Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
~~ TTENANT LES PAGES 1 A 243
NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 243
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
TUMOR NECROSIS FACTOR RECEPTORS 6a & 6J3
Field of tire Inverztion
[0001] The present invention relates to novel human genes encoding
polypeptidas which
are members of the TNF receptor family. More specifically, isolated nucleic
acid molecules
are provided encoding human polypeptides named tumor necrosis factor receptor-
6a & -6(3
hereinafter sometimes referred to as "TNFR-6a, & TNFR-6(3" or generically as
"TNFR
polypeptides". TNFR polypeptides are also provided, as are vectors, host cells
and
recombinant methods for producing the same. The invention further relates to
screening
methods for identifying agonists and antagonists of TNFR polypeptide activity.
Also
provided are diagnostic and therapeutic methods utilizing such compositions.
Background of the Irzventiora
[0002] Many biological actions, for instance, response to certain stimuli and
natural
biological processes, are controlled by factors, such as cytokines. Many
cytokines act
through receptors by engaging the receptor and producing an intra-cellular
response.
[0003] For example, tumor necrosis factors (TNF) alpha and beta are cytokines
which act
through TNF receptors to regulate numerous biological processes, including
protection
against infection and induction of shock and inflammatory disease. The TNF
molecules
belong to the "TNF-ligand" superfamily, and act together with their receptors
or counter-
ligands, the "TNF-receptor" superfarnily. So far, sixteen members of the TNF
ligand
superfamily have been identified and seventeen members of the TNF-receptor
superfamily
have been characterized.
[0004] Among the ligands there are included TNF-a, lymphotoxin-a (LT-a, also
known
as TNF-(3), LT-(3 (found in complex heterotrimer LT-a2-(3 ), Fast, CD40L,
CD27L, CD30L,
4-1BBL, OX40L and nerve growth factor (NGF). The superfamily of TNF receptors
includes
the p55TNF receptor, p75TNF receptor, TNF receptor-related protein, FAS
antigen or APO-
1, CD40, CD27, CD30, 4-1BB, OX40, low affinity p75 and NGF-receptor (Meager,
A.,
Biologicals, 22:291-295 (1994)).
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0005] Many members of the TNF-ligand superfamily are expressed by activated T-
cells,
implying that they are necessary for T-cell interactions with other cell types
which underlie
cell ontogeny and functions. (Meager, A., supra).
[0006] Considerable insight into the essential functions of several members of
the TNF
receptor family has been gained from the identification and creation of
mutants that abolish
the expression of these proteins. For example, naturally occurring mutations
in the FAS
antigen and its ligand cause lymphoproliferative disease (Watanabe-Fukunaga,
R., et al.,
Nature 356:314 (1992)), perhaps reflecting a failure of programmed cell death.
Mutations of
the CD40 ligand cause an X-linked immunodeficiency state characterized by high
levels of
immunoglobulin M and low levels of immunoglobulin G in plasma, indicating
faulty T-cell-
dependent B-cell activation (Allen, R.C. et al., Science 259:990 (1993)).
Targeted mutations
of the low affinity nerve growth factor receptor cause a disorder
characterized by faulty
sensory innovation of peripheral structures (Lee, K.F. et al., Cell 69:737
(1992)).
[0007] TNF and LT-oc are capable of binding to two TNF receptors (the 55- and
75-kd
TNF receptors). A large number of biological effects elicited by TNF and LT-
ct, acting
through their receptors, include hemorrhagic necrosis of transplanted tumors,
cytotoxicity, a
role in endotoxic shock, inflammation, immunoregulation, proliferation and
anti-viral
responses, as well as protection against the deleterious effects of ionizing
radiation. TNF and
LT-a are involved in the pathogenesis of a wide range of diseases, including
endotoxic
shock, cerebral malaria, tumors, autoimmune disease, AIDS and graft-host
rejection (Beutler,
B. and Von Huffel, C., Science 264:667-668 (1994)). Mutations in the p55
Receptor cause
increased susceptibility to microbial infection.
[0008] Moreover, an about 80 amino acid domain near the C-terminus of TNFR1
(p55)
and Fas was reported as the "death domain," which is responsible fox
transducing signals for
programmed cell death (Tartaglia et al., Cell 74:845 (1993)). Apoptosis, or
programmed cell death, is a physiologic process essential to the normal
development and
homeostasis of multicellular organisms (H. Steller, Science 267, 1445-1449
(1995)).
Derangements of apoptosis contribute to the pathogenesis of several human
diseases
including cancer, neurodegenerative disorders, and acquired immune deficiency
syndrome
(C.B. Thompson, Science 267, 1456-1462 (1995)). Recently, much attention has
focused on
the signal transduction and biological function of two cell surface death
receptors, Fas/APO-1
2
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
and TNFR-1 (J.L. Cleveland, J.N. Ihle, Cell 81, 479-482 (1995); A. Fraser, G.
Evan, Cell 85,
781-784 (1996); S. Nagata, P. Golstein, Science 267, 1449-56 (1995)). Both are
members of
the TNF receptor family which also include TNFR-2, low affinity NGFR, CD40,
and CD30,
among others (C.A. Smith, et al., Science 248, 1019-23 (1990); M. Tewari, V.M.
Dixit, in
Modular Texts in Molecular and Cell Biology M. Purton, Heldin, Carl, Ed.
(Chapman and
Hall, London, 1995). While family members are defined by the presence of
cysteine-rich
repeats in their extracellular domains, Fas/APO-1 and TNFR-1 also share a
region of
intracellular homology, appropriately designated the "death domain", which is
distantly
related to the Drosophila suicide gene, reaper (P. Golstein, D. Marguet, V.
Depraetere, Cell
81, 185-6 (1995); K. White et al., Science 264, 677-83 (1994)). This shared
death domain
suggests that both receptors interact with a related set of signal transducing
molecules that,
until recently, remained unidentified. Activation of Fas/APO-1 recruits the
death
domain-containing adapter molecule FADD/MORT1 (A.M. Chinnaiyan, K. O'Rourke,
M.
Tewari, V. M. Dixit, Cell 81, 505-12 (1995); M. P. Boldin, et al., J. Biol
Chem 270, 7795-8
(1995); F.C. Kischkel, et al., EMBO 14, 5579-5588 (1995)), which in turn binds
and
presumably activates FLICE/MACHl, a member of the ICE/CED-3 family of pro-
apoptotic
proteases (M. Muzio et al., Cell 85, 817-827 (1996); M.P. Boldin, T.M.
Goncharov, Y.V.
Goltsev, D. Wallach, Cell 85, 803-815 (1996)). While the central role of
Fas/APO-1 is to
trigger cell death, TNFR-1 can signal an array of diverse biological
activities-many of which
stem from its ability to activate NF-kB (L.A. Tartaglia, D.V. Goeddel, Immunol
Today 13,
151-3 (1992)). Accordingly, TNFR-1 recruits the multivalent adapter molecule
TRADD,
which like FADD, also contains a death domain (H. Hsu, J. Xiong, D.V. Goeddel,
Cell 81,
495-504 (1995); H. Hsu, H.-B. Shu, M.-P. Pan, D.V. Goeddel, Cell 84, 299-308
(1996)).
Through its associations with a number of signaling molecules including FADD,
TRAF2,
and RIP, TRADD can signal both apoptosis and NF-kB activation (H. Hsu, H.-B.
Shu, M.-P.
Pan, D.V. Goeddel, Cell 84, 299-308 (1996); H. Hsu, J. Huang, H.-B. Shu, V.
Baichwal,
D.V. Goeddel, Immunity 4, 387-396 (1996)).
[0009] The effects of TNF family ligands and TNF family receptors are varied
and
influence numerous functions, both normal and abnormal, in the biological
processes of the
mammalian system. There is a clear need, therefore, for identification and
characterization of.
such receptors and ligands that influence biological activity, both normally
and in disease
3
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
states. In particular, there is a need to isolate and characterize novel
members of the TNF
receptor family.
Summary of the Invention
[0010] The present invention provides isolated nucleic acid molecules
comprising, or
alternatively consisting of, a polynucleotide encoding at least a portion of a
TNFR (i.e.,
TNFR-6a or TNFR-6(3 polypeptide) having the complete amino acid sequences
shown in
SEQ ID NOS:2 and 4, respectively, or the complete amino acid sequence encoded
by a
cDNA clone deposited as plasmid DNA as ATCC Deposit Number 97810 and 97809,
respectively. The nucleotide sequence determined by sequencing the deposited
TNFR-6 alpha
and TNFR-6 beta clones, which are shown in Figures 1 and 2 (SEQ ID NOS:1 and
3,
respectively), contain open reading frames encoding complete polypeptides of
300 and 170
amino acid residues, respectively, including an initiation codon encoding an N-
terminal
methionine at nucleotide positions 25-27 and 73-75 in SEQ ID NOS: 1 and 3,
respectively.
[0011] The TNFR proteins of the present invention share sequence homology with
other
TNF receptors. Splice variants TNFR-6 alpha and TNFR-6 beta show the highest
degree of
sequence homology with the translation products of the human mRNAs fox TNFR-I
and -II
(Figure 3) (SEQ ID NOS:5 and 6, respectively) also including multiple
conserved cysteine
rich domains.
[0012] The TNFR-6 alpha and TNFR-6 beta polypeptides have predicted leader
sequences of 30 amino acids each; and the amino acid sequence of the predicted
mature
TNFR-6 alpha and TNFR-6 beta polypeptides are also shown in Figures 1 and 2 as
amino
acid residues 31-300 (SEQ ID NO:2) and 31-170 (SEQ ID N0:4), respectively.
[0013] Thus, one aspect of the invention provides an isolated nucleic acid
molecule
comprising, or alternatively consisting of, a polynucleotide having a
nucleotide sequence
selected from the group consisting of: (a) a nucleotide sequence encoding a
TNFR
polypeptide having the complete amino acid sequence in SEQ ID N0:2 or 4, or as
encoded
by the cDNA clone contained in ATCC Deposit No. 97810 or 97809; (b) a
nucleotide
sequence encoding a mature TNFR polypeptide having the amino acid sequence at
positions
31-300 in SEQ ID N0:2, or 31-170 in SEQ ID N0:4, or as encoded by the cDNA
clone
contained in ATCC Deposit No. 97810 or 97809; (c) a nucleotide sequence
encoding a
4
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
soluble extracellular domain of a TNFR polypeptide having the amino acid
sequence at
positions 31 to 283 in SEQ ID N0:2 or 31 to 166 in SEQ 1D N0:4, or as encoded
by the
cDNA clone contained in the ATCC Deposit No. 97810 or 97809; (d) a nucleotide
sequence
encoding a fragment of a TNFR polypeptide having the amino acid sequence at
positions 31
to 283 in SEQ ID N0:2 or 31 to 166 in SEQ ID N0:4, or as encoded by the cDNA
clone
contained in the ATCC Deposit No. 97810 or 97809 wherein said fragment has
TNFR-6cc
and/or TNFR-6(3 functional activity; and (e) a nucleotide sequence
complementary to any of
the nucleotide sequences in (a), (b), (c), or (d) above.
[0014] Further embodiments of the invention include isolated nucleic acid
molecules that
comprise, or alternatively consist of, a polynucleotide having a nucleotide
sequence at least
90% identical, and more preferably at least 80%, 85%, 90%, 92%, or 95%, 96%,
97%, 98%
or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d) and
(e) above, or a
polynucleotide which hybridizes under stringent hybridization conditions to a
polynucleotide
in (a), (b), (c), (d), or (e) above. This polynucleotide which hybridizes does
not hybridize
under stringent hybridization conditions to a polynucleotide having a
nucleotide sequence
consisting of only A residues or of only T residues. An additional nucleic
acid embodiment
of the invention relates to an isolated nucleic acid molecule comprising, or
alternatively
consisting of, a polynucleotide which encodes the amino acid sequence of an
epitope-bearing
portion of a TNFR polypeptide having an amino acid sequence in (a), (b), (c),
or (d) above.
[0015] The present invention also relates to recombinant vectors, which
include the
isolated nucleic acid molecules of the present invention, and to host cells
containing the
recombinant vectors, as well as to methods of making such vectors and host
cells and for
using them for production of TNFR polypeptides or peptides by recombinant
techniques.
[0016] The invention further provides an isolated TNFR polypeptide comprising
an
amino acid sequence selected from the group consisting of: (a) the amino acid
sequence of a
full-length TNFR polypeptide having the complete amino acid sequence shown in
SEQ ID
N0:2 or 4 or as encoded by the cDNA clone contained in ATCC Deposit No. 97810
or
97809; (b) the amino acid sequence of a mature TNFR polypeptide having the
amino acid
sequence at positions 31-300 in SEQ >D N0:2, or 31-170 in SEQ >D NO:4, or as
encoded by
the cDNA clone contained in ATCC Deposit No. 97810 or 97809; (c) the amino
acid
sequence of a soluble extracellular domain of a TNFR polypeptide having the
amino acid
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
sequence at positions 31 to 283 in SEQ ID N0:2 or 31 to 166 in SEQ ID N0:4, or
as encoded
by the cDNA clone contained in ATCC Deposit No. 97810 or 97809; or (d) the
amino acid
sequence of a fragment of the TNFR polypeptide having the amino acid sequence
at positions
31 to 283 in SEQ ID N0:2 or 31 to 166 in SEQ ID N0:4, or as encoded by the
cDNA clone
contained in ATCC Deposit No. 97810 or 97809, wherein said fragment has has
TNFR-hoc
and/or TNFR-6(3 functional activity.
[0017] The polypeptides of the present invention also include polypeptides
having an
amino acid sequence at least 80% identical, more preferably at least 85%
identical, and still
more preferably 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to those
described in (a),
(b), (c) or (d) above, as well as polypeptides having an amino acid sequence
with at least 90%
similarity, and more preferably at least 80%, 85%, 90%, 92%, or 95%
similarity, to those
above.
[0018] An additional embodiment of this aspect of the invention relates to a
peptide or
polypeptide which comprises the amino acid sequence of an epitope-bearing
portion of a
TNFR polypeptide having an amino acid sequence described in (a), (b), (c) or
(d), above.
Peptides or polypeptides having the amino acid sequence of an epitope-bearing
portion of a
TNFR polypeptide of the invention include portions of such polypeptides with
at least six or
seven, preferably at least nine, and more preferably at least about 30 amino
acids to about 50
amino acids, although epitope-bearing polypeptides of any length up to and
including the
entire amino acid sequence of a polypeptide of the invention described above
also are
included in the invention.
[0019] In another embodiment, the invention provides an isolated antibody that
binds
specifically to a TNFR polypeptide having an amino acid sequence described in
(a), (b), (c)
or (d) above. The invention further provides methods for isolating- antibodies
that bind
specifically to a TNFR polypeptide having an amino acid sequence as described
herein.
Such antibodies are useful diagnostically or therapeutically as described
below.
[0020] Tumor Necrosis Factor (TNF) family ligands are known to be among the
most
pleiotropic cytokines, inducing a large number of cellular responses,
including cytotoxicity,
anti-viral activity, immunoregulatory activities, and the transcriptional
regulation of several
genes. The invention also provides for pharmaceutical compositions comprising
TNFR
polypeptides, particularly human TNFR polypeptides, which may be employed, for
instance,
6
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
to treat infectious disease including HIV infection, endotoxic shock, cancer,
autoimmune
diseases, graft vs. host disease, acute graft rejection, chronic graft
rejection,
neurodegenerative disorders, myelodysplastic syndromes, ischemic injury (e.g.,
ischemic
cardiac injury), toxin-induced liver disease, septic shock, cachexia and
anorexia. Methods of
treating individuals in need of TNFR polypeptides are also provided.
