Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
NOVEL SEVEN TRANSMEMBRANE PROTEINS AND POLYNUCLEOTIDES
ENCODING THE SAME
DESCRIPTION OF THE INVENTION
[001] The present application claims priority to U.S. Application
Serial No. 60/203,875, filed May 12, 2000, and U.S. Application Serial No.
60/207,932, filed May 30, 2000, which are hereby incorporated by reference
herein for any purpose.
Field of the Invention
[002] The present invention relates to the discovery, identification and
characterization of novel human polynucleotides that encode membrane
associated proteins and receptors. The invention encompasses the described
polynucleotides, host cell expression systems, the encoded proteins, fusion
proteins, polypeptides and peptides, antibodies to the encoded proteins and
peptides, and genetically engineered animals that lack the disclosed genes, or
over express the disclosed genes, or antagonists and agonists of the proteins,
and other compounds that modulate the expression or activity of the proteins
encoded by the disclosed genes that can be used for diagnosis, drug
screening, clinical trial monitoring, and/or the treatment of physiological or
behavioral disorders.
Background of the invention
[003] Membrane receptor proteins can serve as integral components
of cellular mechanisms for sensing their environment, and maintaining cellular
homeostasis and function. Accordingly; membrane receptor proteins are
often involved in signal transduction pathways that control cell physiology,
chemical communication, and gene expression. A particularly relevant class
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
of membrane receptors are those typically characterized by the presence of 7
conserved transmembrane domains that are interconnected by nonconserved
hydrophilic loops. Such "7TM receptors" include a superfamily of receptors
known as G-protein coupled receptors (GPCRs). GPCRs are typically
involved in signal transduction pathways involving G-proteins or PPG
proteins. As such, the GPCR family includes many receptors that are known
to serve as drug targets for therapeutic agents.
SUMMARY OF THE INVENTION
[004] The present invention relates to the discovery, identification, and
characterization of nucleotides that encode novel GPCRs, and the
corresponding novel GPCR (NGPCR) amino acid sequences. The NGPCRs
described for the first time herein are transmembrane proteins that span the
cellular membrane and are involved in signal transduction after ligand
binding.
The described NGPCRs have structural motifs found in the 7TM receptor
family. Expression of the described NGPCRs can be detected in human fetal
brain, brain, pituitary, cerebellum, spinal cord, thymus, spleen, lymph node,
bone marrow, trachea, lung, kidney, fetal liver, liver, prostate, testis,
thyroid,
adrenal gland, pancreas, salivary gland, stomach, small intestine, colon,
skeletal muscle, heart, uterus, placenta, mammary gland, adipose, skin,
esophagus, bladder, cervix, rectum, pericardium, ovary, fetal kidney, and
fetal
lung cells (SEQ ID NOS:1-5), or human heart and testis (SEQ ID NOS:6 and
7). The novel human GPCR sequences described herein encode proteins of
994, 826, and 335 amino acids in length (see respectively SEQ ID NOS: 2, 4,
and 7). The described NGPCRs have multiple transmembrane regions (of
2
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
about 20-30 amino acids) characteristic of 7TM proteins as well as several
predicted cytoplasmic domains.
[005] Additionally contemplated are "knockout" ES cells that have
been engineered using conventional methods (see, for example, PCT Applic.
No. PCT/US98/03243, filed February 20, 1998, herein incorporated by
reference). A gene trapped knockout ES cell line has been produced in a
murine homolog of the described human sequences. Accordingly, an
additional aspect of the present invention includes knockout cells and animals
having genetically engineered mutations in the gene encoding the presently
described NGPCRs.
[006] The invention encompasses the nucleotide sequences
presented in the Sequence Listing, host cells expressing such nucleotide
sequences, and the expression products of such nucleotide sequences, and:
(a) nucleotide sequences that encode mammalian homologs of the described
NGPCRs, including the specifically described human NGPCRs, and the
human NGPCR gene products; (b) nucleotide sequences that encode one or
more portions of the NGPCRs that correspond to functional domains, and the
polypeptide products specified by such nucleotide sequences, including but
not limited to the novel regions of the described extracellular domains) ECD,
one or more transmembrane domains) (TM) first disclosed herein, and the
cytoplasmic domains) (CD); (c) isolated nucleotide sequences that encode
mutants, engineered or naturally occurring, of the described NGPCRs in
which all or a part of at least one of the domains is deleted or altered, and
the
polypeptide products specified by such nucleotide sequences, including but
3
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
not limited to soluble receptors in which all or a portion of the TM is
deleted,
and nonfunctional receptors in which all or a portion of the CD is deleted;
and
(d) nucleotides that encode fusion proteins containing the coding region from
an NGPCR, or one of its domains (e.g., an ECD) fused to another peptide or
polypeptide.
[007] The invention also encompasses agonists and antagonists of
the NGPCRs, including small molecules, large molecules, mutant NGPCR
proteins, or portions thereof that compete with the native NGPCR, and
antibodies, as well as nucleotide sequences that can be used to inhibit the
expression of the described NGPCR (e.g., antisense and ribozyme molecules,
and gene or regulatory sequence replacement constructs) or to enhance the
expression of the described NGPCR gene (e.g., expression constructs that
place the described gene under the control of a strong promoter system), and
transgenic animals that express a NGPCR transgene or "lenoclc-outs" that do
not express a functional NGPCR.
[008] Further, the present invention also relates to methods for the
use of the described NGPCR gene andlor NGPCR gene products for the
identification of compounds that modulate, i.e., act as agonists or
antagonists,
of NGPCR gene expression and or NGPCR gene product activity. Such
compounds can be used as therapeutic agents for the treatment of various
symptomatic representations of biological disorders or imbalances.
4
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
BRIEF DESCRIPTION OF THE SEQUENCE LISTINGS
[009] The Sequence Listing provides the sequences of certain
described NGPCR ORFs, the amino acid sequences encoded thereby, as
well as an ORF with surrounding 5' and 3' regions (SEQ ID N0:5).
DESCRIPTION OF CERTAIN EMBODIMENTS
[010] The human NGPCRs, described for the first time herein, are
novel receptor proteins that are expressed in human cells. The human
NGPCR sequences were obtained using sequences from gene trapped
human cells, genomic DNA, and cDNA clones isolated from human kidney
and lymph node cDNA libraries (SEQ ID NOS:1-5), or skeletal muscle cDNA
libraries were used to generate SEQ ID NOS:6-7 (Edge Biosystems,
Gaithersburg, MD, and Clontech, Palo Alto, CA). The described NGPCRs are
transmembrane proteins that fall within the 7TM protein family of receptors.
As with other GPCRs, signal transduction is triggered when a ligand binds to
the receptor. Interfering with the binding of the natural ligand, or
neutralizing
or removing the ligand, or interfering with its binding to a NGPCR will affect
NGPCR mediated signal transduction. Because of their biological
significance, 7TM, and particularly GPCR, proteins have been subjected to
intense scientific/commercial scrutiny (see, for example, U.S. Application
Ser.
Nos. 08/820,521, filed March 19, 1997, and 08/833,226, filed April 17, 1997
both of which are herein incorporated by reference in their entirety for
applications, uses, and assays involving the described NGPCRs).
[011] The invention encompasses the use of the described NGPCR
nucleotides, NGPCR proteins and peptides, as well as antibodies, preferably
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
humanized monoclonal antibodies, or binding fragments, domains, or fusion
proteins thereof, to the NGPCRs (which can, for example, act as NGPCR
agonists or antagonists), antagonists that inhibit receptor activity or
expression, or agonists that activate receptor activity or increase its
expression in the diagnosis and treatment of disease.
[012] According to certain embodiments, the nucleotide sequences
encompassed by the invention can be useful for chromosome mapping. For
example, the nucleotide sequences as set forth in SEQ ID NOs 1, 3, 5, and 6
are found on chromosome 2 at 2p24.1 in the human genome. In certain
embodiments, these sequences can act as highly specific probes to show
which regions of the chromosome actually code for protein. Thus, in certain
embodiments, these sequences can provide mapping information for protein
coding regions within the 2p24.1 location of chromosome 2. In certain
embodiments, these sequences allow for the identification of exons and the
verification of splice junction sites. In certain embodiments, these sequences
also can allow for the identification of the genomic locations for the NGPCR
gene in mouse. This information is useful for creating "knock-out" mice in
which the expression of this protein is abrogated.
[013] In particular, the invention encompasses NGPCR polypeptides
or peptides corresponding to functional domains of NGPCR (e.g., ECD, TM or
CD), mutated, truncated or deleted NGPCRs (e.g., NGPCRs missing one or
more functional domains or portions thereof, such as, DECD, ATM and/or
BCD), NGPCR fusion proteins (e.g., a NGPCR or a functional domain of a
NGPCR, such as the ECD, fused to an unrelated protein or peptide such as
6
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
an immunoglobulin constant region, i.e., IgFc), nucleotide sequences
encoding such products, and host cell expression systems that can produce
such NGPCR products.
[014] The invention also encompasses antibodies and anti-idiotypic
antibodies (including Fab fragments), antagonists and agonists of the
NGPCR, as well as compounds or nucleotide constructs that inhibit
expression of a NGPCR gene (transcription factor inhibitors, antisense and
ribozyme molecules, or gene or regulatory sequence replacement constructs),
or promote expression of NGPCR (e.g., expression constructs in which
NGPCR coding sequences are operatively associated with expression control
elements such as promoters, promoter/enhancers, etc.). The invention also
relates to host cells and animals genetically engineered to express the human
NGPCRs (or mutants thereof) or to inhibit or "knock-out" expression of the
animal's endogenous NGPCR genes.
[015] In certain embodiments, the NGPCR proteins or peptides,
NGPCR fusion proteins, NGPCR nucleotide sequences, antibodies,
antagonists and agonists can be useful for the detection of mutant NGPCRs
or inappropriately expressed NGPCRs for the diagnosis of disease. In certain
embodiments, the NGPCR proteins or peptides, NGPCR fusion proteins,
NGPCR nucleotide sequences, host cell expression systems, antibodies,
antagonists, agonists and genetically engineered cells and animals can be
used for screening for drugs (or high throughput screening of combinatorial
libraries) effective in the treatment of the symptomatic or phenotypic
manifestations of perturbing the normal function of NGPCR in the body. In
7
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
certain embodiments, the use of engineered host cells and/or animals may
offer an advantage in that such systems allow not only for the identification
of
compounds that bind to an ECD of a NGPCR, but can also identify
compounds that affect the signal transduced by an activated NGPCR.
[016] Finally, in certain embodiments, the NGPCR protein products
(especially soluble derivatives such as peptides corresponding to the NGPCR
ECD, or truncated polypeptides lacking on or more TM domains) and fusion
protein products (especially NGPCR-Ig fusion proteins, i.e., fusions of a
NGPCR, or a domain of a NGPCR, e.g., ECD, ATM to an IgFc), antibodies
and anti-idiotypic antibodies (including Fab fragments), antagonists or
agonists (including compounds that modulate signal transduction which may
act on downstream targets in a NGPCR-mediated signal transduction
pathway) can be used for therapy of such diseases. For example, in certain
embodiments, the administration of an effective amount of soluble NGPCR
ECD, OTM, or an ECD-IgFc fusion protein or an anti-idiotypic antibody (or its
Fab) that mimics the NGPCR ECD would "mop up" or "neutralize" the
endogenous NGPCR ligand, and prevent or reduce binding and receptor
activation. In certain embodiments, nucleotide constructs encoding such
NGPCR products can be used to genetically engineer host cells to express
such products in vivo; these genetically engineered cells function as
"bioreactors" in the body delivering a continuous supply of a NGPCR, a
NGPCR peptide, soluble ECD or ATM or a NGPCR fusion protein that will
"mop up" or neutralize a NGPCR ligand. In certain embodiments, nucleotide
constructs encoding functional NGPCRs, mutant NGPCRs, as well as
8
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
antisense and ribozyme molecules can be used in "gene therapy" approaches
for the modulation of NGPCR expression. Thus, the invention also
encompasses pharmaceutical formulations and methods for treating biological
disorders.
[017] Various aspects of the invention are described in greater detail
in the subsections below.
NGPCR POLYNUCLEOTIDES
[018] The cDNA sequences and deduced amino acid sequences of
the described human NGPCRs are presented in the Sequence Listing. Two
polymorphisms were identified including: a translationally silent A or G
transition at the position represented by, for example, nucleotide 2091 of SEQ
ID N0:1, or at nucleotide position 1,587 of SEQ ID N0:1 which can results in
a ser or a gly being present at the corresponding amino acid position 529 of,
for example, SEQ ID N0:2.
[019] The NGPCRs of the present invention include: (a) the human
DNA sequences presented in the Sequence Listing and any additionally
contemplated nucleotide sequence encoding a contiguous and functional
NGPCR open reading frame (ORF) that hybridizes to a complement of the
DNA sequences presented in the Sequence Listing under highly stringent
conditions, e.g., hybridization to filter-bound DNA in 0.5 M NaHP04, 7%
sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in
0.1xSSCl0.1 % SDS at 68°C (Ausubel F.M. et al., eds., 1989, Current
Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and
John Wiley & sons, Inc., New York, at p. 2.10.3) and encodes a functionally
9
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
equivalent gene product. Additionally contemplated are any nucleotide
sequences that hybridize to the complement of DNA sequences that encode
and express an amino acid sequence presented in the Sequence Listing
under moderately stringent conditions, e.g., washing in 0.2xSSC/0.1 % SDS at
42°C (Ausubel et al., 1989, supra), yet which still encode a
functionally
equivalent NGPCR gene product. Functional equivalents of NGPCR include
naturally occurring NGPCRs present in other species, and mutant NGPCRs
whether naturally occurring or engineered. The invention also includes
degenerate variants of the disclosed sequences.
[020] Additionally contemplated are polynucleotides encoding NGPCR
ORFs, or their functional equivalents, encoded by polynucleotide sequences
that are about 99, 95, 90, or about 85 percent similar or identical to
corresponding regions of the polynucleotide sequences described in the
Sequence Listing (as measured by BLAST sequence comparison analysis
using, for example, the GCG sequence analysis package using default
parameters).
[021] In certain embodiments, the invention also includes nucleic acid
molecules, preferably DNA molecules, that hybridize to, and are therefore the
complements of, the described NGPCR nucleotide sequences. Such
hybridization conditions may be highly stringent or moderately stringent (less
highly stringent), as described above. In certain embodiments, in instances
wherein the nucleic acid molecules are deoxyoligonucleotides ("DNA oligos"),
such molecules (in certain embodiments, those about 16 to about 100 base
long, about 20 to about 80, or about 34 to about 45 base long, or those of at
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
least 300 nucleotides in length, or any variation or combination of sizes
represented therein incorporating a contiguous region of sequence first
disclosed in the present Sequence Listing) can be used in conjunction with
the polymerase chain reaction (PCR) to screen libraries, isolate clones, and
prepare cloning and sequencing templates, etc. In certain embodiments,
these DNA oligos will comprise at least 22 nucleotides. In certain
embodiments, these DNA oligos will comprise at least 30 nucleotides.
[022] In certain embodiments, the oligonucleotides can be used singly
or in chip format as hybridization probes. For example, in certain
embodiments, a series of the described NGPCR oligonucleotide sequences,
or the complements thereof, can be used to represent all or a portion of the
described NGPCRs. The oligonucleotides, in certain embodiments, between
about 16 to about 40 (or any whole number within the stated range)
nucleotides in length may partially overlap each other and/or the NGPCR
sequence may be represented using oligonucleotides that do not overlap.
Accordingly, in certain embodiments, the NGPCR polynucleotide sequences
shall typically comprise at least about two or three distinct oligonucleotide
sequences of at least about 18 nucleotides in length that are each first
disclosed in the described Sequence Listing. Such oligonucleotide
sequences may begin at any nucleotide present within a sequence in the
Sequence Listing and proceed in either a sense (5'-to-3') orientation vis-a-
vis
the described sequence or in an antisense orientation. For oligonucleotides
probes, highly stringent conditions may refer, e.g., to washing in
11
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
6xSSC10.05% sodium pyrophosphate at 37°C (for 14-base oligos),
48°C (for
17-base oligos), 55°C (for 20-base oligos), and 60°C (for 23-
base oligos).
[023] In certain embodiments, the described oligonucleotides may
encode or act as NGPCR antisense molecules, useful, for example, in
NGPCR gene regulation (for and/or as antisense primers in amplification
reactions of NGPCR gene nucleic acid sequences). With respect to NGPCR
gene regulation, in certain embodiments, such techniques can be used to
regulate biological functions. Further, in certain embodiments, such
sequences may be used as part of ribozyme and/or triple helix sequences,
also useful for NGPCR gene regulation.
