CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
NOVEL HUMAN PROTEIN KINASES AND
PROTEIN KINASE-LIKE ENZYMES
The present invention claims priority on provisional application serial nos.
60/195,953
filed April 10, 2000 and 60/201,015, filed May 1, 2000 and 60/213,805 filed
June 22, 2000,
all of which are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION
The present invention relates to kinase polypeptides, nucleotide sequences
encoding
~20 the kinase polypeptides, as well as various products and methods useful
for the diagnosis and
treatment of various kinase-related diseases and conditions.
BACKGROUND OF THE 1NVENTION
The following description of the background of the invention is provided to
aid in
understanding the invention, but is not admitted to be or to describe prior
art to the invention.
Cellular signal transduction is a fundamental mechanism whereby external
stimuli
that regulate diverse cellular processes axe relayed to the interior of cells.
One of the key
biochemical mechanisms of signal transduction involves the reversible
phosphorylation of
proteins, which enables regulation of the activity of mature proteins by
altering their structure
and function.
Protein phosphorylation plays a pivotal role in cellular signal transduction.
Among the
biological functions controlled by this type of postranslational modification
are: cell division,
differentiation and death (apoptosis); cell motility and cytoskeletal
structure; control of DNA
replication, transcription, splicing and translation; protein translocation
events from the
-1-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
endoplasmic reticulum and Golgi apparatus to the membrane and extracellular
space; protein
nuclear import and export; regulation of metabolic reactions, etc. Abnormal
protein
phosphorylation is widely recognized to be causally linked to the etiology of
many diseases
including cancer as well as immunologic, neuronal and metabolic disorders.
The following abbreviations are used for kinases throught this application:
ASK Apoptosis signal-regulating kinase
CaMK Ca2+/calmodulin-dependent protein kinase
CORK Cell cycle-related kinase
CDK Cyclin-dependent kinase
CK Casein kinase
DAPK Death-associated
protein kinase
DM myotonic dystrophy kinase
Dyrk dual-specificity-tyrosine phosphorylating-regulated
kinase
GAK Cyclin G-associated kinase
GRK G-protein coupled receptor
GuC Guanylate cyclase
HIPK Homeodomain-interacting protein kinase
IRAK Interleukin-1 receptor-associated kinase
MAPKMitogen activated protein kinase
MAST Microtubule-associated STK
MLCKMyosin-light chain kinase
MLK Mixed lineage kinase
NIMA NimA-related protein kinase
PKA cAMP-dependent protein kinase
RSK Ribosomal protein S6 kinase
RTK Receptor tyrosine kinase
SGK Serum and glucocorticoid-regulated kinase
STK serine threonine kinase
ULK LTNC-51-like kinase
The best-characterized protein kinases in eukaryotes phosphorylate proteins on
the
hydroxyl substiiuent of serine, threonine and tyrosine residues, which are the
most common
-2-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
phospho-acceptor amino acid residues. However, phosphorylation on histidine
has also been
observed in bacteria.
The presence of a phosphate moiety modulates protein function in multiple
ways. A
common mechanism includes changes in the catalytic properties (Vmax and Km) of
an
enzyme, leading to its activation or inactivation.
A second widely recognized mechanism involves promoting protein-protein
interactions. An example of this is the tyrosine autophosphorylation of the
ligand-activated
EGF receptor tyrosine kinase. Tlus event triggers the high-affnity binding to
the
phosphotyrosine residue on the receptor's C-terminal intracellular domain to
the SH2 motif
of the adaptor molecule Grb2. Grb2, in turn, binds through its SH3 motif to a
second adaptor
molecule, such as SHC. The formation of this ternary complex activates the
signaling events
that are responsible for the biological effects of EGF. Serine and threonine
phosphorylation
events also have been recently recognized to exert their biological function
through protein-
protein interaction events that are mediated by the high-affinity binding of
phosphoserine and
phosphothreonine to WW motifs present in a large variety of proteins (Lu, P.J.
et al (1999)
Science 283:1325-1325).
A third important outcome of protein phosphorylation is changes in the
subcellular
localization of the substrate. As an example, nuclear import and export events
in a large
diversity of proteins are regulated by protein phosphorylation (Drier E.A. et
al (1999) Genes
Dev 13: 556-568).
Protein kinases are one of the largest families of eukaryotic proteins with
several
hundred known members. These proteins share a 250-300 amino acid domain that
can be
subdivided into 12 distinct subdomains that comprise the common catalytic core
structure.
These conserved protein motifs have recently been exploited using PCR-based
and
bioinformatic strategies leading to a significant expansion of the known
kinases. Multiple
alignment of the sequences in the catalytic domain of protein kinases and
subsequent
parsimony analysis permits their segregation into sub-families of related
kinases.
Kinases largely fall into two groups: those specific for phosphorylating
serines and
threonines, and those specific for phosphorylating tyrosines. Some kinases,
referred to as
"dual specificity" kinases, are able to phosphorylate on tyrosine as well as
serinelthreonine
residues.
-3-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Protein kinases can also be characterized by their location within the cell.
Some
kinases are transmembrane receptor-type proteins capable of directly altering
their catalytic
activity in response to the external environment such as the binding of a
ligand. Others are
non-receptor-type proteins lacking any transmembrane domain. They can be found
in a
variety of cellular compartments from the inner surface of the cell membrane
to the nucleus.
Many kinases axe involved in regulatory cascades wherein their substrates may
include other kinases whose activities are regulated by their phosphorylation
state.
Ultimately the activity of some downstream effector is modulated by
phosphorylation
resulting from activation of such a pathway. The conserved protein motifs~of
these kinases
have recently been exploited using PCR-based cloning strategies leading to a
significant
expansion of the known kinases.
Multiple alignment of the sequences in the catalytic domain of protein kinases
and
subsequent parsimony analysis permits the segregation of related kinases into
distinct
branches of subfamilies including: tyrosine kinases (PTK's), dual-specificity
kinases, and
serineltlueonine kinases (STK's). The latter subfamily includes cyclic-
nucleotide-dependent
kinases, calcium/calinodulin kinases, cyclin-dependent kinases (CDK's), MAP-
kinases,
serine-threonine kinase receptors, and several other less defined subfamilies.
The protein kinases may be classified into several major groups including AGC,
CAMK, Casein kinase 1, CMGC, STE, tyrosine kinases, and atypical kinases
(Plowman, GD
et al., Proceedings of the National Academy of Sciences, USA, Vol. 96, Issue
24, 13603-
13610, November 23, 1999; see also www.kinase.com). In addition, there are a
number of
minor yet distinct families, including families related to worm- or fungal-
specific kinases,
and a family designated "other" to represent several smaller families. Within
each group are
several distinct families of more closely related kinases. In addition, an
"atypical" family
represents those protein kinases whose catalytic domain has little or no
primary sequence
homology to conventional kinases, including the A6 kinases and PI3 kinases.
AGC group
The AGC kinases are basic amino acid-directed enzymes that phosphorylate
residues
found proximal to Arg and Lys. Examples of this group are the G protein-
coupled receptor
kinases (GRKs), the cyclic nucleotide-dependent kinases (PKA, PKC, PKG), NDR
or DBF2
-4-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
kinases, ribosomal S6 kinases, AKT kinases, myotonic dystrophy kinases
(DMPKs), MAPK
interacting kinases (MNKs), MAST kinases, and Mo3C11.1 ce family originally
identified
only in nematodes.
GRKs regulate signaling from heterotrimeric guanine protein coupled receptors
(GPCRs). Mutations in GPCRs cause a number of human diseases, including
retinitis
pigmentosa, stationary night blindness, color blindness , hyperfunctioning
thyroid adenomas,
familial precocious puberty , familial hypocalciuric hypercalcemia and
neonatal severe
hyperparathroidism (OMIM, htip://www.ncbi.nlm.nih.~ov/Omim~. The regulation of
GPCRs by GRKs indirectly implicates GRKs in these diseases.
The cAMP-dependent protein kinases (PKA) consist of heterotetramers comprised
of
2 catalytic (C) and 2 regulatory (R) subunits, in which the R subunits bind to
the second
messenger cAMP, leading to dissociation of the active C subunits from the
complex. Many
of these kinases respond to second messengers such as cAMP resulting in a wide
range of
cellular responses to hormones and neurotransmitters.
AKT is a mammalian proto-oncoprotein regulated by phosphatidylinositol 3-
kinase
(PI3-K), which appears to function as a cell survival signal to protect cells
from apoptosis.
Insulin receptor, RAS, PI3-K, and PDKl all act as upstream activators of AKT,
whereas the
lipid phosphatase PTEN functions as a negative regulator of the PI3-I~/AKT
pathway.
Downstream targets for AKT-mediated cell survival include the pro-apoptotic
factors BAD
and Caspase9, and transcription factors in the forkhead family, such as DAF-16
in the worm.
AKT is also an essential mediator in insulin signaling, in part due to its use
of GSK-3 as
another downstream target.
The S6 kinases regulate a wide array of cellular processes involved in
mitogenic
response including protein synthesis, translation of specific mRNA species,
and cell cycle
progression from Gl to S phase. The gene has been localized to chromosomal
region 17q23
and is amplified in breast cancer (Couch, et al., Cancer Res. 1999 Apr
1;59(7):1408-11).
CAMK Group
The CAMK kinases are also basic amino acid-directed kinases. They include the
Ca2+/calinodulin-regulated and AMP-dependent protein kinases (AMPK), myosin
light chain
kinases (MLCK), MAP kinase activating protein kinases (MAPKAPKs) checkpoint 2
kinases
-5-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
(CHK2), death-associated protein kinases (DAPKs), phosphorylase kinase (PHK),
Rac and
Rho-binding Trio kinases, a "unique" family of CAMKs, and the EMK-related
protein
kinases.
The EMK family of STKs are involved in the control of cell polarity,
microtubule
stability and cancer. One member of the EMK family, C-TAK1, has been reported
to control
entry into mitosis by activating Cdc25C which in turn dephosphorylates Cdc2.
Also included
in the EMK family is MAKV, which has been shown to be overexpressed in
metastatic
tumors (Dokl. Akad. Nauk 354 (4), 554-556 (1997)).
CMGC Groub
The CMGC kinases are "proline-directed" enzymes phosphorylating residues that
exist in a proline-rich context. They include the cyclin-dependent kinases
(CDKs), mitogen-
activated protein kinases (MAPKs), GSK3s, RCKs, and CLKs. Most CMGC kinases
have
larger-than-average kinase domains owing to the presence of insertions within
subdomains X
and XI.
CDK's play a pivotal role in the regulation of mitosis during cell division.
The
process of cell division occurs in four stages: S phase, the period during
which chromosomes
duplicate, G2, mitosis and Gl or interphase. During mitosis the duplicated
chromosomes are
evenly segregated allowing each daughter cell to receive a complete copy of
the genome. A
key mitotic regulator in all eukaryotic cells is the STK cdc2, a CDK regulated
by cyclin B.
However some CDK-like kinases, such as CDKS are not cyclin associated nor are
they cell
cycle regulated.
MAPKs play a pivotal role in many cellular signaling pathways, including
stress
response and mitogenesis (Lewis, T. S., Shapiro, P. S., and Ahn, N. G. (1998)
Adv. Cancer
Res. 74, 49-139). MAP kinases can be activated by growth factors such as EGF,
and
cytokines such as TNF-alpha. In response to EGF, Ras becomes activated and
recruits Rafl
to the membrane where Rafl is activated by mechanisms that may involve
phosphorylation
and conformational changes (Mornson, D. K., and Cutler, R. E. (1997) Cu~~.
Opiya. Cell Biol.
9, 174-179). Active Rafl phosphorylates MEKl which in turn phosphorylates and
activates
the ERKs.
-6-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Tyrosine Protein Kinase Group
The tyrosine kinase group encompass both cytoplasmic (e.g. sic) as well as
transmembrane receptor tyrosine kinases (e.g. EGF receptor). These kinases
play a pivotal
role in the signal transduction processes that mediate cell proliferation,
differentiation and
apoptosis. One of the sequences, 17000030181412, is related to the human RET
kinase.
Mutations of the RET gene, encoding a receptor tyrosine kinase, have been
associated with
the inherited cancer syndromes MEN 2A and MEN 2B. They have also further been
associated with both familial and sporadic medullary thyroid carcinomas. The
kinase activity
can be aberrantly activated by missense mutations affecting cysteine residues
within the
extracellular domain, leading to potent oncogenicity (Oncogehe 1999 Aug
26;18(34):4833-
8).
STE Groun
The STE family refers to the 3 classes of protein kinases that lie
sequentially upstream
of the MAPKs. This group includes STE7 (MEK or MAPKK) kinases, STE11 (MEKK or
MAPKKK) kinases and STE20 (MEKKK) kinases. In humans, several protein kinase
families that bear only distant homology with the STE11 family also operate at
the level of
MAPKKKs including RAF, MLK, TAKl, and COT. Since crosstalk takes place between
protein kinases functioning at different levels of the MAPK cascade, the large
number of STE
family lcinases could translate into an enormous potential for upstream signal
specificity.
The prototype STE20 from baker's yeast is regulated by a hormone receptor,
signaling
to directly affect cell cycle progression through modulation of CDK activity.
It also
coordinately regulates changes in the cytoskeleton and in transcriptional
programs in a
bifurcating pathway. In a similar way, the homologous kinases in humans are
likely to play a
role in extracellular regulation of growth, cell adhesion and migration, and
changes in
transcriptional programs, all three of which have critical roles in
tumorigenesis. Mammalian
STE20-related protein kinases have been implicated in response to growth
factors or
cytokines, oxidative-, W-, or irradiation-related stress pathways,
inflammatory signals (e.g.
TNFa), apoptotic stimuli (e.g. Fas), T and B cell costimulation, the control
of cytoskeletal
architecture, and cellular transformation. Typically the STE20-related kinases
serve as
_7_
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
upstream regulators of MAPK cascades. Examples include: HPKl, a protein-
serine/threonine kinase (STK) that possesses a STE20-like kinase domain that
activates a
protein kinase pathway leading to the stress-activated protein kinase
SAPK/JNK; PAK1, an
STK with an upstream CDC42-binding domain that interacts with Rac and plays a
role in
cellular transformation through the Ras-MAPK pathway; and marine NIK, which
interacts
with upstream receptor tyrosine kinases and connects with downstream STE11-
family
kinases.
NEK kinases are related to NIMA, which is required for entry into mitosis in
the
filamentous fungus A. nidulans. Mutations in the nimA gene cause the nim
(never in mitosis)
G2 arrest phenotype in this fungus (Fry, A.M. and Nigg, E.A. (1995) Curreht
Biology 5:
1122-1125). Several observations suggest that higher eukaryotes may have a
NIMA
functional counterpart(s): (1) expression of a dominant-negative form of NIMA
in HeLa cells
causes a G2 arrest; (2)overexpression of NIMA causes chromatin condensation,
not only in
A. nidulans, but also in yeast, Xenopus oocytes and HeLa cells (Lu, K.P. and
Hunter, T.
(1995) Prog. Cell Cycle Res. 1, 187-205); (3) NIMA when expressed in mammalian
cells
interacts with pink a prolyl-prolyl isomerase that functions in cell cycle
regulation (Lu, K.P.
et al. (1996) Nature 380, 544-547); (4) okadaic acid inhibitor studies
suggests the presence of
cdc2-independent mechanism to induce mitosis (Ghosh, S. et a1.(1998) Exp. Cell
Res. 242, 1-
9) and (5) a NIMA-like kinase (finl) exists in another eukaryote besides
Aspergillus,
Saccharomyces pombe (Krien, M.J.E. et a1.(1998) J. Cell Sci. 111, 967-976).
Four
mammalian NIMA-like kinases have been identified. NEKl, NEK2, NEK3 and NRK2.
Despite the similarity of the NIMA-related kinases to NIMA over the catalytic
region, the
mammalian kinases are structurally different to NIMA over the extracatalytic
regions. In
addition the mammalian kinases are unable to complement the nim phenotype in
Aspergillus
nimA mutants. These observations lead to the following three possibilities: 1)
the mammalian
NIMA homologue remains unidentified; 2) there is no NIMA homologue in higher
eukaryotes; 3) the biological function of NIMA is carried out by multiple,
related kinases in
higher eukaryotes. The elucidation and biological characterization of
additional mammalian
NIMA- and NEK-related kinases should assist in elucidating this question.
Casein Kinase 1 Groub
_g_
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
The CKl family represents a distant branch of the protein kinase family. The
hallmarks of protein kinase subdomains VIII and IX are difficult to identify.
One or more
forms are ubiquitously distributed in mammalian tissues and cell lines. CKl
kinases are
found in cytoplasm, in nuclei, membrane-bound, and associated with the
cytoskeleton. Splice
variants differ in their subcellular distribution.
"Other" Groun
Several families cluster within a group of unrelated kinases termed "Other".
Included
are: CHKl; Elongation 2 factor kinases (EIFK); homologues of the yeast sterile
family
kinases (STE), which refers to 3 classes of kinases which lie sequentially
upstream of the
MAPKs; Calcium-calinodulin kinase kinases (CAMKK); dual-specific tyrosine
kinases
(DYRK); IkB kinases (IKK); Integrin receptor kinase (IR.AK); endoribonuclease-
associated
kinases (IRE); Mixed lineage kinase (MLK); LIM-domain containing kinase
(LIMK); MOS;
PIM; Receptor interacting kinase (RIP); SR-protein specific kinase (SRPK);
RAF; Serine-
threonine kinase receptors (STKR); TAKl; Testis specific kinase (TSK); tousled-
related
kinase (TSL); UNC51-related kinase (UNC); VRK; WEE; mitotic kinases (BUBl,
AURORA, PLK, and NIMA/NEK); several families that are close homologues to worm
(C26C2.1, YQ09, ZC581.9, YFL033c, C24A1.3); Drosophila (SLOB), or yeast (YDOD
sp,
YGR262 sc) kinases; and others that are "unique," that is, those which do not
cluster into any
obvious family. Additional families are even less well defined and first were
identified in
lower eukaryotes such as yeast or worms (YNL020, YPL236, YQ09, YWY3, SCYl,
COlH6.9, C26C2.1)
RIP2 is a serine-threonine kinase associated with the tumor necrosis factor
(TNF)
receptor complex and is implicated in the activation of NF-kappa B and cell
death in
mammalian cells. It has recently been demonstrated that RIP2 activates the
MAPK pathway
(Navas, et al., JBiol. Chem. 1999 Nov 19;274(47):33684-33690). RIP2 activates
AP-1 and
serum response element regulated expression by inducing the activation of the
Elk1
transcription factor. RIP2 directly phosphorylates and activates ERK2 in vivo
and ih vitro.
RIP2 in turn is activated through its interaction with Ras-activated Rafl.
These results
highlight the integrated nature of kinase signaling pathway.
-9-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
The tousled (TSL) kinase was first identified in the plant Arabidopsis
thaliana. TSL
encodes a serine/threonine kinase that is essential for proper flower
development. Human
tousled-like kinases (Tlks) are cell-cycle-regulated enzymes, displaying
maximal activities
during S phase. This regulated activity suggests that Tlk function is linked
to ongoing DNA
replication (Sillje, et al., EMBO J 1999 Oct 15;18(20):5691-5702).
Atypical Protein Kinase Group
There are several proteins with protein kinase activity that appear
structurally
unrelated to the eukaryotic protein kinases. These include; Dictyostelium
myosin heavy chain
kinase A (MHCKA), Physa~um polycephalum actin-fragmin kinase, the human A6
PTK,
human BCR, mitochondria) pyruvate dehydrogenase and branched chain fatty acid
dehydrogenase kinase, and the prokaryotic "histidine" protein kinase family.
The slime mold,
worm, and human eEF-2 kinase homologues have all been demonstrated to have
protein
kinase activity, yet they bear little resemblance to conventional protein
kinases except for the
presence of a putative GxGxxG ATP-binding motif.
The so-called histidine kinases are abundant in prokaryotes, with more than 20
representatives in E. coli, and have also been identified in yeast, molds, and
plants. In
response to external stimuli, these kinases act as part of two-component
systems to regulate
DNA replication, cell division, and differentiation through phosphorylation of
an aspartate in
the target protein. To date, no "histidine" kinases have been identified in
metazoans,
although mitochondria) pyruvate dehydrogenase (PDK) and branched chain alpha-
ketoacid
dehydrogenase kinase (BCKD kinase), are related in sequence. PDK and BCKD
kinase
represent a unique family of atypical protein kinases involved in regulation
of glycolysis, the
citric acid cycle, and protein synthesis during protein malnutrition.
Structurally they conserve
only the C-terminal portion of "histidine" kinases including the G box
regions. BCKD kinase
phosphorylates the Ela subunit of the BCKD complex on Ser-293, proving it to
be a
functional protein kinase. Although no bona fide "1>istidine" kinase has yet
been identified in
humans, they do contain PDK.
Several other proteins contain protein kinase-like homology including:
receptor
guanylyl cyclases, diacylglycerol kinases, choline/ethanolamine kinases, and
YLKl-related
antibiotic resistance kinases. Each of these families contain short motifs
that were recognized
-10-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
by our profile searches with low scoring E-values, but a p~io~i would not be
expected to
function as protein kinases. Instead, the similarity could simply reflect the
modular nature of
protein evolution and the primal role of ATP binding in diverse
phosphotransfer enzymes.
However, two recent papers on a bacterial homologue of the YLKl family
suggests that the
aminoglycoside phosphotransferases (APHs) are structurally and functionally
related to
protein kinases. There are over 40 APHs identified from bacteria that are
resistant to
aminoglycosides such as kanamycin, gentamycin, or amikacin. The crystal
structure of one
well characterized APH reveals that it shares greater than 40% structural
identity with the 2
lobed structure of the catalytic domain of cAMP-dependent protein kinase
(PKA), including
an N-terminal lobe composed of a 5-stranded antiparallel beta sheet and the
core of the C-
terminal lobe including several invariant segments found in all protein
kinases. APHs lack
the GxGxxG normally present in the loop between beta strands l and 2 but
contain 7 of the
12 strictly conserved residues present in most protein kinases, including the
HGDxxxN
signature sequence in kinase subdomain VIB. Furthermore, APH also has been
shown to
exhibit protein-serine/threonine kinase activity, suggesting that other YLK-
related molecules
may indeed be functional protein kinases.
The eukaryotic lipid kinases (PI3Ks, PI4Ks, and PIPKs) also contain several
short
motifs similar to protein kinases, but otherwise shaxe minimal primary
sequence similarity.
However, once again structural analysis of PIPKII-beta defines a conserved ATP-
binding
core that is strikingly similar to conventional protein kinases. Three
residues are conserved
among all of these enzymes including (relative to the PKA sequence) Lys-72
which binds the
gamma-phosphate of ATP, Asp-166 which is part of the HRDLK motif and Asp-184
from
the conserved Mgr or Mn~ binding DFG motif. The worm genome contains 12
phosphatidylinositol kinases, including 3 PI3-kinases, 2 PI4-kinases, 3 PIPS-
kinases, and 4
PI3-kinase-related kinases. The latter group has 4 mammalian members (DNA-PK,
FRAP/TOR, ATM, and ATR), which have been shown to participate in the
maintenance of
genomic integrity in response to DNA damage, and exhibit true protein kinase
activity,
raising the possibility that other PI-kinases may also act as protein kinases.
Regardless of
whether they have true protein kinase activity, PI3-kinases are tightly linked
to protein kinase
signaling, as evidenced by their involvement downstream of many growth factor
receptors
and as upstream activators of the cell survival response mediated by the AKT
protein kinase.
-11-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
SUMMARY OF THE INVENTION
The present invention relates, in part, to human protein kinases and protein
kinase-like
enzymes identified from genomic sequencing.
Tyrosine and serine/threonine kinases (PTK's and STK's) have been identified
and
their protein sequence predicted as part of the instant invention. Mammalian
members of
these families were identified through the use of a bioinformatics strategy.
The partial or
complete sequences of these kinases are presented here, together with their
classification,
predicted or deduced protein structure.
One aspect of the invention features an identified, isolated, enriched, or
purified
nucleic acid molecule encoding a kinase polypeptide having an amino acid
sequence selected
from the group consisting of those set forth in SEQ ID N0:3 and SEQ ID N0:4.
The teen "identified" in reference to a nucleic acid is meant that a sequence
was
selected from a genomic, EST, or cDNA sequence database based on it being
predicted to
encode a portion of a previously unknown or novel protein kinase.
By "isolated," in reference to nucleic acid, is meant a polymer of 10
(preferably 21,
more preferably 39, most preferably 75) or more nucleotides conjugated to each
other,
including DNA and RNA that is isolated from a natural source or that is
synthesized as the
sense or complementary antisense strand. In certain embodiments of the
invention, longer
nucleic acids are preferred, for example those of 300, 600, 900, 1200, 1500;
or more
nucleotides and/or those having at least 50%, 60%, 75%, 80%, 85%, 90%, 95% or
99%
identity to a sequence selected from the group consisting of those set forth
in SEQ ID N0:1
and SEQ ID N0:2.
The isolated nucleic acid of the present invention is unique in the sense that
it is not
found in a pure or separated state in nature. Use of the term "isolated"
indicates that a
naturally occurring sequence has been removed from its normal cellular (i.e.,
chromosomal)
environment. Thus, the sequence may be in a cell-free solution or placed in a
different
cellular environment. The term does not imply that the sequence is the only
nucleotide chain
present, but that it is essentially free (about 90 - 95% pure at least) of non-
nucleotide material
naturally associated with it, and thus is distinguished from isolated
chromosomes.
By the use of the term "enriched" in reference to nucleic acid is meant that
the
specific DNA or RNA sequence constitutes a significantly higher fraction (2-
to 5-fold) of the
total DNA or RNA present in the cells or solution of interest than in normal
or diseased cells
-12-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
or in the cells from which the sequence was taken. This could be caused by a
person by
preferential reduction in the amount of other DNA or RNA present, or by a
preferential
increase in the amount of the specific DNA or RNA sequence, or by a
combination of the
two. However, it should be noted that enriched does not imply that there are
no other DNA
or RNA sequences present, just that the relative amount of the sequence of
interest has been
significantly increased. The term "significant" is used to indicate that the
level of increase is
useful to the person making such an increase, and generally means an increase
relative to
other nucleic acids of about at least 2-fold, more preferably at least 5- to
10-fold or even
more. The term also does not imply that there is no DNA or RNA from other
sources. The
DNA from other sources may, for example, comprise DNA from a yeast or
bacterial genome,
or a cloning vector such as pUC 19. This term distinguishes from naturally
occurring events,
such as viral infection, or tumor-type growths, in which the level of one mRNA
may be
naturally increased relative to other species of mRNA. That is, the term is
meant to cover
only those situations in which a person has intervened to elevate the
proportion of the desired
nucleic acid.
It is also advantageous for some purposes that a nucleotide sequence be in
purified
form. The term "purified" in reference to nucleic acid does not require
absolute purity (such
as a homogeneous preparation). Instead, it represents an indication that the
sequence is
relatively more pure than in the natural environment (compared to the natural
level this level
should be at least 2- to 5-fold greater, e.g., in terms of mg/mL). Individual
clones isolated
from a cDNA library may be purified to electrophoretic homogeneity. The
claimed DNA
molecules obtained from these clones could be obtained directly from total DNA
or from
total RNA. The cDNA clones are not naturally occurring, but rather are
preferably obtained
via manipulation of a partially purified naturally occurring substance
(messenger RNA). The
construction of a cDNA library from mRNA involves the creation of a synthetic
substance
(cDNA) and pure individual cDNA clones can be isolated from the synthetic
library by clonal
selection of the cells carrying the cDNA library. Thus, the process which
includes the
construction of a cDNA library from mRNA and isolation of distinct cDNA clones
yields an
approximately 106-fold purification of the native message. Thus, purification
of at least one
order of magnitude, preferably two or three orders, and more preferably four
or five orders of
magnitude is expressly contemplated.
-13-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
By a "kinase polypeptide" is meant 32 (preferably 40, more preferably 45, most
preferably 55) or more contiguous amino acids in a polypeptide having an amino
acid
sequence selected from the group consisting of those set forth in SEQ ID N0:3
and SEQ ID
N0:4. In certain aspects, polypeptides of 100, 200, 300, 400, 450, 500, 550,
600, 700, 800,
900 or more amino acids are preferred. The kinase polypeptide can be encoded
by a full-
length nucleic acid sequence or any portion (e.g., a "fragment" as defined
herein) of the full-
length nucleic acid sequence, so long as a functional activity of the
polypeptide is retained,
including, for example, a catalytic domain, as defined herein, or a portion
thereof. One of
skill in the art would be able to select those catalytic domains, or portions
thereof, which
exhibit a kinase or kinase-like activity, e.g., catalytic activity, as defined
herein. It is well
known in the art that due to the degeneracy of the genetic code numerous
different nucleic
acid sequences can code for the same amino acid sequence. Equally, it is also
well known in
the art that conservative changes in amino acid can be made to arnve at a
protein or
polypeptide which retains the functionality of the original. Such
substitutions may include
the replacement of an amino acid by a residue having similar physicochemical
properties,
such as substituting one aliphatic residue (Ile, Val, Leu or Ala) for another,
or substitution
between basic residues Lys and Arg, acidic residues Glu and Asp, amide
residues Gln and
Asn, hydroxyl residues Ser and Tyr, or axomatic residues Phe and Tyr. Further
information
regarding making amino acid exchanges which have only slight, if any, effects
on the overall
protein can be found in Bowie et al., Scieface, 1990, 247, 1306-1310, which is
incorporated
herein by reference in its entirety including any figures, tables, or
drawings. In all cases, all
permutations are intended to be covered by this disclosure.
The amino acid sequence of a kinase peptide of the invention will be
substantially
similar to a sequence having an amino acid sequence selected from the group
consisting of
those set forth in SEQ ID N0:3 and SEQ ID N0:4, or the corresponding full-
length amino
acid sequence, or fragments thereof.
A sequence that is substantially similar to a sequence selected from the group
consisting of those set forth in SEQ ID N0:3 and SEQ ID N0:4, will preferably
have at least
90% identity (more preferably at least 95% and most preferably 99-100%) to the
sequence.
By "identity" is meant a property of sequences that measures their similarity
or
relationship. Identity is measured by dividing the number of identical
residues by the total
number of residues and gaps and multiplying the product by 100. "Gaps" are
spaces in an
-14-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
alignment that are the result of additions or deletions of amino acids. Thus,
two copies of
exactly the same sequence have 100% identity, but sequences that are less
highly conserved,
and have deletions, additions, or replacements, may have a lower degree of
identity. Those
skilled in the art will recognize that several computer programs are available
for determining
sequence identity using standard parameters, for example Gapped BLAST or PSI-
BLAST
(Altschul, et al. (1997) Nucleic Acids Res. 25:3389-3402), BLAST (Altschul, et
al. (1990) J.
Mol. Biol. 215:403-410), and Smith-Waterman (Smith, et al. (1981) J. Mol.
Biol. 147:195-
197). Preferably, the default settings of these programs will be employed, but
those skilled in
the art recognize whether these settings need to be changed and know how to
make the
changes.
"Similarity" is measured by dividing the number of identical residues plus the
number
of conservatively substituted residues (see Bowie, et al. Science, 1999), 247,
1306-1310,
which is incorporated herein by reference in its entirety, including any
drawings, figures, or
tables) by the total number of residues and gaps and multiplying the product
by 100.
In preferred embodiments, the invention features isolated, enriched, or
purified
nucleic acid molecules encoding a lcinase polypeptide comprising a nucleotide
sequence that:
(a) encodes a polypeptide having an amino acid sequence selected from the
group consisting
of those set forth in SEQ ID N0:3 and SEQ ID N0:4; (b) is the complement of
the nucleotide
sequence of (a); (c) hybridizes under highly stringent conditions to the
nucleotide molecule of
(a) and encodes a naturally occurring kinase polypeptide; (d) encodes a
polypeptide having
an amino acid sequence selected from the group consisting of those set forth
in SEQ 117 NO:3
and SEQ ID N0:4, except that it lacks one or more, but not all, of the domains
selected from
the group consisting of an N-terminal domain, a catalytic domain, a C-terminal
catalytic
domain, a C-terminal domain, a coiled-coil structure region, a proline-rich
region, a spacer
region, and a C-terminal tail; and (e) is the complement of the nucleotide
sequence of (d).
The term "complement" refers to two nucleotides that can form multiple
favorable
interactions with one another. For example, adenine is complementary to
thymine as they can
form two hydrogen bonds. Similarly, guanine and cytosine are complementary
since they
can form three hydrogen bonds. A nucleotide sequence is the complement of
another
nucleotide sequence if all of the nucleotides of the first sequence are
complementary to all of
the nucleotides of the second sequence.
-15-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Various low or high stringency hybridization conditions may be used depending
upon
the specificity and selectivity desired. These conditions are well known to
those skilled in the
art. Under stringent hybridization conditions only highly complementary
nucleic acid
sequences hybridize. Preferably, such conditions prevent hybridization of
nucleic acids
having more than 1 or 2 mismatches out of 20 contiguous nucleotides, more
preferably, such
conditions prevent hybridization of nucleic acids having more than 1 or 2
mismatches out of
50 contiguous nucleotides, most preferably, such conditions prevent
hybridization of nucleic
acids having more than 1 or 2 mismatches out of 100 contiguous nucleotides. In
some
instances, the conditions may prevent hybridization of nucleic acids having
more than 5
mismatches in the full-length sequence.
By stringent hybridization assay conditions is meant hybridization assay
conditions at
least as stringent as the following: hybridization in 50% formamide, SX SSC,
50 mM
NaH2P04, pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon sperm DNA, and SX
Denhardt's
solution at 42 °C overnight; washing with 2X SSC, 0.1% SDS at 45
°C; and washing with
0.2X SSC, 0.1% SDS at 45 °C. Under some of the most stringent
hybridization assay
conditions; the second wash can be done with O.1X SSC at a temperature up to
70 °C (Berger
et al. (1987) Guide to Molecular Cloning Techniques pg 421, hereby
incorporated by
reference herein in its entirety including any figures, tables, or drawings.).
However, other
applications may require the use of conditions falling between these sets of
conditions.
Methods of determining the conditions required to achieve desired
hybridizations are well
known to those with ordinary skill in the art, and are based on several
factors, including but
not limited to, the sequences to be hybridized and the samples to be tested.
Washing
conditions of lower stringency frequently utilize a lower temperature during
the washing
steps, such as 65 °C, 60 °C, 55 °C, 50 °C, or 42
°C.
:__»
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
The term "N-terminal domain" refers to the extracatalytic region located
between the
initiator methionine and the catalytic domain of the protein kinase. The N-
terminal domain
can be identified following a Smith-Waterman alignment of the protein sequence
against the
non-redundant protein database to define the N-terminal boundary of the
catalytic domain.
Depending on its length, the N-terminal domain may or may not play a
regulatory role in
kinase function. An example of a protein kinase whose N-terminal domain has
been shown to
play a regulatory role is PAK65, which contains a CRIB motif used for Cdc42
and rac
binding (Burbelo, P.D. et al. (1995) J. Biol. Chem. 270, 29071-29074).
The term "catalytic domain" refers to a region of the protein kinase that is
typically
25-300 amino acids long and is responsible for carrying out the phosphate
transfer reaction
from a high-energy phosphate donor molecule such as ATP or GTP to itself
(autophosphorylation) or to other proteins (exogenous phosphorylation). The
catalytic
domain of protein kinases is made up of 12 subdomains that contain highly
conserved amino
acid residues, and are responsible for proper polypeptide folding and for
catalysis. The
catalytic domain can be identified following a Smith-Waterman alignment of the
protein
sequence against the non-redundant protein database.
The term "catalytic activity", as used herein, defines the rate at which a
kinase
catalytic domain phosphorylates a substrate. Catalytic activity can be
measured, for example,
by determining the amount of a substrate converted to a phosphorylated product
as a function
of time. Catalytic activity can be measured by methods of the invention by
holding time
constant and determining the concentration of a phosphorylated substrate after
a fixed period
of time. Phosphorylation of a substrate occurs at the active site of a protein
kinase. The
active site is normally a cavity in which the substrate binds to the protein
kinase and is
phosphorylated.
The term "substrate" as used herein refers to a molecule phosphorylated by a
kinase
of the invention. Kinases phosphorylate substrates on serine/threonine or
tyrosine amino
acids. The molecule may be another protein or a polypeptide.
The term "C-terminal domain" refers to the region located between the
catalytic
domain or the last (located closest to the C-terminus) functional domain and
the carboxy-
terminal amino acid residue of the protein kinase. By "functional" domain is
meant any
region of the polypeptide that may play a regulatory or catalytic role as
predicted from amino
acid sequence homology to other proteins or by the presence of amino acid
sequences that
-17-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
may give rise to specific structural conformations (e.g. N-terminal domain).
The C-terminal
domain can be identified by using a Smith-Waterman alignment of the protein
sequence
against the non-redundant protein database to define the C-terminal boundary
of the catalytic
domain or of any functional C-terminal extracatalytic domain. Depending on its
length and
amino acid composition, the C-terminal domain may or may not play a regulatory
role in
kinase function. An example of a protein kinase whose C-terminal domain may
play a
regulatory role is PAK3 which contains a heterotrimeric Gb subunit-binding
site near its C-
terminus (Leeuw, T. et al. (1998) Nature, 391, 191-195). For the some of the
kinases of the
instant invention, the C-terminal domain may also comprise the catalytic
domain (above).
The term "C-terminal tail" as used herein, refers to a C-terminal domain of a
protein
kinase, that by homology extends or protrudes past the C-terminal amino acid
of its closest
homolog. C-terminal tails can be identified by using a Smith-Waterman sequence
alignment
of the protein sequence against the non-redundant protein database, or by
means of a multiple
sequence alignment of homologous sequences using the DNAStar program Megalign.
Depending on its length, a C-terminal tail may or may not play a regulatory
role in kinase
function.
The term "coiled-coil structure region" as used herein, refers to a
polypeptide
sequence that has a high probability of adopting a coiled-coil structure as
predicted by
computer algorithms such as COILS (Lupas, A. (1996) Meth. Enzymology 266:513-
525).
Coiled-coils are formed by two or three amphipathic oc-helices in parallel.
Coiled-coils can
bind to coiled-coil domains of other polypeptides resulting in homo- or
heterodimers (Lupas,
A. (1991) Science 252:1162-1164). Coiled-coil-dependent oligomerization has
been shown
to be necessary for protein function including catalytic activity of
serine/threonine kinases
(Roe, J. et al. (1997) J. Biol. Claem. 272:5838-5845).
The term "proline-rich region" as used herein, refers to a region of a protein
kinase
whose proline content over a given amino acid length is higher than the
average content of
this amino acid found in proteins(i.e., >10%). Proline-rich regions are easily
discernable by
visual inspection of amino acid sequences and quantitated by standard computer
sequence
analysis programs such as the DNAStar program EditSeq. Proline-rich regions
have been
demonstrated to participate in regulatory protein -protein interactions. Among
these
interactions, those that are most relevant to this invention involve the
"PxxP" proline rich
motif found in certain protein kinases (i.e., human PAKl) and the SH3 domain
of the adaptor
-18-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
molecule Nck (Galisteo, M.L. et al. (1996) J. Biol. Chem. 271:20997-21000).
Other
regulatory interactions involving "PxxP" proline-rich motifs include the WW
domain (Sudol,
M. (1996) P~og. Biochys. Mol. Bio. 65:113-132).
The term "spacer region" as used herein, refers to a region of the protein
kinase
located between predicted functional domains. The spacer region has no
detectable
homology to any amino acid sequence in the database, and can be identified by
using a
Smith-Waterman alignment of the protein sequence against the non-redundant
protein
database to define the C- and N-terminal boundaries of the flanking functional
domains.
Spacer regions may or may not play a fundamental role in protein kinase
function.
Precedence for the regulatory role of spacer regions in kinase function is
provided by the role
of the sic kinase spacer in inter-domain interactions (Xu, W. et al. (1997)
Nature 385:595-
602).
The term "insert" as used herein refers to a portion of a protein kinase that
is absent
from a close homolog. Inserts may or may not by the product alternative
splicing of exons.
