Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02401916 2002-09-19
s RECOMBINANT ANTI-TUMOR RNASE
CROSS REFERENCE TO RELATED APPLICATIONS
Not applicable.
FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
Not applicable.
BACKGROUND OF THE INVENTION
Ribonucleases such as ribonuclease A ("RNase A") and their cytotoxicity
towards tumor cells were discovered in the 1960s (reviewed in Roth, J., Cancer
Res.
23:657-666 (1963)). In the 1970s, human serum was also discovered to contain
several
RNAses that are expressed in a tissue specific manner (Reddi, E., Biochem.
Biophys. Res.
Commun. 67:110-118 (1975); and Blank, et al., HUMAN BODY FLUID RiBONUCLEASES:
DETECTION, INTERRELATIONSHIPS .AND SIGNIFICANCE, pp203-209 (IRL Press, London,
1981)).
Further to these early studies was the discovery that an anti-tumor protein
from oocytes of Rana pipiens had homology to RNAse A (Ardelt, et al., J. Biol.
Chem.
256:245-251(1991)). This protein was termed ONCONASE~, Alfacell Corporation,
N.J.
See also e.g., Darzynkiewicz, et al., Cell Tissue Kinet. 21:169-182 (1988);
Mikulski, et al.,
Cell Tissiee Kinet. 23:237-246 (1990); and U.S. Patent No. 4,888,172).
Phase I and Phase I/II clinical trials of ONCONASE~ as a single
therapeutic agent in patients with a variety of solid tumors (Mikulski, et
al., Int. J. of
Oncology 3: 57-64 (1993)) or combined with tamoxifen in patients with advanced
pancreatic carcinoma have been completed (Chun, et al., Proc. Amer. Soc. Clin.
Oncol.
14:210 (199s)) and the protein has been found to be efficacious in pancreatic,
renal cell,
and prostate cancers as well as mesothelioma.
Conjugation of ONCONASE~ to cell-type-specific ligands was found to
increase its potency towards tumor cells (Rybak, et al., Drug Delivery 1:3-10
(1993)).
CA 02401916 2002-09-19
2
Taken together, these results indicated that ONCONASE~ has properties
advantageous to
the generation of a potent selective cell killing agent.
Development of OnconasetP conjugates for human therapeutics has been
slow. Onconase~ is derived from amphibian tissue and trace contaminants
present in the
purified preparation stimulate undesirable immune responses in humans. This
side-effect
has led to production of a recombinant form of the protein (Newton, et al.,
Protein
Engirzeering 10:463-470 (1997) and PCT published application WO 97/38112).
However, expression of active recombinant Onconase~ has been
problematic. Onconase~ requires a pyroglutamic acid at the N-terminus for
activity.
Unfortunately, Onconase~ with a N-terminal glutamine is not expressed by
bacteria but
accumulates in insoluble inclusion bodies. To increase bacterial expression of
soluble
Onconase~, methionine has been appended to the N-terminus. However, this
modification
of the protein prevents the formation of the pyroglutamic acid necessary for
activity.
Therefore, it has been necessary to engineer Onconase~ with an N-terminal
methionine
only to remove it for activity. The cleaved and the uncleaved proteins must
then be
separated to obtain a pure composition of high purity and activity.
Other problems have arisin in the manufacture of Onconase~-based fusion
proteins. It has been difficult to fuse recombinant Onconase~ in frame to
ligand binding
moieties and retain proper folding of both the Onconase~ and the ligand
binding moiety.
This has limited the use of Onconase~ in targeted cell killing to only those
compounds
that can be chemically conjugated.
Thus, there exists in the art a need for recombinant ribonucleases that can
be expressed in bacteria and retain activity. Furthermore, there exists a need
for a
ribonuclease with anti-tumor activity that retains its activity when produced
as a single
chain fusion protein. This invention fulfills these and other needs.
SL;fMNiARY OF THE INVENTION
This invention is based on new recombinant ribonuclease proteins. The
proteins, unlike Onconase~, are expressed well by bacteria without an N-
terminal
methionine. This is due largely to the presence of a signal peptide that is
cleaved by the
bacteria. The ribonucleases are then secreted into the bacterial media. The
soluble
CA 02401916 2002-09-19
3
expression of these ribonucleases allows the proteins to be fused in-frame
with ligand binding moieties to form cytotoxic fusion proteins.
Specifically, the ribonuclease is expressed from
recombinant DNA that has (a) measurable ribonuclease activity; (b) an amino
terminal end
beginning with a glutamine or a glutamine cyclized to a pyroglutamic acid; (c)
a leucine at
position 11; an asparagine at position 21, a threonine at position 85, and a
histidine at
position 103, such positions being determined with reference to those
specified amino acid
positions of SEQ ID N0:2; and (d) is substantially identical to SEQ ID N0:2.
In one
embodiment, the ribonuclease is expressed with a methionine at the 1 position
(SEQ ID
N0:6). In another, more preferred embodiment, the ribonuclease is expressed
with a
methionine at the 1 position and an amino acid change from methionine to
leucine at
position 24 (SEQ ID N0:8). In the most preferred embodiment, the ribonuclease
is
expressed with histidine residues at positions 1 to 6, a methionine at 7 and a
leucine at
position 30 (SEQ ID N0:9). In alternative embodiment of the invention, the
glutamine at
position 1 is replaced with a serine (SEQ ID NO:11).
In another embodiment relating to SEQ ID N0:2, the ribonuclease is
transcribed and translated with a signal peptide (SEQ ID N0:28). Post-
translation
modification by the expressing cell cleaves the signal peptide from the
ribonuclease and
the protein is secreted by the host cell.
In another embodiment, ribonucleases encoded by the
nucleic acid sequence of SEQ ID N0:14 and conservative variants thereof are
claimed.
Within this embodiment are the amino acid sequences of SEQ ID N0:17, SEQ ID
N0:19,
SEQ ID N0:21, SEQ ID N0:24 and SEQ ID N0:2b. This ribonuclease can also be
engineered to comprise the signal sequence mentioned above.
Also encompassed are cytotoxic reagents comprising
the ribonucleases with or without the conservative substitutions listed above
linked to a
ligand binding moiety. In one embodiment, the linkage is through a covalent
bond. In a
preferred embodiment, the covalent bond is at the carboxy terminus of the
ribonuclease.
CA 02401916 2002-09-19
4
In yet another embodiment, a method is provided which prepares a
substantially pure ribonuclease of this invention. In addition, the method can
be used to
purify a cytotoxic reagent of this invention. The method comprises: (i)
contacting a
ribonuclease with an (His)6 histidine tag and a methionine at position ? with
an effective
concentration of a cleaving agent such that the ribonuclease is cleaved after
the carboxy
group of methionine at position 1; (ii) passing the ribonuclease through a
NiZ+-NTA
agarose column; and (iii) eluting the substantially pure ribonuclease from the
column. In a
preferred embodiment, the cleaving agent is CNBr.
In still another embodiment, pharmaceutical compositions
are provided which comprise a ribonuclease expressed from recombinant DNA. The
ribonucleases are selected from the group consisting of SEQ ID N0:2, SEQ ID
N0:4,
SEQ ID N0:6, SEQ ID N0:8, SEQ ID NO:11, SEQ ID N0:13, SEQ ID NO:15, SEQ ID
N0:17, SEQ ID N0:19, SEQ ID N0:21, SEQ ID N0:24 and SEQ ID N0:26 in a
pharmaceutically acceptable carrier. In one aspect of this embodiment, the
pharmaceutical
composition also contains an antineoplast, preferably Adriamycin.
In another embodiment, pharmaceutical compositions are provided which
comprise the ribonucleases of this invention linked to a ligand binding
moiety. As above,
the pharmaceutical composition may contain an antineoplast, preferably
Adriamycin.
In yet another embodiment, a method is provided for
killing cancer cells. The method comprises contacting cells to be killed with
a
ribonuclease expressed by recombinant DNA and having a sequence selected from
the
group consisting of SEQ ID N0:2, SEQ ID N0:4, SEQ ID N0:6, SEQ ID N0:8, SEQ ID
NO:11, SEQ ID N0:13, SEQ ID NO:15, SEQ ID N0:17, SEQ ID N0:19, SEQ ID
N0:21, SEQ ID N0:24 and SEQ ID N0:26. In addition, the method also comprises
contacting cells to be killed with a cytotoxic reagent comprising the
ribonucleases listed
above linked to a ligand binding moiety. In a preferred embodiment, the cancer
cell to be
killed is a malignant B cell and the ligand binding moiety is an antibody. In
a preferred
aspect, the antibody is a single chain antibody directed against CD22. In a
most preferred
embodiment, the antibody is LL2.
CA 02401916 2002-09-19
4a
This invention provides a cytotoxic reagent comprising a recombinant
ribonuclease linked to
an antibody directed against a cell surface antigen on a cancerous B cell,
wherein the
recombinant ribonuclease has (a) measurable ribonuclease activity; (b) an
amino terminal end
beginning with a glutamine; (c) a leucine at position 1 l; an asparagine at
position 21, a
threonine at position 85, and a histidine at position 103, such positions
being determined with
reference to those specified amino acid positions of SEQ ID N0:2; and (d)
substantial identity
to SEQ ID N0:2.
This invention also provides a cytotoxic reagent comprising a recombinant
ribonuclease
encoded by a nucleic acid comprising SEQ ID N0:14 and conservative variants
thereof linked
to an antibody directed against a cell surface antigen on a cancerous B cell.
This invention also provides a method of killing cancerous B cells comprising
contacting cells
to be killed with a cytotoxic reagent comprising a recombinant ribonuclease
linked to an
antibody directed against a cell surface antigen on a cancerous B cell,
wherein the recombinant
ribonuclease has an amino acid sequence selected from the group consisting of
SEQ ID N0:2,
SEQ ID N0:4, SEQ ID N0:6, SEQ ID N0:8, SEQ ID NO:11, SEQ ID N0:13, SEQ ID
NO:15,
SEQ ID N0:17, SEQ ID N0:19, SEQ ID N0:21, SEQ ID N0:24, and SEQ ID N0:26.
In the aforementioned cytotoxic reagents and method of this invention, the
antibody may be
directed against CD22 and may be LL2. An LL2 antibody may be humanized or may
be a
single chain antibody.
CA 02401916 2002-09-19
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
Unless defined otherwise herein, all technical and scientific terms used
herein have the same meaning as commonly understood by one of ordinary skill
in the art
5 to which this invention belongs. Singleton, et al., DICTIONARY OF
MICROBIOLOGY AND
MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale &
Marham, THE HARDER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991)
provide one of skill with a general dictionary of many of the terms used in
this invention.
Although any methods and materials similar or equivalent to those described
herein can be
used in the practice or testing of the present invention, the preferred
methods and materials
are described. Numeric ranges are inclusive of the numbers defining the range.
Unless
otherwise indicated, nucleic acids are written left to right in 5' to 3'
orientation; amino
acid sequences are written left to right in amino to carboxy orientation,
respectively. The
headings provided herein are not limitations of the various aspects or
embodiments of the
invention which can be had by reference to the specification as a whole.
Accordingly, the
terms defined immediately below are more fully defined by reference to the
specification
as a whole.
The terms "isolated," "purified" or "biologically pure" refer to material that
is substantially or essentially free from components which normally accompany
it as found
in its native state. Purity and homogeneity are typically determined using
analytical
chemistry techniques such as polyacrylamide gel electrophoresis or high
performance
liquid chromatography. A protein that is the predominant species :present in a
preparation
is substantially purified. In particular, an isolated ribonuclease nucleic
acid is separated
from open reading frames that flank the ribonuclease gene and encode proteins
other than
ribonuclease. The term "purified" denotes that a nucleic acid or protein gives
rise to
essentially one band in an electrophoretic gel. Particularly, it means that
the nucleic acid
or protein is at least 85% pure, more preferably at least 95% pure, and most
preferably at
least 99% pure.
"Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and
polymers thereof in either single- or double-stranded form. Unless
specifically limited, the
term encompasses nucleic acids containing known analogs of natural
nucleotides, which
have similar binding properties as the reference nucleic acid and are
metabolized in a
CA 02401916 2002-09-19
6
manner similar to naturally occurring nucleotides. Unless otherwise indicated,
a particular
nucleic acid sequence also implicitly encompasses conservatively modified
variants thereof
(e.g., degenerate codon substitutions) and complementary sequences, as well as
the
sequence explicitly indicated. Specifically, degenerate codon substitutions
may be
achieved by generating sequences in which the third position of one or more
selected (or
all) codons is substituted with mixed-base and/or deoxyinosine residues
(Batter, et al.,
Nucleic Acid Res. 19:5081 (1991); Ohtsuka, et al., J. BioL Chem. 260:2605-2608
(1985);
and Rossolini, et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic
acid is used
interchangeably with gene, cDNA, and mRNA encoded by a gene.
The tenors "polypeptide," "peptide" and "protein" are used interchangeably
herein to refer to a polymer of amino acid residues. The terms apply to amino
acid
polymers in which one or more amino acid residue is an artificial chemical
analog of a
corresponding naturally occurring amino acid, as well as to naturally
occurring amino acid
polymers.
Amino. acids may be referred to herein by either their commonly known
three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB
Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to
by
their commonly accepted single-letter codes.
"Conservatively modified variants" applies to both amino acid and nucleic
acid sequences. With respect to particular nucleic acid sequences,
conservatively modified
variants refers to those nucleic acids 'which encode identical or essentially
identical amino
acid sequences, or where the nucleic acid does not encode an amino acid
sequence, to
essentially identical sequences. Because of the degeneracy of the genetic
code, a large
number of functionally identical nucleic acids encode any given protein. For
instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every
position where an alanine is specified by a codon, the codon can be altered to
any of the
corresponding codons described without altering the encoded polypeptide. Such
nucleic
acid variations are "silent variations," which are one.species of
conservatively modified
variations. Every nucleic acid sequence herein which encodes a polypeptide
also describes
every possible silent variation of the nucleic acid. One of skill will
recognize that each
codon in a nucleic acid (except AUG, which is ordinarily the only codon for
methionine)
can be modified to yield a functionally identical molecule. Accordingly, each
silent
CA 02401916 2002-09-19
7
variation of a nucleic acid which encodes a polypeptide is implicit in each
described
sequence.
As to amino acid sequences, one of skill will recognize that individual
substitutions, deletions or additions to a nucleic acid, peptide, polypeptide,
or protein
sequence which alters, adds or deletes a single amino acid or a small
percentage of amino
acids in the encoded sequence is a "conservatively modified variant" where the
alteration
results in the substitution of an amino acid with a chemically similar amino
acid.
Conservative substitution tables providing functionally similar amino acids
are well known
in the art.
The following six groups each contain amino acids that are conservative
substitutions for one another:
1) Alanine (A), Serine (S), Threonine (T);
2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (I~, Glutamine (Q);
4) Arginine (R), Lysine (K);
5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (V4~.
(see, e.g., Creighton, Proteins (19$4)).
"Pyroglutamic acid" is the cyclized internal amide of L-glutamic acid with
the following structure:
o=c~ cooH
H
As used herein a "nucleic acid probe or oligonucleotide" is defined as a
nucleic acid capable of binding to a target nucleic acid of complementary
sequence
through one or more types of chemical bonds, usually through complementary
base
pairing, usually through hydrogen bond formation. As used herein, a probe may
include
natural (i.e., A, G, C, or T) or modified bases (7-deazaguanosine, inosine,
etc.). In
addition, the bases in a probe may be joined by a linkage other than a
phosphodiester
CA 02401916 2002-09-19
8
bond, so long as it does not interfere with hybridization. Thus, for example,
probes may
be peptide nucleic acids in which the constituent bases are joined by peptide
bonds rather
than phosphodiester linkages. It will be understood by one of skill in the art
that probes
may bind target sequences lacking complete complementarity with the probe
sequence
S depending upon the stringency of the hybridization conditions. The probes
are preferably
directly labeled as with isotopes, chromophores, lumiphores, chromogens, or
indirectly
labeled such as with biotin to which a streptavidin complex may later bind. By
assaying
for the presence or absence of the probe, one can detect the presence or
absence of the
select sequence or subsequence.
A "labeled nucleic acid probe or oligonucleotide" is one that is bound, either
covalently, through a linker, or through ionic, van der Waals or hydrogen
bonds to a label
such that the presence of the probe may be detected by detecting the presence
of the label
bound to the probe.
"Amplification" primers are oligonucleotides comprising either natural or
analog nucleotides that can serve as the basis for the amplification of a
select nucleic acid
sequence. They include, e.g., polymerase chain reaction primers and ligase
chain reaction
oligonucleotides.
The term "recombinant" when used with reference, e.g., to a cell, or nucleic
acid, or vector, indicates that the cell, or nucleic acid, or vector, has been
modified by the
introduction of a heterologous nucleic acid or the alteration of a native
nucleic acid, or that
the cell is derived from a cell so modified. Thus, for example, recombinant
cells express
genes that are not found within the native (non-recombinant) form of the cell
or express
native genes that are otherwise abnormally expressed, under expressed or not
expressed at
a11.