[024] Additionally, the antisense oligonucleotides may comprise at
least one modified base moiety which is selected from the group including, but
not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil,
5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine,
5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid
(v),
12
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[025] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including but not limited to
arabinose, 2-fluoroarabinose, xylulose, and hexose.
[026] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from the group
consisting of a phosphorothioate, a phosphorodithioate, a
phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a
methylphosphonate, an alkyl phosphotriester, and a formacetal or analog
thereof.
[027] In yet another embodiment, the antisense oligonucleotide is an
a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific
double-stranded hybrids with complementary RNA in which, contrary to the
usual (3-units, the strands run parallel to each other (Gautier et al., 1987,
Nucl.
Acids Res. 75:6625-6641). The oligonucfeotide is a 2'-0-methylribonucleotide
(Inoue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA
analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).
[028] Oligonucleotides of certain embodiments of the invention may
be synthesized by standard methods known in the art, e.g. by use of an
automated DNA synthesizer (such as are commercially available from
Biosearch, Applied Biosystems, etc.). As examples of certain embodiments,
phosphorothioate oligonucleotides may be synthesized by the method of Stein
et al. (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides
13
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
can be prepared by use of controlled pore glass polymer supports (Sarin et
al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451 ), etc.
[029] Low stringency conditions are well known to those of skill in the
art, and will vary predictably depending on the specific organisms from which
the library and the labeled sequences are derived. For guidance regarding
such conditions see, for example, Sambrook et al., 1989, Molecular Cloning,
A Laboratory Manual (and periodic updates thereof), Cold Springs Harbor
Press, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology,
Green Publishing Associates and Wiley Interscience, N.Y.
[030] Alternatively, in certain embodiments, suitably labeled NGPCR
nucleotide probes may be used to screen a human genomic library using
appropriately stringent conditions or by PCR. The identification and
characterization of human genomic clones in certain embodiments is helpful
for identifying polymorphisms, determining the genomic structure of a given
locus/allele, and/or designing diagnostic tests. For example, sequences
derived from regions adjacent to the intron/exon boundaries of the human
gene in certain embodiments can be used to design primers for use in
amplification assays to detect mutations within the exons, introns, splice
sites
(e.g., splice acceptor and/or donor sites), etc., that can be used in
diagnostics
and pharmacogenomics.
[031] Further, a NGPCR gene homolog may be isolated from nucleic
acid of the organism of-interest in certain embodiments, by performing PCR
using two degenerate oligonucleotide primer pools designed on the basis of
amino acid sequences within the NGPCR gene product disclosed herein. The
14
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
template for the reaction may be total RNA, mRNA, and/or cDNA obtained by
reverse transcription of mRNA prepared from, for example, human or non-
human cell lines or tissue known or suspected to express a NGPCR gene
allele.
[032] In certain embodiments, the PCR product may be subcloned
and sequenced to ensure that the amplified sequences represent the
sequence of the desired NGPCR gene. In certain embodiments, the PCR
fragment may then be used to isolate a full length cDNA clone by a variety of
methods. For example, the amplified fragment may be labeled and used to
screen a cDNA library, such as a bacteriophage cDNA library. In certain
embodiments, the labeled fragment may be used to isolate genomic clones
via the screening of a genomic library.
[033] In certain embodiments, PCR technology may also be utilized to
isolate full length cDNA sequences. For example, in certain embodiments
RNA may be isolated, following standard procedures, from an appropriate
cellular or tissue source (i.e., one known, or suspected, to express a NGPCR
gene). In certain embodiments, a reverse transcription (RT) reaction may be .
performed on the RNA using an oligonucleotide primer specific for the most 5'
end of the amplified fragment for the priming of first strand synthesis. In
certain embodiments, the resulting RNA/DNA hybrid may then be "tailed"
using a standard terminal transferase reaction, the hybrid may be digested
with RNase H, and second strand synthesis may then be primed with a
corriplementary primer. Thus, in certain embodiments, cDNA sequences
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
upstream of the amplified fragment may easily be isolated. For a review of
cloning strategies which may be used, see e.g., Sambrook et al., 1989, supra.
[034] In certain embodiments, a cDNA of a mutant NGPCR gene can
be isolated, for example, by using PCR. In certain embodiments, the first
cDNA strand may be synthesized by hybridizing an oligo-dT oligonucleotide to
mRNA isolated from tissue known or suspected to be expressed in an
individual putatively carrying a mutant NGPCR allele, and by extending the
new strand with reverse transcriptase. In certain embodiments, the second
strand of the cDNA is then synthesized using an oligonucleotide that
hybridizes specifically to the 5' end of the normal gene. Using these two
primers, the product is then amplified via PCR, optionally cloned into a
suitable vector, and subjected to DNA sequence analysis through methods
well known to those of skill in the art. In certain embodiments, by comparing
the DNA sequence of the mutant NGPCR allele to that of the normal NGPCR
allele, the mutations) responsible for the loss or alteration of function of
the
mutant NGPCR gene product can be ascertained.
[035] Alternatively, in certain embodiments, a genomic library can be
constructed using DNA obtained from an individual suspected of or known to
carry the mutant NGPCR allele, or a cDNA library can be constructed using
RNA from a tissue known, or suspected, to express the mutant NGPCR allele.
A normal NGPCR gene, or any suitable fragment thereof, can then be labeled
and used as a probe to identify the corresponding mutant NGPCR allele in
such libraries. Clones containing the mutant NGPCR gene sequences can
16
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
then be purified and subjected to sequence analysis according to methods
well known to those of skill in the art.
[036] Additionally, in certain embodiments, an expression library can
be constructed utilizing cDNA synthesized from, for example, RNA isolated
from a tissue known, or suspected, to express a mutant NGPCR allele in an
individual suspected of or known to carry such a mutant allele. In this
manner, gene products made by the putatively mutant tissue may be
expressed and screened using standard antibody screening techniques in
conjunction with antibodies raised against the normal NGPCR gene product,
as described, below, in Section 5.3. (For screening techniques, see, for
example, Harlow, E. and Lane, eds., 1988, "Antibodies: A Laboratory
Manual", Cold Spring Harbor Press, Cold Spring Harbor)
[037] Additionally, in certain embodiments, screening can be
accomplished by screening with labeled NGPCR fusion proteins, such as, for
example, AP-NGPCR or NGPCR-AP fusion proteins. In cases where a
NGPCR mutation results in an expressed gene product with altered function
(e.g., as a result of a missense or a frameshift mutation), a polyclonal set
of
antibodies to NGPCR are likely to cross-react with the mutant NGPCR gene
product. Library clones detected via their reaction with such labeled
antibodies can be purified and subjected to sequence analysis according to
methods well known to those of skill in the art.
[038] The invention also encompasses nucleotide-sequences that
encode mutant NGPCRs, peptide fragments of the NGPCRs, truncated
NGPCRs, and NGPCR fusion proteins. These include, but are not limited to,
17
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
nucleotide sequences encoding mutant NGPCRs described below;
polypeptides or peptides corresponding to one or more ECD, TM and/or CD
domains of the NGPCR or portions of these domains; truncated NGPCRs in
which one or two of the domains is deleted, e.g., a soluble NGPCR lacking
the TM or both the TM and CD regions, or a truncated, nonfunctional NGPCR
lacking all or a portion of the CD region. Nucleotides encoding fusion
proteins
may include, but are not limited to, full length NGPCR sequences, truncated
NGPCRs, or nucleotides encoding peptide fragments of NGPCR fused to an
unrelated protein or peptide, such as for example, a transmembrane
sequence, which anchors the NGPCR ECD to the cell membrane; an IgFc
domain which increases the stability and half life of the resulting fusion
protein
(e.g., NGPCR-Ig) in the bloodstream; or an enzyme, fluorescent protein,
luminescent protein which can be used as a marker.
[039] The invention also encompasses (a) DNA vectors that contain
any of the foregoing NGPCR coding sequences and/or their complements
(i.e., antisense); (b) DNA expression vectors that contain any of the
foregoing
NGPCR coding sequences operatively associated with a regulatory element
that directs the expression of the coding sequences; and (c) genetically
engineered host cells that contain any of the foregoing NGPCR coding
sequences operatively associated with a regulatory element that directs the
expression of the coding sequences in the host cell. As used herein,
regulatory elements include but are not limited to inducible and non-inducible
promoters, enhancers, operators and other elements known to those skilled in
the art that drive and regulate expression. Such regulatory elements include
18
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
but are not limited to the cytomegalovirus hCMV immediate early gene,
regulatable, viral (particularly retroviral LTR promoters) the early or late
promoters of SV40 adenovirus, the lac system, the trp system, the tet system,
the TAC system, the TRC system, the major operator and promoter regions of
phage A, the control regions of fd coat protein, the promoter for
3-phosphoglycerate kinase (PGK), the promoters of acid phosphatase, and
the promoters of the yeast a-mating factors.
NGPCR PROTEINS AND POLYPEPTIDES
[040] NGPCR proteins, polypeptides and peptide fragments, mutated,
truncated or deleted forms of the NGPCR andlor NGPCR fusion proteins can
be prepared for a variety of uses, including but not limited to the generation
of
antibodies, as reagents in diagnostic assays, the identification of other
cellular
gene products related to a NGPCR, as reagents in assays for screening for
compounds that can be used as pharmaceutical reagents useful in the
therapeutic treatment of mental, biological, or medical disorders (i.e.,
heartbeat rate, improper blood pressure, etc.) and disease.
[041] The Sequence Listing discloses the amino acid sequences
encoded by certain NGPCR genes. The NGPCRs have initiator methionines
in DNA sequence contexts consistent with translation initiation sites,
followed
by hydrophobic signal sequences typical of membrane associated proteins.
The sequence data presented herein indicate that alternatively spliced forms
of the NGPCRs exist (which may or may not be tissue specific).
j042] The NGPCR sequences of the invention include the nucleotide
and amino acid sequences presented in the Sequence Listing as well as
19
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
analogues and derivatives thereof. Further, corresponding NGPCR
homologues from other species are encompassed by the invention. In fact,
any NGPCR protein encoded by the NGPCR nucleotide sequences described
above are within the scope of the invention, as are any novel polynucleotide
sequences encoding all or any novel portion of an amino acid sequence
presented in the Sequence Listing. The degenerate nature of the genetic
code is well known, and, accordingly, each amino acid presented in the
Sequence Listing, is generically representative of the well known nucleic acid
"triplet" codon, or in many cases codons, that can encode the amino acid. As
such, as contemplated herein, the amino acid sequences presented in the
Sequence Listing, when taken together with the genetic code (see, for
example, Table 4-1 at page 109 of "Molecular Cell Biology", 1986, J. Darnell
et al. eds., Scientific American Books, New York, NY, herein incorporated by
reference) are generically representative of all the various permutations and
combinations of nucleic acid sequences that can encode such amino acid
sequences.
[043] The invention also encompasses proteins that are functionally
equivalent to the NGPCR encoded by the described nucleotide sequences as
judged by any of a number of criteria, including but not limited to the
ability to
bind a ligand for a NGPCR, the ability to affect an identical or complementary
signal transduction pathway, a change in cellular metabolism (e.g., ion flux,
tyrosine phosphorylation,-etc.) or a change-in phenotype when the NGPCR
equivalent is present in an appropriate cell type (such as the amelioration,
prevention or delay of a biochemical, biophysical, or overt phenotype. Such
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
functionally equivalent NGPCR proteins include, but are not limited to,
additions or substitutions of amino acid residues within the amino acid
sequence encoded by the NGPCR nucleotide sequences described above but
which result in a silent change, thus producing a functionally equivalent gene
product. For example, in certain embodiments, one can employ a
conservative amino acid substitution or substitutions which may be made on
the basis of similarity in polarity, charge, solubility, hydrophobicity,
hydrophilicity, andlor the amphipathic nature of the residues involved. For
example, nonpolar (hydrophobic) amino acids include alanine, leucine,
isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar
neutral amino acids include glycine, serine, threonine, cysteine, tyrosine,
asparagine, and glutamine; positively charged (basic) amino acids include
arginine, lysine, and histidine; and negatively charged (acidic) amino acids
include aspartic acid and glutamic acid.
[044] While random mutations can be made to NGPCR DNA (using
random mutagenesis techniques well known to those skilled in the art) and
the resulting mutant NGPCRs tested for activity, in certain embodiments, site-
directed mutations of the NGPCR coding sequence can be engineered (using
site-directed mutagenesis techniques well known to those skilled in the art)
to
generate mutant NGPCRs with increased function, e.g., higher binding affinity
for the target ligand, and/or greater signaling capacity; or decreased
function,
and/or decreased signal transduction capacity. In certain embodiments, one
starting point for such analysis is by aligning the disclosed human sequences
with corresponding gene/protein sequences from, for example, other
21
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
mammals in order to identify amino acid sequence motifs that are conserved
between different species. In certain embodiments, non-conservative
changes can be engineered at variable positions to alter function, signal
transduction capability, or both. Additionally, where alteration of function
is
desired, in certain embodiments, deletion or non-conservative alterations of
the conserved regions (i.e., identical amino acids) can be engineered.
[045] In certain embodiments, polypeptides of the invention will be at
least 85% identical, or at least 95% identical, to the polypeptides described
in
SEQ ID NOs 2, 4, and 7. Percent sequence identity can be determined by
standard methods that are commonly used to compare the similarity in
position of the amino acids of two polypeptides, to generate an optimal
alignment of two respective sequences. By way of illustration, using a
computer program such as BLAST or FASTA, two polypeptides are aligned
for optimal matching of their respective amino acids (either along the full
length of one or both sequences, or along a pre-determined portion of one or
both sequences). The programs provide a "default" opening penalty and a
"default" gap penalty, and a scoring matrix such as PAM 250. A standard
scoring matrix can be used in conjunction with the computer program; see
Dayhoff et al., in Atlas of Protein Sequence and Structure, Volume 5,
Supplement 3 (1978), which is incorporated by reference herein for any
purpose. In certain embodiments, the substitutions will be conservative so as
-to-have little or no effect on the overall net charge, polarity, or
hydrophobicity
of the protein.
22
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
[046] In certain embodiments, the described NGPCR polynucleotide
sequences can be used in the molecular mutagenesis/evolution of proteins
that are at least partially encoded by the described novel sequences using,
for
example, polynucleotide shuffling or related methodologies. Such
approaches are described in U.S. Patents Nos. 5,830,721 and 5,837,458
which are herein incorporated by reference herein in their entirety for any
purpose.
[047] In certain embodiments, the described sequences can be used
for engineering of constitutively "on" variants for use in cell assays and
genetically engineered animals using the methods and applications described
in U.S. Patent Applications Ser Nos. 60/110,906, 60/106,300, 60/094,879,
and 60/121,851 all of which are incorporated by reference herein in their
entirety for any purpose:
[048] In certain embodiments, mutations to the NGPCR coding
sequence can be made to generate NGPCRs that are better suited for
expression, scale up, etc. in the host cells chosen. For example, in certain
embodiments, cysteine residues can be deleted or substituted with another
amino acid in order to eliminate disulfide bridges; in certain embodiments, N-
linked glycosylation sites can be altered or eliminated to achieve, for
example,
expression of a homogeneous product that is more easily recovered and
purified from yeast hosts which are known to hyperglycosylate N-linked sites.
To this end, a variety of amino acid substitutions at one or both of the first
or
third amino acid positions of any one or more of the glycosylation recognition
sequences which occur in the ECD (N-X-S or N-X-T), and/or an amino acid
23
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
deletion at the second position of any one or more such recognition
sequences in the ECD will prevent glycosylation of the NGPCR at the
modified tripeptide sequence. (See, e.g., Miyajima et al., 1986, EMBO J.
5(6):1193-1197).
[049] Peptides corresponding to one or more domains of the NGPCR
(e.g., ECD, TM, CD, etc.), truncated or deleted NGPCRs (e.g., NGPCR in
which a ECD, TM and/or CD is deleted) as well as fusion proteins in which a
full length NGPCR, a NGPCR peptide, or truncated NGPCR is fused to an
unrelated protein, are also within the scope of the invention and can be
designed on the basis of the presently disclosed NGPCR nucleotide and
NGPCR amino acid sequences. Such fusion proteins include, but are not
limited to, IgFc fusions which stabilize the NGPCR protein or peptide and
prolong half-life in vivo; or fusions to any amino acid sequence that allows
the
fusion protein to be anchored to the cell membrane, allowing an ECD to be
exhibited on the cell surface; or fusions to an enzyme, fluorescent protein,
or
Luminescent protein which provide a marker function.