Inserts can be identified by using a Smith-Waterman sequence alignment of the
protein
sequence against the non-redundant protein database, or by means of a multiple
sequence
alignment of homologous sequences using the DNAStar program Megalign. Inserts
may play
a functional role by presenting a new interface for protein-protein
interactions, or by
interfering with such interactions.
The term "signal transduction pathway" refers to the molecules that propagate
an
extracellular signal through the cell membrane to become an intracellular
signal. This signal
can then stimulate a cellular response. The polypeptide molecules involved in
signal
transduction processes are typically receptor and non-receptor protein
tyrosine kinases,
receptor and non-receptor protein phosphatases, polypeptides containing SRC
homology 2
and 3 domains, phosphotyrosine binding proteins (SRC homology 2 (SH2) .and
phosphotyrosine binding (PTB and PH) domain containing proteins), proline-rich
binding
proteins (SH3 domain containing proteins), GTPases, phosphodiesterases,
phospholipases,
prolyl isomerases, proteases, Ca2+ binding proteins, cAMP binding proteins,
guanyl
cyclases, adenylyl cyclases, NO generating proteins, nucleotide exchange
factors, and
transcription factors.
In other preferred embodiments, the invention features isolated, enriched, or
purified
nucleic acid molecules encoding kinase polypeptides, further comprising a
vector or promoter
-19-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
effective to initiate transcription in a host cell. The invention also
features recombinant
nucleic acid, preferably in a cell or an organism. The recombinant nucleic
acid may contain a
sequence selected from the group consisting of those set forth in SEQ ID NO:1
and SEQ ID
N0:2, or a functional derivative thereof and a vector or a promoter effective
to initiate
transcription in a host cell. The recombinant nucleic acid can alternatively
contain a
transcriptional initiation region functional in a cell, a sequence
complementary to an RNA
sequence encoding a kinase polypeptide and a transcriptional termination
region functional in
a cell. Specific vectors and host cell combinations are discussed herein.
The term "vector" relates to a single or double-stranded circular nucleic acid
molecule
that can be transfected into cells and replicated within or independently of a
cell genome. A
circular double-stranded nucleic acid molecule can be cut and thereby
linearized upon
treatment with restriction enzymes. An assortment of nucleic acid vectors,
restriction
enzymes, and the knowledge of the nucleotide sequences cut by restriction
enzymes are
readily available to those skilled in the art. A nucleic acid molecule
encoding a kinase can be
inserted into a vector by cutting the vector with restriction enzymes and
ligating the two
pieces together.
The term "transfecting" defines a number of methods to insert a nucleic acid
vector or
other nucleic acid molecules into a cellular organism. These methods involve a
variety of
techniques, such as treating the cells with high concentrations of salt, an
electric field,
detergent, or DMSO to render the outer membrane or wall of the cells permeable
to nucleic
acid molecules of interest or use of various viral transduction strategies.
The term "promoter" as used herein, refers to nucleic acid sequence needed for
gene
sequence expression. Promoter regions vary from organism to organism, but are
well known
to persons skilled in the art for different organisms. For example, in
prokaryotes, the
promoter region contains both the promoter (which directs the initiation of
RNA
transcription) as well as the DNA sequences which, when transcribed into RNA,
will signal
synthesis iizitiation. Such regions will normally include those 5'-non-coding,
sequences
involved with initiation of transcription and translation, such as the TATA
box, capping
sequence, CAAT sequence, and the like.
In preferred embodiments, the isolated nucleic acid comprises, consists
essentially of,
or consists of a nucleic acid sequence selected from the group consisting of
those set forth in
SEQ ID NO:1 and SEQ ID N0:2, which encodes an amino acid sequence selected
from the
-20-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
group consisting of those set forth in SEQ ID NO: SEQ ID N0:3 and SEQ ID N0:4
, a
functional derivative thereof, or at least 35, 40, 45, 50, 60, 75, 100, 200,
or 300 contiguous
amino acids selected from the group consisting of those set forth in SEQ ID
N0:3 and SEQ
ID N0:4. The nucleic acid may be isolated from a natural source by cDNA
cloning or by
subtractive hybridization. The natural source may be mammalian, preferably
human,
preferably blood, semen or tissue, and the nucleic acid may be synthesized by
the triester
method or by using an automated DNA synthesizer.
The term "mammal" refers preferably to such organisms as mice, rats, rabbits,
guinea
pigs, sheep, and goats, more preferably to cats, dogs, monkeys, and apes, and
most preferably
to humans.
In yet other preferred embodiments, the nucleic acid is a conserved or unique
region,
for example those useful for: the design of hybridization probes to facilitate
identification
and cloning of additional polypeptides, the design of PCR probes to facilitate
cloning of
additional polypeptides, obtaining antibodies to polypeptide regions, and
designing antisense
oligonucleotides.
By "conserved nucleic acid regions", are meant regions present on two or more
nucleic acids encoding a kinase polypeptide, to which a particular nucleic
acid sequence can
hybridize under lower stringency conditions. Examples of lower stringency
conditions
suitable for screening for nucleic acid encoding kinase polypeptides are
provided in Wahl et
al. Meth. Ehzym. 152:399-407 (1987) and in Wahl et al. Meth. Ehzym. 152:415-
423 (1987),
which are hereby incorporated by reference herein in its entirety, including
any drawings,
figures, or tables. Preferably, conserved regions differ by no more than 5 out
of 20
nucleotides, even more preferably 2 out of 20 nucleotides or most preferably 1
out of 20
nucleotides.
By "unique nucleic acid region" is meant a sequence present in a nucleic acid
coding
for a kinase polypeptide that is not present in a sequence coding for any
other naturally
occurring polypeptide. Such regions preferably encode 32 (preferably 40, more
preferably
45, most preferably 55) or more contiguous amino acids, for example, an amino
acid
sequence selected from the group consisting of those set forth in SEQ ID N0:3
and SEQ ID
N0:4. In particular, a unique nucleic acid region is preferably of mammalian
origin.
Another aspect of the invention features a nucleic acid probe for the
detection of
nucleic acid encoding a kinase polypeptide having an amino acid sequence
selected from the
-21-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
group consisting of those set forth in SEQ ID N0:3 and SEQ ID N0:4 in a
sample. The
nucleic acid probe contains a nucleotide base sequence that will hybridize to
the sequence
selected from the group consisting of those set forth in SEQ ID NO:1 and SEQ
ID N0:2, or a
functional derivative thereof.
In preferred embodiments, the nucleic acid probe hybridizes to nucleic acid
encoding
at least 12, 32, 75, 90, 105, 120, 150, 200, 250, 300 or 350 contiguous amino
acids, wherein
the nucleic acid sequence is selected from the group consisting of SEQ ID NO:1
and SEQ ID
N0:2, or a functional derivative thereof
Methods for using the probes include detecting the presence or amount of
kinase
RNA in a sample by contacting the sample with a nucleic acid probe under
conditions such
that hybridization occurs and detecting the presence or amount of the probe
bound to kinase
RNA. The nucleic acid duplex formed between the probe and a nucleic acid
sequence coding
for a kinase polypeptide may be used in the identification of the sequence of
the nucleic acid
detected (Nelson et al., in Nonisotopic DNA Probe Techniques, Academic Press,
San Diego,
Kricka, ed., p. 275, 1992, hereby incorporated by reference herein in its
entirety, including
any drawings, figures, or tables). Kits for performing such methods may be
constructed to
include a container means having disposed therein a nucleic acid probe.
Methods for using the probes also include using these probes to find, for
example, the
full-length clone of each of the predicted kinases by techniques known to one
skilled in the
art. These clones will be useful for screening for small molecule compounds
that inhibit the
catalytic activity of the encoded kinase with potential utility in treating
cancers, immune-
related diseases and disorders, cardiovascular disease, brain or neuronal-
associated diseases,
and metabolic disorders. More specifically disorders including cancers of
tissues or blood, or
hematopoietic origin, particularly those involving breast, colon, lung,
prostate, cervical,
brain, ovarian, bladder, or kidney; central or peripheral nervous system
diseases and
conditions including migraine, pain, sexual dysfunction, mood disorders,
attention disorders,
cognition disorders, hypotension, and hypertension; psychotic and neurological
disorders,
including anxiety, schizophrenia, manic depression, delirium, dementia, severe
mental
retardation and dyskinesias, such as Huntington's disease or Tourette's
Syndrome;
neurodegenerative diseases including Alzheimer's, Parkinson's, multiple
sclerosis, and
amyotrophic lateral sclerosis; viral or non-viral infections caused by HIV-I,
HIV-2 or other
viral- or prion-agents or fungal- or bacterial- organisms; metabolic disorders
including
-22-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Diabetes and obesity and their related syndromes, among others; cardiovascular
disorders
including reperfusion restenosis, coronary thrombosis, clotting disorders,
unregulated cell
growth disorders, atherosclerosis; ocular disease including glaucoma,
retinopathy, and
macular degeneration; inflammatory disorders including rheumatoid arthritis,
chronic
S inflammatory bowel disease, chronic inflammatory pelvic disease, multiple
sclerosis, asthma,
osteoarthritis, psoriasis, atherosclerosis, rhinitis, autoimmunity, and organ
transplant
rej ection.
In another aspect, the invention describes a recombinant cell or tissue
comprising a
nucleic acid molecule encoding a kinase polypeptide having an amino acid
sequence selected
from the group consisting of those set forth in SEQ ID N0:3 and 4. In such
cells, the nucleic
acid may be under the control of the genomic regulatory elements, or may be
under the
control of exogenous regulatory elements including an exogenous promoter. By
"exogenous"
it is meant a promoter that is not normally coupled ih vivo transcriptionally
to the coding
sequence for the kinase polypeptides.
The polypeptide is preferably a fragment of the protein encoded by an amino
acid
sequence selected from the group consisting of those set forth in SEQ ID N0:3
and 4. By
"fragment," is meant an amino acid sequence present in a kinase polypeptide.
Preferably,
such a sequence comprises at least 32, 45, 50, 60, 100, 200, or 300 contiguous
amino acids of
a sequence selected from the group consisting of those set forth in SEQ ID
N0:3 and 4.
In another aspect, the invention features an isolated, enriched, or purified
kinase polypeptide having the amino acid sequence selected from the group
consisting of
those set forth in SEQ ID N0:3 and 4.
By "isolated" in reference to a polypeptide is meant a polymer of 6
(preferably 12,
more preferably 18, most preferably 25, 32, 40, or 50) or more amino acids
conjugated to
each other, including polypeptides that are isolated from a natural source or
that are
synthesized. In certain aspects longer polypeptides are preferred, such as
those comprising
100, 200, 300, 400, 450, 500, 550, 600, 700, 800, 900 or more contiguous amino
acids,
including an amino acid sequence selected from the group consisting of those
set forth in
SEQ ID N0:3 and 4 .
The isolated polypeptides of the present invention are unique in the sense
that they are
not found in a pure or separated state in nature. Use of the term "isolated"
indicates that a
naturally occurring sequence has been removed from its normal cellular
environment. Thus,
-23-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
the sequence may be in a cell-free solution or placed in a different cellular
environment. The
term does not imply that the sequence is the only amino acid chain present,
but that it is
essentially free (about 90 - 95% pure at least) of non-amino acid-based
material naturally
associated with it.
By the use of the term "enriched" in reference to a polypeptide is meant that
the
specific amino acid sequence constitutes a significantly higher fraction (2-
to 5-fold) of the
total amino acid sequences present in the cells or solution of interest than
in normal or
diseased cells or in the cells from which the sequence was taken. This could
be caused by a
person by preferential reduction in the amount of other amino acid sequences
present, or by a
preferential increase in the amount of the specific amino acid sequence of
interest, or by a
combination of the two. However, it should be noted that enriched does not
imply that there
are no other amino acid sequences present, just that the relative amount of
the sequence of
interest has been significantly increased. The term "significantly" here is
used to indicate
that the level of increase is useful to the person making such an increase,
and generally means
an increase relative to other amino acid sequences of about at least 2-fold,
more preferably at
least 5- to 10-fold or even more. The term also does not imply that there is
no amino acid
sequence from other sources. The other source of amino acid sequences may, for
example,
comprise amino acid sequence encoded by a yeast or bacterial genome~ or a
cloning vector
such as pUCl9. The term is meant to cover only those situations in which man
has
intervened to increase the proportion of the desired amino acid sequence.
It is also advantageous for some purposes that an amino acid sequence be in
purified
form. The teen "purified" in reference to a polypeptide does not require
absolute purity
(such as a homogeneous preparation); instead, it represents an indication that
the sequence is
relatively purer than in the natural environment. Compared to the natural
level this level
should be at least 2-to 5-fold greater (e.g., in terms of mg/mL). Purification
of at least one
order of magnitude, preferably two or three orders, and more preferably four
or five orders of
magnitude is expressly contemplated. The substance is preferably free of
contamination at a
functionally significant level, for example 90%, 95%, or 99% pure.
In preferred embodiments, the kinase polypeptide is a fragment of the protein
encoded
by an amino acid sequence selected from the group consisting of those set
forth in SEQ ID
N0:3 and 4 . Preferably, the kinase polypeptide contains at least 32, 45, 50,
60, 100, 200, or
-24-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
300 contiguous amino acids of a sequence selected from the group consisting of
those set
forth in SEQ ID NO: 3 and 4 , or a functional derivative thereof.
In preferred embodiments, the kinase polypeptide comprises an amino acid
sequence
having (a) an amino acid sequence selected from the group consisting of those
set forth in
SEQ ID N0:3 and 4 ; and (b) an amino acid sequence selected from the group
consisting of
those set forth in SEQ ID N0:3 and 4 , except that it lacks one or more of the
domains
selected from the group consisting of a C-terminal catalytic domain, an N-
terminal domain, a
catalytic domain, a C-terminal domain, a coiled-coil structure region, a
proline-rich region, a
spacer region, and a C-terminal tail.
The polypeptide can be isolated from a natural source by methods well-known in
the
art. The natural source may be mammalian, preferably human, preferably blood,
semen or
tissue, and the polypeptide may be synthesized using an automated polypeptide
synthesizer.
In some embodiments the invention includes a recombinant kinase polypeptide
having
(a) an amino acid sequence selected from the group consisting of those set
forth in SEQ ID
N0:3 and 4 . By "recombinant kinase polypeptide" is meant a polypeptide
produced by
recombinant DNA techniques such that it is distinct from a naturally occurring
polypeptide
either in its location (e.g., present in a different cell or tissue than found
in nature), purity or
structure. Generally, such a recombinant polypeptide will be present in a cell
in an amount
different from that normally observed in nature.
The polypeptides to be expressed in host cells may also be fusion proteins
which
include z~egions from heterologous proteins. Such.regions may be included to
allow, e.g.,
secretion, improved stability, or facilitated purification of the polypeptide.
For example, a
sequence encoding an appropriate signal peptide can be incorporated into
expression vectors.
A DNA sequence for a signal peptide (secretory leader) may be fused in-frame
to the
polynucleotide sequence so that the polypeptide is translated as a fusion
protein comprising
the signal peptide. A signal peptide that is functional in the intended host
cell promotes
extracellular secretion of the polypeptide. Preferably, the signal sequence
will be cleaved
from the polypeptide upon secretion of the polypeptide from the cell. Thus,
preferred fusion
proteins can be produced in which the N-terminus of a kinase polypeptide is
fused to a carrier
peptide.
In one embodiment, the polypeptide comprises a fusion protein which includes a
heterologous region used to facilitate purification of the polypeptide. Many
of the available
-25-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
peptides used for such a function allow selective binding of the fusion
protein to a binding
partner. A preferred binding partner includes one or more of the IgG binding
domains of
protein A are easily purified to homogeneity by affinity chromatography on,
for example,
IgG-coupled Sepharose. Alternatively, many vectors have. the advantage of
carrying a stretch
of histidine residues that can be expressed at the N-terminal or C-terminal
end of the target
protein, and thus the protein of interest can be recovered by metal chelation
chromatography.
A nucleotide sequence encoding a recognition site for a proteolytic enzyme
such as
enterokinase, factor X procollagenase or thrombine may immediately precede the
sequence
for a kinase polypeptide to permit cleavage of the fusion protein to obtain
the mature kinase
polypeptide. Additional examples of fusion-protein binding partners include,
but are not
limited to, the yeast I-factor, the honeybee melatin leader in s~ insect
cells, 6-His tag,
thioredoxin tag, hemaglutinin tag, GST tag, and OmpA signal sequence tag. As
will be
understood by one of skill in the art, the binding partner which recognizes
and binds to the
peptide may be any ion, molecule or compound including metal ions (e.g., metal
affinity
columns), antibodies, or fragments thereof, and any protein or peptide which
binds the
peptide, such as the FLAG tag.
In another aspect, the invention features an antibody (e.g., a monoclonal or
polyclonal
antibody) having specific binding affinity to a kinase polypeptide or a kinase
polypeptide
domain or fragment where the polypeptide is selected from the group having an
amino acid
sequence selected from the group consisting of those set forth in SEQ ID N0:3
and 4 . By
"specific binding affinity" is meant that the antibody binds to the target
kinase polypeptide
with greater affinity than it binds to other polypeptides under specified
conditions.
Antibodies or antibody fragments are polypeptides that contain regions that
can bind other
polypeptides. The term "specific binding affinity" describes an antibody that
binds to a
kinase polypeptide with greater affinity than it binds to other polypeptides
under specified
conditions.. Antibodies case be used to identify an endogenous source of
kinase polypeptides,
to monitor cell cycle regulation, and for immuno-localization of kinase
polypeptides within
the cell.
The term "polyclonal" refers to antibodies that are heterogenous populations
of
antibody molecules derived from the sera of animals immunized with an antigen
or an
antigenic functional derivative thereof. For the production of polyclonal
antibodies, various
-26-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
host animals may be immunized by injection with the antigen. Various adjuvants
may be
used to increase the immunological response, depending on the host species.
"Monoclonal antibodies" are substantially homogenous populations of antibodies
to a
particular antigen. They may be obtained by any technique which provides for
the
production of antibody molecules by continuous cell lines in culture.
Monoclonal antibodies
may be obtained by methods known to those skilled in the art (I~ohler et al.,
Natuf~e 256:495-
497, 1975, and U.S. Patent No. 4,37 6,110, both of which are hereby
incorporated by
reference herein in their entirety including any figures, tables, or
drawings).
The term "antibody fragment" refers to a portion of an antibody, often the
hypervariable region and portions of the surrounding heavy and light chains,
that displays
specific binding affinity for a particular molecule. A hypervariable region is
a portion of an
antibody that physically binds to the polypeptide target.
Antibodies or antibody fragments having specific binding affinity to a kinase
polypeptide of the invention may be used in methods for detecting the presence
and/or
amount of kinase polypeptide in a sample by probing the sample with the
antibody under
conditions suitable for kinase-antibody immunocomplex formation and detecting
the
presence and/or amount of the antibody conjugated to the kinase polypeptide.
Diagnostic kits
for performing such methods may be constructed to include antibodies or
antibody fragments
specific for the kinase as well as a conjugate of a binding partner of the
antibodies or the
antibodies themselves.
An antibody or antibody fragment with specific binding affinity to a kinase
polypeptide of the invention can be isolated, enriched, or purified from a
prokaryotic or
eukaryotic organism. Routine methods known to those skilled in the art enable
production of
antibodies or antibody fragments, in both prokaryotic and eukaryotic
organisms. Purification,
enrichment, and isolation of antibodies, which are polypeptide molecules, are
described
above.
Antibodies having specific binding affinity to a kinase polypeptide of the
invention
may be used in methods for detecting the presence and/or amount of kinase
polypeptide in a
sample by contacting the sample with the antibody under conditions such that
an
immunocomplex forms and detecting the presence and/or amount of the antibody
conjugated
to the kinase polypeptide. Diagnostic kits for performing such methods may be
constructed
to include a first container containing the antibody and a second container
having a conjugate
-27-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
of a binding partner of the antibody and a label, such as, for example, a
radioisotope. The
diagnostic kit may also include notification of an FDA approved use and
instructions
therefor.
h1 another aspect, the invention features a hybridoma which produces an
antibody
S having specific binding affinity to a kinase polypeptide or a kinase
polypeptide domain,
where the polypeptide is selected from the group having an amino acid sequence
selected
from the group consisting of those set forth in SEQ ID N0:3 and 4 . By
"hybridoma" is
meant an immortalized cell line that is capable of secreting an antibody, for
example an
antibody to a kinase of the invention. In preferred embodiments, the antibody
to the kinase
comprises a sequence of amino acids that is able to specifically bind a kinase
polypeptide of
the invention.
In another aspect, the present invention is also directed to kits comprising
antibodies
that bind to a polypeptide encoded by any of the nucleic acid molecules
described above, and
a negative control antibody.
The term "negative control antibody" refers to an antibody derived from
similar
source as the antibody having specific binding affinity, but where it displays
no binding
affinity to a polypeptide of the invention.
In another aspect, the invention features a kinase polypeptide binding agent
able to
bind to a kinase polypeptide selected from the group having (a) an amino acid
sequence
selected from the group consisting of those set forth in SEQ ID N0:3 and 4 .
The binding
agent is preferably a purified antibody that recognizes an epitope present on
a kinase
polypeptide of the invention. Other binding agents include molecules that bind
to kinase
polypeptides and analogous molecules that bind to a kinase polypeptide. Such
binding agents
may be identified by using assays that measure kinase binding partner
activity, such as those
that measure PDGFR activity.
The invention also features a method for screening for human cells containing
a
kinase polypeptide of the invention or an equivalent sequence. The method
involves
identifying the novel polypeptide in human cells using techniques that are
routine and
standard in the art, such as those described herein for identifying the
kinases of the invention
(e.g., cloning, Southern or Northern blot analysis, ifZ situ hybridization,
PCR amplification,
etc.).
_~8_
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
In another aspect, the invention features methods for identifying a substance
that
modulates kinase activity comprising the steps of (a) contacting a kinase
polypeptide
selected from the group having an amino acid sequence selected from the group
consisting of
those set forth in SEQ ID N0:3 and 4 with a test substance; (b) measuring the
activity of said
polypeptide; and (c) determining whether said substance modulates the activity
of said
polypeptide. The skilled artisan will appreciate that the kinase polypeptides
of the invention,
including, for example, a portion of a full-length sequence such as a
catalytic domain or a
portion thereof, are useful for the identification of a substance which
modulates kinase
activity. Those kinase polypeptides having a functional activity (e.g.,
catalytic activity as
defined herein) are useful for identifying a substance that modulates kinase
activity.
The term "modulates" refers to the ability of a compound to alter the function
of a
kinase of the invention. A modulator preferably activates or inhibits the
activity of a kinase
of the invention depending on the concentration of the compound exposed to the
kinase.
The term "modulates" also refers to altering the function of kinases of the
invention
by increasing or decreasing the probability that a complex forms between the
kinase and a
natural binding partner. A modulator preferably increases the probability that
such a complex
forms between the kinase and the natural binding partner, more preferably
increases or
decreases the probability that a complex forms between the kinase and the
natural binding
partner depending on the concentration of the compound exposed to the kinase,
and most
preferably decreases the probability that a complex forms between the kinase
and the natural
binding partner.
The term "activates" refers to increasing the cellular activity of the kinase.
The term
inhibit refers to decreasing the cellular activity of the kinase. Kinase
activity is preferably the
interaction with a natural binding partner.
The term "complex" refers to an assembly of at least two molecules bound to
one
another. Signal transduction complexes often contain at least two protein
molecules bound to
one another. For instance, a protein tyrosine receptor protein kinase, GRB2,
SOS, RAF, and
RAS assemble to form a signal transduction complex in response to a mitogenic
ligand.
The term "natural binding partner" refers to polypeptides, lipids, small
molecules, or
nucleic acids that bind to kinases in cells. A change in the interaction
between a kinase and a
natural binding partner can manifest itself as an increased or decreased
probability that the
-29-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
interaction forms, or an increased or decreased concentration of
kinase/natural binding
partner complex.
The term "contacting" as used herein refers to mixing a solution comprising
the test
compound with a liquid medium bathing the cells of the methods. The solution
comprising
the compound may also comprise another component, such as dimethyl sulfoxide
(DMSO),
which facilitates the uptake of the test compound or compounds into the cells
of the methods.
The solution comprising the test compound may be added to the medium bathing
the cells by
utilizing a delivery apparatus, such as a pipette-based device or syringe-
based device.
In another aspect, the invention features methods for identifying a substance
that
modulates kinase activity in a cell comprising the steps of: (a) expressing a
kinase
polypeptide in a cell, wherein said polypeptide is selected from the group
having an amino
acid sequence selected from the group consisting of those set forth in SEQ ID
N0:3 and 4 ;
(b) adding a test substance to said cell; and (c) monitoring a change in cell
phenotype or the
interaction between said polypeptide and a natural binding partner. The
skilled artisan will
appreciate that the kinase polypeptides of the invention, including, for
example, a portion of a
full-length sequence such as a catalytic domain or a portion thereof, are
useful for the
identification of a substance which modulates kinase activity. Those kinase
polypeptides
having a functional activity (e.g., catalytic activity as defined herein) are
useful for
identifying a substance that modulates kinase activity.
The term "expressing" as used herein refers to the production of kinases of
the
invention from a nucleic acid vector containing kinase genes within a cell.
The nucleic acid
vector is transfected into cells using well known techniques in the art as
described herein.
Another aspect of the instant invention is directed to methods of identifying
compounds that bind to kinase polypeptides of the present invention,
comprising contacting
the lcinase polypeptides with a compound, and determining whether the compound
binds the
kinase polypeptides. Binding can be determined by binding assays which are
well known to
the skilled artisan, including, but not limited to, gel-shift assays, Western
blots, radiolabeled
competition assay, phage-based expression cloning, co-fractionation by
chromatography, co-
precipitation, cross linking, interaction trap/two-hybrid analysis,
southwestern analysis,
ELISA, and the like, which are described in, for example, Current Protocols ih
Molecular
Biology, 1999, John Wiley & Sons, NY, which is incorporated herein by
reference in its
-3 0-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
entirety. The compounds to be screened include, but are not limited to,
compounds of
extracellular, intracellular, biological or chemical origin.
The methods of the invention also embrace compounds that are attached to a
label,
such as a radiolabel (e.g., lash 3sS~ 32P~ 33P~ 3H)~ a fluorescence label, a
chemiluminescent
label, an enzymic label and an immunogenic label. The kinase polypeptides
employed in
such a test may either be free in solution, attached to a solid support, borne
on a cell surface,
located intracellularly or associated with a portion of a cell. One skilled in
the art can, for
example, measure the formation of complexes between a kinase polypeptide and
the
compound being tested. Alternatively, one skilled in the art can examine the
diminution in
complex formation between a kinase polypeptide and its substrate caused by the
compound
being tested.
Other assays can be used to examine enzymatic activity including, but not
limited to,
photometric, radiometric, HPLC, electrochemical, and the like, which are
described in, for
example, Ehzvme Assavs: A Practical Abproach, eds. R. Eisenthal and M. J.
Danson, 1992,
Oxford University Press, which is incorporated herein by reference in its
entirety.
Another aspect of the present invention is directed to methods of identifying
compounds which modulate (i.e., increase or decrease) activity of a kinase
polypeptide
comprising contacting the kinase polypeptide with a compound, and determining
whether the
compound modifies activity of the kinase polypeptide. As described herein, the
kinase
polypeptides of the invention include a portion of a full-length sequence,
such as a catalytic
domain, as defined herein. In some instances, the kinase polypeptides of the
invention
comprise less than the entire catalytic domain, yet exhibit kinase or kinase-
like activity.
These compounds are also referred to as "modulators of protein kinases." The
activity in the
presence of the test compound is measured to the activity in the absence of
the test
compound. Where the activity of a sample containing the test compound is
higher than the
activity in a sample lacking the test compound, the compound will have
increased the
activity. Similarly, where the activity of a sample containing the test
compound is lower than
the activity in the sample lacking the test compound, the compound will have
inhibited the
activity.
The present invention is particularly useful for screening compounds by using
a
kinase polypeptide in any of a variety of drug screeiung techniques. The
compounds to be
screened include, but are not limited to, extracellular, intracellular,
biological or chemical
-31-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
origin. The kinase polypeptide employed in such a test may be in any form,
preferably, free
in solution, attached to a solid support, borne on a cell surface or located
intracellularly. One
skilled in the art can, for example, measure the formation of complexes
between a kinase
polypeptide and the compound being tested. Alternatively, one skilled in the
art can examine
the diminution in complex formation between a kinase polypeptide and its
substrate caused
by the compound being tested.
The activity of kinase polypeptides of the invention can be determined by, for
example, examining the ability to bind or be activated by chemically
synthesised peptide
ligands. Alternatively, the activity of the kinase polypeptides can be assayed
by examining
their ability to bind metal ions such as calcium, hormones, chemokines,
neuropeptides,
neurotransmitters, nucleotides, lipids, odorants, and photons. Thus,
modulators of the kinase
polypeptide's activity may alter a kinase function, such as a binding property
of a kinase or
an activity such as signal transduction or membrane localization.
Tn various embodiments of the method, the assay may take the form of a yeast
growth
assay, an Aequorin assay, a Luciferase assay, a mitogenesis assay, a MAP
Kinase activity
assay, as well as other binding or function-based assays of kinase activity
that are generally
known in the art. In several of these embodiments, the invention includes any
of the receptor
and non-receptor protein tyrosine kinases, receptor and non-receptor protein
phosphatases,
polypeptides containing SRC homology 2 and 3 domains, phosphotyrosine binding
proteins
(SRC homology 2 (SH2) and phosphotyrosine binding (PTB and PH) domain
contaiung
proteins), proline-rich binding proteins (SH3 domain containing proteins),
GTPases,
phosphodiesterases, phospholipases, prolyl isomerases, proteases, Ca2+ binding
proteins,
CAMP binding proteins, guanyl cyclases, adenylyl cyclases, NO generating
proteins,
nucleotide exchange factors, and transcription factors. Biological activities
of kinases
according to the invention include, but are not limited to, the binding of a
natural or a
synthetic ligand, as well as any one of the functional activities of kinases
known in the art.
Non-limiting examples of kinase activities include transmembrane signaling of
various
forms, which may involve kinase binding interactions and/or the exertion of an
influence over
signal transduction.
The modulators of the invention exhibit a variety of chemical structures,
which can be
generally grouped into mimetics of natural kinase ligands, and peptide and non-
peptide
allosteric effectors of kinases. The invention does not restrict the sources
for suitable
-32-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
modulators, which may be obtained from natural sources such as plant, animal
or mineral
extracts, or non-natural sources such as small molecule libraries, including
the products of
combinatorial chemical approaches to library construction, and peptide
libraries.
The use of cDNAs encoding kinases in drug discovery programs is well-known;
assays capable of testing thousands of unknown compounds per day in high-
throughput
screens (HTSs) are thoroughly documented. The literature is replete with
examples of the use
of radiolabelled ligands in HTS binding assays for drug discovery (see
Williams, Medicinal
Research Reviews, 1991, Il, 147-184.; Sweetnam, et al., J. Natural Products,
1993, 56, 441-
455 for review). Recombinant receptors are preferred for binding assay HTS
because they
allow for better specificity (higher relative purity), provide the ability to
generate large
amounts of receptor material, and can be used in a broad variety of formats
(see Hodgson,
BiolTechnology, 1992, 10, 973-980; each of which is incorporated herein by
reference in its
entirety).
A variety of heterologous systems is available for functional expression of
recombinant receptors that are well known to those skilled in the art. Such
systems include
bacteria (Strosberg, et al., Trends in Pharmacological Sciences, 1992, 13, 95-
98), yeast
(Pausch, Trends in Biotechnology, 1997,15, 487-494), several kinds of insect
cells (Vanden
Broeck, Int. Rev. Cytology, 1996, 164, 189-268), amphibian cells (Jayawickreme
et al.,
Current Opinion in Biotechnology, 1997, 8, 629-634) and several mammalian cell
lines
(CHO, HEK293, COS, etc.; see Gerhardt, et al., Eur. J. Pharmacology, 1997,
334, 1-23).
These examples do not preclude the use of other possible cell expression
systems, including
cell lines obtained from nematodes (PCT application WO 98/37177).
An expressed kinase can be used for HTS binding assays in conjunction with its
defined ligand, in this case the corresponding peptide that activates it. The
identified peptide
is labeled with a suitable radioisotope, including, but not limited to, lash
sH~ ssS or 3aP, by
methods that are well known to those skilled in the art. Alternatively, the
peptides may be
labeled by well-known methods with a suitable fluorescent derivative (Baindur,
et al., Drug
Dev. Res., 1994, 33, 373-398; Rogers, Drug Discovery Today, 1997, 2, 156-160).
Radioactive ligand specifically bound to the receptor in membrane preparations
made from
the cell line expressing the recombinant protein can be detected in HTS assays
in one of
several standard ways, including filtration of the receptor-ligand complex to
separate bound
ligand from unbound ligand (Williams, Med. Res. Rev., 1991, Il, 147-184.;
Sweetnam, et al.,
-33-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
J. Natural Products, 1993, 56, 441-455). Alternative methods include a
scintillation
proximity assay (SPA) or a FlashPlate format in which such separation is
unnecessary
(Nakayama, Cuf°. Opinion Drug Disc. Dev., 1998, l, 85-91 Bosse, et al.,
J. Biomolecular
Screening, 1998, 3, 285-292.). Binding of fluorescent ligands can be detected
in various
ways, including fluorescence energy transfer (FRET), direct
spectrophotofluorometric
analysis of bound ligand, or fluorescence polarization (Rogers, Drug Discovery
Today, 1997,
2, 156-160; Hill, Cur. Opinion Drug Disc. Dev., 1998, 1, 92-97).
The kinases and natural binding partners required for functional expression of
heterologous kinase polypeptides can be native constituents of the host cell
or can be
introduced through well-known recombinant technology. The kinase polypeptides
can be
intact or chimeric. The kinase activation results in the stimulation or
inhibition of other native
proteins, events that can be linked to a measurable response.
Examples of such biological responses include, but are not limited to, the
following:
the ability to survive in the absence of a limiting nutrient in specifically
engineered yeast
cells (Pausch, Trends in Biotechnology, 1997, 1 S, 487-494); changes in
intracellular Ca2+
concentration as measured by fluorescent dyes (Murphy, et al., Cur. Opinion
Drug Disc.
Dev., 1998, 1, 192-199). Fluorescence changes can also be used to monitor
ligand-induced
changes in membrane potential or intracellular pH; an automated system
suitable for HTS has
been described for these purposes (Schroeder, et al., J. Biomolecular
Screening, 1996, l, 75-
80). Assays are also available for the measurement of common second but these
are not
generally preferred for HTS.
The invention contemplates a multitude of assays to screen and identify
inhibitors of
ligand binding to kinase polypeptides. In one example, the kinase polypeptide
is
immobilized and interaction with a binding partner is assessed in the presence
and absence of
a candidate modulator such as an inhibitor compound. In another example,
interaction
between the kinase polypeptide and its binding partner is assessed in a
solution assay, both in
the presence and absence of a candidate inhibitor compound. In either assay,
an inhibitor is
identified as a compound that decreases binding between the kinase polypeptide
and its
natural binding partner. Another contemplated assay involves a variation of
the di-hybrid
assay wherein an inhibitor of protein/protein interactions is identified by
detection of a
positive signal in a transformed or transfected host cell, as described in PCT
publication
-34-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
number WO 95/20652, published August 3, 1995 and is included by reference
herein
including any figures, tables, or drawings.
Candidate modulators contemplated by the invention include compounds selected
from libraries of either potential activators or potential inhibitors. There
are a number of
different libraries used for the identification of small molecule modulators,
including: (1)
chemical libraries, (2) natural product libraries, and (3) combinatorial
libraries comprised of
random peptides, oligonucleotides or organic molecules. Chemical libraries
consist of
random chemical structures, some of which are analogs of known compounds or
analogs of
compounds that have been identified as "hits" or "leads" in other drug
discovery screens,
while others are derived from natural products, and still others arise from
non-directed
synthetic organic chemistry. Natural product libraries are collections of
microorganisms,
animals, plants, or marine organisms which are used to create mixtures for
screening by: (1)
fermentation and extraction of broths from soil, plant or marine
microorganisms or (2)
extraction of plants or marine organisms. Natural product libraries include
polyketides, non-
ribosomal peptides, and variants (non-naturally occurring) thereof. For a
review, see Scieyace
282:63-68 (1998). Combinatorial libraries are composed of large numbers of
peptides,
oligonucleotides, or organic compounds as a mixture. These libraries are
relatively easy to
prepare by traditional automated synthesis methods, PCR, cloning, or
proprietary synthetic
methods. Of particular interest are non-peptide combinatorial libraries. Still
other libraries
of interest include peptide, protein, peptidomimetic, multiparallel synthetic
collection,
recombinatorial, and polypeptide libraries. For a review of combinatorial
chemistry and
libraries created therefrom, see Myers, Cu~~. Opih. Biotec7Znol. 8:701-707
(1997).
Identification of modulators through use of the various libraries described
herein permits
modification of the candidate "hit" (or "lead") to optimize the capacity of
the "hit" to
modulate activity.
Still other candidate inhibitors contemplated by the invention can be designed
and
include soluble forms of binding partners, as well as such binding partners as
chimeric, or
fusion, proteins. A "binding partner" as used herein broadly encompasses both
natural
binding partners as described above as well as chimeric polypeptides, peptide
modulators
other than natural ligands, antibodies, antibody fragments, and modified
compounds
comprising antibody domains that are immunospecific for the expression product
of the
identified kinase gene.
-35-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Other assays may be used to identify specific peptide ligands of a kinase
polypeptide,
including assays that identify ligands of the target protein through measuring
direct binding
of test ligands to the target protein, as well as assays that identify ligands
of target proteins
through affinity ultrafiltration with ion spray mass spectroscopy/HPLC methods
or other
physical and analytical methods. Alternatively, such binding interactions are
evaluated
indirectly using the yeast two-hybrid system described in Fields et al.,
Nature, 340:245-246
(1989), and Fields et al., Trends i~ Genetics, 10:286-292 (1994), both of
which are
incorporated herein by reference. The two-hybrid system is a genetic assay for
detecting
interactions between two proteins or polypeptides. It can be used to identify
proteins that
bind to a known protein of interest, or to delineate domains or residues
critical for an
interaction. Variations on this methodology have been developed to clone genes
that encode
DNA binding proteins, to identify peptides that bind to a protein, and to
screen for drugs.
The two-hybrid system exploits the ability of a pair of interacting proteins
to bring a
transcription activation domain into close proximity with a DNA binding domain
that binds
to an upstream activation sequence (UAS) of a reporter gene, and is generally
performed in
yeast. The assay requires the construction of two hybrid genes encoding (1) a
DNA-binding
domain that is fused to a first protein and (2) an activation domain fused to
a second protein.
The DNA-binding domain targets the first hybrid protein to the UAS of the
reporter gene;
however, because most proteins lack an activation domain, this DNA-binding
hybrid protein
does not activate transcription of the reporter gene. The second hybrid
protein, which
contains the activation domain, cannot by itself activate expression of the
reporter gene
because it does not bind the UAS. However, when both hybrid proteins are
present, the
noncovalent interaction of the first and second proteins tethers the
activation domain to the
UAS, activating transcription of the reporter gene. For example, when the
first protein is a
kinase gene product, or fragment thereof, that is known to interact with
another protein or
nucleic acid, this assay can be used to detect agents that interfere with the
binding interaction.
Expression of the reporter gene is monitored as different test agents are
added to the system.
The presence of an inhibitory agent results in lack of a reporter signal.
When the function of the kinase polypeptide gene product is unknown and no
ligands
are known to bind the gene product, the yeast two-hybrid assay can also be
used to identify
proteins that bind to the gene product. In an assay to identify proteins that
bind to a kinase
polypeptide, or fragment thereof, a fusion polynucleotide encoding both a
kinase polypeptide
-36-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
(or fragment) and a UAS binding domain (i.e., a first protein) may be used. In
addition, a
large number of hybrid genes each encoding a different second protein fused to
an activation
domain are produced and screened in the assay. Typically, the second protein
is encoded by
one or more members of a total cDNA or genomic DNA fusion library, with each
second
protein coding region being fused to the activation domain. This system is
applicable to a
wide variety of proteins, and it is not even necessary to know the identity or
function of the
second binding protein. The system is highly sensitive and can detect
interactions not
revealed by other methods; even transient interactions may trigger
transcription to produce a
stable mRNA that can be repeatedly translated to yield the reporter protein.