The term "identical" in the context of two nucleic acids or polypeptide
sequences refers to the residues in the two sequences that are the same when
aligned for
maximum correspondence, as measured using one of the following "sequence
comparison
algorithms."
One example of a useful algorithm is PILEUP. PILEUP creates a multiple
sequence alignment from a group of related sequences using progressive,
pairwise
alignments. It can also plot a tree showing the clustering relationships used
to create the
alignment. PILEUP uses a simplification of the progressive alignment method of
Feng &
CA 02401916 2002-09-19
9
Doolittle, J. Mol. Evol. 35:351-360 (1987). The method used is similar to the
method
described by Higgins & Sharp, CABIOS 5:151-153 (1989). The, program can align
up to
300 sequences of a maximum length of 5,000. The multiple alignment procedure
begins
with the pairwise alignment of the two most similar sequences, producing a
cluster of two
aligned sequences. This cluster can then be aligned to the next most related
sequence or
cluster of aligned sequences. Two clusters of sequences can be aligned by a
simple
extension of the pairwise alignment of two individual sequences. The final
alignment is
achieved by a series of progressive, pairwise alignments. The program can also
be used to
plot a dendrogram or tree representation of clustering relationships. The
program is run
IO by designating specific sequences and their amino acid or nucleotide
coordinates for
regions of sequence comparison. Another example of an algorithm that is
suitable for
determining sequence similarity is the BLAST algorithm, which is described in
Altschul,
et aL, J. Mol. Biol. 215:403-410 ( 1990). Software for performing BLAST
analyses is
publicly available through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov~. This algorithm involves first identifying high
scoring
sequence pairs (HSPs) by identifying short words of length W in the query
sequence that
either match or satisfy some positive-valued threshold score T when aligned
with a word
of the same length in a database sequence. T is referred to as the
neighborhood word
score threshold (Altschul, et al, supra). These initial neighborhood word hits
act as seeds
for initiating searches to find longer HSPs containing them. The word hits are
extended in
both directions along each sequence for as far as the cumulative alignment
score can be
increased. Extension of the word hits in each direction are halted when: the
cumulative
alignment score falls off by the quantity X from its maximum achieved value;
the
cumulative score goes to zero or below, due to the accumulation of one or more
negative-
scoring residue alignments; or the end of either sequence is reached. The
BLAST
algorithm parameters W, T, and X determine the sensitivity and speed of the
alignment.
The BLAST program uses as defaults a wordlength (W) of I 1, the BLOSLTM62
scoring
matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 ( 1989))
alignments
(B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.
The BLAST algorithm performs a statistical analysis of the similarity
between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'1. Acad. Sci.
USA
90:5873-5787 (1993)). One measure of similarity provided by the BLAST
algorithm is
CA 02401916 2002-09-19
the smallest sum probability (P(I~), which provides an indication of the
probability by
which a match between two nucleotide or amino acid sequences would occur by
chance.
For example, a nucleic acid is considered similar to an ribonuclease nucleic
acid if the
smallest sum probability in a comparison of the test nucleic acid to an
ribonuclease nucleic
5 acid is less than about 0.1, more preferably less than about 0.01, and most
preferably less
than about 0.001. Where the test nucleic acid encodes a ribonuclease
polypeptide, it is
considered similar to a specified ribonuclease nucleic acid if the comparison
results in a
smallest sum probability of less than about 0.5, and more preferably less than
about 0.2.
The phrase "substantially identical" in the context of two nucleic acids or
10 polypeptides thus typically means that a polynucleotide or polypeptide
comprises a
sequence that has at least 60% sequence identity, preferably at least 80%,
more preferably
at least 90% and most preferably at least 95%, compared to a reference
sequence using the
local homology algorithm of Smith & Waterman, Adu Appl. Math. 2:482 (1981), by
the
homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443
(1970), by
I S the search for similarity method of Pearson & Lipman, Proc. Nat'1. Acad.
Sci. USA
85:2444 (1988), by computerized implementations of these algorithms (GAP,
BESTFIT,
FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer
Group, 575 Science Dr., Madison, WI); or by inspection. One indication that
two nucleic
acid sequences or polypeptide are substantially identical is.that the
polypeptide which the
first nucleic acid encodes is immunologically cross reactive with the
polypeptide encoded
by the second nucleic acid. Thus, a polypeptide is substantially identical to
a second
polypeptide, for example, where the two peptides differ only by a conservative
substitution. Another indication that two nucleic acid sequences are
substantially identical
is that the two molecules hybridize to each other under stringent conditions.
The phrase "determined with reference to" in the context of identifying
changes in amino acid sequence means that the amino acid as indicated in the
sequence
listing at that position is changed to the amino acid indicated. For example,
in some
embodiments of this invention the methionine corresponding to position 23 of
SEQ ID
N0:2, is changed to a leucine. In SEQ ID N0:2, a methionine is at position 23.
In SEQ
ID N0:8, the methionine at position 23 in SEQ ID N0:2 corresponds to a
methionine at
position 24 which has been changed to a leucine.
CA 02401916 2002-09-19
11
The phrase "selectively hybridizes to" refers to the binding, duplexing, or
hybridizing of a molecule only to a particular nucleotide sequence under
stringent
hybridization conditions when that sequence is present in a complex mixture
(e.g., total
cellular) DNA or RNA. The phrase "stringent hybridization conditions" refers
to
conditions under which a probe will hybridize to its target subsequencc, but
to no other
sequences. Stringent conditions are sequence-dependent and will be different
in different
circumstances. Longer sequences hybridize specifically at higher temperatures.
An
extensive guide to the hybridization of nucleic acids is found in Tijssen,
TECHNIQUES IN
BIOCHEMISTRY AND MOLECULAR BIOLOGY--HYBRIDIZATION WITH NUCLEIC PROBES,
"Overview of principles of hybridization and the strategy of nucleic acid
assays" (1993).
Generally, stringent conditions are selected to be about 5-10°C lower
than the thermal
melting point (T"a for the specific sequence at a defined ionic strength pH:
The Tm is the
temperature (under defined ionic strength, pH, and nucleic concentration) at
which 50% of
the probes complementary to the target hybridize to the target sequence at
equilibrium (as
the target sequences are present in excess, at T,°, 50% of the probes
are occupied at
equilibrium). Stringent conditions will be those in which the salt
concentration is less than
about 1.0 sodium ion, typically about 0.01 to 1.0 M sodium ion concentration
(or other
salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for
short probes (e.g., 10
to SO nucleotides) and at least about 60°C for long probes (e.g.,
greater than 50 .
nucleotides). Stringent conditions may also be achieved with the addition of
destabilizing
agents as formamide.
"Antibody" refers to a polypeptide substantially encoded by an
immunoglobulin gene or immunoglobulin genes, or fragments thereof which
specifically
bind and recognize an antigen. The recognized immunoglobulin genes include the
kappa,
lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as
the myriad
immunoglobulin variable region genes. Light chains are classified as either
kappa or
lambda. Heavy chains are classified as gamma; mu, alpha, delta, or epsilon,
which in turn
define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
An exemplary immunoglobulin (antibody) structural unit comprises a
tetramer. Each tetramer is composed of two identical pairs of polypeptide
chains, each
pair having one "light" (about 25 kDa) and one "heavy" chain (about 50-70
kDa). The
N-terminus of each chain defines a variable region of about 100 to 110 or more
amino
CA 02401916 2002-09-19
12
acids primarily responsible for antigen recognition. The terms variable light
chain (V~
and variable heavy chain (V~ refer to these light and heavy chains
respectively.
Antibodies exist, e.g., as intact immunoglobulins or as a number of well
characterized fragments produced by digestion with various peptidases. Thus,
for examplc,
pepsin digests an antibody below the disulfide linkages in the hinge region to
produce
F(ab)'i, a dimer of Fab which itself is a light chain joined to VH-CH1 by a
disulfide bond.
The F(ab)'Z may be reduced under mild conditions to break the disulfide
linkage in the
hinge region, thereby converting the F(ab)'z dimer into an Fab' monomer. The
Fab'
monomer is essentially an Fab with part of the hinge region (see, FUNDAMENTAL
IMMUNOLOGY, 3D ED., Paul (ed.) 1993). While various antibody fragments are
defined in
terms of the digestion of an intact antibody, one of skill will appreciate
that such
fragments may be synthesized de novo either chemically or by using recombinant
DNA
methodology. Thus, the term antibody, as used herein, also includes antibody
fragments
either produced by the modification of whole antibodies or those synthesized
de novo
using recombinant DNA methodologies (e.g., single chain Fv).
The phrase "single chain Fv" or "scFv" refers to an antibody in which the
heavy chain and the light chain of a traditional two chain antibody have been
joined to
form one chain. Typically, a linker peptide is inserted between the two chains
to allow for
proper folding and creation of an active binding site.
The term "linker peptide" includes reference to a peptide within an antibody
binding fragment (e.g., Fv fragment) which serves to indirectly bond the
variable heavy
chain to the variable light chain.
The term "contacting" includes reference to placement in direct physical
association. With regards to this invention, the term refers to antibody-
antigen binding.
An "anti-ribonuclease" antibody is an antibody or antibody fragment that
specifically binds a polypeptide encoded by the ribonuclease gene, cDNA, or a
subsequence thereof.
An "immunoconjugate" is an antibody molecule in which (a) the constant
region, or a portion thereof, is altered, replaced or exchanged so that the
antigen binding
site (variable region) is linked to a constant region of a different or
altered class, effector
function and/or species, or an entirely different molecule which confers new
properties to
the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug,
etc.; or (b)
CA 02401916 2002-09-19
13
the variable region, or a portion thereof, is altered, replaced or exchanged
with a variable
region having a different or altered antigen specificity.
A "fusion protein" or when a molecule is "linked" to another refers to a
chimeric molecule formed by the joining of two or more polypeptides through a
bond
formed one polypeptide and another polypeptide. The bond may be covalent or
noncovalent. An example of a covalent bond is the chemical coupling of the two
polypeptides to form peptide bond. Examples of non-covalent bond are hydrogen
bonds,
electrostatic interactions and van der Waal's forces.
Tf the bond is by a peptide bond, the fusion protein may be expressed as a
single polypeptide from a nucleic acid sequence encoding a single contiguous
fusion
protein. A single chain fusion protein is a fusion protein having a single
contiguous
polypeptide backbone.
A "ligand" or a "ligand binding moiety", as used herein, refers generally to
all molecules capable of specifically delivering a molecule, reacting with or
otherwise
recognizing or binding to a receptor on a target cell. Specifically, examples
of ligands
include, but are not limited to, immunoglobulins or binding fragments thereof,
lymphokines, cytokines, cell surface antigens such as CD22, CD4 and CDB,
solubilized
receptor proteins such as soluble CD4, hormones, growth factors such as
epidermal growth
factor (EGF), and the like which specifically bind desired target cells.
The phrase "specifically (or selectively) binds" to an antibody or
"specifically (or selectively) immunoreactive with," when referring to a
protein or peptide,
refers to a binding reaction that is determinative of the presence of the
protein in a
heterogeneous population of proteins and other biologics. Thus, under
designated
immunoassay conditions, the specified antibodies bind to a particular protein
at least two
times the background and do not substantially bind in a significant amount to
other
proteins present in the sample. Specific binding to an antibody under such
conditions may
require an antibody that is selected for its specificity for a particular
protein. For example,
antibodies raised to ribonuclease with the amino acid sequence encoded in SEQ
TD N0:2
can be selected to obtain only those antibodies that are specifically
immunoreactive with
ribonuclease and not with other proteins, except for polymorphic variants,
alleles, and
closely related interspecies homologs of ribonuclease. This selection may be
achieved by
subtracting out antibodies that cross react with molecules such as Onconase~.
A variety
CA 02401916 2002-09-19
14
of immunoassay formats may be used to select antibodies specifically
immunoreactive with
a particular protein. For example, solid-phase ELISA immunoassays are
routinely used to
select antibodies specifically immunoreactive with a protein (see, e.g.,
Harlow & Lane,
ArrrtsoniES, A LABORATORY MANUAL ( 1988), for a description of immunoassay
formats
and conditions that can be used to determine specific immunoreactivity).
Typically a
specific or selective reaction will be at least twice background signal or
noise and more
typically more than 10 to 100 times background.
"Cytotoxicity", as used herein, refers to the inhibition of protein synthesis
in
human tumor cells, e.g., HS578T (ATCC No. HTB 126) using the protocol
described in
Rybak, et al., JNCI 88:747-753 ( 1996). A "cytotoxic reagent" of the present
invention
will have a relative 50% inhibitory concentration (ICso) at least 50% that of
an equimolar
amount of the polypeptide of SEQ ID N0:2. More preferably, the relative ICS
will be at
least 60% or 70% that of the polypeptide of SEQ ID N0:2, and even more
preferably, at
least 100%.
II. Introduction
This invention provides highly active and cytotoxic ribonuclease molecules
which can be used to selectively kill and target cells, particularly tumor
cells. In some
embodiments the molecules are designed to fold into more cytotoxic molecules
and in
other embodiments, the molecules are designed for better expression in
bacteria.
The ribonucleases of this invention are isolated from members of the genus
Rana. SEQ ID NO:1 represents the nucleic acid sequence of a RNAse derived from
a
Rana pipiens liver mRNA library. The corresponding amino acid sequence is
represented
by SEQ ID N0:2 (RaPLRI). SEQ ID N0:6 is the amino acid sequence of RaPLRl but
with a methionine at the 1 position. SEQ ID N0:4 is the amino acid sequence of
RaPLRI
but with a leucine at position 23 (instead of a methionine). SEQ ID N0:8
represents the
sequence shown in SEQ ID N0:4 but with a methionine at the 1 position. SEQ ID
N0:9
represents a protein with the amino acid sequence of SEQ ID N0:8 but with a
six histidine
residue tag at the amino terminus. SEQ ID NO:11 represents RaPLRl with a
serine at the
N-terminus and SEQ ID N0:13 represents RaPLRI with a serine at the 2 position
and a
methionine at the 1 position. SEQ ID N0:28 is the amino acid sequence of
RaPLRl with
the signal peptide at the N-terminus.
CA 02401916 2002-09-19
In addition to ribonuclease derived from Rana pipiens, this invention also
encompasses ribonucleases derived from Rana catesbeiana oocytes. Although the
amino
acid sequence of Rana catesbeiana oocyte RNAse (RaCORl) has been known since
1989
(Nitta, R., et al., J. Biochem. 106:729 (1989); Okabe, Y., et al., J. Biochem
109:786
5 (1991); Liao, Y, Nucl., Acids Res. 20:1371 (1992); Nitta, K., et al.,
Glycobiology 3:37
(1993); Liao, Y. & Wang, J., Eur. J. Biochem. 222:215 (1994); Wang, J., et
al., Cell
Tissue Res. 280:259 (I995); Liao, Y., et al., Protein Expr. Purif. 7:194
(1996); and
Inokuchi, N., et al., Biol. Pharm. Bull. 20:471 (1997)), genomic DNA or mRNA
which
encodes the oocyte RNAse has not been discovered. An object of this invention
was to
10 deduce the nucleic acid sequence encoding this RNAse and express the RNAse
recombinantly.
SEQ ID N0:14 represents the nucleic acid sequence of RaCORI but
modified to use the preferred codons for E. coli, the expression system
exemplified in this
invention. SEQ ID NO:I S is the corresponding amino acid sequence. SEQ ID
NO:I7 is
15 the same amino acid sequence as SEQ ID NO:15 but with a methionine at the 1
position.
SEQ ID N0:19 is the amino acid sequence of SEQ ID NO:15 but with leucines
substituted
for methionines at positions 22 and 57. SEQ ID N0:21 is the same as SEQ ID
N0:19
except for a methionine at the 1 position. SEQ ID N0:22 is the same as SEQ ID
N0:21
except six histidine residues have been appended to the N-terminus. Finally,
SEQ ID
N0:24 represents RaCORl but with a serine at the N-terminus and SEQ ID NO:26
is the
same as SEQ ID N0:24 except a methionine is at the 1 position.
Preferably, the ribonuclease molecules will have an amino terminal end
selected from the group consisting of
Gln-
Met-Gln;
Met-Ser;
Met-Thr;
Tyr; and
Pyroglutamic acid-.
Further, it is preferred that the ribonuclease molecules be modified so that
the methionine of amino acid position 23 of SEQ ID N0:2 is deleted or replaced
by Leu.
CA 02401916 2002-09-19
16
In one embodiment of the invention, the methionines at position 22 and 57 of
SEQ ID
NO: I S are also replaced by a leucine.