[050] While the NGPCR polypeptides and peptides can be chemically
synthesized (e.g., see Creighton, 1983, Proteins: Structures and Molecular
Principles, W.H. Freeman & Co., N.Y.), in certain embodiments, large
polypeptides derived from a NGPCR and full length NGPCRs can be
advantageously produced by recombinant DNA technology using techniques
-well-known' in the art for expressing nucleic acid sequences containing
NGPCR gene sequences and/or coding sequences. In certain embodiments,
such methods can be used to construct expression vectors containing a
24
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
presently described NGPCR nucleotide sequence and appropriate
transcriptional and translational control signals. These methods include, for
example, in vitro recombinant DNA techniques, synthetic techniques, and in
vivo genetic recombination. See, for example, the techniques described in
Sambrook et al., 1989, supra, and Ausubel et al., 1989, supra. In certain
embodiments, RNA corresponding to all or a portion of a transcript encoded
by a NGPCR nucleotide sequence may be chemically synthesized using, for
example, synthesizers. See, for example, the techniques described in
"Oligonucleotide Synthesis", 1984, Gait, M.J. ed., IRL Press, Oxford, which is
incorporated by reference herein in its entirety.
(051] According to various embodiments, a variety of host-expression
vector systems may be utilized to express the NGPCR nucleotide sequences
of the invention. In certain embodiments, where the NGPCR peptide or
polypeptide is a soluble derivative (e.g., NGPCR peptides corresponding to an
ECD; truncated or deleted NGPCR in which a TM and/or CD are deleted), the
peptide or polypeptide can be recovered from the culture, i.e., from the host
cell in cases where the NGPCR peptide or polypeptide is not secreted, and
from the culture media in cases where the NGPCR peptide or polypeptide is
secreted by the cells. However, such expression systems also encompass
engineered host cells that express a NGPCR, or functional equivalent, in situ,
i.e., anchored in the cell membrane. In certain embodiments, purification or
enrichment of NGPCR from such expression systems can be accomplished
using appropriate detergents and lipid micelles and methods well known to
those skilled in the art. However, in certain embodiments, such engineered
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
host cells themselves may be used in situations where it is important not only
to retain the structural and functional characteristics of the NGPCR, but to
assess biological activity, e.g., in drug screening assays.
(052] In certain embodiments, the expression systems that may be
used for purposes of the invention include but are not limited to
microorganisms such as bacteria (e.g., E. coli, 8. subtilis) transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing NGPCR nucleotide sequences; yeast (e.g.,
Saccharomyces, Pichia) transformed with recombinant yeast expression
vectors containing NGPCR nucleotide sequences; insect cell systems infected
with recombinant virus expression vectors (e.g., baculovirus) containing
NGPCR sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic
virus, TMV) or transformed with recombinant plasmid expression vectors
(e.g., Ti plasmid) containing NGPCR nucleotide sequences; or mammalian
cell systems (e.g., COS, CHO, BHK, 293, 3T3) harboring recombinant
expression constructs containing promoters derived from the genome of
mammalian cells (e.g., metallothionein promoter) or from mammalian viruses
(e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter).
[053] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the NGPCR
wgene-product being-expresse-d.- For example, when a large quantity of such a
protein is to be produced, for the generation of pharmaceutical compositions
of NGPCR protein or for raising antibodies to a NGPCR protein, for example,
26
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
vectors that direct the expression of high levels of fusion protein products
that
are readily purified may be desirable. Such vectors include, but are not
limited, to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J.
2:1791 ), in which a NGPCR coding sequence may be ligated individually into
the vector in frame with the IacZ coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye; 1985, Nucleic Acids Res. 13:3101-
3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 264:5503-5509); and the
like. pGEX vectors may also be used to express foreign poiypeptides as
fusion proteins with glutathione S-transferase (GST). Typically, such fusion
proteins are soluble and can easily be purified from lysed cells by adsorption
to glutathione-agarose beads followed by elution in the presence of free gluta-
thione. The PGEX vectors are designed to include thrombin or factor Xa
protease cleavage sites so that the cloned target gene product can be
released from the GST moiety.
[054] In an insect system, Autographs californica nuclear polyhidrosis
virus (AcNPV) can be used as a vector to express foreign genes. The virus
grows in Spodoptera frugiperda cells. A NGPCR gene coding sequence may
be cloned individually into non-essential regions (for example the polyhedrin
gene) of the virus and placed under control of an AcNPV promoter (for
example the polyhedrin promoter). Successful insertion of NGPCR gene
coding sequence will result in inactivation of the polyhedrin gene and
production of non=occluded-recombinant virus (i.e.;-virus lacking the--
proteinaceous coat coded for by the polyhedrin gene). These recombinant
viruses are then used to infect Spodoptera frugiperda cells in which the
27
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
inserted gene is expressed (e.g., see Smith et al., 1983, J. Virol. 46: 584;
Smith, U.S. Patent No. 4,215,051 ).
[055] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the NGPCR nucleotide sequence of interest may be ligated
to an adenovirus transcription/translation control complex, e.g., the late
promoter and tripartite leader sequence. This chimeric gene may then be
inserted in the adenovirus genome by in vitro or in vivo recombination.
Insertion in a non-essential region of the viral genome (e.g., region E1 or
E3)
will result in a recombinant virus that is viable and capable of expressing a
NGPCR gene product in infected hosts (e.g., See Logan & Shenk, 1984,
Proc. Natl. Acad. Sci. USA 81:3655-3659). Specific initiation signals may also
be used for efficient translation of inserted NGPCR nucleotide sequences.
These signals include the ATG initiation codon and adjacent sequences. In
cases where an entire NGPCR gene or cDNA, including its own initiation
codon and adjacent sequences, is inserted into the appropriate expression
vector, one may not employ additional translational control signals. However,
in cases where only a portion of a NGPCR coding sequence is inserted, in
certain embodiments, exogenous translational control signals, including, e.g.,
the ATG initiation codon, may be provided. Furthermore, the initiation codon
typically is in phase with the reading frame of the desired coding sequence to
-ensure translation of-the- entire insert. These exogenous translational
control
signals and initiation codons can be of a variety of origins, both natural and
synthetic. The efficiency of expression may be enhanced by the inclusion of
28
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
appropriate transcription enhancer elements, transcription terminators, etc.
(See Bitter et al., 1987, Methods in Enzymol. 153:516-544).
[056] In addition, a host cell strain may be chosen that modulates the
expression of the inserted sequences, or modifies and processes the gene
product in the specific fashion desired. Such modifications (e.g.,
glycosylation) and processing (e.g., cleavage) of protein products may be
important for the function of the protein. Different host cells have charac-
teristic and specific mechanisms for the post-translational processing and
modification of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and processing of
the foreign protein expressed. To this end, eukaryotic host cells which
possess the cellular machinery for proper processing of the primary
transcript,
glycosylation, and phosphorylation of the gene product may be used. Such
mammalian host cells include, but are not limited to, CHO, VERO, BHIC,
HeLa, COS, MDCK, 293, 3T3, and W138 cell lines.
[057] For long-term, high-yield production of recombinant proteins,
one can use stable expression. For example, cell lines which stably express
the NGPCR sequences described above may be engineered. In certain
embodiments, rather than using expression vectors that contain viral origins
of
replication, host cells can be transformed with DNA controlled by appropriate
expression control elements (e.g., promoter, enhancer sequences,
transcription terminators,-polyadenylation sites, etc.),-and a selectable
marker.
Following the introduction of the foreign DNA, engineered cells may be
allowed to grow for 1-2 days in an enriched media, and then are switched to a
29
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
selective media. The selectable marker in the recombinant plasmid confers
resistance to the selection and allows cells to stably integrate the plasmid
into
their chromosomes and grow to form foci which in turn can be cloned and
expanded into cell lines. This method may advantageously be used to
engineer cell lines which express the NGPCR gene product. Such
engineered cell lines may be particularly useful in screening and evaluation
of
compounds that affect the endogenous activity of the NGPCR gene product.
[058] A number of selection systems can be used, including, but not
limited to, the herpes simplex virus thymidine kinase (Wigler, et al., 1977,
Cell
7 7:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska &
Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine
phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817) genes can be
employed in tk-, hgprt- or aprt' cells, respectively. Also, in certain
embodiments, antimetabolite resistance can be used as the basis of selection
for the following genes: dhfr, which confers resistance to methotrexate
(Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981,
Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic
acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which
confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al.,
1981, J. Mol. Biol. 750:1); and hygro, which confers resistance to hygromycin
(Santerre, et al., 1984, Gene 30:147).
[059] In certain-embodiments, a fusion protein can be readily purified
by utilizing an antibody specific for the fusion protein being expressed. For
example, a system described by Janknecht et al. allows for the ready
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
purification of non-denatured fusion proteins expressed in human cell lines
(Janknecht, et al., 1991, Proc. Natl. Acad. Sci. USA 88: 8972-8976). In this
system, the gene of interest is subcloned into a vaccinia recombination
plasmid such that the gene's open reading frame is translationally fused to an
amino-terminal tag having six histidine residues. Extracts from cells infected
with recombinant vaccinia virus are loaded onto Ni2+~nitriloacetic acid-
agarose
columns and histidine-tagged proteins are selectively eluted with imidazole-
containing buffers.
[060] In certain embodiments, NGPCR gene products can also be
expressed in transgenic animals. Animals of any species, including, but not
limited to, worms, mice, rats, rabbits, guinea pigs, rodents, pigs, micro-
pigs,
birds, goats, farm animals, and non-human primates, e.g., baboons, monkeys,
and chimpanzees may be used in various embodiments to generate NGPCR
transgenic animals.
[061] Any technique known in the art may be used to introduce a
NGPCR transgene. into animals to produce the founder lines of transgenic
animals. Such techniques include, but are not limited to pronuclear
microinjection (Hoppe, P.C. and Wagner, T.E., 1989, U.S. Pat. No.
4,873,191); retrovirus mediated gene transfer into germ lines (Van der Putten
et al., 1985, Proc. Natl. Acad. Sci., USA 82:6148-6152); gene targeting in
embryonic stem cells (Thompson et al., 1989, Cell 56:313-321 );
-electroporatio~-of embryos (Lo, 1983,-Mol Cell. Biol. 3:1803-1814); and
sperm-mediated gene transfer (Lavitrano et al., 1989, Cell 57:717-723); etc.
For a review of such techniques, see Cordon, 1989, Transgenic Animals, Intl.
31
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
Rev. Cytol. 775:171-229, which is incorporated by reference herein in its
entirety.
(062] The present invention provides for transgenic animals that carry
the NGPCR transgene in all their cells, as well as animals which carry the
transgene in some, but not all their cells, i.e., mosaic animals or somatic
cell
transgenic animals. The transgene may be integrated as a single transgene
or in concatamers, e.g., head-to-head tandems or head-to-tail tandems. The
transgene may also be selectively introduced into and activated in a
particular
cell type by following, for example, the teaching of Lasko et al., 1992, Proc.
Natl. Acad. Sci. USA 89:6232-6236. The regulatory sequences required for
such a cell-type specific activation will depend upon the particular cell type
of
interest, and will be apparent to those of skill in the art.
[063] When it is desired that a NGPCR transgene be integrated into
the chromosomal site of the endogenous NGPCR gene, in certain
embodiments, gene targeting may be used. Briefly, in certain embodiments,
when such a technique is to be utilized, vectors containing some nucleotide
sequences homologous to the endogenous NGPCR gene are designed for
the purpose of integrating, via homologous recombination with chromosomal
sequences, into and disrupting the function of the nucleotide sequence of the
endogenous NGPCR gene (i.e., "knockout" animals).
[064] In certain embodiments, the transgene can also be selectively
introduced into a particula-r-cell type;~thus inactivating the endogenous
NGPCR gene in only that cell type, by following, for example, the teaching of
Gu et al., 1994, Science, 265:103-106. The regulatory sequences for such a
32
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
cell-type specific inactivation typically will depend upon the particular cell
type
of interest, and will be apparent to those of skill in the art.
[065] Once transgenic animals have been generated, the expression
of the recombinant NGPCR gene may be assayed utilizing standard
techniques. Initial screening may be accomplished by Southern blot analysis
or PCR techniques to analyze animal tissues to assay whether integration of
the transgene has taken place. The level of mRNA expression of the
transgene in the tissues of the transgenic animals may also be assessed
using techniques which include but are not limited to Northern blot analysis
of
tissue samples obtained from the animal, in situ hybridization analysis, and
RT-PCR. Samples of NGPCR gene-expressing tissue, may also be
evaluated immunocytochemically using antibodies specific for the NGPCR
transgene product.
ANTIBODIES TO NGPCR PROTEINS
[066] Antibodies that specifically recognize one or more epitopes of a
NGPCR, or epitopes of conserved variants of a NGPCR, or peptide fragments
of a NGPCR are also encompassed by the invention. Such antibodies include
but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs),
humanized or chimeric antibodies, single chain antibodies, Fab fragments,
F(ab')2 fragments, fragments produced by a Fab expression library, anti-
idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the
above.
[067] In certain embodiments, the antibodies of the invention may be
used, for example, in the detection of NGPCR in a biological sample and may,
33
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
therefore, be utilized as part of a diagnostic or prognostic technique whereby
patients may be tested for abnormal amounts of NGPCR. In certain
embodiments, antibodies may be utilized in conjunction with, for example,
compound screening schemes, as described below, for the evaluation of the
effect of test compounds on expression and/or activity of a NGPCR gene
product. In certain embodiments antibodies can be used in conjunction gene
°~therapy to, for example, evaluate the normal andlor engineered NGPCR-
expressing cells prior to their introduction into the patient. In certain
embodiments, antibodies may additionally be used as a method for the
inhibition of abnormal NGPCR activity. In certain embodiments, antibodies
may, therefore, be utilized as part of weight disorder treatment methods.
[068] For the production of antibodies, various host animals may be
immunized by injection with the NGPCR, an NGPCR peptide (e.g., one
corresponding to a functional domain of the receptor, such as an ECD, TM or
CD), truncated NGPCR polypeptides (NGPCR in which one or more domains,
e.g., a TM or CD, has been deleted), functional equivalents of the NGPCR or
mutants of the NGPCR. Such host animals may include but are not limited to
rabbits, mice, and rats, to name but a few. Various adjuvants may be used to
increase the immunological response, depending on the host species,
including but not limited to Freund's (complete and incomplete), mineral gels
such as aluminum hydroxide, surface active substances such as lysolecithin,
pluronic-polyois, polyanions;-peptides', oil emulsions, keyhole limpet
hemocyanin, dinitrophenol, and potentially useful human adjuvants such as
BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Polyclonal
34
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
antibodies are heterogeneous populations of antibody molecules derived from
the sera of the immunized animals.
[069] Monoclonal antibodies, which are homogeneous populations of
antibodies to a particular antigen, may be obtained by any technique which
provides for the production of antibody molecules by continuous cell lines in
culture. These include, but are not limited to, the hybridoma technique of
Kohler and Milstein, (1975, Nature 256:495-497; and U.S. Patent No.
4,376,110), the human B-cell hybridoma technique (Kosbor et al., 1983,
Immunology Today 4:72; Cole ef al., 1983, Proc. Natl. Acad. Sci. USA
80:2026-2030), and the EBV-hybridoma technique (Cole et al., 1985,
Monoclonal Antibodies And Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE,
IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this
invention may be cultivated in vitro or in vivo. Production of high titers of
mAbs in vivo makes this the presently preferred method of production.
[070] In addition, techniques developed for the production of "chimeric
antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci., 81:6851-6855;
Neuberger et al., 1984, Nature, 312:604-608; Takeda et al., 1985, Nature,
314:452-454) by splicing the genes from a mouse antibody molecule of
appropriate antigen specificity together with genes from a human antibody
molecule of appropriate biological activity can be used. A chimeric antibody
is
a molecule in which different portions are derived from different animal
species, such as those having a variable region derived from a murine mAb
and a human immunogiobulin constant region. Such technologies are
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
described in U.S. Patents Nos. 6,075,181 and 5,877,397 and their respective
disclosures which are incorporated by reference herein in their entirety.
[071] In certain embodiments, techniques described for the production
of single chain antibodies (U.S. Patent 4,946,778; Bird, 1988, Science
242:423-426; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883;
and Ward et al., 1989, Nature 347:544-546) can be adapted to produce single
chain antibodies against NGPCR gene products. Single chain antibodies are
formed by linking the heavy and light chain fragments of the Fv region via an
amino acid bridge, resulting in a single chain polypeptide.
[072] Antibody fragments that recognize specific epitopes may be
generated by known techniques. For example, such fragments include but
are not limited to: the F(ab')2 fragments which can be produced by pepsin
digestion of the antibody molecule and the Fab fragments which can be
generated by reducing the disulfide bridges of the F(ab')2 fragments.
Alternatively, Fab expression libraries may be constructed (Huse et al., 1989,
Science, 246:1275-1281 ) to allow rapid and easy identification of monoclonal
Fab fragments with the desired specificity.