Other assays may be used to search for agents that bind to the target protein.
One
such screening method to identify direct binding of test ligands to a target
protein is described
in U.S. Patent No. 5,585,277, incorporated herein by reference. This method
relies on the
principle that proteins generally exist as a mixture of folded and unfolded
states, and
continually alternate between the two states. When a test ligand binds to the
folded form of a
target protein (i.e., when the test ligand is a ligand of the target protein),
the target protein
molecule bound by the ligand remains in its folded state. Thus, the folded
target protein is
present to a greater extent in the presence of a test ligand which binds the
target protein, than
in the absence of a ligand. Binding of the ligand to the target protein can be
determined by
any method which distinguishes between the folded and unfolded states of the
target protein.
The function of the target protein need not be known in order for this assay
to be performed.
Virtually any agent can be assessed by this method as a test ligand,
including, but not limited
to, metals, polypeptides, proteins, lipids, polysaccharides, polynucleotides
and small organic
molecules.
Another method for identifying ligands of a target protein is described in
Wieboldt et
al., Anal. Chefn., 69:1683-1691 (1997), incorporated herein by reference. This
technique
screens combinatorial libraries of 20-30 agents at a time in solution phase
for binding to the
target protein. Agents that bind to the target protein are separated from
other library
components by simple membrane washing. The specifically selected molecules
that are
retained on the filter are subsequently liberated from the target protein and
analyzed by
HPLC and pneumatically assisted electrospray (ion spray) ionization mass
spectroscopy.
This procedure selects library components with the greatest affinity for the
target protein, and
is particularly useful for small molecule libraries.
-37-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
In preferred embodiments of the invention, methods of screening for compounds
which modulate kinase activity comprise contacting test compounds with kinase
polypeptides
and assaying for the presence of a complex between the compound and the kinase
polypeptide. In such assays, the ligand is typically labelled. After suitable
incubation, free
ligand is separated from that present in bound form, and the amount of free or
uncomplexed
label is a measure of the ability of the particular compound to bind to the
kinase polypeptide.
In another embodiment of the invention, high throughput screening for
compounds
having suitable binding affinity to kinase polypeptides is employed. Briefly,
large numbers
of different small peptide test compounds are synthesised on a solid
substrate. The peptide
test compounds are contacted with the kinase polypeptide and washed. Bound
kinase
polypeptide is then detected by methods well known in the art. Purified
polypeptides of the
invention can also be coated directly onto plates for use in the
aforementioned drug screening
techniques. In addition, non-neutralizing antibodies can be used to capture
the protein and
immobilize it on the solid support.
Other embodiments of the invention comprise using competitive screening assays
in
which neutralizing antibodies capable of binding a polypeptide of the
invention specifically
compete with a test compound for binding to the polypeptide. In this manner,
the antibodies
can be used to detect the presence of any peptide that shares one or more
antigenic
determinants with a kinase polypeptide. Radiolabeled competitive binding
studies are
described in A.H. Lin et al. Antimicrobial Agents and Chemotherapy, 1997, vol.
41, no. 10.
pp. 2127-213 l, the disclosure of which is incorporated herein by reference in
its entirety.
In another aspect, the invention provides methods for treating a disease by
administering to a patient in need of such treatment a substance that
modulates the activity of
a kinase polypeptide selected from the group consisting of those set forth in
SEQ ID N0:3
and 4 , as well as the full-length polypeptide thereof, or a portion of any of
these sequences
that retains functional activity, as described herein. Preferably the disease
is selected from
the group consisting of cancers, immune-elated diseases and disorders,
cardiovascular
disease, brain or neuronal-associated diseases, and metabolic disorders. More
specifically
these diseases include cancer of tissues, blood, or hematopoietic origin,
particularly those
involving breast, colon, lung, prostate, cervical, brain, ovarian, bladder, or
kidney; central or
peripheral nervous system diseases and conditions including migraine, pain,
sexual
dysfunction, mood disorders, attention disorders, cognition disorders,
hypotension, and
-38-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
hypertension; psychotic and neurological disorders, including anxiety,
schizophrenia, manic
depression, delirium, dementia, severe mental retardation and dyskinesias,
such as
Huntington's disease or Tourette's Syndrome; neurodegenerative diseases
including
Alzheimer's, Parkinson's, Multiple sclerosis, and Amyotrophic lateral
sclerosis; viral or non-
viral infections caused by HIV-1, HIV-2 or other viral- or prion-agents or
fungal- or
bacterial- orgaiusms; metabolic disorders including Diabetes and obesity and
their related
syndromes, among others; cardiovascular disorders including reperfusion
restenosis,
coronary thrombosis, clotting disorders, unregulated cell growth disorders,
atherosclerosis;
ocular disease including glaucoma, retinopathy, and macular degeneration;
inflammatory
disorders including rheumatoid arthritis, chronic inflammatory bowel disease,
chronic
inflammatory pelvic disease, multiple sclerosis, asthma, osteoarthritis,
psoriasis,
atherosclerosis, rhinitis, autoimmunity, and organ transplant rejection.
In preferred embodiments, the invention provides methods for treating or
preventing a
disease or disorder by administering to a patient in need of such treatment a
substance that
modulates the activity of a kinase polypeptide having an amino acid sequence
selected from
the group consisting of those set forth in SEQ ID N0:3 and 4 , as well as the
full-length
polypeptide thereof, or a portion of any of these sequences that retains
functional activity, as
described herein. Preferably, the disease is selected from the group
consisting of cancers,
immune-related diseases and disorders, cardiovascular disease, brain or
neuronal-associated
diseases, and metabolic disorders. More specifically these diseases include
cancer of tissues,
blood, or hematopoietic origin, particularly those involving breast, colon,
lung, prostate,
cervical, brain, ovarian, bladder, or kidney; central or peripheral nervous
system diseases and
conditions including migraine, pain, sexual dysfunction, mood disorders,
attention disorders,
cognition disorders, hypotension, and hypertension; psychotic and neurological
disorders,
including anxiety, schizophrenia, manic depression, delirium, dementia, severe
mental
retardation and dyskinesias, such as Huntington's disease or Tourette's
Syndrome;
neurodegenerative diseases including Alzheimer's, Parkinson's, Multiple
sclerosis, and
Amyotrophic lateral sclerosis; viral or non-viral infections caused by HIV-1,
HIV-2 or other
viral- or prion-agents or fungal- or bacterial- organisms; metabolic disorders
including
Diabetes and obesity and their related syndromes, among others; cardiovascular
disorders
including reperfusion restenosis, coronary thrombosis, clotting disorders,
unregulated cell
growth disorders, atherosclerosis; ocular disease including glaucoma,
retinopathy, and
-39-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
macular degeneration; inflammatory disorders including rheumatoid arthritis,
chronic
inflammatory bowel disease, chronic inflammatory pelvic disease, multiple
sclerosis, asthma,
osteoarthritis, psoriasis, atherosclerosis, rhinitis, autoimmunity, and organ
transplant
rej ection.
The invention also features methods of treating or preventing a disease or
disorder by
administering to a patient in need of such treatment a substance that
modulates the activity of
a kinase polypeptide having an amino acid sequence selected from the group
consisting of
those set forth in SEQ ID N0:3 and 4 , as well as the full-length polypeptide
thereof, or a
portion of any of these sequences that retains functional activity, as
described herein.
Preferably the disease is selected from the group consisting of cancers,
immune-related
diseases and disorders, cardiovascular disease, brain or neuronal-associated
diseases, and
metabolic disorders. More specifically these diseases include cancer of
tissues, blood, or
hematopoietic origin, particularly those involving breast, colon, lung,
prostate, cervical,
brain, ovarian, bladder, or kidney; central or peripheral nervous system
diseases and
conditions including migraine, pain, sexual dysfunction, mood disorders,
attention disorders,
cognition disorders, hypotension, and hypertension; psychotic and neurological
disorders,
including anxiety, schizophrenia, manic depression, delirium, dementia, severe
mental
retardation and dyskinesias, such as Huntington's disease or Tourette's
Syndrome;
neurodegenerative diseases including Alzheimer's, Parkinson's, Multiple
sclerosis, and
Amyotrophic lateral sclerosis; viral or non-viral infections caused by HIV-1,
HIV-2 or other
viral- or prion-agents or fungal- or bacterial- organisms; metabolic disorders
including
Diabetes and obesity and their related syndromes, among others; cardiovascular
disorders
including reperfusion restenosis, coronary thrombosis, clotting disorders,
unregulated cell
growth disorders, atherosclerosis; ocular disease including glaucoma,
retinopathy, and
macular degeneration; inflammatory disorders including rheumatoid arthritis,
chronic
inflammatory bowel disease, chronic inflammatory pelvic disease, multiple
sclerosis, asthma,
osteoarthritis, psoriasis, atherosclerosis, rhinitis, autoixmnunity, and organ
transplant
rej ection.
The invention also features methods of treating or preventing a disease or
disorder by
administering to a patient in need of such treatment a substance that
modulates the activity of
a kinase polypeptide having an amino acid sequence selected from the group
consisting those
set forth in SEQ ID N0:3 and 4 , as well as the full-length polypeptide
thereof, or a portion of
-40-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
any of these sequences that retains functional activity, as described herein.
Preferably the
disease is selected from the group consisting of immune-related diseases and
disorders,
cardiovascular disease, and cancer. More preferably these diseases include
cancer of tissues,
blood, or hematopoietic origin, particularly those involving breast, colon,
lung, prostate,
cervical, brain, ovarian, bladder, or kidney; central or peripheral nervous
system diseases and
conditions including migraine, pain, sexual dysfunction, mood disorders,
attention disorders,
cognition disorders, hypotension, and hypertension; psychotic and neurological
disorders,
including anxiety, schizophrenia, manic depression, delirium, dementia, severe
mental
retardation and dyskinesias, such as Huntington's disease or Tourette's
Syndrome;
neurodegenerative diseases including Alzheimer's, Parkinson's, Multiple
sclerosis, and
Amyotrophic lateral sclerosis; viral or non-viral infections caused by HIV-1,
HIV-2 or other
viral- or prion-agents or fungal- or bacterial- organisms; metabolic disorders
including
Diabetes and obesity and their related syndromes, among others; cardiovascular
disorders
including reperfusion restenosis, coronary thrombosis, clotting disorders,
unregulated cell
growth disorders, atherosclerosis; ocular disease including glaucoma,
retinopathy, and
macular degeneration; inflammatory disorders including rheumatoid arthritis,
chronic
inflammatory bowel disease, chronic inflammatory pelvic disease, multiple
sclerosis, asthma,
osteoarthritis, psoriasis, atherosclerosis, rhinitis, autoimmunity, and organ
transplant
rejection. Most preferably, the immune-related diseases and disorders are
selected from the
group consisting of rheumatoid arthritis, chronic inflammatory bowel disease,
chronic
inflammatory pelvic disease, multiple sclerosis, asthma, osteoarthritis,
psoriasis,
atherosclerosis, rhinitis, autoimmunity, and organ transplantation.
Substances useful for treatment of kinase-related disorders or diseases
preferably
show positive results in one or more ih vitro assays for an activity
corresponding to treatment
of the disease or disorder in question (Examples of such assays are provided
in the references
in section VI, below; and in Example 7, herein). Examples of substances that
can be
screened for favorable activity are provided and referenced in section VI,
below. The
substances that modulate the activity of the kinases preferably include, but
are not limited to,
antisense oligonucleotides and inhibitors of protein kinases, as determined by
methods and
screens referenced in section VI and Example 7, below.
The term "preventing" refers to decreasing the probability that an organism
contracts
or develops an abnormal condition.
-41-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
The term "treating" refers to having a therapeutic effect and at least
partially
alleviating or abrogating an abnormal condition in the organism.
The term "therapeutic effect" refers to the inhibition or activation factors
causing or
contributing to the abnormal condition. A therapeutic effect relieves to some
extent one or
more of the symptoms of the abnormal condition. In reference to the treatment
of abnormal
conditions, a therapeutic effect can refer to one or more of the following:
(a) an increase in
the proliferation, growth, and/or differentiation of cells; (b) inhibition
(i.e., slowing or
stopping) of cell death; (c) inhibition of degeneration; (d) relieving to some
extent one or
more of the symptoms associated with the abnormal condition; and (e) enhancing
the
function of the affected population of cells. Compounds demonstrating efficacy
against
abnormal conditions can be identified as described herein.
The term "abnormal condition" refers to a function in the cells or tissues of
an
organism that deviates from their normal functions in that organism. An
abnornlal condition
can relate to cell proliferation, cell differentiation, or cell survival.
Abnormal cell proliferative conditions include cancers such as fibrotic and
mesangial
disorders, abnormal angiogenesis and vasculogenesis, wound healing, psoriasis,
diabetes
mellitus, and inflammation.
Abnormal differentiation conditions include, but are not limited to
neurodegenerative
disorders, slow wound healing rates, and slow tissue grafting healing rates.
Abnormal cell survival conditions relate to conditions in which programmed
cell
death (apoptosis) pathways are activated or abrogated. A number of protein
kinases are
associated with the apoptosis pathways. Aberrations in the function of any one
of the protein
kinases could lead to cell immortality or premature cell death.
The term "aberration", in conjunction with the function of a kinase in a
signal
transduction process, refers to a kinase that is over- or under-expressed in
an organism,
mutated such that its catalytic activity is lower or higher than wild-type
protein kinase
activity, mutated such that it can no longer interact with a natural binding
partner, is no
longer modified by another protein kinase or protein phosphatase, or no longer
interacts with
a natural binding partner.
The term "administering" relates to a method of incorporating a compound into
cells
or tissues of an organism. The abnormal condition can be prevented or treated
when the cells
or tissues of the organism exist within the organism or outside of the
organism. Cells
-42-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
existing outside the organism can be maintained or grown in cell culture
dishes. For cells
harbored within the organism, many techniques exist in the art to administer
compounds,
including (but not limited to) oral, parenteral, dermal, injection, and
aerosol applications. For
cells outside of the organism, multiple techniques exist in the art to
administer the
compounds, including (but not limited to) cell microinjection techniques,
transformation
techniques, and carrier techniques.
The abnormal condition can also be prevented or treated by administering a
compound to a group of cells having an aberration in a signal transduction
pathway to an
organism. The effect of administering a compound on organism function can then
be
monitored. The organism is preferably a mouse, rat, rabbit, guinea pig, or
goat, more
preferably a monkey or ape, and most preferably a human.
In another aspect, the invention features methods for detection of a kinase
polypeptide
in a sample as a diagnostic tool for diseases or disorders, wherein the method
comprises the
steps of: (a) contacting the sample with a nucleic acid probe which hybridizes
under
hybridization assay conditions to a nucleic acid target region of a kinase
polypeptide having
an amino acid sequence selected from the group consisting of those set forth
in SEQ ID N0:3
and 4 , said probe comprising the nucleic acid sequence encoding the
polypeptide, fragments
thereof, and the complements of the sequences and fragments; and (b) detecting
the presence
or amount of the probeaarget region hybrid as an indication of the disease.
In preferred embodiments of the invention, the disease or disorder is selected
from the
group consisting of rheumatoid arthritis, arteriosclerosis, autoimmune
disorders, organ
transplantation, myocardial infarction, cardiomyopathies, stroke, renal
failure, oxidative
stress-related neurodegenerative disorders, and cancer.
The kinase "target region" is the nucleotide base sequence selected from the
group
consisting of those set forth in SEQ ID NO:1 and SEQ ID N0:2, or the
corresponding full-
length sequences, a functional derivative thereof, or a fragment thereof, to
which the nucleic
acid probe will specifically hybridize. Specific hybridization indicates that
in the presence of
other nucleic acids the probe only hybridizes detectably with the kinase of
the invention's
target region. Putative target regions can be identified by methods well known
in the art
consisting of alignment and comparison of the most closely related sequences
in the database.
In preferred embodiments the nucleic acid probe hybridizes to a kinase target
region
encoding at least 6, 12, 75, 90, 105, 120, 150, 200, 250, 300 or 350
contiguous amino acids of
-43-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
a sequence selected from the group consisting of those set forth in SEQ ID
N0:3 and 4 , or
the corresponding full-length amino acid sequence, a portion of any of these
sequences that
retains fractional activity, as described herein, or a functional derivative
thereof.
Hybridization conditions should be such that hybridization occurs only with
the kinase genes
in the presence of other nucleic acid molecules. Under stringent hybridization
conditions
only highly complementary nucleic acid sequences hybridize. Preferably, such
conditions
prevent hybridization of nucleic acids having more than 1 or 2 mismatches out
of 20
contiguous nucleotides. Such conditions are defined supra.
The diseases for which detection of kinase genes in a sample could be
diagnostic
include diseases in which kinase nucleic acid (DNA and/or RNA) is amplified in
comparison
to normal cells. By "amplification" is meant increased numbers of kinase DNA
or RNA in a
cell compared with normal cells. In normal cells, kinases are typically found
as single copy
genes. In selected diseases, the chromosomal location of the kinase genes may
be amplified,
resulting in multiple copies of the gene, or amplification. Gene amplification
can lead to
amplification of kinase RNA, or kinase RNA can be amplified in the absence of
kinase DNA
amplification.
"Amplification" as it refers to RNA can be the detectable presence of kinase
RNA in
cells, since in some normal cells there is no basal expression of kinase RNA.
In other normal
cells, a basal level of expression of kinase exists, therefore in these cases
amplification is the
detection.of at least 1-2-fold, and preferably more, kinase RNA, compared to
the basal level.
The diseases that could be diagnosed by detection of kinase nucleic acid in a
sample
preferably include cancers. The test samples suitable for nucleic acid probing
methods of the
present invention include, for example, cells or nucleic acid extracts of
cells, or biological
fluids. The samples used in the above-described methods will vary based on the
assay
format, the detection method and the nature of the tissues, cells or extracts
to be assayed.
Methods for preparing nucleic acid extracts of cells are well known in the art
and can be
readily adapted in order to obtain a sample that is compatible with the method
utilized.
The invention also features a method for detection of a kinase polypeptide in
a sample
as a diagnostic tool for a disease or disorder, wherein the method comprises:
(a) comparing a
nucleic acid target region encoding the kinase polypeptide in a sample, where
the kinase
polypeptide has an amino acid sequence selected from the group consisting
those set forth in
SEQ ID N0:3 and SEQ ID N0:4 , or one or more fragments thereof, with a control
nucleic
-44-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
acid target region encoding the kinase polypeptide, or one or more fragments
thereof; and (b)
detecting differences in sequence or amount between the target region and the
control target
region, as an indication of the disease or disorder. Preferably the disease is
selected from the
group consisting of cancers, immune-related diseases and disorders,
cardiovascular disease,
brain or neuronal-associated diseases, and metabolic disorders. More
specifically these
diseases include cancer of tissues, blood, or hematopoietic origin,
particularly those involving
breast, colon, lung, prostate, cervical, brain, ovarian, bladder, or kidney;
central or peripheral
nervous system diseases and conditions including migraine, pain, sexual
dysfunction, mood
disorders, attention disorders, cognition disorders, hypotension, and
hypertension; psychotic
and neurological disorders, including anxiety, schizophrenia, manic
depression, delirium,
dementia, severe mental retardation and dyskinesias, such as Huntington's
disease or
Tourette's Syndrome; neurodegenerative diseases including Alzheimer's,
Parkinson's,
Multiple sclerosis, and Amyotrophic lateral sclerosis; viral or non-viral
infections caused by
HIV-1, HIV-2 or other viral- or prion-agents or fungal- or bacterial-
organisms; metabolic
disorders including Diabetes and obesity and their related syndromes, among
others;
cardiovascular disorders including reperfusion restenosis, coronary
thrombosis, clotting
disorders, unregulated cell growth disorders, atherosclerosis; ocular disease
including
glaucoma, retinopathy, and macular degeneration; inflammatory disorders
including
rheumatoid arthritis, chronic inflammatory bowel disease, chronic inflammatory
pelvic
disease, multiple sclerosis, asthma, osteoarthritis, psoriasis,
atherosclerosis, rhinitis,
autoimmunity, and organ transplant rejection.
The term "comparing" as used herein refers to identifying discrepancies
between the
nucleic acid target region isolated from a sample, and the control nucleic
acid target region.
The discrepancies can be in the nucleotide sequences, e.g. insertions,
deletions, or point
mutations, or in the amount of a given nucleotide sequence. Methods to
determine these
discrepancies in sequences are well-known to one of ordinary skill in the axt.
The "control"
nucleic acid target region refers to the sequence or amount of the sequence
found in normal
cells, e.g. cells that are not diseased as discussed previously.
The summary of the invention described above is not limiting and other
features and
advantages of the invention will be apparent from the following detailed
description of the
invention, and from the claims.
-45-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
BRIEF DESCRIPTION OF THE FIGURES
Figures 1A and B show the nucleotide sequences for human protein kinases
oriented
in a 5' to 3' direction (SEQ ID N0:1, SEQ ID N0:2).
Figures 2A and B show the amino acid sequences for the human protein kinases
encoded by SEQ ID No. 1 and 2 in the direction of translation (SEQ ID N0:3 and
4). If a
predicted stop codons is within the coding region, it is indicated by an 'x.'
DETAILED DESCRIPTION OF THE INVENTION
The invention provides, inter alia, protein kinase and kinase-like genes, as
well as
fragments thereof, which have been identified in genomic databases. In part,
the invention
provides nucleic acid molecules that are capable of encoding polypeptides
having a kinase or
kinase-like activity. By reference to Tables 1 though 8, below, genes of the
invention can be
better understood. The invention additionally provides a number of different
embodiments,
such as those described below.
Nucleic Acids
Associations of chromosomal localizations for mapped genes with amplicons
implicated in cancer are based on literature searches (PubMed
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi), OMIM searches (Online
Mendelian
Inheritance in Man, http://www.ncbi.nlm.nih.gov/Omim/searchomim.html) and the
comprehensive database of cancer amplicons maintained by Knuutila, et al.
(Knuutila, et al.,
DNA copy number amplifications in human neoplasms. Review of comparative
genomic
hybridization studies. Am J Pathol 152:1107-1123, 1998.
http://www.helsinki.fi/~lgl www/CMG.html). For many of the mapped genes, the
cytogenetic region from I~nuutila is listed followed by the number of cases
with documented
amplification and the total number of cases studied.
For single nucleotide polymorphisms, an accession number is given if the SNP
is
documented in dbSNP (the database of single nucleotide polymorphisms)
maintained at
-46-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
NCBI (http://www.ncbi.nhn.nih.~ov/SNP/index.html). The accession number for
SNP can
be used to retrieve the full SNP-containing sequence from this site.
Nucleic Acid Probes, Methods, and Kits for Detection of Kinases
The invention additionally provides nucleic acid probes and uses therefor. A
nucleic
acid probe of the present invention may be used to probe an appropriate
chromosomal or
cDNA library by usual hybridization methods to obtain other nucleic acid
molecules of the
present invention. A chromosomal DNA or cDNA library may be prepared from
appropriate
cells according to recognized methods in the art (cf. "Molecular Cloning: A
Laboratory
Manual", second edition, Cold Spring Harbor Laboratory, Sambrook, Fritsch, &
Maniatis,
eds., 1989).
In the alternative, chemical synthesis can be carried out in order to obtain
nucleic acid
probes having nucleotide sequences which correspond to N-terminal and C-
terminal portions
of the amino acid sequence of the polypeptide of interest. The synthesized
nucleic acid
probes may be used as primers in a polymerise chain reaction (PCR) carried out
in
accordance with recognized PCR techniques, essentially according to
PCR'Protocols, "A
Guide to Methods and Applications", Academic Press, Michael, et al., eds.,
1990, utilizing
the appropriate chromosomal or cDNA library to obtain the fragment of the
present
invention.
One skilled in the art can readily design such probes based on the sequence
disclosed
herein using methods of computer alignment and sequence analysis known in the
art
("Molecular Cloning: A Laboratory Manual", 1989, supra). The hybridization
probes of the
present invention can be labeled by standard labeling techniques such as with
a radiolabel,
enzyme label, fluorescent label, biotin-avidin label, chemiluminescence, and
the like. After
hybridization, the probes may be visualized using known methods.
The nucleic acid probes of the present invention include RNA, as well as DNA
probes, such probes being generated using techniques known in the art. The
nucleic acid
probe may be irmnobilized on a solid support. Examples of such solid supports
include, but
are not limited to, plastics such as polycarbonate, complex carbohydrates such
as agarose and
sepharose, and acrylic resins, such as polyacrylamide and latex beads.
Techniques for
coupling nucleic acid probes to such solid supports axe well known in the art.
The test samples suitable for nucleic acid probing methods of the present
invention
include, for example, cells or nucleic acid extracts of cells, or biological
fluids. The samples
-47-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
used in the above=described rr~ethods will vary based on the assay format, the
detection
method and the nature of the tissues, cells or extracts to be assayed. Methods
for preparing
nucleic acid extracts of cells are well known in the art and can be readily
adapted in order to
obtain a sample which is compatible with the method utilized.
One method of detecting the presence of nucleic acids of the invention in a
sample
comprises (a) contacting said sample with the above-described nucleic acid
probe under
conditions such that hybridization occurs, and (b) detecting the presence of
said probe bound
to said nucleic acid molecule. One skilled in the art would select the nucleic
acid probe
according to techniques known in the art as described above. Samples to be
tested include
but should not be limited to RNA samples of human tissue.
A kit for detecting the presence of nucleic acids of the invention in a sample
comprises at least one container means having disposed therein the above-
described nucleic
acid probe. The kit may further comprise other containers comprising one or
more of the
following: wash reagents and reagents capable of detecting the presence of
bound nucleic
acid probe. Examples of detection reagents include, but are not limited to
radiolabelled
probes, enzymatic labeled probes (horseradish peroxidase, alkaline
phosphatase), and affinity
labeled probes (biotin, avidin, or steptavidin). Preferably, the kit further
comprises
instructions for use.
In detail, a compartmentalized kit includes any kit in which reagents are
contained in
separate containers. Such containers include small glass containers, plastic
containers or
strips of plastic or paper. Such containers allow the efficient transfer of
reagents from one
compartment to another compartment such that the samples and reagents are not
cross-
contaminated and the agents or solutions of each container can be added in a
quantitative
fashion from one compartment to another. Such containers will include a
container which
will accept the test sample, a container which contains the probe or primers
used in the assay,
containers which contain wash reagents (such as phosphate buffered saline,
Tris-buffers, and
the like), and containers which contain the reagents used to detect the
hybridized probe,
bound antibody, amplified product, or the like. One skilled in the art will
readily recognize
that the nucleic acid probes described in the present invention can readily be
incorporated
into one of the established kit formats which are well known in the art.
-48-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
CATEGORIZATION OF THE POLYPEPTIDES ACCORDING TO THE INVENTION
For a number of protein kinases of the invention, there is provided a
classification of
the protein class and family to which it belongs, a summary of non-catalytic
protein motifs,
as well as a chromosomal location. This information is useful in determing
function,
regulation and/or therapeutic utility for each of the proteins. Amplification
of chromosomal
region can be associated with various cancers. For amplicons discussed in this
application,
the source of information was Knuutila, et al (Knuutila S, Bjorkqvist A-M,
Autio K,
Tarkkanen M, Wolf M, Monni O, Szymanska J, Larramendy ML, Tapper J, Pere H, El-
Rifai
W, Hemmer S, Wasenius V-M, Vidgren V & Zhu Y: DNA copy number amplifications
in
human neoplasms. Review of comparative genomic hybridization studies. Am J
Pathol
152:1107-1123, 199. http://www.helsinki.fi/~lgl www/CMG.html).
The lcinase classification and protein domains often reflect pathways,
cellulax roles, or
1 S mechanisms of up- or down-stream regulation. Also disease-relevant genes
often occur in
families of related genes. For example, if one member of a kinase family
functions as an
oncogene, a tumor suppressor, or has been found to be disrupted in an immune,
neurologic,
cardiovascular, or metabolic disorder, frequently other family members may
play a related
role.
The expression analysis organizes kinases into groups that are
transcriptionally
upregulated in tumors and those that are more restricted to specific tumor
types such as
melanoma or prostate. This analysis also identifies genes that are regulated
in a cell cycle
dependent manner, and are therefore likely to be involved in maintaining cell
cycle
checkpoints, entry, progression, or exit from mitosis, oversee DNA repair, or
are involved in
cell proliferation and genome stability. Expression data also can identify
genes expressed in
endothelial sources or other tissues that suggest a role in angiogenesis,
thereby implicating
them as targets for control of diseases that have an angiogenic component,
such as cancer,
endometriosis, retinopathy and macular degeneration, and various ischemic or
vascular
pathologies. A proteins' role in cell survival can also be suggested based on
restricted
expression in cells subjected to external stress such as oxidative damage,
hypoxia, drugs such
as cisplatinum, or irradiation. Metastases-associated genes can be implicated
when
expression is restricted to invading regions of a tumor, or is only seen in
local or distant
-49-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
metastases compared to the primary tumor, or when a gene is upregulated during
cell culture
models of invasion, migration, or motility.
Chromosomal location can identify candidate targets for a tumor amplicon or a
tumor-
suppressor locus. Summaries of prevalent tumor amplicons are available in the
literature, and
can identify tumor types to experimentally be confirmed to contain amplified
copies of a
kinase gene which localizes to an adjacent region.
As described herein, the polypeptides of the present invention can be
classified, for
example, among two different groups. The salient features related to the
biological and
clinical implications of these different groups are described hereafter in
more general teens.
A more specific characterization of the polypeptides of the invention,
including
potential biological and clinical implications, is provided, e.g., in EXAMPLES
2a and 2b.
CLASSIFICATION OF POLYPEPTIDES EXHIBITING KINASE ACTIVITY
The following information also is referenced, for example, at Tables 1 and 2.
AGC Group
Family members are described that belong to the AGC group of protein kinases.
The
AGC group of protein kinases includes as its major prototypes protein kinase C
(PKC),
cAMP-dependent protein kinases (PKA), the G protein-coupled receptor kinases
(ARK and
rhodopsin kinase (GRKl)) as well as p70S6K and AKT.
Potential biological and cliucal implications of the novel AGC group protein
kinases
are described below. A novel AGC group kinase includes SEQ ID N0:4.
The STE Group
Family members are described that belong to the STE group of protein kinases.
The
STE group of protein kinases includes, as its major prototypes, the NEK
kinases, as well as
the STE11 and STE20 family of sterile protein kinases.
Potential biological and clinical implications of the novel protein kinases
belonging to
the STE group are described in below. A novel STE protein kinase includes: SEQ
m NO: 3.
THERAPEUTIC METHODS ACCORDING TO THE INVENTION.'
-50-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Diagnostics:
The invention provides methods for detecting a polypeptide in a sample as a
diagnostic tool for diseases or disorders, wherein the method comprises the
steps of (a)
contacting the sample with a nucleic acid probe which hybridizes under
hybridization assay
conditions to a nucleic acid target region of a polypeptide selected from the
group consisting
of SEQ m N0:3 or 4, said probe comprising the nucleic acid sequence encoding
the
polypeptide, fragments thereof, and the complements of the sequences and
fragments; and (b)
detecting the presence or amount of the probeaarget region hybrid as an
indication of the
disease.
In preferred embodiments of the invention, the disease or disorder is selected
from the
group consisting of rheumatoid arthritis, atherosclerosis, autoimmune
disorders, organ
transplantation, myocardial infarction, cardiomyopathies, stroke, renal
failure, oxidative
stress-related neurodegenerative disorders, metabolic disorder including
diabetes,
reproductive disorders including infertility, and cancer.
Hybridization conditions should be such that hybridization occurs only with
the genes
in the presence of other nucleic acid molecules. Under stringent hybridization
conditions
only highly complementary nucleic acid sequences hybridize. Preferably, such
conditions
prevent hybridization of nucleic acids having 1 or 2 mismatches out of 20
contiguous
nucleotides. Such conditions are defined supra.
The diseases for wluch detection of genes in a sample could be diagnostic
include
diseases in which nucleic acid (DNA and/or RNA) is amplified in comparison to
normal
cells. By "amplification" is meant increased numbers of DNA or RNA in a cell
compared
with normal cells.
"Amplification" as it refers to RNA can be the detectable presence of RNA in
cells,
since in some normal cells there is no basal expression of RNA. In other
normal cells, a basal
level of expression exists, therefore in these cases amplification is the
detection of at least 1-
2-fold, and preferably more, compared to the basal level.
The diseases that could be diagnosed by detection of nucleic acid in a sample
preferably include cancers. The test samples suitable for nucleic acid probing
methods of the
present invention include, for example, cells or nucleic acid extracts of
cells, or biological
fluids. The samples used in the above-described methods will vary based on the
assay
format, the detection method and the nature of the tissues, cells or extracts
to be assayed.
-51-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Methods for preparing nucleic acid extracts of cells are well known in the art
and can be
readily adapted in order to obtain a sample that is compatible with the method
utilized.
Antibodies, Hybridomas, Methods of Use and Kits for Detection of Kinases
The present invention relates to an antibody having binding affinity to a
kinase of the
invention. The polypeptide may have the amino acid sequence selected from the
group
consisting of those set forth in SEQ m N0:3 or 4 , or a functional derivative
thereof, or at
least 9 contiguous amino acids thereof (preferably, at least 20, 30, 35, or 40
contiguous amino
acids thereof).
The present invention also relates to an antibody having specific binding
affinity to a
kinase of the invention. Such an antibody may be isolated by comparing its
binding affinity
to a kinase of the invention with its binding affinity to other polypeptides.
Those which bind
selectively to a kinase of the invention would be chosen for use in methods
requiring a
distinction between a kinase of the invention and other polypeptides. Such
methods could
include, but should not be limited to, the analysis of altered kinase
expression in tissue
containing other polypeptides.
The kinases of the present invention can be used in a variety of procedures
and
methods, such as for the generation of antibodies, for use in identifying
pharmaceutical
compositions, and for studying DNA/protein interaction.
The kinases of the present invention can be used to produce antibodies or
hybridomas.
One skilled in the art will recognize that if an antibody is desired, such a
peptide could be
generated as described herein and used as an immunogen. The antibodies of the
present
invention include monoclonal and polyclonal antibodies, as well fragments of
these
antibodies, and humanized forms. Humanized forms of the antibodies of the
present
invention may be generated using one of the procedures known in the art such
as
chimerization or CDR grafting.
The present invention also relates to a hybridoma which produces the above-
described
monoclonal antibody, or binding fragment thereof. A hybridoma is an
immortalized cell line
which is capable of secreting a specific monoclonal antibody.
In general, techniques for preparing monoclonal antibodies and hybridomas are
well
known in the art (Campbell, "Monoclonal Antibody Technology: Laboratory
Techniques in
Biochemistry and Molecular Biology," Elsevier Science Publishers, Amsterdam,
The
-52-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Netherlands, 1984; St. Groth et al., J. Immunol. Methods 35:1-21, 1980). Any
animal
(mouse, rabbit, and the like) which is known to produce antibodies can be
immunized with
the selected polypeptide. Methods for immunization are well known in the art.
Such
methods include subcutaneous or intraperitoneal injection of the polypeptide.
One skilled in
the art will recognize that the amount of polypeptide used for immunization
will vary based
on the animal which is immunized, the antigenicity of the polypeptide and the
site of
inj ection.
The polypeptide may be modified or administered in an adjuvant in order to
increase
the peptide antigenicity. Methods of increasing the antigenicity of a
polypeptide are well
known in the art. Such procedures include coupling the antigen with a
heterologous protein
(such as globulin or (3-galactosidase) or through the inclusion of an adjuvant
during
immunization.
For monoclonal antibodies, spleen cells from the immunized animals are
removed,
fused with myeloma cells, such as SP2/0-Agl4 myeloma cells, and allowed to
become
monoclonal antibody producing hybridoma cells. Any one of a number of methods
well
known in the art can be used to identify the hybridoma cell which produces an
antibody with
the desired characteristics. These include screening the hybridomas with an
ELISA assay,
western blot analysis, or radioimmunoassay (Lutz et al., Exp. Cell Res.
175:109-124, 1988).
Hybridomas secreting the desired antibodies are cloned and the class and
subclass are
determined using procedures known in the art (Campbell, "Monoclonal Antibody
Technology: Laboratory Techniques in Biochemistry and Molecular Biology",
supra, 1984).
For polyclonal antibodies, antibody-containing antisera is isolated from the
immunized animal and is screened for the presence of antibodies with the
desired specificity
using one of the above-described procedures. The above-described antibodies
may be
detestably labeled. Antibodies can be detestably labeled through the use of
radioisotopes,
affinity labels (such as biotin, avidin, and the like), enzymatic labels (such
as horseradish
peroxidase, alkaline phosphatase, and the like) fluorescent labels (such as
FITC or
rhodamine, and the like), paramagnetic atoms, and the like. Procedures for
accomplishing
such labeling are well-known in the art, for example, see Stemberger et al.,
J. Histochem.
Cytoclaem. 18:315, 1970; Bayer et al., Meth. Ehzym. 62:308, 1979; Engval et
al., Immuhol.
109:129, 1972; Goding, J. Immuhol. Metla. 13:215, 1976. The labeled antibodies
of the
-53-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
present invention can be used for in vitYO, in vivo, and in situ assays to
identify cells or tissues
which express a specific peptide.
The above-described antibodies may also be immobilized on a solid support.
Examples of such solid supports include plastics such as polycarbonate,
complex
carbohydrates such as agarose and sepharose, acrylic resins such as
polyacrylamide and latex
beads. Techniques for coupling antibodies to such solid supports are well
known in the art
(Weir et al., "Handbook of Experimental Ixnrnunology" 4th Ed., Blackwell
Scientific
Publications, Oxford, England, Chapter 10, 1986; Jacoby et al., Meth. Enzyyn.
34, Academic
Press, N.Y., 1974). The immobilized antibodies of the present invention can be
used for in
vitro, in vivo, and in situ assays as well as in immunochromotography.
Furthermore, one skilled in the art can readily adapt currently available
procedures, as
well as the techniques, methods and kits disclosed herein with regard to
antibodies, to
generate peptides capable of binding to a specific peptide sequence in order
to generate
rationally designed antipeptide peptides (Hurby et al., "Application of
Synthetic Peptides:
Antisense Peptides", In Synthetic Peptides, A User's Guide, W.H. Freeman, NY,
pp. 289-307,
1992; I~aspczak et al., Biochemistry 28:9230-9238, 1989).
Anti-peptide peptides can be generated by replacing the basic amino acid
residues
found in the peptide sequences of the kinases of the invention with acidic
residues, while
maintaining hydrophobic and uncharged polar groups. For example, lysine,
arginine, and/or
histidine residues are replaced with aspartic acid or glutamic acid and
glutamic acid residues
are replaced by lysine, arginine or histidine.
The present invention also encompasses a method of detecting a kinase
polypeptide in
a sample, comprising: (a) contacting the sample with an above-described
antibody, under
conditions such that irmnunocomplexes form, and (b) detecting the presence of
said antibody
bound to the polypeptide. Iri detail, the methods comprise incubating a test
sample with one
or more of the antibodies of the present invention and assaying whether the
antibody binds to
the test sample. Altered levels of a kinase of the invention in a sample as
compared to
normal levels may indicate disease.
Conditions for incubating an antibody with a test sample vary. Incubation
conditions
depend on the format employed in the assay, the detection methods employed,
and the type
and nature of the antibody used in the assay. One skilled in the art will
recognize that any
one of the commonly available immunological assay formats (such as
radioimmunoassays,
-54-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
enzyme-linked immunosorbent assays, diffusion-based Ouchterlony, or rocket
immunofluorescent assays) can readily be adapted to employ the antibodies of
the present
invention. Examples of such assays can be found in Chard ("An Introduction to
Radioimmunoassay and Related Techniques" Elsevier Science Publishers,
Amsterdam, The
Netherlands, 1986), Bullock et al. ("Techniques in Immunocytochemistry,"
Academic Press,
Orlando, FL Vol. 1, 1982; Vol. 2, 1983; Vol. 3, 1985), Tijssen ("Practice and
Theory of
Enzyme Immunoassays: Laboratory Techniques in Biochemistry and Molecular
Biology,"
Elsevier Science Publishers, Amsterdam, The Netherlands, 1985).