[0021] The invention further provides compositions comprising a TNFR
polynucleotide
or a TNFR polypeptide for administration to cells in vitro, to cells ex vivo
and to cells in
vivo, or to a multicellular organism. In certain particularly preferred
embodiments of this
aspect of the invention, the compositions comprise a TNFR polynucleotide for
expression of
a TNFR polypeptide in a host organism for treatment of disease. Particularly
preferred in this
regard is expression in a human patient for treatment of a dysfunction
associated with
aberrant endogenous activity of a TNFR polypeptide.
[0022] In another aspect, a screening assay for agonists and antagonists is
provided which
involves determining the effect a candidate compound has on TNFR polypeptide
binding to a
TNF-family ligand. In particular, the method involves contacting the TNF-
family ligand
with a TNFR polypeptide and a candidate compound and determining whether TNFR
polypeptide binding to the TNF-family ligand is increased or decreased due to
the presence
of the candidate compound. In this assay, an increase in binding of a TNFR
polypeptide over
the standard binding indicates that the candidate compound is an agonist of
TNFR
polypeptide binding activity and a decrease in TNFR polypeptide binding
compared to the
standard indicates that the compound is an antagonist of TNFR polypeptide
binding activity.
[0023] TNFR-6 alpha and TNFR-6 beta are expressed in endothelial cells,
keratinocytes,
normal prostate and prostate tumor tissue. For a number of disorders of these
tissues or cells,
particularly of the immune system, significantly higher or lower levels of
TNFR gene
expression may be detected in certain tissues (e.g., cancerous tissues) or
bodily fluids (e.g.,
serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual
having such a
disorder, relative to a "standard" TNFR gene expression level, i.e., the TNFR
expression
level in healthy tissue from an individual not having the immune system
disorder. Thus, the
invention provides a diagnostic method useful during diagnosis of such a
disorder, which
involves: (a) assaying TNFR gene expression level in cells or body fluid of an
individual; (b)
comparing the TNFR gene expression level with a standard TNFR gene expression
level,
7
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
whereby an increase or decrease in the assayed TNFR gene expression level
compared to the
standard expression level is indicative of disorder in the immune system.
[0024] An additional aspect of the invention is related to a method for
treating an
individual in need of an increased level of TNFR polypeptide activity in the
body comprising
administering to such an individual a composition comprising a therapeutically
effective
amount of an isolated TNFR polypeptide of the invention or an agonist thereof.
[0025] A still further aspect of the invention is related to a method for
treating an
individual in need of a decreased level of TNFR polypeptide activity in the
body comprising,
administering to such an individual a composition comprising a therapeutically
effective
amount of a TNFR antagonist. Preferred antagonists for use in the present
invention are
TNFR-specific antibodies.
Brief Description of the Figures
[0026] Figure 1 shows the nucleotide sequence (SEQ ID NO:1) and deduced amino
acid
sequence (SEQ ID N0:2) of TNFR-hoc. The initial 30 amino acids (underlined)
are the
putative leader sequence.
[0027] Figure 2 shows the nucleotide sequence (SEQ m N0:3) and deduced amino
acid
sequence (SEQ ID N0:4) of TNFR-6(3. The initial 30 amino acids (underlined)
are the
putative leader sequence.
[0028] Figure 3 shows an alignment created by the Clustal method using the
Megaline
program in the DNAstar suite comparing the amino acid sequences of TNFR-6a
("TNFR-6
alpha" (SEQ ID N0:2)), and TNFR-6(3 ("TNFR-6 beta" (SEQ ID N0:4)) with other
TNF
receptors, as follows: TNFRl (SEQ ID N0:5); TNFR2 (SEQ ID N0:6); NGFR (SEQ ID
N0:7); LTbR (SEQ m N0:8); FAS (SEQ ID N0:9); CD27 (SEQ ID NO:10); CD30 (SEQ
ID N0:11); CD40 (SEQ ID NO:12); 4-1BB (SEQ ID N0:13); OX40 (SEQ ID NO:14);
VC22 (SEQ ID N0:15); and CRMB (SEQ 117 N0:16).
[0029] Figures 4 and 5 show separate analyses of the TNFR-6 alpha and TNFR-6
beta
amino acid sequences, respectively. Alpha, beta, turn and coil regions;
hydrophilicity;
amphipathic regions; flexible regions; antigenic index and surface probability
are shown, as
predicted for the amino acid sequence of SEQ ID N0:2 and SEQ ID N0:4,
respectively,
using the default parameters of the recited computer programs. In the
"Antigenic Index -
8
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Jameson-Wolf" graph, which indicates the location of the highly antigenic
regions of TNFR-
6oc and TNFR-6(3, i.e., regions from which epitope-bearing peptides of the
invention may be
obtained. Antigenic regions of TNFR-6a, incude from about Ala-31 to about Thr-
46, from
about Phe-57 to about Thr-117, from about Cys-132 to about Thr-175, from about
Gly-185 to
about Thr-194, from about Val-205 to about Asp-217, from about Pro-239 to
about Leu-264,
and from about Ala-283 to about Pro-298 (SEQ ID N0:2). Antigenic regions of
TNFR-6(3,
include from about Ala-31 to about Thr-46, from about Phe-57 to about Gln-80,
from about
Glu-86 to about His-106, from about Thr-108 to about Phe-119, from about His-
129 to about
Val-138, and from about Gly-142 to about Pro-166 (SEQ ID N0:4). These
polypeptide
fragments have been determined to bear antigenic epitopes of the TNFR-6 alpha
and TNFR-6
beta polypeptides by the analysis of the Jameson-Wolf antigenic index.
[0030] The data presented in Figures 4 and 5 are also represented in tabular
form in
Tables I and II, respectively. The columns are labeled with the headings
"Res", "Position",
and Roman Numerals I-XIV. The column headings refer to the following features
of the
amino acid sequence presented in Figure 4, (Table I) and Figure 5 (Table II):
"Res": amino
acid residue of SEQ ID N0:2 (Figure 1) or SEQ ID N0:4 (Figure 2); "Position":
position of
the corresponding residue within of SEQ ID N0:2 (Figure 1) or SEQ 117 N0:4
(Figure 2); I:
Alpha, Regions - Gamier-Robson; II: Alpha, Regions - Chou-Fasman; III: Beta,
Regions -
Garnier-Robson; IV: Beta, Regions - Chou-Fasman; V: Turn, Regions - Gamier-
Robson; VI:
Turn, Regions - Chou-Fasman; VII: Coil, Regions - Gamier-Robson; VIII:
Hydrophilicity
Plot - Kyte-Doolittle; IX: Hydrophobicity Plot - Hopp-Woods; X: Alpha,
Amphipathic
Regions - Eisenberg; XI: Beta, Amphipathic Regions - Eisenberg; XII: Flexible
Regions -
Karplus-Schulz; XIII: Antigenic Index - Jameson-Wolf; and XIV: Surface
Probability Plot -
Emini.
[0031] Figure 6 shows the nucleotide sequences of HELDI06R (SEQ ID NO:17) and
HCEOW38R (SEQ ID N0:18) which are related to SEQ ID NOS:1 and 3.
[0032] Figures 7A-B show TNFR6 alpha blocking of Fas ligand mediated cell
death.
Jurkat T-cells were treated with a combination of Fas ligand and TNFR 6 alpha
Fc receptor
for 16 hours. To measure the levels of viable cells after treatment, cells
were incubated for 5
hours with 10% ALOMAR blue and examined spectrophotometrically at OD 570nm-
630nm.
9
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
AlI samples were tested in triplicate. TNFR6 alpha-Fc appears to block Fas
ligand mediated
apoptosis of Jurkat cells in a dose dependent manner as effectively as Fas
ligand.
Detailed Description
[0033] The present invention provides isolated nucleic acid molecules
comprising, or
alternatively consisting of, a polynucleotide,encoding a TNFR-6a or -6[3
polypeptide,
generically "TNFR polypeptide(s)" having the amino acid sequence shown in SEQ
ID NOS:2
and 4, respectively, which were determined by sequencing cloned cDNAs. The
nucleotide
sequences shown in Figures 1 and 2 (SEQ m NOS:1 and 3) were obtained by
sequencing the
HPHAE52 and HTPCH84 clones, respectively, which were deposited on November 22,
1996
at the American Type Culture Collection, 10801 University Boulevard,
Mantissas, Virginia
20110-2209 and given accession numbers ATCC 97810 and 97809, respectively. The
deposited clones are contained in the pBluescript SK(-) plasmid (Stratagene,
La Jolla, CA).
[0034] The TNFR-6 alpha and TNFR-6 beta proteins of the present invention are
splice
variants which share an identical nucleotide and amino acid sequence over the
N-terminal
142 residues of the respective proteins. The amino acid sequences of these
proteins are about
23% similar to and share multiple conserved cysteine rich domains with the
translation
product of the human TNFR-2 mRNA (Figure 3) (SEQ 1D NO:6). Importantly, these
proteins share substantial sequence similarity over a polypeptide sequence
including four
repeated cysteine rich motifs with significant intersubunit homology. TNFR-2
is thought to
exclusively mediate human T-cell proliferation by TNF (PCT WO/94109137).
Nucleic Acid Molecules
[0035] Unless otherwise indicated, all nucleotide sequences determined by
sequencing a
DNA molecule herein were determined using an automated DNA sequencer (such as
the
Model 373 from Applied Biosystems, Inc., Foster City, CA), and all amino acid
sequences of
polypeptides encoded by DNA molecules determined herein were predicted by
translation of
a DNA sequence determined as above. Therefore, as is known in the art for any
DNA
sequence determined by this automated approach, any nucleotide sequence
determined herein
may contain some errors. Nucleotide sequences determined by automation are
typically at
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
least about 90% identical, more typically at least about 95% to at least about
99.9% identical
to the actual nucleotide sequence of the sequenced DNA molecule. The actual
sequence can
be more precisely determined by other approaches including manual DNA
sequencing
methods well known in the art. As is also known in the art, a single insertion
or deletion in a
determined nucleotide sequence compared to the actual sequence will cause a
frame shift in
translation of the nucleotide sequence such that the predicted amino acid
sequence encoded
by a determined nucleotide sequence will be completely different from the
amino acid
sequence actually encoded by the sequenced DNA molecule, beginning at the
point of such
an insertion or deletion.
[0036] By "nucleotide sequence" of a nucleic acid molecule or polynucleotide
is
intended, for a DNA molecule or polynucleotide, a sequence of
deoxyribonucleotides, and for
an RNA molecule or polynucleotide, the corresponding sequence of
ribonucleotides (A, G, C
and U), where each thymidine deoxyribonucleotide (T) in the specified
deoxyribonucleotide
sequence is replaced by the ribonucleotide uridine (U).
[0037] Using the information provided herein, such as the nucleotide sequences
in
Figures 1 and 2 (SEQ >D NOS:1 and 3), a nucleic acid molecule of the present
invention
encoding a TNFR polypeptide may be obtained using standard cloning and
screening
procedures, such as those for cloning cDNAs using mRNA as starting material.
Illustrative
of the invention, the TNFR-6a and TNFR-6(3 clones (Figures 1 and 2,
respectively) were
identified in cDNA libraries from the following tissues: endothelial cells,
keratinocytes,
normal prostate tissue, and prostate tumor tissue.
[0038] The determined nucleotide sequences of the TNFR cDNAs of Figures 1 and
2
(SEQ >D NOS:1 and 3) contain open reading frames encoding proteins of 300 and
170 amino
acid residues, with an initiation codon at nucleotide positions 25-27 and 73-
75 of the
nucleotide sequences in Figures 1 and 2 (SEQ JD NOS:l and 3), respectively.
[0039] The open reading frames of the TNFR-6a and TNFR-6(3 genes share
sequence
homology with the translation product of the human mRNA for TNFR-2, including
the
soluble extracellular domain of about residues 3I-283 of SEQ )D N0:2 and 31-
166 of SEQ
ID N0:4, respectively.
[0040] As one of ordinary skill would appreciate, due to the possibilities of
sequencing
errors discussed above, the actual complete TNFR polypeptides encoded by the
deposited
11
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
cDNAs, which comprise about 300 and 170 amino acids, may be somewhat longer or
shorter.
More generally, the actual open reading frames may be anywhere in the range of
~20 amino
acids, more likely in the range of ~10 amino acids, of that predicted from the
first methionine
codon from the N-terminus shown in Figures 1 and 2 (SEQ ID NOS:1 and 3), which
is in-
frame with the translated sequences shown in each respective figure. It will
further be
appreciated that, depending on the analytical criteria used for identifying
various functional
domains, the exact "address" of the extracellular and transmembrane domains)
of the TNFR
polypeptides may differ slightly from the predicted positions above. For
example, the exact
location of the extracellular domain or antigenic regions in SEQ ID N0:2 and
SEQ ID N0:4
may vary slightly (e.g., the address may "shift" by about 1 to about 20
residues, more likely
about 1 to about 5 residues) depending on the criteria used to define the
domains and
antigenic regions. In any event, as di$cussed further below, the invention
further provides
polypeptides having various residues deleted from the N-terminus of the
complete
polypeptide, including polypeptides lacking one or more amino acids from the N-
terminus of
the extracellular domain described herein, which constitute soluble forms of
the extracellular
domains of the TNFR-hoc and TNFR-6(3 proteins.
[0041] The amino acid sequences of the complete TNFR proteins include a leader
sequence and a mature protein, as shown in SEQ m NOS:2 and 4. More in
particular, the
present invention provides nucleic acid molecules encoding mature forms of the
TNFR
proteins. Thus, according to the signal hypothesis, once export of the growing
protein chain
across the rough endoplasmic reticulum has been initiated, proteins secreted
by mammalian
cells have a signal or secretory leader sequence which is cleaved from the
complete
polypeptide to produce a secreted "mature" form of the protein. Most mammalian
cells and
even insect cells cleave secreted proteins with the same specificity. However,
in some cases,
cleavage of a secreted protein is not entirely uniform, which results in two
or more mature
species of the protein. Further, it has long been known that the cleavage
specificity of a
secreted protein is ultimately determined by the primary structure of the
complete protein,
that is, it is inherent in the amino acid sequence of the polypeptide.
Therefore, the present
invention provides a nucleotide sequence encoding a mature TNFR polypeptide
having the
amino acid sequence encoded by a cDNA clone identified as ATCC Deposit No.
97810 or
9709. By the "mature TNFR polypeptides having the amino acid sequence encoded
by a
12
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97810, or
97809" is
meant the mature forms) of the protein produced by expression in a mammalian
cell (e.g.,
COS cells, as described below) of the complete open reading frame encoded by
the human
DNA sequence of the clone contained in the deposited vector.
[0042] In addition, methods for predicting whether a protein has a secretory
leader as
well as the cleavage point for that leader sequence are available. For
instance, the method of
McGeoch (Virus Res. 3:271-286 (1985)) uses the information from a short N-
terminal
charged region and a subsequent uncharged region of the complete (uncleaved)
protein. The
method of von Heinje (Nucleic Acids Res. 14:4683-4690 (1986)) uses the
information from
the residues surrounding the cleavage site, typically residues -13 to +2 where
+1 indicates the
amino terminus of the mature protein. The accuracy of predicting the cleavage
points of
known mammalian secretory proteins for each of these methods is in the range
of 75-80%
(von Heinje, supra). However, the two methods do not always produce the same
predicted
cleavage points) for a given protein.
[0043] In the present case, the deduced amino acid sequence of the complete
TNFR
polypeptides were analyzed by a computer program "PSORT", available from Dr.
Kenta
Nakai of the Institute for Chemical Research, Kyoto University (see K. Nakai
and M.
