herein a molecule of the
present
invention.
The present invention provides for methods of using the molecules of
the present invention. For example, one method is use as a factor to stimulate
the
growth and/or differentiation of mesenchymal lineage cells comprising
culturing
mesenchymal stem cells or progenitor cells in the presence of zFGFl2
polypeptides
described herein in an amount sufficient to increase the number of mesenchymal
cells
as compared to cells grown in the absence of zFGFl2 polypeptides.
The invention is further illustrated by the following non-limiting
examples.
EXAMPLES
Example 1
Homologous recombination in yeast is used to create expression
plasmids containing the polynucleotide encoding zFGFl2 for expression in
mammalian
cells. To construct the zFGFl2/pCZF199 expression vectors the following DNA
fragments are transformed into S. cerevisiae: Sna BI digested pCZR 199 as an
acceptor
vector, the zFGFl2 EcoRI restriction fragment, and two, double stranded linker
segments. The expression vector, pCZR199, has yeast replication elements,
(CEN,
ARS), the selectable marker, URA3, E. coli replication elements (e.g., AMPR
and on ),
a blunt-ended cloning site, Sna BI, and adds either a N-terminal or C-terminal
Glu-Glu
tag (SEQ ID NO: 6). The vectors are used to create zFGFl2 polypeptides having
either
end of the expressed protein Glu-Glu tagged. The double stranded linker
segments are
prepared using PCR. The linkers served to join the vector to the insert
fragments at
3 0 both the 5' and 3' ends. Two sets of linkers are prepared. One set of
linkers joins the
insert to a vector placing the Glu-Glu tag (SEQ ID NO: 6) on the 5' end of the
insert
sequence using a linker. The second set of linkers is used to join the zFGFl2
insert into
a vector placing a 3' Glu-Glu tag (SEQ ID NO: 6). A third set of linkers is
used to join
the zFGFl2 insert into the vector, resulting in an untagged constructs The 5'
linker is
3 5 same as the linked used for the C-terminally Glu-Glu tagged zFGFl2. The 3'
linker is
the same as the linker used for the N-terminally Glu-Glu tagged zFGFl2. The
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
44
oligonucleotides are joined using standard PCR reaction conditions and heated
to 94°C
for 1.5 minutes followed by 10 cycles at 94°C for 30 seconds,
50°C for 1 minute and
72°C for 1 minute, then a 10 minute extension at 72°C.
The DNA fragments are added to 100 ?1 competent yeast (Genetic strain
SF838-9Da , Roffman et al., EMBO J. 8:2057-65, 1989) and electroporated. The
yeast
cells are immediately diluted in 600 ?1 1.2 M sorbitol and plated on Ura D
plates and
incubated at 30oC for 48 hours. Ura+ colonies are selected from both the N-
terminally
tagged and C-terminally-tagged zFGFl2 proteins and the DNA from the resulting
yeast
colonies is extracted and transformed into E. coli. Individual clones
harboring the
correct expression construct are identified by restriction digests. DNA
sequencing
confirms that the desired sequences has been enjoined with one another.
Large scale plasmid DNA is isolated from one or more correct clones
from both the N- and C-terminally tagged zFGFl2 sequences, the expression
cassette
liberated from the vector and transformed into yeast or E. coli for large
scale protein
production.
Example 2
The procedure described below is used for protein expressed in
conditioned media of E. coli, Pichia methanolica, and Chinese hamster ovary
cells
(CHO). For zFGFl2 expressed in E. coli and Pichia, however, the media is not
concentrated before application to the AF Heparin 650m affinity column. Unless
otherwise noted, all operations are carried out at 4°C. A total of 25
liters of conditioned
media from CHO cells is sequentially sterile filtered through a 4 inch, 0.2 mM
Millipore (Bedford, MA) OptiCap capsule filter and a 0.2 mM Gelman (Anr~
Arbor,
2 5 MI) Supercap 50. The material is then concentrated to about 1.3 liters
using a Millipore
ProFlux A30 tangential flow concentrator fitted with a 3000 kDa cutoff Amicon
(Bedford, MA) S 10Y3 membrane. The concentrated material is again sterile-
filtered
with the Gelman filter as described above. A mixture of protease inhibitors is
added to
the concentrated conditioned media to final concentrations of 2.5 mM
3 0 ethylenediaminetetraacetic acid (EDTA, Sigma Chemical Co. St. Louis, MO),
0.001
mM leupeptin (Boehringer-Mannheim, Indianapolis, IN), 0.001 mM pepstatin
(Boehringer-Mannheim) and 0.4 mM Pefabloc (Boehringer-Mannheim).