In other alternative embodiments, the ribonuclease molecules will be fused
at either the carboxyl or amino end to a ligand binding moiety, such as a
single chain Fv
which recognizes a cell surface antigen on a tumor cell. Other ligand binding
moieties
include, but are not limited to, other antibody fragments, receptors,
antigens, lectins,
cytokines, Iipopolysaccharides and any other compound that binds to a cell.
Comparisons of the ribonuclease sequences provided here can be made to
described sequences in the pancreatic RNAse A superfamily. Many of such
members are
known and include, but are not limited to, ONCONASE~ (Ardelt, W. et al., ,l.
Biol.
Chem. 266:245 (199I)); eosinophil derived neurotoxin (EDN) and human
eosinophil
cationic protein (ECP) (Rosenberg, et al., J. Exp. Med. 170:163 (1989));
angiogenin (Ang)
(Fett, J.W. et al., Biochemistry 24:5480 (1985)); bovine seminal RNase
(Preuss, et al.,
Nuc. Acids. Res. 18:1057 (1990)); and bovine pancreatic RNase (Beintama, et
al., Prog.
Biophys. Mol. Biol. 51:165 ( 1988)). Amino acid sequence alignment for such
RNAses are
set out in Youle, et al., Crit. Rev Ther. drug. Carrier Systems 10:1-28
(1993).
III. Numbering of Amino Acid Residues
The amino acid sequence positions described herein, unless otherwise
indicated, use as a frarn-e of reference the RNAse sequences of the respective
SEQ ID
NOS: in the SEQUENCE LISTING. Residue numbers indicate the distance from the
amino terminus. The amino acid sequence for SEQ ID N0:2 and for SEQ ID NO:15
are
set forth in the SEQUENCE LISTING.
IV. RNAse Proteins
The present invention includes RNAse proteins comprising a polypeptide of
SEQ ID N0:2 and 15 and conservative variants thereof. The polypeptides of the
prescnt
invention (SEQ ID N0:2 and 15 and conservative variants thereof) demonstrate
cytotoxic
activity, as defined herein. The RNAse proteins of the present invention may
be limited to
the polypeptides of SEQ ID N0:2 and 15 and conservative variants thereof, or
may be
inclusive of additional amino acid residues linked via peptide bonds to the
carboxy and/or
amino termini of the polypeptide. Preferably, the conservative variants of SEQ
ID N0:2
CA 02401916 2002-09-19
17
and 15 comprise a glutamine residue capable of spontaneous cyclization to
pyroglutamic
acid at the 1 position.
The RNAse proteins of this invention optionally are translated by the host
cell with a signal peptide attached. The signal peptide is shown in SEQ ID
NO:28. The
presence of this sequence allows the host cell, in particular E. coli, to
secrete soluble
protein. In this configuration, the presence of a N-terminal methionine is not
necessary for
bacterial expression and the N-terminal residue is a glutamine or pyroglutamic
acid. One
of skill will recognize that other signal peptides may be appended to the
RNAse proteins
of this invention. The choice of signal peptide will depend on the expressing
cell, the
protein being expressed and the preference of the practitioner.
The polypeptide of SEQ ID N0:2 or conservatively modified variants
thereof may have a leucine or other hydrophobic residue substituting for the
methidnine at
position 23. The polypeptide of SEQ ID NO:15 or conservatively modified
variants
thereof may have a leucine or other hydrophobic residue substituting for the
methionine at
positions 22 and 57, Those of skill will recognize that a polypeptide lacking
a methionine
is typically not subject to specific cleavage using cyanogen bromide.
Proteins of the present invention can be produced by recombinant
expression of a nucleic acid encoding the polypeptide followed by purification
using
standard techniques. Typically, the RNAse proteins are encoded and expressed
as a
contiguous chain from a single nucleic acid. The length of the RNAse proteins
of the
present invention is generally less than about 600 amino acids in length.
Recombinant RNAse proteins can also be synthetically prepared in a wide
variety of well-known ways. , Polypeptides of relatively short size are
typically synthesized
in solution or on a solid support in accordance with conventional techniques.
See, e.g.,
Merrifield, J. Am. Chem. Soc. 85:2149-2154 (1963). Recombinantly produced or
synthetic
polypeptides can be condensed to form peptide bonds with other polypeptide~ or
proteins
formed synthetically or by recombinant methods. Various automatic synthesizers
and
sequencers are commercially available and can be used in accordance with known
protocols. See, e.g., Stewart & Young, SOLID PHASE PEPTIDE SYNTHESIS, 2d. ed.,
Pierce
Chemical Co. (1984).
CA 02401916 2002-09-19
18
A. RNAse Proteins Comprising Amino Terminal Methionine
The present invention also includes RNAse proteins comprising: 1 ) a
polypeptide of SEQ ID N0:2 or SEQ ID NO:15 and conservatively modified
variants
thereof, and 2) a methionine at position 1 (see, e.g., SEQ ID N0:6 and SEQ ID
N0:17).
Isolated nucleic acids coding for the RNAse proteins of the present invention
are also
provided. Preferably, as in SEQ ID N0:2 and 15, the position 1 residues of the
polypeptides are glutamines. Various embodiments of the polypeptide of SEQ ID
N0:2
and 15 and conservative variants thereof may be employed in this aspect of the
invention.
Those of skill will understand that an N-terminal methionine or
formylmethionine (collectively, "methionine") is typically required for
protein synthesis in
a bacterial host cell. The N-terminal methionine may be directly linked to the
amino acid
of position 1 of the polypeptides of the present invention where position 1 is
not
methionine via a peptide bond. Alternatively, the methionine is indirectly or
directly
linked to the amino acid of position 1 of the polypeptides of the present
invention via a
plurality of peptide bonds from a contiguous chain of amino acid residues. The
residues,
extending and inclusive of the amino terminal methionine to the amino acid
directly linked
via a peptide bond to the amino terminal amino acid residue of the
polypeptide, constitute
an amino terminal peptide. Thus, the amino terminal peptide consists of all
amino acid
residues linked to position 1 of SEQ ID N0:2 or 15 or conservatively modified
variants
thereof. The N-terminal peptide is at least one amino acid residue in length
(i.e., a
methionine residue) or may be 5, 10, 20, 50, 100, 200, 300, 400, or more amino
acids in
length. .
The N-terminal peptide may comprise a signal sequence for transport into
various organelles or compartments of the host cell, or for transport into the
surrounding
media. The N-terminal peptide may also encode sequences which aid in
purification such
as epitopes which allow purification via immunoaffinity chromatography, e.g..
a plurality
of histidine residues, or sequences recognized by endoproteases such as Factor
Xa. The N-
terminal peptide may also recognize extracellular and intracellular targets,
such as
telomerase.
.
CA 02401916 2002-09-19
19
B. Making the RNAse Protein
The present invention is also directed to methods of making the RNAse
polypeptides of SEQ ID N0:2, SEQ ID NO:15 and conservative variants thereof.
The
polypeptides of the SEQ ID N0:2 and 15 and conservative variants thereof may
conveniently be assayed for cytotoxicity or anti-viral (e.g., HIV-1)
inhibition by methods
disclosed herein.
1. Expressing the RNAse Protein
This invention relies on routine techniques in the field of recombinant
genetics. Basic texts disclosing the general methods of use in this invention
include
Sambrook, et al., MOLECULAR CLONING, A LABORATORY MANUAL , 2ND ED. (1989);
Kriegler, GENE TRANSFER AND EXPRESSION: A LABORATORY MANUAL (1990); and
Ausubel et al., (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (I994)).
For nucleic acids, sizes are given in either kilobases (kb) or base pairs
(bp).
These are estimates derived from agarose or acrylamide gel electrophoresis,
from
sequenced nucleic acids, or from published DNA sequences. For proteins, sizes
are given
in kilodaltons (kD) or amino acid residue numbers. Proteins sizes are
estimated from gel
electrophoresis, from sequenced proteins, from derived amino acid sequences,
or from
published protein sequences.
Oligonucleotides that are not commercially available can be chemically
synthesized according to the solid phase phosphoramidite triester method first
described by
Beaucage & Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), using an
automated
synthesizer, as described in Van Devanter, et al., Nucl. Acids Res. 12:6159-
6168 (1984).
Purification of oligonucleotides is by either native acrylamide gel
electrophoresis or by
anion-exchange HPLC as described in Pearson & Regnier, J. Chrom. 255:137-149
(1983).
The sequence of the cloned genes and synthetic oligonucleotides can be
verified after cloning using, e.g., the chain termination method for
sequencing
double-stranded templates of Wallace, et al., Gene 16:21-26 (1981).
In one embodiment of the invention, a RNAse of SEQ ID N0:4, 8, 9, 13,
17, 21, 22, 26 and conservative variants thereof wherein the nucleic acids
encode an amino
terminal methionine, are expressed in a host cell. Various aspects of the
polypeptides of
the present invention which have been previously described may be utilized in
this aspect
CA 02401916 2002-09-19
of the invention. By "host cell" is meant a cellular recipient, or extract
thereof, of an
isolated nucleic acid which allows for translation of the nucleic acid and
requires an amino
terminal methionine for translation of the nucleic acid into its encoded
polypeptide.
Eukaryotic and prokaryotic host cells may be used such as animal cells, insect
cells,
5 bacteria, fungi, and yeasts. Methods for the use of host cells in expressing
isolated nucleic
acids are well known to those of skill and may be found, for example, in
Bergen &
Kimmel, GUTDE TO MOLECULAR CLONING TECT~NIQUES, METHODS IN ENZYMOLOGY VOL.
152, Academic Press, Inc., San Diego, CA (Bergen); Sambrook, et al., MOLECULAR
CLONING - A LABORATORY MANUAL (2ND ED.) VOL. 1-3 (1989) and CURRENT
10 PROTOCOLS TN MOLECULAR BIOLOGY, F.M. Ausubel et al., eds., Current
Protocols, a joint
venture between Greene Publishing Associates, Inc. and John Wiley & Sons,
Inc., (1997
Supplement) (Ausubel). A variety of host cells and expression vectors arc
available from
commercial vendors, or the American Type Culture Collection (Rockville, MD).
Accordingly, this invention also provides for host cells and expression
vectors comprising
15 the nucleic acid sequences described herein.
. Nucleic acids encoding RNAse proteins can be made using standard
recombinant or synthetic techniques. Nucleic acids may be RNA, DNA, or hybrids
thereof. Given the polypeptides of the present invention, one of skill can
construct a
variety of clones containing functionally equivalent nucleic acids, such as
nucleic acids
20 which encode the same polypeptide. Cloning methodologies to accomplish
these ends, and
sequencing methods to verify the sequence of nucleic acids are well known in
the art.
Examples of appropriate cloning and sequencing techniques, and instructions
sufficient to
direct persons of skill through many cloning exercises are found in Bergen &
Kimmel;
Sambrook et al.; and F.M. Ausubel et al. (all supra). Product information from
manufacturers of biological reagents and experimental equipment also provide
information
useful in known biological methods. Such manufacturers include the SIGMA
chemical
company (Saint Louis, MO), R&D systems (Minneapolis, MN), Pharmacia LKB
Biotechnology (Piscataway, NJ), CLONTECH Laboratories, Inc. (Palo Alto, CA),
Chem
Genes Corp., Aldrich Chemical Company (Milwaukee, WI), Glen Research, Inc.,
GIBCO
BRL Life Technologies, Inc. (Gaithersberg, MD), Fluka Chemica-Biochemika
Analytika
(Fluka Chemie AG, Buchs, Switzerland), Invitrogen, San Diego, CA, and Applied
CA 02401916 2002-09-19
21
Biosystems (Foster City, CA), as well as many other commercial sources known
to one of
skill.
The nucleic acid compositions of this invention, whether RNA, cDNA,
genomic DNA, or a hybrid of the various combinations, are isolated from
biological
sources or synthesized in vitro. Deoxynucleotides may be synthesized
chemically
according to the solid phase phosphoramidite triester method described by
Beaucage &
Caruthers, Tetrahedron Letts. 22(20):1859-1862 ( 1981 ), e.g., using an
automated
synthesizer, e.g., as described in Needham-VanDevanter, et al., Nucleic Acids
Res.
12:6159-6168 (1984).
In one embodiment of the invention, the amino acid sequence of RaCORI,
which had been previously published, was used to deduce a nucleic acid
sequence and,
using the preferred codon for the expressing cell, synthesized. For example,
the RaCORl
nucleic acid sequence was prepared from the published amino acid sequence of
the native
RNAse and the preferred codon usage by E. coli.
To generate the full length nucleic acid sequence, overlapping
oligonucleotides, representing both the sense and nonsense strands of the gene
and usually
40-120 by in length, were synthesized chemically. These DNA fragments were
then
annealed, ligated and cloned. For example, from the published amino acid
sequence of
ribonuclease from Rana catesbeiana oocytes, a series of oligonucleotide
primers were
prepared. These primers (SEQ ID. N0:32-41 ) were used to generate the S' and
3' ends of
ribonuclease. The two regions of nucleic acid were then ligated to form the
complete
coding sequence. An advantage of this method is that mutations are relatively
easy to
engineer. To do so, one changes the nucleotides within the synthetic primer to
correspond
to the codon that translates to the desired amino acid.
One of skill will recognize many other ways of generating alterations or
variants of a given nucleic acid sequence. Such well-known methods include
site-directed
mutagenesis, PCR amplification using degenerate oligonucleotides, exposure of
cells
containing the nucleic acid to mutagenic agents or radiation, chemical
synthesis of a
desired oligonucleotide (e.g., in conjunction with ligation and/or cloning to
generate large
. 30 nucleic acids) and other well-known techniques. See, Giliman & Smith,
Gene 8:81-97
(1979), Roberts, et al., Nature 328:731-734 (1987) and Sambrook, Innis,
Ausubel, and
Berger (all supra).
CA 02401916 2002-09-19
22
In another embodiment of the present invention, site directed mutagenesis is
used to change an interior methionine to a leucine. The nucleic acid sequence
is changed
by synthesizing an oligonucleotide primer that contains the mutation. The
primer is
hybridized to a nucleic acids of SEQ ID NO:1 and SEQ ID N0:14 and a new
sequence
amplified. After suitable rounds of amplification (approximately 20-30), the
overwhelming majority of the sequences contain the mutation. The amplification
product
with the mutation is ligated into an expression vector and the RNAse with the
mutation
expressed.
Most commonly, polypeptide sequences are altered by changing the
corresponding nucleic acid sequence and expressing the polypeptide. However,
polypeptide sequences can also be generated synthetically using commercially
available
peptide synthesizers to produce any desired polypeptide (see, Merrifield, and
Stewart &
Young, supra).
One of skill can select a desired nucleic acid or polypeptide of the invention
based upon the sequences provided and upon knowledge in the art regarding
ribonucleases
generally. The physical characteristics and general properties of RNAses are
known to
skilled practitioners. The specific effects of some mutations in RNAses are
known.
Moreover, general knowledge regarding the nature of proteins and nucleic acids
allows one
of skill to select appropriate sequences with activity similar or equivalent
to the nucleic
acids and polypeptides disclosed in the sequence listings herein. The
definitions section
herein describes exemplary conservative amino acid substitutions.
Finally, most modifications to nucleic acids and polypeptides are evaluated
by routine screening techniques in suitable assays for the desired
characteristic. For
instance, changes in the immunological character of a polypeptide can be
detected by an
appropriate immunological assay. Modifications of other properties such as
nucleic acid
hybridization to a target nucleic acid, redox or thermal stability of a
protein, thermal
hysteresis, hydrophobicity, susceptibility to proteolysis, or the tendency to
aggregate are all
assayed according to standard techniques.
To obtain high level expression of a cloned gene, such as those cDNAs
encoding ribonuclease, it is important to construct an expressiow vector that
contains a
strong promoter to direct transcription, a transcription/translation
terminator, and a
ribosome binding site for translational initiation. Suitable bacterial
promoters are well
CA 02401916 2002-09-19
23
known in the art and described, e.g., in Sambrook et al. and Ausubel et al.
Bacterial
expression systems for expressing ribonuclease are available in, ,e.g., E.
coli, Bacillus sp.,
and Salmonella (Palva, et al., Gene 22:229-235 (1983); Mosbach, et al., Nature
302:543-
545 (1983). Kits for such expression systems are commercially available.
Eukaryotic
expression systems for mammalian cells, yeast, and insect cells are well known
in the art
and are also commercially available.
The promoter used to direct expression of a heterolvgous nucleic acid
depends on the particular application. The promoter is preferably positioned
about the
same distance from the heterologous transcription start site as it is from the
transcription
start site in its natural setting. As is known in the art, however, some
variation in this
distance can be accommodated without loss of promoter function. .