Kanehisa, Gefzomics 14: 897-911 (1992)), which is an expert system for
predicting the
cellular location of a protein based on the amino acid sequence. As part of
this computational
prediction of localization, the methods of McGeoch and von Heinje are
incorporated. The
analysis of the TNFR amino acid sequences by this program provided the
following results:
TNFR-hoc & TNFR-6(3 encode mature polypeptides having the amino acid sequences
of
residues 31-300 and 31-170 of SEQ ID NOS:2 and 4, respectively.
[0044] In certain preferred embodiments, TNFR-hoc & TNFR-6~3 encode mature
polypeptides having the amino acid sequences of residues 31-299 and 31-169 of
SEQ ID
NOS:2 and 4, respectively.
[0045] As indicated, nucleic acid molecules of the present invention may be in
the form
of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and
genomic
DNA obtained by cloning or produced synthetically. The DNA may be double-
stranded or
single-stranded. Single-stranded DNA or RNA may be the coding strand, also
known as the
sense strand, or it may be the non-coding strand, also referred to as the anti-
sense strand.
13
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0046] By "isolated" nucleic acid molecules) is intended a nucleic acid
molecule, DNA
or RNA, which has been removed from its native environment For example,
recombinant
DNA molecules contained in a vector are considered isolated for the purposes
of the present
invention. Further examples of isolated DNA molecules include recombinant DNA
molecules maintained in heterologous host cells or purified (partially or
substantially) DNA
molecules in solution. Isolated RNA molecules include in vivo or if2 vitro RNA
transcripts of
the DNA molecules of the present invention. However, a nucleic acid contained
in a clone
that is a member of a mixed clone library (e.g., a genomic or cDNA library)
and that has not
been isolated from other clones of the library (e.g., in the form of a
homogeneous solution
containing the clone without other members of the library) or a chromosome
isolated or
removed from a cell or a cell lysate (e.g., a "chromosome spread", as in a
karyotype), is not
"isolated" for the purposes of this invention. As discussed further herein,
isolated nucleic
acid molecules according to the present invention may be produced naturally,
recombinantly,
or synthetically.
[0047] Isolated nucleic acid molecules of the present invention include DNA
molecules
comprising an open reading frame (ORF) with an initiation codon at positions
25-27 and 73-
75 of the nucleotide sequences shown in SEQ ID NOS:1 and 3, respectively.
[0048] Also included are DNA molecules comprising the coding sequence for the
predicted mature TNFR polypeptides shown at positions 31-300 and 31-170 of SEQ
ID
NOS:2 and 4, respectively.
[0049] Also included are DNA molecules comprising the coding sequence for the
predicted mature TNFR polypeptides shown at positions 31-299 and 31-169 of SEQ
ID
NOS:2 and 4, respectively.
[0050] In specific embodiments, the present invention encompasses isolated
nucleic acid
molecules comprising a polynucleotide sequence encoding exon 1 of TNFR-6
alpha, (i.e., a
polynucleotide sequence comprising nucleotides 1-424 of SEQ ID N0:28 which
corresponds
to nucleotides 25-448 of SEQ )D NO:I). In other embodiments, the present
invention
encompasses isolated nucleic acid molecules comprising a polynucleotide
sequence encoding
exon 2 of TNFR-6 alpha, (i.e., a polynucleotide sequence comprising
nucleotides 561-755 of
SEQ 1D N0:28 which corresponds to nucleotides 449-643 of SEQ ID NO:1). In
other
embodiments, the present invention encompasses isolated nucleic acid molecules
comprising
a polynucleotide sequence encoding exon 3 of TNFR-6 alpha, (i.e., a
polynucleotide
14
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
sequence comprising nucleotides 1513-1793 of SEQ ID N0:28 which corresponds to
nucleotides 644-924 of SEQ ID N0:1).
[0051] In still other embodiments, the present invention comprises isolated
nucleic acid
molecules comprising a polynucleotide sequence encoding exons 1 and 2 of TNFR-
6 alpha.
In other embodiments, the present invention comprises isolated nucleic acid
molecules
comprising a polynucleotide sequence encoding exons 1 and 3 of TNFR-6 alpha.
In other
embodiments, the present invention comprises isolated nucleic acid molecules
comprising a
polynucleotide sequence encoding exons 2 and 3 of TNFR-6 alpha.
[0052] In addition, isolated nucleic acid molecules of the invention include
DNA
molecules which comprise a sequence substantially different from those
described above but
which, due to the degeneracy of the genetic code, still encode a TNFR protein.
Of course, the
genetic code and species-specific codon preferences are well known in the art.
Thus, it
would be routine for one skilled in the art to generate the degenerate
variants described
above, for instance, to optimize codon expression for a particular host (e.g.,
change codons in
the human mRNA to those preferred by a bacterial host such as E. coli).
[0053] In another aspect, the invention provides isolated nucleic acid
molecules encoding
a TNFR polypeptide having an amino acid sequence encoded by the cDNA clone
contained
in the plasmid deposited as ATCC Deposit No. 97810 or 97809. Preferably, this
nucleic acid
molecule will encode the mature polypeptide encoded by the above-described
deposited
cDNA clone.
[0054] The invention further provides an isolated nucleic acid molecule having
the
nucleotide sequence shown in Figure 1 or 2 (SEQ ID NO:1 or 3) or the
nucleotide sequence
of the TNFR cDNAs contained in the above-described deposited clones, or a
nucleic acid
molecule having a sequence complementary to one of the above sequences. Such
isolated
molecules, particularly DNA molecules, are useful, for example, as probes fox
gene mapping
by in situ hybridization with chromosomes, and for detecting expression of the
TNFR genes
in human tissue, for instance, by Northern blot analysis.
[0055] The present invention is further directed to nucleic acid molecules
encoding
portions of the nucleotide sequences described herein as well as to fragments
of the isolated
nucleic acid molecules described herein. In particular, the invention provides
polynucleotides having a nucleotide sequence representing the portion of SEQ
ID NO:1 or 3
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
which consist of positions 25-924 and 73-582 of SEQ ID NOS:1 and 3,
respectively. Also
contemplated are polynucleotides encoding TNFR polypeptides which lack an
amino
terminal methionine such polynucleotides having a nucleotide sequence
representing the
portion of SEQ ID NOS:1 and 3 which consist of positions 28-924 and 76-582,
respectively.
Polypeptides encoded by such polynucleotides are also provided, such
polypeptides
comprising an amino acid sequence at positions 2-300 and 2-170 of SEQ ID NOS:2
and 4,
respectively.
[0056] In addition, the invention provides nucleic acid molecules having
nucleotide
sequences related to extensive portions of SEQ 117 NOS:l and 3 as follows:
HELDI06R
(SEQ ID N0:17) and HCEOW38R (SEQ ID N0:18) are related to both SEQ ID NOS:l
and
3. Preferred are polynucleotide fragments of SEQ ID NOS:l and 3 which are not
SEQ ID
N0:17 or 18 or subfragments of either SEQ ID N0:17 or 18. The sequences of
HELDI06R
and HCEOW38R are shown in Figure 6.
[0057] More generally, by a fragment of an isolated nucleic acid molecule
having the
nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in
Figures 1 or
2 (SEQ ID NOS:l or 3) is intended fragments at least about 15 nt, and more
preferably at
least about 20 nt, still more preferably at least about 30 nt, and even more
preferably, at least
about 40 nt in length. These fragments have numerous uses, which include, but
are not
limited to, as diagnostic probes and primers as discussed herein. Of course,
larger fragments
50-300 nt in length are also useful according to the present invention as are
fragments
corresponding to most, if not all, of the nucleotide sequence of the deposited
cDNAs or as
shown in Figures 1 and 2 (SEQ ID NOS:1 and 3). Especially preferred are
fragments
comprising at least 500 nucleotides which are at least 80%, 85%, 90%, 92%, or
95% identical
to 500 contiguous nucleotides shown in SEQ ID NO:1. By a fragment at least
about 20 nt in
length, for example, is intended fragments which include 20 or more contiguous
bases from
the nucleotide sequence of a deposited cDNA or the nucleotide sequence as
shown in Figures
1 and 2 (SEQ ID NOS:1 and 3). In this context "about" includes the
particularly recited size,
and those sizes that are larger or smaller by several (5, 4, 3, 2, or 1)
nucleotides, at either
terminus or at both termini. Preferred nucleic acid fragments of the present
invention include
nucleic acid molecules encoding epitope-bearing portions of the TNFR
polypeptides as
identified in Figures 4 and 5 and described in more detail below.
16
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0058] Representative examples of TNFR-6cc nucleic acid fragments of the
invention
include, for example, fragments that comprise, or alternatively, consist of, a
sequence from
about nucleotide 1 to about nucleotide 25, about nucleotide 26 to about
nucleotide 75, about
nucleotide 76 to about nucleotide 114, about nucleotide 115 to about
nucleotide 162, about
nucleotide 163 to about nucleotide 216, about nucleotide 217 to about
nucleotide 267, about
nucleotide 268 to about nucleotide 318, about nucleotide 319 to about
nucleotide 369, about
nucleotide 370 to about nucleotide 420, about nucleotide 421 to about
nucleotide 471, about
nucleotide 472 to about nucleotide 522, about nucleotide 523 to about
nucleotide 573, about
nucleotide 574 to about nucleotide 625, about nucleotide 626 to about
nucleotide 675, about
nucleotide 676 to about nucleotide 714, about nucleotide 715 to about
nucleotide 765, about
nucleotide 766 to about nucleotide 816, about nucleotide 817 to about
nucleotide 867, about
nucleotide 868 to about nucleotide 924, about nucleotide 925 to about
nucleotide 975 of SEQ
ID NO:1, or the complementary strand thereto, or the cDNA contained in the
plasmid
deposited as ATCC Deposit No. 97810. In this context "about" includes the
particularly
recited ranges, and those ranges that are larger or smaller by several (5, 4,
3, 2, or 1)
nucleotides, at either terminus or at both termini.
[0059] In specific embodiments, the nucleic acid fragments of the invention
comprise, or
alternatively, consist of, a polynucleotide sequence encoding amino acid
residues 100 to 150,
150 to 200, 200 to 300, 220 to 300, 240 to 300, 250 to 300, 260 to 300, and/or
280 to 300, of
SEQ ID N0:2, or the complementary strand thereto. Polynucleotides that
hybridize to these
polynucleotide fragments are also encompassed by the invention.
[0060] Representative examples of TNFR--6(3 nucleic acid fragments of the
invention
include, for example, fragments that comprise, or alternatively, consist of, a
sequence from
about nucleotide 1 to about nucleotide 36, about nucleotide 37 to about
nucleotide 72, about
nucleotide 73 to about nucleotide 123, about nucleotide 124 to about
nucleotide 175, about
nucleotide 176 to about nucleotide 216, about nucleotide 217 to about
nucleotide 267, about
nucleotide 268 to about nucleotide 318, about nucleotide 319 to about
nucleotide 369, about
nucleotide 370 to about nucleotide 420, about nucleotide 421 to about
nucleotide 471, about
nucleotide 472 to about nucleotide 522, about nucleotide 523 to about
nucleotide 582, about
nucleotide 583 to about nucleotide 622, about nucleotide 623 to about
nucleotide 682, about
nucleotide 683 to about nucleotide 750, about nucleotide 751 to about
nucleotide 800, about
17
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
nucleotide 801 to about nucleotide 850, about nucleotide 851 to about
nucleotide 900, about
nucleotide 901 to about nucleotide 950, about nucleotide 951 to about
nucleotide 1000, about
nucleotide 1001 to about nucleotide 1050, about nucleotide 1051 to about
nucleotide 1100,
about nucleotide1101 to about nucleotide 1150, about nucleotide 1151 to about
nucleotide
1200, about nucleotide 1201 to about nucleotide 1250, about nucleotide 1251 to
about
nucleotide 13000, about nucleotide 1301 to about nucleotide 1350, about
nucleotide 1351 to
about nucleotide 1400, about nucleotide1401 to about nucleotide 1450, about
nucleotide
1451 to about nucleotide 1500, about nucleotide 1501 to about nucleotide 1550,
about
nucleotide 1551 to about nucleotide 1600 about nucleotide 1601 to about
nucleotide 1650,
about nucleotide 1651 to about nucleotide 1667 of SEQ 117 N0:3, or the
complementary
strand thereto, or the cDNA contained in the plasmid deposited as ATCC Deposit
No. 97809.
In this context "about" includes the particularly recited ranges, and those
ranges that arelarger
or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at
both termini.
[0061] In specific embodiments, the nucleic acid fragments of the invention
comprise, or
alternatively, consist of, a polynucleotide sequence encoding amino acid
residues 50 to 100,
100 to 170, 110 to 170, 130 to 170, 140 to 170, 150 to 170, and/or 160 to 170,
of SEQ ID
N0:4, or the complementary strand thereto. Polynucleotides that hybridize to
these
polynucleotide fragments are also encompassed by the invention.
[0062] Preferably, the polynucleotide fragments of the invention encode a
polypeptide
which demonstrates a TNFR-hoc and/or TNFR-6(3 functional activity. By a
polypeptide
demonstrating "functional activity" is meant, a polypeptide capable of
displaying one or
more known functional activities associated with a complete (full-length) or
mature TNFR-
6oc and/or TNFR -6(3 polypeptide. Such functional activities include, but are
not limited to,
biological activity (e.g., inhibition or reduction of Fast mediated apoptosis,
inhibition or
reduction of AIM-II mediated apoptosis), antigenicity [ability to bind (or
compete with a
TNFR-6a and/or TNFR -6~3 polypeptide for binding) to an anti-TNFR-6o~ antibody
and/or
anti-TNFR -6(3 antibody], immunogenicity (ability to generate antibody which
binds to a
TNFR-6a and/or TNFR -6(3 polypeptide), ability to form multimers with TNFR-6a
and/or
TNFR -6(3 polypeptides of the invention, and ability to bind to a receptor or
ligand for a
TNFR-hoc and/or TNFR -6(3 polypeptide (e.g., Fas ligand and/or AIM-II
(International
application publication number WO 97/34911, published September 25, 1997)) .
18
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0063] The functional activity of TNFR-6a and/or TNFR -6(3 polypeptides, and
fragments, variants derivatives, and analogs thereof, can be assayed by
various methods.
[0064] For example, in one embodiment where one is assaying for the ability to
bind or
compete with complete (full-length) or mature TNFR-6a and/or TNFR-6(3
polypeptide fox
binding to anti-TNFR-6a andlor anti-TNFR-6(3 antibody, various immunoassays
known in
the art can be used, including but not limited to, competitive and non-
competitive assay
systems using techniques such as radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoradiometric assays, gel
diffusion
precipitation reactions, immunodiffusion assays, ifz situ immunoassays (using
colloidal gold,
enzyme or radioisotope labels, for example), western blots, precipitation
reactions,
agglutination assays (e.g., gel agglutination assays, hemagglutination
assays), complement
fixation assays, immunofluorescence assays, protein A assays, and
immunoelectrophoresis
assays, etc. In one embodiment, antibody binding is detected by detecting a
label on the
primary antibody. In another embodiment, the primary antibody is detected by
detecting
binding of a secondary antibody or reagent to the primary antibody. In a
further embodiment,
the secondary antibody is labelled. Many means are known in the art for
detecting binding in
an immunoassay and are within the scope of the present invention.
[0065] In another embodiment, where a TNF-ligand is identified (e.g., Fas
Ligand and/or
AIM-II (International application publication number WO 97/34911, published
September
25, 1997)), or the ability of a polypeptide fragment, variant or derivative of
the invention to
multimerize is being evaluated, binding can be assayed, e.g., by means well-
known in the
art, such as, for example, reducing and non-reducing gel chromatography,
protein affinity
chromatography, and affinity blotting. See generally, Phizicky, E., et al.,
Microbiol. Rev.