The concentrated conditioned media is applied to a 5.0 x 15.0 cm AF
Heparin 650m (TosoHaas, Montgomeryville, PA) column equilibrated in 0.25M
NaCI,
3 5 50 mM sodium phosphate, pH 7.2 at a flow rate of 5 ml/min using a BioCad
Sprint
HPLC (PerSeptive BioSystems, Framingham, MA). Two-ml fractions are collected
and
CA 02396401 2002-07-03
WO 01/49740 PCT/IJSO1/00238
the absorbance at 280 nM is monitored. After sample application, the column is
washed
with 10 column volumes of loading buffer and when the absorbance of the
effluent is
less than that 0.05, the column is eluted with a three column volume gradient
from 0.25
M to 2.0 M NaCI in 50 mM sodium phosphate, pH 7.2. The fractions containing
5 zFGFl2 are identified by SDS-PAGE and western blotting with anti-zFGFl2
antibodies.
Fractions containing zFGFl2 are pooled together and diluted ten-fold
into 50 mM sodium phosphate pH 7.5 and the material is applied to a 1.5 x 20.0
cm
Poros HS canon exchange column equilibrated in 50 mM phosphate pH 7.5 using
the
10 BioCad Sprint as described above. After sample application, the column is
washed with
10 column volumes of loading buffer and when the absorbance of the effluent is
less
than that 0.05, the column is eluted with a 40.0 column volume gradient from
0.0 M to
2.0 M NaCI in 50 mM sodium phosphate, pH 7.5. Fractions are collected as
described
above and those containing zFGFl2 will be identified by SDS-PAGE and Western
15 blotting, pooled together and concentrated using an Amicon stirred cell
fitted with a
YM-10 membrane.
The concentrated material is then be applied to a 3.5 x 100 cm
Sephacryl-S 100 gel filtration column equilibrated in 1.0 M NaCI, 0.01 M EDTA
and
0.05 M sodium phosphate, pH 7.2. Fractions are analyzed by SDS-PAGE and
Western
20 blotting with anti-zFGFl2 antibodies as described above. Fractions
containing pure
zFGFl2 are pooled together and samples are taken for amino acid analysis and N-
terminal sequencing. The remainder of the sample is aliquoted, and stored at -
80°C.
Example 3
25 E.coli fermentation medium is obtained from a strain expressing
zFGFl2 as a Maltose Binding protein fusion. The MBPzFGFI2 fusion is
solubilized
during sonication or French press rupture, using a buffer containing 20 mM
Hepes, 0.4
M Nacl, 0.01 M EDTA, 10 mM DTT, at pH 7.4. The extraction buffer also includes
5
p.g/ml quantities of Pepstatin, Leupeptin, Aprotinin, Bestatin. Phenyl methyl
3 0 sulfonylfluoride (PMSF) is also included at a final concentration of 0.5
mM.
The extract is spun at 18,000 x g for 30 minutes at 4°C. The
resulting
supernatent is processed on an Amylose resin (Pharmacia LKB Biotechnology,
Piscataway, NJ) which binds the MBP domain of the fusion. Upon washing the
column,
the bound MBPzFGFI2 fusion is eluted in the same buffer as extraction buffer
without
3 5 DTT and protease inhibitors but containing 10 mM Maltose.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
46
The eluted pool of MBPzFGFl2 is treated with 1:100 (w/w) Bovine
thrombin to MBPzFGFl2 fusion. The cleavage reaction is allowed to proceed for
6 to
8 hours at room temperature, after which the reaction mixture is passed over a
bed of
Benzamidine sepharose (Pharmacia LKB Biotechnology, Piscataway, NJ) to remove
the
thrombin, using the same elution buffer as described above for Amylose
affinity
chromatography.
The passed fraction, containing the cleaved product zFGFl2 and free
MBP domain are applied to a Toso Haas Heparin affinity matrix (Toro Haas,
Montgomeryville, PA) equilibrated in 0.5 M NaCI, 20 mM Hepes, 0.01 M EDTA at
pH
7.4. The MBP and zFGFl2 both bound to heparin under these conditions. The
bound
proteins are eluted with a 2 to 3 column volume gradient formed between O.SM
NaCI
and 2.0 M NaCI in column buffer.