In addition to the promoter, the expression vector typically contains a
transcription unit or expression cassette that contains all the additional
elements required
for the expression of the ribonucIease-encoding nucleic acid in host cells. A
typical
expression cassette thus contains a promoter operably linked to the nucleic
acid sequence
encoding ribonuclease and signals required for efficient polyadenylation of
the transcript,
ribosome binding sites, and translation termination. Depending on the
expression system,
the nucleic acid sequence encoding ribonuclease may be linked to a cleavable
signal
peptide sequence to promote secretion of the encoded protein by the
transformed cell.
Such signal peptides would include, among others, the signal peptides from
tissue
plasminogen activator, insulin, and neuron growth factor, and juvenile hormone
esterase of
Heliothis virescens. Additional elements of the cassette may include enhancers
and, if
genomic DNA is used as the structural gene, introns with functional splice
donor and
acceptor sites.
In addition to a promoter sequence, the expression cassette should also
contain a transcription termination region downstream of the structural gene
to provide for
efficient termination. The termination region may be obtained from the same
gene as the
promoter sequence or may be obtained from different genes.
The particular expression vector used to transport the genetic information
into the cell is not particularly critical. Any of the conventional vectors
used for
expression in eukaryotic or prokaryotic cells may be used. Standard bacterial
expression
vectors include plasmids such as pBR322 based plasmids, pSKF, pETI Sb, pET23D,
and
CA 02401916 2002-09-19
24
fusion expression systems such as GST and LacZ. Epitope tags can also be added
to
recombinant proteins to provide convenient methods of isolation, e.g., 6-his.
For example, the cDNA of the RNAses of this invention were inserted into
pETlld and the pETlSb vectors. These vectors comprise, in addition to the
expression
cassette containing the coding sequence, the T7 promoter, transcription
initiator and
terminator, the pBR322 on site, a bla coding sequence and a lacl operator.
The vectors comprising the nucleic acid sequences encoding the RNAse
molecules or the fusion proteins may be expressed in a variety of host cells,
including E.
coli, other bacterial hosts, yeast, and various higher eukaryotic cells such
as the COS,
CHO and HeLa cells lines and myeloma cell lines. In addition to cells, vectors
may be
expressed by transgenic animals, preferably sheep, goats and cattle.
Typically, in this
expression system, the recorribinant protein is expressed in the transgenic
animal's milk.
The recombinant nucleic acid will be operably linked to appropriate
expression control sequences for each host. For E. coli this includes a
promoter such as
the T7, hp, or lambda promoters, a ribosome binding site and preferably a
transcription
termination signal. For eukaryotic cells, the control sequences will include a
promoter and
preferably an enhancer derived from immunoglobulin genes, SV40,
cytomegalovirus, etc.,
and a polyadenylation sequence, and may include splice donor and acceptor
sequences.
The expression vectors or plasmids of the invention can be transferred into
the chosen host cell by well-known methods such as calcium chloride
transformation for
E. coli and calcium phosphate treatment, liposomal fusion or electroporation
for
mammalian cells. Cells transformed by the plasmids can be selected by
resistance to
antibiotics conferred by genes contained on the plasmids, such as the amp,
gpt, neo and
hyg genes.
Once expressed, the RNAse protein can be purified according to standard
procedures of the art, including ammonium sulfate precipitation, column
chromatography
(including affinity chromatography), gel electrophoresis and the like (see,
generally, R.
Scopes, Protein Purification, Springer-Verlag, N.Y. (1982), Deutscher, Methods
in
Enrymology Vol. 182: Guide to Protein Purification., Academic Press, Inc. N.Y.
(1990)).
CA 02401916 2002-09-19
2. Cleavinle~, the RNAse Protein
After translation in the host cell, the RNAse which comprises a signal
peptide is cleaved within the bacterial periplasm. Thus, no further
manipulation of the
protein is required for activity. For proteins with an amino terminal
methionine, if a N-
5 terminal glutamine or pyroglutamic acid is desired, the protein is treated
with a cleaving
agent or a combination of cleaving agents to remove the methionine. By
"cleaving the
amino terminal methionine" is meant cleaving the amino terminal methionine or
amino
terminal peptide from the polypeptides of SEQ ID N0:6, 8, 9; 13, 17, 21, 22,
26 and
conservative variants thereof. Thus, by "cleaving the amino terminal
methionine", a
i0 polypeptide of SEQ ID N0:2, 4, 11, 15, 19, 24 or conservative variants
thereof is
generated, optionally linked via peptide bonds to additional residues at the
carboxy or
amino terminus.
The cleaving agent may be a proteolytic enzyme such as an exopeptidase or
endopeptidase (collectively, "peptidase") or a chemical cleaving agent.
Exopeptidases
15 include aminopeptidase M (Pierce, Rockford, IL) which sequentially remove
amino acids
from the amino-terminus. Cleavage of the amino terminal methionine by
exopeptidases
may be controlled by modulating the enzyme concentration, temperature, or time
under
which the cleavage takes place. The resulting mixture may be.purified for the
desired
protein by means well known to those of skill; for example, on the basis of
length by
20 electrophoresis. The chemical cleaving agent, cyanogen bromide, is
conveniently
employed to selectively cleave methionine residues.
The cleaving agent employed to cleave the amino terminal methionine will
typically be chosen so as not to break a peptide bond within the polypeptide
of SEQ ID
N0:2 and 15 or conservative variants thereof. Alternatively, use of a
particular cleaving
25 agent may guide the choice of conservative substitutions of the
conservative variants of the
polypeptides of the present invention. For example, the sequence of the native
protein of
SEQ ID N0:2 contains a rnethionine at position 23. As shown in_SEQ ID N0:4 and
SEQ
1D N0:8, this methionine was changed to a leucine to prevent cleavage of the
RNAse
polypeptide chain with a 1 methionine by CNBr. Similarly, the native protein
of SEQ ID
N0:15 contains 2 internal methionines, one at position 22 and the other at
position 57. As
shown in SEQ ID N0:19 and 21, these methionines corresponding to position 22
and 57
CA 02401916 2002-09-19
26
in SEQ ID NO:15 were changed to leucines to prevent cleavage of the
polypeptide chain
when the N-terminal methionine was cleaved from the remainder of the protein.
The polypeptides of this invention may be purified to substantial purity by
standard techniques, including selective precipitation with such substances as
ammonium
sulfate; column chromatography, immunopurification methods, and others. See,
for
instance, R. Scopes, PROTEIN PURIFICATION: PRINCIPLES AND PRACTICE, Springer-
Verlag:
New.York (1962), U.S. Patent No. 4,673,641, Ausubel, and Sambrook.
C. Purification of RNAse from Bacterial Cultures
In the case of secreted proteins, the RNAses of this invention can be
isolated and purified from the broth in which the expressing bacteria have
been grown
without having to resort to the cell lysis methods detailed below.
1. Purification of Protein from Bacterial Periplasm
It is anticipated that RNAse expression from E. coli may be low and the
protein is exported into the periplasm of the bacteria. The periplasmic
fraction of the
bacteria can be isolated by cold osmotic shock in addition to other methods
known to skill
in the art (see Ausubel, and Trayer, H.R. & Buckley, III, C.E., J. Biol. Chem.
245( 18):4$42 ( 1970)).
To isolate proteins from the periplasm, the bacterial cells are centrifuged to
form a pellet. The pellet is resuspended in a buffer containing 20% sucrose.
To lyre the
cells, the bacteria are centrifuged and the pellet is resuspended in ice-cold
5 mM MgS04
and kept in an ice bath for approximately 10 minutes. The cell suspension is
centrifuged
and the supernatant decanted and saved. The proteins present in the
supernatant can be
separated from the host proteins by standard separation techniques well known
to those of
skill in the art.
CA 02401916 2002-09-19
27
2. Purification of Inclusion Bodies
When recombinant proteins are expressed by the transformed bacteria in
large amounts, typically after promoter induction; but expression can be
constitutive, the
proteins may form insoluble aggregates.
Purif ration of aggregate proteins (hereinafter referred to as inclusion
bodies) involves the extraction, separation and/or purification of inclusion
bodies by
disruption of bacterial cells, typically but not limited by, incubation in a
buffer of about
100-150 pglmL lysozyme and 0.1% Nonidet P40~, a non-ionic detergent. The cell
suspension can be ground using a Polytron~ grinder (Brinkman Instruments,
Westbury,
N.Y.). Alternatively, the cells can be sonicated on ice. Alternate methods of
lysing
bacteria are described in Ausubel and Sambrook and will be apparent to those
of skill in
the art.
The cell suspension is centrifuged and the pellet containing the inclusion
bodies resuspended in buffer, e.g., 20 mM Tris-HCI (pH 7.2), 1 mM EDTA, 150 mM
NaCI
and 2% Triton-X 100~, a non-ionic detergent. It may be necessary to repeat the
wash step
to remove as much cellular debris as possible. The remaining pellet of
inclusion bodies
may be resuspended in an appropriate buffer (e.g. 20 mM sodium phosphate, pH
6.8, 150
mM NaC1). Other appropriate buffers will be apparent to those of skill in the
art.
Following the washing step, the inclusion bodies are solubilized by the
addition of a solvent that is both a strong hydrogen acceptor and a strong
hydrogen donor
(or a combination of solvents each having one of these properties); the
proteins that
formed the inclusion~bodies may then be renatured by dilution or dialysis with
a
compatible buffer. Suitable solvents include, but are not limited to urea
(from about 4 M
to about 8 M), formamide (at least about 80%, volumelvolume basis), and
guanidine
hydrochloride (from about 4 M to about 8 M). Somc solvents which are capable
of
solubilizing aggregate-forming proteins, for example SDS (sodium dodecyl
sulfate), 70%
formic acid, are inappropriate for use in this procedure due to the
possibility of irreversible
denaturation of the proteins, accompanied by a Iack of immunogenicity and/or
activity.
Although guanidine hydrochloride and similar agents are denaturants, this
denaturation is
not irreversible and renaturation may occur upon removal (by dialysis, for
example) or
dilution of the denaturant, allowing re-formation of immunologically and/or
biologically
active protein.
CA 02401916 2002-09-19
28
After solubilization, the protein can be separated from other bacterial
proteins by standard separation techniques.
D. Standard Protein Separation Techniques
1. Solubilitv Fractionation
Often as an initial step and if the protein mixture is complex, an initial
salt
fractionation can separate many of the unwanted host cell proteins (or
proteins derived
from the cell culture media) from the recombinant protein of interest. The
preferred salt is
ammonium sulfate. Ammonium sulfate precipitates proteins by effectively
reducing the
amount of water in the protein mixture. Proteins then precipitate on the basis
of their
solubility. The more hydrophobic a protein is, the more likely it is to
precipitate at lower
ammonium sulfate concentrations. A typical protocol is to add saturated
ammonium
sulfate to a protein solution so that the resultant ammonium sulfate
concentration is
between 20-30%. This will precipitate the most hydrophobic of proteins. The
precipitate
is discarded (unless the protein of interest is hydrophobic) and ammonium
sulfate is added
to the supernatant to a concentration known to precipitate the protein of
interest. The
precipitate is then solubilized in buffer and the excess salt removed if
necessary, either
through dialysis or' diafiltration. Other methods that rely on solubility of
proteins, such as
cold ethanol precipitation, are well known to those of skill in the art and
can be used to
fractionate complex protein mixtures.
2. Size Differential Filtration
if the size of the protein of interest is known or can be estimated from the
cDNA sequence, proteins of greater and lesser size can be rernaved by
uItrafiltration
through membranes of different pore size (for example, Amicon or Millipore
membranes).
As a first step, the protein mixture is ultrafiltered through a membrane with
a pore size
that has a lower molecular weight cut-off than the molecular weight of the
protein of
interest. The retentate of the ultrafiltration is then ultrafiltered against a
membrane with a
molecular cut off greater than the molecular weight of the protein of
interest. The
recombinant protein will pass through the membrane into the filtrate. The
filtrate can then
be chromatographed as described below.
CA 02401916 2002-09-19
29
3. Column Chromatoerap~y
Proteins can be separated on the basis of their size, net surface charge,
hydrophobicity, and affinity for ligands. In addition, antibodies raised
against proteins can
be conjugated to column matrices and the proteins immunopurified: A11 of these
methods
are well known in the art.
It will be apparent to one of skill that chromatographic techniques can be
performed at any scale and using equipment from many different manufacturers
(e.g.,
Pharmacia Biotech).
In a preferred embodiment of this invention, the proteins are expressed from
E. colt with a six histidine residue tag joined via a peptide bond to a 7
methionine. After
the protein is purified to homogeneity as in Newton, et al., Biochemistry
35:545 (1996),
the protein is cleaved at the 7 methionine as described above. The CNBr is
removed and
the'mixture applied to a Ni2+-NTA agarose column. The flow-through material is
the
cleaved product of interest.
E. Cyclization
Upon cleavage of the N-terminal methionine and other residues of the
amino terminal peptide, a protein comprising the polypeptide of SEQ ID N0:2 or
15 or a
conservatively modified variant thereof is generated. The glutamine residue of
SEQ ID
N0:2 or 15 is caused to cyclize by any number of weans, including
spontaneously or by
catalysis, to a pyroglutamyl residue. Spontaneous hydrolysis of amino terminal
glutamine
residues to their pyroglutamyl form is well known to the skilled artisan and
its rate may be
hastened by, for example, increasing the temperature. See, e.g., Robinson, et
al., J. Am.
Chem. Soc. 95:8156-8159 (1973). Cytotoxicity or anti-viral activity of the
resultant
RNAse protein may be assessed by means herein disclosed and well known to the
skilled
artisan.
VII. Ligand Binding Moieties
The polypeptides and proteins of the present invention may also be joined
via covalent or non-covalent bond to a ligand binding moiety. The RNAse
molecule may
be joined at the amino or carboxy terminus to the ligand or may also be joined
at an
internal region as long as the attachment does not interfere with the
respective activities of
CA 02401916 2002-09-19
the molecules. Immunoglobulins or binding fragments thereof (e.g., single-
chain Fv
fragments) may conveniently be joined to the polypeptides of the present
invention.
Vaughan, et aL, Nature Biotechnology 14:309-314 (I996).
5 A. Chemically Conjugated Fusion Proteins
In one embodiment, the RNAse molecule is chemically conjugated to
another molecule (e.g. a cytotoxin, a label, a ligand, or a. drug or
liposome). Means of
chemically conjugating molecules are well-known to those of skill.
The procedure for attaching an agent to an antibody or other polypeptide
10 targeting molecule will vary according to the chemical structure of the
agent. Polypeptides
typically contain a variety of functional groups; e.g., carboxylic acid (COOH)
or free
amine (-NHZ) groups, which are available for reaction with a suitable
functional group on
an RNAse molecule to bind the other molecule thereto.
Alternatively, the ligand and/or RNAse molecule may be derivatized to
15 expose or attach additional reactive functional groups. The derivatization
may involve
attachment of any of a number of linker molecules such as those available from
Pierce
Chemical Company, Rockford Illinois.
A "linker", as used herein, is a molecule that is used to join two molecules.
The linker is capable of forming covalent bonds to both molecules. Suitable
linkers are
20 well known to those of skill in the art and include, but are not limited
to, straight or
branched-chain carbon linkers, heterocyclic carbon linkers, or peptide
linkers. Where both
molecules are polypeptides, the linkers may be joined to the constituent amino
acids
through their side groups (e.g., through a disulfide linkage to cysteine).
However, in a
preferred embodiment, the linkers will be joined to the alpha carbon amino and
carboxyl
25 groups of the terminal amino acids.
A bifunctional linker having one functional group reactive with a group on
a particular agent, and another group reactive with an antibody, may be used
to form a
desired immunoconjugate. Alternatively, derivatization may involve chemical
treatment of
the ligand, e.g., glycol cleavage of the sugar moiety of a glycoprotein
antibody with
30 periodate to generate free aldehyde groups. The free aldehyde groups on the
antibody may
be reacted with free amine or hydrazine groups on an agent to bind the agent
thereto.
(See U.S. Patent No. 4,671,958). Procedures for generation of free sulfhydryl
groups on
CA 02401916 2002-09-19
31
polypeptides, such as antibodies or antibody fragments, are also known (See
U.S. Pat. No.
4,659,839).
Many procedure and linker molecules for attachment of various compounds
including radionuclide metal chelates, toxins and drugs to proteins such as
antibodies are
S known. See, for example, European Patent Application No. 188,256; U.S.
Patent Nos.
4,671,958, 4,659,839, 4,414,148, 4,699,784; 4,680,338; 4,569,789; and
4,589,071; and
Borlinghaus, et al. Cancer Res. 47:4071-4075 (1987),
In particular, production of various immunotoxins is well-known within the art
and can be found, for example in "Monoclonal Antibody-Toxin Conjugates: Aiming
the
Magic Bullet," Thorpe, et al., MONOCLONAL ANTIBODIES IN CLINICAL MEDICINE,
Academic Press, pp. 168-190 (I982), Waldmann, Science 252:1657 (1991), U.S.
Patent
Nos. 4,545,985 and 4,894,443.