59:94-123 (1995). In another embodiment, physiological correlates of TNFR-6o~
and/or
TNFR -6(3 binding to its substrates (signal transduction) can be assayed.
[0066] In addition, assays described herein (e.g., see Examples 7 -9) and
otherwise
known in the art may routinely be applied or modified to measure the ability
of TNFR-6a
and/or TNFR -6(3 polypeptides and fragments, variants derivatives and analogs
thereof, to
elicit TNFR-hoc and/or TNFR-6(3 related biological activity (e.g., to inhibit
or reduce Fast
mediated apoptosis in vitro oY in vivo, or to inhibit or reduce AIM-II
mediated apoptosis ifa
VltYO OY Z12 VlVO).
19
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0067] For example, the ability of TNFR polypeptides of the invention to
reduce or block
Fast mediated apoptosis can be assayed using a Fas expressing T-cell line,
such as Jurkat. In
this assay, Jurkat cells treated with soluble Fast undergo apoptosis.
Pretreatment of cells
with TNFR and/or TNFR agonists prior to addition of Fast protects cells from
undergoing
apoptosis and results in a reduced level of apoptosis when compared to that
observed when
the same concentration of soluble Fast is contacted with the same
concentration of the Fas
expressing cells in the absence of the TNFR polypeptide or TNFR agonist.
Alternatively
mixing of the Fast protein with TNFR andlor TNFR agonist will also block the
ability of
Fast to bind the Jurkat cells and mediate apoptosis (see, e.g., Example 9).
[0068] In contrast, TNFR antagonists of the invention block TNFR mediated
inhibition
of Fast mediated apoptosis. Accordingly, TNFR antagonists of the invention can
be assayed,
for example, by combining the mature TNFR (known to bind FasL), the TNFR
antagonist to
be tested, and soluble Fast, and contacting this combination with the Fas
expressing cell line.
TNFR antagonists reduce or block TNFR mediated inhibition of Fast mediated
apoptosis.
Accordingly, Fas expressing T cells contacted with mature TNFR, TNFR
antagonist and
soluble Fast exhibit elevated apoptosis levels when compared with the same
concentration of
Fas expressing cells that have been contacted with the same concentrations of
mature TNFR
and Fast in the absence of the TNFR antagonist.
[0069] Apoptosis can be measured, for example, by increased staining with
Annexin,
which selectively binds apoptotic cells. In another example, the decrease in
cell numbers due
to apoptosis can be detected by a decrease in ALOMAR blue staining which
detects viable
cells.
[0070] Other methods will be known to the skilled artisan and are within the
scope of the
invention.
[0071] In additional embodiments, the polynucleotides of the invention encode
functional
attributes of TNFR-6a and/or TNFR -6(3. Preferred embodiments of the invention
in this
regard include fragments that comprise alpha-helix and alpha-helix forming
regions
("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"),
turn and
turn-forming regions ("turn-regions"), coil and coil-forming regions ("coil-
regions"),
hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
regions, flexible regions, surface-forming regions and high antigenic index
regions of TNFR-
6a andlor TNFR -6(3 polypeptides.
[0072] Certain preferred regions in this regard are set out in Figure 4 (Table
I) and Figure
(Table II). The data presented in Figures 4 and Figure 5 and that presented in
Table I and
Table II, respectively, merely present a different format of the same results
obtained when the
amino acid sequence of SEQ ID N0:2 and the amino acid sequence of SEQ ID N0:4
is
analyzed using the default parameters of the DNA*STAR computer algorithm.
[0073] The above-mentioned preferred regions set out in Figure 4 (Table I)
and'Figure 5
(Table II) include, but are not limited to, regions of the aforementioned
types identified by
analysis of the amino acid sequence set out in Figure 1 and Figure 2. As set
out in Figure 4
(Table I) and Figure 5 (Table II), such preferred regions include Gamier-
Robson
alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-
regions,
beta-regions, and coil-regions, Kyte-Doolittle hydrophilic regions, Eisenberg
alpha- and
beta-amphipathic regions, Karplus-Schulz flexible regions, Emini surface-
forming regions
and Jameson-Wolf regions of high antigenic index. Among highly preferred
polynucleotides
in this regard are those that encode polypeptides comprising regions of TNFR-
6~ and/or
TNFR-6(3 that combine several structural features, such as several (e.g., l,
2, 3 , or 4) of the
features set out above.
[0074] Additionally, the data presented in columns VIII, TX, XIII, and XIV of
Tables I
and II can routinely be used to determine regions of TNFR-6 ~ which exhibit a
high degree of
potential for antigenicity. Regions of high antigenicity are determined from
the data
presented in columns VIII, IX, XTII, and/or XIV by choosing values which
represent regions
of the polypeptide which are likely to be exposed on the surface of the
polypeptide in an
environment in which antigen recognition may occur in the process of
initiation of an
immune response.
21
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table I (con't)
ResPositionI II III IV V VI VIII IX X XI XIIXIII XIV
VII
Met1 . . B . . . . 0.06 0.09 * . . -0.100.60
Arg2 . . B . . . . 0.10 -0.34* . . 0.50 0.82
Ala3 . . B . . . . 0.28 -0.34* . . 0.50 0.63
Leu4 A . . . . . . 0.32 -0.34* . . 0.50 0.99
Glu5 A . . . . . . -0.10-0.53* . F 0.95 0.50
Gly6 . . . . . T C 0.20 0.16 * . F 0.45 0.41
Pro7 . . . . T T . -0.720.04 * . F 0.65 0.66
Gly8 . . . . T T . -0.940.04 . . F 0.65 0.32
Leu9 A . . . . T . -0.800.73 . . . -0.200.26
Ser10 A A . . . . . -1.610.87 . . . -0.600.09
Leu11 . A B . . . . -2.121.13 . . . -0.600.08
Leu12 . A B . . . . -2.721.34 . . . -0.600.07
Cys13 . A B . . . . -2.971.34 . . . -0.600.04
Leu14 . A B . . . . -2.971.46 . . . -0.600.05
Val15 . A B . . . . -2.881.46 . . . -0.600.05
Leu16 . A B . . . . -2.661.20 . . . -0.600.15
Ala17 . A B . . . . -2.661.13 . . . -0.600.18
Leu18 . A B . . . . -2.801.13 . . . -0.600.20
Pro19 A A . . . . . -2.201.17 . . . -0.600.20
Ala20 . A B . . . . -2.200.91 . . . -0.600.31
Leu21 . A B . . . . -1.601.06 . * . -0.600.28
Leu22 . A B . . . . -1.600.80 . . . -0.600.28
Pro23 . A B . . . . -1.640.87 . * . -0.600.28
Val24 . . B . . . . -1.321.02 . * . -0.400.25
Pro25 . . B . . . . -1.080.33 * . . -0.100.60
Ala26 . . B B . . . -1.120.07 . . . -0.300.38
Va127 . . B B . . . -0.900.29 * * . -0.300.38
Arg28 . . B B . . . -0.690.14 * * . -0.300.25
Gly29 . . B B . . . -0.14-0.29* * . 0.30 0.43
Val30 . . B B . . . -0.14-0.30* * . 0.30 0.83
Ala31 . . B B . . . 0.13 -0.51* * . 0.60 0.66
Glu32 . . B . . . . 0.74 -0.03* * F 0.65 0.96
Thr33 . . B . . T . 0.42 0.30 * * F 0.40 2.02
Pro34 . . . ~. T T . 0.48 0.09 * * F 0.80 3.10
Thr35 . . . . T T . 1.44 0.50 * . F 0.50 1.88
Tyr36 . . . . . T C 2.03 0.50 * . . 0.15 2.55
Pro37 . . . . T . . 1.44 0.01 * . . 0.45 2.76
Trp38 . A . . . . C 1.76 0.09 * . . 0.05 1.93
Arg39 . A B . . . . 1.66 -0.40* . F 0.60 2.13
Asp40 A A . . .~ . . 1.62 -0.67* . F 0.90 1.99
Ala41 . A . . . . C 1.87 -0.67* . F 2.10 1.87
Glu42 A A . . . . . 2.19 -1.59* * F 0.90 1.66
Thr43 A A . . . . . 1.67 -1.59* . F 0.90 1.94
Gly44 . A . . T . . 0.70 -0.90* . F 1.30 1.59
Glu45 A A . . . . . 0.03 -0.76* * F 0.75 0.68
Arg46 A A . . . . . 0.03 -0.19* . F 0.45 0.25
Leu47 A A . . . . . 0.03 -0.17* . . 0.30 0.26
Val48 . A B . . . . -0.32-0.20. . . 0.30 0.26
Cys49 . A B . . . . -0.190.37 . . . -0.300.07
Ala50 . A B . . . . -0.400.80 . . . -0.600.13
22
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table I (con't)
ResPositionI III IVV VIVTI VIII IX X XI XIIXIII XIV
II
Gln51 . B . . . . -0.860.54 . . . -0.600.28
A
Cys52 . B . . . . -0.360.33 . . . -0.300.51
A
Pro53 . . . . T C -0.200.24 . . F 0.45 0.73
.
Pro54 . . . T T . -0.390.53 . . F 0.35 0.36
.
Gly55 . . . T T . 0.20 0.77 * . F 0.35 0.50
.
Thr56 . B . . T . 0.31 0.60 . . F -0.050.56
.
Phe57 . B B . . . 0.77 0.17 * . F -0.150.71
.
Val58 . B B . . . 0.31 0.17 * . . 0.19 1.12
.
Gln59 . B B . . . 0.63 0.31 * . F 0.53 0.41
.
Arg60 . B . . T . 1.09 -0.17* . F 1.87 0.94
.
Pro61 . B . . T . 1.40 -0.96* . F 2.66 2.47
.
Cys62 . . . T T . 1.80 -1.60* . F 3.40 2.38
.
Arg63 . . . T T . 2.44 -1.61* . F 3.06 1.63
.
Arg64 . . . T . . 2.13 -1.19* . F 2.77 1.63
.
Asp65 . . . T . . 1.71 -1.13* . F 2.68 4.39
.
Ser66 . . . T T . 1.26 -1.21. . F 2.79 3.24
.
Pro67 . . . T T . 1.58 -0.64. . F 2.55 0.89
.
Thr68 . . . T T . 1.26 -0.21. . F 2.50 0.52
.
Thr69 . . . T T . 0.48 0.21 . . F 1.65 0.61
.
Cys70 . . . T . . 0.27 0.40 . . F 1.14 0.21
.
Gly71 . . . T T . 0.36 0.40 * * F 1.33 0.22
.
Pro72 . . . T T . 0.68 0.34 * . F 1.62 0.24
.
Cys73 . . . . T C 0.96 -0.14* . F 2.01 0.88
.
Pro74 . . . . T C 1.02 -0.21* . F 2.40 1.21
.
Pro75 . . . T T . 1.38 0.11 * * F 1.76 1.23
.
Arg76 . . . T T . 1.72 0.17 * * F 1.52 3.30
.
His77 . B . . T . 1.23 0.00 * * F 0.88 3.70
.
Tyr78 . B . . T . 1.61 0.36 * * . 0.49 2.07
.
Thr79 . B . . . . 1.82 0.84 * . . -0.251.11
.
Gln80 . B . . . . 1.79 1.24 * * . -0.251.31
.
Phe81 . . . T . . 0.87 1.50 * * . 0.15 1.31
.
Trp82 . . . T . . 0.90 1.43 * . . 0.00 0.75
.
Asn83 . . . T . . 1.26 0.94 * . . -0.200.75
A
Tyr84 . . . T . . 0.90 0.54 * * . -0.051.70
A
Leu85 . . . T . . 1.01 0.33 * * . 0.38 0.87
A
Glu86 . . . T . . 1.47 -0.59* * . 2.72 1.05
A
Arg87 . . . T . . 1.09 -0.23. * . 1.69 1.05
A
Cys88 . . . T T . 1.09 -0.41. * . 2.22 0.69
.
Arg89 . . . T T . 0.48 -0.70. * . 2.80 0.64
.
Tyr90 . . . T T . 0.48 -0.06. * . 2.22 0.24
.
Cys91 . . . T T . -0.190.63 . * . 1.04 0.37
.
Asn92 . B B . . , -0.640.63 . * . -0.040.10
.
Val93 . B B . . . 0.02 1.06 . * . -0.320.06
.
Leu94 . B B . , , 0.02 0.30 . . . -0.300.21
.
Cys95 . B . . T . 0.27 -0.27. . . 0.70 0.25
.
Gly96 . . . . T C 0.93 -0.67. . F 1.35 0.59
.
Glu97 A . . . T . 0.93 -1.31. . F 1.30 1.24
.
Arg98 A . . . T . 1.20 -2.00. * F 1.30 4.00
.
Glu99 A . . . . . 2.12 -2.07. * F 0.90 4.08
A
Glu100 A . . . . . 2.20 -2.50. * F 0.90 4.61
A
23
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table I (con't)
ResPositionI II III IV VI VII VIII IX X XI XIIXIII XIV
V
Glu101 A A . . . . 1.88 -2.00. * F 0.90 2.38
.
Ala102 A A . , . . 1.84 -1.43. . F 0.75 0.74
.
Arg103 A A . . . . 1.14 -0.93. . . 0.60 0.58
.
Ala104 A A . . . . 0.83 -0.43. * . 0.30 0.34
.
Cys105 A A . , . . 0.80 0.06 . * . -0.300.48
.
His106 A A . . . . 0.80 0.06 * * . -0.300.34
.
Ala107 A A . , . . 2.50 0.46 * * . -0.600.53
.
Thr108 A A . . . . 0.80 -0.04* * . 0.45 1.95
.
His109 . A . . . . 0.72 -0.11* . . 1.13 1.45
T
Asn110 . A . . . . 1.50 -0.04* . . 1.26 0.77
T
Arg111 . A . . . . 0.87 -0.54. * . 1.99 1.04
T
Ala112 . A . . . . 1.57 -0.46. * . 1.82 0.41
T
Cys113 . . . . T . 1.57 -0.96. * . 2.80 0.50
T
Arg114 . . B . T . 1.26 -0.87* * . 2.12 0.37
.
Cys115 . . . . T . 0.56 -0.44* * . 1.94 0.36
T
Arg116 . . . . T . -0.26-0.16. * . 1.66 0.58
T
Thr117 . A . B . . -0.260.06 . * F 0.53 0.26
T
Gly118 . A . B . . 0.38 0.56 . * . -0.200.49
T
Phe119 . A B B . . -0.320.49 . * . -0.600.34
.
Phe120 . A B B . . -0.000.99 . * . -0.600.24
.
Ala121 A A . B . . -0.810.93 . * . -0.600.24
.
His122 A A . . . . -1.171.29 . . . -0.600.24
.
Ala123 A A . . . . -1.631.07 . * . -0.600.15
.
Gly124 A A . . . . -0.930.97 . * . -0.600.12
.
Phe125 A A . . . . -0.270.47 . . . -0.600.15
.
Cys126 A A . . . . -0.270.47 . * . -0.600.20
.
Leu127 A A . . . . -0.530.47 . . . -0.600.21
.
Glu128 A A . . . . -0.610.43 . . . -0.600.32
.
His129 . . . . T . -0.480.21 . . . 0.50 0.32
T
Ala130 . . . . T . 0.01 0.07 . . . 0.63 0.61
T
Ser131 . . . . T . 0.33 -0.19. . . 1.36 0.54
T ~
Cys232 . . . . T C 0.56 0.24 . . . 0.69 0.39
.
Pro133 . . . . T C 0.21 0.24 . . F 0.97 0.39
.
Pro134 . . . . T . -0.610.17 . . F 1.30 0.29
T
Gly135 . . . . T . -0.910.43 . . F 0.87 0.40
T
Ala136 . . B . T . -1.200.54 . . . 0.19 0.18
.