[073] Antibodies to a NGPCR can, in turn, be utilized to generate anti-
idiotype antibodies that "mimic" a given NGPCR, using techniques well known
to those skilled in the art. (See, e.g., Greenspan & Bona, 1993, FASEB J
7(5):437-444; and Nissinoff, 1991, J. Immunol. 747(8):2429-2438). For
-example antibodies-which bind to~a-NGPCR ECD and competitively inhibit the
binding of a ligand of NGPCR can be used to generate anti-idiotypes that
"mimic" a NGPCR ECD and, therefore, bind and neutralize a ligand. Such
36
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be
used
in therapeutic regimens involving the NGPCR signaling pathway.
DIAGNOSIS OF ABNORMALITIES RELATED TO A NGPCR
[074] A variety of methods can be employed for the diagnostic and
prognostic evaluation of disorders related to NGPCR function, and for the
identification of subjects having a predisposition to such disorders.
[075] Such methods can, for example, utilize reagents such as the
NGPCR nucleotide sequences and NGPCR antibodies described herein.
Specifically, such reagents may be used, for example, for: (1 ) the detection
of
the presence of NGPCR gene mutations, or the detection of either over- or
under-expression of NGPCR mRNA relative to a given phenotype; (2) the
detection of either an over- or an under-abundance of NGPCR gene product
relative to a given phenotype; and (3) the detection of perturbations or
abnormalities in the signal transduction pathway mediated by NGPCR.
[076] The methods described herein may be performed, for example,
by utilizing pre-packaged diagnostic kits comprising at least one specific
NGPCR nucleotide sequence or NGPCR antibody reagent described herein,
which may be conveniently used, e.g., in clinical settings, to diagnose
patients
exhibiting body weight disorder abnormalities.
[077] For the detection of NGPCR mutations, any nucleated cell can
be used as a starting source for genomic nucleic acid. For the detection of
NGPCR gene expression or NGPCR gene products, any cell type or tissue in
which the NGPCR gene is expressed, such as, for example, kidney, stomach
or brain cells can be utilized.
37
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
[078] Nucleic acid-based detection techniques and peptide detection
techniques are described below.
DETECTION OF NGPCR GENES AND TRANSCRIPTS
[079] Mutations within a NGPCR gene can be detected by utilizing a
number of techniques. Nucleic acid from any nucleated cell can be used as
the starting point for such assay techniques, and may be isolated according to
standard nucleic acid preparation procedures which are well known to those
of skill in the art.
[080] DNA may be used in hybridization or amplification assays of
biological samples to detect abnormalities involving NGPCR gene structure,
including point mutations, insertions, deletions and chromosomal
rearrangements. Such assays may include, but are not limited to, Southern
analyses, single stranded conformational polymorphism analyses (SSCP),
and PCR analyses.
[081] Such diagnostic methods for the detection of NGPCR gene-
specific mutations can involve for example, contacting and incubating nucleic
acids including recombinant DNA molecules, cloned genes or degenerate
variants thereof, obtained from a sample, e.g., derived from a patient sample
or other appropriate cellular source, with one or more labeled nucleic acid
reagents including recombinant DNA molecules, cloned genes or degenerate
variants thereof, as described herein, under conditions favorable for the
specific annealing of these reagents to their complementary sequences within
a given NGPCR gene. In certain embodiments, the lengths of these nucleic
acid reagents are at least 15 to 30 nucleotides. In certain embodiments, after
38
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
incubation, all non-annealed nucleic acids are removed from the nucleic
acid:NGPCR molecule hybrid. The presence of nucleic acids which have
hybridized, if any such molecules exist, is then detected. Using such a
detection scheme, the nucleic acid from the cell type or tissue of interest
can
be immobilized, for example, to a solid support such as a membrane, or a
plastic surface such as that on a microtiter plate or polystyrene beads. In
this
case, after incubation, non-annealed, labeled nucleic acid reagents of the
type
described herein are easily removed: Detection of the remaining, annealed,
labeled NGPCR nucleic acid reagents is accomplished using standard
techniques well-known to those in the art. The NGPCR gene sequences to
which the nucleic acid reagents have annealed can be compared to the
annealing pattern expected from a normal NGPCR gene sequence in order to
determine whether a NGPCR gene mutation is present.
[082] Alternative diagnostic methods for the detection of NGPCR gene
specific nucleic acid molecules, in patient samples or other appropriate cell
sources, may involve their amplification, e.g., by PCR (the experimental
embodiment set forth in Mullis, I<.B., 1987, U.S. Patent No. 4,683,202),
followed by the detection of the amplified molecules using techniques well
known to those of skill in the art. The resulting amplified sequences can be
compared to those which would be expected if the nucleic acid being
amplified contained only normal copies of a NGPCR gene in order to
determine whether a NGPCR gene mutation exists.
[083] Additionally, well-known genotyping techniques can be
performed to identify individuals carrying NGPGR gene mutations. Such
39
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
techniques include, for example, the use of restriction fragment length
polymorphisms (RFLPs), which involve sequence variations in one of the
recognition sites for the specific restriction enzyme used.
[084] Additionally, improved methods for analyzing DNA
polymorphisms which can be utilized for the identification of NGPCR gene
mutations have been described which capitalize on the presence of variable
numbers of short, tandemly repeated DNA sequences between the restriction
enzyme sites. For example, Weber (U.S. Pat. No. 5,075,217, which is
incorporated herein by reference in its entirety) describes a DNA marker
based on length polymorphisms in blocks of (dC-dA)n-(dG-dT)n short tandem
repeats. The average separation of (dC-dA)n-(dG-dT)n blocks is estimated to
be 30,000-60,000 bp. Markers which are so closely spaced exhibit a high
frequency co-inheritance, and are extremely useful in the identification of
genetic mutations, such as, for example, mutations within a given NGPCR
gene, and the diagnosis of diseases and disorders related to NGPCR
mutations.
[085] Also, Caskey et al. (U.S. Pat. No. 5,364,759, which is
incorporated herein by reference in its entirety) describe a DNA profiling
assay for detecting short tri and tetra nucleotide repeat sequences. The
process includes extracting the DNA of interest, such as the NGPCR gene,
amplifying the extracted DNA, and labeling the repeat sequences to form a
genotypic map of the individual's DNA.
[086] The level of NGPCR gene expression can also be assayed by
detecting and measuring NGPCR transcription. For example, RNA from a cell
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
type or tissue known, or suspected to express the NGPCR gene may be
isolated and tested utilizing hybridization or PCR techniques such as are
described, above. The isolated cells can be derived from cell culture or from
a patient. The analysis of cells taken from culture may be a step in the
assessment of cells to be used as part of a cell-based gene therapy technique
or, alternatively, to test the effect of compounds on the expression of the
NGPCR gene. Such analyses may reveal both quantitative and qualitative
aspects of the expression pattern of the NGPCR gene, including activation or
inactivation of NGPCR gene expression.
[087] In certain embodiments of such a detection scheme, cDNAs are
synthesized from the RNAs of interest (e.g., by reverse transcription of the
RNA molecule into cDNA). A sequence within the cDNA is then used as the
template for a nucleic acid amplification reaction, such as a PCR
amplification
reaction, or the like. The nucleic acid reagents used as synthesis initiation
reagents (e.g., primers) in the reverse transcription and nucleic acid
amplification steps of this method can be chosen from among the NGPCR
nucleic acid reagents described herein. In certain embodiments, the lengths
of such nucleic acid reagents are at least 9-30 nucleotides. For detection of
the amplified product, the nucleic acid amplification may be perFormed using
radioactively or non-radioactively labeled nucleotides. Alternatively, enough
amplified product may be made such that the product may be visualized by
standard ethidium bromide staining, by utilizing any other suitable nucleic
acid
staining method, or by sequencing.
41
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
[088] Additionally, it is possible to perform such NGPCR gene
expression assays "in situ", i.e., directly upon tissue sections (fixed and/or
frozen) of patient tissue obtained from biopsies or resections, such that no
nucleic acid purification is necessary. Nucleic acid reagents such as those
described above may be used as probes and/or primers for such in situ
procedures (See, for example, Nuovo, G.J., 1992, "PCR In Situ Hybridization:
Protocols And Applications", Raven Press, NY).
[089] Alternatively, if a sufficient quantity of the appropriate cells can
be obtained, standard Northern analysis can be performed to determine the
level of NGPCR mRNA expression.
DETECTION OF NGPCR GENE PRODUCTS
[090] Antibodies directed against wild type or mutant NGPCR gene
products or conserved variants or peptide fragments thereof, which are
discussed above, may also be used as diagnostics and prognostics, as
described herein. Such diagnostic methods, may be used to detect
abnormalities in the level of NGPCR gene expression, or abnormalities in the
structure and/or temporal, tissue, cellular, or subcellular location of the
NGPCR, and may be performed in vivo or in vitro, such as, for example, on
biopsy tissue.
[091] For example, in certain embodiments, antibodies directed to
epitopes of the NGPCR ECD can be used in vivo to detect the pattern and
level of expression of the NGPCR in the body. Such antibodies can be
labeled, e.g., with a radio-opaque or other appropriate compound and injected
into a subject in order to visualize binding to the NGPCR expressed in the
42
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
body using methods such as X-rays, CAT-scans, or MRI. Labeled antibody
fragments, e.g., the Fab or single chain antibody comprising the smallest
portion of the antigen binding region, are used for this purpose in certain
embodiments to promote crossing the blood-brain barrier and permit labeling
NGPCRs expressed in the brain.
[092] Additionally, any NGPCR fusion protein or NGPCR conjugated
protein whose presence can be detected, can be administered. For example,
NGPCR fusion~or conjugated proteins labeled with a radio-opaque or other
appropriate compound can be administered and visualized in vivo, as
discussed, above for labeled antibodies. Further such NGPCR fusion
proteins as AP-NGPCR on NGPCR-Ap fusion proteins can be utilized for in
vitro diagnostic procedures.
[093] In certain embodiments, immunoassays or fusion protein
detection assays, as described above, can be utilized on biopsy and autopsy
samples in vitro to permit assessment of the expression pattern of the
NGPCR. Such assays are not confined to the use of antibodies that define a
NGPCR EGD, but can include the use of antibodies directed to epitopes of
any of the domains of a NGPCR, e.g., the ECD, the TM and/or CD. In certain
embodiments, the use of each or all of these labeled antibodies will yield
useful information regarding translation and intracellular transport of the
NGPCR to the cell surface, and can identify defects in processing.
[094]w The tissuewor cell type to be analyzed will typically include those
which are known, or suspected, to express the NGPCR gene. The protein
isolation methods employed herein may, for example, be such as those
43
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
described in Harlow and Lane (Harlow, E. and Lane, D., 1988, "Antibodies: A
Laboratory Manual", Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York), which is incorporated herein by reference in its entirety
for
any purpose. The isolated cells can be derived from cell culture or from a
patient. The analysis of cells taken from culture may be a step in the
assessment of cells that could be used as part of a cell-based gene therapy
technique or, alternatively, to test the effect of compounds on the expression
of a NGPCR gene.
[095] For example, antibodies, or fragments of antibodies, such as
those described herein, useful in the present invention may be used to
quantitatively or qualitatively detect the presence of NGPCR gene products or
conserved variants or peptide fragments thereof. This can be accomplished,
for example, by immunofluorescence techniques employing a fluorescently
labeled antibody (see below, this Section) coupled with light microscopic,
flow
cytometric, or fluorimetric detection. In certain embodiments, such techniques
are used if such NGPCR gene products are expressed on the cell surface.
[096] The antibodies (or fragments thereof) or NGPCR fusion or
conjugated proteins useful in the present invention may, in certain
embodiments, be employed histologically, as in immunofluorescence,
immunoelectron microscopy or non-immuno assays, for in situ detection of
NGPCR gene products or conserved variants or peptide fragments thereof, or
for NGPCR binding (in the case of labeled NGPCR ligand fusion protein).
[097] In situ detection may be accomplished by removing a
histological specimen from a patient, and applying thereto a labeled antibody
44
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
or fusion protein of the present invention. In certain embodiments, the
antibody (or fragment) or fusion protein is applied by overlaying the labeled
antibody (or fragment) onto a biological sample. Through the use of such a
procedure in certain embodiments, it is possible to determine not only the
presence of a NGPCR gene product, or conserved variants or peptide
fragments, or NGPCR binding, but also its distribution in the examined tissue.
Using the present invention, those of ordinary skill will readily perceive
that
any of a wide variety of histological methods (such as staining procedures)
can be modified in order to achieve such in situ detection.
[098] In certain embodiments, immunoassays and non-immunoassays
for NGPCR gene products or conserved variants or peptide fragments thereof
will typically comprise incubating a sample, such as a biological fluid, a
tissue
extract, freshly harvested cells, or lysates of cells which have been
incubated
in cell culture, in the presence of a detectably labeled antibody capable of
identifying NGPCR gene products or conserved variants or peptide fragments
thereof, and detecting the bound antibody by any ofi a number of techniques
well-known in the art.
[099] In certain embodiments, the biological sample may be brought in
contact with and immobilized onto a solid phase support or carrier such as
nitrocellulose, or other solid support which is capable of immobilizing cells,
cell particles or soluble proteins. The support may then be washed with
suitable-buffers followed-by treatment with the detectably labeled NGPCR
antibody or NGPCR ligand fusion protein. The solid phase support may then
be washed with the buffer a second time to remove unbound antibody or
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
fusion protein. The amount of bound label on solid support may then be
detected by conventional means.
[0100] By "solid phase support or carrier" is intended any support
capable of binding an antigen or an antibody. Well-known supports or carriers
include, but are not limited to, glass, polystyrene, polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified celluloses,
polyacrylamides, gabbros, and magnetite. The nature of the carrier can be
either soluble to some extent or insoluble for the purposes of the present
invention. The support material can have virtually any possible structural
configuration so long as the coupled molecule is capable of binding to an
antigen or antibody. Thus, the support configuration may be spherical, as in a
bead, or cylindrical, as in the inside surface of a test tube, or the external
surface of a rod. Alternatively, the surface may be flat such as a sheet, test
strip, etc. Preferred supports include, but are not limited to, polystyrene
beads. Those skilled in the art will know many other suitable carriers for
binding antibody or antigen, or will be able to ascertain the same by use of
routine experimentation.
[0101] The binding activity of a given lot of NGPCR antibody or
NGPCR ligand fusion protein may be determined according to well known
methods. Those skilled in the art will be able to determine operative and
optimal assay conditions for each determination by employing routine
experimentation.
[0102] With respect to antibodies, one of the ways in which the NGPCR
antibody can be detectably labeled is by linking the same to an enzyme and
46
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
use in an enzyme immunoassay (EIA) (Volley, A., "The Enzyme Linked
Immunosorbent Assay (ELISA)", 1978, Diagnostic Horizons 2:1-7,
Microbiological Associates Quarterly Publication, Walkersville, MD); Volley,
A.
et al., 1978, J. Clin. Pathol. 37:507-520; Butler, J.E., 1981, Meth. Enzymol.
73:482-523; Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca
Raton, FL,; Ishikawa, E. etal., (eds.), 1981, Enzyme Immunoassay, Kgaku
Shoin, Tokyo). The enzyme that is bound to the antibody will react with an
appropriate substrate, prefierably a chromogenic substrate, in such a manner
as to produce a chemical moiety which can be detected, for example, by
spectrophotometric, fluorimetric or by visual means. Enzymes which can be
used to detectably label the antibody include, but are not limited to, malate
dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast
alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose
phosphate isomerase, horseradish peroxidase, alkaline phosphatase,
asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease,
catalase, glucose-6-phosphate dehydrogenase, glucoamylase and
acetylcholinesterase. The detection can be accomplished by colorimetric
methods which employ a chromogenic substrate for the enzyme. Detection
may also be accomplished by visual comparison of the extent of enzymatic
reaction of a substrate in comparison with similarly prepared standards.
[0103] Detection may also be accomplished using any of a variety of
other immunoassays. For example, in certain embodiments, byradioactively
labeling the antibodies or antibody fragments, it is possible to detect NGPCR
through the use of a radioimmunoassay (RIA) (see, for example, Weintraub,
47
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
B., Principles of Radioimmunoassays, Seventh Training Course on
Radioligand Assay Techniques, The Endocrine Society, March, 1986, which is
incorporated by reference herein). The radioactive isotope can be detected
by such means as the use of a gamma counter or a scintillation counter or by
autoradiography.
[0104] It is also possible to label the antibody with a fluorescent
compound. When the fluorescently labeled antibody is exposed to light of the
proper wave length, its presence can then be detected due to fluorescence.
Among commonly used fluorescent labeling compounds are fluorescein
isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-
phthaldehyde and fluorescamine.
[0105] In certain embodiments, the antibody can also be detestably
labeled using fluorescence emitting metals such as ~52Eu, or others of the
lanthanide series. These metals can be attached to the antibody using such
metal chelating groups as diethylenetriaminepentacetic acid (DTPA) or
ethylenediaminetetraacetic acid (EDTA).