In some circumstances, it is desirable to free the RNAse from the ligand
when the chimeric molecule has reached its target site. Therefore, chimeric
conjugates
1 S comprising linkages which are cleavable in the vicinity of the target site
may be used
when the effector is to be released at the target site. Cleaving of the
linkage to release the
agent from the ligand may be prompted by enzymatic activity or conditions to
which the
immunoconjugate is subjected either inside the target cell or in the vicinity
of the target
site. When the target site is a tumor, a linker which is cleavable under
conditions present
at the tumor site (e.g. when exposed to tumor-associated enzymes or acidic pH)
may be
used.
A number of different cleavable linkers are known to those of skill in the
art. See U.S. Pat. Nos. 4,618,492; 4,542,225, and 4,625,014. The mechanisms
for release
of an agent from these linker groups include, for example, irradiation of a
photolabile
2S bond and acid-catalyzed hydrolysis. U.S. Pat. No. 4,671,958, for example,
includes a
description of immunoconjugates comprising linkers which are cleaved at the
target site in
vivo by the proteolytic enzymes of the patient's complement system. In view of
the large
number of methods that have been reported for attaching a variety of
radiodiagnostic
compounds, radiotherapeutic compounds, drugs, toxins, and other agents to
antibodies one
skilled in the art will be able to determine a suitable method for attaching a
given agent to
an antibody or other polypeptide.
CA 02401916 2002-09-19
32
B. Recombinant Fusion Proteins
In a preferred embodiment, the chimeric fusion proteins of the present
invention are synthesized using recombinant DNA methodology. Generally this
involves
creating a DNA sequence that encodes the fusion protein, placing the DNA in an
expression cassette under the control of a particular promoter, expressing the
protein in a
host, isolating the expressed protein and, if required, renaturing the
protein.
In one embodiment, the ribonucleases of the invention are fused in frame to
single chain antibodies. For tumor cell killing, the antibodies typically
specifically bind to
a target on the tumor cell. In other embodiment, the fusion proteins comprise
a ligand
which binds to a receptor on a tumor cell. For exampleY hCG binds and is
cytotoxic to
Kaposi's Sarcoma cells. By making a fusion protein comprising hCG and the
ribonucleases of this invention, a compound that binds to the tumor cells and
is more
cytotoxic than hCG alone can be achieved.
DNA encoding the fusion proteins of this invention, as well as the
recombinant RNAse molecules themselves, may be prepared by any suitable
method,
including, for example, cloning and restriction of appropriate sequences or
direct chemical
synthesis by methods such as the phosphotriester method of Narang, et al.
Meth. Enzymol.
68:90-99 (1979); the phosphodiester method of Brown, et al., Meth. Enzymol.
68:109-I S l
(1979); the diethylphosphoramidite method of Beaucage, et al., Tetra. Lett.
22:1859-1862
(1981); and the solid support method of U.S. Patent No. 4,458,066.
In a preferred embodiment, DNA encoding fusion proteins or recombinant
RNAse proteins of the present invention may be cloned using DNA amplification
methods
such as polymerase chain reaction (PCR). If two molecules are joined together,
one of
skill will appreciate that the molecules may be separated by a peptide spacer
consisting of
one or more amino acids. Generally the spacer will have no specific biological
activity
other than to join the proteins or to preserve some minimum distance or other
spatial
relationship between them. However, the constituent amino acids of the spacer
may be
selected to influence some property of the molecule such as the folding, net
chargc, or
hydrophobicity.
The nucleic acid sequences encoding the recombinant RNAse molecules or
the fusion proteins may be expressed in a variety of host cells, including E.
coli, other
bacterial hosts, yeast, and various higher eukaryotic cells such as the COS;
CHO and HcLa
CA 02401916 2002-09-19
33
cell lines and myeloma cell lines. The recombinant protein gene will be
operably linked
to appropriate expression control sequences for each host. For E. coli, this
includes a
promoter such as the T7, trp, or lambda promoters, a ribosome binding site and
preferably
a transcription termination signal. For eukaryotic cells, the control
sequences will include
a promoter and preferably an enhancer derived from immunoglobulin genes, SV40,
cytomegalovirus, etc., and a polyadenylation sequence, and may also include
splice donor
and acceptor sequences.
The expression vectors or plasmids of the invcntion can be transferred into
the chosen host cell by well-known methods such as calcium chloride
transformation for
E. coli and calcium phosphate treatment or electroporation for mammalian
cells. Cells
transformed by the plasrriids can be selected by resistance to antibiotics
conferred by genes
contained on the plasmids, such as the amp, gpt, neo and hyg genes.
Once expressed, the recombinant RNAse or fusion proteins can be purified
according to standard procedures of the art, as described above, including
ammonium
sulfate precipitation, affinity columns, column chromatography, gel
electrophoresis and the
like (see, generally, R. Scopes, PROTEIN PUR1F1CATION, Springer-Verlag, N.Y.
(1982),
Deutscher, METHODS IN EN2YMOLOGY VOL. 182: Guide to Protein Purification.,
Academic Press, Inc. N.Y. (1990)). Substantially pure compositions of at least
about 90
to 95% homogeneity are preferred, and 98 to 99% or more homogeneity are most
preferred for pharmaceutical uses. Once purified, partially or to homogeneity
as desired,
the polypeptides may then be used therapeutically.
VIII. Uses of RNAse
The molecules of this invention, both the fusion proteins and RNAse alone
can be used for a variety of uses.
A. Anti-Tumor Drug
The RNAse molecules are uniquely adapted for gene therapy applications.
They can be fused to other therapeutic agents, for example, they could be
fused to an anti-
B cell lymphoma antibody, an anti-transfertin receptor antibody or an anti-
colon cancer
antibody. As mentioned above, native Onconase~ has anti-tumor effects in vivo
and
preferentially kills rapidly dividing cells stimulated by serum or growth
promoting agents
CA 02401916 2002-09-19
34
such as ras. The RNAses of this invention can be used in a similar manner. The
RNAses
of this invention are readily internalized in the cell. Their activity can be
further
facilitated by joining them to a nuclear localization signal (NLS) and the
like to redirect
the molecules within the cell. Of particular use in tumor cells would be to
target
telomerase, an enzyme subject to degradation by ribonuclease.
Telomerase is being investigated as a "universal cancer target." It is an
RNA protein that is located in the nucleus. It has been shown that antisense
to telomerase
RNA can inhibit the function of the enzyme and block the growth of cancer
cells (Feng,
et al., Science 269:123'6 (1995)). Previous studies have shown RNase can
destroy the
activity of the enzyme .when incubated with a cell extract containing
telomerase. Thus a
RNAse molecule can be made, which when administered to a person with cancer,
would
be routed to the nucleus of cells.
In a gene therapy protocol, a vector containing an expression cassette which
encodes for the RNAses of this invention can be used either to infect cells ex
vivo, for
example hematopoietic cells in lymphoma or leukemia, or to infect cells in
vitro.
Recently, there has been a lot of activity in synthesizing retroviral vectors
with chimeric
coat proieins. The chimeric proteins typically comprise two domains, one of
which is
embedded in the viral coat and is of retroviral origin. The second domain is
heterologous
to the virus and is a member of a binding pair. For example, the second domain
consists
of a single chain Fv fragment which binds to a tumor cell surface marker or it
is the
ligand to which an antibody expressed on the cell surface binds. Other binding
pairs, not
necessarily monoclonal antibodies and their ligands will be apparent to those
of skill.
Studies with Onconase~ have indicated other potential uses. It has been
found that Onconase~ synergizes with ras in microinjection studies. Onconase~
does not
synergize with ras when it enters the cell via its own routing but requires a
CAAX motif
to localize ras at the plasma membrane (C~ys, A = an aliphatic amino acid, X =
S,M,C,A, or Q, an example is Cys-Val-Ile-Met (SEQ ID N0:29)). Importantly this
type
of sequence has been shown to target heterologous proteins to the plasma
membrane
(Hancock, J., et al., EMBO J. 10:4033 (1991)). The RNAses of this invention
have
identical uses.
CA 02401916 2002-09-19
B. Targeted Fusion Proteins
The RNAses of this invention can be joined to a ligand binding moiety that
is specific for tumor cells. Examples of such ligand binding moieties include,
but are not
limited to, monoclonal antibodies directed against tumor cell markers such as
heregulin,
5 CD22, PSA, etc.; cytokines that target tumor cells, such as tumor necrosis
factor; and
other tumor cell binding proteins, including hCG.
In addition; one of skill will recognize that two cytotoxic factors can be
joined to one ligand binding moiety. For example, the RNAses of this invention
can be
joined to a monoclonal antibody directed against a tumor cell marker which is
also joined
10 to a synthetic drug with cytotoxic activity, such as paclitaxel or
methotrexate.
Finally, the fusion proteins of this invention find use as cytotoxic agents
against cells other than tumor cells. For example, the RNAses of this
invention are joined
to ligand binding moieties that specifically target B cells which secrete
antibodies directed
against self. Thus, the RNAses of this invention are useful in the treatment
of
15 autoimmune diseases.
IX. Pharmaceutical Compositions
The molecules and fusion proteins employing them of this invention are
useful for parenteral, topical, oral, or local administration, such as by
aerosol or
20 transdermally, for prophylactic and/or therapeutic treatment. The
pharmaceutical
compositions can be administered in a variety of unit dosage forms depending
upon the
method of administration. For example, unit dosage forms suitable for oral
administration
include powder, tablets, pills, capsules and lozenges. It is recognized that
the subject
molecules and fusion proteins and pharmaceutical compositions of this
invention, when
25 administered orally, must be protected from digestion. This is typically
accomplished
either by complexing the protein with a composition to render it resistant to
acidic and
enzymatic hydrolysis or by packaging the protein in an appropriately resistant
carrier such
as a liposome. Means of protecting proteins from digestion are well known in
the art.
The pharmaceutical compositions of this invention are particularly useful for
30 parenteral administration, such as intravenous administration or
administration into a body
cavity or lumen of an organ. The compositions for administration will commonly
comprise a solution of the chimeric molecule dissolved in a pharmaceutically
acceptable
CA 02401916 2002-09-19
36
carrier, preferably an aqueous carrier. A variety of aqueous carriers can be
used, e.g.,
buffered saline and the like. These solutions are sterile and generally free
of undesirable
matter. These compositions may be sterilized~by conventional, well known
sterilization
techniques. The compositions may contain pharmaceutically acceptable auxiliary
substances as required to approximate physiological conditions such as pH
adjusting and
buffering agents, toxicity adjusting agents and the like, for example, sodium
acetate,
sodium chloride, potassium chloride, calcium chloride, sodium lactate and the
like. The
concentration of therapeutic molecule in these formulations can vary widely,
and will be
selected primarily based on fluid volumes, viscosities, body weight and the
like in
accordance with the particular mode of administration selected and the
patient's needs.
Thus, a typical pharmaceutical composition for intravenous administration
would be about 0.1 mg to IO mg per patient per day. Dosages from 0.1 mg up to
about
100 mg per patient per day may be used, particularly when the drug is
administered to a
secluded site and not into the blood stream, such as into a body cavity or
into a lumen of
an organ. Actual methods for preparing parenterally administrable compositions
will be
known or apparent to those skilled in the art and are described in more detail
in such
publications as 1ZEMINGTON'S PHARMACEUTICAL SCIENCE, I Sth ed., Mack
Publishing
Company, Easton, Pennsylvania (1980).
The compositions containing the present recombinant RNAse molecules or
the fusion proteins or a cocktail thereof (i.e., with other proteins) can be
administered far
therapeutic treatments. In therapeutic applications, compositions are
administered to a
patient suffering from a disease, in a cytotoxic amount, an amount sufficient
to kill cells of
interest. An amount adequate to accomplish this is defined as a
"therapeutically effective
dose." Amounts effective for this use will depend upon the severity of the
disease and the
general state of the patient's health.
Single or multiple administrations of the compositions may be administered
depending on the dosage and frequency as required and tolerated by the
patient. In any
event, the composition should provide a sufficient quantity of the proteins of
this invention
to effectively treat the patient.
Although the present invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding, it will be
obvious that
CA 02401916 2002-09-19
37
certain changes and modifications may be practiced within the scope of the
appended
claims.
X. Examples
A. Example l: Expression Pattern of RNAse in Rana pipiens Tissues
A DNA sequence corresponding to amino acid residues 16-98 of
Onconase~ was cloned by PCR amplification of Rana pipiens genomic DNA and
sequenced. The sequence, consisting of 252 by of DNA encoding the ribonuclease
was
designated Rana clone 9. Total cellular RNA was isolated from either male or
female Rana. pipiens tissues using RNA STAT-60 (TEL-TEST "B", Ine.) according
to the
manufacturer's protocol. Poly A+ containing mRNA was prepared using an
Oligotex
mRNA kit (Qiagen). Poly (A+) RNA was size fractionated on a 1 % agarose gel
containing 6% formaldehyde and blotted onto Nitran~ nylon membranes
(Schleicher &
Schuell) in lOX SSC overnight. The membrane was rinsed in ZX SSC for 5 min,
air dried
and the RNA was cross linked to the membrane by exposure to UV light (Ultra-
Lum) for
2 min. The RNA blot was hybridized at 42°C for 16-18 hours with a (3zP]-
labeled DNA
probe prepared from 30 ng of Rana clone 9 insert using the oligo labeling kit
from
Amersham. After hybridization, the RNA blot was washed twice in 1X SSC, 1% SDS
for
min at 42°G. The blot was exposed to X-ray film for 4 days. The
molecular size of
20 mRNA was estimated using 0.24-9.5 kb RNA molecular weight markers (BRL).
Since Onconase~tl is isolated in large quantities from the oocytes of Rana
pipiens, it was assumed that high levels of RNAse RNA would be present in the
mRNA
from oocytes. Surprisingly, mRNA reacting with Rana clone 9 was not detected
in Rana
pipiens oocyte, heart, lung and kidney tissues. The only mRNA signal detected
with Rana
clone 9 was a strongly hybridizing 3.6 kb RNA in mRNA isolated from Rar:a
pipiens
liver. As a protocol control, the same northern blot was probed with a (3zP]-
labeled
human actin cDNA. Actin mRNA was detectable in all of the tissues. In another
northern
analysis with four-fold more liver poly (A+) mRNA, a second weakly hybridizing
mRNA
of about 950 by was detected.
To confirm that RNAse mRNA was present in Rana pipiens liver but not in
oocytes, RT-PCR was performed using total RNA isolated from Rana pipiens liver
and
oocytes and with the degenerate primers used in the cloning of the Rana clone
9 insert.
CA 02401916 2002-09-19
38
Total RNA was isolated from Rana pipiens liver and oocytes. The
procedure of Chen, et al., Oncogene 12:741 (1996) was used. Briefly, PCR was
carried
out under the following conditions: 94°C for 5 minutes and then 30
cycles of denaturation
at 94°C for 1 min, annealing for 2 min at 55°C, and primer
extension for 1 min at 72°C.
The degenerate forward primer used [(5'-
AG(GA)GATGT(GT)GATTG(TC)GATAA(CT)ATCATG-3' (SEQ ID NO:30)] with the
reverse degenerate primer [5'-
AAA(GA)TG(CA)AC(AT)GG(TG)GCCTG(GA)TT(CT)TCACA-3' (SEQ ID N0:31)].
The PCR products were analyzed on a 1.5% agarose gel and stained with
ethidium bromide. the PCR product obtained from liver was subcloned into PCR3
vector
by TA cloning (Invitrogen) and sequenced.
A band of the expected size of about 254 by was. generated in the liver
RNA but not oocyte RNA, consistent with the result from northern blot
analysis. To
ensure that the 250 by band represented RNAse cDNA, this PCR product was
subcloned
and its DNA sequence determined with the Sequenase v. 2.0 kit (United States
Biochemical).
Bases 1, 7, 13, 23 and 235 of the PCR product differed from the sequence
of Rana clone 9. With the exception of the change at base 23, all of the other
base
changes were within the degenerate primer sequences. The difference at base 23
is an A
to T transition which results in conservative amino acid change from threonine
to serine,
and could be due to polymorphism of the RNAse gene or a PCR error.
B. Example 2: Expression of RNAse in Rana pipiens
To determine if RNAse is present in Rana pipiens oocytes or other tissues,
protein extracts were isolated from various Rana pipiens tissues and separated
on a 4-20%
Tris-Glycine SDS- containing polyacrylamide gel. The protein extracts were
transferred to
a nitrocellulose membrane using 1 X transfer buffer (Novagen) at 250 mA for 45
min. The
membrane was probed with primary and secondary antibodies as described in
Chen, et al.,
Oncogene 12:241 ( 1996). The primary anti-Onconase~ antibody was used at 1:100
dilution. The detecting antibody (horseradish peroxidase labeled.donkey anti-
rabbit Ig
(Amersham)) was used at 1:2500 dilution. The antibodies were visualized using
an ECL
detection kit from Amersham.