Gly137 . . B B . . -0.740.61 . . . -0.340.12
.
Val138 . . B B . . -0.880.61 . . . -0.470.19
.
Ile139 . . B B . . -0.980.61 . . . -0.600.18
.
AIa140 . . B B . . -0.840.60 . . . -0.600.27
.
Pro141 . . B . . . -0.560.60 . . F -0.250.55
.
Gly142 . . . . . . -0.210.34 . . F 0.88 1.06
T
Thr143 . . . . T C 0.64 0.06 . . F 1.16 1.82
.
Pro144 . . . . T C 1.22 -0.04. . F 2.04 1.89
.
Ser145 . . . . T . 1.81 0.01 . . F 1.92 2.76
T
Gln146 . . . . T . 1.36 -0.01. . F 2.80 3.31
T
Asn147 . . . . T . 1.70 0.07 . . F 1.92 1.15
T
Thr148 . . . . T . 1.80 0.04 . . F 1.64 1.48
T
Gln149 . . . . T . 1.34 0.09 . . F 1.36 1.32
T
Cys150 . . B . T . 1.43 0.26 . . F 0.53 0.44
.
24
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table I (con't)
ResPositionII III IV VI VII VIII IX X XI XIIXIII XIV
I V
Gln151 . . B . . . 1.22 0.29 . . F 0.05 0.47
.
Pro152 . . B . . . 0.88 0.23 . * F 0.05 0.42
.
Cys153 . . B . . . 0.88 0.26 . * F 0.05 0.78
.
Pro154 . . B . T . 0.18 0.17 . * F 0.25 0.65
.
Pro155 . . . . T . 0.54 0.56 . * F 0.35 0.36
T
Gly156 . . . . T . .-0.040.51 . * F 0.35 0.91
T
Thr157 . . B , T . -0.130.44 . . F -0.050.59
.
Phe158 . . B . . . 0.23 0.40 . . F -0.250.51
.
Ser159 . . B . . . 0.14 0.36 . . F 0.39 0.70
' .
Ala16 . B . . . 0.06 0.31 . . F 0.73 0.65
0 . .
Ser161 . . . . T C 0.10 0.21 . . F 1.62 1.00
.
Ser162 . . . . T C 0.41 -0.19. . F 2.56 1.00
.
Ser163 . . . . T . 1.11 -0.57. . F 3.40 1.72
T
Ser164 . . . . T . 0.74 -0.67. . F 3.06 2.22
T
Ser165 . . . . . . 1.33 -0.49. . F 2.07 0.89
T
Glu166 . . . . . . 1.42 -0.47. . F 1.88 1.15
T
Gln167 . . . . . . 1.69 -0.43. . F 1.82 1.32
T
Cys168 . . . . . . 2.10 -0.31. . F 1.76 1.34
T
Gln169 . . B . . . 2.40 -0.70. . F 1.94 1.52
.
Pro170 . . . . . . 2.03 -0.30. . F 2.32 1.41
T
His171 . . . . T . 1.72 -0.13. . F 2.80 1.41
T
Arg172 . . . . T . 1.13 -0.21. . F 2.52 1.18
T
Asn173 . . . . T . 0.99 -0.11* . . 1.94 0.77
T
Cys174 . . B . T . 0.64 0.14 . . . 0.66 0.47
.
Thr175 . A B . . . 0.04 0.07 . . . -0.020.24
.
Ala176 . A B . . . -0.510.76 * . . -0.600.12
.
Leu177 . A B . . . -1.430.86 * . . -0.600.23
.
Gly178 . A B . . . -1.430.97 . * . -0.600.13
.
Leu179 . A B . . . -1.620.89 . * . -0.600.21
.
Ala180 . A B . . . -1.521.03 . * . -0.600.19
.
Leu181 . A B . . . -1.280.77 . * . -0.600.29
.
Asn182 . A B . . . -0.770.77 . * . -0.600.35
.
Val183 . . B . T . -0.720.47 . * F -0.050.46
.
Pro184 . . . . T C -0.210.36 . * F 0.73 0.75
.
Gly185 . . . . T . 0.34 0.06 . * F 1.21 0.63
T
Ser186 . . . . T . 1.16 0.16 . * F 1.64 1.15
T
Ser187 . . . . T C 0.84 -0.49. . F 2.32 1.24
.
Ser188 . . . . T . 0.89 -0.43. . F 2.80 1.81
T
His189 . . B . T . 0.43 -0.17. . F 2.12 1.11
.
Asp190 . . . . T . 0.47 0.01 . . F 1.49 0.45
T
Thr191 . . B . . . 0.47 0.11 . . F 0.61 0.48
.
Leu192 . . B . . . 0.10 0.11 . . . 0.18 0.47
.
Cys193 . . B . T . 0.09 0.19 . . . 0.10 0.15
.
Thr194 , . B . T . -0.220.67 . . . -0.200.15
.
Ser195 . . B . T . -0.920.61 * . F -0.050.18
.
Cys196 . . B . T . -0.820.71 . . F -0.050.29
.
Thr197 . . . . . . -0.820.57 . . F 0.15 0.31
T
Gly198 . . . . . . -0.460.77 . . . 0.00 0.19
T
Phe199 . . B . . . -0.460.77 . * . -0.400.48
.
Pro200 . . B . . . -0.040.69 * * . -0.400.48
.
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table I (con't)
ResPositionI II III IV V VI VIII TX X XI XIT XIII XIV
VII
Leu201 . . B . . . . -0.230.20 * * . -0.100.96
Ser202 . . B . . . . -0.130.41 * * F 0.02 0.82
Thr203 . . B . . . . -0.130.06 . * F 0.59 0.82
Arg204 . . . . . . C -0.020.06 . * F 1.06 0.99
Val205 . . . . . T C 0.19 -0.13. * F 2.13 0.74
Pro206 . . . . . T C 1.00 -0.51. * F 2.70 0.89
Gly207 . . . . . T C 0.63 -1.00. * F 2.43 0.79
Ala208 A . . . . T . 0.94 -0.43. * F 1.66 0.57
Glu209 A A . . . . . 0.94 -1.07. * F 1.29 0.64
Glu210 A A . . . . . 1.21 -1.50* . F 1.17 1.26
Cys211 A A . . . . . 0.57 -1.43* . F 0.90 1.26
Glu212 A A . . . . . 0.02 -1.29* * F 0.75 0.54
Arg213 A A . . . . . 0.61 -0.60* * . 0.60 0.22
Ala214 A A . . . . . -0.09-0.60* * . 0.60 0.68
Val215 A A . . . . . -0.94-0.39* * . 0.30 0.34
I1e216 A A . . . . . -0.870.26 * * . -0.300.13
Asp217 A A . . . . . -1.570.76 * * . -0.600.13
Phe218 A A . . . . . -1.681.04 * * . -0.600.15
Val219 A A . . . . . -1.090.80 . . . -0.600.37
Ala220 A A . . . . . -1.120.11 . . . -0.300.37
Phe221 A A . . . . . -0.530.80 . * . -0.600.30
G1n222 A A . . . . . -1.420.40 . * . -0.600.54
Asp223 A A . . . . . -0.680.44 . . F -0.450.38
Ile224 A A . . . . . 0.29 -0.06. . F 0.45 0.87
Ser225 A A . . . . . 0.07 -0.84. . F 0.75 0.99
Ile. 226 A A . . . . . 0.77 -0.56* . F 0.75 0.49
Lys227 A A . . . . . 0.88 -0.16* * F 0.60 1.20
Arg228 A A . . . . . 0.07 -0.84* * F 0.90 1.76
Leu229 A A . . . . . 0.14 -0.54* . F 0.90 2.07
Gln230 A A . . . . . 0.44 -0.54* . F 0.75 0.85
Arg231 . A B . . . ~. 0.74 -0.14* . . 0.30 0.76
Leu232 A A . . . . . -0.110.36 * . . -0.300.93
Leu233 . A B . . . . -0.220.36 * * . -0.300.44
Gln234 . A B . . . . -0.00-0.04* . . 0.30 0.39
Ala235 . A B . . . . -0.210.46 * . . -0.600.48
Leu236 . A B . . . . -0.320.20 * * . -0.300.89
G1u237 . A B . . . . 0.14 -0.49. . . 0.30 0.89
Ala238 . . B . . T . 0.67 -0.46. . F 0.85 0.88
Pro239 . . . . T T . 0.32 -0.04. . F 1.40 1.12
Glu240 . . . . T T . 0.70 -0.30. . F 1.25 0.64
Gly- 241 . . . . T T . 1.20 0.13 . . F 0.65 0.98
Trp242 . . . . T . . 0.99 0.11 * . F 0.45 0.92
Gly243 . . . . . . C 1.69 0.11 * * F 0.59 0,81
Pro244 . . . . . . C 1.31 0.11 * * F 1.08 1,61
Thr245 . . . . . T C 0.97 0.19 * . F 1.62 1.55
Pro246 . . . . . T C 1.42 -0.30* . F 2.56 1.55
Arg247 . . . . T T . 1.12 -0.73* . F 3.40 1,96
Ala248 . . . . . T C 0.88 -0.66* . F 2.86 1.37
Gly249 A A . . . , . 0.28 -0.64* * F 1.77 0,90
Arg250 A A . . . . . 0.59 -0.39* * . 0.98 0.38
26
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table I (con't)
ResPositionI II III IV V VI VIII IX X XI XIIXIII XIV
VII
Ala251 A A . . . . . -0.010.01 * * . 0.04 0.65
Ala252 A A . . . . . -0.080.20 * * . -0.300.54
Leu253 A A . . . . . -0:30-0.23* * . 0.30 0.55
Gln254 A A . . . . . 0.16 0.46 . * . -0.600.45
Leu255 A A . . . . . 0.16 -0.04. * . 0.30 0.87
Lys256 A A . . . . . 0.86 -0.54. * . 0.75 2.07
Leu~ 257 A A . . . . . 0.63 -1.23. * F 0.90 2.34
Arg258 A A . . . . . 1.13 -0.94* * F 0.90 2.34
Arg259 . A B . . . . 1.13 -1.14* * F 0.90 1.69
Arg260 . A B . . . . 113 -1.14* * F 0.90 3.55
Leu261 . A B . . . . 0.28 -1.14* * F 0.90 1.49
Thr262 . A B : . . . 0.74 -0.46* * F 0.45 0.63
Glu263 . A B . . . . 0.04 -0.03* * . 0.30 0.32
Leu264 . A B . . . . -0.070.47 * . . -0.600.39
Leu265 . A B . . . . -0.180.19 . * . -0.300.47
Gly266 A A . . . . . 0.29 -0.30. . . 0.30 0.45
Ala267 A . . . . T . 0.01 0.13 . . F 0.25 0.54
Gln268 A . . . . T . -0.80-0.06. . F 0.85 0.66
Asp269 A . . . . T . -0.80-0.06. . F 0.85 0.55
Gly270 A . . . . T . -0.840.20 * * . 0.10 0.45
A1a271 A A . . . . . -0.390.34 * * . -0.300.19
Leu272 . A B . . . . -0.61-0.06* * . 0.30 0.23
Leu273 . A B . . . . -1.420.63 * * . -0.600.19
Val274 A A . . . . . -1.420.89 * * . -0.600.15
Arg275 A A . . . . . -1.670.79 * * . -0.600.32
Leu276 A A . . . . . -1.890.60 * * . -0.600.40
Leu277 A A . . . . . -0.970.60 * * . -0.600.44
Gln278 A A . . . . . -1.01-0.04* * . 0.30 0.44
Ala279 A A . . . . . -0.740.60 * * . -0.600.40
Leu280 A A . . . . . -0.740.41 * * . -0.600.49
Arg281 . A B . . . . -0.53-0.27* . . 0.30 0.55
Val282 . A B . . . . 0.07 -0.06* . , 0.30 0.54
Ala283 . A B . . . . -0.28-0.13* . . 0.72 1.01
Arg284 . A B . . . . -0.50-0.39* . . 0.84 0.51
Met285 . . B . . T . 0,31 0.30 . * . 0.91 0.57
Pro286 . . . . . T C 0,31 -0.34. * F 2.13 0.97
Gly287 . . . . . T C 0.87 -0.84* * F 2.70 0.97
Leu288 A . . . . T . 0.60 -0.46* * F 2.08 1.32
Glu2$9 A . . . . . . 0.60 -0.43* * F 1.46 0.63
Arg290 A . . . . . . 1.20 -0.86* * F 1.64 1.25
Ser291 A . . . . . . 1.52 -1.29* * F 1.37 2.62
Val292 A . . . . . . 1.17 -1.97* * F 1.10 2.97
Arg293 A . . . . . . 1.17 -1.19* * F 1.10 1.31
Glu294 A . . . . . . 0.96 -0.50* * F 0.65 0.81
Arg295 A . . . . . . -0.01-0.46* * F 0.80 1.68
Phe296 . . B . . . . 0.26 -0.46. * . 0.50 0.64
Leu297 . . B . . . . 0.72 0.04 . * . -0.100.50
Pro298 A . . . . . . 0.22 0.47 . * . -0.400.33
Val299 A . . . . . . ~-0.170.90 * . . -0.40'0.48
His300 A . . . . . . -0.670.54 . . . -0.400.75
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table II
ResPosition IT III IV VI VTI VIIIIX X XI XIIXIII XIV
I V
Met1 . . B . . . 0.06 0.09 * . . -0.100.60
.
Arg2 . . B . . . 0.10 -0.34* ,. . 0.50 0.82
.
Ala3 . . B . . . 0.28 -0.34* . . 0.50 0.63
.
Leu4 . . B . . . 0.32 -0.34. . . 0.50 0.99
.
Glu5 . . B . . . -0.10 -0.53. . F 0.95 0.50
.
Gly6 . . . . T C 0.20 0.16 * . F 0.45 0.41
.
Pro7 . . . . T . -0.72 0.04 * . F 0.65 0.66
T
Gly8 . . . . T . -0.94 0.04 . . F 0.65 0.32
T
Leu9 . . B . T . -0.80 0.73 . . . -0.200.26
.
Ser10 . A B . . . -1.61 0.87 . . . -0.600.09
.
Leu11 . A B . . . -2.12 1.13 . . . -0.600.08
.
Leul2 . A B . . . -2.72 1.34 . . . -0.600.07
.
Cys13 . A B . . . -2.97 1.34 . . . -0.600.04
.
Leu14 . A B . . . -2.97 1.46 . . . -0.600.05
.
Val15 . A B . . . -2.88 1.46 . . . -0.600.05
.
Leu16 . A B . . . -2.66 1.20 . . . -0.600.15
.
Ala17 . A B . . . -2.66 1.13 . . . -0.600.18
.
Leu18 . A B . . . -2.80 1.13 . . . -0.600.20
.
Pro19 . A B . . . -2.20 1.17 . . . -0.600.20
.
Ala20 . A B . . . -2.20 0.91 . . . -0.600.31
.
Leu21 . A B . . . -1.60 1.06 . * . -0.600.28
.
Leu22 . A B . . . -1.60 0.80 . . . -0.600.28
.
Pro23 . A B . . . -1.64 0.87 . * . -0.600.28
.
Val24 . . B . . . -1.32 1.01 . * . -0.400.25
.
Pro25 . . B . . . -1.08 0.33 . . . -0.100.60
.
Ala26 . . B B . . -1.12 0.07 . . . -0.300.38
.
Val27 . . B B . . -0.90 0.29 * * . -0.300.38
.
Arg28 . . B B . . -0.69 0.14 * * . -0.300.25
.
Gly29 . . B B . . -0.14 -0.29* * . 0.30 0.43
.