The immunological assay test samples of the present invention include cells,
protein
or membrane extracts of cells, or biological fluids such as blood, serum,
plasma, or urine.
The test samples used in the above-described method will vary based on the
assay format,
nature of the detection method and the tissues, cells or extracts used as the
sample to be
assayed. Methods for preparing protein extracts or membrane extracts of cells
are well
known in the art and can readily be adapted in order to obtain a sample which
is testable with
the system utilized.
A kit contains all the necessary reagents to carry out the previously
described methods
of detection. The kit may comprise: (i) a first container means containing an
above-described
antibody, and (ii) second container means containing a conjugate comprising a
binding
partner of the antibody and a label. In another preferred embodiment, the kit
further
comprises one or more other containers comprising one or more of the
following: wash
reagents and reagents capable of detecting the presence of bound antibodies.
Examples of detection reagents include, but are not limited to, labeled
secondary
antibodies, or in the alternative, if the primary antibody is labeled, the
chromophoric,
enzymatic, or antibody binding reagents which are capable of reacting with the
labeled
antibody. The compartmentalized kit may be as described above for nucleic acid
probe kits.
One skilled in the art will readily recognize that the antibodies described in
the present
invention can readily be incorporated into one of the established kit formats
which are well
known in the art. '
Isolation of Compounds Capable of Interacting with Kinases
The present invention also relates to a method of detecting a compound capable
of
binding to a kinase of the invention comprising incubating the compound with a
kinase of the
-55-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
invention and detecting the presence of the compound bound to the kinase. The
compound
may be present within a complex mixture, for example, serum, body fluid, or
cell extracts.
The present invention also relates to a method of detecting an agonist or
antagonist of
kinase activity or kinase binding partner activity comprising incubating cells
that produce a
kinase of the invention in the presence of a compound and detecting changes in
the level of
kinase activity or kinase binding partner activity. The compounds thus
identified would
produce a change in activity indicative of the presence of the compound. The
compound may
be present within a complex mixture, for example, serum, body fluid, or cell
extracts. Once
the compound is identified it can be isolated using techniques well known in
the art.
Modulating polypeptide activity:
The invention additionally provides methods for treating a disease or abnormal
condition by administering to a patient in need of such treatment a substance
that modulates
the activity of a polypeptide selected from the group consisting of SEQ a7
N0:3 and 4.
Preferably, the disease is selected from the group consisting of rheumatoid
arthritis,
atherosclerosis, autoimmune disorders, organ transplantation, myocardial
infarction,
cardiomyopathies, stroke, renal failure, oxidative stress-related
neurodegenerative disorders,
metabolic and reproductive disorders, and cancer.
Substances useful for treatment of disorders or diseases preferably show
positive
results in one or more assays for an activity corresponding to treatment of
the disease or
disorder in question Substances that modulate the activity of the polypeptides
preferably
include, but are not limited to, antisense oligonucleotides and inhibitors of
protein kinases.
The term "preventing" refers to decreasing the probability that an organism
contracts
or develops an abnormal condition.
The term "treating" refers to having a therapeutic effect and at least
partially
alleviating or abrogating an abnormal condition in the organism.
The term "therapeutic effect" refers to the inhibition or activation factors
causing or
contributing to the abnormal condition. A therapeutic effect relieves to some
extent one or
more of the symptoms of the abnormal condition. In reference to the treatment
of abnormal
conditions, a therapeutic effect can refer to one or more of the following:
(a) an increase in
the proliferation, growth, and/or differentiation of cells; (b) inhibition (,
slowing or stopping)
-56-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
of cell death; (c) inhibition of degeneration; (d) relieving to some extent
one or more of the
symptoms associated with the abnormal condition; and (e) enhancing the
function of the
affected population of cells. Compounds demonstrating efficacy against
abnormal conditions
can be identified as described herein.
The term "abnormal condition" refers to a function in the cells or tissues of
an
organism that deviates from their normal functions in that organism. An
abnormal condition
can relate to cell proliferation, cell differentiation or cell survival. An
abnormal condition
may also include irregularities in cell cycle progression, i.e.,
irregularities in normal cell
cycle progression through mitosis and meiosis.
Abnormal cell proliferative conditions include cancers such as fibrotic and
mesangial
disorders, abnormal angiogenesis and vasculogenesis, wound healing, psoriasis,
diabetes
mellitus, and inflammation.
Abnormal differentiation conditions include, but are not limited to,
neurodegenerative
disorders, slow wound healing rates, and slow tissue grafting healing rates.
1 S Abnormal cell survival conditions may also relate to conditions in which
programmed
cell death (apoptosis) pathways are activated or abrogated. A number of
protein kinases are
associated with the apoptosis pathways. Aberrations in the function of any one
of the protein
kinases could lead to cell immortality or premature cell death.
The term "aberration", in conjunction with the function of a kinase in a
signal
transduction process, refers to a kinase that is over- or under-expressed in
an organism,
mutated such that its catalytic activity is lower or higher than wild-type
protein kinase
activity, mutated such that it can no longer interact with a natural binding
partner, is no
longer modified by another protein kinase or protein phosphatase, or no longer
interacts with
a natural binding partner.
The term "administering" relates to a method of incorporating a compound into
cells
or tissues of an organism. The abnormal condition can be prevented or treated
when the cells
or tissues of the organism exist within the organism or outside of the
organism. Cells
existing outside the organism can be maintained or grown in cell culture
dishes. For cells
harbored within the organism, many techniques exist in the art to administer
compounds,
including (but not limited to) oral, parenteral, dermal, injection, and
aerosol applications. For
cells outside of the organism, multiple techniques exist in the art to
administer the
-57-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
compounds, including (but not limited to) cell microinj ection techniques,
transformation
techniques and carrier techniques.
The abnormal condition can also be prevented or treated by administering a
compound to a group of cells having an aberration in a signal transduction
pathway to an
organism. The effect of administering a compound on organism function can then
be
monitored. The organism is preferably a mouse, rat, rabbit, guinea pig or
goat, more
preferably a monkey or ape, and most preferably a human.
The present invention also encompasses a method of agonizing (stimulating) or
antagonizing kinase associated activity in a mammal comprising administering
to said
mammal an agonist or antagonist to a kinase of the invention in an amount
sufficient to effect
said agonism or antagonism. A method of treating diseases in a mammal with an
agonist or
antagonist of the activity of one of the kinases of the invention comprising
,administering the
agonist or antagonist to a mammal in an amount sufficient to agonize or
antagonize kinase-
associated functions is also encompassed in the present application.
In an effort to discover novel treatments for diseases, biomedical researchers
and
chemists have designed, synthesized, and tested molecules that inhibit the
function of protein
kinases. Some small organic molecules form a class of compounds that modulate
the
function of protein kinases. Examples of molecules that have been reported to
inhibit the
function of protein kinases include, but are not limited to, bis monocyclic,
bicyclic or
heterocyclic aryl compounds (PCT WO 92/20642, published November 26, 1992 by
Maguire
et al.), vinylene-azaindole derivatives (PCT WO 94/14808, published July 7,
1994 by
Ballinari et al.), 1-cyclopropyl-4-pyridyl-quinolones (U.S. Patent No.
5,330,992), styryl
compounds (CT.S. Patent No. 5,217,999), styryl-substituted pyridyl compounds
(IJ.S. Patent
No. 5,302,606), certain quinazoline derivatives (EP Application No. 0 566 266
A1),
seleoindoles and selenides (PCT WO 94/03427, published February 17, 1994 by
Denny et
al.), tricyclic polyhydroxylic compounds (PCT WO 92/21660, published December
10, 1992
by Dow), and benzylphosphonic acid compounds (PCT WO 91/15495, published
October I7,
1991 by Dow et a~.
Compounds that can traverse cell membranes and are resistant to acid
hydrolysis are
potentially advantageous as therapeutics as they can become highly
bioavailable after being
administered orally to patients. However, many of these protein kinase
inhibitors only
-58-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
weakly inhibit the function of protein kinases. In addition, many inhibit a
variety of protein
kinases and will therefore cause multiple side-effects as therapeutics for
diseases.
Some indolinone compounds, however, form classes of acid resistant and
membrane
permeable organic molecules. WO 96/22976 (published August 1, 1996 by
Ballinari et al.)
describes hydrosoluble indolinone compounds that harbor tetralin, naphthalene,
quinoline,
and indole substituents fused to the oxindole ring. These bicyclic
substituents are in turn
substituted with polar moieties including hydroxylated alkyl, phosphate, and
ether moieties.
U.S. Patent Application Serial Nos. 08/702,232, filed August 23, 1996,
entitled "Indolinone
Combinatorial Libraries and Related Products and Methods for the Treatment of
Disease" by
Tang et al. (Lyon & Lyon Docket No. 221/187) and 08/485,323, filed June 7,
1995, entitled
"Benzylidene-Z-Indoline Compounds for the Treatment of Disease" by Tang et al.
(Lyon &
Lyon Docket No. 223/298) and International Patent Publications WO 96/40116,
published
December 19, 1996 by Tang, et al., and WO 96/22976, published August 1,. 1996
by Ballinari
et al., all of which are incorporated herein by reference in their entirety,
including any
drawings, figures, or tables, describe indolinone chemical libraries of
indolinone compounds
harboring other bicyclic moieties as well as monocyclic moieties. fused to the
oxindole ring.
Applications 08/702,232, filed August 23, 1996, entitled "Indolinone
Combinatorial Libraries
and Related Products and Methods for the Treatment of Disease" by Tang et al.
(Lyon &
Lyon Docket No. 221/187), 08/485,323, filed June 7, 1995, entitled
"Benzylidene-Z-Indoline
Compounds for the Treatment of Disease" by Tang et al. (Lyon & Lyon Docket No.
223/298), and WO 96/22976, published August 1, 1996 by Ballinari et al. teach
methods of
indolinone synthesis, methods of testing the biological activity of indolinone
compounds in
cells, and inhibition patterns of indolinone derivatives.
Other examples of substances capable of modulating kinase activity include,
but are
not limited to, tyrphostins, quinazolines, quinoxolines, and quinolines. The
quinazolines,
tyrphostins, quinolines, and quinoxolines referred to above include well known
compounds
such as those described in the literature. For example, representative
publications describing
quinazolines include Barker et al., EPO Publication No. 0 520 722 Al; Jones et
al., U.S.
Patent No. 4,447,608; Kabbe et al., U.S. Patent No. 4,757,072; Kaul and
Vougioukas, U.S.
Patent No. 5,316,553; Kreighbaum and Comer, U.S. Patent No. 4,343,940; Pegg
and
Wardleworth, EPO Publication No. 0 562 734 Al; Barker et al., (1991) PYOG. of
Am. Assoc.
for Cancer Research 32:327; Bertino, J.R., (1979) Cancer Research 3:293-304;
Bertino, J.R.,
-59-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
(1979) Cancer Research 9(2 part 1):293-304; Curtin et al., (1986) Br. J.
Cancer 53:361-368;
Fernandes et al., (1983) Cancer Research 43:1117-1123 ; Ferris et al. J. Org.
Chem.
44(2):173-178; Fry et al., (1994) Science 265:1093-1095; Jackman et al.,
(1981) Cancer
Research 51:5579-5586; Jones et al. J. Med. Chem. 29(6):1114-1118; Lee and
Skibo, (1987)
Biochemistry 26(23):7355-7362; Lemus et al., (1989) J. Org. Chenz. 54:3511-
3518; Ley and
Seng, (1975) Synthesis 1975:415-522; Maxwell et al., (1991) Magnetic Resonance
in
Medicine 17:189-196 ; Mini et al., (1985) Cancer Research 45:325-330; Phillips
and Castle,
J. (1980) Heterocyclic Chem. 17(19):1489-1596; Reece et al., (1977) Cancer
Research
47(11):2996-2999; Sculier et al., (1986) Cancer Immunol. and Immunother. 23,
A65; Sikora
et al., (1984) Cancers Letters 23:289-295; Sikora et al., (1988) Analytical
Biochem. 172:344-
355; all of which are incorporated herein by reference in their entirety,
including any
drawings.
Quinoxaline is described in Kaul and Vougioukas, U.S. Patent No. 5,316,553,
incorporated herein by reference in its entirety, including any drawings.
Quinolines are described in Dolle et al., (1994) J. Med. Chem. 37:2627-2629;
MaGuire, J. (1994) Med. Chem. 37:2129-2131; Burke et al., (1993) J. Med. Chem.
36:425-
432 ; and Burke et al. (1992) BioOrganic Med. Chem. Letters 2:1771-1774, all
of which are
incorporated by reference in their entirety, including any drawings.
Tyrphostins are described in Allen et al., (1993) Clin. Exp. Immunol. 91:141-
156;
Anafi et al., (1993) Blood 82:12, 3524-3529; Baker et al., (1992) J. Cell Sci.
102:543-555;
Bilder et al., (1991) Amen. Physiol. Soc. pp. 6363-6143:C721-0730; Brunton et
al., (1992)
Proceedings of Amer. Assoc. Cancer Rsch. 33:558; Bryckaert et al., (1992) Exp.
Cell
Research 199:255-261; Dong et al., (1993) J. Leukocyte Biology 53:53-60; Dong
et al.,
(1993) J. Immunol. 151(5):2717-2724; Gazit et al., (1989) J. Med. Chem. 32,
2344-2352;
Gazit et al., (1993) J. Med. Claena. 36:3556-3564; Kaur et al., (1994) Anti-
Cancer Drugs
5:213-222; King et al., (1991) Biochem. J. 275:413-418; Kuo et al., (1993)
Cancer Letters
74:197-202; Levitzki, A., (1992) The FASEB J. 6:3275-3282; Lyall et al.,
(1989) J. Biol.
Claem. 264:14503-14509; Peterson et al., (1993) The Prostate 22:335-345;
Pillemer et al.,
(1992) Int. J. Cancer 50:80-85; Posner et al., (1993) Molecular Pharmacology
45:673-683;
Rendu et al., (1992) Biol. Pharmacology 44(5):881-888; Sauro and Thomas,
(1993) Life
Sciences 53:371-376; Sauro and Thomas, (1993) J. Pharm. and Experimental
Therapeutics
267(3):119-1125; Wolbring et al., (1994) J. Biol. Chem. 269(36):22470-22472;
and Yoneda
-60-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
et al., (1991) Cancer Research 51:4430-4435; all of which are incorporated
herein by
reference in their entirety, including any drawings.
Other compounds that could be used as modulators include oxindolinones such as
those described in U.S. patent application Serial No. 08/702,232 filed August
23, 1996,
incorporated herein by reference in its entirety, including any drawings.
RECOMBINANT DNA TECHNOLOGY.
DNA Constructs Comprising a Kinase Nucleic Acid Molecule and
Cells Containing These Constructs:
The present invention also relates to a recombinant DNA molecule comprising,
5' to
3', a promoter effective to initiate transcription in a host cell and the
above-described nucleic
acid molecules. In addition, the present invention relates to a recombinant
DNA molecule
comprising a vector and an above-described nucleic acid molecule. The present
invention
also relates to a nucleic acid molecule comprising a transcriptional region
functional in a cell,
a sequence complementary to an RNA sequence encoding an amino acid sequence
corresponding to the above-described polypeptide, and a transcriptional
termination region
functional in said cell. The above-described molecules may be isolated and/or
purified DNA
molecules.
The present invention also relates to a cell or organism that contains an
above-
described nucleic acid molecule and thereby is capable of expressing a
polypeptide. The
polypeptide may be purified from cells which have been altered to express the
polypeptide.
A cell is said to be "altered to express a desired polypeptide" when the cell,
through genetic
manipulation, is made to produce a protein which it normally does not produce
or which the
cell normally produces at lower levels. One skilled in the art can readily
adapt procedures for
introducing and expressing either genomic, cDNA, or synthetic sequences into
either
eukaryotic or prokaryotic cells.
A nucleic acid molecule, such as DNA, is said to be "capable of expressing" a
polypeptide if it contains nucleotide sequences which contain transcriptional
and translational
regulatory information and such sequences are "operably linked" to nucleotide
sequences
which encode the polypeptide. An operable linkage is a linkage in which the
regulatory DNA
sequences and the DNA sequence sought to be expressed are connected in such a
way as to
-61-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
permit gene sequence expression. The precise nature of the regulatory regions
needed for
gene sequence expression may vary from organism to organism, but shall in
general include a
promoter region which, in prokaryotes, contains both the promoter (which
directs the
initiation of RNA transcription) as well as the DNA sequences which, when
transcribed into
RNA, will signal synthesis initiation. Such regions will normally include
those 5'-non-coding
sequences involved with initiation of transcription and translation, such as
the TATA box,
capping sequence, CAAT sequence, and the like.
If desired, the non-coding region 3' to the sequence encoding a kinase of the
invention
may be obtained by the above-described methods. This region may be retained
for its
transcriptional termination regulatory sequences, such as termination and
polyadenylation.
Thus, by retaining the 3'-region naturally contiguous to the DNA sequence
encoding a kinase
of the invention, the transcriptional termination signals may be provided.
Where the
transcriptional termination signals are not satisfactorily functional in the
expression host cell,
then a 3' region functional in the host cell may be substituted.
Two DNA sequences (such as a promoter region sequence and a sequence encoding
a
kinase of the invention) are said to be operably linked if the nature of the
linkage between the
two DNA sequences does not (1) result in the introduction of a frame-shift
mutation, (2)
interfere with the ability of the promoter region sequence to direct the
transcription of a gene
sequence encoding a kinase of the invention, or (3) interfere with the ability
of the gene
sequence of a kinase of the invention to be transcribed by the promoter region
sequence.
Thus, a promoter region would be operably linked to a DNA sequence if the
promoter were
capable of effecting transcription of that DNA sequence. Thus, to express a
gene encoding a
kinase of the invention, transcriptional and translational signals recognized
by an appropriate
host are necessary.
The present invention encompasses the expression of a gene encoding a kinase
of the
invention (or a functional derivative thereof) in either prokaryotic or
eukaryotic cells.
Prokaryotic hosts are, generally, very efficient and convenient for the
production of
recombinant proteins and are, therefore, one type of preferred expression
system for kinases
of the invention. Prokaryotes most frequently are represented by various
strains of E. coli.
However, other microbial strains may also be used, including other bacterial
strains.
In prokaryotic systems, plasmid vectors that contain replication sites and
control
sequences derived from a species compatible with the host may be used.
Examples of
-62-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
suitable plasmid vectors may include pBR322, pUC118, pUC119 and the like;
suitable phage
or bacteriophage vectors may include ~,gtl0, 7~gt1 l and the like; and
suitable virus vectors
may include pMAM-neo, pKRC and the like. Preferably, the selected vector of
the present
invention has the capacity to replicate in the selected host cell.
Recognized prokaryotic hosts include bacteria such as E. coli, Bacillus,
StYeptomyces,
Pseudomonas, Salmonella, Sernatia, and the like. However, under such
conditions, the
polypeptide will not be glycosylated. The prokaryotic host must be compatible
with the
replicon and control sequences in the expression plasmid.
To express a kinase of the invention (or a functional derivative thereof) in a
prokaryotic cell, it is necessary to operably link the sequence encoding the
kinase of the
invention to a functional prokaryotic promoter. Such promoters may be either
constitutive or,
more preferably, regulatable (i.e., inducible or derepressible). Examples of
constitutive
promoters include the int promoter of bacteriophage 7~, the bla promoter of
the ~3-lactamase
gene sequence of pBR322, and the cat promoter of the chloramphenicol acetyl
transferase
gene sequence of pPR325, and the like. Examples of inducible prokaryotic
promoters
include the major right and left promoters of bacteriophage 7~ (PL and PR),
the tip, ~,~~ecA, acZ,
7~acl, and gal promoters of E. coli, the a-amylase (Ulmanen et al., J.
Bacteniol. 162:176-182,
1985) and the S-28-specific promoters of B. subtilis (Gilman et al., Gene
Sequence 32:11-20,
1984), the promoters of the bacteriophages of Bacillus (Gryczan, in: The
Molecular Biology
of the Bacilli, Academic Press, Inc., NY, 1982), and Stneptomyces promoters
(Ward et al.,
Mol. Gen. Genet. 203:468-478, 1986). Prokaryotic promoters are reviewed by
Glick (Ind.
Micnobiot. 1:277-282, 1987), Cenatiempo (BioclZimie 68:505-516, 1986), and
Gottesman
(Ann. Rev. Genet. 18:415-442, 1984).
Proper expression in a prokaryotic cell also requires the presence of a
ribosome-
binding site upstream of the gene sequence-encoding sequence. Such ribosome-
binding sites
are disclosed, for example, by Gold et al. (Aran. Rev. Micnobiol. 35:365-404,
1981). The
selection of control sequences, expression vectors, transformation methods,
and the like, are
dependent on the type of host cell used to express the gene. As used herein,
"cell", "cell
line", and "cell culture" may be used interchangeably and all such
designations include
progeny. Thus, the words "transformants" or "transformed cells" include the
primary subject
cell and cultures derived therefrom, without regard to the number of
transfers. It is also
understood that all progeny may not be precisely identical in DNA content, due
to deliberate
-63-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
or inadvertent mutations. However, as defined, mutant progeny have the same
functionality
as that of the originally transformed cell.
Host cells which may be used in the expression systems of the present
invention are
not strictly limited, provided that they are suitable for use in the
expression of the kinase
polypeptide of interest. Suitable hosts may often include eukaryotic cells.
Preferred
eukaryotic hosts include, for example, yeast, fungi, insect cells, mammalian
cells either in
vivo, or in tissue culture. Mammalian cells which may be useful as hosts
include HeLa cells,
cells of fibroblast origin such as VERO or CHO-Kl, or cells of lymphoid origin
and their
derivatives. Preferred mammalian host cells include SP210 and J558L, as well
as
neuroblastoma cell lines such as IMR 332, which may provide better capacities
for correct
post-translational processing.
In addition, plant cells are also available as hosts, and control sequences
compatible
with plant cells are available, such as the cauliflower mosaic virus 35S and
195, and nopaline
synthase promoter and polyadenylation signal sequences. Another preferred host
is an insect
cell, for example the D~osophila larvae. Using insect cells as hosts, the
D~osophila alcohol
dehydrogenase promoter can be used (Rubin,. Sciehce 240:1453-1459, 1988).
Alternatively,
baculovirus vectors can be engineered to express large amounts of kinases of
the invention in
insect cells (Jasny, Science 238:1653, 1987; Miller et al., in: Genetic
Engineering, Vol. 8,
Plenum, Setlow et al., eds., pp. 277-297, 1986).
Any of a series of yeast expression systems can be utilized which incorporate
promoter and termination elements from the actively expressed sequences coding
for
glycolytic enzymes that are produced in large quantities when yeast are grown
in mediums
rich in glucose. Known glycolytic gene sequences can also provide very
efficient
transcriptional control signals. Yeast provides substantial advantages in that
it can also carry
out post-translational modifications. A number of recombinant DNA strategies
exist utilizing
strong promoter sequences and high copy number plasmids which can be utilized
for
production of the desired proteins in yeast. Yeast recognizes leader sequences
on cloned
mammalian genes and secretes peptides bearing leader sequences (i.e., pre-
peptides). Several
possible vector systems are available for the expression of kinases of the
invention in a
mammalian host.
A wide variety of transcriptional and translational regulatory sequences may
be
employed, depending upon the nature of the host. The transcriptional and
translational
-64-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
regulatory signals may be derived from viral sources, such as adenovirus,
bovine papilloma
virus, cytomegalovirus, simian virus, or the like, where the regulatory
signals are associated
with a particular gene sequence which has a high level of expression.
Alternatively,
promoters from mammalian expression products, such as actin, collagen, myosin,
and the
like, may be employed. Transcriptional initiation regulatory signals may be
selected which
allow for repression or activation, so that expression of the gene sequences
can be modulated.
Of interest are regulatory signals which are temperature-sensitive so that by
varying the
temperature, expression can be repressed or initiated, or are subject to
chemical (such as
metabolite) regulation.
Expression of kinases of the invention in eukaryotic hosts requires the use of
eukaryotic regulatory regions. Such regions will, in general, include a
promoter region
sufficient to direct the initiation of RNA synthesis. Preferred eukaryotic
promoters include,
for example, the promoter of the mouse metallothionein I gene sequence (Hamer
et al., J.
Mol. Appl. Gen. 1:273-288, 1982); the TK promoter of Herpes virus (McKnight,
Cell 31:355-
1 S 365, 1982); the SV40 early promoter (Benoist et al., Nature (London)
290:304-31, 1981);
and the yeast gal4 gene sequence promoter (Johnston et al., Proc. Natl. Aced.
Sci. (USA)
79:6971-6975, 1982; Silver et al., PYOG. Natl. Aced. Sci. (USA) 81:5951-5955,
1984).
Translation of eukaryotic mRNA is initiated at the codon which encodes the
first
methionine. For this reason, it is preferable to ensure that the linkage
between a eukaryotic
promoter and a DNA sequence which encodes a kinase of the invention (or a
functional
derivative thereof) does not contain any intervening codons which are capable
of encoding a
methionine (i.e., AUG). The presence of such codons results either in the
formation of a
fusion protein (if the AUG codon is in the same reading frame as the kinase of
the invention
coding sequence) or a frame-shift mutation (if the AUG codon is not in the
same reading
frame as the kinase of the invention coding sequence).
A nucleic acid molecule encoding a kinase of the invention and an operably
linked
promoter may be introduced into a recipient prokaryotic~or eukaryotic cell
either as a
nonreplicating DNA or RNA molecule, which may either be a linear molecule or,
more
preferably, a closed covalent circular molecule. Since such molecules are
incapable of
autonomous replication, the expression of the gene may occur through the
transient
expression of the introduced sequence. Alternatively, permanent expression may
occur
through the integration of the introduced DNA sequence into the host
chromosome.
-65-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
A vector may be employed which is capable of integrating the desired gene
sequences
into the host cell chromosome. Cells which have stably integrated the
introduced DNA into
their chromosomes can be selected by also introducing one or more markers
which allow for
selection of host cells which contain the expression vector. The marker may
provide for
prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or
heavy metals, such
as copper, or the like. The selectable marker gene sequence can either be
directly linked to
the DNA gene sequences to be expressed, or introduced into the same cell by co-
transfection.
Additional elements may also be needed for optimal synthesis of mRNA. These
elements
may include splice signals, as well as transcription promoters, enhancers, and
termination
signals. cDNA expression vectors incorporating such elements include those
described by
Okayama (Mol. Cell. Biol. 3:280-289, 1983).
The introduced nucleic acid molecule can be incorporated into a plasmid or
viral
vector capable of autonomous replication in the recipient host. Any of a wide
variety of
vectors rnay be employed for this purpose. Factors of importance in selecting
a particular
plasmid or viral vector include: the ease with which recipient cells that
contain the vector
may be recognized and selected from those recipient cells which do not contain
the vector;
the number of copies of the vector which are desired in a particular host; and
whether it is
desirable to be able to "shuttle" the vector between host cells of different
species.
Preferred prokaryotic vectors include plasmids such as those capable of
replication in
E. coli (such as, for example, pBR322, ColEl, pSC101, pACYC 184, ~VX;
"Molecular
Cloning: A Laboratory Manual", 1989, supra). Bacillus plasmids include pC194,
pC221,
pT127, and the like (Gryczan, In: The Molecular Biology of the Bacilli,
Academic Press,
NY, pp. 307-329, 1982). Suitable St~eptomyces plasmids include p1J101 (Kendall
et al., J.
Bacteriol. 169:4177-4183, 1987), and streptomyces bacteriophages such as ~C31
(Chater et
al., In: Sixth International Symposium on Actinomycetales Biology, Akademiai
I~aido,
Budapest, Hungary, pp. 45-54, 1986). Pseudomoraas plasmids are reviewed by
John et al.
(Rev. Ihfect. Dis. 8:693-704, 1986), and Izaki (Jpu. J. Bacteriol. 33:729-742,
1978).
Preferred eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2-
micron
circle, and the like, or their derivatives. Such plasmids are well known in
the art (Botstein et
al., Miami Wntr. Symp. 19:265-274, 1982; Broach, In: "The Molecular Biology of
the Yeast
Saccharomyces: Life Cycle and Inheritance", Cold Spring Harbor Laboratory,
Cold Spring
Harbor, NY, p. 445-470, 1981; Broach, Cell 28:203-204, 1982; Bollon et al., J.
Clin.
-66-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Hematol. Ohcol. 10:39-48, 1980; Maniatis, In: Cell Biology: A Comprehensive
Treatise, Vol.
3, Gene Sequence Expression, Academic Press, NY, pp. 563-608, 1980).
Once the vector or nucleic acid molecule containing the constructs) has been
prepared for expression, the DNA constructs) may be introduced into an
appropriate host
cell by any of a variety of suitable means, i.e., transformation,
transfection, conjugation,
protoplast fusion, electroporation, particle gun technology, calcium phosphate-
precipitation,
direct microinjection, and the like. After the introduction of the vector,
recipient cells are
grown in a selective medium, which selects for the growth of vector-containing
cells.
Expression of the cloned genes) results in the production of a kinase of the
invention, or
fragments thereof. This can take place in the transformed cells as such, or
following the
induction of these cells to differentiate (for example, by administration of
bromodeoxyuracil
to neuroblastoma cells or the like). A variety of incubation conditions can be
used to form
the peptide of the present invention. The most preferred conditions are those
which mimic
physiological conditions.
Transgenic Animals:
A variety of methods are available for the production of transgenic animals
associated
with this invention. DNA can be injected into the pronucleus of a fertilized
egg before fusion
of the male and female pronuclei, or injected into the nucleus of an embryonic
cell (e.g., the
nucleus of a two-cell embryo) following the initiation of cell division
(Brinster et al., Proc.
Nat. Acad. Sci. USA 82:4438-4442, 1985). Embryos can be infected with viruses,
especially
retroviruses, modified to carry inorganic-ion receptor nucleotide sequences of
the invention.
Pluripotent stem cells derived from the inner cell mass of the embryo and
stabilized in
culture can be manipulated in culture to incorporate nucleotide sequences of
the invention. A
transgenic animal can be produced from such cells through implantation into a
blastocyst that
is implanted into a foster mother and allowed to come to term. Animals
suitable for
transgenic experiments can be obtained from standard commercial sources such
as Charles
River (Wilmington, MA), Taconic (Germantown, NY), Harlan Sprague Dawley
(Indianapolis, III, etc.
The procedures for manipulation of the rodent embryo and for microinjection of
DNA
into the pronucleus of the zygote are well known to those of ordinary skill in
the art (Hogan
et al., supf~a). Microinjection procedures for fish, amphibian eggs and birds
are detailed in
-67-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Houdebine and Chourrout (Expe~iehtia 47:897-905, 1991). Other procedures for
introduction
of DNA into tissues of animals are described in U.S. Patent No. 4,945,050
(Sanford et al.,
July 30, 1990).
By way of example only, to prepare a transgenic mouse, female mice are induced
to
superovulate. Females are placed with males, and the mated females are
sacrificed by C02
asphyxiation or cervical dislocation and embryos are recovered from excised
oviducts.
Surrounding cumulus cells are removed. Pronuclear embryos are then washed and
stored
until the time of injection. Randomly cycling adult female mice are paired
with
vasectomized males. Recipient females are mated at the same time as donor
females.
Embryos then are transferred surgically. The procedure for generating
transgenic rats is
similar to that of mice (Hammer et al., Cell 63:1099-1112, 1990).
Methods for the culturing of embryonic stem (ES) cells and the subsequent
production
of transgenic animals by the introduction of DNA into ES cells using methods
such as
electroporation, calcium phosphate/DNA precipitation and direct injection also
are well
known to those of ordinary skill in the art (Teratocarcinomas and Embryonic
Stem Cells, A
Practical Approach, E.J. Robertson, ed., IRI, Press, 1987).
In cases involving random gene integration, a clone containing the sequences)
of the
invention is co-transfected with a gene encoding resistance. Alternatively,
the gene encoding
neomycin resistance is physically linked to the sequences) of the invention.
Transfection
and isolation of desired clones are carried out by any one of several methods
well known to
those of ordinary skill in the art (E.J. Robertson, supra).
DNA molecules introduced into ES cells can also be integrated into the
chromosome
through the process of homologous recombina-tion (Capecchi, Science 244:1288-
1292,
1989). Methods for positive selection of the recombination event (i. e., neo
resistance) and
dual positive-negative selection (i.e., neo resistance and gancyclovir
resistance) and the
subsequent identification of the desired clones by PCR have been described by
Capecchi,
supra and Joyner et al. (NatuYe 338:153-156, 1989), the teachings of which are
incorporated
herein in their entirety including any drawings. The final phase of the
procedure is to inj ect
targeted ES cells into blastocysts and to transfer the blastocysts into
pseudopregnant females.
The resulting chimeric animals are bred and the offspring are analyzed by
Southern blotting
to identify individuals that carry the transgene. Procedures for the
production of non-rodent
mammals and other animals have been discussed by others (Houdebine and
Chourrout,
-68-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
supra; Pursel et al., Science 244:1281-1288, 1989; and Simms et al.,
BiolTechnology 6:179-
183, 1988).
Thus, the invention provides transgenic, nonhuman mammals containing a
transgene
encoding a kinase of the invention or a gene affecting the expression of the
kinase. Such
transgenic nonhuman mammals are particularly useful as an in vivo test system
for studying
the effects of introduction of a kinase, or regulating the expression of a
kinase (i.e., through
the introduction of additional genes, antisense nucleic acids, or ribozymes).
A "transgenic animal" is an animal having cells that contain DNA which has
been
artificially inserted into a cell, which DNA becomes part of the genome of the
animal which
develops from that cell. Preferred transgenic animals are primates, mice,
rats, cows, pigs,
horses, goats, sheep, dogs and cats. The transgenic DNA may encode human
kinases. Native
expression in an animal may be reduced by providing an amount of antisense RNA
or DNA
effective to reduce expression of the receptor.
Gene Therapy:
Kinases or their genetic sequences will also be useful in gene therapy
(reviewed in
Miller, Nature 357:455-460, 1992). Miller states that advances have resulted
in practical
approaches to human gene therapy that have demonstrated positive initial
results. The basic
science of gene therapy is described in Mulligan (Science 260:926-931, 1993).
In one preferred embodiment, an expression vector containing a kinase coding
sequence is inserted into cells, the cells are grown in vitro and then infused
in large numbers
into patients. In another preferred embodi-ment, a DNA segment containing a
promoter of
choice (for example a strong promoter) is transferred into cells containing an
endogenous
gene encoding kinases of the invention in such a manner that the promoter
segment enhances
expression of the endogenous kinase gene (for example, the promoter segment is
transferred
to the cell such that it becomes directly linked to the endogenous kinase
gene).
The gene therapy may involve the use of an adenovirus containing kinase cDNA
targeted to a tumor, systemic kinase increase by implantation of engineered
cells, injection
with kinase-encoding virus, or injection of naked kinase DNA into appropriate
tissues.
Target cell populations may be modified by introducing altered forms of one or
more
components of the protein complexes in order to modulate the activity of such
complexes.
For example, by reducing or inhibiting a complex component activity within
target cells, an
-69-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
abnormal signal transduction events) leading to a condition may be decreased,
inhibited, or
reversed. Deletion or missense mutants of a component, that retain the ability
to interact with
other components of the protein complexes but cannot function in signal
transduction, may be
used to inhibit an abnormal, deleterious signal transduction event.
Expression vectors derived from viruses such as retroviruses, vaccinia virus,
adenovirus, adeno-associ-ated virus, herpes viruses, several RNA viruses, or
bovine
papilloma virus, may be used for delivery of nucleotide sequences (e.g., cDNA)
encod-ing
recom-binant kinase of the invention protein into the targeted cell population
(e.g., tumor
cells). Methods which are well known to those skilled in the art can be used
to construct
recombinant viral vectors contain-ing coding sequences (Maniatis et al.,
Molecular Cloning:
A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y., 1989; Ausubel et
al., Current
Proto-cots in Molecular Biology, Greene Publishing Associates and Wiley
Interscience, N.Y.,
1989). Alter-natively, recombinant nucleic acid mole-cules encoding protein
sequences can
be used as naked DNA or in a recon-stituted system e.g., lipo-somes or other
lipid systems
for delivery to target cells~(e.g., Felgner et al., Nature 337:387-8, 1989).
Several other
methods for the direct transfer of plasmid DNA into cells exist for use in
human gene therapy
and involve targeting the DNA to receptors on cells by complexing the plasmid
DNA to
proteins (Miller, supra).
In its simplest form, gene transfer can be performed by simply injecting
minute
amounts of DNA into the nucleus of a cell, through a process of microinjection
(Capecchi,
Cell 22:479-88, 1980). Once recombinant genes are introduced into a cell, they
can be
recognized by the cell's normal mechanisms for transcription and translation,
and a gene
product will be expressed. Other methods have also been attempted for
introducing DNA
into larger numbers of cells. These methods include: transfection, wherein DNA
is
precipitated with calcium phosphate and taken into cells by pinocytosis (Chen
et al.; Mol.
Cell Biol. 7:2745-52, 1987); electroporation, wherein cells are exposed to
large voltage
pulses to introduce holes into the membrane (Chu et al., Nucleic Acids Res.
15:1311-26,
1987); lipofection/liposome fusion, wherein DNA is packaged into lipophilic
vesicles which
fuse with a target cell (Felgner et al., Proc. Natl. Acad. Sci. USA. 84:7413-
7417, 1987); and
particle bombardment using DNA bound to small projectiles (Yang et al., Proc.
Natl. Acad.
Sci. 87:9568-9572, 1990). Another method for introducing DNA into cells is to
couple the
DNA to chemically modified proteins.
-70-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
It has also been shown that adenovirus proteins are capable of destabilizing
endosomes and enhancing the uptake of DNA into cells. The admixture of
adenovirus to
solutions containing DNA complexes, or the binding of DNA to polylysine
covalently
attached to adenovirus using protein crosslinking agents substantially
improves the uptake
and expression of the recombinant gene (Curiel et al., Am. J. Respir. Cell.
Mol. Biol., 6:247-
52, 1992).
As used herein "gene transfer" means the process of introducing a foreign
nucleic
acid molecule into a cell. Gene transfer is commonly performed to enable the
expres-sion of
a particular product encoded by the gene. The product may include a protein,
polypeptide,
anti-sense DNA or RNA, or enzymatically active RNA. Gene transfer canabe
performed in
cultured cells or by direct administration into animals. Generally gene
transfer involves the
process of nucleic acid contact with a target cell by non-specific or receptor
mediated
interactions, uptake of nucleic acid into the cell through the membrane or by
endocytosis, and
release of nucleic acid into the cyto-plasm from the plasma membrane or
endosome.
Expression may require, in addition, movement of the nucleic acid into the
nucleus of the cell
and binding to appropriate nuclear factors for transcription.
As used herein "gene therapy" is a form of gene transfer and is included
within the
definition of gene transfer as used herein and specifically refers to gene
transfer to express a
therapeutic product from a cell in vivo or in vitro. Gene transfer can be
performed ex vivo on
cells which are then transplanted into a patient, or can be performed by
direct administration
of the nucleic acid or nucleic acid-protein complex into the patient.
In another preferred embodiment, a vector having nucleic acid sequences
encoding a
kinase polypeptide is provided in which the nucleic acid sequence is expressed
only in
specific tissue. Methods of achieving tissue-specific gene expression are set
forth in
International Publication No. WO 93/09236, filed November 3, 1992 and
published May
13, 1993.
In all of the preceding vectors set forth above, a further aspect of the
invention is that
the nucleic acid sequence contained in the vector may include additions,
deletions or
modifications to some or all of the sequence of the nucleic acid, as defined
above.
In another preferred embodiment, a method of gene replacement is set forth.
"Gene
replacement" as used herein means supplying a nucleic acid sequence which is
capable of
-71-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
being expressed ih vivo in an animal and thereby providing or augmenting the
function of an
endogenous gene which is missing or defective in the animal.