CA 02401916 2002-09-19
39
The western blot analysis demonstrated that a protein of the correct size (12
kDa) was present in extracts from oocytes. Other tissues, including liver, did
not contain a
12 kDa protein that reacted with the anti-Onconase~ antibody. High molecular
weight
bands were also observed. These represented other forms of Onconase~ (e.g.,
glycosylated or multimeric) or represented related members of the pancreatic
ribonuclease
A amphibian superfamily. It had been previously determined that the anti-
Onconase~
antibody cross reacts with other pancreatic type RNAses such as bovine
pancreatic
ribonuclease as well as two human RNAses; eosinophil-derived neurotoxin and
angiogenin.
C. Example 3: Isolation and cloning of cDNA from Rana pipiens liver mRNA
Liver poly (A+) RNA was purified twice using the poly (A+) Pure kit
(Ambion). The cDNA library was constructed using a ZAP-cDNA synthesis kit. and
Gigapack II gold packaging extracts according to the manufacturer's protocol
(Stratagene).
The library contained about 1.5 x 106 pfu from 5 pg of liver poly (A+) RNA and
was
amplified once according to Stratagene's protocol. The library titer after
amplification was
9 x 109 pfu/mL. About 3 x 105 plaques were screened by using a (3iP]-labeled
insert of
Rana clone 9 following Stratagene's procedure. Positive clones (3alb, 4alb and
Salb)
were excised from the lambda ZAP II vector and subcloned into pBluescript SF-
vector.
Plasmid DNA was prepared using the Qiagen spin plasmid miniprep kit.
Clone Salb was digested with KpnI and HindIII to generate 3' and 5'
protruding ends, and digested with exonuclease III to generate Salb deletion
clones.
Overlapping deletions were generated according to the manufacturer's
instructions with the
Erase-a-Base system (Promega). The size of DNA inserts from the deletion
clones were
estimated from agarose gel analysis, and the selected clones were sequenced
using the T7
promoter primer. The cDNA of clone 4alb, the 5' end of clone 3alb and part of
the
clone Salb were sequenced using T3, T7 and appropriate primers. All the
sequencing
reactions were performed using the Sequenase v. 2.0 kit (United States
Biochemical) and
a-(35S] dATP (>1000 Ci/mmole, Amersham). Both strands of clone Salb were
sequenced.
Clone 5alb cDNA (SEQ ID N0:27) which was about 2.8 kb in size,
contained an open reading frame (ORF) at the 5' end. The deduced amino acids
at
positions 1-23 were characteristic of a signal peptide with a charged amino
acid within the
CA 02401916 2002-09-19
first 5 amino acids, a stretch of at least 9 hydrophobic amino acids to span
the membrane,
and a cysteine at position 23. The putative signal peptide sequence was
followed by a
highly conserved but not identical amino acid sequence compared to Onconase~.
There
were four amino acid differences between the ORF of clone Salb and Onconase~
5 including amino acid residues 11, 20, 85 and 103. With the exception of a
conservative
change at amino acid residue 11, all the other amino acid conversions are
between polar
and charged amino acid residues.
D. Example 9: Cloning and Expression of RaPLRI
10 Oligonucleotide primers were designed to clone the cDNA sequence of Rana
pipiens liver
RNAse (RaPLRl) as a [met-1] fusion protein as well as to modify the primary
amino acid
structure by changing the N-terminal amino acid residue following the
initiating
m~thionine from glutamine to serine ([Met-(-1)]RaPLRl(Q1S). Thus, the
recombinant
RNAses obtained from the bacteria in this expression system contain an extra
methionine
15 at the amino terminal end [Met-(-1)].
Amplification of these sequences was carried out in a thermal cycler and the
DNA was cloned into an expression vector using methodology previously
described in
Newton, et al., . The plasmids were expressed in B121 (DE3) E. coli and the
recombinant
proteins were isolated from inclusion bodies as described (Newton, et al.,
supra) before
20 being applied to a CM Sephadex C-50 column. Final purification to
homogeneity as
assessed by gel electrophoresis was achieved by size exclusion chromatography.
E. Example S: Assembly of Synthetic RaCORI Gene
The following oligonucleotides were synthesized:
ZS 5'-CAGAACTGGGCTACTTTCCAGFCAGAAACATATCATCAACACTCCGATCATCT
G CAACACTATCATGGACAACAACATCTACATCGTTGGTGGTCAG-3' (SEQ ID
N0:~2)
5'-TACATCGTTGGTGGTCAGTGCAAACGTGTTAACACTTTCATCATCTCTCTGCTA
30 CTACTGTTAAACGTATCTGCACTGGTGTTATC-3 (SEQ ID N0:33)
CA 02401916 2002-09-19
41
5'-ATCTGCACTGGTGTTACTAACATGAACGTTCTGTCTACTACTCGTTTCCAGCTG
AACACTTGCACTCGTACTTCTATCACTCCGCGTCCGTGCCCG-3 (SEQ ID N0:34)
5'-GTTGATAACACCAGTGCAGAT-3' (SEQ ID N0:35)
5'-ATCTGCACTGGTGTTATCAAC-3' (SEQ ID N0:3b)
5'-ACTCCGCGTCCGTGCCCGTACTCTTCTCGTACTGAAACTAACTACATCTGCGTT
AAATGCGAAAACCAGTACCCGGTTCATTTCGCTGGTATCGG-3' (SEQ ID N0:37)
5'-ATATATCTAGAAATAATTTTATTTAACTTTAAGAAGGAGATATACATATGCAG
A ACTGGGCTACTTTCCAG-3' (SEQ >D N0:38)
5'-CGCGCCGGATCCCTACTACGGGCAACGACCGATACCAGCGAAATGAAC-3'
IS (SEQ m N0:39)
5'-CAGAACTGGGCTACTTTCCAGCAGAAACATATCATCAACACTCCGATCATCTG
CAACACTATCCTGCAGAACAACATCTACATCGTTGGTGGTCAG-3' (SEQ ID
NO:40)
S'-ATCTGCACTGGTGTTATCAACCTGAACGTTCTGTCTACTACTCGTTTCCAGCTG
AACACTTGCACTCGTACTTCTATCACTCCGCGTCCGTGCCCG-3' (SEQ ID 10:41 )
PCR reactions were performed containing:
1 X reaction buffer ( 100 mM Tris-HCI, pH 8.3, 500 mM KCI, 1.5 mM MgClz);
0.4 mM nucleotides;
5.0 units Amplitaq~ DNA polymerise;
0.5 pM oligonucleotides (SEQ ID N0:32-41 ) in the combinations listed below;
and
water to adjust to 100 pL final volume.
The thermal cycler conditions were as follows: 94°C for 5 min
preincubation then 20
cycles at 94°C for 1 min; 55° for 2 min; and 72°C for 2
min. The first PCR reaction
contained SEQ ID N0:32, 33~ and 35, which comprised the S' half of the RNAse
gene.
CA 02401916 2002-09-19
42
The second PCR reaction contained SEQ ID N0:34, 36, and 37 which comprised the
3'
half of the gene. For the proteins wherein positions corresponding to
positions 22 and 57
of SEQ ID NO:15 were changed to leucines, the first reaction was with SEQ ID
N0:33,
35 and 38 to synthesize the 5' half of the gene and the second was with SEQ ID
N0:36,
37 and 38 to synthesize the 3' half of the gene.
The PCR products were purified using the Genecleant~ II kit from Bio 101,
Inc. Vista, CA) according to the manufacturer's instructions. The following
PCR reactions
were performed under conditions as above to assemble the complete gene as
shown in
Figure 1. To assemble the non-mutated gene, SEQ ID N0:38 and 39 were added to
the
purified PCR products. To assemble the gene with the methionine to leucine
mutation,
SEQ ID N0:40 and 41 were used.
The assembled genes were purified by the GeneClean~ procedwe, cleaved
with th_e endonucleases,XbaI and BamHI overnight and ligated into the pET-Ild
vector.
The DNA was sequences, expressed and the protein purified as described in
Newton, et
al., Biochemistry 35:545 (1996). The nucleotide sequence of the non-mutated
synthetic
gene is shown in SEQ ID N0:14. The amino acid sequence of the gene product is
as
shown in SEQ ID NO:IS.
The clone containing the mutations was subsequently modified by PCR to
insert an NdeI restriction site for ligation into the pET-ISb vector (which
encodes a six
histidine tag as well as a thrombin cleavage site at the 5' end of the
expression cassette
insertion point) by using primers as shown in SEQ ID NO:39 and
5'-GGATTCCATATGCAGAACTGGGCTATT1'TCCAG-3' (SEQ ID N0:42). The PCR
methods were as shown above.
F. Example 6: Purification of RNAse with Mutations
The purified Rana catesbeiana proteins of Example 5 contained a six
histidine tail at the N-terminus. The protein was treated with CNBr as
described by Gross
& Witkop, J. Biol. Chem. 237:1855 (1952). In brief, the protein (dissolved in
0.1 N HCl)
was treated with 100-fold molar excess of CNBr for 24 hours at ambient
temperature.
CNBr cleaves on the carboxyl side of methionine residues; the mutated protein
contains
only one methionine at the 1 position. The CNBr was removed by lyophilization
and the
protein dissolved in 0.1 M Tris-HCI, pH 7.5. The soluble protein was applied
to a Ni2+-
CA 02401916 2002-09-19
43
NTA agarose column (Qiagen) to remove the uncleaved protein from the +1 Gln
cleaved
protein. The His tail bound to the Ni2+-NTA column and the cleaved RNAse was
found in
the flow-through. Elution of the column yielded the His-containing cleavage
product and
non-cleaved (His)6 (SEQ ID N0:43) containing protein. Densitomeiry analysis of
cleaved
and non-cleaved protein demonstrated that SO% of the protein was cleaved by
CNBr.
The mutated protein was allowed to cyclize at the N-terminus to form
pyroglutamic acid by dialysis in 0.2 M KP04 buffer. An amino end group
analysis was
performed to ensure the presence of a blocked NH2-terminus.
G. Example 7; Analysis of RNAse Activity
The methods used to assay the recombinant RNAses of this invention were
done as described in Newton, et al., Protein Engineering 10:463 (1997).
Briefly,
ribonuclease activity using high molecular weight RNA and tRNA was determined
at 37°C
by monitoring the formation of perchloric acid-soluble nucleotides. The buffer
was 0.16
M Tris-HCI, pH 7.5 with 1.6 mM EDTA and 0.2 mg/mL human serum albumin (HSA).
Ribonuclease activity was assayed according to DePrisco, et al., Biochemica et
Biophysica
Acta 788:356 (1984) and Libonati & Floridi, Eur. J. Biochem. 8:81 (1969) by
measuring
the increase with time in absorbance at 260 nm. Incubation mixtures (1 mL of
10 mM
imidazole, 0.1 M NaCI, pH 7.0) contained substrate and appropriate amounts of
enzyme
solution at 25°C. Final substrate concentration in the assays was 0.33
mg/mL tRNA.
Each assay was repeated 2-6 times and the average value was used in data
treatment.
Kinetic parameters were obtained with the aid of the data analysis program of
Cleland,
Methods of Enzymol. 63:103 (I979).
The results of the assay is shown in Table I.
CA 02401916 2002-09-19
44
Table I. Ribonuclease Activity
RNAse Activity
RNAse ~ (units/mg protein)Fold Increase
native Onconase~ 9
recombinant Rana catesbeiana RNAse 200 22
recombinant Onconase~ (Q1S) 1.5
recombinant Rana pipiens RNAse (Q1S) 2.5 1.7
The cytotoxicity of the RNAses of this invention was determined by
measuring the protein synthesis of tumor cells in the presence of the RNAsc.
Protein
synthesis was measured as previously described in Rybak, et al., J. Biol.
Chem.266:21202
(1991). 0.1 mL of cells (2.5 x. 104 cells/mL) were platcd into 96-well
microtiter plates in
Dulbecco's Minimum Essential Medium supplement with ZO% heat-inactivated fetal
bovine serum (e-FBS); additions were made in a total volume of 10 pL; and the
plates
were incubated at 37°C for the times indicated. Phosphate-buffered
saline (PBS)
containing 0.1 mCi of ['4C]-leucine was added for 2-4 hours, and the cells
were harvested
onto glass fiber filters using a PHIL cell harvester, washed with water, dried
with ethanol
and counted in a scintillation counter. The results are expressed in Table II
as percent of
['"C]-leucine incorporation in the mock-treated wells.
Recombinant Onconase~l with a methionine at the 1 position was not very
cytotoxic since correct hydrogen bonding at the active site is fostered by the
pyroglutamic
acid N-terminus of the native protein (Newton, et al., Protein Engineering
10:463 (1997)).
In the four human tumor cell lines tested, the recombinant Rana pipiens liver
RNAses
were more active than recombinant Onconase~. It appears that the four amino
acid
differences in RaPLRl change the active site configuration such that is does
not display
the degree of dependence Onconase~ has on the N-terminal pyroglutamic acid
residue for
correct hydrogen bonding at the active site.
Similarly, RaCORl was also more cytotoxic than recombinant Onconasec~.
Again, most likely this is due to an active site that is not dependent on the
N-terminal
pyroglutamic acid for correct hydrogen bonding.
CA 02401916 2002-09-19
as
H
O p N M ~ N N
(i, N
i.r
O
U
M V1 O C O
M
r, N .~ .-
O
H
'D V
O p O 00 ~ M
G4 ir t~ A r, M
r.a
O
00
a h
U
d
H
b
M ~ M
W H ~ A 0 d'
A ...
R a
R
O O
E O ~ O O
M M M
a~ . N oo r1 v1
i.
w
O
v C
O
O p O O O O
O O
O N M Ir p M
w N n
N N
is ~
,7a O . ~ N O
~r
O
O~
' '_' v~ U ~'" U
..,.~." ~n c0
U ~ x Q
CA 02401916 2002-09-19
46
It is understood that the examples and embodiments described herein are for
illustrative purposes only and that various modifications or changes in Iight
thereof will be
suggested to persons skilled in the art and are to be included within the
spirit and purview
of this application and scope of the appended claims.