Example 4
For construction of adenovirus vectors, the protein coding region of
human zFGFl2 is amplified by PCR using primers that add PmeI and AscI
restriction
sites at the 5' and 3' termini respectively. Amplification is performed with a
full-length
zFGFl2 cDNA template in a PCR reaction as follows: one cycle at 95°C
for 5 minutes;
followed by 15 cycles at 95°C for 1 min., 61°C for 1 min., and
72°C for 1.5 min.;
2 0 followed by 72°C for 7 min.; followed by a 4°C soak. The PCR
reaction product is
loaded onto a 1.2% low-melting-temperature agarose gel in TAE buffer (0.04 M
Tris-
aeetate, 0.001 M EDTA). The zFGFl2 PCR product is excised from the gel and
purified using a commercially available kit comprising a silica gel mambrane
spin
column (QIAquick0 PCR Purification Kit and gel cleanup kit; Qiagen, Inc.) as
per kit
2 5 instructions. The PCR product is then digested with PmeI and AscI,
phenol/chloroform
extracted, EtOH precipitated, and rehydrated in 20 ml TE (Tris/BDTA pH 8). The
zFGFl2 fragment is then ligated into the PmeI-AscI sites of the transgenic
vector
pTG 12-8 and transformed into E. coli DH IOBTM competent cells by
electroporation.
Vector pTGl2-8 was derived from p2999B4 (Palmiter et al., Mol. Cell Biol.
13:5266-
3 0 5275, 1993) by insertion of a rat insulin II intron (ca. 200 bp) and
polylinker (Fse I/Pme
I/Asc I) into the Nru I site. The vector comprises a mouse metallothionein (MT-
1)
promoter (ca. 750 bp) and human growth hormone (hGH) untranslated region and
polyadenylation signal (ca. 650 bp) flanked by 10 kb of MT-1 5' flanking
sequence and
7 kb of MT-1 3' flanking sequence. The cDNA is inserted between the insulin II
and
35 hGH sequences. Clones containing zFGFl2 are identified by plasmid DNA
miniprep
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
47
followed by digestion with PmeI and AscI. A positive clone is sequenced to
insure that
there were no deletions or other anomalies in the construct.
DNA is prepared using a commercially available kit (Maxi Kit, Qiagen,
Inc.), and the zFGFl2 cDNA is released from the pTGl2-8 vector using PmeI and
AscI
enzymes. The cDNA is isolated on a I °70 low melting temperature
agarose gel and
excised from the gel. The gel slice is melted at 70?C, and the DNA is
extracted twice
with an equal volume of Tris-buffered phenol, precipitated with EtOH, and
resuspended
in 10 ~tl H20.
The zFGFl2 cDNA is cloned into the EcoRV-AscI sites of a modified
l0 pAdTrack-CMV (He, T-C. et al., Proc. Natl. Acad. Sci. USA 95:2509-2514,
1998).
This construct contains the green fluorescent protein (GFP) marker gene. The
CMV
promoter driving GFP expression is replaced with the SV40 promoter, and the
SV40
polyadenylation signal is replaced with the human growth hormone
polyadenylation
signal. In addition, the native polylinker is replaced with FseI, EcoRV, and
AscI sites.
This modified form of pAdTrack-CMV is named pZyTrack. Ligation is performed
using a commercially available DNA ligation and screening kit (Fast-Link~ kit;
Epicentre Technologies, Madison, WI). Clones containing zFGFl2 are identified
by
digestion of mini prep DNA with FseI and AscI. In order to linearize the
plasmid,
approximately 5 pg of the resulting pZyTrack zFGFl2 plasmid is digested with
PmeI.
2 0 Approximately 1 pg of the linearized plasmid is cotransformed with 200 ng
of
supercoiled pAdEasy (He et al., ibid.) into E. coli BJ5183 cells (He et al.,
ibicl.). The
co-transformation is done using a Bio-Rad Gene Pulser at 2.5 kV, 200 ohms and
25
p,Fa. The entire co-transformation mixture is plated on 4 LB plates containing
25 ~g/ml
kanamycin. The smallest colonies are picked and expanded in LB/kanamycin, and
recombinant adenovirus DNA is identified by standard DNA miniprep procedures.
The
recombinant adenovirus miniprep DNA is transformed into E. coli DHIOBTM
competent cells, and DNA is prepared using a Maxi Kit (Qiagen, Inc.)
aaccording to kit
instructions.