PHARMACE UTICAL FORMULATIONS AND RO UTES OF ADMINISTRATION
The compounds described herein can be administered to a human patient per se,
or in
pharmaceutical compositions where it is mixed with other active ingredients,
as in
combination therapy, or suitable carriers or excipient(s). Techniques for
formulation and
administration of the compounds of the instant application may be found in
"Remington's
Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition.
Routes Of Administration:
Suitable routes of administration may, for example, include oral, rectal,
transmucosal,
or intestinal administration; parenteral delivery, including intramuscular,
subcutaneous,
intravenous, intramedullary injections, as well as intrathecal, direct
intraventricular,
intraperitoneal, intranasal, or intraocular injections.
Alternately, one may administer the compound in a local rather than systemic
manner,
for example, via injection of the compound directly into a solid tumor, often
in a depot or
sustained release formulation.
Furthermore, one may administer the drug in a targeted drug delivery system,
for
example, in a liposome coated with tumor-specific antibody. The liposomes will
be targeted
to and taken up selectively by the tumor.
Composition/Formulation:
The pharmaceutical compositions of the present invention may be manufactured
in a
manner that is itself known, e.g., by means of conventional mixing,
dissolving, granulating,
dragee-making, levigating, emulsifying, encapsulating, entrapping or
lyophilizing processes.
Pharmaceutical compositions for use in accordance with the present invention
thus
may be formulated in conventional manner using one or more physiologically
acceptable
carriers comprising excipients and auxiliaries which facilitate processing of
the active
compounds into preparations which can be used pharmaceutically. Proper
formulation is
dependent upon the route of administration chosen.
-72_
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
For injection, the agents of the invention may be formulated in aqueous
solutions,
preferably in physiologically compatible buffers such as Hanks's solution,
Ringer's solution,
or physiological saline buffer. For transmucosal administration, penetrants
appropriate to the
barrier to be permeated are used in the formulation. Such penetrants are
generally known in
the art.
For oral administration, the compounds can be formulated readily by combining
the
active compounds with pharmaceutically acceptable carriers well known in the
art. Such
carriers enable the compounds of the invention to be formulated as tablets,
pills, dxagees,
capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral
ingestion by a
patient to be treated. Suitable carriers include excipients such as, fillers
such as sugars,
including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such
as, for example,
maize starch, wheat starch, rice starch, potato starch, gelatin, gum
tragacanth, methyl
cellulose, hydroxypropylmethyl- cellulose, sodium carboxymethylcellulose,
and/or
polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added,
such as the
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof
such as sodium
alginate.
Dragee cores are provided with suitable coatings. For this purpose,
concentrated
sugar solutions may be used, which may optionally contain gum arabic, talc,
polyvinyl
pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide,
lacquer solutions,
and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may
be added to the
tablets or dragee coatings for identification or to characterize different
combinations of active
compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules
made
of gelatin, as well as soft, sealed capsules made of gelatin and a
plasticizes, such as glycerol
or sorbitol. The push-fit capsules can contain the active ingredients in
admixture with filler
such as lactose, binders such as starches, andlor lubricants such as talc or
magnesium stearate
and, optionally, stabilizers. In soft capsules, the active compounds may be
dissolved or
suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid
polyethylene
glycols. W addition, stabilizers may be added. All formulations for oral
administration
should be in dosages suitable for such administration.
For buccal administration, the compositions may take the form of tablets or
lozenges
formulated in conventional manner.
-73-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
For administration by inhalation, the compounds for use according to the
present
invention are conveniently delivered in the form of an aerosol spray
presentation from
pressurized packs or a nebuliser, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane,
carbon dioxide
or other suitable gas. Tn the case of a pressurized aerosol the dosage unit
may be determined
by providing a valve to deliver a metered amount. Capsules and cartridges of
e.g. gelatin for
use in an inhaler or insufflator may be formulated containing a powder mix of
the compound
and a suitable powder base such as lactose or starch.
The compounds may be formulated for parenteral administration by injection,
e.g., by
bolus injection or continuous infusion. Formulations for injection may be
presented in unit
dosage form, e.g., in ampoules or in multi-dose containers, with an added
preservative. The
compositions may take such forms as suspensions, solutions or emulsions in
oily or aqueous
vehicles, and may contain formulatory agents such as suspending, stabilizing
and/or
dispersing agents.
Pharmaceutical formulations far parenteral administration include aqueous
solutions
of the active compounds in water-soluble form. Additionally, suspensions of
the active
compounds may be prepared as appropriate oily injection suspensions. Suitable
lipophilic
solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty
acid esters, such as
ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may
contain
substances which increase the viscosity of the suspension, such as sodium
carboxymethyl
cellulose, sorbitol, or dextran. Optionally, the suspension may also contain
suitable
stabilizers or agents which increase the solubility of the compounds to allow
for the
preparation of highly concentrated solutions.
Alternatively, the active ingredient may be in powder form for constitution
with a
suitable vehicle, e.g., sterile pyrogen-free water, before use.
The compounds may also be formulated in rectal compositions such as
suppositories
or retention enemas, e.g., containing conventional suppository bases such as
cocoa butter or
other glycerides.
In addition to the formulations described previously, the compounds may also
be
formulated as a depot preparation. Such long acting formulations may be
administered by
implantation (for example subcutaneously or intramuscularly) or by
intramuscular injection.
Thus, for example, the compounds may be formulated with suitable polymeric or
-74-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
hydrophobic materials (for example as an emulsion in an acceptable oil) or ion
exchange
resins, or as sparingly soluble derivatives, for example, as a sparingly
soluble salt.
A pharmaceutical carrier for the hydrophobic compounds of the invention is a
cosolvent system comprising benzyl alcohol, a nonpolar surfactant, a water-
miscible organic
polymer, and an aqueous phase. The cosolvent system may be the VPD co-solvent
system.
VPD is a solution of 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant
polysorbate
80, and 65% w/v polyethylene glycol 300, made up to volume in absolute
ethanol. The VPD
co-solvent system (VPD:DSV~ consists of VPD diluted 1:1 with a 5% dextrose in
water
solution. This co-solvent system dissolves hydrophobic compounds well, and
itself produces
low toxicity upon systemic administration. Naturally, the proportions of a co-
solvent system
may be varied considerably without destroying its solubility and toxicity
characteristics.
Furthermore, the identity of the co-solvent components may be varied: for
example, other
low-toxicity nonpolar surfactants may be used instead of polysorbate 80; the
fraction size of
polyethylene glycol may be varied; other biocompatible polymers may replace
polyethylene
glycol, e.g. polyvinyl pyrrolidone; and other sugars or polysaccharides may
substitute for
dextrose.
Alternatively, other delivery systems for hydrophobic pharmaceutical compounds
may be employed. Liposomes and emulsions are well known examples of delivery
vehicles
or carriers for hydrophobic drugs. Certain organic solvents such as
dimethylsulfoxide also
may be employed, although usually at the cost of greater toxicity.
Additionally, the
compounds may be delivered using a sustained-release system, such as
semipermeable
matrices of solid hydrophobic polymers containing the therapeutic agent.
Various sustained-
release materials have been established and are well known by those skilled in
the art.
Sustained-release capsules may, depending on their chemical nature, release
the compounds
for a few weeks up to over 100 days. Depending on the chemical nature and the
biological
stability of the therapeutic reagent, additional strategies for protein
stabilization may be
employed.
The pharmaceutical compositions also may comprise suitable solid or gel phase
carriers or excipients. Examples of such carriers or excipients include but
are not limited to
calcium carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin,
and polymers such as polyethylene glycols.
-75-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Many of the tyrosine or serine/threonine kinase modulating compounds of the
invention may be provided as salts with pharmaceutically compatible
counterions.
Pharmaceutically compatible salts may be formed with many acids, including but
not limited
to hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc.
Salts tend to be more
soluble in aqueous or other protonic solvents that are the corresponding free
base forms.
Suitable Dosage Regimens:
Pharmaceutical compositions suitable for use in the present invention include
compositions where the active ingredients are contained in an amount effective
to achieve its
intended purpose. More specifically, a therapeutically effective amount means
an amount of
compound effective to prevent, alleviate or ameliorate symptoms of disease or
prolong the
survival of the subject being treated. Determination of a therapeutically
effective amount is
well within the capability of those skilled in the art, especially in light of
the detailed
disclosure provided herein.
Methods of determining the dosages of compounds to be administered to a
patient and
modes of administering compounds to an organism are disclosed in U.S.
Application Serial
No. 08/702,282, filed August 23, 1996 and International patent publication
number WO
96/22976, published August 1 1996, both of which are incorporated herein by
reference in
their entirety, including any drawings, figures or tables. Those skilled in
the art will
appreciate that such descriptions are applicable to the present invention and
can be easily
adapted to it.
The proper dosage depends on various factors such as the type of disease being
treated, the particular composition being used and the size and physiological
condition of the
patient. Therapeutically effective doses for the compounds described herein
can be estimated
initially from cell culture and animal models. For example, a dose can be
formulated in
animal models to achieve a circulating concentration range that initially
takes into account
the ICso as determined in cell culture assays. The animal model data can be
used to more
accurately determine useful doses in humans.
For any compound used in the methods of the invention, the therapeutically
effective
dose can be estimated initially from cell culture assays. For example, a dose
can be
formulated in animal models to achieve a circulating concentration range that
includes the
ICSO as determined in cell culture (i.e., the concentration of the test
compound which achieves
-76-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
a half maximal inhibition of the tyrosine or serine/threonine kinase
activity). Such
information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the compounds described herein can be
determined by standard pharmaceutical procedures in cell cultures or
experimental animals,
e.g., for determining the LDso (the dose lethal to 50% of the population) and
the EDso (the
dose therapeutically effective in 50% of the population). The dose ratio
between toxic and
therapeutic effects is the therapeutic index and it can be expressed as the
ratio between LDso
and EDso. Compounds which exhibit high therapeutic indices are preferred. The
data
obtained from these cell culture assays and animal studies can be used in
formulating a range
of dosage for use in human. The dosage of such compounds lies preferably
within a range of
circulating concentrations that include the EDso with little or no toxicity.
The dosage may
vary within this range depending upon the dosage form employed and the route
of
administration utilized. The exact formulation, route of administration and
dosage can be
chosen by the individual physician in view of the patient's condition. (See
e.g., Fingl et al.,
1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1).
In another example, toxicity studies can be carried out by measuring the blood
cell
composition. For example, toxicity studies can be carried out in a suitable
animal model as
follows: 1) the compound is administered to mice (an untreated control mouse
should also be
used); 2) blood samples are periodically obtained via the tail vein from one
mouse in each
treatment group; and 3) the samples are analyzed for red and white blood cell
counts, blood
cell composition and the percent of lymphocytes versus polymorphonuclear
cells. A
comparison of results for each dosing regime with the controls indicates if
toxicity is present.
At the termination of each toxicity study, further studies can be carried out
by
sacrificing the animals (preferably, in accordance with the American
Veterinary Medical
Association guidelines Report of the American Veterinary Medical Assoc. Panel
on
Euthanasia:229-249, 1993). Representative aumals from each treatment group can
then be
examined by gross necropsy for immediate evidence of metastasis, unusual
illness or toxicity.
Gross abnormalities in tissue are noted and tissues are examined
histologically. Compounds
causing a reduction in body weight or blood components are less preferred, as
are compounds
having an adverse effect on major organs. In general, the greater the adverse
effect the less
preferred the compound.
_77_
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
For the treatment of cancers the expected daily dose of a hydrophobic
pharmaceutical
agent is between 1 to S00 mg/day, preferably 1 to 2S0 mg/day, and most
preferably 1 to SO
mg/day. Drugs can be delivered less frequently provided plasma levels of the
active moiety
are sufficient to maintain therapeutic effectiveness.
S Plasma levels should reflect the potency of the drug. Generally, the more
potent the
compound the lower the plasma levels necessary to achieve efficacy.
Plasma half life and biodistribution of the drug and metabolites in the
plasma, tumors
and major organs can also be determined to facilitate the selection of drugs
most appropriate
to inhibit a disorder. Such measurements can be carried out. For example, HPLC
analysis
can be performed on the plasma of animals treated with the drug and the
location of
radiolabeled compounds can be determined using detection methods such as X-
ray, CAT
scan and MRI. Compounds that show potent inhibitory activity in the screening
assays, but
have poor pharmacokinetic characteristics, can be optimized by altering the
chemical
structure and retesting. In this regard, compounds displaying good
pharmacokinetic
1S characteristics can be used as a model.
Dosage amount and interval may be adjusted individually to provide plasma
levels of
the active moiety which are sufficient to maintain the kinase modulating
effects, or minimal
effective concentration (MEC). The MEC will vary for each compound but can be
estimated
from in vitro data; e.g., the concentration necessary to achieve SO-90%
inhibition of the
kinase using the assays described herein. Dosages necessary to achieve the MEC
will depend
on individual characteristics and route of administration. However, HPLC
assays or
bioassays can be used to determine plasma concentrations.
Dosage intervals can also be determined using MEC value. Compounds should be
administered using a regimen which maintains plasma levels above the MEC for
10-90% of
2S the time, preferably between 30-90% and most preferably between SO-90%.
In cases of local administration or selective uptake, the effective local
concentration
of the drug may not be related to plasma concentration.
The amount of composition administered will, of course, be dependent on the
subject
being treated, on the subject's weight, the severity of the affliction, the
manner of
administration and the judgment of the prescribing physician.
Packaging:
_78_
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
The compositions may, if desired, be presented in a pack or dispenser device
which
may contain one or more unit dosage forms containing the active ingredient.
The pack may
for example comprise metal or plastic foil, such as a blister pack. The pack
or dispenser
device may be accompanied by instructions for administration. The pack or
dispenser may
also be accompanied with a notice associated with the container in form
prescribed by a
governmental agency regulating the manufacture, use, or sale of
pharmaceuticals, which
notice is reflective of approval by the agency of the form of the
polynucleotide for human or
veterinary administration. Such notice, for example, may be the labeling
approved by the
U.S. Food and Drug Administration for prescription drugs, or the approved
product insert.
Compositions comprising a compound of the invention formulated in a compatible
pharmaceutical carrier may also be prepared, placed in an appropriate
container, and labeled
for treatment of an indicated condition. Suitable conditions indicated on the
label may
include treatment of a tumor, inhibition of angiogenesis, treatment of
fibrosis, diabetes, and
the like.
FUNCTIONAL DERIVATIVES
Also provided herein are functional derivatives of a polypeptide or nucleic
acid of the
invention. By "functional derivative" is meant a "chemical derivative,"
"fragment," or
"variant," of the polypeptide or nucleic acid of the invention, which terms
are defined below.
A functional derivative retains at least a portion of the function of the
protein, for example
reactivity with an antibody specific for the protein, enzymatic activity or
binding activity
mediated through noncatalytic domains, which permits its utility in accordance
with the
present invention. It is well known in the art that due to the degeneracy of
the genetic code
numerous different nucleic acid sequences can code for the same amino acid
sequence.
Equally, it is also well known in the art that conservative changes in amino
acid can be made
to arrive at a protein or polypeptide that retains the functionality of the
original. In both
cases, all permutations are intended to be covered by this disclosure.
Included within the scope of this invention are the functional equivalents of
the
herein-described isolated nucleic acid molecules. The degeneracy of the
genetic code permits
substitution of certain codons by other codons that specify the same amino
acid and hence
would give rise to the same protein. The nucleic acid sequence can vary
substantially since,
with the exception of methionine and tryptophan, the known amino acids can be
coded for by
-79-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
more than one codon. Thus, portions or all of the genes of the invention could
be synthesized
to give a nucleic acid sequence significantly different from one selected from
the group
consisting of those set forth in SEQ ID NO: l and SEQ m N0:2. The encoded
amino acid
sequence thereof would, however, be preserved.
In addition, the nucleic acid sequence may comprise a nucleotide sequence
which results
from the addition, deletion or substitution of at least one nucleotide to the
5'-end andlor the
3'-end of the nucleic acid formula selected from the group consisting of those
set forth in
SEQ m NO:l and SEQ ID N0:2, or a derivative thereof. Any nucleotide or
polynucleotide
may be used in this regard, provided that its addition, deletion or
substitution does not alter
the amino acid sequence of selected from the group consisting of those set
forth in SEQ m
NO:1, and SEQ >D N0:2 which is encoded by the nucleotide sequence. For
example, the
present invention is intended to include any nucleic acid sequence resulting
from the addition
of ATG as an initiation codon at the 5'-end of the inventive nucleic acid
sequence or its
derivative, or from the addition of TTA, TAG or TGA as a termination codon at
the 3'-end of
the inventive nucleotide sequence or its derivative. Moreover, the nucleic
acid molecule of
the present invention may, as necessary, have restriction endonuclease
recognition sites
added to its 5'-end and/or 3'-end.
Such functional alterations of a given nucleic acid sequence afford an
opportunity to
promote secretion and/or processing of heterologous proteins encoded by
foreign nucleic acid
sequences fused thereto. All variations of the nucleotide sequence of the
kinase genes of the
invention and fragments thereof permitted by the genetic code are, therefore,
included in this
invention.
Further, it is possible to delete codons or to substitute one or more codons
with
codons other than degenerate codons to produce a structurally modified
polypeptide, but one
which has substantially the same utility or activity as the polypeptide
produced by the
unmodified nucleic acid molecule. As recognized in the art, the two
polyp~ptides are
functionally equivalent, as are the two nucleic acid molecules that give rise
to their
production, even though the differences between the nucleic acid molecules are
not related to
the degeneracy of the genetic code.
A "chemical derivative" of the complex contains additional chemical moieties
not
normally a part of the protein. Covalent modifications of the protein or
peptides are included
within the scope of this invention. Such modifications may be introduced into
the molecule
-~0-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
by reacting targeted amino acid residues of the peptide with an organic
derivatizing agent that
is capable of reacting with selected side chains or terminal residues, as
described below.
Cysteinyl residues most commonly are reacted with alpha-haloacetates (and
corresponding amines), such as chloroacetic acid or chloroacetamide, to give
carboxymethyl
or carboxyamidomethyl derivatives. Cysteinyl residues also are derivatized by
reaction with
bromotrifluoroacetone, chloroacetyl phosphate, N-alkylmaleimides, 3-vitro-2-
pyridyl
disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2-
chloromercuri-4-
nitrophenol, or chloro-7-nitrobenzo-2-oxa-1,3-diazole.
Histidyl residues are derivatized by reaction with diethylprocarbonate at pH
5.5-7.0
because this agent is relatively specific for the histidyl side chain. Para-
bromophenacyl
bromide also is useful; the reaction is preferably performed in 0.1 M sodium
cacodylate at pH
6Ø
Lysinyl and amino terminal residues are reacted with succinic or other
carboxylic acid
anhydrides. Derivatization with these agents has the effect or reversing the
charge of the
lysinyl residues. Other suitable reagents for derivatizing primary amine
containing residues
include imidoesters such as methyl picolinimidate; pyridoxal phosphate;
pyridoxal;
chloroborohydride; trinitrobenzenesulfonic acid; O-methylisourea; 2,4
pentanedione; and
transaminase-catalyzed reaction with glyoxylate.
Arginyl residues are modified by reaction with one or several conventional
reagents,
among them phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and
ninhydrin.
Derivatization of arginine residues requires that the reaction be performed in
alkaline
conditions because of the high pKa of the guanidine functional group.
Furthermore, these
reagents may react with the groups of lysine as well as the arginine alpha-
amino group.
Tyrosyl residues are well-known targets of modification for introduction of
spectral
labels by reaction with aromatic diazonium compounds or tetranitromethane.
Most
commonly, N-acetylimidizol and tetranitromethane are used to form O-acetyl
tyrosyl species
and 3-vitro derivatives, respectively.
Carboxyl side groups (aspartyl or glutamyl) are selectively modified by
reaction with
carbodiimide (R'-N-C-N-R') such as 1-cyclohexyl-3-(2-morpholinyl(4-ethyl)
carbodiimide or
1-ethyl-3-(4-azonia-4,4-dimethylpentyl) carbodiimide. Furthermore, aspartyl
and glutamyl
residues are converted to asparaginyl and glutaminyl residues by reaction with
ammonium
ions.
-~ 1-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Glutaminyl and asparaginyl residues are frequently deamidated to the
corresponding
glutamyl and aspartyl residues. Alternatively, these residues are deamidated
under mildly
acidic conditions. Either form of these residues falls within the scope of
this invention.
Derivatization with bifunctional agents is useful, for example, for cross-
linking the
component peptides of the protein to each other or to other proteins in a
complex to a water-
insoluble support matrix or to other macromolecular Garners. Commonly used
cross-linking
agents include, for example, 1,1-bis(diazoacetyl)-2-phenylethane,
glutaraldehyde, N-
hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid,
homobifunctional
imidoesters, including disuccinimidyl esters such as 3,3'-
dithiobis(succinimidylpropionate),
and bifunctional maleimides such as bis-N-maleimido-1,8-octane. Derivatizing
agents such
as methyl-3-[p-azidophenyl) dithiolpropioimidate yield photoactivatable
intermediates that
are capable of forming crosslinks in the presence of light. Alternatively,
reactive water-
insoluble matrices such as cyanogen bromide-activated carbohydrates and the
reactive
substrates described in U.S. Patent Nos. 3,969,287; 3,691,016; 4,195,128;
4,247,642;
4,229,537; and 4,330,440 are employed for protein immobilization.
Other modifications include hydroxylation of proline and lysine,
phosphorylation of
hydroxyl groups of seryl or threonyl residues, methylation of the alpha-amino
groups of
lysine, arginine, and histidine side chains (Creighton, T.E., Proteins:
Structure and Molecular
Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)), acetylation
of the N-
terminal amine, and, in some instances, amidation of the C-terminal carboxyl
groups.
Such derivatized moieties may improve the stability, solubility, absorption,
biological
half life, and the like. The moieties may alternatively eliminate or attenuate
any undesirable
side effect of the protein complex and the like. Moieties capable of mediating
such effects
are disclosed, for example, in Remington's Pharmaceutical Sciences, 18th ed.,
Mack
Publishing Co., Easton, PA (1990).
The term "fragment" is used to indicate a polypeptide derived from the amino
acid
sequence of the proteins, of the complexes having a length less than the full-
length
polypeptide from which it has been derived. Such a fragment may, for example,
be produced
by proteolytic cleavage of the full-length protein. Preferably, the fragment
is obtained
recombinantly by appropriately modifying the DNA sequence encoding the
proteins to delete
one or more amino acids at one or more sites of the C-terminus, N-terminus,
and/or within
the native sequence. Fragments of a protein are useful for screening for
substances that act to
-82-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
modulate signal transduction, as described herein. It is understood that such
fragments may
retain one or more characterizing portions of the native complex. Examples of
such retained
characteristics include: catalytic activity; substrate specificity;
interaction with other
molecules in the intact cell; regulatory functions; or binding with an
antibody specific for the
native complex, or an epitope thereof.
Another functional derivative intended to be within the scope of the present
invention
is a "variant" polypeptide which either lacks one or more amino acids or
contains additional
or substituted amino acids relative to the native polypeptide. The variant may
be derived
from a naturally occurring complex component by appropriately modifying the
protein DNA
coding sequence to add, remove, and/or to modify codons for one or more amino
acids at one
or more sites of the C-terminus, N-terminus, and/or within the native
sequence. It is
understood that such variants having added, substituted and/or additional
amino acids retain
one or more characterizing portions of the native protein, as described above.
A functional derivative of a protein with deleted, inserted and/or substituted
amino
acid residues may be prepared using standard techniques well-known to those of
ordinary
skill in the art. For example, the modified components of the functional
derivatives may be
produced using site-directed mutagenesis techniques (as exemplified by
Adelinan et al.,
1983, DNA 2:183) wherein nucleotides in the DNA coding the sequence are
modified such
that a modified coding sequence is modified, and thereafter expressing this
recombinant
DNA in a prokaryotic or eukaryotic host cell, using techniques such as those
described above.
Alternatively, proteins with amino acid deletions, insertions and/or
substitutions may be
conveniently prepared by direct chemical synthesis, using methods well-known
in the art.
The functional derivatives of the proteins typically exhibit the same
qualitative biological
activity as the native proteins.
-83-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
TABLES
AND
DESCRIPTION THEREOF
This patent application describes two protein kinase polypeptides identified
in
genomic sequence databases. The results are summarized in five tables,
described below.
Table 1 documents the name of each gene, the classification of each gene, the
positions of the open reading frames within the sequence, and the length of
the corresponding
peptide. From left to right the data presented is as follows: "Gene Name",
"ID#na", "ID#aa",
"FL/Cat", "Superfamily", "Group", "Family", "NA length", "ORF Start", "ORF
End", "ORF
Length", and "AA length". "Gene name" refers to name given the sequence
encoding the
kinase or kinase-like enzyme. Each gene is represented by "SGK" designation
followed by a
number. The SGK name usually represents multiple overlapping sequences built
into a single
contiguous sequence (a "contig"). The "ID#na" and "ID#aa" refer to the
identification
numbers given each nucleic acid and amino acid sequence in this patent.
"FL/Cat" refers to
the length of the gene, with FL indicating full length, and "Cat' indicating
that only the
catalytic domain is presented. "Partial" in this column indicates that the
sequence encodes a
partial protein kinase catalytic domain. [insert* - "FLv" means ????? and "no"
means
??????]"Superfamily" identifies whether the gene is a protein kinase or
protein-kinase-like.
"Group" and "Family" refer to the protein kinase classification defined by
sequence
homology and based on previously established phylogenetic analysis [Hardie, G.
and Hanks
S. The Protein Kinase Book, Academic Press (1995) and Hunter T. and Plowman,
G. Trends
in Biochemical Sciences (1977) 22:18-22 and Plowman G.D. et al. (1999) Proc.
Natl. Acad.
Sci. 96:13603-13610)]. "NA length" refers to the length in nucleotides of the
corresponding
nucleic acid sequence. "ORF start" refers to the beginning nucleotide of the
open reading
frame. "ORF end" refers to the last nucleotide of the open reading frame,
excluding the stop
codon. "ORF length" refers to the length in nucleotides of the open reading
frame (excluding
the stop codon). "AA length" refers to the length in amino acids of the
peptide encoded in
the corresponding nuclei acid sequence.
-84-
<IMG>
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Table 2 lists the following features of the genes described in this
application:
chromosomal localization, single nucleotide polymorphisms (SNPs),
representation in
dbEST, and repeat regions. From left to right the data presented is as
follows: "Gene Name",
"ID#na", "ID#aa", "FL/Cat", "Superfasnily", "Group", "Family", "Chromosome",
"SNPs",
"dbEST hits", & "Repeats". The contents of the first 7 columns (i.e.,. "Gene
Name",
"ID#na", "ID#aa", "FL/Cat", "Superfamily", "Group", "Family") are as described
above for
Table 1. "Chromosome" refers to the cytogenetic localization of the gene.
Information in the
"SNPs" column describes the nucleic acid position and degenerate nature of
candidate single
nucleotide polymorphisms (SNPs). For example, for SGK386, the "SNPs" column
contains
"835=M", indicating that there are instances of both a C and an A (M = C or A)
at position
835. "dbESThits" lists accession numbers of entries in the public database of
ESTs (dbEST,
http://www.ncbi.nlm.nih.gov/dbEST/index.html) that contain at least 100 by of
100% identity
to the corresponding gene. These ESTs were identified by blastn of dbEST.
"Repeats"
contains information about the location of short sequences, approximately 20
by in length,
that are of low complexity and that are present in several distinct genes.
These repeats were
identified by blastn of the DNA sequence against the non-redundant nucleic
acid database at
NCBI (nrna). To be included in this repeat column, the sequence typically
could have 100%
identity over its length and typically is present in at least 5 different
genes.
-86-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
N
w
R
d
C.
d
H
N
W
N
a
z
x
U
N
d
.Q
H
_87_
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Table 3 lists the extent and the boundaries of the kinase catalytic domains.
The
column headings are: "Gene Name", "ID#na", "ID#aa", "FL/Cat", "Profile start",
" »" »" » " »
Profile end , Kinase start , I~inase end , and profile . The contents of the
first 7
columns (i.e.,. "Gene Name", "ID#na", "ID#aa", "FL/Cat", "Superfamily",
"Group",
"Family") are as described above for Table 1. "Profile Start", "Profile End",
"Kinase Start"
and "Kinase End" refer to data obtained using a Hidden-Markov Model to define
catalytic
range boundaries. The profile has a length of 261 amino acids, corresponding
to the
complete protein kinase catalytic domain. Proteins in which the profile
recognizes a full
length catalytic domain have a "Profile Start" of 1 and a "Profile End" of
261. Genes which
have a partial catalytic domain will have a "Profile Start" of greater than 1
(indicating that the
beginning of the kinase domain is missing, and/or a "Profile End" of less than
261 (indicating
that the C-terminal end of the kinase domain is missing). The boundaries of
the catalytic
domain within the overall protein are noted in the "Kinase Start" and "Kinase
End" columns.
"Profile" indicates whether the complete or "Smith Watennan" (partial).
Starting from a
multiple sequence aligmnent of kinase catalytic domains, two hidden Markov
models were
built. One of them allows for partial matches to the catalytic domain; this is
a "local" HMM,
similar to Smith-Waterman alignments in sequence matching. The other
"complete" model
allows matches only to the complete catalytic domain; this is a "global" HMM
similar
toNeedleman-Wunsch alignments in sequence matching. The Smith Waterman local
model
is more specific, allowing for fragmentary matches to the kinase catalytic
domain whereas the
global "complete" model is more sensitive, allowing for remote homologue
identification.
_88_
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
N
O
D
L
__
O
N
__
O
L
a
M
_O
H
-89-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Table 4 describes the results of Smith Waterman similarity searches (Matrix:
Pam100;
gap open/extension penalties 12/2) of the amino acid sequences against the
NCBI database of
non-redundant protein sequences
(http://www.ncbi.nhn.nih.~ov/Entrez/protein.html),. The
column headings axe: "Gene Name", "ID#na", "ID#aa", "FL/Cat", "Superfamily",
"Group",
"Family", "Pscore", "aa length", "aa ID match", "%Identity", "%Similar",
"ACC# nraa match", and "Description". The contents of the first 8 columns
(i.e.,. "Gene
Name", "ID#na", "ID#aa", "FL/Cat", "Serial #", "Superfamily", "Group",
"Family") are as
described above for Table 1. "Pscore" refers to the Smith Waterman probability
score. This
number approximates the chance that the alignment occurred by chance. Thus, a
very low
number, such as 2.10E-64, indicates that there is a very significant match
between the query
and the database target. "aa length" refers to the length of the protein in
amino acids.
"aa ID match" indicates the number of amino acids that were identical in the
alignment. "%
Identity" lists the percent of nucleotides that were identical over the
aligned region. "%
Similarity" lists the percent of amino acids that were similar over the
alignment.
"ACC#nraa match" lists the accession number of the most similar protein'in the
NCBI
database of non-redundant proteins. "Description" contains the name of the
most similar
protein in the NCBI database of non-redundant proteins.
-90-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
c
ca
~t ''
ca
.Q
ca
H- .~
N
-91-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Table 5 gives results of a PCR screen of 96 human cDNA sources for the two
kinases
exemplified in this application. A plus sign (+) indicates the presence of a
band on an
agarose gel of the expected size for the target kinase. The columns in table 5
are as follows:
"Tissue name", "RNA source" ("Clontech": from Clontech Inc
(http://www.clontech.com),
"Sugen": (from in-house sources); "NCI": (derived in-house from from human
tumor cell
lines), "Tissue" (tissue from which RNA is derived), and PCR screening results
(SGK341 and
SGK 351), followed by "Comments".
-92-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
c a~
v, o
O
N _
(~ fn U fn
O (a
(6 U ~ O "-' I6
o a O ~ E c
~ ~ ~
~ E
~n . O fl- N c ~L
- ~
C N ~ O
d C ' ~ y U
L ~ O '
~
." U
'-' '
O U C E
~ U ~' U
_ ~
9
V ~ (0 f C ~ . ~
~ ~ V N
. E .~ Y
~' D
oc ac c E
..c a o
n' E c ' U
. co c
p>
L
L CO .
_d
.C'r
M
+ + + + + + + + + + + + +
+
M
Y + + +
(9
U' LLJ LIJ- L1J -~ Z J
U
~' .G.CL.C.C.C.CL.C.C.CL.Ctt.C.Ct.C.C.C.C.C.C O O N N N N N
U U U U U U U U U U U U U U U U U U U U U U U U C C C C C C C C C C C C C
.nØ..4:.,0..+O..+0..~0. ~"Or ~~ O.~ ~.,0..~Ø ~",O~ ~~.~~ ~rØ O N N N N N
J J._IJJJJ
C C C C C C C C C C C C C C C C C C C C C C C C ~
I o 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 > > ~ o ~ a
Z U U U U U U U U U U U U U U U U U U U U U U U U ~ ~ ~ ~ ~ ~ U U U U U U U
d .a a~ o -o -o Z .- W
Z_>_>~~~~~~~ocv~~N~°=~°c~ >, o UUUUoUN~~~ o
U ~ N O~ ~ ' ~ ~ 'p 7 ~ ~ ~ c ~ LL! LIJ ~ W ~ Q 00 f~ D N ~
o c~,o >, c o U o ~ ~ . ~ Q o ~ U ~ m 3 0 ~ > > .~ a~ Q I" ~ V -o ~ ~ ,.c~ Q ~
~y. O
n.Q-w o ~~a~ ~n °~~ o ~ ~ ~~~Y ~=Z~=Z ~~Q=~ ~QO
h- Q Y N ~ ~ ~ "' ,a? ?, ~ Q ~ U ~ U
-93-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
o c
Y
O ~ N
fp _O
C a? ~ N j m
tU ~ Y
f0 L U 0 O (0 N
~ f
~ ~ V ~ _ _ iO
~~ ~ U -N O
Y . U f0 ~ f6 G Y 'Y N f0 ~ N
-
U
.
~
O ~ N O ~ ~ ~ O ~ fLf O ' O
~ ~ E
C N O .' O U ' - d N '
O O > p
U . O ~ ~ ~ U ~ .C
(E N f0 ~ C U C U U ~ .C
C C (~7
Ctf 'O ~ U O U E o O ~ ~ ~ U C
~ O ~ ,U
O O O _ t0O E
(U - ~ >' N
~ ftSf6 O O N p ~, ~ ' >,
(00 O O t ~ ~ .D ~ ~ U
' E L
~
E _ fly N ~'.~~ U~ ~ ~C U ~ ~~t~V O U (6C
Q ~U
Q
- . f0
o o o o -o a~ -o~ - ~n a~ C m ~
-o - . >' o o a o
~~
~ ~ o a ~ ~ ' o c
:~
~ a~
~c c~i~~, ~ ~ ~ ~ N ~ - g
~ ~ a -~_
' ac~
, , C y
~ - ~ ~~ j ~
- g
cu ~ c ~ c ~ ~ ~ ~ ( ~
c c J o o
U ~ ~ ~ J ~ _ O U
C J V
'fl
~
' O - - ' ~ , L V O
a ,~
~
o J J - a~ ~.C ~
.
a (D -J J N ~. C U
a ~' ~' J ~ Q O ~ U
m N
a
m .
0 -U . p N
~ J
_ U
~ p_ '
a
U
_d
.G
T
h
M
Y + + + + + + + + + + + + + + + +
+ + + + + + +
+ +
M
o ~ CA fn f~ f~ C~ C~ C~ C~ C~ C~ C~ C~ C~ U = _ _ > > O O J J J J J Z Z
N tlJ Z Z' Z Z '> > _ Z Z Z Z Z Z Z Z > > > > U U J J J J J d a ~ O O O O ~ ~
-t U U U U U U ~ J J J J J J ~ U O O O
O
U
L .N O N 'O O O N N N N N N O N N N N O N N O O N N N O N N N O N N N N N
C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C
O J_!JJ_!JJ ~~JJ~,J_iJJJ_IJJJJ.JJ_IJJ,_I_1JJJJ.J,JJ_IJ
_ _
N O N N N N O ~j ~j N N O ~ N O N N N N O ~ N ~ N O O N O O O N N N O N N O
Z U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U U
d
R W p~ ~ O7 dw'~ CV N CV ~''~ N N ~ ~ e- M ~ LPL! d' N ~ ~ ~ .O
'7 Q Q C~ U ~ 'n ~ j Z N M '~' ~ ~ > > r~ cfl U ~ 1-~- c°o aNO d' c~ o~
~ cu ~ T ~ .-
~ ~ ~- ~- j Z j > H Z U U U W U = U U ~ ~ z ~ ~ ~ p -_~ ~ ~ ~ U I- ~°
~.' ~ O
U ~ ~ ~ O O = Z = z Z U Z O O ~ U U ~ U Y ~ ~ D U = ~ = Y ~ U
Z U ~ Z
-94-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
s o
-n
~
0
c c ' .-.
0 o co
'
co c ~ ~ ~N
. O ,C 'X . ~ cN
~
C N (0 N O O
U c-
W B O O f0
U N
N
C~U..
fn 7
7
' N
'
Q
C c O O
p N _N
. N ~ O
= O ~ (
0 C
V ~ . O
(D
f0
~k
N N ~ ~ ~
~
~
U ..J
. ~ E .~' ..-. O
C O
~ C C
C
C (Q C
~ ~
N
~
. . (~ O
N
N ~ O CO ~ ~ N
~ ~ .N
~
~
v
m m J
47
_Cf
.Q T
F- M
Y + +
+
N
T
M
Y
C9
N
Z Z Z Z -~ J J J J J J w w w w w ~ O (6 (U N
N w w w w w w w w w w w ~ ~ ~ ~ ~ E E E E E ~
mmmmm~°cc°°ccJ
d
y' N N N N N N N N N N N N N N N N O
C C C C C C C C C C C C C C C C N N N N N C
J J J J J .J J J _l J J J J -1 J J ~ ~ ~ ~ N J
tO f_n t_n !O !_n
N ~ N N N N ~ N N N O N N N N N ~ ~ ~.~ ~- O
z U U U U U U U U U U U U U U U U U
as '°
R M > N ~ N N t7 N ~ O
~ W j l j ~ j ~j N ~ LPL. m m z ~ ,gin ~f ~ Z c
d ~ U oo Y X ~ ~ ~ U V ~ U ~ ~ ~ ~- N E co .c ~ t~
~ ~ fn f!J Y ~ a ~ ~ ~ ~ I- .~ c ~ ~ 7
-~5-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
EXAMPLES
The examples below are not limiting and are merely representative of various
aspects
and features of the present invention. The examples below demonstrate the
isolation and
characterization of the nucleic acid molecules according to the invention, as
well as the
polypeptides they encode.
EXAMPLE 1: Identification and Characterization of Genomic Fragments Encoding
Protein Kinases
Materials and Methods
Novel kinases were identified from the Celera human genomic sequence
databases,
and from the public Human Genome Sequencing project (http://www.ncbi.nlm.nih.
ovn
using a hidden Markov model (HMMR) built with 70 mammalian and yeast kinase
catalytic
domain sequences. These sequences were chosen from a comprehensive collection
of
kinases such that no two sequences had more than 50% sequence identity. The
genomic
database entries were translated in six open reading frames and searched
against the model
using a Timelogic Decypher box with a Field programmable array (FPGA)
accelerated
version of HMMR2.1. The DNA sequences encoding the predicted protein sequences
aligning to the I~~IMR profile were extracted from the original genomic
database. The
nucleic acid sequences were then clustered using the Pangea Clustering tool to
eliminated
repetitive entries. The putative protein kinase sequences were then
sequentially run through a
series of queries and filters to identify novel protein kinase sequences.
Specifically, the
HMMR identified sequences were searched using BLASTN and BLASTX against a
nucleotide and amino acid repository containing 634 known human protein
kinases and all
subsequent new protein kinase sequences as they axe identified. The output was
parsed into a
spreadsheet to facilitate elimination of known genes by manual inspection. Two
models were
developed, a "complete" model and a "partial" or Smith Waterman model. The
partial model
was used to identify sub-catalytic kinase domains, whereas the complete model
was used to
identify complete catalytic domains. The selected hits were then queried using
BLASTN
against the public nrna and EST databases to confirm they are indeed unique.
In some cases
the novel genes were judged to be homologues of previously identified rodent
or vertebrate
protein kinases.