Val30 . . B B . . -0.14 -0.30* * . 0.30 0.83
.
Ala31 . . B B . . 0.13 -0.51* * . 0.60 0.66
.
Glu32 . . B . . . 0.74 -0.03* * F 0.65 0.96
.
Thr33 . . B . T . 0.42 0.30 * * F 0.40 2.02
.
Pro34 . . . . T . 0.48 0.09 * * F 0.80 3.10
T
Thr35 . . . . T . 1.44 0.50 * . F 0.50 1.88
T
Tyr36 . . . . T C 2.03 0.50 * . . 0.15 2.55
.
Pro37 . . . . . . 1.44 0.01 * . . 0.45 2.76
T
Trp38 . A . . . C 1.76 0.09 * . . 0.05 1.93
.
Arg39 . A B . . . 1.66 -0.40* . F 0.60 2.13
.
Asp40 . A . . . C 1.62 -0.67* . F 1.10 1.99
.
Ala41 . A . . . C 1.87 -0.67* * F 1.10 1.87
.
Glu42 . A . . . C 2.19 -1.59* * F 1.10 1.66
.
Thr43 . A . . . . 1.67 -1.59* . F 1.30 1.94
T
Gly44 . A . . . . 0.70 -0.90* . F 1.30 1.59
T
Glu45 . A . . . 0.03 -0.76* * F 1.15 0.68
T
Arg46 . A . . . . 0.03 -0.19* . F 0.85 0.25
T
Leu47 . A B . . . 0.03 -0.17* . . 0.30 0.26
.
Val48 . A B . . . -0.32 -0.20. . . 0.30 0.26
.
Cys49 . A B . . . -0.19 0.37 . . . -0.300.07
.
Ala50 . A B . . . -0.40 0.80 . . . -0.600.13
.
28
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table II (con't)
Res Position II III IVV VIVII VIII IX X XI XIIXIII XIV
I
Gln 51 . A B . . . . -0.860.54 . . . -0.600.28
Cys 52 . A B . . . . -0.360.33 . . . -0.300.51
Pro 53 . . . . . T C -0.200.24 . . F 0.45 0.73
Pro 54 . . . . T T . -0.390.53 . . F 0.35 0.36
Gly 55 . . . . T T . 0.20 0.77 * . F 0.35 0.50
Thr 56 . . B . . T . 0.31 0.60 . . F -0.050.56
Phe 57 . . B B . . . 0.77 0.17 * . F -0.150.71
Val 58 . . B B . . . 0.31 0.17 * . . 0.19 1.12
Gln 59 . . B B . . . 0.63 0.31 * . F 0.53 0.41
Arg 60 . . B . . T . 1.09 -0.17* . F 1.87 0.94
Pro 61 . . B . . T . 1.40 -0.96* . F 2.66 2.47
Cys 62 . . . . T T . 1.80 -1.60* . F 3.40 2.38
Arg 63 . . . . T T . 2.44 -1.62* . F 3.06 1.63
Arg 64 . . . . T . . 2.13 -1.19* . F 2.77 1.63
Asp 65 . . . . T . . 2.71 -1.13* . F 2.68 4.39
Ser 66 . . . . T T . 1.26 -1.21. . F 2.79 3.24
Pro 67 . . . . T T . 2.58 -0.64. . F 2.55 0.89
Thr 68 . . . . T T . 1.26 -0.21. . F 2.50 0.52
Thr 69 . . . . T T . 0.48 0.21 . . F 1.65 0.61
Cys 70 . . . . T . . 0.27 0.40 . . F 1.14 0.21
Gly 71 . . . . T T . 0.36 0.40 . * F 1.33 0.22
Pro 72 . . . . T T . 0.68 0.34 . * F 1.62 0.24
Cys 73 . . . . . T C 0.96 -0.14* . F 2.01 0.88
Pro 74 . . . . . T C 1.02 -0.21* . F 2.40 1.21
Pro 75 . . . . T T . 1.38 0.11 * * F 1.76 1.23
Arg 76 . . . . T T . 1.72 0.17 * * F 1.52 3.30
His 77 . . B . . T . 1.23 0.00 * * F 0.88 3.70
Tyr 78 . . B . . T . 1.61 0.36 * * . 0.49 2.07
Thr 79 . . B . . . . 1.82 0.84 * * . -0.251.11
Gln 80 . . B . . . . 1.79 1.24 * * . -0.251.31
Phe 81 . . . . T . . 0.87 1.50 * * . 0.15 1.31
Trp 82 . . . . T . . 0.90 1.43 * . . 0.00 0.75
Asn 83 . A . . T . . 1.26 0.94 * . . -0.200.75
Tyr 84 . A . . T . . 0.90 0.54 * * . -0.051.70
Leu 85 . A . . T . . 1.01 0.33 * * . 0.38 0.87
Glu 86 . A . . T . . 1.47 -0.59* * . 1.71 1.05
Arg ~87 . A . . T . . 1.09 -0.23. * . 1.69 1.05
Cys 88 . . . . T T . 1.09 -0.41, * . 2.22 0.69
Arg 89 . . . . T T . 0.48 -0.70. * . 2.80 0.64
Tyr 90 . . . . T T . 0.48 -0.06. * . 2.22 0.24
Cys 91 . . . . T T . -0.190.63 . * . 1.04 0.37
Asn 92 . . B B . . . -0.640.63 . * . -0.040.10
Val 93 . . B B . . . 0.02 1.06 . * . -0.020.06
Leu 94 . . B B . . . 0.02 0.30 . . . 0.30 0.21
Cys 95 . . B . . T . 0.27 -0.27. . . 1.60 0.25
Gly 96 . . . . . T C 0.93 -0.67. . F 2.55 0.59
Glu 97 . . . . . T C 0.93 -1.31. . F 3.00 1.24
Arg 98 A . . , , T , 1.20 -2.00. * F 2.50 4.00
Glu 99 A A . . . , . 2.12 -2.07. * F 1.80 4.08
G1u 100 A A . . . , . 2.20 -2.50. * F 1.50 4.61
29
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table II (con't)
Res PositionI II III IV VI VII VIII IX X XI XIIXIII XIV
V
Glu 101 A A . . . . 1.88 -2.00. * F 1.20 2.38
.
Ala 102 A A . . . . 1.84 -1.43. . F 0.75 0.74
.
Arg 103 A A . . . . 1.14 -0.93. . . 0.60 0.58
.
Ala 104 A A . . . . 0.83 -0.43. * . 0.30 0.34
.
Cys 105 A A . . . . 0.80 0.06 . * , -0.300.48
.
His 106 A A . . . . 0.80 0.06 * * . -0.300.34
.
Ala 107 . A . . . . 1.50 0.46 * * , -0.200.53
T
Thr 108 . A . . . . 0.80 -0.04* * . 0.85 1.95
T
His 109 . A . . . . 0.72 -0.11* . . 1.13 1.45
T
Asn 110 . A . . . . 1.50 -0.04* . . 1.26 0.77
T
Arg 111 . A . . . . 0.87 -0.54. * . 1.99 1.04
T
Ala 112 . A . . . . 1.57 -0.46. * . 1.82 0.41
T
Cys 113 . . . . T . 1.57 -0.96. * . 2.80 0.50
T
Arg 114 . . B . T . 1.26 -0.87. * . 2.12 0.37
.
Cys 115 . . . . T . 0.56 -0.44* * . 1.94 0.36
T
Arg 116 . . . . T . -0.26-0.16. * . 1.66 0.58
T
Thr 117 . A . B . . -0.260.06 . * F 0.53 0.26
T
Gly 118 . A . B . . 0.38 0.56 . * . -0.200.49
T
Phe 119 . A B B . . -0.320.49 . * . -0.600.34
.
Phe 120 . A B B . . -0.000.99 . * . -0.600.24
.
Ala 121 . A B B . . -0.810.93 . * . -0.600.24
.
His 122 . A . . . C -1.171.29 . * . -0.400.24
.
Ala 123 . A . . . C -1.631.07 . * . -0.400.15
.
Gly 124 . A . . . . -0.930.97 . * . -0.200.12
T
Phe 125 . A . . . . -0.270.47 . . . -0.200.15
T
Cys 126 . A . . . . -0.270.47 . * . -0.200.20
T
Leu 127 . A B . . . -0.530.47 . . . -0.600.21
.
Glu 128 . A B . . . -0.610,43 . . . -0.200.32
T
His 129 . . . . T . -0.480,21 . . . 0.50 0.32
T
Ala 130 . . . . T . 0.01 0,07 . . . 0.63 0.62
T
Ser 131 . . . . T . 0.33 -0.19. . . 1.36 0.54
T
Cys 132 . . . . T C 0.56 0.24 . . . 0.69 0.39
.
Pro 133 . . . . T C 0.22 0.24 . . F 0.97 0.39
.
Pro 134 . . . . T . -0.610.17 . . F 1.30 0.29
T
Gly 135 . . . . T . -0.910.43 . . F 0.87 0.40
T
Ala 136 . . B . T . -1.200.54 . . . 0.19 0.28
.
Gly 137 . . B B . . -0.740.61 . . . -0.340.12
.
Val 138 . . B B . . -0.880.61 . . . -0.470.19
.
Ile 139 . . B B . . -0.670.61 . . . -0.600.18
.
Ala 140 . . B . T . -0.620.11 . . . 0.10 0.32
.
Pro 141 . . B . T . -0.320.07 . . F 0.25 0.58
.
Gly 142 . . . . T C -0.570.34 * * F 0.45 0.86
.
Glu 143 . . . . T C 0.40 0.16 * * F 0.45 0.86
.
Ser 144 . . B . . . 0.94 -0.34* * F 0.80 1.10
. '
Trp 145 . . . . . . 1.19 -0.34* * F 1.20 1.10
T
Ala 146 . . B , T . 0.81 -0.34* * F 0.85 0.63
.
Arg 147 . . . . T . 0.94 0.16 * * F 0.65 0.47
T
Gly 148 . . . . T . 2.06 0.20 . * F 0.65 0.69
T
Gly 149 . . . . T C 1.06 -0.71. . F 1.84 1.35
.
A1a l50 . . . , . C 1.00 -0.83. . F 1.83 0.92
.
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Table II (con't)
ResPosition II III IV VI VII VIII IX X XI XIIXITI XIV
I V
Pro151 . . . . . C 1.24 -0.40. * F 1.87 0.92
.
Arg152 . . . . T . 1.24 -0.40. . F 2.61 0.92
T
Ser153 . . . . T . 1.70 -0.83* . F 3.40 1.78
T
Gly154 . . . . T . 1.38 -1.33* * F 3.06 2.26
T
Gly155 . . . . T . 1.62 -1.19* * F 2.57 0.62
T
Arg156 . . . . . . 1.94 -0.76* * F 2.26 0.46
T
Arg157 . . . . . . 1.49 -1.14* * F 2.15 0.90
T
Cys158 . . B . . . 1.79 -1.14* * F 1.64 0.90
.
Gly159 . . . . T . 1.28 -1.17* * F 2.47 0.80
T
Arg160 . . B . T . 1.03 -0.53* * F 2.30 0.30
.
Gly161 . . B . T . 0.58 -0.03* * F 1.77 0.57
.
Gln162 . . B . T . 0.26 -0.17* * F 1.54 0.57
.
Val163 . . B . . . 0.62 -0.17. * F 1.22 0.45
.
Ala164 . . B . . . 0.16 0.21 . * F 0.28 0.61
.
Gly165 . . B . T . -0.540.47 . * F -0.050.29
.
Pro166 . . B . T . -0.410.57 . . F -0.050.40
.
Ser167 . . . . T C -0.800.36 . . F 0,45 0.61
.
Leu168 . . B . T . -0.330.29 . . . 0.10 0.78
.
Ala169 . . B . . . -0.130.29 . . . -0.100.65
.
Pro170 . . B . . . -0.180.29 . . . -0.100.62
.
31
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0075] Additional preferred nucleic acid fragments of the present invention
comprise, or
alternatively consist of, nucleic acid molecules encoding one or more epitope-
bearing
portions of TNFR-hoc andlor TNFR-6(3. In particular, such nucleic acid
fragments of the
present invention include nucleic acid molecules encoding: a polypeptide
comprising, or
alternatively consisting of, amino acid residues from about Phe-57 to about
Thr-117, from
about Cys-132 to about Thr-175, from about Gly-185 to about Thr-194, from
about Val-205
to about Asp-217, from about Pro-239 to about Leu-264, and/or from about Ala-
283 to about
Pro-298 in SEQ TD N0:2. In additional embodiments, nucleic acid fragments of
the present
invention comprise, or alternatively consist of nucleic acid molecules
encoding one or more
epitpope bearing portions of TNFR-6(3 from about Ala-31 to about Thr-46, from
about Phe-
57 to about Gln-80, from about Glu-86 to about His-106, from about Thr-108 to
about Phe-
119, from about His-129 to about Val-138, and/or from about Gly-142 to about
Pro-166 in
SEQ ID N0:4. In this context "about" includes the particularly recited ranges
and rangers
larger or smaller by several (5, 4, 3, 2, or 1) amino acids at either terminus
or at both termini.
These polypeptide fragments have been determined to bear antigenic epitopes of
the TNFR-
6cc and TNFR-6(3 polypeptides respectively, by the analysis of the Jameson-
Wolf antigenic
index, as shown in Figures 4 and 5, above. Further, polypeptide fragments
which bear
antigenic epitopes of TNFR-hoc and/or TNFR-6~i may be easily determined by one
of skill in
the art using the above-described analysis of the Jameson-Wolf antigenic
index, as shown in
Figures 4 and 5. Methods for determining other such epitope-bearing portions
of TNFR-6a
and/or TNFR-6(3 are described in detail below.
[0076] In specific embodiments, the nucleic acids of the invention are less
than 100000
kb, 50000 kb, 10000 kb, 1000 kb, 500 kb, 400 kb, 350 kb, 300 kb, 250 kb, 200
kb, 175 kb,
150 kb, 125 kb, 100 kb, 75 kb, SO kb, 40 kb, 30 kb, 25 kb, 20 kb, 15 kb, 10
kb, 7.5 kb, or 5
kb in length.
[0077] In further embodiments, nucleic acids of the invention comprise at
least 15, at
least 30, at least 50, at least 100, or at least 250, at least 500, or at
least 1000 contiguous
nucleotides of TNFR coding sequence, but consist of less than or equal to 1000
kb, 500 kb,
250 kb, 200 kb, 150 kb, 100 kb, 75 kb, 50 kb, 30 kb, 25 kb, 20 kb, 15 kb, 10
kb, or 5 kb of
genomic DNA that flanks the 5' or 3' coding nucleotide sequence set forth in
Figure 1 (SEQ
ID NO:l) or Figure 2 (SEQ ID NO:3). In further embodiments, nucleic acids of
the
32
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
invention comprise at least 15, at least 30, at least 50, at least 100, or at
least 250, at least
500, or at least 1000 contiguous nucleotides of TNFR coding sequence, but do
not comprise
all or a portion of any TNFR intron. In another embodiment, the nucleic acid
comprising
TNFR coding sequence does not contain coding sequences of a genomic flanking
gene (i.e.,
5' or 3' to the TNFR gene in the genome). In other embodiments, the nucleic
acids of the
invention do not contain the coding sequence of more than 1000, 500, 250, 100,
50, 25, 20,
15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s).
[0078] In another aspect, the invention provides an isolated nucleic acid
molecule
comprising, or alternatively consisting of, a polynucleotide which hybridizes
under stringent
hybridization conditions to a portion of the polynucleotide in a nucleic acid
molecule of the
invention described above, for instance, the cDNA contained in the plasmid
deposited as
ATCC Deposit No. 97810 or 97809, or a fragment of the polynucleotide sequence
disclosed
in Figure 1 and/or Figure 2. By "stringent hybridization conditions" is
intended overnight
incubation at 42° C in a solution comprising: 50% formamide, 5x SSC
(750 mM NaCI, 75
mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's
solution, 10%
dextran sulfate, and 20 ~,g/ml denatured, sheared salmon sperm DNA, followed
by washing
the filters in 0.1x SSC at about 65° C.