Approximately 5 pg of recombinant adenoviral DNA is digested with
3 0 PacI enzyme (New England Biolabs) for 3 hours at 37°C in a reaction
volume of 100 ~l
containing 20-30U of PacI. The digested DNA is extracted twice with an equal
volume
of phenol/chloroform and precipitated with ethanol. The DNA pellet is
resuspended in
10 ~l distilled water. A T25 flask of QBI-293A cells (Quantum Biotechnologies,
Inc.
Montreal, Qc. Canada), inoculated the day before and grown to 60-70%
confluence, is
3 5 transfected with the PacI digested DNA. The PacI-digested DNA is diluted
up to a total
volume of 50 p1 with sterile HBS (150mM NaCI, 20mM HEPES). In a separate tube,
CA 02396401 2002-07-03
WO 01/49740 PCT/iJS01/00238
48
20 ~l of lmg/ml N-[I-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium salts
(DOTAP) (Boehringer Mannheim, Indianapolis, IN) is diluted to a total volume
of 100
~l with HBS. The DNA is added to the DOTAP, mixed gently by pipeting up and
down, and left at room temperature for I S minutes. The media is removed from
the
293A cells and washed with 5 ml serum-free minimum essential medium (MEM)
alpha
containing I mM sodium pyruvate, 0.1 mM MEM non-essential amino acids, and
25mM HEPES buffer (reagents obtained from Life Technologies, Gaithersburg,
MD).
5 ml of serum-free MEM is added to the 293A cells and held at 37°C. The
DNA/lipid
mixture is added drop-wise to the T25 flask of 293A cells, mixed gently, and
incubated
at 37°C for 4 hours. After 4 hours the media containing the DNA/lipid
mixture is
aspirated off and replaced with 5 ml complete MEM containing 5% fetal bovine
serum.
The transfected cells are monitored for GFP expression and formation of foci
(viral
plaques).
Seven days after transfection of 293A cells with the recombinant
adenoviral DNA, the cells express the GFP protein and start to form foci
(viral
"plaques"). The crude viral lysate is collected using a cell scraper to
collect all of the
293A cells. The lysate is transferred to a 50-ml conical tube. To release most
of the
virus particles from the cells, three freeze/thaw cycles are done in a dry
ice/ethanol bath
and a 37°C waterbath.
2 0 The crude lysate is amplified (Primary ( 1 °) amplification) to
obtain a
working ''stock" of zFGFl2 rAdV lysate. Ten lOcm plates of nearly confluent
(80-
90%) 293A cells are set up 20 hours previously, 200 ml of crude rAdV lysate is
added
to each 10-cm plate, and the cells are monitored for 48 to 72 hours for CPE
(cytopathic
effect) under the white light microscope and expression of GFP under the
fluorescent
2 5 microscope. When all of the 293A cells show CPE, this stock lysate is
collected and
freeze/thaw cycles performed as described above.
A secondary (2°) amplification of zFGFl2 rAdV is then performed.
Twenty IS-cm tissue culture dishes of 293A cells are prepared so that the
cells are 80-
90% confluent. All but 20 ml of 5% MEM media is removed, and each dish is
3 0 inoculated with 300-500 ml of the 1 ° amplified rAdv lysate. After
48 hours the 293A
cells are lysed from virus production, the lysate is collected into 250-ml
polypropylene
centrifuge bottles, and the rAdV is purified.
NP-40 detergent is added to a final concentration of 0.5% to the bottles
of crude lysate in order to lyse all cells. Bottles are placed on a rotating
platform for 10
3 5 minutes agitating as fast as possible without the bottles falling over.
The debris is
pelleted by centrifugation at 20,000 X G for 15 minutes. The supernatant is
transferred
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
49
to 250-ml polycarbonate cer_trifuge bottles, and 0.5 volume of 20% PEG8000/2.5
M
NaCI solution is added. The bottles are shaken overnight on ice. The bottles
are
centrifuged at 20,000 X G for 15 minutes, and the supernatant is discarded
into a bleach
solution. Using a sterile cell scraper, the white, virus/PEG precipitate from
2 bottles is
resuspended in 2.5 ml PBS. The resulting virus solution is placed in 2-ml
microcentrifuge tubes and centrifuged at 14,000 X G in the microcentrifuge for
10
minutes to remove any additional cell debris. The supernatant from the 2-ml
microcentrifuge tubes is transferred into a 15-ml polypropylene snapcap tube
and
adjusted to a density of 1.34 g/ml with CsCI. The solution is transferred to
3.2-ml,
polycarbonate, thick-walled centrifuge tubes and spun at 348,000 X G for 3-4
hours at
25?C. The virus forms a white band. Using wide-bore pipette tips, the virus
band is
collected.