-96-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Extension of partial DNA sequences to encompass the full-length open-reading
frame
was carried out by several methods. Iterative blastn searching of the cDNA
databases listed
in Table 9 was used to find cDNAs that extended the genomic sequences.
"LifeSeqGold"
databases are from Incyte Genomics, Inc (http://www.incyte.com~. NCBI
databases are
from the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/ ).
All blastn searches were conducted using a penalty for a nucleotide mismatch
of -3 and
reward for a nucleotide match of 1. The gapped blast algorithm is described
in: Altschul,
Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng
Zhang, Webb
Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new
generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402).
Extension of partial DNA sequences to encompass the full-length open-reading
frame
was also carried out by iterative searches of genomic databases. The first
method made use
of the Smith-Waterman algorithm to carry out protein-protein searches of a
close protein
homologue to the partial. The target databases consisted of Genscan and open-
reading frame
(ORF) predictions of all human genomic sequence derived from the human genome
proj ect
(HGP) as well as from Cetera. The complete set of genomic databases searched
is shown in
Table 10, below. Genomic sequences encoding potential extensions were further
assessed by
blastx analysis against the NCBI nonredundant database to confirm the novelty
of the hit. The
extending genomic sequences were incorporated into the cDNA sequence after
removal of
potential introns using the Seqman program from DNAStar. The default
parameters used for
Smith-Waterman searches were as shown next. Matrix: blosum 62; gap-opening
penalty: 12;
gap extension penalty: 2. Genscan predictions were made using the Genscan
program as
detailed in Chris Burge and Sam Karlin "Prediction of Complete Gene Structures
in Human
Genomic DNA", JMB (1997) 268(1):78-94). ORF predictions from genomic DNA were
made using a standard 6-frame translation.
Another method for defining DNA extensions from genomic sequence used
iterative
searches of genomic databases through the Genscan program to predict exon
splicing. These
predicted genes were then assessed to see if they represented "real"
extensions of the partial
genes based on homology to related kinases.
Another method involved using the Genewise program
(http://www.sanger.ac.uk/Software/Wise2/ ) to predict potential ORFs based on
homology to
the closest orthologue/homologue. Genewise requires two inputs, the homologous
protein,
-97-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
and genomic DNA containing the gene of interest. The genomic DNA was
identified by
blastn searches of Celera and Human Genome Project databases. The orthologs
were
identified by blastp searches of the NCBI non-redundant protein database
(NRAA).
Genewise compares the protein sequence to a genomic DNA sequence, allowing for
introns
and frameshifting errors.
-98-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
TABLE 6
Databases used for cDNA-based sequence extensions
Database Database Date
LifeGold templates Feb 2001
LifeGold compseqs Feb 2001
LifeGold compseqs Feb 2001
LifeGold compseqs Feb 2001
LifeGold fl Feb 2001
LifeGold flft Feb 2001
NCBI human Ests Feb 2001
NCBI marine Ests Feb 2001
NCBI nonredundant Feb 2001
-99-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
TABLE 7
Databases used for genomic-based sequence extensions
Database Number Database
of
entries Date
Celera v. 1-5 5,306,158 Jan 2000
Celera v. 6-10 4,209,980 March
2000
Celera v. 11-14 7,222,425 April
2000
Celera v. 15 243,044 April
2000
Celera v. 16-17 25,885 April
2000
Celera Assembly 5 (release479,986 March
2001
25h)
HGP Phase 0 3,189 Nov 1/00
HGP Phase 1 20,447 Jan 1/01
HGP Phase 2 1,619 Jan 1/0l
HGP Phase 3 9,224 March
2001
HGP Chromosomal assemblies2759 March
2001
-100-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Results:
The sources for the sequence information used to extend the genes in the
provisional
patents are listed below. For genes that were extended using Genewise, the
accession
numbers of the protein ortholog and the genomic DNA are given. (Genewise uses
the
ortholog to assemble the coding sequence of the target gene from the genomic
sequence).
The amino acid sequences for the orthologs were obtained from the NCBI non-
redundant
database of proteins .(http://www.ncbi.nlm.nih.gov/Entrez/protein.html). The
genomic DNA
came from two sources: Celera and NCBI-NRNA, as indicated below. cDNA sources
are
also listed below. All of the genomic sequences were used as input for Genscan
predictions
to predict splice sites [Barge and Karlin, JMB (1997) 268(1):78-94)].
Abbreviations: HGP:
Human Genome Proj ect; NCBI, National Center for Biotechnology Information.
SGK341, SEQ ID NO:1 and 3.
Genewise homolog: NP_005914 M3K5 (MEKK 5, ASK1) [Homo sapiens]
Genomic contig: Celera contig 90000627861182
Blastx vs. NCBI nonredundant of SGK341 hit MAP/ERK kinase kinase 5 (Homo
Sapiens) as the closest homolog. 200 kb of Celera AsmSh contig 90000627861182
was used
for genewise/genscan/sym4 predictions. Genewise was run with MAP/ERK kinase
kinase 5
as the model to derive the final sequence.
SGK351, ID#N0:2 and 4
Genewise homolog: human Ribosomal S6 kinase P23443
Genomic contig: 8099920
SGK341, SEQ JD NOS: 1 and 3, is 4480 nucleotides long. The open reading frame
starts at
position 1 and ends at position 4080, giving an ORF length of 4080
nucleotides. The stop
codon is from 4081 to 4083. The 3' untranslated region runs from nucleotides
4081 to 4480.
The predicted protein is 1360 amino acids long. Tlus sequence is a full length
kinase gene. It
is classified as a protein kinase in the STE11 family. This gene maps to
chromosomal
position Xp22.1. Amplification of genes in this region (Xp) have been
associated with
increased risk of colorectal cancer (Knuutila, et al.). This gene contains
three single
-101-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
nucleotide polymorphisms, at nucleotides 4120, 4166, and 4335. The nature of
the
polymorphism and the dbSNP accession numbers are as follow: 4120 = Y
(tgtcccaccaY)
ss18233; 4166 = K (cacgaattccK), ss1509704; 4335=Y (ggaaattcacY) ss1509699.
(The 10
nucleotides preceding the polymorphism are given to reduce any ambiguity in
the position of
the polymorphisms). All of the SNPs are in the 3' non-coding region. The
nucletide
sequence for this gene is represented in the public database of expressed
sequence tags by the
following ESTs: AV710158, AA410835, and BF132430. There are no small repeat
regions
in this gene.
SGK351, (SEQ ID N0:2 and 4) is 594 nucleotides long. The open reading frame
starts at
position 1 and ends at position 594, giving an ORF length of 594 nucleotides.
The predicted
protein is 198 amino acids long. This sequence contains a partial kinase
catalytic domain. It
is classified as a Protein Kinase of the AGC group and the S6K family. This
gene maps to
cytogenetic region 17q23. Amplification of this chromosomal position (17q22-
q25 ) has
been assosciated with increased incidence of breast carcinoma and bladder
cancer (Knuutila,
et al.). This gene does not contain mapped candidate single nucleotide
polymorphisms. No
ESTs representing this gene in were not found in dbEST. This gene has
repetitive sequence
at nucleotide positions 109 - 131.
EXAMPLE 2a: Expression Analysis of Polypeptides of the Invention
The gene expression patterns for selected genes were studied using a PCR
screen of
96 human tissues. This technique does not yield quantitative expression levels
between
tissues, but does identify which tissues express the gene at a level
detectable by PCR and
those which do not.
Example 2b: Predicted proteins
SGK341, SEQ ID NOS: 1 and 3, encodes a protein that is 1360 amino acids long.
It is
classified as a protein kinase in the STET 1 family. The kinase domain in this
protein matches
the hidden Markov profile for a full length kinase domain of 261 amino acids
from profile
position 3 to profile position 261. The position of the kinase catalytic
region within the
encoded protein is from amino acid 701 to amino acid 955. The results of a
Smith Waterman
-102-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
search of the public database of amino acid sequences (NRAA) with this protein
sequence
yielded the following results: Pscore =1.2e-315; number of identical amino
acids = 783;
percent identity = 58%; percent similarity = 74%; the accession number of the
most similar
entry in NRAA is NP_005914; the name or description, and species, of the most
similar
protein in NRAA is M3K5 (MEKK 5, ASKl) [Homo Sapiens].
SGK351, SEQ ID NOS: 2 and 4, encodes a protein that is 198 amino acids long.
It is
classified as (superfamily/group/family): Protein Kinase, AGC, S6K. The kinase
domain in
this protein matches the hidden Markov profile for a full length kinase domain
of 261 amino
acids from profile position 24 to profile position 261. The position of the
partial kinase
catalytic region within the encoded protein is from amino acid 1 to amino acid
175. The
results of a Smith Waterman search of the public database of amino acid
sequences (NRA.A)
with this protein sequence yielded the following results: Pscore = 1.30E-82;
number of
identical amino acids = 192; percent identity = 97%; percent similarity = 98%;
the accession
number of the most similar entry in NRAA is P23443; the name or description,
and species,
of the most similar protein in NR.AA is RIBOSOMAL PROTEIN S6 KINASE [Homo
Sapiens]. Domains other than the kinase catalytic domain identified within
this protein are:
Protein kinase C terminal domain, amino acids 176 to 196, Pscore=5.9e-014.
PCR Screening: Screenin, f~ or expression sources by PCR from ds cDNA
templates
Preparation of dscDNA tem fates
dscDNA templates were prepared by PCR amplification of symmetrically-tagged
reverse transcriptase sscDNA products generated as described in detail under
Materials and
Methods for the Tissue Array Gene Expression protocol. The tissue sources
amplified are
listed, for example, in Table 7. The amplification conditions were as follows:
per 200 microl
of PCR reaction, added 100 microl of Premix TaKaRa ExTaq, 20.0 microl of pwo
DNA
polymerase (1/10 dilution made as follows: 1 microl pwo (5 units/microl), 1
microl lOx PCR
buffer with 20 mM MgS04, 8 microl water), 4.0 microl sscDNA template (reverse
transcriptase product), 8.0 microl 10 pmoles/microl (10 microM) primer
(AAGCAGTGGTAACAACGCAGAGT ) (1.0 microM final cone) and 68.0 microl HaO. The
reaction was amplified according to the following regiment: hot start
(95°C for 1 min), 95°C
-103-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
for 1 min, 24 cycles, 95°C for 20 s, 65°C for 30 s, 68°C
for 6 min, 68°C for 10 min, 1 cycle
and 4°C forever. Following the PCR reaction, 5-10 microl of product
were applied to an
agarose gel together with lkb ladder size standards to assess the yield and
uniformity of the
product. A ;positive sign(+) Table 5 indicates the presence of the PCT product
at the
expected size. Products were cut out for sequence verification. The
oligonucleotides used to
screen the DNA sources, and the size of the PCR product, are listed below.
SEQID NA 1 SGK341 (Ste/Stel1)
5' primer CAGCAGGCAGTACGGTGGAGC
3' primer GTTTGGTGTAAAACTTGATTGTCGG
expected size band 336 by
observed size band 350
SEQID NA 2, SGK351 (AGC/S6K)
5' primer GAGAACTATTTATGCAGTTAGAAAG
3' primer CCAGAAGTTCTTCCCAGTTAATGTG
expected size band 519 by
observed size band 550 by
expression pattern stomach, thyroid, trachea, uterus, adrenal, fetal brain and
other normal tissues, numerous cancer cell lines also display the correct size
band.
Results
SEQ ID NO: 1, SGK341 was successfully identified by PCR from the following
human
tissues/cell lines uterus, fetal brain and heart. This gene is restricted in
its expression.
SEQ ID N0:2, SGK351 was successfully identified by PCR from the following
human
tissues/cell lines: fetal liver, thymus, pancreas , pituitary gland , placenta
, prostate, salivary
g1. , skeletal muscle , small intestine , spinal cord , Spleen , stomach,
thyroid gland , trachea ,
uterus , adrenal gland , fetal brain , fetal kidney , fetal lung , heart ,
kidney , liver , lung ,
lymph node ,Heart ,HPAEC, RPTEC, HMEC, HCAEC, 458 medullo RNA, A549/ATCC
MDA-MB-231, Hs 578T, MCF-7/ADR-RES, Maline-3M, A498, COLO 205, CCRF-CEM,
SF-539, SF-295, U251, and SNB-19. This gene has a broad expression pattern.
EXAMPLE 2c: Classification of polypeptides exhibiting kinase activity among
defined
groups
-104-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
STE Groun
SEQ ID NO:1, SGK341 is a novel member of the STE family of kinases. The STE
family of
protein kinases represent key regulators of multiple signal transduction
pathways important in
cell proliferation, survival, differentiation and response to cellular stress.
The STE group of
protein kinases includes as its major prototypes the NEK kinases as well as
the STE7, STE11
and STE20 family of sterile protein kinases. SGK341 (SEQID NA #1) represents a
novel
STE11 family member of the STE group. The encoded protein shares 58% identity
to ASKl,
a kinase involved in regulating cell survival (Hatai, et al. JBiol Chem 2000
Aug
25;275(34):26576-81). SGK341 (SEQID NA# 1) may play a role in cell survival,
as well as
other important signalling pathways regulated by STE family members.
AGC Group
SEQ ID NO: 2, SGK351 is a member of the AGC group of protein kinases. The AGC
group of protein kinases includes as its major prototypes protein kinase C
(PKC), cAMP-
dependent protein kinases (PKA), the G protein-coupled receptor kinases [(ARK
and
rhodopsin kinase (GRKl)] as well as p70S6K and AKT. SEQID NA 2 SGK351 belongs
specifically to the S6K family of AGC group kinases. It is 97% identical over
a 198 amino
acid region to human ribosomal protein S6 kinase (P23443). The family of human
ribosomal S6 protein kinases consists of at least 8 members (RSKl, RSK2, RSK3,
RSK4,
MSKl, MSK2, p70S6K and p70S6Kb). Ribosomal protein S6 protein kinases play
important
pleotropic functions, among them is a key role in the regulation of mRNA
translation during
protein biosynthesis (Eur JBiochem 2000 Nov; 267(21):6321-30, Exp Cell Res.
1999 Nov
25;253 (1):100-9, Mol Cell E~cdoc~ihol 1999 May 25;151(1-2):65-77). The
phosphorylation
of the S6 ribosomal protein by p70S6 has also been implicated in the
regulation of cell
motility (Immuhol Cell Biol 2000 Aug;78(4):447-51 ) and cell growth (frog
Nucleic Acid
Res Mol Biol 2000;65:101-27), and hence, may be important in tumor metastasis,
the immune
response and tissue repair. SEQID_NA_2 SGK351 may represent an additional
member of
4
the family of S6 kinases with a potential role in cancer, inflammation, as
well as other disease
conditions.
EXAMPLE 3: Isolation of cDNAs Encoding Mammalian Protein Kinases
Materials and Methods
-105-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Identification of novel clones
Total RNAs are isolated using the Guanidine Salts/Phenol extraction protocol
of
Chomczynski and Sacchi (P. Chomczynski and N. Sacchi, Anal. Biochem. 162, 156
(1987))
from primary human tumors, normal and tumor cell lines, normal human tissues,
and sorted
human hematopoietic cells. These RNAs are used to generate single-stranded
cDNA using
the Superscript Preamplification System (GIBCO BRL, Gaithersburg, MD; Gerard,
GF et al.
(1989), FOCUS 11, 66) under conditions recommended by the manufacturer. A
typical
reaction uses 10 ~,g total RNA with 1.5 ~,g oligo(dT)lz-is in a reaction
volume of 60 ~,L. The
product is treated with RNaseH and diluted to 100 ~,L with H20. For subsequent
PCR
amplification, 1-4 ~,L of this sscDNA is used in each reaction.
Degenerate oligonucleotides are synthesized on an Applied Biosystems 3948 DNA
synthesizer using established phosphoramidite chemistry, precipitated with
ethanol and used
unpurified for PCR. These primers are derived from the sense and antisense
strands of
conserved motifs within the catalytic domain of several protein kinases.
Degenerate
1 S nucleotide residue designations are: N = A, C, G, or T; R = A or G; Y = C
or T; H = A, C or
TnotG; D=A, GorTnotC; S=Core; andW=AorT.
PCR reactions are performed using degenerate primers applied to multiple
single-
stranded cDNAs. The primers are added at a final concentration of 5 ~.M each
to a mixture
containing 10 mM TrisHCl, pH 8.3, 50 mM ICI, 1.5 mM MgCl2, 200 p,M each
deoxynucleoside triphosphate, 0.001 % gelatin, 1.5 U AmpliTaq DNA Polymerase
(Perkin-
Elmer/Cetus), and 1-4 ~L cDNA. Following 3 min denaturation at 95 °C,
the cycling
conditions are 94 °C for 30 s, 50 °C for 1 min, and 72 °C
for 1 min 45 s for 35 cycles. PCR
fragments migrating between 300-350 by are isolated from 2% agarose gels using
the
GeneClean Kit (Bio101), and T-A cloned into the pCRII vector (Invitrogen Corp.
U.S.A.)
according to the manufacturer's protocol.
Colonies are selected for mini plasmid DNA-preparations using Qiagen columns
and
the plasmid DNA is sequenced using a cycle sequencing dye-terminator kit with
AmpliTaq
DNA Polymerase, FS (ABI, Foster City, CA). Sequencing reaction products are
run on an
ABI Prism 377 DNA Sequences, and analyzed using the BLAST alignment algorithm
(Altschul, S.F. et al., J.Mol.Biol. 215: 403-10).
Additional PCR strategies are employed to connect various PCR fragments or
ESTs
using exact or near exact oligonucleotide primers. PCR conditions are as
described above
-106-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
except the annealing temperatures are calculated for each oligo pair using the
formula: Tm =
4(G+C)+2(A+T).
Isolation of cDNA clones:
Human cDNA libraries are probed with PCR or EST fragments corresponding to
kinase-related genes. Probes are 32P-labeled by random priming and used at
2x106 cpm/mL
following standard techniques for library screening. Pre-hybridization (3 h)
and
hybridization (overnight) are conducted at 42 oC in SX SSC, SX Denhart's
solution, 2.5%
dextran sulfate, 50 mM Na2P04/NaHP04, pH 7.0, 50% formamide with 100 mg/mL
denatured salmon sperm DNA. Stringent washes are performed at 65 °C in
O.1X SSC and
0.1 % SDS. DNA sequencing was carried out on both strands using a cycle
sequencing dye-
terminator kit with AmpliTaq DNA Polymerase, FS (ABI, Foster City, CA).
Sequencing
reaction products are run on an ABI Prism 377 DNA Sequencer.
-107-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
EXAMPLE 4: Expression Analysis of Mammalian Protein Kinases
Materials and Methods
Northern blot analysis
Northern blots are prepared by running 10 ~,g total RNA isolated from 60 human
tumor cell lines (such as HOP-92, EKVX, NCI-H23, NCI-H226, NCI-H322M, NCI-
H460,
NCI-H522, A549, HOP-62, OVCAR-3, OVCAR-4, OVCAR-5, OVCAR-8, IGROV1, SK-
OV-3, SNB-19, SNB-75, U251, SF-268, SF-295, SF-539, CCRF-CEM, K-562, MOLT-4,
HL-60, RPMI 8226, SR, DU-145, PC-3, HT-29, HCC-2998, HCT-116, SW620, Colo 205,
HTC15, KM-12, UO-31, SN12C, A498, CaKil, RXF-393, ACHN, 786-0, TK-10, LOX
IMVI, Malme-3M, SK-MEL-2, SK-MEL-5, SK-MEL-28, UACC-62, UACC-257, M14,
MCF-7, MCF-7/ADR RES, Hs578T, MDA-MB-231, MDA-MB-435, MDA-N, BT-549,
T47D), from human adult tissues (such as thymus, lung, duodenum, colon,
testis, brain,
cerebellum, cortex, salivary gland, liver, pancreas, kidney, spleen, stomach,
uterus, prostate,
skeletal muscle, placenta, mammary gland, bladder, lymph node, adipose
tissue), and 2
human fetal normal tissues (fetal liver, fetal brain ), on a denaturing
formaldehyde 1.2%
agarose gel and transferring to nylon membranes.
Filters are hybridized with random primed [a32P]dCTP-labeled probes
synthesized
from the inserts of several of the kinase genes. Hybridization is performed at
42 °C overnight
in 6X SSC, 0.1% SDS, 1X Denhardt's solution, 100 ~.g/mL denatured herring
sperm DNA
with 1-2 x 106 cpm/mL of 32P-labeled DNA probes. The filters are washed in
0.1X
SSClO.l% SDS, 65 °C, and exposed on a Molecular Dynamics
phosphorimager.
Quantitative PCR analysis
RNA is isolated from a variety of normal human tissues and cell lines. Single
stranded cDNA is synthesized from 10 p,g of each RNA as described above using
the
Superscript Preamplification System (GibcoBRL). These single strand templates
are then
used in a 25 cycle PCR reaction with primers specific to each clone. Reaction
products are
electrophoresed on 2% agarose gels, stained with ethidium bromide and
photographed on a
UV light box. The relative intensity of the STK-specific bands were estimated
for each
sample.
DNA Array Based Expression Analysis
-108-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Plasmid DNA array blots are prepared by loading 0.5 p,g denatured plasmid for
each
kinase on a nylon membrane. The [y32P]dCTP labeled single stranded DNA probes
are
synthesized from the total RNA isolated from several human immune tissue
sources or tumor
cells (such as thymus, dendrocytes, mast cells, monocytes, B cells (primary,
Jurkat,
RPMI8226, SR), T cells (CD8/CD4+, TH1, TH2, CEM, MOLT4), K562
(megakaryocytes).
Hybridization is performed at 42 °C for 16 hours in 6X SSC, 0.1% SDS,
1X Denhardt's
solution, 100 ~,g/mL denatured herring sperm DNA with 106 cpmlmL of [y32P]dCTP
labeled
single stranded probe. The filters are washed in 0.1X SSC/0.1% SDS, 65
°C, and exposed for
quantitative analysis on a Molecular Dynamics phosphorimager.
EXAMPLE 5: Protein Kinase Gene Expression
Vector Construction
Materials and Methods
Expression Vector Construction
Expression constructs are generated for some of the human cDNAs including: a)
full-
length clones in a pCDNA expression vector; b) a GST-fusion construct
containing the
catalytic domain of the novel kinase fused to the C-terminal end of a GST
expression
cassette; and c) a full-length clone containing a Lys to Ala (K to A) mutation
at the predicted
ATP binding site within the kinase domain, inserted in the pCDNA vector.
The "K to A" mutants of the kinase might function as dominant negative
constructs,
and will be used to elucidate the function of these novel STKs.
EXAMPLE 6: Generation of Specific Immunoreaøents to Protein Kinases
Materials and Methods
Specific immunoreagents are raised in rabbits against KLH- or MAP-conjugated
synthetic peptides corresponding to isolated kinase polypeptides. C-terminal
peptides were
conjugated to KLH with glutaraldehyde, leaving a free C-terminus. Internal
peptides were
MAP-conjugated with a blocked N-terminus. Additional immunoreagents can also
be
generated by immunizing rabbits with the bacterially expressed GST-fusion
proteins
containing the cytoplasmic domains of each novel PTK or STK.
The various immune sera are first tested for reactivity and selectivity to
recombinant
protein, prior to testing for endogenous sources.
-109-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Western blots
Proteins in SDS PAGE are transferred to immobilon membrane. The washing buffer
is PBST (standard phosphate-buffered saline pH 7.4 + 0.1% Triton X-100).
Blocking and
antibody incubation buffer is PBST +5% milk. Antibody dilutions varied from
1:1000 to
1:2000.
EXAMPLE 7: Recombinant Expression and Biological Assays for Protein Kinases
Materials and Methods
Transient Expression of Kinases in Mammalian Cells
The pcDNA expression plasmids (10 ~.g DNA/100 mm plate) containing the kinase
constructs are introduced into 293 cells with lipofectamine (Gibco BRL). After
72 hours, the
cells are harvested in 0.5 mL solubilization buffer (20 mM HEPES, pH 7.35, I50
mM NaCI,
10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, 2 mM
phenylmethylsulfonyl
fluoride, 1 p,g/mL aprotinin). Sample aliquots are resolved by SDS
polyacrylamide gel
electrophoresis (PAGE) on 6% acrylamide/0.5% bis-acrylamide gels and
electrophoretically
transferred to nitrocellulose. Non-specific binding is blocked by
preincubating blots in Blotto
(phosphate buffered saline containing 5% w/v non-fat dried milk and 0.2% v/v
nonidet P-40
(Sigma)), and recombinant protein was detected using the various anti-peptide
or anti-GST-
fusion specific antisera.
Ih Vitro Kinase Assays
Three days after transfection with the kinase expression constructs, a 10 cm
plate of
293 cells is washed with PBS and solubilized on ice with 2 mL PBSTDS
containing
phosphatase inhibitors (10 mM NaHP04, pH 7.25, 150 mM NaCI, 1% Triton X-100,
0.5%
deoxycholate, 0.1% SDS, 0.2% sodium azide, 1 mM NaF, 1 mM EGTA, 4 mM sodium
orthovanadate, 1 % aprotinin, 5 ~,g/mL leupeptin). Cell debris was removed by
centrifugation
(12000 x g, 15 min, 4 °C) and the lysate was precleared by two
successive incubations with
50 ~.L of a 1:1 slurry of protein A sepharose for 1 hour each. One-half mL of
the cleared
supernatant was reacted with 10 p,L of protein A purified kinase-specific
antisera (generated
from the GST fusion protein or antipeptide antisera) plus 50 ~.L of a 1:1
slurry of protein A-
sepharose for 2 hr at 4 °C. The beads were then washed 2 times in
PBSTDS, and 2 times in
HNTG (20 mM HEPES, pH 7.5/150 mM NaCI, 0,1% Triton X-100, 10% glycerol).
-110-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
The immunopurified kinases on sepharose beads are resuspended in 20 ~.L HNTG
plus 30 mM MgCl2, 10 mM MnCla, and 20 ~.Ci [a32P]ATP (3000 Ci/mmol). The
kinase
reactions are run for 30 min at room temperature, and stopped by addition of
HNTG
supplemented with 50 mM EDTA. The samples are washed 6 times in HNTG, boiled 5
min
in SDS sample buffer and analyzed by 6% SDS-PAGE followed by autoradiography.
Phosphoamino acid analysis is performed by standaxd 2D methods on 32P-labeled
bands
excised from the SDS-PAGE gel.
Similar assays are performed on bacterially expressed GST-fusion constructs of
the
15
kinases.
EXAMPLE 8a: Chromosomal Localization of Protein Kinases
Materials and Methods
Several sources were used to find information about the chromosomal
localization of each of
the genes described in this patent. First, cytogenetic map locations of these
contigs were
found in the title or text of their Genbank record, or by inspection through
the NCBI human
genome map viewer (http://www.ncbi.nhn.nih.gov/cgi-bin/Entrez/hum srch?).
Alternatively, the accession number of a genomic contig (identified by BLAST
against
NRNA) was used to query the Entrez Genome Browser
(http://www.ncbi.nhn.nih.gov/PMGifs/Genomes/MapViewerHelp.html ), and the
cytogenetic
localization was read from the NCBI data. A thorough search of available
literature for the
cytogenetic region is also made using Medline
(http://www.ncbi.nlm.nih.gov/PubMed/medline.html). References for association
of the
mapped sites with chromosomal amplifications found in human cancer can be
found in:
Knuutila, et al., Am J Pathol, 1998, 152:1107-1123.
Alternatively, the accession number for the nucleic acid sequence is used to
query the
Unigene database. The site containing the Unigene search engine is:
http://www.ncbi.nhn.nih.gov/UniGene/Hs.Home.html. Information on map position
within
the Unigene database is imported from several sources, including the Online
Mendelian
Inheritance in Man (OMIM, http://www.ncbi.nlm.nih.gov/Omim/searchomim.html),
The
Genome Database
-111-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
(http://gdb.infobiogen.frlgdb/simpleSearch.html), and the Whitehead Institute
human
physical map (http://carbon.wi.mit.edu:8000/cgi-bin/contig/sts
info?database=release).
Once a cytogenetic region has been identified by one of these approaches,
disease
association can be established by searching OMIM with the cytogenetic
location. OM1M
maintains a searchable catalog of cytogenetic map locations organized by
disease. A
thorough search of available literature for the cytogenetic region is also
made using Medline
(http://www.ncbi.nlm.nih.gov/PubMed/medline.html). As noted above, feferences
for
association of the mapped sites with chromosomal abnormalities found in human
cancer can
be found in: Knuutila, et al., Am J Pathol, 1998, 152:1107-1123.
Results
The chromosomal regions for mapped genes are listed in Table 2. The
chromosomal
positions were cross-checked with the Online Mendelian Inheritance in Man
database
(OMIM, http://www.ncbi.nlm.nih.~ov/htbin-post/Omim), which tracks genetic
information
for many human diseases, including cancer. References for association of the
mapped sites
with chromosomal abnormalities found in human cancer can be found in:
Knuutila, et al., Am
J Pathol, 1998, 152:1107-1123. A third source of information on mapped
positions was
searching published literature (at NCBI, http://www.ncbi.nlm.nih.~ov/entrez/
uer ~.fc~i) for
documented association of the mapped position with human disease.
EXAMPLE 8b: Candidate Single Nucleotide Polymorphisms (SNPs)
Materials and Methods
The most common variations in human DNA are single nucleotide polymorphisms
(SNPs),
which occur approximately once every 100 to 300 bases. Because SNPs are
expected to
facilitate large-scale association genetics studies, there has recently been
great interest in SNP
discovery and detection. Candidate SNPs for the genes in tlus patent were
identified by
blastn searching the nucleic acid sequences against the public database of
sequences
containing documented SNPs (dbSNP: sequence files were downloaded from
ftp://ncbi.nhn.nih.gov/SNP/human/rs-fasts/ and
ftp://ncbi.nlm.nih.gov/SNP/human/ss-fasts/
and used to create a blast database). dbSNP accession numbers for the SNP-
containing
-112-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
sequences are given. SNPs were also identified by comparing several databases
of expressed
genes (dbEST, NRNA) and genomic sequence (i.e., NRNA) for single basepair
mismatches.
The results are shown in Table 2, in the column labeled "SNPs". These are
candidate SNPs -
their actual frequency in the human population was not determined. The code
below is
standard for representing DNA sequence:
G = Guanosine
A =Adenosine
T = Thymidine
C = Cytidine
R = G or A, puRine
Y = C or T, pYrimidine
K = G or T, Keto
W = A or T, Weak (2 H-bonds)
S = C or G, Strong (3 H-bonds)
M = A or C, aMino
B = C, G or T (i.e., not A)
D =A, G or T (i.e., not C)
H =A, C or T (i.e., not G)
V =A, C or G (i.e., not T)
N = A, C, G or T, aNy
X - A, C, G or T
complementary GATCRYWSKMBVDHNX
DNA +-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+
strands CTAGYRSWMKVBHDNX
For example, if two versions of a gene exist, one with a "C" at a given
position, and a
second one with a "T: at the same position, then that position is represented
as a Y, which
means C or T. In table 2, for SGK002, the SNP column says "1165=R" , which
means that at
position 1165, a polymorphism exists, with that position sometimes containing
a G and
=113-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
sometimes an A (R represents A or G). SNPs may be important in identifying
heritable traits
associated with a gene.
Results
SGK341 (SEQ ID NO:1 and 3) maps to chromosomal position Xp22.1. Amplification
of
genes in this region (Xp) have been associated with increased risk of
colorectal cancer
(Knuutila, et al.). This gene contains three single nucleotide polymorphisms,
at nucleotides
4120, 4166, and 4335. The nature of the polymorphism and the dbSNP accession
numbers
are as follow: 4120 = Y (tgtcccaccaY) ss18233; 4166 = K (cacgaattccK),
ss1509704; 4335=Y
(ggaaattcacY) ss1509699. (The 10 nucleotides preceding the polymorphism are
given to
reduce any ambiguity in the position of the polymorphisms). All of the SNPs
are in the 3'
non-coding region. The nucletide sequence for this gene is represented in the
public database
of expressed sequence tags by the following ESTs: AV714158, AA410835, and
BF132430.
1 S There are no small repeat regions in this gene.
SGK351 (SEQ ID N0:2 and 4) maps to cytogenetic region 17q23. Amplification of
this
chromosomal position (17q22-q25 ) has been assosciated with increased
incidence of breast
carcinoma and bladder cancer (Knuutila, et al.). This gene does not contain
mapped
candidate single nucleotide polymorphisms. No ESTs representing this gene in
were not
found in dbEST. This gene has repetitive sequence at nucleotide positions 109 -
131.
EXAMPLE 9: Demonstration Of Gene Amplification By Southern Blotting
Materials and Methods
Nylon membranes are purchased from Boehringer Mannheim. Denaturing solution
contains 0.4 M NaOH and 0.6 M NaCI. Neutralization solution contains 0.5 M
Tris-HCL, pH
7.5 and 1.5 M NaCl. Hybridization solution contains 50% formamide, 6X SSPE,
2.5X
Denhardt's solution, 0.2 mg/mL denatured salinon DNA, 0.1 mg/mL yeast tRNA,
and 0.2
sodium dodecyl sulfate. Restriction enzymes are purchased from Boehringer
Mannheim.
Radiolabeled probes are prepared using the Prime-it II kit by Stratagene. The
beta actin DNA
fragment used for a probe template is purchased from Clontech.
Genomic DNA is isolated from a variety of tumor cell lines (such as MCF-7, MDA-
MB-231, Calu-6, A549, HCT-15, HT-29, Colo 205, LS-180, DLD-1, HCT-116, PC3,
-114-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
CAPAN-2, MIA-PaCa-2, PANC-1, AsPc-l, BxPC-3, OVCAR-3, SKOV3, SW 626 and PA-
l, and from two normal cell lines.
A 10 ~.g aliquot of each genomic DNA sample is digested with EcoR I
restriction
enzyme and a separate 10 p,g sample is digested with Hind III restriction
enzyme. The
restriction-digested DNA samples are loaded onto a 0.7% agarose gel and,
following
electrophoretic separation, the DNA is capillary-transferred to a nylon
membrane by standard
methods (Sambrook, J. et al (1989) Molecular Cloning: A Laboratory Manual,
Cold Spring
Harbor Laboratory).
EXAMPLE 10: Detection Of Protein-Protein Interaction Through Phase Display
Materials And Methods
Phage display provides a method for isolating molecular interactions based on
affinity
for a desired bait. cDNA fragments cloned as fusions to phage coat proteins
are displayed on
the surface of the phage. Phage(s) interacting with a bait are enriched by
affinity purification
and the insert DNA from individual clones is analyzed.
T7 Phage Display Libraries
All libraries were constructed in the T7SeIectl-Ib vector (Novagen) according
to the
manufacturer's directions.
Bait Presentation
Protein domains to be used as baits are generated as C-terminal fusions to GST
and
expressed in E. coli. Peptides are chemically synthesized and biotinylated at
the N-terminus
using a long chain spacer biotin reagent.
Selection
Aliquots of refreshed libraries (101°-1012 pfu) supplemented with
PanMix and a
cocktail of E. coli inhibitors (Sigma P-8465) are incubated for 1-2 hrs at
room temperature
with the immobilized baits. Unbound phage is extensively washed (at least 4
times) with
wash buffer.
After 3-4 rounds of selection, bound phage is eluted in 100 ~,L of 1 % SDS and
plated
on agarose plates to obtain single plaques.
-115-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Identification of insert DNAs
Individual plaques are picked into 25 ~.L of 10 mM EDTA and the phage is
disrupted
by heating at 70 °C for 10 min. 2 ~.L of the disrupted phage are added
to 50 ~.L PCR reaction
mix. The insert DNA is amplified by 35 rounds of thermal cycling (94
°C, 50 sec; 50 °C,
lmin; 72 °C, lmin).
Composition of Buffer
lOx PanMix
5% Triton X-100
10% non-fat dry mills (Carnation)
10 mM EGTA
250 mM NaF
250 ~g/mL Heparin (sigma)
250 ~,g/mL sheared, boiled salmon sperm DNA (sigma)
0.05% Na azide
Prepared in PBS
Wash Buffer
PBS supplemented with:
0.5% NP-40
~,1 g/mL heparin
PCR reaction mix
1.0 mL l Ox PCR buffer (Perkin-Eliner, with 15 mM Mg)
0.2 mL each dNTPs (10 mM stock)
25 0.1 mL T7UP primer (15 pmol/~,L) GGAGCTGTCGTATTCCAGTC
0.1 mL T7DN primer (15 pmol/~L) AACCCCTCAAGACCCGTTTAG
0.2 mL 25 mM MgCla or MgS04 to compensate for EDTA
Q.S. to 10 mL with distilled water
Add 1 unit of Taq polymerase per 50 ~,L reaction
LIBRARY: T7 Selectl-H441
EXAMPLE 11: FLK-1
-116-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
An ELISA assay was conducted to measure the kinase activity of the FLK-1
receptor
and more specifically, the inhibition or activation of TK activity on the FLK-
1 receptor.
Specifically, the following assay was conducted to measure kinase activity of
the FLK-1
receptor in cells genetically engineered to express Flk-1.
Materials
and Reagents
The following reagents and supplies were used:
1. Corning 96-well ELISA plates (Corning Catalog No. 25805-96);
2. Cappel goat anti-rabbit IgG (catalog no. 55641);
3. PBS (Gibco Catalog No. 450-1300EB);
4. TBSW Buffer (50 mM Tris (pH 7.2), 150 mM NaCI and 0.1%
Tween-20);
5. Ethanolamine stock (10% ethanolamine (pH 7.0), stored
at 4 C);
6. HNTG buffer (20 mM HEPES buffer (pH 7.5), 150 mM NaCI,
0.2% Triton X-
100, and % glycerol); '
10
7. EDTA (0.5 M (pH 7.0) as a 100X stock);
8. Sodium orthovanadate (0.5 M as a 100X stock);
9. Sodium pyrophosphate (0.2 M as a 100X stock);
10. NUNC 96 well V bottom polypropylene plates (Applied
Scientific Catalog
No. AS-72092);
11. NIH3T3 C7#3 Cells (FLK-1 expressing cells);
12. DMEM with 1X high glucose L-Glutamine (catalog No. 11965-050);
13. FBS, Gibco (catalog no. 16000-028);
14. L-glutamine, Gibco (catalog no. 25030-016);
15. VEGF, PeproTech, Inc. (catalog no. 100-20) (kept as
1 p,g1100 ~.1 stock in
Milli-Q dH20
and stored
at -20 C);
16. Affinity purified anti-FLK-1 antiserum;
17. UB40 monoclonal antibody specific for phosphotyrosine (see, Fendley, et
al.,
1990, Cahce~ Research 50:1550-1558);
18. EIA grade Goat anti-mouse IgG-POD (BioRad catalog no. 172-1011);
19. 2,2-azino-bis(3-ethylbenz-thiazoline-6-sulfonic acid (ABTS) solution (100
mM citric acid (anhydrous), 250 mM Na2HP04 (pH 4.0), 0.5 mglml ABTS (Sigma
catalog
no. A-1888)), solution should be stored in dark at 4 °C until ready for
use;
20. H20a (30% solution) (Fisher catalog no. H325);
-117-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
21. ABTS/H2O2 (15 ml ABTS solution, 2 p1 H202) prepared 5 minutes before use
and left at room temperature;
22. 0.2 M HCl stock in H20;
23. dimethylsulfoxide (100%) (Sigma Catalog No. D-8418); and
24. Trypsin-EDTA (Gibco BRL Catalog No. 25200-049).
Protocol
The following protocol was used for conducting the assay:
1. Coat Corning 96-well ELISA plates with 1.0 ~.g per well Cappel Anti-rabbit
IgG antibody in 0.1 M NaZC03 pH 9.6. Bring final volume to 150 ~,l per well.
Coat plates
overnight at 4 °C. Plates can be kept up to two weeks when stored at 4
°C.
2. Grow cells in Growth media (DMEM, supplemented with 2.0 mM L-
Glutamine, 10% FBS) in suitable culture dishes until confluent at 37
°C, 5% C02.
3. Harvest cells by trypsinization and seed in Corning 25850 polystyrene 96-
well
round bottom cell plates, 25.000 cells/well in 200 ~,1 of growth media.