[0079] By a polynucleotide which hybridizes to a "portion" of a polynucleotide
is
intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15
nucleotides
(nt), and more preferably at least about 20 nt, still more preferably at least
about 30 nt, and
even more preferably about 30-70 (e.g., 50) nt of the reference
polynucleotide. These have
uses that include, but are not limited to, as diagnostic probes and primers as
discussed above
and in more detail below.
[0080] By a portion of a polynucleotide of "at least about 20 nt in length,"
for example, is
intended 20 or more contiguous nucleotides from the nucleotide sequence of the
reference
polynucleotide (e.g., a deposited cDNA or a nucleotide sequence as shown in
Figure 1 or 2
(SEQ ID NO:1 or 3)). In this context "about" includes the particularly recited
size, and those
sizes that are larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at
either terminus or at
both termini. Of course, a polynucleotide which hybridizes only to a poly A
sequence (such
as the 3' terminal poly(A) tract of a TNFR cDNA, or to a complementary stretch
of T (or U)
residues, would not be included in a polynucleotide of the invention used to
hybridize to a
portion of a nucleic acid of the invention, since such a polynucleotide would
hybridize to any
33
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
nucleic acid molecule containing a poly (A) stretch or the complement thereof
(e.g.,
practically any double-stranded cDNA clone that has been generated using oligo
dT as a
primer).
[0081] As indicated, nucleic acid molecules of the present invention which
encode a
TNFR polypeptide may include, but are not limited to, those encoding the amino
acid
sequence of the mature polypeptide, by itself; and the coding sequence for the
mature
polypeptide and additional sequences, such as those encoding the about 26-35
amino acid
leader or secretory sequence, such as a pre-, or pro- or prepro- protein
sequence; the coding
sequence of the mature polypeptide, with or without the aforementioned
additional coding
sequences.
[0082] Also encoded by nucleic acids of the invention are the above protein
sequences
together with additional, non-coding sequences, including for example, but not
limited to
introns and non-coding 5' and 3' sequences, such as the transcribed, non-
translated sequences
that play a role in transcription, mRNA processing, including splicing and
polyadenylation
signals, for example - ribosome binding and stability of mRNA; an additional
coding
sequence which codes for additional amino acids, such as those which provide
additional
functionalities.
[0083] Thus, the sequence encoding the polypeptide may be fused to a marker
sequence,
such as a sequence encoding a peptide which facilitates purification of the
fused polypeptide.
In certain preferred embodiments of this aspect of the invention, the marker
amino acid
sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector
(QIAGEN,
Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which
are
commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci.
USA 86:821-824
(1989), for instance, hexa-histidine provides for convenient purification of
the fusion protein.
The "HA" tag is another peptide useful for purification which corresponds to
an epitope
derived from the influenza hemagglutinin protein, which has been described by
Wilson et al.,
Cell 37: 767 (1984). As discussed below, other such fusion proteins include a
TNFR-6~c or
TNFR-6(3 fused to Fc at the N- or C-terminus.
[0084] The present invention further relates to variants of the nucleic acid
molecules of
the present invention, which encode portions, analogs or derivatives of a TNFR
polypeptide.
Variants may occur naturally, such as a natural allelic variant. By an
"allelic variant" is
34
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
intended one of several alternate forms of a gene occupying a given locus on a
chromosome
of an organism. Genes 11, Lewin, B., ed., John Wiley & Sons, New Yorlc (1985).
Non-naturally occurring variants may be produced using art-known mutagenesis
techniques
which include, but are not limited to oligonucleotide mediated mutagenesis,
alanine
scanning, PCR mutagenesis, site directed mutagenesis (see e.g., Carter et al.,
Nucl. Acids
Res. 13:4331 (1986); and Zoller et al., Nucl. Acids Res. 10:6487 (1982)),
cassette
mutagenesis (see e.g., Wells et al., Gene 34:315 (1985)), restriction
selection mutagenesis
(see e.g., Wells et al., Philos. Trans. R. Soc. London SerA 317:415 (1986)).
[0085] Thus, the invention also encompasses TNFR variants (e.g., derivatives
and
analogs) that have one or more amino acid residues deleted, added, or
substituted to generate
TNFR polypeptides that are better suited for expression, scale up, etc., in
the host cells
chosen. For example, cysteine residues can be deleted or substituted with
another amino acid
residue in order to eliminate disulfide bridges; N-linked glycosylation sites
can be altered or
eliminated to achieve, for example, expression of a homogeneous product that
is more easily
recovered and purified from yeast hosts which are known to hyperglycosylate N-
linked sites.
To this end, a variety of amino acid substitutions at one or both of the first
or third amino
acid positions on any one or more of the glycosylation recognition sequences
in the TNFR
polypeptides of the invention, and/or an amino acid deletion at the second
position of any one
or more such recognition sequences will prevent glycosylation of the TNFR at
the modified
tripeptide sequence (see, e.g., Miyajimo et al., EMBO J 5(6):1193-97).
Additionally, one or
more of the amino acid residues of the polypeptides of the invention (e.g.,
arginine and lysine
residues) may be deleted or substituted with another residue to eliminate
undesired
processing by proteases such as, for example, furins or kexins. For example,
polypeptides of
the invention containing carboxy terminal TNFR polypeptide sequences may have
the amino
acid residue corresponding to the arginine residue at position 290 and/or 295
of SEQ ID
N0:2 deleted or substituted with another residue.
[0086] Variants of the invention include those produced by nucleotide
substitutions,
deletions or additions. The substitutions, deletions or additions may involve
one or more
nucleotides. The variants may be altered in coding regions, non-coding
regions, or both.
Alterations in the coding regions may produce conservative or non-conservative
amino acid
substitutions, deletions or additions. Especially preferred among these are
silent
substitutions, additions and deletions, which do not alter the properties and
activities of the
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
TNFR polypeptide or portions thereof. Also especially preferred in this regard
are
conservative substitutions.
[0087] Highly preferred are nucleic acid molecules encoding a mature protein
having an
amino acid sequence shown in SEQ ID NOS:2 and 4 or the mature TNFR polypeptide
sequences encoded by the cDNA clone contained in the plasmid deposited as ATCC
Deposit
No. 97810 or ATCC Deposit No. 97809.
[0088] Further embodiments include an isolated nucleic acid molecule
comprising, or
alternatively consisting of, a polynucleotide having a nucleotide sequence at
least 90%
identical, and more preferably at least 80%, 8S%, 90%, 92%, or 95%, 96%, 97%,
98% or
99% identical to a polynucleotide selected from the group consisting of: (a) a
nucleotide
sequence encoding a TNFR polypeptide having the complete amino acid sequence
in SEQ m
N0:2 or 4, or as encoded by the cDNA clone contained in the plasmid deposited
as ATCC
Deposit No. 97810 or 97809; (b) a nucleotide sequence encoding a mature TNFR
polypeptide
having an amino acid sequence at positions 31-300 or 31-170 in SEQ ID N0:2 or
4,
respectively, or as encoded by the cDNA clone contained in the plasmid
deposited as ATCC
Deposit No. 97810 or 97809; (c) a nucleotide sequence encoding a soluble
extracellular
domain of a TNFR polypeptide having the amino acid sequence at positions 31-
283 and 31-
166 of SEQ ID NOS:2 and 4, respectively; (d) a nucleotide sequence encoding a
fragment of
the TNFR polypeptide having the complete amino acid sequence in SEQ )D N0:2 or
4, or as
encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit
No. 97810
or 97809, wherein the fragment has TNFR-hoc and/or TNFR-6(3 functional
activity; and (e) a
nucleotide sequence complementary to any of the nucleotide sequences in (a),
(b), (c) or (d)
above. Polypeptides encoded by the polynucleotides are also encompassed by the
invention.
[0089] Further embodiments of the invention include isolated nucleic acid
molecules that
comprise a polynucleotide having a nucleotide sequence at least 90% identical,
and more
preferably at least 80%, 85%, 90%, 92%, or 95%, 96%, 97%, 98% or 99%
identical, to any of
the nucleotide sequences in (a), (b), (c), (d), or (e), above, or a
polynucleotide which
hybridizes under stringent hybridization conditions to a polynucleotide in
(a), (b), (c), (d), or
(e), above. This polynucleotide which hybridizes does not hybridize under
stringent
hybridization conditions to a polynucleotide having a nucleotide sequence
consisting of only
A residues or of only T residues. An additional nucleic acid embodiment of the
invention
36
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
relates to an isolated nucleic acid molecule comprising, or alternatively
consisting of, a
polynucleotide which encodes the amino acid sequence of an epitope-bearing
portion of a
TNFR polypeptide having an amino acid sequence in (a), (b), (c), (d), or (e),
above.
[0090] By a polynucleotide having a nucleotide sequence at least, for example,
95%
"identical" to a reference nucleotide sequence encoding a TNFR polypeptide is
intended that
the nucleotide sequence of the polynucleotide is identical to the reference
sequence except
that the polynucleotide sequence may include up to five point mutations per
each 100
nucleotides of the reference nucleotide sequence encoding the TNFR
polypeptide. In other
words, to obtain a polynucleotide having a nucleotide sequence at least 80%,
85%, 90%,
92%, or 95% identical to a reference nucleotide sequence, up to 5% of the
nucleotides in the
reference sequence may be deleted or substituted with another nucleotide, or a
number of
nucleotides up to 5% of the total nucleotides in the reference sequence may be
inserted into
the reference sequence. These mutations of the reference sequence may occur at
the 5' or 3'
terminal positions of the reference nucleotide sequence or anywhere between
those terminal
positions, interspersed either individually among nucleotides in the reference
sequence or in
one or more contiguous groups within the reference sequence. The reference
sequence may
be the entire TNFR-hoc and/or TNFR -6(3 encoding sequence shown in Figures I
(SEQ ID
NO:1 and 2) and Figure 2 (SEQ ID N0:3 and 4) or any fragment, variant,
derivative or
analog thereof, as described herein.
[0091] As a practical matter, whether any particular nucleic acid molecule is
at least 90%,
95%, 96%, 97%, 98% or 99% identical to, for instance, a nucleotide sequence
shown in
Figure 1 or 2, or to the nucleotides sequence contained in one or both of the
deposited cDNA
clones can be determined conventionally using known computer programs such as
the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics
Computer
Group, University Research Park, 575 Science Drive, Madison, WI 53711).
Bestfit uses the
local homology algorithm of Smith and Waterman, Advasices ih Applied
Matherrlatics
2:482-489 (1981), to find the best segment of homology between two sequences.
When
using Bestfit or any other sequence alignment program to determine whether a
particular
sequence is, for instance, 95% identical to a reference sequence according to
the present
invention, the parameters are set, of course, such that the percentage of
identity is calculated
over the full length of the reference nucleotide sequence and that gaps in
homology of up to
37
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
5% of the total number of nucleotides in the reference sequence are allowed.
The reference
(query) sequence may be the entire TNFR encoding nucleotide sequence shown in
Figure 1
(SEQ ID NO:1), Figure 2 (SEQ ID N0:3) or any TNFR-6a and/or TNFR-6(3
polynucleotide
fragment (e.g,. a polynucleotide encoding the amino acid sequence of any of
the N or C
terminal deletions described herein), variant, derivative or analog, as
described herein.
[0092] In a specific embodiment, the identity between a reference (query)
sequence (a
sequence of the present invention) and a subject sequence, also referred to as
a global
sequence alignment, is determined using the FASTDB computer program based on
the
algorithm of Brutlag et al. (Comp. App. Bi.osci. 6:237-245 (1990)). Preferred
parameters used
in a FASTDB alignment of DNA sequences to calculate percent identity are:
Matrix=Unitary,
k-tuple=4, Mismatch Penalty=1, Joining Penalty=30, Randomization Group
Length=0,
Cutoff Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the
length of
the subject nucleotide sequence, whichever is shorter. According to this
embodiment, if the
subject sequence is shorter than the query sequence because of 5' or 3'
deletions, not because
of internal deletions, a manual correction is made to the results to take into
consideration the
fact that the FASTDB program does not account for 5' and 3'truncations of the
subject
sequence when calculating percent identity. For subject sequences truncated at
the S' or 3'
ends, relative to the query sequence, the percent identity is corrected by
calculating the
number of bases of the query sequence that are 5' and 3' of the subject
sequence, which are
not matched/aligned, as a percent of the total bases of the query sequence. A
determination
of whether a nucleotide is matched/aligned is determined by results of the
FASTDB sequence
alignment. This percentage is then subtracted from the percent identity,
calculated by the
above FASTDB program using the specified parameters, to arrive at a final
percent identity
score. This corrected score is what is used for the purposes of this
embodiment. Only bases
outside the 5' and 3' bases of the subject sequence, as displayed by the
FASTDB alignment,
which are not matched/aligned with the query sequence, are calculated for the
purposes of
manually adjusting the percent identity score. For example, a 90 base subject
sequence is
aligned to a 100 base query sequence to determine percent identity. The
deletions occur at the
5' end of the subject sequence and therefore, the FASTDB alignment does not
show a
matched/alignment of the first 10 bases at 5' end. The 10 unpaired bases
represent 10% of
the sequence (number of bases at the 5' and 3' ends not matched/total number
of bases in the
38
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
query sequence) so 10% is subtracted from the percent identity score
calculated by the
FASTDB program. If the remaining 90 bases were perfectly matched the final
percent
identity would be 90%. In another example, a 90 base subject sequence is
compared with a
100 base query sequence. This time the deletions are internal deletions so
that there are no
bases on the 5' or 3' of the subject sequence which are not matched/aligned
with the query. In
this case the percent identity calculated by FASTDB is not manually corrected.
Once again,
only bases 5' and 3' of the subject sequence which are not matched/aligned
with the query
sequence are manually corrected for. No other manual corrections are made for
the purposes
of this embodiment.
[0093] The present application is directed to nucleic acid molecules at least
90%, 95%,
96%, 97%, 98% or 99% identical to a nucleic acid sequence shown in Figure 1 or
2 (SEQ ID
NO: l or 3), to the nucleic acid sequence of a deposited cDNA andlor to a
nucleic acid
sequence otherwise disclosed herein (e.g., encoding polypeptide having the
amino acid
sequence of a N andlor C terminal deletion disclosed herein, such as, for
example, a nucleic
acid molecule encoding amino acids Val-30 to His-300 of SEQ ID N0:2),
irrespective of
whether they encode a polypeptide having TNFR functional activity. This is
because even
where a particular nucleic acid molecule does not encode a polypeptide having
TNFR
functional activity, one of skill in the art would still know how to use the
nucleic acid
molecule, for instance, as a hybridization probe or a polymerase chain
reaction (PCR) primer.
Uses of the nucleic acid molecules of the present invention that do not encode
a polypeptide
having TNFR functional activity include, inter alia, (1) isolating a TNFR gene
or allelic
variants thereof in a cDNA library; (2) ih situ hybridization (e.g., "FISH")
to metaphase
chromosomal spreads to provide precise chromosomal location of the TNFR gene,
as
described in Verma et al., Fluntasz Chromosomes: A Masaual of Basic
Techf2iques, Pergamon
Press, New York (1988); and Northern Blot analysis for detecting TNFR mRNA
expression
in specific tissues.