[0106] In certain embodiments, the antibody can be detestably labeled
by coupling it to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by detecting the
presence of luminescence that arises during the course of a chemical
reaction. Examples of particularly useful chemiluminescent labeling
compounds-are luminol, isoluminol, theromatic acridinium ester, imidazole,
acridinium salt and oxalate ester.
48
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
[0107] In certain embodiments, a bioluminescent compound may be
used to label the antibody of the present invention. Bioluminescence is a type
of chemiluminescence found in biological systems in which a catalytic protein
increases the efficiency of the chemiluminescent reaction. The presence of a
bioluminescent protein is determined by detecting the presence of
luminescence. Bioluminescent compounds for purposes of labeling according
to certain embodiments are luciferin, luciferase and aequorin.
SCREENING ASSAYS FOR COMPOUNDS THAT MODULATE NGPCR
EXPRESSION OR ACTIVITY
[0108] The following assays are designed to identify compounds that
interact with (e.g., bind to) NGPCRs (including, but not limited to an ECD or
CD of a NGPCR), compounds that interact with (e.g., bind to) intracellular
proteins that interact with NGPCR (including but not limited to the TM and CD
of NGPCR), compounds that interfere with the interaction of NGPCR with
transmembrane or intracellular proteins involved in NGPCR-mediated signal
transduction, and to compounds which modulate the activity of NGPCR gene
(i.e., modulate the level of NGPCR gene expression) or modulate the level of
NGPCR. In certain embodiments, assays may be utilized which identify
compounds which bind to NGPCR gene regulatory sequences (e.g., promoter
sequences) and which may modulate NGPCR gene expression. See e.g.,
Platt, K.A., 1994, J. Biol. Chem. 269:28558-28562, which is incorporated
herein-by-reference in its.entirety.
[0109] The compounds that can be screened in accordance with
certain embodiments of the invention include, but are not limited to,
peptides,
49
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
antibodies and fragments thereof, and other organic compounds (e.g.,
peptidomimetics) that bind to an ECD of a NGPCR and either mimic the
activity triggered by the natural ligand (i.e., agonists) or inhibit the
activity
triggered by the natural ligand (i.e., antagonists); as well as peptides,
antibodies or fragments thereof, and other organic compounds that mimic the
ECD of the NGPCR (or a portion thereof) and bind to and "neutralize" the
natural ligand.
[0110] Such compounds may include, but are not limited to, peptides
such as, for example, soluble peptides, including but not limited to members
of random peptide libraries; (see, e.g., Lam, K.S. et al., 1991, Nature 354:82-
84; Houghten, R. et al., 1991, Nature 354:84-86), and combinatorial
chemistry-derived molecular library made of D- and/or L- configuration amino
acids, phosphopeptides (including, but not limited to members of random or
partially degenerate, directed phosphopeptide libraries; see, e.g., Songyang,
Z. et al., 1993, Cell 72:767-778), antibodies (including, but not limited to,
polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain
antibodies, and FAb, F(ab')2 and FAb expression library fragments, and
epitope-binding fragments thereof), and small organic or inorganic molecules.
[0111] Other compounds which can be screened in accordance with
certain embodiments of the invention include but are not limited to small
organic molecules that are able to cross the blood-brain barrier, gain entry
into an appropriate cell (e.g., in the cerebellum, the-hypothalamus, etc.) and
affect the expression of a NGPCR gene or some other gene involved in the
NGPCR signal transduction pathway (e.g., by interacting with the regulatory
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
region or transcription factors involved in gene expression); or such
compounds that affect the activity of the NGPCR (e.g., by inhibiting or
enhancing the enzymatic activity of a CD) or the activity of some other
intracellular factor involved in the NGPCR signal transduction pathway.
[0112] Computer modeling and searching technologies permit
identification of compounds, or the improvement of already identified
compounds, that can modulate NGPCR expression or activity. Having
identified such a compound or composition, the active sites or regions are
identified. Such active sites might typically be ligand binding sites. The
active
site can be identified using methods known in the art including, for example,
from the amino acid sequences of peptides, from the nucleotide sequences of
nucleic acids, or from study of complexes of the relevant compound or
composition with its natural ligand. In the latter case, chemical or X-ray
crystallographic methods can be used to find the active site by finding where
on the factor the complexed ligand is found.
[0113] Next, the three dimensional geometric structure of the active site
is determined. This can be done by known methods, including X-ray
crystallography, which can determine a complete molecular structure. On the
other hand, solid or liquid phase NMR can be used to determine certain intra-
molecular distances. Any other experimental method of structure
determination can be used to obtain partial or complete geometric structures.
The geometric structures may be measured with a complexed ligand, natural
or artificial, which may increase the accuracy of the active site structure
determined.
51
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
[0114] If an incomplete or insufficiently accurate structure is
determined, the methods of computer based numerical modeling can be used
to complete the structure or improve its accuracy. Any recognized modeling
method may be used, including parameterized models specific to particular
biopolymers such as proteins or nucleic acids, molecular dynamics models
based on computing molecular motions, statistical mechanics models based
on thermal ensembles, or combined models. For most types of models,
standard molecular force fields, representing the forces between constituent
atoms and groups, are necessary, and can be selected from force fields
known in physical chemistry. The incomplete or less accurate experimental
structures can serve as constraints on the complete and more accurate
structures computed by these modeling methods.
[0115] Finally, having determined the structure of the active site, either
experimentally, by modeling, or by a combination, candidate modulating
compounds can be identified by searching databases containing compounds
along with information on their molecular structure. Such a search seeks
compounds having structures that match the determined active site structure
and that interact with the groups defining the active site. Such a search can
be manual, but is preferably computer assisted. These compounds found
from this search are potential NGPCR modulating compounds.
[0116] Alternatively, these methods can be used to identify improved
--modulating-compounds from an already-known modulating compound or
ligand. The composition of the known compound can be modified and the
structural effects of modification can be determined using the experimental
52
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
and computer modeling methods described above applied to the new
composition. The altered structure is then compared to the active site
structure of the compound to determine if an improved fit or interaction
results. In this manner systematic variations in composition, such as by
varying side groups, can be quickly evaluated to obtain modified modulating
compounds or ligands of improved specificity or activity.
[0117] Further experimental and computer modeling methods useful to
identify modulating compounds based upon identification of the active sites of
a NGPCR, and related transduction and transcription factors will be apparent
to those of skill in the art.
[0118] Examples of molecular modeling systems are the CHARMm and
QUANTA programs (Polygen Corporation, Waltham, MA). CHARMm
performs the energy minimization and molecular dynamics functions.
QUANTA performs the construction, graphic modeling and analysis of
molecular structure. QUANTA allows interactive construction, modification,
visualization, and analysis of the behavior of molecules with each other.
[0119] A number of articles review computer modeling of drugs
interactive with specific proteins, such as Rotivinen, et al., 1988, Acta
Pharmaceutical Fennica 97:159-166; Ripka, New Scientist 54-57 (June 16,
1988); Mci<inaly and Rossmann, 1989, Annu. Rev. Pharmacol. Toxiciol.
29:111-122; Perry and Davies, OSAR: Quantitative Structure-Activity
Relationships in~Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis
and Dean, 1989 Proc. R. Soc. Lond. 236:125-140 and 141-162; and, with
respect to a model receptor for nucleic acid components, Askew, et al., 1989,
53
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
J. Am. Chem. Soc. 111:1082-1090. Other computer programs that screen
and graphically depict chemicals are available from companies such as
BioDesign, Inc. (Pasadena, CA.), Allelix, Inc. (Mississauga, Ontario, Canada),
and Hypercube, Inc. (Cambridge, Ontario). Although these are primarily
designed for application to drugs specific to particular proteins, they can be
adapted to design of drugs specific to regions of DNA or RNA, once that
region is identified.
[0120] Although described above with reference to design and
generation of compounds which could alter binding, one could also screen
libraries of known compounds, including natural products or synthetic
chemicals, and biologically active materials, including proteins, for
compounds
which are inhibitors or activators.
[0121] Cell-based systems can also be used to identify compounds that
bind NGPCRs as well as assess the altered activity associated with such
binding in living cells. Assays for agonists and antagonists of NGPCRS that
can be used in cell-based systems according to certain embodiments include,
but are not limited to, those de-scribed in U.S. Patent Serial No. 6,004,808,
and PCT Application Number US99/17425, which are herein incorporated by
reference in their entirety for any purpose.
[0122] One tool of particular interest for such assays is green
fluorescent protein which is described, inter alia, in U.S. Patent.No.
5,625,048,
--herein incorporated by reference:- Cells that may be-used in such cellular
assays include, but are not limited to, leukocytes, or cell lines derived from
leukocytes, lymphocytes, stem cells, including embryonic stem cells, and the
54
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
like. In addition, expression host cells (e.g., B95 cells, COS cells, CHO
cells,
OMK cells, fibroblasts, Sf9 cells) genetically engineered to express a
functional NGPCR of interest and to respond to activation by the test, or
natural, ligand, as measured by a chemical or phenotypic change, or induction
of another host cell gene, can be used as an end point in the assay.
[0123] Compounds identified via assays such as those described
herein may be useful, for example, in elaborating certain biological functions
of a NGPCR gene product. Such compounds can be administered to a
patient at therapeutically effective doses to treat any of a variety of
physiological or mental disorders. A therapeutically effective dose refers to
that amount of the compound sufficient to result in any amelioration,
impediment, prevention, or alteration of any biological or overt symptom.
[0124] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures or
experimental animals, e.g., for determining the LD50 (the dose lethal to 50%
of the population) and the ED50 (the dose therapeutically effective in 50% of
the population). The dose ratio between toxic and therapeutic effects is the
therapeutic index and it can be expressed as the ratio LD50/ED50.
Compounds which exhibit large therapeutic indices are preferred. While
compounds that exhibit toxic side effects may be used, typically care should
be taken to design a delivery system that targets such compounds to the site
of affected tissue-in order-to~ minimize potential damage to uninfected cells
and, thereby, reduce side effects.
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
[0125] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in humans. The
dosage of such compounds lies preferably within a range of circulating
concentrations that include the ED50 with little or no toxicity. The dosage
may vary within this range depending upon the dosage form employed and
the route of administration utilized. For any compound used in the method of
the invention, the therapeutically effective dose can be estimated initially
from
cell culture assays. A dose may be formulated in animal models to achieve a
circulating plasma concentration range that includes the IC50 (i.e., the
concentration of the test compound which achieves a half maximal inhibition
of symptoms) as determined in cell culture. Such information can be used to
more accurately determine useful doses in humans. Levels in plasma may be
measured, for example;~byhigh performance liquid chromatography.
[0126] Pharmaceutical compositions for use in accordance with the
present invention may be formulated in conventional manner using one or
more physiologically acceptable carriers or excipients. Thus, the compounds
and their physiologically acceptable salts and solvates may be formulated for
administration by inhalation or insufflation (either through the mouth or the
nose) or oral, buccal, parenteral, intracranial, intrathecal, or rectal
administration.
[0127] For oral administration, the pharmaceutical compositions may
-take-the-form of; for-example; tablets or capsules prepared by conventional
means with pharmaceutically acceptable excipients such as binding agents
(e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl
56
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or
calcium
hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycolate); or wetting
agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods
well known in the art. Liquid preparations for oral administration may take
the
form of, for example, solutions, syrups or suspensions, or they may be
presented as a dry product for constitution with water or other suitable
vehicle
before use. Such liquid preparations may be prepared by conventional
means with pharmaceutically acceptable additives such as suspending agents
(e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats);
emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g.,
almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and
preservatives (e.g.,wmethyfor propyl-p-hydroxybenzoates or sorbic acid). The
preparations may also contain buffer salts, flavoring, coloring and sweetening
agents as appropriate.
[0128] Preparations for oral administration may be suitably formulated
to give controlled release of the active compound.
[0129] For buccal administration the compositions may take the form of
tablets or lozenges formulated in conventional manner.
[0130] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in the form of
an
aerosol spray presentation from pressurizedwpacks-or-a nebulizer, with the
use of a suitable propellant, e.g., dichlorodifluoromethane,
trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other
57
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
suitable gas. In the case of a pressurized aerosol the dosage unit may be
determined by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insufflator may be
formulated
containing a powder mix of the compound and a suitable powder base such
as lactose or starch.
[0131] The compounds may be formulated for parenteral administration
by injection, e.g., by bolus injection or continuous infusion. Formulations
for
injection may be presented in unit dosage form, e.g., in ampoules or in multi-
dose containers, with an added preservative. The compositions may take
such forms as suspensions, solutions or emulsions in oily or aqueous
vehicles, and may contain formulatory agents such as suspending, stabilizing
and/or dispersing agents. Alternatively, the active ingredient may be in
powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-
free
water, before use.
[0132] The compounds may also be formulated in rectal compositions
such as suppositories or retention enemas, e.g., containing conventional
suppository bases such as cocoa butter or other glycerides.
(0133] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long acting
formulations may be administered by implantation (for example
subcutaneously or intramuscularly) or by intramuscular injection. Thus, for
-example; the compounds maybe formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion'in an acceptable oil) or ion
58
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
exchange resins, or as sparingly soluble derivatives, for example, as a
sparingly soluble salt.
[0134] The compositions may, if desired, be presented in a pack or
dispenser device which may contain one or more unit dosage forms
containing the active ingredient. The pack may for example comprise metal
or plastic foil, such as a blister pack. The pack or dispenser device may be
accompanied by instructions for administration.
IN VITRO SCREENING ASSAYS FOR COMPOUNDS THAT BIND TO
NGPCRs
[0135] In vitro systems may be designed to identify compounds
capable of interacting with (e.g., binding to) NGPCR (including, but not
limited
to, a ECD or CD of NGPCR). Compounds identified may be useful, for
example, in modulating the activity of wild type and/or mutant NGPCR gene
products; may be useful in elaborating certain biological functions of the
NGPCR; may be utilized in screens for identifying compounds that disrupt
normal NGPCR interactions; or may in themselves disrupt such interactions.
[0136] The principle of the assays used to identify compounds that bind
to the NGPCR involves preparing a reaction mixture of the NGPCR and the
test compound under conditions and for a time sufficient to allow the two
components to interact and bind, thus forming a complex which can be
removed and/or detected in the reaction mixture. The NGPCR species used
can vary depending upon the goal of the screening assay. For example, in
certain embodiments, where agonists of the natural ligand are sought, the full
length NGPCR, or a soluble truncated NGPCR, e.g., in which the TM and/or
CD is deleted from the molecule, a peptide corresponding to a ECD or a
59
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
fusion protein containing one or more NGPCR ECD fused to a protein or
polypeptide that affords advantages in the assay system (e.g., labeling,
isolation of the resulting complex, etc.) can be utilized. Where compounds
that interact with the cytoplasmic domain are sought to be identified,
peptides
corresponding to the NGPCR CD and fusion proteins containing the NGPCR
CD can be used.
[0137] The screening assays can be conducted in a variety of ways.
For example, one method to conduct such an assay would involve anchoring
the NGPCR protein, polypeptide, peptide or fusion protein or the test
substance onto a solid phase and detecting NGPCR/test compound
complexes anchored on the solid phase at the end of the reaction. In certain
embodiments of such a method, the NGPCR reactant may be anchored onto
a solid surface, and the test compound, which is not anchored, may be
labeled, either directly or indirectly.
[0138] In practice, in certain embodiments, microtiter plates may
conveniently be utilized as the solid phase. The anchored component may be
immobilized by non-covalent or covalent attachments. Non-covalent
attachment may be accomplished by simply coating the solid surface with a
solution of the protein and drying. In certain embodiments, an immobilized
antibody, e.g., a monoclonal antibody, specific for the protein to be
immobilized may be used to anchor the protein to the solid surface. The
surfaces may be-prepared in advance and-stored.
[0139] In order to conduct the assay, the nonimmobilized component is
added to the coated surface containing the anchored component. In certain
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
embodiments, after the reaction is complete, unreacted components are
removed (e.g., by washing) under conditions such that any complexes formed
will remain immobilized on the solid surface. In various embodiments, the
detection of complexes anchored on the solid surface can be accomplished in
a number of ways. Where the previously nonimmobilized component is pre-
labeled, the detection of label immobilized on the surface indicates that
complexes were formed. Where the previously nonimmobilized component is
not pre-labeled, in certain embodiments, an indirect label can be used to
detect complexes anchored on the surface; e.g., using a labeled antibody
specific for the previously nonimmobilized component (the antibody, in turn,
may be directly labeled or indirectly labeled with a labeled anti-Ig
antibody).
[0140] In certain embodiments, a reaction can be conducted in a liquid
phase, the reaction products separated from unreacted components, and
complexes detected; e.g., using an immobilized antibody specific for a
NGPCR protein, polypeptide, peptide or fusion protein or the test compound
to anchor any complexes formed in solution, and a labeled antibody specific
for the other component of the possible complex to detect anchored
complexes.