A commercially available ion-exchange columns (e.g., PD-10 columns
prepacked with Sephadex~ G-25M; Pharmacia Biotech, Piscataway, NJ) is used to
desalt the virus preparation. The column is equilibrated with 20 ml of PBS.
The virus
is loaded and allowed to run into the column. 5 ml of PBS is added to the
column, and
fractions of 8-10 drops are collected. The optical densities of 1:50 dilutions
of each
fraction are determined at 260 nm on a spectrophotometer. Peak fractions are
pooled,
and the optical density (OD) of a 1:25 dilution is determined. OD is converted
to virus
concentration using the formula: (OD at 260nm)(25)(1.1 x 1012) = virions/ml.
To store the virus, glycerol is added to the purified virus to a final
concentration of IS%, mixed gently but effectively, and stored in aliquots at -
80°C.
A protocol developed by Quantum Biotechnologies, Inc. (Montreal,
Canada) is followed to measure recombinant virus infectivity. Briefly, two 96-
well
tissue culture plates are seeded with 1 X 104 293A cells per well in MEM
containing
2% fetal bovine serum for each recombinant virus to be assayed. After 24 hours
10
fold dilutions of each virus from 1X10 2 to 1X10 14 are made in MEM containing
2%
fetal bovine serum. 100 ~1 of each dilution is placed in each of 20 wells.
After 5 days
at 37°C, wells are read either positive or negative for CPE, and a
value for "Plaque
3 0 Forming Units/ml" (PFU) is calculated.
Example 5
A panel of cDNAs from human tissues is screened for zFGFl2
expression using PCR. The panel is made in-house and contained 94 marathon
cDNA
3 5 and cDNA samples from various normal and cancerous human tissues and cell
lines is
shown in Table 5, below. The cDNAs come from in-house libraries or marathon
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
cDNAs from in-house RNA preps, Clontech RNA, or Invitrogen RNA. The marathon
cDNAs are made using the marathon-ReadyTM kit (Clontech, Palo Alto, CA) and QC
tested with clathrin primers, and then diluted based on the intensity of the
clathrin band.
To assure quality of the panel samples, three tests for quality control (QC)
are run: ( 1 )
5 To assess the RNA quality used for the libraries, the in-house cDNAs are
tested for
average insert size by PCR with vector oligos that are specific for the vector
sequences
for an individual eDNA library; (2) Standardization of the concentration of
the cDNA
in panel samples is achieved using standard PCR methods to amplify full length
alpha
tubulin or G3PDH cDNA using a 5' vector oligonucleotide and 3' alpha tubulin
10 specific oligonucleotide primer or 3' G3PDH specific oligo primer; and (3)
a sample is
sequenced to check for possible ribosomal or mitochondria) DNA contamination.
The
panel is set up in a 96-well format that included a human genomic DNA
(Clontech,
Palo Alto, CA) positive control sample. Each well contains approximately 0.2-
100
pg/~tl of cDNA. The PCR reactions are set up using appropriate
oligonucleotides,
15 TaKaRa Ex TaqTM (TAKARA Shuzo Co LTD, Biomedicals Group, Japan), and
Rediload dye (Research Genetics, Inc., Huntsville, AL). The typical
amplification is
carried out as follows: 1 cycle at 94"C for 2 minutes, 35 cycles of
94°C for 30 seconds,
66.3°C for 30 seconds and 72"C for 30 seconds, followed by 1 cycle at
72"C for 5
minutes. About 10 ~1 of the PCR reaction product is subjected to standard
Agarose gel
2 0 electrophoresis using a 4% agarose gel. The correct predicted DNA fragment
size is
observed in: (1) normal tissues from fetal brain, fetal heart, fetal kidney,
fetal liver, fetal
lung, K562 cell line, testis, bone marrow and B-cells; and (2) cancerous
tissues from
lung, ovary, rectum and uterus.