4. Grow cells at least one day at 37 °C, 5% C02.
5. Wash cells with D-PBS 1X.
6. Add 200 ~,l/well of starvation media (DMEM, 2.0 mM 1-Glutamine, 0.1
FBS). Incubate overnight at 37 °C, 5% COa.
7. Dilute Compounds 1:20 in polypropylene 96 well plates using starvation
media. Dilute dimethylsulfoxide 1:20 for use in control wells.
8. Remove starvation media from 96 well cell culture plates and add 162 ~.1 of
fresh starvation media to each well.
9. Add 18 ~,1 of 1:20 diluted Compound dilution (from step 7) to each well
plus
the 1:20 dimethylsulfoxide dilution to the control wells (~ VEGF), for a final
dilution of
1:200 after cell stimulation. Final dimethylsulfoxide is 0.5%. Incubate the
plate at 37 °C, 5%
C02 for two hours.
10. Remove unbound antibody from ELISA plates by inverting plate to remove
liquid. Wash 3 times with TBSW + 0.5% ethanolamine, pH 7Ø Pat the plate on a
paper
towel to remove excess liquid and bubbles.
11. Block plates with TBSW + 0.5% Ethanolamine, pH 7.0, 150 ~.l per well.
Incubate plate thirty minutes while shaking on a microtiter plate shaker.
-118-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
12. Wash plate 3 times as described in step 10.
13. Add 0.5 ~.g/well affinity purified anti-FLU-1 polyclonal rabbit antiserum.
Bring final volume to 150 ~l/well with TBSW + 0.5% ethanolamine pH 7Ø
Incubate plate
for thirty minutes while shaking.
14. Add 180 ~.1 starvation medium to the cells and stimulate cells with 20
~,1/well
10.0 mM sodium ortho vanadate and 500 ng/ml VEGF (resulting in a final
concentration of
1.0 mM sodium ortho vanadate and 50 ng/ml VEGF per well) for eight minutes at
37 °C, 5%
C02. Negative control wells receive only starvation medium.
15. After eight minutes, media should be removed from the cells and washed one
time with 200 ~,l/well PBS.
16. Lyse cells in 150 ~,1/well HNTG while shaking at room temperature for five
minutes. HNTG formulation includes sodium ortho vanadate, sodium pyrophosphate
and
EDTA.
17. Wash ELISA plate three times as described in step 10.
1 S 18. Transfer cell lysates from the cell plate to ELISA plate and incubate
while
shaking for two hours. To transfer cell lysate pipette up and down while
scrapping the wells.
19. Wash plate three times as described in step 10.
20. Incubate ELISA plate with 0.02 ~,g/well UB40 in TBSW + 05% ethanolamine.
Bring final volume to 150 ~,llwell. Incubate while shaking for 30 minutes.
21. Wash plate three times as described in step 10.
22. Incubate ELISA plate with 1:10,000 diluted EIA grade goat anti-mouse IgG
conjugated horseradish peroxidase in TBSW + 0.5% ethanolamine, pH 7Ø Bring
final
volume to 150 p,l/well. Incubate while shaking for thirty minutes.
23. Wash plate as described in step 10.
24. Add 100 ~.l of ABTS/H202 solution to well. Incubate ten minutes while
shaking.
25. Add 100 ~,1 of 0.2 M HCl for 0.1 M HCl final to stop the color development
reaction. Shake 1 minute at room temperature. Remove bubbles with slow stream
of air and
read the ELISA plate in an ELISA plate reader at 410 nm.
EXAMPLE 12: HER-2 ELISA
Assay 1: EGF Receptor-HERZ Chimeric Receptor Assay In Whole Cells.
-119-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
HER2 kinase activity in whole EGFR-NITI3T3 cells was measured as described
below:
Materials and Reag-ents
The following materials and reagents were used to conduct the assay:
1. EGF: stock concentration: 16.5 ILM; EGF 201, TOYOBO, Co., Ltd. Japan.
2. OS-101 (UBI) (a monoclonal antibody recognizing an EGFR extracellular
domain).
3. Anti-phosphotyrosine antibody (anti-Ptyr) (polyclonal) (see, Fendley, et
al.,
supra).
4. Detection antibody:
Goat anti-rabbit 1gG
horse radish peroxidase
conjugate,
TACO, Inc.,
Burlingame,
CA.
5. TBST buffer:
Tris-HCI, pH 7.2 50 mM
NaCI 150 mM
Triton X-100 0.1
6. HNTG SX stock:
HEPES 0.1 M
NaCI 0.75 M
Glycerol 50%
Triton X-100 1.0%
7. ARTS stock:
Citric Acid 100 mM
Na2HP04 250 mM
HCI, conc. 0.5 pM
ABTS* 0.5 mg/ml
* (2,2'-azinobis(3-ethylbenzthiazolinesulfonic
acid)). Keep solution
in dark at 4 C
until use.
8. Stock reagents o~
EDTA 100 mM pH 7.0
Na3V04 0.5 M
Na4 (P207) 0.2 M
-120-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Protocol
The following protocol was used:
A. Pre-coat ELISA Plate
1. Coat ELISA plates (Corning, 96 well, Cat. #25805-96) with OS-101 antibody
at 0.5 g per well in PBS, 100 ~.1 final volume/well, and store overnight at 4
°C. Coated plates
are good for up to 10 days when stored at 4 °C.
2. On day of use, remove coating buffer and replace with 100 ~,1 blocking
buffer
(5% Carnation Instant Non-Fat Dry Milk in PBS). Incubate the plate, shaking,
at room
temperature (about 23°C to 25°C) for 30 minutes. Just prior to
use, remove blocking buffer
and wash plate 4 times with TBST buffer. v
B. Seedin Cells
1. An NIH3T3 cell line overexpressing a chimeric receptor containing the EGFR
extracellular domain and intracellular HER2 kinase domain can be used for this
assay.
2. Choose dishes having 80-90% confluence for the experiment. Trypsinize cells
and stop reaction by adding 10% fetal bovine serum. Suspend cells in DMEM
medium (10%
CS DMEM medium) and centrifuge once at 1500 rpm, at room temperature for 5
minutes.
3. Resuspend cells in seeding medium (DMEM, 0.5% bovine serum), and count
the cells using trypan blue. Viability above 90% is acceptable. Seed cells in
DMEM medium
(0.5% bovine serum) at a density of 10,000 cells per well, 100 ~.1 per well,
in a 96 well
microtiter plate. Incubate seeded cells in 5% C02 at 37 °C for about 4
0 hours.
C. Assay Procedures
1. Check seeded cells for contamination using an inverted microscope. Dilute
drug stock (10 mg/ml in DMSO) 1:10 in DMEM medium, then transfer 5 ~.1 to a
TBST well
for a final drug dilution of 1:200 and a final DMSO concentration of 1%.
Control wells
receive DMSO alone. Incubate in 5% COZ at 37 °C for two hours.
2. Prepare EGF ligand: dilute stock EGF in DMEM so that upon transfer of 10
~,1
dilute EGF (1:12 dilution), 100 nM final concentration is attained.
3. Prepare fresh HNTG* sufficient for 100 ~ 1 per well; and place on ice.
HNTG* (10 ml):
HNTG stock 2.0 ml
milli-Q H20 7.3 ml
EDTA, 100 mM, pH 7.0 0.5 ml
-121-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Na3V04, 0.5 M 0.1 ml
Na4 (P207), 0.2 M 0.1 ml
4. After 120 minutes incubation with drug, add prepared SGF ligand to cells,
10
~1 per well, to a final concentration of 100 nM. Control wells receive DMEM
alone. Incubate,
shaking, at room temperature, for 5 minutes.
5. Remove drug, EGF, and DMEM. Wash cells twice with PBS. Transfer
HNTG* to cells, 100 ~,1 per well. Place on ice for 5 minutes. Meanwhile,
remove blocking
buffer from other ELISA plate and wash with TBST as described above.
6. With a pipette tip securely fitted to a micropipettor, scrape cells from
plate and
homogenize cell material by repeatedly aspirating and dispensing the HNTG*
lysis buffer.
Transfer lysate to a coated, blocked, and washed ELISA plate. Incubate shaking
at room
temperature for one hour.
7. Remove lysate and wash 4 times with TBST. Transfer freshly diluted anti-
Ptyr antibody to ELISA plate at 100 ~,l per well. Incubate shaking at room
temperature for 30
minutes in the presence of the anti-Ptyr antiserum (1:3000 dilution in TBST).
8. Remove the anti-Ptyr antibody and wash 4 times with TBST. Transfer the
freshly diluted TAGO anti-rabbit IgG antibody to the ELISA plate at 100 ~,1
per well.
Incubate shaking at room temperature for 30 minutes (anti-rabbit IgG antibody:
1:3000
dilution in TBST).
9. Remove TAGO detection antibody and wash 4 times with TBST. Transfer
freshly prepared ABTS/H202 solution to ELISA plate, 100 ~.1 per well. Incubate
shaking at
room temperature for 20 minutes. (ABTS/H202 solution: 1.0 ~,l 30% H202 in 10
ml ABTS
stock).
10. Stop reaction by adding 50 x.15 N H2S04 (optional), and determine O.D. at
4
10 nm.
11. The maximal phosphotyrosine signal is determined by subtracting the value
of
the negative controls from the positive controls. The percent inhibition of
phosphotyrosine
content for extract-containing wells is then calculated, after subtraction of
the negative
controls.
EXAMPLE 13: PDGF-R ELISA
-122-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
All cell culture media, glutamine, and fetal bovine serum were purchased from
Gibco
Life Technologies (Grand Island, NY) unless otherwise specified. All cells
were grown in a
humid atmosphere of 90-95% air and 5-10% COZ at 37 °C. All cell lines
were routinely
subcultured twice a week and were negative for mycoplasma as determined by the
Mycotect
method (Gibco).
For ELISA assays, cells (U124 2, obtained from Joseph Schlessinger, NYLJ) were
grown to 80-90% confluency in growth medium (MEM with 10% FBS, NEAR, 1 mM
NaPyr
and 2 mM GLN) and seeded in 96-well tissue culture plates in 0.5% serum at
25,000 to
30,000 cells per well. After overnight incubation in 0.5% serum-containing
medium, cells
were changed to serum-free medium and treated with test compound for 2 hr in a
5% C02, 37
°C incubator. Cells were then stimulated with ligand for 5-10 minute
followed by lysis with
HNTG (20 mM Hepes, 150 mM NaCI, 10% glycerol, 5 mM EDTA, 5 mM Na3V04 , 0.2%
Triton X-100, and 2 mM NaPyr). Cell lysates (0.5 mg/well in PBS) were
transferred to
ELISA plates previously coated with receptor-specific antibody and which had
been blocked
with 5% milk in TBST (50 mM Tris-HCl pH 7.2, 150 mM NaCI and 0.1% Triton X-
100) at
room temperature for 30 min. Lysates were incubated with shaking for 1 hour at
room
temperature. The plates were washed with TBST four times and then incubated
with
polyclonal anti-phosphotyrosine antibody at room temperature for 30 minutes.
Excess anti-
phosphotyrosine antibody was removed by rinsing the plate with TBST four
times. Goat
anti-rabbit IgG antibody was added to the ELISA plate for 30 min at room
temperature
followed by rinsing with TBST four more times. ABTS (100 mM citric acid, 250
mM
Na2HP04 and 0.5 mg/ml 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid))
plus H2O2
(1.2 ml 30% H2O2 to 10 ml ABTS) was added to the ELISA plates to start color
development. Absorbance at 4 10 nm with a reference wavelength of 630 nm was
recorded
about 15 to 30 min after ABTS addition.
EXAMPLE 14: IGF-I Receptor ELISA
The following protocol may be used to measure phosphotyrosine level on IGF-I
receptor, which indicates IGF-I receptor tyrosine kinase activity.
Materials and Rea-gents
The following materials and reagents were used:
-123-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
1. The cell line used in this assay is 3T3/IGF-1R, a cell line genetically
engineered to overexpresses IGF-1 receptor.
2. NIH3T3/IGF-1R is grown in an incubator with 5% COZ at 37 °C. The
growth
media is DMEM + 10% FBS (heat inactivated)+ 2 mM L-glutamine.
3. Affinity purified anti-IGF-1R antibody 17-69.
4. D-PBS:
KHzP04 0.20 g/L
K~HP04 2.16 g/L
KCl 0.20 g/L
NaCI 8.00 g/L(pH 7.2)
5. Blocking Buffer: TBST plus 5% Milk (Carnation Instant Non-Fat Dry Milk).
6. TBST buffer:
Tris-HCl 50 mM
NaCI 150 mM (pH 7.2/HCl 10 N)
Triton X-100 0.1%
Stock solution of TBS (10X) is prepared, and Triton X-100 is added to the
buffer
during dilution.
7. HNTG buffer:
HEPES 20 mM
NaCI 150 mM (pH 7.2/HCl 1 N)
Glycerol 10%
Triton X-100 0.2%
Stock solution (5X) is prepared and kept at 4 °C.
8. EDTA/HCI: 0.5 M pH 7.0 (NaOH) as 100X stock.
9. Na3V04 : 0.5 M as 100X stock and aliquots are kept in -80 °C.
10. Na4 P207: 0.2 M as 100X stock.
11. Insulin-like growth factor-1 from Promega (Cat# G5111).
12. Rabbit polyclonal anti-phosphotyrosine antiserum.
13. Goat anti-rabbit IgG, POD conjugate (detection antibody), Tago (Cat. No. 4
520, Lot No. 1802): Tago, Inc., Burlingame, CA.
14 . ABTS (2,2'-azinobis(3-ethylbenzthiazolinesulfonic acid)) solution:
Citric acid 100 mM
-124-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Na2HP04 250 mM (pH 4.0/1 N HCl)
ABTS 0.5 mg/ml
ABTS solution should be kept in dark and 4 °C. The solution should be
discarded
when it turns green.
15. Hydrogen Peroxide: 30% solution is kept in the dark and at 4 °C.
Protocol
All the following steps are conducted at room temperature unless it is
specifically
indicated. All ELISA plate washings are performed by rinsing the plate with
tap water three
times, followed by one TBST rinse. Pat plate dry with paper towels.
A. Cell Seeding:
1. The cells, grown in tissue culture dish (Corning 25020-100) to 80-90%
confluence, are harvested with Trypsin-EDTA (0.25%, 0.5 ml/D-100, GIBCO).
2. Resuspend the cells in fresh DMEM + 10% FBS + 2 mM L-Glutamine, and
transfer to 96-well tissue culture plate (Corning, 25806-96) at 20,000
cells/well (100 ~,l/well).
Incubate for 1 day then replace medium to serum-free medium (90/x,1) and
incubate in 5%
C02 and 37 °C overnight.
B. ELISA Plate Coating and Blocking:
1. Coat the ELISA plate (Corning 25805-96) with Anti-IGF-1R Antibody at 0.5
~.g/well in 100 ~.l PBS at least 2 hours.
2. Remove the coating solution, and replace with 100 ~.1 Blocking Buffer, and
shake for 30 minutes. Remove the blocking buffer and wash the plate just
before adding
lysate.
C. Assay Procedures:
1. The drugs are tested in serum-free condition.
2. Dilute drug stock (in 100% DMSO) 1:10 with DMEM in 96-well poly-
propylene plate, and transfer 10 p,l/well of this solution to the cells to
achieve final drug
dilution 1:100, and final DMSO concentration of 1.0%. Incubate the cells in 5%
COa at 37
°C for 2 hours.
3. Prepare fresh cell lysis buffer (HNTG*)
HNTG 2 ml
EDTA 0.1 ml
-125-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Na3V04 0.1 ml
Na4 (P207) 0.1 ml
H20 7.3 ml
4 . After drug incubation for two hours, transfer 10 p,l/well of 200nM IGF-1
Ligand in PBS to the cells (Final Conc. = 20 nM), and incubate at 5% C02 at 37
°C for 10
minutes.
5. Remove media and add 100 ~,1/well HNTG* and shake for 10 minutes. Look
at cells under microscope to see if they are adequately lysed.
6. Use a 12-channel pipette to scrape the cells from the plate, and homogenize
the lysate by repeated aspiration and dispensing. Transfer all the lysate to
the antibody
coated ELISA plate, and shake for 1 hour.
7. Remove the lysate, wash the plate, transfer anti-pTyr (1:3,000 with TBST)
100
~,l/well, and shake for 30 minutes.
8. Remove anti-pTyr, wash the plate, transfer TAGO (1:3,000 with TBST) 100
~,1/well, and shake for 30 minutes.
9. Remove detection antibodyx wash the plate, and transfer fresh ABTS/H20z
(1.2 ~,1 H2O2 to 10 ml ABTS) 100 ~l/well to the plate to start color
development.
10. Measure OD at 4 10 n111 with a reference wavelength of 630 nm in Dynatec
MR5000.
25
EXAMPLE 15: EGF Receptor ELISA
EGF Receptor kinase activity in cells genetically engineered to express human
EGF-R
was measured as described below:
Materials and Reagents
The following materials and reagents were used:
1. EGF Ligand: stock concentration = 16.5 ~,M; EGF 201, TOYOBO, Co., Ltd.
Japan.
2. OS-101 (UBI) (a monoclonal antibody recognizing an EGFR extracellular
domain).
3. Anti-phosphotyosine antibody (anti-Ptyr) (polyclonal).
-126-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
4 . Detection antibody: Goat
anti-rabbit 1gG horse radish
peroxidase conjugate,
TAGO, Inc., Burlingame, CA.
5. TBST buffer:
Tris-HCI, pH 7 50 mM
NaCI 150 mM
Triton X-100 0.1
6. HNTG SX stock:
HEPES 0.1 M
NaCI 0.75 M
Glycerol 50
Triton X-100 1.0%
7. ABTS stock:
Citric Acid 100 mM
NaaHP04 250 mM
HCI, conc. 4.0 pH
ABTS* 0.5 mg/ml
Keep solution in dark at 4 C used.
until
8. Stock reagents of
EDTA 100 mM pH 7.0
Na3V04 0.5 M
Na4(P207) 0.2 M
Protocol
The following protocol was used:
A. Pre-coat ELISA Plate
1. Coat ELISA plates (Corning, 96 well, Cat. #25805-96) with OS-101 antibody
at 0.5 ~.g per well in PBS, 150 ~,1 final volume/well, and store overnight at
4 °C. Coated
plates are good for up to 10 days when stored at 4 °C.
2. On day of use, remove coating buffer and replace with blocking buffer (5%
Carnation Instant Non--Fat Dry Milk in PBS). Incubate the plate, shaking, at
room
temperature (about 23 °C to 25 °C) for 30 minutes. Just prior to
use, remove blocking buffer
and wash plate 4 times with TBST buffer.
B. Seeding Cells
-127-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
1. NIH 3T3/C7 cell line (Honegger, et al., 1987, Cell 51:199-209) can be use
for
this assay.
2. Choose dishes having 80-90% confluence for the experiment. Trypsinize cells
and stop reaction by adding 10% CS DMEM medium. Suspend cells in DMEM medium
(10% CS DMEM medium) and centrifuge once at 1000 rpm at room temperature for 5
minutes.
3. Resuspend cells in seeding medium (DMEM, 0.5% bovine serum), and count
the cells using trypan blue. Viability above 90% is acceptable. Seed cells in
DMEM medium
(0.5% bovine serum) at a density of 10,000 cells per well, 100 p1 per well, in
a 96 well
microtiter plate. Incubate seeded cells in S% C02 at 37 °C for about 40
hours.
C. Assay Procedures.
1. Check seeded cells for contamination using an inverted microscope. Dilute
drug stock (10 mg/ml in DMSO) 1:10 in DMEM medium, then transfer 5 ~,1 to a
test well for
a final drug dilution of 1:200 and a final DMSO concentration of 1%. Control
wells receive
DMSO alone. Incubate in 5% CO2 at 37 °C for one hour.
2. Prepare EGF ligand: dilute stock EGF in DMEM so that upon transfer of 10
~,1
dilute EGF (1:12 dilution), 25 nM final concentration is attained.
3. Prepare fresh 10 ml HNTG* sufficient for 100 p,1 per well wherein HNTG*
comprises: HNTG stock (2.0 ml), milli-Q HZO (7.3 ml), EDTA, 100 rnM, pH 7.0
(0.5 ml),
Na3V04 0.5 M (0.1 ml) and Na4(P207), 0.2 M (0.1 ml).
4. Place on ice.
5. After two hours incubation with drug, add prepared EGF ligand to cells, 10
~,l
per well, to yield a final concentration of 25 nM. Control wells receive DMEM
alone.
Incubate, shaking, at room temperature, for 5 minutes.
6. Remove drug, EGF, and DMEM. Wash cells twice with PBS. Transfer
HNTG* to cells, 100 ~,1 per well. Place on ice for 5 minutes. Meanwhile,
remove blocking
buffer from other ELISA plate and wash with TBST as described above.
7. With a pipette tip securely fitted to a micropipettor, scrape cells from
plate and
homogenize cell material by repeatedly aspirating and dispensing the HNTG*
lysis buffer.
Transfer lysate to a coated, blocked, and washed ELISA plate. Incubate shaking
at room
temperature for one hour.
-128-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
8. Remove lysate and wash 4 times with TBST. Transfer freshly diluted anti-
Ptyr
antibody to ELISA plate at 100 ~,1 per well. Incubate shaking at room
temperature for 30
minutes in the presence of the anti-Ptyr antiserum (1:3000 dilution in TBST).
9. Remove the anti-Ptyr antibody and wash 4 times with TBST. Transfer the
freshly diluted TAGO 30 anti-rabbit IgG antibody to the ELISA plate at 100 p,1
per well.
Incubate shaking at room temperature for 30 minutes (anti-rabbit IgG antibody:
1:3000
dilution in TBST).
10. Remove detection antibody and wash 4 times with TBST. Transfer freshly
prepared ABTS/HZOZ solution to ELISA plate, 100 ~,1 per well. Incubate at room
temperature for 20 minutes. ABTS/H202 solution: 1.2 p,1 30% H202 in 10 ml ABTS
stock.
11. Stop reaction by adding 50 x.15 N H2S04 (optional), and determine O.D. at
410 nm.
12. The maximal phosphotyrosine signal is determined by subtracting the value
of
the negative controls from the positive controls. The percent inhibition of
phosphotyrosine
content for extract-containing wells is then calculated, after subtraction of
the negative
controls.
EXAMPLE 16: Met Autophosphorylation Assay - ELISA
This assay determines Met tyrosine kinase activity by analyzing Met protein
tyrosine
kinase levels on the Met receptor.
Materials and Reagents
The following materials and reagents were used:
1. HNTG (5X stock solution): Dissolve 23.83 g HEPES and 43.83 g NaCI in
about 350 ml dH20. Adjust pH to 7.2 with HCl or NaOH, add 500 ml glycerol and
10 ml
Triton X-100, mix, add dH20 to 1 L total volume. To make 1 L of 1X working
solution add
200 ml SX stoclc solution to 800 ml dHaO, check and adjust pH as necessary,
store at 4 °C.
2. PBS (Dulbecco's Phosphate-Buffered Saline), Gibco Cat. # 450-1300EB (1X
solution).
3. Blocking Buffer: in 500 ml dH20 place 100 g BSA, 12.1 g Tris-pH7.5, 58.44
g NaCI and 10 ml Tween-20, dilute to 1 L total volume.
-129-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
4. Kinase Buffer: To 500 ml dH20 add 12.1 g TRIS pH7.2, 58.4 g NaCI, 40.7 g
MgCla and 1.9 g EGTA; bring to 1 L total volume with dH20.
5. PMSF (Phenylmethylsulfonyl fluoride), Sigma Cat. # P-7626, to 435.5 mg,
add 100% ethanol to 25 ml total volume, vortex.
6. ATP (Bacterial Source), Sigma Cat. # A-7699, store powder at -20°C;
to make
up solution for use, dissolve 3.31 mg in 1 ml dH20.
7. RC-20H HRPO Conjugated Anti-Phosphotyrosine, Transduction Laboratories
Cat. # E120H.
8. Pierce 1-Step (TM) Turbo TMB-ELISA (3,3',5,5'-tetramethylbenzidine, Pierce
Cat. # 34022.
9. H2SO4, add 1 ml conc. (18 N) to 35 ml dH20.
10. Tris-HCl, Fischer Cat. # BP152-5; to 121.14 g of material, add 600 ml
MilliQ
H20, adjust pH to 7.5 (or 7.2) with HCl , bring volume to 1 L with MilliQ H20.
11. NaCI, Fischer Cat. # 5271-10, make up 5 M solution.
12. Tween-20, Fischer Cat. # 5337 -500.
13. Na3V04, Fischer Cat. # 5454-50, to 1.8 g material add 80 ml MilliQ H20,
adjust pH to 10.0 with HCl or NaOH, boil in microwave, cool, check pH, repeat
procedure
until pH stable at 10.0, add MilliQ Ha0 to 100 ml total volume, make 1 ml
aliquots and store
at -80°C.
14. MgCl2, Fischer Cat. # M33-500, make up 1 M solution.
15. HEPES, Fischer Cat. # BP310-500, to 200 ml MilliQ H20, add 59.6 g
material, adjust pH to 7.5, bring volume to 250 ml total, sterile filter.
16. Albumin, Bovine (BSA), Sigma Cat. # A-4503, to 30 grams material add
sterile distilled water to make total volume of 300 ml, store at 4 °C.
17. TBST Buffer: to approx. 900 ml dH20 in a 1 L graduated cylinder add 6.057
g
TRIS and 8.766 g NaCI, when dissolved, adjust pH to 7.2 with HCI, add 1.0 ml
Triton X-100
and bring to 1 L total volume with dH20.
18. Goat Affiuty purified antibody Rabbit IgG (whole molecule), Cappel Cat. #
55641.
19. Anti h-Met (C-28) rabbit polyclonal IgG antibody, Santa Cruz Chemical Cat.
# SC-161.
-130-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
20. Transiently Transfected EGFR/Met chimeric cells (EMR) (Komada, et al.,
1993, Ohcogehe 8:2381-2390.
21. Sodium Carbonate Buffer, (Na2C04, Fischer Cat. # 5495): to 10.6 g material
add 800 ml MilliQ H20, when dissolved adjust pH to 9.6 with NaOH, bring up to
1 L total
volume with MilliQ H20, filter, store at 4 °C.
Procedure
All of the following steps are conducted at room temperature unless it is
specifically
indicated otherwise. All ELISA plate washing is by rinsing 4X with TBST.
A. EMR Lysis
This procedure can be performed the night before or immediately prior to the
start of
receptor capture.
1. Quick thaw lysates in a 37 °C waterbath with a swirling motion until
the last
crystals disappear.
2. Lyse cell pellet with 1X HNTG containing 1 mM PMSF. Use 3 ml of HNTG
per 15 cm dish of cells. Add 1/z the calculated HNTG volume, vortex the tube
for 1 min., add
the remaining amount of HNTG, vortex for another min.
3. Balance tubes, centrifuge at 10,000x g for 10 min at 4 °C.
4. Pool supernatants, remove an aliquot for protein determination.
5. Quick freeze pooled sample in dry ice/ethanol bath. This step is performed
regardless of whether lysate will be stored overnight or used immediately
following protein
determination.
6. Perform protein determination using standard bicinchoninic acid (BCA)
method (BCA Assay Reagent Kit from Pierce Chemical Cat. # 23225).
B. ELISA Procedure
1. Coat Corning 96 well ELISA plates with 5 ~,g per well Goat anti-Rabbit
antibody in Carbonate Buffer for a total well volume of 50 ~,1. Store
overnight at 4 °C.
2. Remove unbound Goat anti-rabbit antibody by inverting plate to remove
liquid.
3. Add 150 p,1 of Blocking Buffer to each well. Incubate for 30 min. at room
temperature with shaking.
-131-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
4. Wash 4X with TBST. Pat plate on a paper towel to remove excess liquid and
bubbles.
5. Add 1 ~g per well of Rabbit anti-Met antibody diluted in TBST for a total
well
volume of 100 ~,1.
6. Dilute lysate in HNTG (90 p,g lysate/100 p,1)
7. Add 100 p,1 of diluted lysate to each well. Shake at room temperature for
60
mm.
8. Wash 4X with TBST. Pat on paper towel to remove excess liquid and
bubbles.
9. Add 50 ~,1 of 1X lysate buffer per well.
10. Dilute compounds/extracts 1:10 in 1X Kinase Buffer in a polypropylene 96
well plate.
11. Transfer 5.5 ~.1 of diluted drug to ELISA plate wells. Incubate at room
temperature with shaking for 20 min.
12. Add 5.5 ~,1 of 60 p,M ATP solution per well. Negative controls do not
receive
any ATP. Incubate at room temperature for 90 min., with shaking.
13. Wash 4X with TBST. Pat plate on paper towel to remove excess liquid and
bubbles.
14. Add 100 ~,1 per well of RC20 (1:3000 dilution in Blocking Buffer).
Incubate
30 min. at room temperature with shaking.
15. Wash 4X with TBST. Pat plate on paper towel to remove excess liquid and
bubbles.
16. Add 100 ~.1 per well of Turbo-TMB. Incubate with shaking for 30-60 min.
17. Add 100 ~,1 per well of 1 M H2S04 to stop reaction.
18. Read assay on Dynatech MR7000 ELISA reader. Test Filter = 450 nm,
reference filter = 410 nm.
EXAMPLE 17: Biochemical sic Assay - ELISA
This assay is used to determine sic protein kinase activity measuring
phosphorylation
of a biotinylated peptide as the readout.
Materials and Reagents
-132-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
The following materials and reagents were used:
1. Yeast transformed with sic.
2. Cell lysates: Yeast cells expressing sf°c are pelleted, washed once
with water,
re-pelleted and stored at -80°C until use.
3. N-terminus biotinylated EEEYEEYEEEYEEEYEEEY is prepared by standard
procedures well known to those skilled in the art.
4. DMSO: Sigma, St. Louis, MO.
5. 96 Well ELISA Plate: Conung 96 Well Easy Wash, Modified flat Bottom
Plate, Corning Cat. #25805-96.
6. NLJNC 96-well V-bottom polypropylene plates for dilution of compounds:
Applied Scientific Cat. # A-72092.
7. Vecastain ELITE ABC reagent: Vector, Burlingame, CA.
8. Anti-sic (327) mab: Schizosaccharomyces Pombe was used to express
recombinant sic (Superb-Furga, et al., EMBO J. 12:2625-2634; Superti-Furga, et
al., NatuYe
Biochem. 14:600-605). S. Pombe strain SP200 (h-s leu1.32 ura4 ade210) was
grown as
described and transformations were pRSP expression plasmids were done by the
lithium
acetate method (Superti-Furga, supra). Cells were grown in the presence of 1
~,M thiamin to
repress expression from the nmtl promoter or in the absence of thiamin to
induce expression.
9. Monoclonal anti-phosphotyrosine, UBI OS-321 (UB40 may be used instead).
10. Turbo TMB-ELISA peroxidase substrate: Pierce Chemical.
Buffer Solutions:
1. PBS (Dulbecco's Phosphate-Buffered Saline): GIBCO PBS, GIBCO Cat. #
450-1300EB.
2. Blocking Buffer: 5% Non-fat milk (Carnation) in PBS.
3. Carbonate Buffer: Na2C04 from Fischer, Cat. # 5495, make up 100 mM stock
solution.
4. Kinase Buffer: 1.0 ml (from 1 M stock solution) MgCl2; 0.2 ml (from a 1 M
stock solution) MnCla; 0.2 ml (from a 1 M stock solution) DTT; 5.0 ml (from a
1 M stock
solution) HEPES; 0.1 ml TX-100; bring to 10 ml total volume with MilliQ HaO.
5. Lysis Buffer: 5.0 HEPES (from 1 M stock solution.); 2.74 ml NaCI (from 5 M
stock solution); 10 ml glycerol; 1.0 ml TX-100; 0.4 ml EDTA (from a 100 mM
stock
-133-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
solution); 1.0 ml PMSF (from a 100 mM stock solution); 0.1 ml Na3VO4 (from a
0.1 M stock
solution); bring to 100 ml total volume with MilliQ HZO.
6. ATP: Sigma Cat. # A-7699, make up 10 mM stock solution (5.51 mg/ml).
7. TRIS-HCI: Fischer Cat. # BP 152-5, to 600 ml MilliQ H20 add 121.14 g
material, adjust pH to 7.5 with HCI, bring to 1 L total volume with MilliQ
HZO.
8. NaCI: Fischer Cat. # 5271-10, Make up 5 M stock solution with MilliQ HZO.
9. Na3V04: Fischer Cat. # 5454-50; to 80 ml MilliQ H20, add 1.8 g material;
adjust pH to 10.0 with HCl or NaOH; boil in a microwave; cool; check pH,
repeat pH
adjustment until pH remains stable after heating/cooling cycle; bring to 100
ml total volume
with MilliQ H20; make 1 ml aliquots and store at -80°C.
10. MgCl2: Fischer Cat. # M33-500, make up 1 M stock solution with MilliQ
H2O.
11. HEPES: Fischer Cat. # BP 310-500; to 200 ml MilliQ H20, add 59.6 g
material, adjust pH to 7.5, bring to 250 ml total volume with MilliQ HBO,
sterile filter (1 M
stock solution).
12. TBST Buffer: TBST Buffer: To 900 ml dH20 add 6.057 g TRIS and 8.766 g
NaCI; adjust pH to 7.2 with HCI, add 1.0 ml Triton-X-100; bring to 1 L total
volume with
dH2O.
13. MnCla: Fischer Cat. # M87-100, make up 1 M stock solution with MilliQ
H20.
14. DTT; Fischer Cat. # BP172-5.
15. TBS (TRIS Buffered Saline): to 900 ml MilliQ H20 add 6.057 g TRIS and
8.777 g NaCI; bring to 1 L total volume with MilliQ H20.
16. Kinase Reaction Mixture: Amount per assay plate (100 wells): 1.0 ml Kinase
Buffer, 200 ~.g GST-S, bring to final volume of 8.0 ml with MilliQ H20.
17. Biotin labeled EEEYEEYEEEYEEEYEEEY: Make peptide stock solution (1
mM, 2.98 mg/ml) in water fresh just before use.
18. Vectastain ELITE ABC reagent: To prepare 14 ml of working reagent, add 1
drop of reagent A to 15 ml TBST and invert tube several times to mix. Then add
1 drop of
reagent B. Put tube on orbital shaker at room temperature and mix for 30
minutes.
Protocol
A. Preparation of sic coated ELISA plate.
-134-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
1. Coat ELISA plate with 0.5 ~,g/well anti-sic mab in 100 ~,1 of pH 9.6 sodium
carbonate buffer at 4 °C overnight.
2. Wash wells once with PBS.
3. Block plate with 0.15 ml 5% milk in PBS for 30 min. at room temperature.
4. Wash plate SX with PBS.
5. Add 10 ~.g/well of sic transformed yeast lysates diluted in Lysis Buffer
(0.1
ml total volume per well). (Amount of lysate may vary between batches.) Shake
plate for 20
minutes at room temperature.
B. Preparation of phosphotyrosine antibody-coated ELISA late.
1. 4610 plate: coat 0.5 ~.g/well 4610 in 100 ~,1 PBS overnight at 4 °C
and block
with 150 ~,1 of 5% milk in PBS for 30 minutes at room temperature.
C. I~inase assa~procedure.
1. Remove unbound proteins from step 1-7, above, and wash plates SX with
PBS.
2. Add 0.08 ml Kinase Reaction Mixture per well (containing 10 ~,1 of l OX
I~inase Buffer and 10 ACM (final concentration) biotin-EEEYEEYEEEYEEEYEEEY per
well
diluted in water.
3. Add 10 ~,1 of compound diluted in water containing 10% DMSO and pre-
incubate for 15 minutes at room temperature.
4. Start kinase reaction by adding 10 ~.1/well of 0.05 mM ATP in water (5 ~.M
ATP final).
5. Shake ELISA plate for 15 min. at room temperature.
6. Stop kinase reaction by adding 10 ~.1 of 0.5 M EDTA per well.
7. Transfer 90 p.1 supernatant to a blocked 4610 coated ELISA plate from
section B, above.
8. Incubate for 30 min. while shaking at room temperature.
9. Wash plate SX with TBST.
10. Incubate with Vectastain ELITE ABC reagent (100 ~,1/well) fox 30 min. at
. room temperature.
11. Wash the wells SX with TBST.
12. Develop with Turbo TMB.
-135-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
E~~AMPLE 18: Biochemical lck Assay - ELISA
This assay is used to determine lck protein kinase activities measuring
phosphorylation of GST-S as the readout.
Materials and Reagents
The following materials and reagents were used:
1. Yeast transformed with lck. Schizosaccharomyces Pombe was used to express
recombinant lck (Superti-Furga, et al., EMBO J. 12:2625-2634; Superb-Furga, et
al., Nature
Biotech. 14:600-605). S. Pombe strain SP200 (h-s leu1.32 ura4 ade210) was
grown as
described and transformations with pRSP expression plasmids were done by the
lithium
acetate method (Superti-Furga, supra). Cells were grown in the presence of 1
~,M thiamin to
induce expression.
2. Cell lysates: Yeast cells expressing lck are pelleted, washed once in
water, re-
pelleted and stored frozen at -80°C until use.
3. GST-S: DNA encoding for GST-S fusion protein for expression in bacteria
obtained from Arthur Weiss of the Howard Hughes Medical Institute at the
Uuversity of
California, San Francisco. Transformed bacteria were grown overnight while
shaking at
25°C. GST-S was purified by glutathione affinity chromatography,
Pharmacia, Alameda,
CA.
4. DMSO: Sigma, St. Louis, MO.
5. 96-Well ELISA plate: Corning 96 Well Easy Wash, Modified Flat Bottom
Plate, Corning Cat. #25805-96.
6. NUNC 96-well V-bottom polypropylene plates for dilution of compounds:
Applied Scientific Cat. # AS-72092.
7. Purified Rabbit anti-GST antiserum: Amrad Corporation (Australia) Cat.
#90001605.
8. Goat anti-Rabbit-IgG-HRP: Amersham Cat. # V010301
9. Sheep ant-mouse IgG (H+L): Jackson Labs Cat. # 5215-005-003.
10. Anti-lck (3A5) mab: Santa Cruz Biotechnology Cat # sc-433.
11. Monoclonal anti-phosphotyrosine UBI OS-321 (UB40 may be used instead).
Buffer solutions:
-136-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
1. PBS (Dulbecco's Phosphate-Buffered Saline) 1X solution: GIBCO PBS,
GIBCO Cat. # 450-1300EB.
2. Blocking Buffer: 100 g BSA, 12.1 g. TRIS-pH7.5, 58.44 g NaCI, 10 ml
Tween-20, bring up to 1 L total volume with MilliQ H20.
3. Carbonate Buffer: Na2C04 from Fischer, Cat. # 5495; make up 100 mM
solution with MilliQ H2O.
4. Kinase Buffer: 1.0 ml (from 1 M stock solution) MgCl2; 0.2 ml (from a 1 M
stock solution) MnCl2; 0.2 ml (from a 1 M stock solution) DTT; 5.0 ml (from a
1 M stock
solution) HEPES; 0.1 ml TX-100; bring to 10 ml total volume with MilliQ HaO.
5. Lysis Buffer: 5.0 HEPES (from 1 M stock solution.); 2.74 ml NaCI (from 5 M
stock solution); 10 ml glycerol; 1.0 ml TX-100; 0.4 ml EDTA (from a 100 mM
stock
solution); 1.0 ml PMSF (from a 100 mM stock solution); 0.1 ml Na3VO4 (from a
0.1 M stock
solution); bring to 100 ml total volume with MilliQ HZO.
6. ATP: Sigma Cat. # A-7699, make up 10 mM stock solution (5.51 mg/ml).
1 S 7. TRIS-HCI: Fischer Cat. # BP 152-5, to 600 ml MilliQ HZO add 121.14 g
material, adjust pH to 7.5 with HCI, bring to 1 L total volume with MilliQ
H20.
8. NaCl: Fischer Cat. # 5271-10, Make up 5 M stock solution with MilliQ HaO.
9. Na3V04: Fischer Cat. # 5454-50; to 80 ml MilliQ HZO, add 1.8 g material;
adjust pH to 10.0 with HCl or NaOH; boil in a microwave; cool; check pH,
repeat pH
adjustment until pH remains stable after heating/cooling cycle; bring to 100
ml total volume
with MilliQ H20; make 1 ml aliquots and store at -80°C.