[0141] In certain embodiments, cell-based assays can be used.to
identify compounds that interact with NGPCR. To this end, cell lines that
express NGPCR, or cell lines (e.g., COS cells, CHO cells, fibroblasts, etc.)
that have been genetically engineered to express a NGPCR (e.g., by
transfection or transduction of NGPCR DNA) can be used. Interaction of the
61
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
test compound with, for example, a ECD of a NGPCR expressed by the host
cell can be determined by comparison or competition with native ligand.
5.5.2. ASSAYS FOR INTRACELLULAR PROTEINS THAT INTERACT WITH
NGPCRs
[0142] Any method suitable for detecting protein-protein interactions
may be employed for identifying transmembrane proteins or intracellular
proteins that interact with a NGPCR. Among the methods which may be
employed are co-immunoprecipitation, crosslinking and co-purification through
gradients or chromatographic columns of cell lysates or proteins obtained
from cell lysates and a, NGPCR to identify proteins in the lysate that
interact
with the NGPCR. For these assays, the NGPCR component used can be a
full length NGPCR, a soluble derivative lacking the membrane-anchoring
region (e.g., a truncated NGPCR in which a TM is deleted resulting in a
truncated molecule containing a ECD fused to a CD), a peptide corresponding
to a CD or a fusion protein containing a CD of a NGPCR. Once isolated, such
an~intracellular protein can be identified and can, in turn, be used, in
conjunction with standard techniques, to identify proteins with which it
interacts. For example, at least a portion of the amino acid sequence of an
intracellular protein which interacts with a NGPCR can be ascertained using
techniques well known to those of skill in the art, such as via the Edman
degradation technique. (See, e.g., Creighton, 1933, "Proteins: Structures
and Molecular Principles", W.H. Freeman & Co., N.Y., pp.34-49). The amino
acid sequence obtained may be used as a guide for the generation of
oligonucleotide mixtures that can be used to screen for gene sequences
62
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
encoding such intracellular proteins. Screening can be accomplished, for
example, by standard hybridization or PCR techniques. Techniques for the
generation of oligonucleotide mixtures and the screening are well-known.
(See, e.g., Ausubel, supra, and PCR Protocols: A Guide to Methods and
Applications, 1990, Innis, M. et al., eds. Academic Press, Inc., New York).
[0143] Additionally, methods may be employed which result in the
simultaneous identification of genes which encode the transmembrane or
intracellular proteins interacting with NGPCR. These methods include, for
example, probing expression, libraries, in a manner similar to the well known
technique of antibody probing of ~gt11 libraries, using labeled NGPCR
protein, or an NGPCR polypeptide, peptide or fusion protein, e.g., an NGPCR
polypeptide or NGPCR domain fused to a marker (e.g., an enzyme, fluor,
luminescent protein, or dye'), or an lg-Fc domain.
[0144] One method that detects protein interactions in vivo, the two-
hybrid system, is described in detail for illustration only and not by way of
limitation. One version of this system has been described (Chien et al., 1991,
Proc. Natl. Acad. Sci. USA, 88:9578-9582) and is commercially available from
Clontech (Palo Alto, CA).
[0145] Briefly, utilizing such a system, plasmids are constructed that
encode two hybrid proteins: one plasmid has nucleotides encoding the DNA-
binding domain of a transcription activator protein fused to a NGPCR
nucleotide sequence encoding NGPCR, an NGPCR polypeptide, peptide or
fusion protein, and the other plasmid has nucleotides encoding the
transcription activator protein's activation domain fused to a cDNA encoding
63
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
an unknown protein which has been recombined into this plasmid as part of a
cDNA library. The DNA-binding domain fusion plasmid and the cDNA library
are transformed into a strain of the yeast Saccharomyces cerevisiae that
contains a reporter gene (e.g., HBS or IacZ) whose regulatory region contains
the transcription activator's binding site. Either hybrid protein alone cannot
activate transcription of the reporter gene: the DNA-binding domain hybrid
cannot because it does not provide activation function and the activation
domain hybrid cannot because it cannot localize to the activator's binding
sites. Interaction of the two hybrid proteins reconstitutes the functional
activator protein and results in expression of the reporter gene, which is
detected by an assay for the reporter gene product.
[0146] The two-hybrid system or related methodology may be used to
screen activation domain libraries for proteins that interact with the "bait"
gene
product. By way of example, and not by way of limitation, a NGPCR may be
used as the bait gene product. Total genomic or cDNA sequences are fused
to the DNA encoding an activation domain. This library and a plasmid
encoding a hybrid of a bait NGPCR gene product fused to the DNA-binding
domain are cotransformed into a yeast reporter strain, and the resulting
transformants are screened for those that express the reporter gene. For
example, and not by way of limitation, a bait NGPCR gene sequence, such as
the open reading frame of a NGPCR (or a domain of a NGPCR) can be
cloned into a vector such that it is translationally fused to the DNA encoding
the DNA-binding domain of the GAL4 protein. These colonies are purified
and the library plasmids responsible for reporter gene expression are
isolated.
64
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
DNA sequencing is then used to identify the proteins encoded by the library
plasmids.
[0147] A cDNA library of the cell line from which proteins that interact
with bait NGPCR gene product are to be detected can be made using
methods routinely practiced in the art. According to certain embodiments of
the system described herein, for example, the cDNA fragments can be
inserted into a vector such that they are translationally fused to the
transcriptional activation domain of GAL4. This library can be co-transformed
along with the bait NGPCR gene-GAL4 fusion plasmid into a yeast strain
which contains a IacZ gene driven by a promoter which contains GAL4
activation sequence. A cDNA encoded protein, fused to GAL4 transcriptional
activation domain, that interacts with bait NGPCR gene product will
reconstitute an active GAL4 protein and thereby drive expression of the HIS3
gene. Colonies which express HIS3 can be detected by their growth on petri
dishes containing semi-solid agar based medis lacking histidine. The cDNA
can then be purified from these strains, and used to produce and isolate the
bait NGPCR gene-interacting protein using techniques routinely practiced in
the art.
ASSAYS FOR COMPOUNDS THAT INTERFERE WITH
NGPCR/INTRACELLULAR OR NGPCR/TRANSMEMBRANE
MACROMOLECULE INTERACTION
[0148] The macromolecules that interact with the NGPCR are referred
to, for purposes of this discussion, as "binding partners." These binding
partners are likely to be involved in the NGPCR signal transduction pathway.
Therefore, it is desirable to identify compounds that interfere with or
disrupt
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
the interaction of such binding partners which may be useful in regulating the
activity of a NGPCR and controlling disorders associated with NGPCR
activity. For example, given their expression pattern, the described NGPCRs
are contemplated to be particularly useful in methods for identifying
compounds useful in the therapeutic treatment of obesity, inflammation,
immune disorders, diabetes, heart and coronary disease, metabolic disorders,
and cancer.
[0149] In certain embodiments, assay systems used to identify
compounds that interFere with the interaction between a NGPCR and 'its
binding partner or partners involve preparing a reaction mixture containing
NGPCR protein, polypeptide, peptide or fusion protein as described herein,
and the binding partner under conditions and for a time sufficient to allow
the
two to interact and bind, thus forming a complex. In order to test a compound
for inhibitory activity, the reaction mixture is prepared in the presence and
absence of the test compound. The test compound may be initially included
in the reaction mixture, or may be added at a time subsequent to the addition
of the NGPCR moiety and its binding partner. Control reaction mixtures are
incubated without the test compound or with a placebo. The formation of any
complexes between the NGPCR moiety and the binding partner is then
detected. The formation of a complex in the control reaction, but not in the
reaction mixture containing the test compound, indicates that the compound
interferes with the interaction of the NGPCR and the interactive binding
partner. Additionally, complex formation within reaction mixtures containing
the test compound and normal NGPCR protein may also be compared to
66
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
complex formation within reaction mixtures containing the test compound and
a mutant NGPCR. This comparison may be important in those cases wherein
it is desirable to identify compounds that specifically disrupt interactions
of
mutant, or mutated, NGPCRs but not normal NGPCRs.
[0150] According to certain embodiments, the assay for compounds
that interfere with the interaction of a NGPCR and its binding partners can be
conducted in a heterogeneous or homogeneous format. Heterogeneous
assays involve anchoring either the NGPCR moiety product or the binding
partner onto a solid phase and detecting complexes anchored on the solid
phase at the end of the reaction. In homogeneous assays, the entire reaction
is carried out in a liquid phase. In either approach, the order of addition of
reactants can be varied to obtain different information about the compounds
being tested. For example, test compounds that interfere with the interaction
by competition can be identified by conducting the reaction in the presence of
the test substance; i.e., by adding the test substance to the reaction mixture
prior to, or simultaneously with, a NGPCR moiety and interactive binding
partner. Alternatively, test compounds that disrupt preformed complexes, e.g.
compounds with higher binding constants that displace one of the
components from the complex, can be tested by adding the test compound to
the reaction mixture after complexes have been formed. Various formats,
according to certain embodiments, are described briefly below.
[0151] In a heterogeneous assay system, either a NGPCR moiety or an
interactive binding partner, is anchored onto a solid surface, while the non-
anchored species is labeled, either directly or indirectly. In practice,
microtiter
67
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
plates are conveniently utilized. The anchored species may be immobilized
by non-covalent or covalent attachments. Non-covalent attachment may be
accomplished simply by coating the solid surface with a solution of the
NGPCR gene product or binding partner and drying. Alternatively, an
immobilized antibody specific for the species to be anchored may be used to
anchor the species to the solid surface. The surfaces may be prepared in
advance and stored.
[0152] To conduct the assay according to certain embodiments, the
partner of the immobilized species is exposed to the coated surface with or
without the test compound. After the reaction is complete, unreacted
components are removed (e.g., by washing) and any complexes formed will
remain immobilized on the solid surface. The detection of complexes
anchored on the solid surface can be accomplished iri a number of ways.
Where the non-immobilized species is pre-labeled, in certain embodiments,
the detection of label immobilized on the surface indicates that complexes
were formed. Where the non-immobilized species is not pre-labeled, in
certain embodiments, an indirect label can be used to detect complexes
anchored on the surface; e.g., using a labeled antibody specific for the
initially
non-immobilized species (the antibody, in turn, may be directly labeled or
indirectly labeled with a labeled anti-Ig antibody). Depending upon the order
of addition of reaction components, test compounds which inhibit complex
formation or which-disrupt preformed complexes can be detected.
[0153] In certain embodiments, the reaction can be conducted in a
liquid phase in the presence or absence of the test compound, the reaction
68
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
products separated from unreacted components, and complexes detected;
e.g., using an immobilized antibody specific for one of the binding
components to anchor any complexes formed in solution, and a labeled
antibody specific for the other partner to detect anchored complexes. Again,
depending upon the order of addition of reactants to the liquid phase, test
compounds which inhibit complex or which disrupt preformed complexes can
be identified.
[0154] In certain embodiments of the invention, a homogeneous assay
can be used in which a preformed complex of a NGPCR moiety and an
interactive binding partner is prepared in which either the NGPCR or its
binding partner is labeled, but the signal generated by the label is quenched
due to formation of the complex (see, e.g., U.S. Patent No. 4,109,496 by
Rubenstein which utilizes this approach for immunoassays). The addition of a
test substance that competes with and displaces one of the species from the
preformed complex will result in the generation of a signal above background.
In this way, test substances which disrupt NGPCR/intracellular binding partner
interaction can be identified.
[0155] In certain embodiments, a NGPCR fusion can be prepared for
immobilization. For example, a NGPCR or a peptide fragment, e.g.,
corresponding to a CD, can be fused to a glutathione-S-transferase (GST)
gene using a fusion vector, such as pGEX-5X-1, in such a manner that its
binding activity is maintained in the resulting fusion protein. The
interactive
binding partner can be purified and used to raise a monoclonal antibody,
using methods routinely practiced in the art and described herein. This
69
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
antibody can be labeled with the radioactive isotope 1251, for example, by
methods routinely practiced in the art. In a heterogeneous assay, e.g., the
GST-NGPCR fusion protein can be anchored to glutathione-agarose beads.
The interactive binding partner can then be added in the presence or absence
of the test compound in a manner that allows interaction and binding to occur.
At the end of the reaction period, unbound material can be washed away, and
the labeled monoclonal antibody can be added to the system and allowed to
bind to the complexed components. The interaction between a NGPCR gene
product and the interactive binding partner can be detected by measuring the
amount of radioactivity that remains associated with the glutathione-agarose
beads. A successful inhibition of the interaction by the test compound will
result in a decrease in measured radioactivity.
[0156] In certain embodiments, the GST-NGPCR fusion protein and the
interactive binding partner can be mixed together in liquid in the absence of
the solid glutathione-agarose beads. The test compound can be added either
during or after the species are allowed to interact. This mixture can then be
added to the glutathione-agarose beads and unbound material is washed
away. Again the extent of inhibition of the NGPCR/binding partner interaction
can be detected by adding the labeled antibody and measuring the
radioactivity associated with the beads.
[0157] In certain embodiments of the invention, these same techniques
can be-employed using peptide fragments that correspond to the binding
domains of a NGPCR and/or the interactive or binding partner (in cases
where the binding partner is a protein), in place of one or both of the full
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
length proteins. Any number of methods routinely practiced in the art can be
used to identify and isolate the binding sites. These methods include, but are
not limited to, mutagenesis of the gene encoding one of the proteins and
screening for disruption of binding in a co-immunoprecipitation assay.
Compensatory mutations in the gene encoding the second species in the
complex can then be selected. Sequence analysis of the genes encoding the
respective proteins will reveal the mutations that correspond to the region of
the protein involved in interactive binding. Alternatively, one protein can be
anchored to a solid surface using methods described above, and allowed to
interact with and bind to its labeled binding partner, which has been treated
with a proteolytic enzyme, such as trypsin. After washing, a relatively short,
labeled peptide comprising the binding domain may remain associated with
the solid material, which can be isolated wand identified by amino acid
sequencing. Also, once the gene coding for the intracellular binding partner
is
obtained, short gene segments can be engineered to express peptide
fragments of the protein, which can then be tested for binding activity and
purified or synthesized.
[0153] For example, and not by way of limitation, a NGPCR gene
product can be anchored to a solid material as described, above, by making a
GST-NGPCR fusion protein and allowing it to bind to glutathione agarose
beads. The interactive binding partner can be labeled with a radioactive
isotope,-such as 35S, and cleaved with a proteolytic enzyme such as trypsin.
Cleavage products can then be added to the anchored GST-NGPCR fusion
protein and allowed to bind. After washing away unbound peptides, labeled
71
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
bound material, representing the intracellular binding partner binding domain,
can be eluted, purified, and analyzed for amino acid sequence by well-known
methods. Peptides so identified can be produced synthetically or fused to
appropriate facilitative proteins using recombinant DNA technology.
[0159] The present invention is not to be limited in scope by the specific
embodiments described herein, which are intended as illustrations of
individual aspects of certain embodiments of the invention, and functionally
equivalent methods and components are within the scope of the invention.
Indeed, various modifications of the invention, in addition to those shown and
described herein will become apparent to those skilled in the art from the
foregoing description and accompanying drawings. Such modifications are
intended to fall within the scope of the appended claims. All referenced
documents, including publications, patents, and patent applications, are
incorporated by reference herein for any purpose.