2 5 Table 5
Tissue/Cellline #samples Tissue/Cellline #samples
Adrenal gland 1 Bone marrow 3
Bladder 1 Fetal brain 3
Bone Marrow 1 Islet 2
Brain 1 Prostate 3
Cervix 1 RPMI #1788 (ATCC # CCL-I56)2
Colon 1 Testis 4
Fetal brain 1 Thyroid 2
Fetal heart 1 WI38 (ATCC # CCL-75 2
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
51
Fetal kidney 1 ARID (ATCC # CRL-1674 1
- rat)
Fetal liver 1 HaCat - human keratinocytesI
Fetal lung 1 HPV (ATCC # CRL-2221 I
)
Fetal muscle 1 Adrenal gland I
Fetal skin 1 Prostate SM 2
Heart 2 CD3+ selected PBMC's 1
Ionomycin + PMA stimulated
K562 (ATCC # CCL-243)1 HPVS (ATCC # CRL-2221) I
-
selected
Kidney 1 Heart I
Liver 1 Pituitary 1
Lung 1 Placenta 2
Lymph node 1 Salivary gland 1
Melanoma 1 HL60 (ATCC # CCL-240) 3
Pancreas 1 Platelet 1
Pituitary 1 HBL-100 I
Placenta 1 Renal mesangial I
Prostate 1 T-cell I
Rectum 1 Neutrophil 1
Salivary Gland I MPC 1
Skeletal muscle 1 Hut-102 (ATCC # TIB-162)1
Small intestine 1 Endothelial 1
Spinal cord 1 HepG2 (ATCC # HB-8065) 1
Spleen I Fibroblast 1
Stomach 1 E. Histo I
Testis 2
Thymus 1
Thyroid 1
Trachea 1
CA 02396401 2002-07-03
WO 01/49740 PCTNSO1/00238
52
Uterus I
Esophagus tumor 1
Gastric tumor 1
Kidney tumor 1
Liver tumor 1
Lung tumor 1
Ovarian tumor I
Rectal tumor 1
Uterus tumor 1
From the foregoing, it will be appreciated that, although specific
embodiments of the invention have been described herein for purposes of
illustration,
various modifications may be made without deviating from the spirit and scope
of the
invention. Accordingly, the invention is not limited except as by the appended
claims.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
1
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> FGF HOMOLOG ZFGF12
<130> 00-02PC
<150> US 09/478,062
<151> 2000-Ol-05
<160> 6
<170> FastSEQ for Windows Version 3.0
<210>1
<211>1211
<212>DNA
<213>Homo Sapiens
<220>
<221> CDS
<222> (115)...(870)
<400> 1
tcacaccagc tacttgcaag ggagaaggaa aaggccagta aggcctgggc caggagagtc 60
ccgacaggag tgtcaggttt caatctcagc accagccact cagagcaggg cacg atg 117
Met
1
ttg ggg gcc cgc ctc agg ctc tgg gtc tgt gcc ttg tgc agc gtc tgc 165
Leu Gly Ala Arg Leu Arg Leu Trp Ual Cys Ala Leu Cys Ser Ual Cys
10 15
agc atg agc gtc ctc aga gcc tat ccc aat gcc tcc cca ctg ctc ggc 213
Ser Met Ser Val Leu Arg Ala Tyr Pro Asn Ala Ser Pro Leu Leu Gly
20 25 30
tcc agc tgg ggt ggc ctg atc cac ctg tac aca gcc aca gcc agg aac 261
Ser Ser Trp Gly Gly Leu Ile His Leu Tyr Thr Ala Thr Ala Arg Asn
35 40 45
CA 02396401 2002-07-03
WO 01/49740 PCT/USOl/00238
4
agc tac cac ctg cag atc cac aag aat ggc cat gtg gat ggc gca ccc 309
Ser Tyr His Leu Gln Ile His Las Asn Gly His Ual Asp Gly Ala Pro
50 55 60 65
cat cag acc atc tac agt gcc ctg atg atc aga tca gag gat get ggc 357
His Gln Thr Ile Tyr Ser Ala Leu Met Ile Arg Ser Glu Asp Ala Gly
70 75 80
ttt gtg gtg att aca ggt gtg atg agc aga aga tac ctc tgc atg gat 405