10. MgCl2: Fischer Cat. # M33-500, make up 1 M stock solution with MilliQ
H20.
11. HEPES: Fischer Cat. # BP 310-500; to 200 ml MilliQ H20, add 59.6 g
material, adjust pH to 7.5, bring to 250 ml total volume with MilliQ H20,
sterile filter (1M
stock solution).
12. Albumin, Bovine (BSA), Sigma Cat. # A4503; to 150 ml MilliQ HZO add 30
g material, bring 300 ml total volume with MilliQ H2O, filter through 0.22 Om
filter, store at
4 °C.
13. TBST Buffer: To 900 ml dH20 add 6.057 g TRIS and 8.766 g NaCI; adjust
pH to 7.2 with HCl, add 1.0 ml Triton-X-100; bring to 1 L total volume with
dH20.
-137-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
14. MnCl2: Fischer Cat. # M87-100, make up 1 M stock solution with MilliQ
H20.
15. DTT; Fischer Cat. # BP 172-5.
16. TBS (TRIS Buffered Saline): to 900 ml MilliQ H20 add 6.057 g TRIS and
8.777 g NaCI; bring to 1 L total volume with MilliQ H20.
17. Kinase Reaction Mixture: Amount per assay plate (100 wells): 1.0 ml Kinase
Buffer, 200 ~g GST-S, bring to final volume of 8.0 ml with MilliQ H20.
Procedures
A. Preparation of lck coated ELISA plate.
1. Coat 2.0 ~,g/well Sheep anti-mouse IgG in 100 p,1 of pH 9.6 sodium
carbonate
buffer at 4 °C overnight.
2. Wash well once with PBS.
3. Block plate with 0.15 ml of blocking Buffer for 30 min. at room temp.
4. Wash plate SX with PBS.
5. Add 0.5 p.g/well of anti-lck (mab 3A5) in 0.1 ml PBS at room temperature
for
1-2 hours.
6. Wash plate SX with PBS.
7. Add 20 ~,g/well of lck transformed yeast lysates diluted in Lysis Buffer
(0.1
ml total volume per well). (Amount of lysate may vary between batches) Shake
plate at 4 °C
overnight to prevent loss of activity.
B. Preparation of phosphotyrosine antibody-coated ELISA late.
1. UB40 plate: 1.0 p,g/well UB40 in 100 ~1 of PBS overnight at 4 °C and
block
with 150 p,1 of Blocking Buffer for at least 1 hour.
C. Kinase assa~procedure.
1. Remove unbound proteins from step 1-7, above, and wash plates SX with
PBS.
2. Add 0.08 ml I~inase Reaction Mixture per well (containing 10 ~.1 of l OX
Kinase Buffer and 2 p,g GST-S per well diluted with water).
3. Add 10 p,1 of compound diluted in water containing 10% DMSO and pre-
incubate for 15 minutes at room temperature.
-138-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
4. Start kinase reaction by adding 10 ~,l/well of 0.1 mM ATP in water (10 p,M
ATP final).
5. Shake ELISA plate for 60 min. at room temperature.
6. Stop kinase reaction by adding 10 v1 of 0.5 M EDTA per well.
7. Transfer 90 ~,1 supernatant to a blocked 4610 coated ELISA plate from
section B, above.
8. Incubate while shaking for 30 min. at room temperature.
9. Wash plate SX with TBST.
10. Incubate with Rabbit anti-GST antibody at 1:5000 dilution in 100 ~,1 TBST
for
30 min. at room temperature.
11. Wash the wells SX with TBST.
12. Incubate with Goat anti-Rabbit-IgG-HRP at 1:20,000 dilution in 100 ~,1 of
TBST for 30 min. at room temperature.
13. Wash the wells SX with TBST.
14. Develop with Turbo TMB.
EXAMPLE 19: Biochemical c-kit Assay - ELISA
A. Materials And Rea _
1) HNTG: SX stock concentration: 100 mM HEPES pH 7.2, 750 mM NaCl,
50% glycerol, 2.5% Triton X-100.
2) PBS (Dulbecco's Phosphate-Buffered Saline): Gibco Catalog # 450-1300EB
3) 1 X Blocking Buffer: 10 mM TRIS-pH7.5, 1 % BSA, 100 mM NaCl, 0.1%
Triton X-100
4) 1 X Kinase Buffer: 25 mM HEPES, 100 mM NaCI, 10 mM Mg C12, 6 mM
Mn C12.
5) PMSF._ Stock Solution =100mM (Sigma Catalog # P-7626)
6) 10 mM ATP (Bacterial source) Sigma A-7699, Sg.
7) UB40 anti-phosphotyrosine mAb (available from Terrance at Sugen.
8) HRP conjugated sheep anti-Mouse IgG. (Amersham NA 931)
9) ABTS (SPrime-3Prime 7-579844)
10) TRIS HCL: Fisher BP 152-5
11) NaCl: Fisher 5271-10
-139-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
12) Triton X-100: Fisher BP151-100
13) Na3V04: Fisher 5454-50 .
14) MgClz: Fisher M33-500
15) MnCla: Fisher M87-500
16) HEPES: Fisher BP310-500
17) Albumin, Bovine (BSA): Sigma A-8551
18) TBST Buffer: 50 rnM Tris pH 7.2, 150 mM NaCI, 0.1% Triton X-100.
19) Goat affinity purified antibody Rabbit IgG (whole molecule): Cappel 55641.
20) Anti Kit (C-20) rabbit polyclonal IgG antibody: Santa Cruz sc-168
21) Kit/CHO cells: CHO cells stably expressing GyrB/Kit, which are grown in
standard CHO medium, supplemented with lmg/ml 6418
22) Indolinone Compounds: The indolinone compounds were synthesized as set
forth in the following application: PCT application number US99/06468, filed
March 26,
1999 by Fong, et al. and entitled METHODS OF MODULATING TYROSINE PROTEIN
KINASE (Lyon & Lyon docket number 231/250 PCT which is hereby incorporated by
reference in its entirety including any drawings.
B. Procedure
All of the following steps are conducted at room temperature unless it is
specifically
indicated. All ELISA plate washing is by rinsing 4x with TBST.
Kit Cell Lysis
This procedure is performed lhour prior to the start of receptor capture.
1) Wash a >95% confluent 15 cm dish with PBS and aspirate as much as
possible.
2) Lyse the cells with 3 ml of lx HNTG containing 1 mM PMSF/15 cm dish.
Scrape the cells from the plate and transfer to a 50 ml centrifuge tube.
3) Pool supernatants, and allow to sit, on ice, for one hour with occasional
vortexing. Failure to do so with result in an increased background
(approximately 3-fold
higher).
4) Balance tubes and centrifuge at 10,000 x g for 10 min at 4~C. Remove an
aliquot for protein determination
5) Perform protein determination as per the SOP for protein determination
using
the bicinchoninic acid (BCA) method.
-140-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
ELISA Procedure
1) Coat Corning 96-well ELISA plates with 2 ~,g per well Goat anti-rabbit
antibody in PBS for a total well volume of 100 p,1. Store overnight at 4
°C.
2) Remove unbound Goat anti-rabbit antibody by inverting plate to remove
liquid.
3) Add 100 ~,1 of Blocking Buffer to each well. Shake at room temperature for
60 min.
4) Wash 4x with TBST. Pat plate on a paper towel to remove excess liquid and
bubbles
5) Add 0.2 ~,g per well of Rabbit anti -Kit antibody diluted in TBST for a
total
well volume of 100 ~,1. Shake at room temperature for 60 min.
6) Dilute lysate in HNTG (180 ~,g lysate/100 ~,1)
7) Add 100 ~.l of diluted lysate to each well. Shake at room temperature for
60
min.
8) Wash 4x with TBST. Pat plate on a paper towel to remove excess liquid and
bubbles.
9) Dilute compounds/extracts (or as stated otherwise) in lx kinase buffer,
with
S~.M ATP in a polypropylene 96 well plate.
10) Transfer 100 ~.l of diluted drug to ELISA plate wells. Incubate at room
temperature with shaking for 60 min.
11) Stop reaction with the addition of 10 ~,1 of 0.5 M EDTA. Plate is now
stable
for a reasonable period of time. '~
12) Wash 4x with TBST. Pat plate on a paper towel to remove excess liquid and
bubbles.
13) Add 100 ~1 per well of LTB40 (1:2000 dilution in TBST). Incubate 60 min at
room temperature, with shaking.
14) Wash 4x with TBST. Pat plate on a paper towel to remove excess liquid and
bubbles.
15) Add 100 ~,1 per well of sheep anti-mouse IgG - HRP (1:5000 dilution in
TBST). Incubate 60 min at room temperature, with shaking.
-141-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
16) Wash 4x with TBST. Pat plate on a paper towel to remove excess liquid and
bubbles.
17) Add 100 p,1 per well of ABTS. Incubate with shaking for 15-30 min.
18) Read assay on Dynatech MR7000 ELISA reader
Test Filter = 410 nm
Reference Filter = 630 nm.
EXAMPLE 20: Assay Measuring Phosphorylating Function of RAF
The following assay reports the amount of RAF-catalyzed phosphorylation of its
target protein MEK as well as MEK's target MAPK. The RAF gene sequence is
described in
Bonner et al., 1985, Molec. Cell. Biol. 5:1400-1407, and is readily accessible
in multiple gene
sequence data banks. Construction of the nucleic acid vector and cell lines
utilized for this
portion of the invention are fully described in Morrison et al., 1988, Proc.
Natl. Acad. Sci.
USA 85:8855-8859.
Materials and Reagents
1. Sfp (Spodopte~a frugipe~da) cells; GIBCO-BRL, Gaithersburg, MD.
2. RIPA buffer: 20 mM Tris/HC1 pH 7.4, 137 mM NaCI, 10% glycerol, 1 mM
PMSF, 5 mg/L Aprotenin, 0.5 % Triton X-100.
3. Thioredoxin-MEK fusion protein (T-MEK): T-MEK expression and
purification by affinity chromatography were performed according to the
manufacturer's
procedures. Catalog# K 350-Ol and R 350-40, Invitrogen Corp., San Diego, CA.
4. His-MAPK (ERK 2); His-tagged MAPK was expressed in XL1 Blue cells
transformed with pUC 18 vector encoding His-MAPK. His-MAPK was purified by Ni-
affinity chromatography. Cat# 27-4949-O1, Pharmacia, Alameda, CA, as described
herein.
5. Sheep anti mouse IgG: Jackson laboratories, West Grove, PA. Catalog, # 515-
006-008, Lot# 28563.
6. RAF-1 protein kinase specific antibody: URP2653 from UBI.
7. Coating buffer: PBS; phosphate buffered saline, GIBCO-BRL, Gaithersburg,
MD.
8. Wash buffer: TBST - 50 mM Tris/HCl pH 7.2, 150 mM NaCI, 0.1 % Triton
X-100.
9. Block buffer: TBST, 0.1 % ethanolamine pH 7.4.
-142-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
10. DMSO, Sigma, St. Louis, MO.
11. Kinase buffer (KB): 20 mM HEPESIHCl pH 7.2, 150 mM NaCI, 0.1 % Triton
X-100, 1 mM PMSF, 5 mg/L Aprotenin, 75 mM sodium ortho vanadate, 0.5 MM DTT
and
mM MgCl2.
5 12. ATP mix:100 mM MgClz, 300 mM ATP, 10 mCi 33P ATP (Dupont-
NEN)/ml.
13. Stop solution: 1 % phosphoric acid; Fisher, Pittsburgh, PA.
14. Wallac Cellulose Phosphate Filter mats; Wallac, Turku, Finnland.
15. Filter wash solution: 1 % phosphoric acid, Fisher, Pittsburgh, PA.
10 16. Tomtec plate harvester, Wallac, Turku, Finnland.
17. Wallac beta plate reader # 1205, Wallac, Turku, Finnland.
18. NUNC 96-well V bottom polypropylene plates for compounds Applied
Scientific Catalog # AS-72092.
Protocol
All of the following steps were conducted at room temperature unless
specifically
indicated.
1. ELISA plate coating: ELISA wells are coated with 100 ml of Sheep anti
mouse affinity purified antiserum (1 mg/100 ml coating buffer) over night at 4
°C. ELISA
plates can be used for two weeks when stored at 4 °C.
2. Invert the plate and remove liquid. Add 100 ml of blocking solution and
incubate for 30 min.
3. Remove blocking solution and wash four times with wash buffer. Pat the
plate
on a paper towel to remove excess liquid.
4. Add 1 mg of antibody specific for R.AF-1 to each well and incubate for 1
hour.
Wash as described in step 3.
5. Thaw lysates from RAS/RAF infected Sf9 cells and dilute with TBST to 10
mg/100 ml. Add 10 mg of diluted lysate to the wells and incubate for 1 hour.
Shake the plate
during incubation. Negative controls receive no lysate. Lysates from RAS/RAF
infected S~
insect cells are prepared after cells are infected with recombinant
baculoviruses at a MOI of 5
for each virus, and harvested 48 hours later. The cells are washed once with
PBS and lysed
in RIPA buffer. Insoluble material is removed by centrifugation (5 min at
10,000 x g).
Aliquots of lysates are frozen in dry ice/ethanol and stored at -80°C
until use.
-143-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
6. Remove non-bound material and wash as outlined above (step 3).
7. Add 2 mg of T-MEK and 2 mg of His-MAEPK per well and adjust the volume
to 40 ml with kinase buffer. Methods for purifying T-MEK and MAPK from cell
extracts are
provided herein by example.
8. Pre-dilute compounds (stock solution 10 mg/ml DMSO) or extracts 20 fold in
TBST plus 1% DMSO. Add 5 ml of the pre-diluted compounds/extracts to the wells
described in step 6. Incubate for 20 min. Controls receive no drug.
9. Start the kinase reaction by addition of 5 ml ATPmix; Shake the plates on
an
ELISA plate shaker during incubation.
10. Stop the kinase reaction after 60 min by addition of 30 ml stop solution
to
each well.
11. Place the phosphocellulose mat and the ELISA plate in the Tomtec plate
harvester. Harvest and wash the filter with the filter wash solution according
to the
manufacturers recommendation. Dry the filter mats. Seal the filter mats and
place them in
the holder. Insert the holder into radioactive detection apparatus and
quantify the radioactive
phosphorous on the filter mats.
Alternatively, 40 ml aliquots from individual wells of the assay plate can be
transferred to the corresponding positions on the phosphocellulose filter mat.
After air drying
the filters, put the filters in a tray. Gently rock the tray, changing the
wash solution at 15 min
intervals for 1 hour. Air-dry the filter mats. Seal the filter mats and place
them in a holder
suitable for measuring the radioactive phosphorous in the samples. Insert the
holder into a
detection device and quantify the radioactive phosphorous on the filter mats.
EXAMPLE 21: CDK2/Cyclin A - Inhibition Assay
This assay analyzes the protein kinase activity of CDK2 in exogenous
substrate.
Materials and Rea-gents
1. Buffer A (80 mM Tris ( pH 7.2), 40 mM MgCl2): 4.84 g Tris (F.W. =121.1
g/mol), 4.07 g MgCl2 (F.W.=203.31 g/mol) dissolved in 500 ml H20. Adjust pH to
7.2 with
HCI.
2. Histone H1 solution (0.45 mg/ml Histone H1 and 20 mM HEPES pH 7.2: S
mg Histone H1 (Boehinger Mannheim) in 11.111 ml 20 mM HEPES pH 7.2 (477 mg
HEPES
(F.W.= 238.3 g/rnol) dissolved in 100 ml ddH20), stored in 1 ml aliquots at -
80°C.
-144-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
3. ATP solution (60 p,M ATP, 300 ~,g/ml BSA, 3 mM DTT): 120 ~,1 10 mM
ATP, 600 p,1 10 mg/ml BSA to 20 ml, stored in 1 ml aliquots at -
80°C.
4. CDK2 solution: cdk2/cyclin A in 10 mM HEPES pH 7.2, 25 mM NaCI, 0.5
mM DTT, 10% glycerol, stored in 9 ~1 aliquots at -80°C.
Description of Assay_:
1. Prepare solutions of inhibitors at three times the desired final assay
concentration in ddH20/15 % DMSO by volume.
2. Dispense 20 p,1 of inhibitors to wells of polypropylene 96-well plates (or
20 ~,1
15% DMSO for positive and negative controls).
3. Thaw Histone H1 solution (1 ml/plate), ATP solution (1 ml/plate plus 1
aliquot for negative control), and CDK2 solution (9 ./plate). Keep CDK2 on ice
until use.
Aliquot CDK2 solution appropriately to avoid repeated freeze-thaw cycles.
4. Dilute 9 ~,1 CDK2 solution into 2.1 ml Buffer A (per plate). Mix. Dispense
20
~,1 into each well.
5. Mix 1 ml Histone H1 solution with 1 ml ATP solution (per plate) into a 10
ml
screw cap tube. Add y33P ATP to a concentration of 0.15 ~,Ci/20 ~,l (0.15
p,Ci/well in assay)
Mix carefully to avoid BSA frothing. Add 20 ~,1 to appropriate wells. Mix
plates on plate
shaker. For negative control, mix ATP solution with an equal amount of 20 mM
HEPES pH
7.2 and add y33P ATP to a concentration of 0.15 ~.Ci/20 p,1 solution. Add 20
~.1 to appropriate
wells.
6. Let reactions proceed for 60 minutes.
7. Add 35 ~,I 10% TCA to each well. Mix plates on plate shaker.
8. Spot 40 ~,1 of each sample onto P30 filter mat squares. Allow mats to dry
(approx. 10-20 minutes).
9. Wash filter mats 4 X 10 minutes with 250 ml 1% phosphoric acid (10 ml
phosphoric acid per liter ddH20).
10. Count filter mats with beta plate reader.
CELLIJLAR/BIOLOGIC ASSAYS
EXAMPLE 22: PDGF-Induced BrdU Incorporation Assay
-145-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Materials and Reagents:
1. PDGF: human PDGF B/B; 1276-956, Boehringer Mannheim, Germany
2. BrdU Labeling Reagent: 10 mM, in PBS (pH7.4), Cat. No. 1 647 229,
Boehringer Mannheim, Germany.
3. FixDenat: fixation solution (ready to use), Cat. No. 1 647 229, Boehringer
Mannheim, Germany.
4. Anti-BrdU-POD: mouse monoclonal antibody conjugated with peroxidase,
Cat. No. 1 647 229, Boehringer Mannheim, Germany.
5. TMB Substrate Solution: tetramethylbenzidine (TMB), ready to use, Cat. No.
1 647 229, Boehringer Mannheim, Germany.
6. PBS Washing Solution: 1X PBS, pH 7.4, made in house (Sugen, Inc.,
Redwood City, California).
7. Albumin, Bovine (BSA): Fraction V powder; A-8551, Sigma Chemical Co.,
USA.
8. 3T3 cell line genetically engineered to express human PDGF-R.
Prntnr.nl
1. Cells are seeded at 8000 cellslwell in DMEM, 10% CS, 2 mM Gln in a 96
well plate. Cells are incubated overnight at 37 °C in 5% C02.
2. After 24 hours, the cells are washed with PBS, and then are serum starved
in
serum free medium (0% CS DMEM with 0.1 % BSA) for 24 hours.
3. On day 3, ligand (PDGF, 3.8 nM, prepared in DMEM with 0.1% BSA) and
test compounds are added to the cells simultaneously. The negative control
wells receive
serum free DMEM with 0.1% BSA only; the positive control cells receive the
ligand (PDGF)
but no test compound. Test compounds are prepared in serum free DMEM with
ligand in a 96
well plate, and serially diluted for 7 test concentrations.
4. After 20 hours of ligand activation, diluted BrdU labeling reagent (1:100
in
DMEM, 0.1% BSA) is added and the cells are incubated with BrdU (final
concentration=10
~,M) for 1.5 hours.
5. After incubation with labeling reagent, the medium is removed by decanting
and tapping the inverted plate on a paper towel. FixDenat solution is added
(50 ~.1/well) and
the plates are incubated at room temperature for 45 minutes on a plate shaker.
-146-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
6. The FixDenat solution is thoroughly removed by decanting and tapping the
inverted plate on a paper towel. Milk is added (5% dehydrated milk in PBS, 200
~,1/well) as a
blocking solution and the plate is incubated for 30 minutes at room
temperature on a plate
shaker.
7. The blocking solution is removed by decanting and the wells are washed once
with PBS. Anti-BrdU-POD solution (1:100 dilution in PBS, 1% BSA) is added (100
p,l/well) and the plate is incubated for 90 minutes at room temperature on a
plate shaker.
8. The antibody conjugate is thoroughly removed by decanting and rinsing the
wells 5 times with PBS, and the plate is dried by inverting and tapping on a
paper towel.
9. TMB substrate solution is added (100 p,l/well) and incubated for 20 minutes
at
room temperature on a plate shaker until color development is sufficient for
photometric
detection.
10. The absorbence of the samples are measured at 410 nm (in "dual wavelength"
mode with a filter reading at 490 nm, as a reference wavelength) on a Dynatech
ELISA plate
reader.
EXAMPLE 23: EGF-Induced BrdU Incorporation Assay
Materials and Reagents
1. EGF: mouse EGF, 201; Toyobo, Co., Ltd. Japan
2. BrdU Labeling Reagent: 1O mM, in PBS (pH7.4), Cat. No. 1 647 229,
Boehringer Mannheim, Germany.
3: FixDenat: fixation solution (ready to use), Cat. No. 1 647 229, Boehringer
Mannheim, Germany.
4. Anti-BrdU-POD: mouse monoclonal antibody conjugated with peroxidase,
Cat. No. 1 647 229, Boehringer Mannheim, Germany.
5. TMB Substrate Solution: tetramethylbenzidine (TMB), ready to use, Cat. No.
1 647 229, Boehringer Mannheim, Germany.
6. PBS Washing Solution : 1X PBS, pH 7.4.
7. Albumin, Bovine (BSA): Fraction V powder; A-8551, Sigma Chemical Co.,
USA.
8. 3T3 cell line genetically engineered to express human EGF-R.
-147-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Protocol
1. Cells are seeded at 8000 cells/well in 10% CS, 2mM Gln in DMEM, in a 96
well plate. Cells are incubated overnight at 37 °C in 5% C02.
2. After 24 hours, the cells are washed with PBS, and then are serum starved
in
serum free medium (0% CS DMEM with 0.1% BSA) for 24 hours.
3. On day 3, ligand (EGF, 2 nM, prepared in DMEM with 0.1% BSA) and test
compounds are added to the cells simultaneously. The negative control wells
receive serum
free DMEM with 0.1 % BSA only; the positive control cells receive the ligand
(EGF) but no
test compound. Test compounds are prepared in serum free DMEM with ligand in a
96 well
plate, and serially diluted for 7 test concentrations.
4. After 20 hours of ligand activation, diluted BrdU labeling reagent (1:100
in
DMEM, 0.1% BSA) is added and the cells are incubated with BrdU (final
concentration=10
~.M) for 1.5 hours.
5. After incubation with labeling reagent, the medium is removed by decanting
and tapping the inverted plate on a paper towel. FixDenat solution is added
(50 p,l/well) and
the plates are incubated at room temperature for 45 minutes on a plate shaker.
6. The FixDenat solution is thoroughly removed by decanting and tapping the
inverted plate on a paper towel. Milk is added (5% dehydrated milk in PBS, 200
~,l/well) as a
blocking solution and the plate is incubated for 30 minutes at room
temperature on a plate
shaker.
7. The blocking solution is removed by decanting and the wells are washed once
with PBS. Anti-BrdU-POD solution (1:100 dilution in PBS, 1% BSA) is added (100
~.l/well) and the plate is incubated for 90 minutes at room temperature on a
plate shaker.
8. The antibody conjugate is thoroughly removed by decanting and rinsing the
wells 5 times with PBS, and the plate is dried by inverting and tapping on a
paper towel.
9. TMB substrate solution is added (100 ~,1/well) and incubated for 20 minutes
at
room temperature on a plate shaker until color development is sufficient for
photometric
detection.
10. The absorbence of the samples are measured at 410 nm (in "dual wavelength"
mode with a filter reading at 490 nm, as a reference wavelength) on a Dynatech
ELISA plate
reader.
-148-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
EXAMPLE 24: EGF-Induced HER2-Driven BrdU Incorporation
Materials and Reagents:
1. EGF: mouse EGF, 201; Toyobo,Co., Ltd. Japan
2. BrdU Labeling Reagent: 10 mM, in PBS (pH 7.4), Cat. No. 1 647 229,
Boehringer Mannheim, Germany.
3. FixDenat: fixation solution (ready to use), Cat. No. 1 647 229, Boehringer
Mannheim, Germany.
4. Anti-BrdU-POD: mouse monoclonal antibody conjugated with peroxidase,
Cat. No. 1 647 229, Boehringer Mannheim, Germany.
5. TMB Substrate Solution: tetramethylbenzidine (TMB), ready to use, Cat. No.
1 647 229, Boehringer Mannheim, Germany.
6. PBS Washing Solution : 1X PBS, pH 7.4, made in house.
7. Albumin, Bovine (BSA): Fraction V powder; A-8551, Sigma Chemical Co.,
USA.
8. 3T3 cell line engineered to express a chimeric receptor having the extra-
cellular domain of EGF-R and the intra-cellular domain of HER2.
Protocol:
1. Cells are seeded at 8000 cells/well in DMEM, 10% CS, 2 mM Gln in a 96-
well plate. Cells are incubated overnight at 37 °C in 5% C02.
2. After 24 hours, the cells are washed with PBS, and then are serum starved
in
serum free medium (0% CS DMEM with 0.1% BSA) for 24 hours.
3. On day 3, ligand (EGF=2 nM, prepared in DMEM with 0.1% BSA) and test
compounds are added to the cells simultaneously. The negative control wells
receive serum
free DMEM with 0.1% BSA only; the positive control cells receive the ligand
(EGF) but no
test compound. Test compounds are prepared in serum free DMEM with ligand in a
96 well
plate, and serially diluted for 7 test concentrations.
4. After 20 hours of ligand activation, diluted BrdU labeling reagent (1:100
in
DMEM, 0.1% BSA) is added and the cells are incubated with BrdU (final
concentration =10
~M) for 1.5 hours.
-149-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
S. After incubation with labeling reagent, the medium is removed by decanting
and tapping the inverted plate on a paper towel. FixDenat solution is added
(SO ~,l/well) and
the plates are incubated at room temperature for 4S minutes on a plate shaker.
6. The FixDenat solution is thoroughly removed by decanting and tapping the
S inverted plate on a paper towel. Milk is added (S% dehydrated milk in PBS,
200 ~.1/well) as a
blocking solution and the plate is incubated for 30 minutes at room
temperature on a plate
shaker.
7. The blocking solution is removed by decanting and the wells are washed once
with PBS. Anti-BrdU-POD solution (1:100 dilution in PBS, 1% BSA) is added (100
~.1/well) and the plate is incubated for 90 minutes at room temperature on a
plate shaker.
The antibody conjugate is thoroughly removed by decanting and rinsing the
wells S times with PBS, and the plate is dried by inverting and tapping on a
paper towel.
9. TMB substrate solution is added (100 ~,l/well) and incubated for 20 minutes
at
room temperature on a plate shaker until color development is sufficient for
photometric
1 S detection.
10. The absorbence of the samples are measured at 410 nm (in "dual wavelength"
mode with a filter reading at 490 nm, as a reference wavelength) on a Dynatech
ELISA plate
reader.
EXAMPLE 25: IGFl-Induced BrdU Incorporation Assay
Materials and Reagents:
1. IGF1 Ligand: human, recombinant; GS11, Promega Corp, USA.
2. BrdU Labeling Reagent: 10 mM, in PBS (pH 7.4), Cat. No. 1 647 229,
2S Boehringer Mannheim, Germany.
3. FixDenat: fixation solution (ready to use), Cat. No. 1 647 229, Boehringer
Mannheim, Germany.
4. Anti-BrdU-POD: mouse monoclonal antibody conjugated with peroxidase,
Cat. No. 1 647 229, Boehringer Mannheim, Germany.
S. TMB Substrate Solution: tetramethylbenzidine (TMB), ready to use, Cat. No.
1 647 229, Boehringer Mannheim, Germany.
6. PBS Washing Solution: 1X PBS, pH 7.4.
-1S0-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
7. Albumin, Bovine (BSA): Fraction V powder; A-8551, Sigma Chemical Co.,
USA.
8. 3T3 cell line genetically engineered to express human IGF-1 receptor.
Protocol:
1. Cells are seeded at 8000 cells/well in DMEM, 10% CS, 2 mM Gln in a 96-
well plate. Cells are incubated overnight at 37 °C in 5% C02.
2. After 24 hours, the cells are washed with PBS, and then are serum starved
in
serum free medium (0% CS DMEM with 0.1% BSA) for 24 hours.
3. On day 3, ligand (IGF1=3.3 nM, prepared in DMEM with 0.1% BSA) and test
compounds are added to the cells simultaneously. The negative control wells
receive serum
free DMEM with 0.1% BSA only; the positive control cells receive the ligand
(IGF1) but no
test compound. Test compounds are prepared in serum free DMEM with ligand in a
96 well
plate, and serially diluted for 7 test concentrations.
1S 4. After 16 hours of ligand activation, diluted BrdU labeling reagent
(1:100 in
DMEM, 0.1% BSA) is added and the cells are incubated with BrdU (final
concentration=10
~.M) for 1.5 hours.
5. After incubation with labeling reagent, the medium is removed by decanting
and tapping the inverted plate on a paper towel. FixDenat solution is added
(50 ~,1/well) and.
. the plates are incubated at room temperature for 45 minutes on a plate
shaker.
6. The FixDenat solution is thoroughly removed by decanting and tapping the
inverted plate on a paper towel. Milk is added (5% dehydrated milk in PBS, 200
~.1/well) as a
blocking solution and the plate is incubated for 30 minutes at room
temperature on a plate
shaker.
7. The blocking solution is removed by decanting and the wells are washed once
with PBS. Anti-BrdU-POD solution (1:100 dilution in PBS, 1% BSA) is added (100
~,l/well) and the plate is incubated for 90 minutes at room temperature on a
plate shaker.
8. The antibody conjugate is thoroughly removed by decanting and rinsing the
wells 5 times with PBS, and the plate is dried by inverting and tapping on a
paper towel.
9. TMB substrate solution is added (100 ~,1/well) and incubated for 20 minutes
at
room temperature on a plate shaker until color development is sufficient for
photometric
detection.
-151-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
10. The absorbence of the samples are measured at 410 nm (in "dual wavelength"
mode with a filter reading at 490 nm, as a reference wavelength) on a Dynatech
ELISA plate
reader.
EXAMPLE 26: HUV-EC-C Assay
The following protocol may also be used to measure a compound's activity
against
PDGF-R, FGF-R, VEGF, aFGF or Flk-1/I~DR, all of which are naturally expressed
by HLJV-
EC cells.
DAY 0
Wash and trypsinize HUV-EC-C cells (human umbilical vein endothelial cells,
(American Type Culture Collection; catalogue no. 1730 CRL). Wash with
Dulbecco's
phosphate-buffered saline (D-PBS; obtained from Gibco BRL; catalogue no. 14190-
029) 2
times at about 1 m1/10 cm2 of tissue culture flask. Trypsinize with 0.05%
trypsin-EDTA in
non-enzymatic cell dissociation solution (Sigma Chemical Company; catalogue
no. C-1544).
The 0.05% trypsin was made by diluting 0.25% trypsin/1 mM EDTA (Gibco;
catalogue no.
25200-049) in the cell dissociation solution. Trypsinize with about 1 m1/25-30
cm2 of tissue
culture flask for about 5 minutes at 37 °C. After cells have detached
from the flask, add an
equal volume of assay medium and transfer to a 50 ml sterile centrifixge tube
(Fisher
Scientific; catalogue no. OS-539-6).
2. Wash the cells with about 35 ml assay medium in the 50 ml sterile
centrifuge
tube by adding the assay medium, centrifuge for 10 minutes at approximately
200 g, aspirate
the supernatant, and resuspend with 35 ml D-PBS. Repeat the wash two more
times with D-
PBS, resuspend the cells in about 1 ml assay medium/15 cm2 of tissue culture
flask. Assay
medium consists of F12K medium (Gibco BRL; catalogue no. 21127-014) + 0.5%
heat-
inactivated fetal bovine serum. Count the cells with a Coulter CounterTM
Coulter Electronics,
Inc.) and add assay medium to the cells to obtain a concentration of 0.8-
1.0x105 cells/ml.
3. Add Bells to 96-well flat-bottom plates at 100 ~,l/well or 0.8-1.0x104
cells/well; incubate ~24 h at 37 °C, 5% C02.
DAY 1
1. Make up two-fold drug titrations in separate 96-well plates, generally 50
~,M
on down to 0 ~,M. Use the same assay medium as mentioned in day 0, step 2,
above.
-152-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
Titrations are made by adding 90 ~1/well of drug at 200 ~,M (4X the final well
concentration)
to the top well of a particular plate column. Since the stock drug
concentration is usually 20
mM in DMSO, the 200 ~,M drug concentration contains 2% DMSO.
Therefore, diluent made up to 2% DMSO in assay medium (F12K + 0.5% fetal
bovine
serum) is used as diluent for the drug titrations in order to dilute the drug
but keep the DMSO
concentration constant. Add this diluent to the remaining wells in the column
at 60 ~,l/well.
Take 60 p1 from the 120 ~.1 of 200 ~.M drug dilution in the top well of the
column and mix
with the 60 ~,l in the second well of the column. Take 60 ~,l from this well
and mix with the
60 ~,1 in the third well of the column, and so on until two-fold titrations
are completed. When
the next-to-the-last well is mixed, take 60 p,1 of the 120 p,1 in this well
and discard it. Leave
the last well with 60 ~.1 of DMSO/media diluent as a non-drug-containing
control. Make 9
columns of titrated drug, enough for triplicate wells each for 1) VEGF
(obtained from Pepro
Tech Inc., catalogue no. 100-200, 2) endothelial cell growth factor (ECGF)
(also known as
acidic fibroblast growth factor, or aFGF) (obtained from Boehringer Mannheim
Biochemica,
catalogue no. 1439 600); or, 3) human PDGF BB (1276-956, Boehringer Mannheim,
Germany) and assay media control. ECGF comes as a preparation with sodium
heparin.
2. Transfer 50 ~,1/well of the drug dilutions to the 96-well assay plates
containing
the 0.8-1.0x104 cells/100 ~,l/well of the HUV-EC-C cells from day 0 and
incubate ~2 h at 37
°C, 5% CO2.
3. In triplicate, add 50 ~,l/well of 80 ~,g/ml VEGF, 20 ng/ml ECGF, or media
control to each drug condition. As with the drugs, the growth factor
concentrations are 4X
the desired final concentration. Use the assay media from day 0, step 2, to
make the
concentrations of growth factors. Incubate approximately 24 hours at 37
°C, 5% COZ. Each
well will have 50 ~,1 drug dilution, 50 ~.1 growth factor or media, and 100
~,1 cells, = 200 ~,l
/well total. Thus the 4X concentrations of drugs and growth factors become 1X
once
everything has been added to the wells.
DAY 2
1. Add 3H-thymidine (Amersham; catalogue no. TRK-686) at 1 ~.Ci/well (10
~.1/well of 100 ~,Ci/ml solution made up in RPMI media + 10% heat-inactivated
fetal bovine
serum) and incubate ~24 h at 37 °C, 5% C02. Note: 3H-thymidine is made
up in RPMI
media because all of the other applications for wluch we use the 3H-thymidine
involve
-153-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
experiments done in RPMI. The media difference at this step is probably not
significant.
RPMI was obtained from Gibco BRL, catalogue no. 11875-051.
DAY 3
1. Freeze plates overnight at -20°C.
DAY 4
1. Thaw plates and harvest with a 96-well plate harvester (Tomtec Harvester
96~R~) onto filter mats (Wallac; catalogue no. 1205-401); read counts on a
Wallac
Betaplate~TM~ liquid scintillation counter.
-154-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
CONCLUSION
One skilled in the art would readily appreciate that the present invention is
well
adapted to carry out the objects and obtain the ends and advantages mentioned,
as well as
those inherent therein. The molecular complexes and the methods, procedures,
treatments,
molecules, specific compounds described herein are presently representative of
preferred
embodiments, are exemplary, and are not intended as limitations on the scope
of the
invention. It will be readily apparent to one skilled in the art that varying
substitutions and
modifications may be made to the invention disclosed herein without departing
from the
scope and spirit of the invention.
All patents and publications mentioned in the specification are indicative of
the levels
of those skilled in the art to which the invention pertains. All patents and
publications are
herein incorporated by reference to the same extent as if each individual
publication was
specifically and individually indicated to be incorporated by reference.
The invention illustratively described herein suitably may be practiced in the
absence
of any element or elements, limitation or limitations that are not
specifically disclosed herein.
Thus, for example, in each instance herein any of the terms "comprising,"
"consisting
essentially of and "consisting of may be replaced with either of the other two
terms. The
terms and expressions which have been employed are used as terms of
description and not of
limitation, and there is no intention that in the use of such terms and
expressions of excluding
any equivalents of the features shown and described or portions thereof, but
it is recognized
that various modifications are possible within the scope of the invention
claimed. Thus, it
should be understood that although the present invention has been specifically
disclosed by
preferred embodiments and optional features, modification and variation of the
concepts
herein disclosed may be resorted to by those skilled in the art, and that such
modifications
and variations are considered to be within the scope of this invention as
defined by the
appended claims.
In addition, where features or aspects of the invention are described in terms
of
Markush groups, those skilled in the art will recognize that the invention is
also thereby
described in terms of any individual member or subgroup of members of the
Markush group.
For example, if X is described as selected from the group consisting of
bromine, chlorine, and
iodine, claims for X being bromine and claims for X being bromine and chlorine
are fully
described.
-155-
CA 02404971 2002-09-30
WO 01/77338 PCT/USO1/11675
In view of the degeneracy of the genetic code, other combinations of nucleic
acids
also encode the claimed peptides and proteins of the invention. For example,
all four nucleic
acid sequences GCT, GCC, GCA, and GCG encode the amino acid alanine.
Therefore, if for
an amino acid there exists an average of three codons, a polypeptide of 100
amino acids in
length will, on average, be encoded by 3100, or 5 x 1047, nucleic acid
sequences. Thus, a
nucleic acid sequence can be modified to form a second nucleic acid sequence,
encoding the
same polypeptide as encoded by the first nucleic acid sequences, using routine
procedures
and without undue experimentation. Thus, all possible nucleic acids that
encode the claimed
peptides and proteins are also fully described herein, as if all were written
out in full taking
into account the codon usage, especially that preferred in humans.
Furthermore, changes in
the amino acid sequences of polypeptides, or in the corresponding nucleic acid
sequence
encoding such polypeptide, may be designed or selected to take place in an
area of the
sequence where the significant activity of the polypeptide remains unchanged.
Fox example,
an amino acid change may take place within a (3-turn, away from the active
site of the
polypeptide. Also changes such as deletions (e.g. removal of a segment of the
polypeptide, or
in the corresponding nucleic acid sequence encoding such polypeptide, which
does not affect
the active site) and additions (e.g. addition of more amino acids to the
polypeptide sequence
without affecting the function of the active site, such as the formation of
GST-fusion proteins,
or additions in the corresponding nucleic acid sequence encoding such
polypeptide without
affecting the function of the active site) are also within the scope of the
present invention.
Such changes to the polypeptides can be performed by those with ordinary skill
in the art
using routine procedures and without undue experimentation. Thus, all possible
nucleic
and/or amino acid sequences that can readily be determined not to affect a
significant activity
of the peptide or protein of the invention are also fully described herein.
The invention has been described broadly and generically herein. Each of the
narrower species and subgenenc groupings falling within the generic disclosure
also form
part of the invention. This includes the generic description of the invention
with a proviso or
negative limitation removing any subject matter from the genus, regardless of
whether or not
the excised material is specifically recited herein.
Other embodiments are within the following claims.
-156-