72
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
SEQUENCE LISTING
<110> Lexicon Genetics Incorporated
<120> Novel Seven Transmembrane Proteins and Polynucleotides Encoding the
Same
<130> 7705.15-304
<140> Not Yet Assigned
<141> 2001-05-11
<150> 60/203,875
<151> 2000-05-12
<150> 60/207,932
<151> 2000-05-30
<160> 7
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 2985
<212> DNA
<213> homo sapiens
<400>
1
atggtctgttcggctgccccactgctgctcctggccacaactcttcccctgctggggtca60
ccagttgcccaagcatcccaacctggacagagtcaggctggaggggaatctggatctggg120
cagctcctggaccaagagaatggagcaggggaatcagcgctggtctccgtctatgtacat180
ctggactttccagataagacctggccccctgaactctccaggacactgactctccctgct240
gcctcagcttcctcttccccaaggcctcttctcactggcctcagactcacaacagagtgt300
aatgtcaaccacaaggggaatttctattgtgcttgcctctctggctaccagtggaacacc360
agcatctgcctccattaccctccttgtcaaagcctccacaaccaccagccttgtggctgc420
cttgtcttcagccatcccgaacccgggtactgccagttgctgccacctgtccccgggatc480
ctcaacctgaactcccagctgcagatgcctggtgacacgctgagcctgactctccatctg540
agccaggaggccaccaacctgagctggttcctgaggcacccagggagccccagtcccatc600
ctcctgcagccagggacacaggtgtctgtgacttccagccacggccaggctgccctcagc660
gtctccaacatgtcccatcactgggcaggtgagtacatgagctgcttcgaggcccagggc720
ttcaagtggaacctgtatgaggtggtgagggtgcccttgaaggcgacagatgtggctcga780
cttccataccagctgtccatctcctgtgccacctcccctggcttccagctgagctgctgc840
atccccagcacaaacctggcctacaccgcggcctggagccctggagagggcagcaaagct900
tcctccttcaacgagtcaggctctcagtgctttgtgctggctgttcagcgctgcccgatg960
gctgacaccacgtacacttgtgacctgcagagcctgggcctggctccactcagggtcccc1020
atctccatcaccatcatccaggatggagacatcacctgccctgaggacgcctcggtgctc1080
acctggaatgtcaccaaggctggccacgtggcacaggccccatgtcctgagagcaagagg1140
ggcatagtgaggaggctctgtggggctgacggagtctgggggccggtccacagcagctgc1200
acagatgcgaggctcctggccttgttcactagaaccaagctgctgcaggcaggccagggc1260
agtcctgctgaggaggtgccacagatcctggcacagctgccagggcaggcggcagaggca1320
agttcaccctccgacttactgaccctgctgagcaccatgaaatacgtggccaaggtggtg1380
gcagaggccagaatacagcttgaccgcagagccctgaagaatctcctgattgccacagac1440
aaggtcctagatatggacaccaggtctctgtggaccctggcccaagcccggaagccctgg1500
gcaggctcgactctcctgctggctgtggagaccctggcatgcagcctgtgcccacaggac1560
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
taccccttcgccttcagcttacccaatgtgctgctgcagagccagctgtttggacccacg1620
tttcctgctgactacagcatctccttccctactcggcccccactgcaggctcagattccc1680
aggcactcactggccccattggtccgtaatggaactgaaataagtattactagcctggtg1740
ctgcgaaaactggaccaccttctgccctcaaactatggacaagggctgggggattccctc1800
tatgccactcctggcctggtccttgtcatttccatcatggcaggtgaccgggccttcagc1860
cagggagaggtcatcatggactttgggaacacagatggttcccctcactgtgtcttctgg1920
gatcacagtctcttccagggcagggggggttggtccaaagaagggtgccaggcacaggtg1980
gccagtgccagccccactgctcagtgcctctgccagcacctcactgccttctccgtcctc2040
atgtccccacacactgttccggaagaacccgctctggcgctgctgactcargtgggcttg2100
ggagcttccatactggcgctgcttgtgtgcctgggtgtgtactggctggtgtggagagtc210
gtggtgcggaacaagatctcctatttccgccacgccgccctgctcaacatggtgttctgc2220
ttgctggccgcagacacttgcttcctgggcgccccattcctctctccagggccccgaagc2280
ccgctctgccttgctgccgccttcctctgtcatttcctctacctggccacctttttctgg2340
atgctggcgcaggccctggtgttggcccaccagctgctctttgtctttcaccagctggca2400
aagcaccgagttctccccctcatggtgctcctgggctacctgtgcccactggggttggca2460
ggtgtcaccctggggctctacctacctcaagggcaatacctgagggagggggaatgctgg2520
ttggatgggaagggaggggcgttatacaccttcgtggggccagtgctggccatcataggc2580
gtgaatgggctggtactagccatggccatgctgaagttgctgagaccttcgctgtcagag2640
ggacccccagcagagaagcgccaagctctgctgggggtgatcaaagccctgctcattctt2700
acacccatctttggcctcacctgggggctgggcctggccactctgttagaggaagtctcc2760
acggtccctcattacatcttcaccattctcaacaccctccagggcgtcttcatcctattg2820
tttggttgcctcatggacaggaagatacaagaagctttgcgcaaacgcttctgccgcgcc2880
caagcccccagctccaccatctccctggccacaaatgaaggctgcatcttggaacacagc2940
aaaggaggaagcgacactgccaggaagacagatgcttcagagtga 2985
<210> 2
<211> 994
<212> PRT
<213> homo Sapiens
<400> 2
Met Val Cys Ser Ala Ala Pro Leu~ Leu Leu Leu Ala Thr Thr Leu Pro
1 5 10 15
Leu Leu Gly Ser Pro Val Ala Gln A1a Ser Gln Pro Gly Gln Ser Gln
20 25 30
Ala Gly Gly G1u Ser Gly 5er Gly Gln Leu Leu Asp Gln Glu Asn Gly
35 40 45
Ala Gly G1u Ser Ala Leu Val Ser Val Tyr Val His Leu Asp Phe Pro
50 55 60
Asp Lys Thr Trp Pro Pro G1u Leu Ser Arg Thr Leu Thr Leu Pro Ala
65 70 75 80
Ala Ser Ala Ser Ser Ser Pro Arg Pro Leu Leu Thr Gly Leu Arg Leu
85 90 95
Thr Thr G1u Cys Asn Val Asn His Lys G1y Asn Phe Tyr Cys Ala Cys
100 105 110
Leu Ser Gly Tyr Gln Trp Asn Thr Ser Ile Cys Leu His Tyr Pro Pro
115 120 125
Cys Gln Ser Leu His Asn His Gln Pro Cys Gly Cys Leu Val Phe Ser
130 135 140
His Pro Glu Pro Gly Tyr Cys Gln Leu Leu Pro Pro Va1 Pro G1y Ile
145 150 155 160
Leu Asn Leu Asn Ser Gln Leu Gln Met Pro Gly Asp Thr Leu Ser Leu
165 170 175
Thr Leu His Leu Ser G1n Glu Ala Thr Asn Leu Ser Trp Phe ~Leu Arg
180 185 190
His Pro G1y Ser Pro Ser Pro Ile Leu Leu Gln Pro Gly Thr Gln Val
195 200 205
Ser Val Thr Ser Ser His Gly Gln Ala Ala Leu Ser Val Ser Asn Met
2
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
210 215 220
Ser His His Trp Ala Gly Glu Tyr Met Ser Cys Phe G1u Ala Gln Gly
225 230 235 240
Phe Lys Trp Asn Leu Tyr Glu Val Val Arg Val Pro Leu Lys Ala Thr
245 250 255
Asp Val Ala Arg Leu Pro Tyr Gln Leu Ser Ile Ser Cys Ala Thr Ser
260 265 270
Pro Gly Phe Gln Leu Ser Cys Cys Ile Pro Ser Thr Asn Leu Ala Tyr
275 280 285
Thr Ala Ala Trp Ser Pro Gly Glu Gly Ser Lys Ala Ser Ser Phe Asn
290 295 300
Glu Ser Gly Ser Gln Cys Phe Val Leu A1a Val G1n Arg Cys Pro Met
305 310 315 320
Ala Asp Thr Thr Tyr Thr Cys Asp Leu Gln Ser Leu Gly Leu Ala Pro
325 330 335
Leu Arg Val Pro Ile Ser Ile Thr Ile Ile Gln Asp G1y Asp Ile Thr
340 345 350
Cys Pro Glu Asp Ala Ser Val Leu Thr Trp Asn Val Thr Lys Ala Gly
355 360 365
His Val Ala Gln Ala Pro Cys Pro Glu Ser Lys Arg Gly Ile Val Arg
370 375 380
Arg Leu Cys Gly Ala Asp Gly Val Trp Gly Pro Val His Ser Ser Cys
385 390 395 400
Thr Asp Ala Arg Leu Leu Ala Leu Phe Thr Arg Thr Lys Leu Leu G1n
405 410 415
Ala Gly Gln G1y Ser Pro Ala Glu Glu Val Pro Gln Ile Leu Ala Gln
420 425 430
Leu Pro Gly Gln Ala Ala Glu Ala Ser Ser Pro Ser Asp Leu Leu Thr
435 440 445
Leu Leu Ser Thr Met Lys Tyr Val Ala Lys Val Val Ala Glu Ala Arg
450 455 460
I1e Gln Leu Asp Arg Arg Ala Leu Lys Asn Leu Leu Ile Ala Thr Asp
465 470 ~ 475 480
Lys Val Leu Asp Met Asp Thr Arg Ser Leu Trp Thr Leu A1a Gln Ala
485 490 495
Arg Lys Pro Trp Ala G1y Ser Thr Leu Leu Leu Ala Val Glu Thr Leu
500 505 510
Ala Cys Ser Leu Cys Pro Gln Asp Tyr Pro Phe A1a Phe Ser Leu Pro
515 520 525
Asn Val Leu Leu Gln Ser Gln Leu Phe Gly Pro Thr Phe Pro Ala Asp
530 535 540
Tyr Ser Ile Ser Phe Pro Thr Arg Pro Pro Leu G1n Ala G1n Ile Pro
545 550 555 560
Arg His Ser Leu Ala Pro Leu Val Arg Asn G1y Thr Glu Ile Ser Ile
565 570 575
Thr Ser Leu Val Leu Arg Lys Leu Asp His Leu Leu Pro Ser Asn Tyr
580 585 590
Gly Gln Gly Leu Gly Asp Ser Leu Tyr Ala Thr Pro Gly Leu Val Leu
595 600 605
Val Ile Ser Ile Met Ala Gly Asp Arg A1a Phe Ser Gln G1y Glu Val
610 615 620
Ile Met Asp Phe Gly Asn Thr Asp Gly Ser Pro His Cys Val Phe Trp
625 630 635 640
Asp His Ser Leu Phe Gln Gly Arg Gly Gly Trp Ser Lys G1u Gly Cys
645 650 655
Gln Ala Gln Val Ala Ser Ala Ser Pro Thr Ala Gln Cys Leu Cys Gln
660 665 670
His Leu Thr~Ala Phe Ser Val Leu Met Ser Pro His Thr Val Pro Glu
3
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
675 680 685
Glu Pro Ala Leu Ala Leu Leu Thr Gln Val Gly Leu Gly Ala Ser Ile
690 695 700
Leu Ala Leu Leu Val Cys Leu Gly Val Tyr Trp Leu Val Trp Arg Val
705 710 715 720
Val Val Arg Asn Lys Ile Ser Tyr Phe Arg His Ala Ala Leu Leu Asn
725 730 735
Met Val Phe Cys Leu Leu Ala Ala Asp Thr Cys Phe Leu Gly Ala Pro
740 745 750
Phe Leu Ser Pro Gly Pro Arg Ser Pro Leu Cys Leu Ala Ala Ala Phe
755 760 765
Leu Cys His Phe Leu Tyr Leu Ala Thr Phe Phe Trp Met Leu Ala Gln
770 775 780
Ala Leu Val Leu Ala His Gln Leu Leu Phe Val Phe His Gln Leu Ala
785 790 795 800
Lys His Arg Val Leu Pro Leu Met Val Leu Leu Gly Tyr Leu Cys Pro
805 810 815
Leu Gly Leu Ala Gly Val Thr Leu Gly Leu Tyr Leu Pro Gln Gly Gln
820 825 830
Tyr Leu Arg Glu Gly Glu Cys Trp Leu Asp Gly Lys Gly Gly Ala Leu
835 840 845
Tyr Thr Phe Val Gly Pro Val Leu Ala Ile Tle Gly Val Asn Gly Leu
850 855 860
Val Leu Ala Met Ala Met Leu Lys Leu Leu Arg Pro Ser Leu Ser Glu
865 870 875 880
Gly Pro Pro Ala Glu Lys Arg Gln Ala Leu Leu Gly Val Ile Lys Ala
885 890 895
Leu Leu Ile Leu Thr Pro Ile Phe Gly Leu Thr Trp Gly Leu Gly Leu
900 905 910
Ala Thr Leu Leu Glu G1u Va1 Ser Thr Val Pro His Tyr I1e Phe Thr
915 920 925
Ile Leu Asn Thr Leu Gln Gly Val Phe I1e Leu Leu Phe Gly Cys Leu
930 935 940
Met Asp Arg Lys Ile Gln Glu Ala Leu Arg Lys Arg Phe Cys Arg Ala
945 950 955 960
Gln Ala Pro Ser Ser Thr Ile Ser Leu Ala Thr Asn Glu Gly Cys Ile
965 970 975
Leu Glu His Ser Lys Gly Gly Ser Asp Thr Ala Arg Lys Thr Asp Ala
980 985 990
Ser Glu
<210> 3
<211> 2481
<212> DNA
<213> homo Sapiens
<400>
3
atgcctggtgacacgctgagcctgactctccatctgagccaggaggccaccaacctgagc 60
tggttcctgaggcacccagggagccccagtcccatcctcctgcagccagggacacaggtg 120
tctgtgacttccagccacggccaggctgccctcagcgtctccaacatgtcccatcactgg 180
gcaggtgagtacatgagctgcttcgaggcccagggcttcaagtggaacctgtatgaggtg 240
gtgagggtgcccttgaaggcgacagatgtggctcgacttccataccagctgtccatctcc 300
tgtgccacctcccctggcttccagctgagctgctgcatccccagcacaaacctggcctac 360
accgcggcctggagccctggagagggcagcaaagcttcctccttcaacgagtcaggctct 420
cagtgctttgtgctggctgttcagcgctgcccgatggctgacaccacgtacacttgtgac 480
ctgcagagcctgggcctggctccactcagggtccccatctccatcaccatcatccaggat 540
ggagacatcacctgccctgaggacgcctcggtgctcacctggaatgtcaccaaggctggc 600
cacgtggcac.aggccccatgtcctgagagcaagaggggcatagtgaggaggctctgtggg 660
4
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
gctgacggagtctgggggccggtccacagcagctgcacagatgcgaggctcctggccttg720
ttcactagaaccaagctgctgcaggcaggccagggcagtcctgctgaggaggtgccacag780
atcctggcacagctgccagggcaggcggcagaggcaagttcaccctccgacttactgacc840
ctgctgagcaccatgaaatacgtggccaaggtggtggcagaggccagaatacagcttgac900
cgcagagccctgaagaatctcctgattgccacagacaaggtcctagatatggacaccagg960
tctctgtggaccctggcccaagcccggaagccctgggcaggctcgactctcctgctggct1020
gtggagaccctggcatgcagcctgtgcccacaggactaccccttcgccttcagcttaccc1080
aatgtgctgctgcagagccagctgtttggacccacgtttcctgctgactacagcatctcc1140
ttccctactcggcccccactgcaggctcagattcccaggcactcactggccccattggtc1200
cgtaatggaactgaaataagtattactagcctggtgctgcgaaaactggaccaccttctg1260
ccctcaaactatggacaagggctgggggattccctctatgccactcctggcctggtcctt1320
gtcatttccatcatggcaggtgaccgggccttcagccagggagaggtcatcatggacttt1380
gggaacacagatggttcccctcactgtgtcttctgggatcacagtctcttccagggcagg1440
gggggttggtccaaagaagggtgccaggcacaggtggccagtgccagccccactgctcag1500
tgcctctgccagcacctcactgccttctccgtcctcatgtccccacacactgttccggaa1560
gaacccgctctggcgctgctgactcargtgggcttgggagcttccatactggcgctgctt1620
gtgtgcctgggtgtgtactggctggtgtggagagtcgtggtgcggaacaagatctcctat1680
ttCCgCCaCgCCCJCCCtgCtCaaCatggtgttctgcttgctggccgcagacacttgcttc1740
ctgggcgccccattcctctctccagggccccgaagcccgctctgccttgctgccgccttc1800
ctctgtcatttcctctacctggccacctttttctggatgctggcgcaggccctggtgttg1860
gcccaccagctgctctttgtctttcaccagctggcaaagcaccgagttctccccctcatg1920
gtgctcctgggctacctgtgcccactggggttggcaggtgtcaccctggggctctaccta1980
cctcaagggcaatacctgagggagggggaatgctggttggatgggaagggaggggcgtta2040
tacaccttcgtggggccagtgctggccatcataggcgtgaatgggctggtactagccatg2100
gccatgctgaagttgctgagaccttcgctgtcagagggacccccagcagagaagcgccaa2160
gctctgctgggggtgatcaaagccctgctcattcttacacccatctttggcctcacctgg2220
gggctgggcctggccactctgttagaggaagtctccacggtccctcattacatcttcacc2280
attctcaacaccctccagggcgtcttcatcctattgtttggttgcctcatggacaggaag2340
atacaagaagctttgcgcaaacgcttctgccgcgcccaagcccccagctccaccatctcc2400
ctggccacaaatgaaggctgcatcttggaacacagcaaaggaggaagcgacactgccagg2460
aagacagatgcttcagagtga 2481
<210> 4
<211> 826
<212> PRT
<213> homo Sapiens
<400> 4
Met Pro Gly Asp Thr Leu Ser Leu Thr Leu His Leu Ser Gln Glu Ala
1 5 10 15
Thr Asn Leu Ser Trp Phe Leu Arg His Pro Gly Ser Pro Ser Pro Ile
20 25 30
Leu Leu Gln Pro Gly Thr Gln Val Ser Val Thr Ser Ser His Gly Gln
35 40 45
Ala Ala Leu Ser Val Ser Asn Met Ser His His Trp Ala Gly Glu Tyr
50 55 60
Met Ser Cys Phe Glu Ala Gln Gly Phe Lys Trp Asn Leu Tyr Glu Val
65 70 75 80
Val Arg Va1 Pro Leu Lys Ala Thr Asp Val Ala Arg Leu Pro Tyr Gln
85 90 95
Leu Ser Ile Ser Cys Ala Thr 5er Pro Gly Phe Gln Leu Ser Cys Cys
100 105 110
Ile Pro Ser Thr Asn Leu Ala Tyr Thr Ala Ala Trp Ser Pro Gly Glu
115 120 125
Gly Ser Lys Ala Ser Ser Phe Asn Glu Ser Gly Ser Gln Cys Phe Val
130 135 140
Leu Ala Val Gln Arg Cys Pro Met A1a Asp Thr Thr Tyr Thr Cys Asp
145 150 155 160
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
Leu Gln Ser Leu Gly Leu Ala Pro Leu Arg Val Pro Ile Ser Ile Thr
165 170 175
Ile Ile Gln Asp Gly Asp Ile Thr Cys Pro Glu Asp Ala Ser Val Leu
180 185 190
Thr Trp Asn Val Thr Lys Ala Gly His Val Ala Gln Ala Pro Cys Pro
195 200 205
Glu Ser Lys Arg Gly Ile Val Arg Arg Leu Cys Gly Ala Asp Gly Val
210 215 220
Trp Gly Pro Val His Ser Ser Cys Thr Asp Ala Arg Leu Leu Ala Leu
225 230 235 240
Phe Thr Arg Thr Lys Leu Leu Gln Ala Gly G1n Gly Ser Pro Ala Glu
245 250 255
Glu Val Pro Gln Ile Leu Ala Gln Leu Pro Gly Gln A1a Ala Glu Ala
2~0 265 270
Ser Ser Pro Ser Asp Leu Leu Thr Leu Leu Ser Thr Met Lys Tyr Val
275 280 285 .