Phe Ual Ual Ile Thr Gly Ual Met Ser Arg Arg Tyr Leu Cys Met Asp
85 90 95
ttc aga ggc aac att ttt gga tca cac tat ttc gac ccg gag aac tgc 453
Phe Arg Gly Asn Ile Phe Gly Ser His Tyr Phe Asp Pro Glu Asn Cys
100 105 110
agg ttc caa cac cag acg ctg gaa aac ggg tac gac gtc tac cac tct 501
Arg Phe Gln His Gln Thr Leu Glu Asn Gly Tyr Asp Ual Tyr His Ser
115 120 125
cct cag tat cac ttc ctg gtc agt ctg ggc cgg gcg aag aga gcc ttc 549
Pro Gln Tyr His Phe Leu Ual Ser Leu Gly Arg Ala Lys Arg Ala Phe
130 135 140 145
ctg cca ggc atg aac cca ccc ccg tac tcc cag ttc ctg tcc cgg agg 597
Leu Pro Gly Met Asn Pro Pro Pro Tyr Ser Gln Phe Leu Ser Arg Arg
150 155 160
aac gag atc ccc cta att cac ttc aac acc ccc ata cca cgg cgg cac 645
Asn Glu Ile Pro Leu Ile His Phe Asn Thr Pro Ile Pro Arg Arg His
165 170 175
acc cgg agc gcc gag gac gac tcg gag cgg gac ccc ctg aac gtg ctg 693
Thr Arg Ser Ala Glu Asp Asp Ser Glu Arg Asp Pro Leu Asn Ual Leu
180 185 190
aag ccc cgg gcc cgg atg acc ccg gcc ccg gcc tcc tgt tca cag gag 741
Lys Pro Arg Ala Arg Met Thr Pro Ala Pro Ala Ser Cys Ser Gln Glu
195 200 205
ctc ccg agc gcc gag gac aac agc ccg atg gcc agt gac cca tta ggg 789
Leu Pro Ser Ala Glu Asp Asn Ser Pro Met Ala Ser Asp Pro Leu Gly
210 215 220 225
CA 02396401 2002-07-03
WO 01/49740 PCT/LJSO1/00238
3
gtg gtc agg ggc ggt cga gtg aac acg cac get ggg gga acg ggc ccg 837
Ual Ual Arg Gly Gly Arg Val Asn Thr His Ala Gly Gly Thr Gly Pro
230 235 240
gaa ggc tgc cgc ccc ttc gcc aag ttc atc tag ggtcgctgga agggcaccct 890
Glu Gly Cys Arg Pro Phe Ala Lys Phe Ile
245 250
ctttaacccatccctcagcaaacgcagctcttcccaaggaccaggtcccttgacgttccg950
aggatgggaaaggtgacaggggcatgtatggaatttgctgcttctctggggtcccttcca1010
caggaggtcctgtgagaaccaacctttgaggcccaagtcatggggtttcaccgccttcct1070
cactccatatagaacacctttcccaataggaaaccccaacaggtaaactagaaatttccc1130
cttcatgaaggtagagagaaggggtctctcccaacatatttctcttccttgtgcctctcc1190
tctttatcacttttaagcata 1211
<210>2
<211>251
<212>PRT
<213>Homo sapiens
<400> 2
Met Leu Gly Ala Arg Leu Arg Leu Trp Ual Cys Ala Leu Cys Ser Ual
1 5 10 15
Cys Ser Met Ser Val Leu Arg Ala Tyr Pro Asn Ala Ser Pro Leu Leu
20 25 30
Gly Ser Ser Trp Gly Gly Leu Ile His Leu Tyr Thr Ala Thr Ala Arg
35 40 45
Asn Ser Tyr His Leu Gln Ile His Lys Asn Gly His Ual Asp Gly Ala
50 55 60
Pro His Gln Thr Ile Tyr Ser Ala Leu Met Ile Arg Ser Glu Asp Ala
65 70 75 80
Gly Phe Ual Ual Ile Thr Gly Ual Met Ser Arg Arg Tyr Leu Cys Met
85 90 95
Asp Phe Arg Gly Asn Ile Phe Gly Ser His Tyr Phe Asp Pro Glu Asn
100 105 110
Cys Arg Phe Gin His Gln Thr Leu Glu Asn Gly Tyr Asp Ual Tyr His
115 120 125
Ser Pro Gln Tyr His Phe Leu Ual Ser Leu Gly Arg Ala Lys Arg Ala
130 135 140
Phe Leu Pro Gly Met Asn Pro Pro Pro Tyr Ser Gln Phe Leu Ser Arg
145 150 155 160
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
4
Arg Asn Glu Ile Pro Leu Ile His Phe Asn Thr Pro Ile Pro Arg Arg
165 170 175