CA 02401916 2002-09-19
47
SEQUENCE LISTING
<110> The United States of America
as represented by The Secretary of the
Department of Health and Human Services
<120> Recombinant Anti-Tumor RNase
<130> 40330-1664D
<140>
<141>
<150> CA 2,324,646
<151> 1999-03-26
<150> US 60/079,751
<151> 1998-03-27
<160> 43
<170> PatentIn Ver. 2.0
<210> 1
<211> 312
<212> DNA
<213> Rana pipiens
<220>
<221> CDS
<222> (1)..(312)
<223> ribonuclease (RaPLRl)
<400> 1
caa gac tgg ctt acg ttt cag aag aag cac ctg aca aac acc cgg gat 48
Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg Asp
1 5 10 15
gtt gac tgt aat att atc atg tca aca aac ttg ttc cac tgc aag gac 96
Val Asp Cys Asn Ile Ile Met Ser Thr Asn Leu Phe His Cys Lys Asp
20 25 30
aag aac act ttt atc tat tca cgt cct gag cca gtg aag gcc atc tgt 144
Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile Cys
35 40 45
aaa gga att ata gcc tcc aaa aat gtg tta act acc tct gag ttt tat 192
Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe Tyr
50 55 60
ctc tct gat tgc aat gta aca agc agg cct tgc aag tat aaa tta aag 240
Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu Lys
65 70 75 80
aaa tca act aat aca ttt tgt gta act tgt gag aat caa get cca gta 288
Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro Val
85 90 95
cat ttc gtg ggt gtc gga cat tgc 312
His Phe Val Gly Val Gly His Cys
100
CA 02401916 2002-09-19
48
<210> 2
<211> 104
<212> PRT
<213> Rana pipiens
<400> 2
Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg Asp
1 5 10 15
Val Asp Cys Asn Tle Ile Met Sex Thr Asn Leu Phe His Cys Lys Asp
20 25 30
Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile Cys
35 40 45
Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe Tyr
50 55 60
Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu Lys
65 70 75 80
Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro Val
85 90 95
His Phe Val Gly Val Gly His Cys
100
<210> 3
<211> 312
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana pipiens
ribonuclease with Met23Leu substitution
(recombinant RaPLRl Met23Leu)
<220>
<221> CDS
<222> (1) . . (312)
<223> RaPLRl Met23Leu
<400> 3
caa gac tgg ctt acg ttt cag aag aag cac ctg aca aac acc cgg gat 48
Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg Asp
1 5 10 15
gtt gac tgt aat aat atc ctg tca aca aac ttg ttc cac tgc aag gac 96
Val Asp Cys Asn Asn Ile Leu Ser Thr Asn Leu Phe His Cys Lys Asp
20 25 30
aag aac act ttt atc tat tca cgt cct gag cca gtg aag gcc atc tgt 144
Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile Cys
35 40 45
aaa gga att ata gcc tcc aaa aat gtg tta act acc ttt gag ttt tat 192
Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Phe Glu Phe Tyr
50 55 60
CA 02401916 2002-09-19
49
ctc tct gat tgc aat gta aca agc agg cct tgc aag tat aaa tta aag 240
Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu Lys
65 70 75 80
aaa tca act aat aca ttt tgt gta act tgt gag aat caa get cca gta 288
Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro Val
85 90 95
cat ttc gtg ggt gtc gga cat tgc 312
His Phe Val Gly Val Gly His Cys
100
<210> 4
<211> 104
<212> PRT
<213> Artificial Sequence
<400> 4
Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg Asp
1 5 10 15
Val Asp Cys Asn Asn Ile Leu Ser Thr Asn Leu Phe His Cys Lys Asp
20 25 30
Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile Cys
35 40 45
Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Phe Glu Phe Tyr
50 55 60
Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu Lys
65 70 75 80
Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro Val
85 90 95
His Phe Val Gly Val Gly His Cys
100
<210> 5
<211> 315
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana pipiens
ribonuclease with Met at position 1 (recombinant
Met(-1) RaPLRI)
<220>
<221> CDS
<222> (1)..(315)
<223> Met(-1) RaPLRI
<400> 5
atg caa gac tgg ctt acg ttt cag aag aag cac ctg aca aac acc cgg 48
Met Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg
1 5 10 15
CA 02401916 2002-09-19
gat gtt gac tgt aat aat atc atg tca aca aac ttg ttc cac tgc aag 96
Asp Val Asp Cys Asn Asn Ile Met Ser Thr Asn Leu Phe His Cys Lys
20 25 30
gac aag aac act ttt atc tat tca cgt cct gag cca gtg aag gcc atc 144
Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile
35 40 45
tgt aaa gga att ata gcc tcc aaa aat gtg tta act acc tct gag ttt 192
Cys Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe
50 55 60
tat ctc tct gat tgc aat gta aca agc agg cct tgc aag tat aaa tta 240
Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu
65 70 75 80
aag aaa tca act aat aca ttt tgt gta act tgt gag aat caa get cca 288
Lys Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro
85 90 95
gta cat ttc gtg ggt gtc gga cat tgc 315
Val His Phe Val Gly Val Gly His Cys
100 105
<210> 6
<211> 105
<212> PRT
<213> Artificial Sequence
<400> 6
Met Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg
1 5 10 15
Asp Val Asp Cys Asn Asn Ile Met Ser Thr Asn Leu Phe His Cys Lys
20 25 30
Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile
35 40 45
Cys Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe
50 55 60
Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu
65 70 75 80
Lys Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro
85 90 95
Val His Phe Val Gly Val Gly His Cys
100 105
<210> 7
<211> 315
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana pipiens
ribonuclease with Met at position 1 and Met24Leu
substitution (recombinant Met(-1) RaPLRl Met23Leu)
CA 02401916 2002-09-19
51
<220>
<221> CDS
<222> (1) . . (315)
<223> Met(-1) RaPLRl Met23Leu
<400> 7
atg caa gac tgg ctt acg ttt cag aag aag cac ctg aca aac acc cgg 48
Met Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg
1 5 10 15
gat gtt gac tgt aat aat atc ctg tca aca aac ttg ttc cac tgc aag 96
Asp Val Asp Cys Asn Asn Ile Leu Ser Thr Asn Leu Phe His Cys Lys
20 25 30
gac aag aac act ttt atc tat tca cgt cct gag cca gtg aag gcc atc 144
Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile
35 40 45
tgt aaa gga att ata gcc tcc aaa aat gtg tta act acc ttt gag ttt 192
Cys Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Phe Glu Phe
50 55 60
tat ctc tct gat tgc aat gta aca agc agg cct tgc aag tat aaa tta 240
Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu
65 70 75 80
aag aaa tca act att aca ttt tgt gta act tgt gag aat caa get cca 288
Lys Lys Ser Thr Ile Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro
85 90 95
gta cat ttc gtg ggt gtc gga cat tgc 315
Val His Phe Val Gly Val Gly His Cys
100 105
<210> 8
<211> 105
<212> PRT
<213> Artificial Sequence
<400> 8
Met Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg
1 5 10 15
Asp Val Asp Cys Asn Asn Ile Leu Ser Thr Asn Leu Phe His Cys Lys
20 25 30
Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile
35 40 45
Cys Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Phe Glu Phe
50 55 60
Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu
65 70 75 80
Lys Lys Ser Thr Ile Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro
85 90 95
CA 02401916 2002-09-19
52
Val His Phe Val Gly Val Gly His Cys
100 105
<210> 9
<211> 111
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana pipiens
ribonuclease with (His)6 tag, Met at position 7
and Met30Leu substitution (recombinant Met(-1)
RaPLRl Met23Leu-(His)6)
<400> 9
His His His His His His Met Gln Asp Trp Leu Thr Phe Gln Lys Lys
1 5 10 15
His Leu Thr Asn Thr Arg Asp Val Asp Cys Asn Asn Ile Leu Ser Thr
20 25 30
Asn Leu Phe His Cys Lys Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro
35 40 45
Glu Pro Val Lys Ala Ile Cys Lys Gly Ile IIe Ala Ser Lys Asn Val
50 55 60
Leu Thr Thr Phe Glu Phe Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg
65 70 75 80
Pro Cys Lys Tyr Lys Leu Lys Lys Ser Thr Ile Thr Phe Cys Val Thr
85 90 95
Cys Glu Asn Gln Ala Pro Val His Phe Val Gly Val Gly His Cys
100 105 110
<210> 10
<211> 312
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana pipiens
ribonuclease with GlnlSer substitution
(recombinant RaPLRI Q1S)
<220>
<221> CDS
<222> (1)..(312)
<223> RaPLRl Q1S
<400> 10
tca gac tgg ctt acg ttt cag aag aag cac ctg aca aac acc cgg gat 48
Ser Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg Asp
1 5 10 15
gtt gac tgt aat aat atc atg tca aca aac ttg ttc cac tgc aag gac 96
Val Asp Cys Asn Asn Ile Met Ser Thr Asn Leu Phe His Cys Lys Asp
20 25 30
CA 02401916 2002-09-19
53
aag aac act ttt atc tat tca cgt cct gag cca gtg aag gcc atc tgt 144
Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile Cys
35 40 45
aaa gga att ata gcc tcc aaa aat gtg tta act acc tct gag ttt tat 192
Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe Tyr
50 55 60
ctc tct gat tgc aat gta aca agc agg cct tgc aag tat aaa tta aag 240
Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu Lys
65 70 75 80
aaa tca act aat aca ttt tgt gta act tgt gag aat caa get cca gta 288
Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro Val
85 90 95
cat ttc gtg ggt gtc gga cat tgc 312
His Phe Val Gly Val Gly His Cys
100
<210> 11
<211> 104
<212> PRT
<213> Artificial Sequence
<400> 11
Ser Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg Asp
1 5 10 15
Val Asp Cys Asn Asn Ile Met Ser Thr Asn Leu Phe His Cys Lys Asp
20 25 30
Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile Cys
35 40 45
Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe Tyr
50 55 60
Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu Lys
65 70 75 80
Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro Val
85 90 95
His Phe Val Gly Val Gly His Cys
100
<210> 12
<211> 315
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana pipiens
ribonuclease with Met at position 1 and Gln2Ser
substitution (recombinant Met(-1) RaPLRl Q1S)
<220>
<221> CDS
<222> (1)..(315)
CA 02401916 2002-09-19
54
<223> Met(-1) RaPLRl Q1S
<400> 12
atg tca gac tgg ctt acg ttt cag aag aag cac ctg aca aac acc cgg 48
Met Ser Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg
1 5 10 15
gat gtt gac tgt aat aat atc atg tea aca aac ttg ttc cac tgc aag 96
Asp Val Asp Cys Asn Asn Ile Met Ser Thr Asn Leu Phe His Cys Lys
20 25 30
gac aag aac act ttt atc tat tca cgt cct gag cca gtg aag gcc atc 144
Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile
35 40 45
tgt aaa gga att ata gcc tcc aaa aat gtg tta act acc tct gag ttt 192
Cys Lys Gly IIe Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe
50 55 60
tat ctc tct gat tgc aat gta aca agc agg cct tgc aag tat aaa tta 240
Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu
65 70 75 80
aag aaa tca act aat aca ttt tgt gta act tgt gag aat caa get cca 288
Lys Lys Ser Thr Asn Thr Phe Cys Va1 Thr Cys Glu Asn Gln Ala Pro
85 90 95
gta cat ttc gtg ggt gtc gga cat tgc 315
Val His Phe Val Gly Val Gly His Cys
100 105
<210> 13
<211> 105
<212> PRT
<213> Artificial Sequence
<400> 13
Met Ser Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg
1 5 10 15
Asp Val Asp Cys Asn Asn Ile Met Ser Thr Asn Leu Phe His Cys Lys
20 25 30
Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile
35 40 45
Cys Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe
50 55 60
Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu
65 70 75 80
Lys Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro
85 90 95
Val His Phe Val Gly Val Gly His Cys
100 105
<210> 14
CA 02401916 2002-09-19
SS
<211> 330
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana oocyte ribonuclease (RaCORl) synthetic
gene modified to use E. coli preferred codons
<220>
<221> CDS
<222> (1) . . (330)
<223> RaCORl for E. coli expression system
<400> 14
cag aac tgg get act ttc cag cag aaa cat atc atc aac act ccg atc 48
Gln Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro Ile
1 5 10 15
atc tgc aac act atc atg gac aac aac atc tac atc gtt ggt ggt cag 96
Ile Cys Asn Thr Ile Met Asp Asn Asn Ile Tyr Ile Val Gly Gly Gln
20 25 30
tgc aaa cgt gtt aac act ttc atc atc tct tct get act act gtt aaa 144
Cys Lys Arg Val Asn Thr Phe Ile Ile Ser Sex Ala Thr Thr Val Lys
35 40 45
get atc tgc act ggt gtt atc aac atg aac gtt ctg tct act act cgt 192
Ala Ile Cys Thr Gly Val Ile Asn Met Asn Val Leu Ser Thr Thr Arg
50 55 60
ttc cag ctg aac act tgc act cgt act tct atc act ccg cgt ccg tgc 240
Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro Cys
65 70 75 80
ccg tac tct tct cgt act gaa act aac tac atc tgc gtt aaa tgc gaa 288
Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys Glu
85 90 95
aac cag tac ccg gtt cat ttc get ggt atc ggt cgt tgc ccg 330
Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 15
<211> 110
<212> PRT
<213> Artificial Sequence
<400> 15
Gln Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro Ile
1 5 10 15
Ile Cys Asn Thr Ile Met Asp Asn Asn Ile Tyr Ile Val Gly Gly Gln
20 25 30
Cys Lys Arg Val Asn Thr Phe Ile Ile Ser Ser Ala Thr Thr Val Lys
35 40 45
Ala Ile Cys Thr Gly Val Ile Asn Met Asn Val Leu Ser Thr Thr Arg
50 55 60
CA 02401916 2002-09-19
56
Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro Cys
65 70 75 80
Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys Glu
85 90 95
Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 16
<211> 333
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease with Met at position 1
(recombinant Met(-1) RaCORl)
<220>
<221> CDS
<222> (1)..(333)
<223> Met(-1) RaCORl
<400> 16
atg cag aac tgg get act ttc cag cag aaa cat atc atc aac act ccg 48
Met Gln Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro
1 5 10 15
atc atc tgc aac act atc atg gac aac aac atc tac atc gtt ggt ggt 96
Ile Ile Cys Asn Thr Ile Met Asp Asn Asn Ile Tyr Ile Val Gly Gly
20 25 30
cag tgc aaa cgt gtt acc act ttc atc atc tct tct get act act gtt 144
Gln Cys Lys Arg Val Thr Thr Phe Ile Ile Ser Ser Ala Thr Thr Val
35 40 45
aaa get atc tgc act ggt gtt atc aac atg aac gtt ctg tct act act 192
Lys Ala Ile Cys Thr Gly Val Ile Asn Met Asn Val Leu Ser Thr Thr
50 55 60
cgt ttc cag ctg aac act tgc act cgt act tct atc act ccg cgt ccg 240
Arg Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro
65 70 75 80
tgc ccg tac tct tct cgt act gaa act aac tac atc tgc gtt aaa tgc 288
Cys Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys
85 90 95
gaa aac cag tac ccg gtt cat ttc get ggt atc ggt cgt tgc ccg 333
Glu Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 17
<211> 111
<212> PRT
<213> Artificial Sequence
CA 02401916 2002-09-19
57
<400> 17
Met Gln Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro
1 5 10 15
Ile Ile Cys Asn Thr Ile Met Asp Asn Asn Ile Tyr Ile Val Gly Gly
20 25 30
Gln Cys Lys Arg Val Thr Thr Phe Ile Ile Ser Ser Ala Thr Thr Val
35 40 45
Lys Ala Ile Cys Thr Gly Val Ile Asn Met Asn Val Leu Ser Thr Thr
50 55 60
Arg Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro
65 70 75 80
Cys Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys
85 90 95
Glu Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 18
<211> 330
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:liana
catesbeiana ribonuclease with Met22Leu and
Met75Leu substitutions (recombinant RaCORi
Met22Leu Met57Leu)
<220>
<221> CDS
<222> (1) . . (330)
<223> RaCORl Met22Leu Met57Leu
<400> 18
cag aac tgg get act ttc cag cag aaa cat atc atc aaa act ccg atc 48
Gln Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Lys Thr Pro Ile
1 5 10 15
atc tgc aac act atc ctg gac aac aac atc tac atc gtt ggt ggt cag 96