A1a Lys Val Val Ala Glu Ala Arg Ile Gln Leu Asp Arg Arg Ala Leu
290 295 300
Lys Asn Leu Leu I1e A1a Thr Asp Lys Val Leu Asp Met Asp Thr Arg
305 310 315 320
Ser Leu Trp Thr Leu Ala Gln Ala Arg Lys Pro Trp Ala Gly Ser Thr
325 330 335
Leu Leu Leu Ala Val G1u Thr Leu Ala Cys Ser Leu Cys Pro Gln Asp
340 345 350
Tyr Pro Phe Ala Phe Ser Leu Pro Asn Val Leu Leu Gln Ser Gln Leu
355 360 365
Phe Gly Pro Thr Phe Pro Ala Asp Tyr Ser Ile Ser Phe Pro Thr Arg
370 375 380
Pro Pro Leu Gln Ala Gln Ile Pro Arg His Ser Leu A1a Pro Leu Val
385 390 395 400
Arg Asn G1y Thr Glu Ile Ser Ile Thr Ser Leu Val Leu Arg Lys Leu
405 410 415
Asp His Leu Leu Pro Ser Asn Tyr Gly G1n Gly Leu Gly Asp Ser Leu
420 425 430
Tyr Ala Thr Pro Gly Leu Val Leu Val Ile Ser Ile Met Ala Gly Asp
435 440 445
Arg Ala Phe Ser Gln Gly Glu Val Ile Met Asp Phe Gly Asn Thr Asp
450 455 460
G1y Ser Pro His Cys Val Phe Trp Asp His Ser Leu Phe Gln Gly Arg
465 470 475 480
Gly Gly Trp Ser Lys Glu Gly Cys Gln Ala Gln Val Ala Ser Ala Ser
485 490 495
Pro Thr Ala Gln Cys Leu Cys Gln His Leu Thr Ala Phe Ser Val Leu
500 505 510
Met Ser Pro His Thr Val Pro Glu Glu Pro A1a Leu Ala Leu Leu Thr
515 520 525
Gln Val Gly Leu Gly Ala Ser I1e Leu Ala Leu Leu Val Cys Leu Gly
530 535 540
Val Tyr Txp Leu Val Trp Arg Val Val Val Arg Asn Lys Ile Ser Tyr
545 550 555 560
Phe Arg His Ala A1a Leu Leu Asn Met Val Phe Cys Leu Leu Ala Ala
565 570 575
Asp Thr Cys Phe Leu Gly Ala Pro Phe Leu Ser Pro Gly Pro Arg Ser
580 585 590
Pro,Leu Cys Leu Ala Ala Ala Phe Leu Cys His Phe Leu Tyr Leu Ala
595 600 605
Thr Phe Phe Trp Met Leu Ala G1n Ala Leu Val Leu Ala His Gln Leu
610 615 620
6
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
Leu Phe Val Phe His Gln Leu Ala Lys His Arg Val Leu Pro Leu Met
625 630 635 640
Val Leu Leu Gly Tyr Leu Cys Pro Leu Gly Leu Ala Gly Val Thr Leu
645 650 655
Gly Leu Tyr Leu Pro Gln Gly Gln Tyr Leu Arg Glu Gly Glu Cys Trp
660 665 670
Leu Asp Gly Lys Gly Gly Ala Leu Tyr Thr Phe Val Gly Pro Val Leu
675 680 685
Ala Ile Ile Gly Val Asn Gly Leu Val Leu Ala Met Ala Met Leu Lys
690 695 700
Leu Leu Arg Pro Ser Leu Ser Glu Gly Pro Pro Ala Glu Lys Arg Gln
705 710 715 720
Ala Leu Leu Gly Val Ile Lys A1a Leu Leu Ile Leu Thr Pro Ile Phe
725 730 735
Gly Leu Thr Trp Gly Leu Gly Leu Ala Thr Leu Leu Glu Glu Val Ser
740 745 750
Thr Val Pro His Tyr Ile Phe Thr Ile Leu Asn Thr Leu Gln Gly Val
755 760 765
Phe Ile Leu Leu Phe Gly Cys Leu Met Asp Arg Lys Ile Gln Glu Ala
770 775 780
Leu Arg Lys Arg Phe Cys Arg Ala Gln Ala Pro Ser Ser Thr Ile Ser
785 790 795 800
Leu Ala Thr Asn Glu Gly Cys Tle Leu Glu His Ser Lys Gly Gly Ser
805 810 815
Asp Thr A1a Arg Lys Thr Asp Ala Ser Glu
820 825
<210> 5
<211> 3207
<212> DNA
<213> homo Sapiens
<400> 5
tgcagttcttccttgcggaaaatttgcatcgtgggcttgtagggactgtttcattgagcc60
atggtctgttcggctgccccactgctgctcctggccacaactcttcccctgctggggtca120
ccagttgcccaagcatcccaacctggacagagtcaggctggaggggaatctggatctggg180
cagctcctggaccaagagaatggagcaggggaatcagcgctggtctccgtctatgtacat240
ctggactttccagataagacctggccccctgaactctccaggacactgactctccctgct300
gcctcagcttcctcttccccaaggcctcttctcactggcctcagactcacaacagagtgt360
aatgtcaaccacaaggggaatttctattgtgcttgcctctctggctaccagtggaacacc420
agcatctgcctccattaccctccttgtcaaagcctccacaaccaccagccttgtggctgc480
cttgtcttcagccatcccgaacccgggtactgccagttgctgccacctgtccccgggatc540
ctcaacctgaactcccagctgcagatgcctggtgacacgctgagcctgactctccatctg600
agccaggaggccaccaacctgagctggttcctgaggcacccagggagccccagtcccatc660
ctcctgcagccagggacacaggtgtctgtgacttccagccacggccaggctgccctcagc720
gtctccaacatgtcccatcactgggcaggtgagtacatgagctgcttcgaggcccagggc780
ttcaagtggaacctgtatgaggtggtgagggtgcccttgaaggcgacagatgtggctcga840
cttccataccagctgtccatCtCCtgtgCCaCCtCCCCtggCttCCagCtgagctgctgc900
atccccagcacaaacctggcctacaccgcggcctggagccctggagagggcagcaaagct960
tcctccttcaacgagtcaggctctcagtgctttgtgctggctgttcagcgctgcccgatg1020
gctgacaccacgtacacttgtgacctgcagagcctgggcctggctccactcagggtcccc1080
atctccatcaccatcatccaggatggagacatcacctgccctgaggacgcctcggtgctc1140
acctggaatgtcaccaaggctggccacgtggcacaggccccatgtcctgagagcaagagg1200
ggcatagtgaggaggctctgtggggctgacggagtctgggggccggtccacagcagctgc1260
acagatgcgaggctcctggccttgttcactagaaccaagctgctgcaggcaggccagggc1320
agtcctgctgaggaggtgccacagatcctggcacagctgccagggcaggcggcagaggca1380
agttcaccctccgacttactgaccctgctgagcaccatgaaatacgtggccaaggtggtg1440
gcagaggccagaatacagcttgaccgcagagccctgaagaatctcctgattgccacagac1500
7
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
aaggtcctagatatggacaccaggtctctgtggaccctggcccaagcccggaagccctgg1560
gcaggctcgactctcctgctggctgtggagaccctggcatgcagcctgtgcccacaggac1620
taccccttcgccttcagcttacccaatgtgctgctgcagagccagctgtttggacccacg1680
tttcctgctgactacagcatCtCCttCCCtactcggcccccactgcaggctcagattccc1740
aggcactcactggccccattggtccgtaatggaactgaaataagtattactagcctggtg1800
ctgcgaaaactggaccaccttctgccctcaaactatggacaagggctgggggattccctc1860
tatgccactcctggcctggtccttgtcatttccatcatggcaggtgaccgggccttcagc1920
cagggagaggtcatcatggactttgggaacacagatggttcccctcactgtgtcttctgg1980
gatcacagtctcttccagggcagggggggttggtccaaagaagggtgccaggcacaggtg2040
gccagtgccagccccactgctCagtgCC'tCtgCCagC3CCtcactgccttCtCCgtCCtC2100
atgtccccacacactgttccggaagaacccgctctggcgctgctgactcargtgggcttg2160
ggagcttccatactggcgctgcttgtgtgcctgggtgtgtactggctggtgtggagagtc2220
gtggtgcggaacaagatctcctatttccgccacgccgccctgctcaacatggtgttctgc2280
ttgctggccgcagacacttgcttcctgggcgccccattcctctctccagggccccgaagc2340
CCgCtCtCjCCttgCtgCCgCcttCCtCtgtCatttCCtCtacctggccacCtttttCtgg2400
atgctggcgcaggccctggtgttggcccaccagctgctctttgtctttcaccagctggca2460
aagcaccgagttctccccctcatggtgctcctgggctacctgtgcccactggggttggca2520
ggtgtcaccctggggctctacctacctcaagggcaatacctgagggagggggaatgctgg2580
ttggatgggaagggaggggcgttatacaccttcgtggggccagtgctggccatcataggc2640
gtgaatgggctggtactagccatggccatgctgaagttgctgagaccttcgctgtcagag2700
ggacccccagcagagaagcgccaagctctgctgggggtgatcaaagccctgctcattctt2760
acacccatctttggcctcacctgggggctgggcctggccactctgttagaggaagtctcc2820
acggtccctcattacatcttcaccattctcaacaccctccagggcgtcttcatcctattg2880
tttggttgcctcatggacaggaagatacaagaagctttgcgcaaacgcttctgccgcgcc2940
caagcccccagctccaccatctccctggccacaaatgaaggctgcatcttggaacacagc3000
aaaggaggaagcgacactgccaggaagacagatgcttcagagtgaaccacacacggaccc3060
atgttcctgcaagggagttgaggctgtgtgcttgaacccaccagatgagccctggcccaa3120
tgctctgaactcttcccgcctcccggagctcagcccttgagaaaggcaggcttatatttc3180
ccttagtgacactcatttatcttacag 3207
<2l0> 6
<211> 1008
<212> DNA
<213> homo Sapiens
<400> 6
atgcagccgtccccgccgcccaccgagctggtgccgtcggagcgcgccgtggtgctgctg60
tcgtgcgcactctccgcgctcggctcgggcctgctggtggccacgcacgccctgtggccc120
gacctgcgcagccgggcacggcgcctgctgctcttcctgtcgctggccgacctgctctcg180
gccgcctcctacttctacggagtgctgcagaacttcgcgggcccgtcgtgggactgcgtg240
ctgcagggcgcgctgtccaccttcgccaacaccagctccttcttctggaccgtggccatt300
gcgctctacttgtacctcagcatcgtccgcgccgcgcgcgggcctcgcacagatcgcctg360
ctttgggccttccatgtcgtcagctggggggtcccgttggtcatcactgtggcagccgtc420
gccctgaagaagattggctatgacgcctcg.gacgtgtctgtgggctggtgctggatcgac480
ctggaggccaaggaccatgtcctgtggatgctgctgacggggaagctgtgggagatgctg540
gcatatgtgctgctgcctctgctgtacctcctggtccggaagcacatcaacagagcgcac600
acggcactctctgagtaccggcccatcctctcccaggagcaccgcctgctgcgccactcc660
tccatggcggacaagaagctggtgctcatcccgctcatcttcatcggcctcagggtctgg720
agcaccgtgcggttcgtgctgaccctctgtggctccccggccgtgcagacgccggtgctg780
gtggttctgcatggtatcgggaacacgtttcagggaggtgccaactgcatcatgttcgtc840
ctctgcacccgcgccgtccgaactcggctcttctctctctgttgctgctgctgctcttct900
cagcctcccaccaagagcccggctggcactcccaaggctcccgcgccttccaagccagga960
gaat~tcaggaatcccaagggaccccaggggaacttccaagcacctga 1008
<210> 7
<211> 335
<212> PRT
<213> homo sapiens
CA 02408503 2002-11-07
WO 01/87932 PCT/USO1/15048
<400> 7
Met Gln Pro Ser Pro Pro Pro Thr Glu Leu Val Pro Ser Glu Arg Ala
1 5 10 15
Val Val Leu Leu Ser Cys Ala Leu Ser Ala Leu Gly Ser Gly Leu Leu
20 25 30
Val Ala Thr His Ala Leu Trp Pro Asp Leu Arg Ser Arg Ala Arg Arg
35 40 45
Leu Leu Leu Phe Leu Ser Leu Ala Asp Leu Leu Ser Ala Ala Ser Tyr
50 55 60
Phe Tyr Gly Val Leu Gln Asn Phe Ala Gly Pro Ser Trp Asp Cys Val
65 - 70 75 80
Leu Gln Gly Ala Leu Ser Thr Phe Ala Asn Thr Ser Ser Phe Phe Trp
85 90 95
Thr Val Ala Ile Ala Leu Tyr Leu Tyr Leu Ser Ile Val Arg Ala A1a
100 105 110
Arg Gly Pro Arg Thr Asp Arg Leu Leu Trp Ala Phe His Val Val Ser
115 120 125
Trp Gly Val Pro Leu Val Ile Thr Val Ala Ala Val A1a Leu Lys Lys
130 135 140
Ile Gly Tyr Asp Ala Ser Asp Val Ser Val Gly Trp Cys Trp Tle Asp
145 150 155 160
Leu Glu Ala Lys Asp His Val Leu Trp Met Leu Leu Thr Gly Lys Leu
165 170 175
Trp Glu Met Leu Ala Tyr Val Leu Leu Pro Leu Leu Tyr Leu Leu Val
l80 l85 190
Arg Lys His Ile Asn Arg A1a His Thr Ala Leu Ser Glu Tyr Arg Pro
195 200 205
Ile Leu Ser Gln Glu His Arg Leu Leu Arg His Ser Ser Met Ala Asp
210 215 220
Lys Lys Leu Val Leu Ile Pro Leu Ile Phe Ile Gly Leu Arg Va1 Trp
225 230 235 240
Ser Thr Val Arg Phe Val Leu Thr Leu Cys Gly Ser Pro Ala Val Gln
245 250 255
Thr Pro Val Leu Val Val Leu His Gly Ile Gly Asn Thr Phe Gln Gly
260 265 270
Gly A1a Asn Cys Ile Met Phe Val Leu Cys Thr Arg Ala Val Arg Thr
275 280 285
Arg Leu Phe Ser Leu Cys Cys Cys Cys Cys Ser Ser Gln Pro Pro Thr
290 295 300
Lys Ser Pro A1a Gly Thr Pro Lys Ala Pro Ala Pro Ser Lys Pro Gly
305 310 315 320
Glu Ser Gln Glu Ser Gln Gly Thr Pro Gly Glu Leu Pro Ser Thr
325 330 335
9