His Thr Arg Ser Ala Glu Asp Asp Ser Glu Arg Asp Pro Leu Asn Ual
180 185 190
Leu Lys Pro Arg Ala Arg Met Thr Pro Ala Pro Ala Ser Cys Ser Gln
195 200 205
Glu Leu Pro Ser Ala Glu Asp Asn Ser Pro Met Ala Ser Asp Pro Leu
210 215 220
Gly Ual Ual Arg Gly Gly Arg Ual Asn Thr His Ala Gly Gly Thr Gly
225 230 235 240
Pro Glu Gly Cys Arg Pro Phe Ala Lys Phe Ile
245 250
<210> 3
<211> 753
<212> DNA
<213> Artificial Sequence
<220>
<223> degenerate sequence
<221> misc_feature
<222> (1). .(753)
<223> n = A.T,C or G
<400>
3
atgytnggngcnmgnytnmgnytntgggtntgygcnytntgywsngtntgywsnatgwsn 60
gtnytnmgngcntayccnaaygcnwsnccnytnytnggnwsnwsntggggnggnytnath 120
cayytntayacngcnacngcnmgnaaywsntaycayytncarathcayaaraayggncay 180
gtngayggngcnccncaycaracnathtaywsngcnytnatgathmgnwsngargaygcn 240
ggnttygtngtnathacnggngtnatgwsnmgnmgntayytntgyatggayttymgnggn 300
aayathttyggnwsncaytayttygayccngaraaytgymgnttycarcaycaracnytn 360
garaayggntaygaygtntaycaywsnccncartaycayttyytngtnwsnytnggnmgn 420
gcnaarmgngcnttyytnccnggnatgaayccnccnccntaywsncarttyytnwsnmgn 480
mgnaaygarathccnytnathcayttyaayacnccnathccnmgnmgncayacnmgnwsn 540
gcngargaygaywsngarmgngayccnytnaaygtnytnaarccnmgngcnmgnatgacn 600
ccngcnccngcnwsntgywsncargarytnccnwsngcngargayaaywsnccnatggcn 660
wsngayccnytnggngtngtnmgnggnggnmgngtnaayacncaygcnggnggnacnggn 720
ccngarggntgymgnccnttygcnaarttyath
753
<210> 4
<211> 216
<212> PRT
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
<213> Homo Sapiens
<400> 4
Met Arg Ser Gly Cys Val Val Val His Val Trp Ile Leu Ala Gly Leu
1 5 10 15
Trp Leu Ala Val Ala Gly Arg Pro Leu Ala Phe Ser Asp Ala Gly Pro
20 25 30
His Ual His Tyr Gly Trp Gly Asp Pro Ile Arg Leu Arg His Leu Tyr
35 40 45
Thr Ser Gly Pro His Gly Leu Ser Ser Cys Phe Leu Arg Ile Arg Ala
50 55 60
Asp Gly Val Ual Asp Cys Ala Arg Gly Gln Ser Ala His Ser Leu Leu
65 70 75 80
Glu Ile Lys Ala Val Ala Leu Arg Thr Val Ala Ile Lys Gly Ual His
85 90 95
Ser Ual Arg Tyr Leu Cys Met Gly Ala Asp Gly Lys Met Gln Gly Leu
100 105 110
Leu Gln Tyr Ser Glu Glu Asp Cys Ala Phe Glu Glu Glu Ile Arg Pro
115 120 125
Asp Gly Tyr Asn Val Tyr Arg Ser Glu Lys His Arg Leu Pro Val Ser
130 135 140
Leu Ser Ser Ala Lys Gln Arg Gln Leu Tyr Lys Asn Arg Gly Phe Leu
145 150 155 160
Pro Leu Ser His Phe Leu Pro Met Leu Pro Met Val Pro Glu Glu Pro
165 170 175
Glu Asp Leu Arg Gly His Leu Glu Ser Asp Met Phe Ser Ser Pro Leu
180 185 190
Glu Thr Asp Ser Met Asp Pro Phe Gly Leu Val Thr Gly Leu Glu Ala
195 200 205
Val Arg Ser Pro Ser Phe Glu Lys
210 215
<210> 5
<211> 5
<212> PRT
<213> Artificial Sequence
<220>
<223> motif
<221> VARIANT
<222> (2)...(2)
<223> Xaa = any amino acid residue except cysteine.
CA 02396401 2002-07-03
WO 01/49740 PCT/USO1/00238
6
<221> VARIANT
<222> (4)...(4)
<223> Xaa = any amino acid residue except cysteine.
<400> 5
Cys Xaa Phe Xaa Glu
1 5
<210> 6
<211> 5
<212> PRT
<213> Artificial Sequence
<220>
<223> peptide
<400> 6
Glu Tyr Pro Met Glu
1 5