Ile Cys Asn Thr Ile Leu Asp Asn Asn Ile Tyr Ile Val Gly Gly Gln
20 25 30
tgc aaa cgt gtt aac act ttc atc atc tct tct get act act gtt aaa 144
Cys Lys Arg Val Asn Thr Phe Ile Ile Ser Ser Ala Thr Thr Val Lys
35 40 45
get atc tgc act ggt gtt atc aac ctg aac gtt ctg tct act act cgt 192
Ala Ile Cys Thr Gly Val Ile Asn Leu Asn Val Leu Ser Thr Thr Arg
50 55 60
ttc cag ctg aac act tgc act cgt act tct atc act ccg cgt ccg tgc 240
Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro Cys
65 70 75 80
CA 02401916 2002-09-19
58
ccg tac tct tct cgt act gaa act aac tac atc tgc gtt aaa tgc gaa 288
Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys Glu
85 90 95
aac cag tac ccg gtt cat ttc get ggt atc ggt cgt tgc ccg 330
Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 19
<211> 110
<212> PRT
<213> Artificial Sequence
<400> 19
Gln Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Lys Thr Pro Ile
1 5 10 15
Ile Cys Asn Thr Ile Leu Asp Asn Asn Ile Tyr Ile Val Gly Gly Gln
20 25 30
Cys Lys Arg Val Asn Thr Phe Ile Ile Ser Ser Ala Thr Thr Val Lys
35 40 45
Ala Ile Cys Thr Gly Val Ile Asn Leu Asn Val Leu Ser Thr Thr Arg
50 55 60
Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro Cys
65 70 75 80
Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys Glu
85 90 95
Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 20
<211> 333
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease with Met at position 1,
Met23Leu and Met58Leu substitutions (recombinant
Met(-1) RaCORI Met22Leu Met57Leu)
<220>
<221> CDS
<222> (1)..(333)
<223> Met(-1) RaCORI Met22Leu Met57Leu
<400> 20
atg cag aac tgg get act ttc cag cag aaa cat atc atc aac act ccg 48
Met Gln Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro
1 5 10 15
CA 02401916 2002-09-19
59
atc atc tgc aac act atc ctg gac aac aac atc tac atc gtt ggt ggt 96
Ile Ile Cys Asn Thr Ile Leu Asp Asn Asn Ile Tyr Ile Val Gly Gly
20 25 30
cag tgc aaa cgt gtt aac act ttc atc atc tct tct get act act gtt 144
Gln Cys Lys Arg Val Asn Thr Phe Ile Ile Ser Ser Ala Thr Thr Val
35 40 45
aaa get atc tgc act ggt gtt atc aac ctg aac gtt ctg tct act act 192
Lys Ala Ile Cys Thr Gly VaI Ile Asn Leu Asn VaI Leu Ser Thr Thr
50 55 60
cgt ttc cag ctg aac act tgc act cgt act tct atc act ccg cgt ccg 240
Arg Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro
65 70 75 80
tgc ccg tac tct tct cgt act gaa act aac tac atc tgc gtt aaa tgc 288
Cys Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys
85 90 95
gaa aac cag tac ccg gtt cat ttc get ggt atc ggt cgt tgc ccg 333
Glu Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 21
<211> 111
<212> PRT
<213> Artificial Sequence
<400> 21
Met Gln Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro
1 5 10 15
Ile Ile Cys Asn Thr Ile Leu Asp Asn Asn Ile Tyr Ile Val Gly Gly
20 25 30
Gln Cys Lys Arg Val Asn Thr Phe Ile Ile Ser Ser Ala Thr Thr Val
35 40 45
Lys Ala Ile Cys Thr Gly Val Ile Asn Leu Asn Val Leu Ser Thr Thr
50 55 60
Arg Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro
65 70 75 80
Cys Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys
85 90 95
Glu Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 22
<211> 117
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease with (His)6 tag, Met at
CA 02401916 2002-09-19
position 7, Met23Leu and Met58Leu substitutions
(recombinant Met(-1) RaCORl Met22Leu Met57Leu-(His)6)
<400> 22
His His His His His His Met Gln Asn Trp Ala Thr Phe Gln Gln Lys
1 5 10 15
His Ile Ile Asn Thr Pro Ile Ile Cys Asn Thr Ile Leu Asp Asn Asn
20 25 30
Ile Tyr Ile Val Gly Gly Gln Cys Lys Arg Val Asn Thr Phe Ile Ile
35 40 45
Ser Ser Ala Thr Thr Val Lys Ala Ile Cys Thr Gly Val Ile Asn Leu
50 55 60
Asn Val Leu Ser Thr Thr Arg Phe Gln Leu Asn Thr Cys Thr Arg Thr
70 75 80
Ser Ile Thr Pro Arg Pro Cys Pro Tyr Ser Ser Arg Thr Glu Thr Asn
85 90 95
Tyr Ile Cys Val Lys Cys Glu Asn Gln Tyr Pro Val His Phe Ala Gly
100 105 110
Ile Gly Arg Cys Pro
115
<210> 23
<211> 330
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease with GlnlSer substitution
(recombinant RaCORl Q1S)
<220>
<221> CDS
<222> (1)..(330)
<223> RaCORl Q1S
<400> 23
tca aac tgg get act ttc cag cag aaa cat atc atc aac act ccg atc 48
Ser Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro Ile
1 5 10 15
atc tgc aac act atc atg gac aac aac atc tac atc gtt ggt ggt cag 96
Ile Cys Asn Thr Ile Met Asp Asn Asn Ile Tyr Ile Val Gly Gly Gln
20 25 30
tgc aaa cgt gtt aac act ttc atc atc tct tct get act act gtt aaa 144
Cys Lys Arg Val Asn Thr Phe Ile Ile Ser Ser Ala Thr Thr Val Lys
35 40 45
get atc tgc act ggt gtt atc aac atg aac gtt ctg tct act act cgt 192
Ala Ile Cys Thr Gly Val Ile Asn Met Asn Val Leu Ser Thr Thr Arg
50 55 60
CA 02401916 2002-09-19
61
ttc cag ctg aac act tgc act cgt act tct atc act ccg cgt ccg tgc 240
Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro Cys
65 70 75 80
ccg tac tct tct cgt act gaa act aac tac atc tgc gtt aaa tgc gaa 288
Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys Glu
85 90 95
aac cag tac ccg gtt cat ttc get ggt atc ggt cgt tgc ccg 330
Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 24
<211> 110
<212> PRT
<213> Artificial Sequence
<400> 24
Ser Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro Ile
1 5 10 15
Ile Cys Asn Thr Ile Met Asp Asn Asn Ile Tyr Ile Val Gly Gly Gln
20 25 30
Cys Lys Arg Val Asn Thr Phe Ile Ile Ser Ser Ala Thr Thr Val Lys
35 40 45
Ala Ile Cys Thr Gly Val Ile Asn Met Asn Val Leu Ser Thr Thr Arg
50 55 60
Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro Cys
65 70 75 80
Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys Glu
85 90 95
Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 25
<211> 333
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease with Met at position 1
and Gln2Ser substitution
<220>
<221> CDS
<222> () . . (333)
<223> Met(-1) RaCORl Q1S
<400> 25
atg tca aac tgg get act ttc cag cag aaa cat atc atc aac act ccg 48
Met Ser Asn Trp Ala Thr Phe Gln Gln Lys His Ile Ile Asn Thr Pro
1 5 10 15
CA 02401916 2002-09-19
62
atc atc tgc aac act atc atg gac aac aac atc tac atc gtt ggt ggt 96
Ile Ile Cys Asn Thr Ile Met Asp Asn Asn Ile Tyr Ile Val Gly Gly
20 25 30
cag tgc aaa cgt gtt aac act ttc atc atc tct tct get act act gtt 144
Gln Cys Lys Arg Val Asn Thr Phe IIe IIe Ser Ser Ala Thr Thr Val
35 40 45
aaa get atc tgc act ggt gtt atc aac atg aac gtt ctg tct act act 192
Lys Ala Ile Cys Thr Gly Val Ile Asn Met Asn Val Leu Ser Thr Thr
50 55 60
cgt ttc cag ctg aac act tgc act cgt act tct atc act ccg cgt ccg 240
Arg Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro
65 70 75 80
tgc ccg tac tct tct cgt act gaa act aac tac atc tgc gtt aaa tgc 288
Cys Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys
85 90 95
gaa aac cag tac ccg gtt cat ttc get ggt atc ggt cgt tgc ccg 333
Glu Asn Gln Tyr Pro Val His Phe Ala Gly Ile Gly Arg Cys Pro
100 105 110
<210> 26
<211> 111
<212> PRT
<213> Artificial Sequence
<400> 26
Met Ser Asn Trp Ala Thr Phe Gln Gln Lys His Ile ile Asn Thr Pro
1 5 10 15
Ile Ile Cys Asn Thr Ile Met Asp Asn Asn Ile Tyr Ile Val Gly Gly
20 25 30
Gln Cys Lys Arg Val Asn Thr Phe Ile ile Ser Ser Ala Thr Thr Val
35 40 45
Lys Ala Ile Cys Thr Gly Val Ile Asn Met Asn Val Leu Ser Thr Thr
50 55 60
Arg Phe Gln Leu Asn Thr Cys Thr Arg Thr Ser Ile Thr Pro Arg Pro
65 70 75 80
Cys Pro Tyr Ser Ser Arg Thr Glu Thr Asn Tyr Ile Cys Val Lys Cys
85 90 95
Glu Asn Gln Tyr Pro Val His Phe Ala Gly IIe Gly Arg Cys Pro
100 105 110
<210> 27
<211> 2855
<212> bNA
<213> Rana pipiens
<220>
CA 02401916 2002-09-19
63
<223> Rana pipiens ribonuclease (RaPLRl) Clone 5alb cDNA
insert
<220>
<221> CDS
<222> (97)..(481)
<223> RaPLRl
<220>
<221> sig~eptide
<222> (97)..(165)
<400> 27
atcagttgct catcgtttga ccaagttgtt ttccatctga agcaatattt atatataatt 60
tctcttatat ataaaggcct gatcacgact tccaga atg ttt cca aaa ttc tca 114
Met Phe Pro Lys Phe Ser
1 5
ttt ctc ctg ata ttt gca gtt gtt ttg agt ctc act cat aag tcc tta 162
Phe Leu Leu Ile Phe Ala Val Val Leu Ser Leu Thr His Lys Ser Leu
15 20
tgt caa gac tgg ctt acg ttt cag aag aag cac ctg aca aac acc cgg 210
Cys Gln Asp Trp Leu Thr Phe Gln Lys Lys His Leu Thr Asn Thr Arg
25 30 35
gat gtt gac tgt aat aat atc atg tca aca aac ttg ttc cac tgc aag 258
Asp Val Asp Cys Asn Asn Ile Met Ser Thr Asn Leu Phe His Cys Lys
40 45 50
gac aag aac act ttt atc tat tca cgt cct gag cca gtg aag gcc atc 306
Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro Glu Pro Val Lys Ala Ile
55 60 65 70
tgt aaa gga att ata gcc tcc aaa aat gtg tta act acc tct gag ttt 354
Cys Lys Gly Ile Ile Ala Ser Lys Asn Val Leu Thr Thr Ser Glu Phe
75 80 85
tat ctc tct gat tgc aat gta aca agc agg cct tgc aag tat aaa tta 402
Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg Pro Cys Lys Tyr Lys Leu
90 95 100
aag aaa tca act aat aca ttt tgt gta act tgt gag aat caa get cca 450
Lys Lys Ser Thr Asn Thr Phe Cys Val Thr Cys Glu Asn Gln Ala Pro
105 110 115
gta cat ttc gtg ggt gtc gga cat tgc tagaaatatg tttgacaaca 497
Val His Phe Val Gly Val Gly His Cys
120 125
gggatgtgat aagcagctgc aagaaattat tttgaagtga atttactaaa gacactaatt 557
ttgcataaat tttccccaga gcttaccggt agtaagaaaa ttccaacagg gagccaagca 617
cagaaagtaa actaaggagc caaagtaatt ataaaagtca cactggaccg ctgctactgc 677
actcagatga ccaaatgaga aacagacaaa aacagcagag ttgggaagcg cagatccggg 737
CA 02401916 2002-09-19
64
aggtggcggg gagtcaattg gggatggagt ccatgtgaga tttggaaccg tttgttgctg 797
gtgaagcatg tggccggtgc acagtacaca tggggaaaga tagtcggatt ggccgggctc 857
gctgtggtgg tgccggcggt tgagccaaag gtggtgggga gatggctgtc cccccttctg 917
tgggggctgt ggacagaggg agctgcggac caggggtggg aggcctggag agaattttca 977
aacagctgac gtggccgggg ctgggcagca tcggggaggg gaagggctgg gctcagatcc 1037
aggaagcatg gtcactgtat gaccagagtg gaagatggca gagccgctgc agtggccggg 1097
gagaccagag ggatctgtgc ccagcctttc ccctccctga tgtggcccgt ttttggttat 1157
ggtaaccgct cccagctgtt tgggggtgtt ttcgggcttc gcatttttgg tctgcggctc 1217
cctctgtcca cggccctcat ggaggggggg tgggcatttc tccaccgcct ttggctctgt 1277
tgctggcact gtcgcagcga gtttggccag tcatggctca ttttcccatt tgtcatgtgt 1337
gttggttgca tgttttgtcg gcggtggact gttttgaatt tcacatggat tccatcttcg 1397
gttggttcct tgccacctcc tggatctgtg ctttccaatt ctgttttttc cccagcgctt 1457
agtggatgca gtgaaactct ggtgattacc atcatccaat catgtgcaag aaaaaatatt 1517
ttcatatttc ttccacccaa ttgggtattc attaggaagt ttgagcacat tcacgttcta 1577
gggaaaatga gtgcaactgc acttccaaag ttcacagtct atttgccttt agtaaatcca 1637
ccccattatt tctgagcaga ggacaaatct atggcaacaa aaaaacttta cctactgaat 1697
tattttatat tgattgaaga taatctttct ttcatttcct aaatattgta atcaaaatta 1757
atacataaca gctatgtatt ataccacagc agcaaatgtt aaaatagttt taaacgtaaa 1817
atatgtttta ccttaaagtg gaagtaaact tctatcacta aattttacct ataggtgaga 1877
cccatgcgct cttcaggaat ggccgctggt gctgttcctt cagagccctg tgctgcgaac 1937
ggcggctccc gtgtgcatgt acaggagtga cgtcatcaca gctccggcca gtcacagagt 1997
tagagttcaa gtgtgagtgg cttgagccac gatgatgtcg ctcccaaaca tgtgtgcggg 2057
ggtctccgtt tgcggcgcag gacactgggg gaatagcatg ggtgtgccgt tccttcagag 2117
catatgcgtg ggtgacgtca ctagctgcat ctaaagtaat atctcctaaa caatgcacat 2177
ttaggagata gttacagtac ctatgggtaa gccttattgt aggcttacct ataggtaaaa 2237
atcatgcatg ggagtttact tccatgtagg gatgaggaga gcaggctgac atattaaagt 2297
aaaaatctta cctatgtagg gatgaggaga gcaggctgac atattaaagt aaaaatctta 2357
cctatagtgg ttgaaagtag ttgaaaataa gatggcctgc agggtcttaa aaaggctagg 2417
atagcacagt atccacatga ggcaccagat ctcgctcccc cacacatgag tagcaaggag 2477
caatggtaat gtgagtttct taggctcgac cgttaaatag cgttggccct ccaagtgata 2537
catgggagat aagcagatgt ccgcgtatgc acgcagacat atgtgggcgg atgttgggat 2597
CA 02401916 2002-09-19
aggacgatca gagagatgct cagatctgcc cgaaggagaa aggtggaaac atccattcaa 2657
tgtcatatgc ctaaagaagc cacccaccat aaaaagttaa tagatcatca ggtggcagcc 2717
aaccacacca ggcccaaagg agggtggccc cagtgaaccg tataggaaca gcactcagct 2777
atcacataat tacacaagag tatagagacc cattgtgggt attaacaacc aaatggctaa 2837
aaaaaaaaaa aaaaaaaa 2855
<210> 28
<211> 127
<212> PRT
<213> Rana pipiens
<400> 28
Met Phe Pro Lys Phe Ser Phe Leu Leu Ile Phe Ala Val Val Leu Ser
1 5 10 15
Leu Thr His Lys Ser Leu Cys Gln Asp Trp Leu Thr Phe Gln Lys Lys
20 25 30
His Leu Thr Asn Thr Arg Asp Val Asp Cys Asn Asn Ile Met Ser Thr
35 40 45
Asn Leu Phe His Cys Lys Asp Lys Asn Thr Phe Ile Tyr Ser Arg Pro
50 55 60
Glu Pro Val Lys Ala Ile Cys Lys Gly Ile Ile Ala Ser Lys Asn Val
65 70 75 80
Leu Thr Thr Ser Glu Phe Tyr Leu Ser Asp Cys Asn Val Thr Ser Arg
85 90 95
Pro Cys Lys Tyr Lys Leu Lys Lys Ser Thr Asn Thr Phe Cys Val Thr
100 105 110
Cys Glu Asn Gln Ala Pro Val His Phe Val Gly Val Gly His Cys
115 120 125
<210> 29
<211> 4
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:CAAX motif to
target heterologous proteins to the plasma
membrane, where A = aliphatic amino acid and
X = Ser, Met, Cys, Ala or Gln
<400> 29
Cys Val Ile Met
1
<210> 30
<211> 27
<212> DNA
<213> Artificial Sequence
CA 02401916 2002-09-19
66
<220>
<223> Description of Artificial Sequence:Rana pipiens
Onconase degenerate forward primer
<400> 30
agrgatgtkg attgygataa yatcatg 27
<210> 31
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana pipiens
Onconase degenerate reverse primer
<400> 31
aaartgmacw ggkgcctgrt tytcaca 27
<210> 32
<211> 96
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 32
cagaactggg ctactttcca gcagaaacat atcatcaaca ctccgatcat ctgcaacact 60
atcatggaca acaacatcta catcgttggt ggtcag 96
<210> 33
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 33
tacatcgttg gtggtcagtg caaacgtgtt aacactttca tcatctctct gctactactg 60
ttaaacgtat ctgcactggt gttatc 86
<210> 34
<211> 96
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
CA 02401916 2002-09-19
67
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 34
atctgcactg gtgttactaa catgaacgtt ctgtctacta ctcgtttcca gctgaacact 60
tgcactcgta cttctatcac tccgcgtccg tgcccg 96
<210> 35
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 35
gttgataaca ccagtgcaga t 21
<210> 36
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 36
atctgcactg gtgttatcaa c 21
<210> 37
<211> 95
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 37
actccgcgtc cgtgcccgta ctcttctcgt actgaaacta actacatctg cgttaaatgc 60
gaaaaccagt acccggttca tttcgctggt atcgg 95
<210> 38
<211> 71
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease .synthetic gene (RaCORl)
CA 02401916 2002-09-19
68
oligonucleotide
<400> 38
atatatctag aaataatttt atttaacttt aagaaggaga tatacatatg cagaactggg 60
ctactttcca g 71
<210> 39
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 39
cgcgccggat ccctactacg ggcaacgacc gataccagcg aaatgaac 48
<210> 40
<211> 96
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 40
cagaactggg ctactttcca gcagaaacat atcatcaaca ctccgatcat ctgcaacact 60
atcctgcaga acaacatcta catcgttggt ggtcag 96
<210> 41
<211> 96
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana ribonuclease synthetic gene (RaCORl)
oligonucleotide
<400> 41
atctgcactg gtgttatcaa cctgaacgtt ctgtctacta ctcgtttcca gctgaacact 60
tgcactcgta cttctatcac tccgcgtccg tgcccg 96
<210> 42
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:Rana
catesbeiana insertion primer for NdeI restriction
site
CA 02401916 2002-09-19
69
<400> 42
ggattccata tgcagaactg ggctattttc cag 33
<210> 43
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:six histidine
residue tag at amino terminus
<400> 43
His His His His His His
1 5