[0094] Preferred, however, are nucleic acid molecules having sequences at
least 90%,
95%, 96%, 97%, 98% or 99% identical to a nucleic acid sequence shown in Figure
1 or 2
(SEQ ID NOS:1 ox 3) or to the nucleic acid sequence of the cDNA clone
contained in the
plasmid deposited as ATCC Deposit No. 97810 or ATCC Deposit No. 97809, and/or
to a
nucleic acid sequence otherwise disclosed herein (e.g., encoding polypeptide
having the
amino acid sequence of a N and/or C terminal deletion disclosed herein), which
do, in fact,
39
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
encode polypeptides having TNFR (i.e., TNFR-6a and/or TNFR-6(3) protein
functional
activity. By "a polypeptide having TNFR functional activity" is intended
polypeptides
exhibiting activity similar, but not necessarily identical, to an activity of
a TNFR-6ct and/or
TNFR-6(3 protein of the invention (e.g., complete (full-length), mature, and
extracellular
domain as measured, for example, in a particular immunoassay or biological
assay. For
example, TNFR-hoc and/or TNFR-6(3 activity can be measured by determining the
ability of a
TNFR-6cc and/or TNFR-6[3 polypeptide to bind a TNFR-hoc and/or -6(3 ligand
(e.g., Fas
Ligand and/or AIM-II (International application publication number WO
97/34911,
published September 25, 1997). In another example, TNFR-6a and/or TNFR-6(3
functional
activity is measured by determining the ability of a polypeptide, such as
cognate ligand
which is free or expressed on a cell surface, to induce apoptosis.
[0095] The TNF family ligands induce various cellular responses by binding to
TNF-
family receptors, including the TNFR-hoc and TNFR-6(3 of the present
invention. Cells
which express the TNFR proteins are believed to have a potent cellular
response to TNFR-I
receptor ligands including B lymphocytes (CD19+), both CD4 and CD8+ T
lymphocytes,
monocytes and endothelial cells. By a "cellular response to a TNF-family
ligand" is intended
any genotypic, phenotypic, and/or morphological change to a cell, cell line,
tissue, tissue
culture or patient that is induced by a TNF-family ligand. As indicated, such
cellular
responses include not only normal physiological responses to TNF-family
ligands, but also
diseases associated with increased cell proliferation or the inhibition of
increased cell
proliferation, such as by the inhibition of apoptosis.
[0096] Screening assays for the forgoing are known in the art. One such
screening assay
involves the use of cells which express the receptor (for example, transfected
CHO cells) in a
system which measures extracellular pH changes caused by receptor activation,
for example,
as described in Science 246:181-296 (October 1989). For example, a TNF-family
ligand
may be contacted with a cell which expresses the mature form of the receptor
polypeptide of
the present invention and a second messenger response, e.g., signal
transduction or pH
changes, may be measured to determine whether the TNFR polypeptide is active.
[0097] Of course, due to the degeneracy of the genetic code, one of ordinary
skill in the
art will immediately recognize that a large number of the nucleic acid
molecules having a
sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic
acid sequence
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
of the cDNA clone deposited as ATCC Deposit No. 97810 or 97809, the nucleic
acid
sequence shown in Figure I or 2 (SEQ ID NO:1 and 3), or fragments thereof,
will encode a
polypeptide "having TNFR protein functional activity." In fact, since
degenerate variants of
these nucleotide sequences all encode the same polypeptide, this will be clear
to the skilled
artisan even without performing the above described comparison assay. It will
be further
recognized in the art that, for such nucleic acid molecules that are not
degenerate variants, a
reasonable number will also encode a polypeptide having TNFR protein
functional activity.
This is because the skilled artisan is fully aware of amino acid substitutions
that are either
less likely or not likely to significantly effect protein function (e.g.,
replacing one aliphatic
amino acid with a second aliphatic amino acid), as further described below.
Vectors and Host Cells
[0098] The present invention also relates to vectors which include the
isolated nucleic
acid molecules of the present invention, host cells which are genetically
engineered with the
recombinant vectors, or which are otherwise engineered to produce the
polypeptides of the
invention, and the production of TNFR polypeptides, or fragments thereof, by
recombinant
techniques.
[0100] ' In one embodiment, the polynucleotides of the invention are joined to
a vector
(e.g., a cloning or expression vector). The vector may be, for example, a
phage, plasmid, viral
or retroviral vector. Retroviral vectors may be replication competent or
replication defective.
In the latter case, viral propagation generally will occur only in
complementing host cells.
Generally, a plasmid vector is introduced in a precipitate, such as a calcium
phosphate
precipitate, or in a complex with a charged lipid. If the vector is a virus,
it may be packaged
in vitro using an appropriate packaging cell line and then transduced into
host cells.
[0101] Generally, recombinant expression vectors will include origins of
replication and
selectable markers permitting transformation of the host cell, e.g., the
ampicillin resistance
gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a
highly-expressed
gene to direct transcription of a downstream structural sequence. Such
promoters can be
derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase
(PGK), a-factor, acid phosphatase, or heat shock proteins, among others. The
expression
constructs will further contain sites for transcription initiation,
termination and, in the
transcribed region, a ribosome binding site for translation. The coding
portion of the
41
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
transcripts expressed by the constructs will preferably include a translation
initiating colon at
the beginning and a termination colon (UAA, UGA or UAG) appropriately
positioned at the
end of the polypeptide to be translated. The heterologous structural sequence
is assembled in
appropriate phase with translation initiation and termination sequences, and
preferably, a
leader sequence capable of directing secretion of translated protein into the
periplasmic space
or extracellular medium. Optionally, the heterologous sequence can encode a
fusion protein
including an N-terminal identification peptide imparting desired
characteristics, for example,
stabilization or simplified purification of expressed recombinant product.
[0102] In one embodiment, the DNA of the invention is operatively associated
with an
appropriate heterologous regulatory element (e.g., promoter or enhancer), such
as, the phage
lambda PL promoter, the E. coli lac, typ, phoA, and tac promoters, the SV40
early and late
promoters and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be
known to the skilled artisan.
[0103] As indicated, the expression vectors will preferably include at least
one selectable
marker. Such markers include dihydrofolate reductase, glutamine synthase, 6418
or
neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or
ampicillin
resistance genes for culturing in E. coli and other bacteria. °
[0104) Vectors which use glutamine synthase (GS) or DHFR as the selectable
markers
can be amplified in the presence of the drugs methionine sulphoximine or
methotrexate,
respectively. The availability of drugs which inhibit the function of the
enzymes encoded by
these selectable markers allows for selection of cell lines in which the
vector sequences have
been amplified after integration into the host cell's DNA. An advantage of
glutamine
synthase based vectors are the availabilty of cell lines (e.g., the murine
myeloma cell Line,
NSO) which are glutamine synthase negative. Vectors containing glutamine
synthase can also
be amplified in glutamine synthase expressing cells (e.g. Chinese Hamster
Ovary (CHO)
Bells) by providing additional inhibitor to prevent the functioning of the
endogenous gene. A
glutamine synthase expression system and components thereof are detailed in
PCT
publications: W087/04462; W086/05807; W089/01036; W089110404; and W091/06657
which are hereby incorporated in their entireties by reference herein.
Additionally, glutamine
synthase expression vectors that may be used according to the present
invention are
commercially available from suppliers including, for example, Lonza Biologics,
Inc.
(Portsmouth, NH). Expression and production of monoclonal antibodies using a
GS
42
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
expression system in murine myeloma cells is described in Bebbington et al.,
Biolteclxnology
10:169(1992) and in Biblia and Robinson Biotechfaol. Prog. 11:1 (1995) which
are herein
incorporated by reference.
[0105] Representative examples of appropriate hosts include, but are not
limited to,
bacterial cells, such as E. coli, Streptornyces and Salnzofaella typhimuriuna
cells; fungal cells,
such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9
cells; animal cells
such as CHO, COS, 293 and Bowes melanoma cells; and plant cells. Appropriate
culture
mediums and conditions for the above-described host cells are known in the
art.
[0106] The host cell can be a higher eukaryotic cell, such as a mammalian cell
(e.g., a
human derived cell), or a lower eukaryotic cell, such as a yeast cell, or the
host cell can be a
prokaryotic cell, such as a bacterial cell. The host strain may be chosen
which modulates the
expression of the inserted gene sequences, or modifies and processes the gene
product in the
specific fashion desired. Expression from certain promoters can be elevated in
the presence
of certain inducers; thus expression of the genetically engineered polypeptide
may be
controlled. Furthermore, different host cells have characteristics and
specific mechanisms for
the translationaI and post-translational processing and modification (e.g.,
phosphoryIation,
cleavage) of proteins. Appropriate cell lines can be chosen to ensure the
desired
modifications and processing of the foreign protein expressed. Selection of
appropriate
vectors and promoters for expression in a host cell is a well known procedure
and the
requisite techniques for expression vector construction, introduction of the
vector into the
host and expression in the host are routine skills in the art.
[0107] Useful expression vectors for bacterial use are constructed by
inserting a structural
DNA sequence encoding a desired protein together with suitable translation
initiation and
termination signals in nnerahle reading nha~e with a fnnetinnal nrnmntPr ThP.
vartnr mill
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
available plasmids comprising genetic elements of the well known cloning
vector pBR322
(ATCC 37017). Such commercial vectors include, fox example,. pKK223-3
(Pharmacia Fine
Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These
pBR322 "backbone" sections are combined with an appropriate promoter and the
structural
sequence to be expressed. Among vectors preferred for use in bacteria include
pHE4-5
(ATCC Accession No. 209311; and variations thereof), pQE70, pQE60 and pQE-9,
available
from QIAGEN, Inc., supYa; pBS vectors, Phagescript vectors, Bluescript
vectors, pNHBA,
pNHl6a, pNHl8A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3,
pKK233-3,
pDR540, pRITS available from Pharmacia. Among preferred eukaryotic vectors are
pWI,NEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3,
pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will be
readily
apparent to the skilled artisan.
[0108] Following transformation of a suitable host strain and growth of the
host strain to
an appropriate cell density, the selected promoter is induced by appropriate
means (e.g.,
temperature shift or chemical induction) and cells are cultured for an
additional period. Cells
are typically harvested by centrifugation, disrupted by physical or chemical
means, and the
resulting crude extract retained for further purification.
[0109] ~ Microbial cells employed in expression of proteins can be disrupted
by any
convenient method, including freeze-thaw cycling, sonication, mechanical
disruption, or use
of cell lysing agents, such methods are well know to those skilled in the art.
[0110] Transcription of the DNA encoding the polypeptides of the present
invention by
higher eukaryotes is increased by inserting an enhancer sequence into the
vector. Enhancers
are cis-acting elements of DNA, usually about from 10 to 300 by that act on a
promoter to
increase its transcription. Examples including the SV40 enhancer on the late
side of the
replication origin by 100 to 270, a cytomegalovirus early promoter enhancer,
the polyoma
enhancer on the late side of the replication origin, and adenovirus enhancers.
[0111] Various mammalian cell culture systems can also be employed to express
recombinant protein. Examples of mammalian expression systems include the COS-
7 lines
of monkey kidney fibroblasts, described by Gluzman (Cell 23:175 (1981)), and
other cell
lines capable of expressing a compatible vector, for example, the C127, 3T3,
CHO, NSO
HeLa and BHK cell lines. NSO cell lines are particularly suitable host cells
for
44
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
transformation with polynucleotides and expression vectors of the invention.
Mammalian
expression vectors will comprise an origin of replication, a suitable promoter
and enhances,
and also any necessary ribosome binding sites, polyadenylation site, splice
donor and
acceptor sites, transcriptional termination sequences, and 5' flanlcing
nontranscribed
sequences. DNA sequences derived from the SV40 splice, and polyadenylation
sites may be
used to provide the required nontranscribed genetic elements.
[0112] Introduction of the vector construct into the host cell can be effected
by techniques
known in the art which include, but are not limited to, calcium phosphate
transfection,
DEAE-dextran mediated transfection, cationic lipid-mediated transfection,
electroporation,
transduction, infection or other methods. Such methods are described in many
standard
laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology
(1986).
[0113] In addition to encompassing host cells containing the vector constructs
discussed
herein, the invention also encompasses primary, secondary, and immortalized
host cells of
vertebrate origin, particularly mammalian origin, that have been engineered to
delete or
replace endogenous genetic material (e.g., TNFR coding sequence), and/or to
include genetic
material (e.g., heterologous polynucleotide sequences) that is operably
associated with TNFR
polynucleotides of the invention, and which activates, alters, and/or
amplifies endogenous
TNFR polynucleotides. For example, techniques known in the art may be used to
operably
associate heterologous control regions (e.g., promoter and/or enhances) and
endogenous
TNFR polynucleotide sequences via homologous recombination (see, e.g., U.S.
Patent No.
5,641,670, issued June 24, 1997; International application publication number
WO 96129411,
published September 26, 1996; International application publication number WO
94/12650,
published August 4, 1994; Roller et al., Proc. Natl. Acaa'. Sci. USA 86:8932-
8935 (1989);
and Zijlstra et al., Nature 342:435-438 (1989), the disclosures of each of
which are
incorporated by reference in their entireties).
[0114] The host cells described ifZfra can be used in a conventional manner to
produce the
gene product encoded by the recombinant sequence. Alternatively, cell-free
translation
systems can also be employed to produce the polypeptides of the invention
using RNAs
derived from the DNA constructs of the present invention.
[0115] The polypeptide of the invention may be expressed or synthesized in a
modified
form, such as a fusion protein (comprising the polypeptide joined via a
peptide bond to a
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
heterologous protein sequence (of a different protein), e.g., the signal
peptide of CK-beta8
(amino acids -21 to -1 of the CK-~8 sequence disclosed in published PCT
application
PCT/LJS95/09058; filed 6/23/95) or the signal peptide of stanniocalcin (See
ATCC Accession
No. 75652, deposited January 25, 1994)), and may include not only secretion
signals, but also
additional heterologous functional regions. Such a fusion protein can be made
by ligating
polynucleotides of the invention and the desired nucleic acid sequence
encoding the desired
amino acid sequence to each other, by methods known in the art, in the proper
reading frame,
and expressing the fusion protein product by methods known in the art.
Alternatively, such a
fusion protein can be made by protein synthetic techniques, e.g., by use of a
peptide
synthesizer. Thus, for instance, a region of additional amino acids,
particularly charged
amino acids, may be added to the N-terminus of the polypeptide to improve
stability and
persistence in the host cell, during purification, or during subsequent
handling and storage.
Also, peptide moieties may be added to the polypeptide to facilitate
purification. Such
regions may be removed prior to final preparation of the polypeptide. The
addition of peptide
moieties to polypeptides to engender secretion or excretion, to improve
stability and to
facilitate purification, among others, are familiar and routine techniques in
the art.
[01I6] In one embodiment, polynucleotides encoding TNFR-6 alpha andlor TNFR-6
beta
polypeptides of the invention may be fused to signal sequences Which will
direct the
localization of a protein of the invention to particular compartments of a
prokaryotic or
eukaryotic cell and/or direct the secretion of a protein of the invention from
a prokaryotic or
eukaryotic cell. For example, in E. coli, one may wish to direct the
expression of the protein
to the periplasmic space. Examples of signal sequences or proteins (or
fragments thereof) to
which the polypeptides of the invention may be fused in order to direct the
expression of the
polypeptide to the periplasmic space of bacteria include, but are not limited
to, the pelB
signal sequence, the maltose binding protein (MBP) signal sequence, MBP, the
ompA signal
sequence, the signal sequence of the periplasmic E. coli heat-labile
enterotoxin B-subunit, the
signal sequence of chemokine-beta-8, and the signal sequence of alkaline
phosphatase.
Several vectors are commercially available for the construction of fusion
proteins which will
direct the localization of a protein, such as the pMAL series of vectors
(particularly the
pMAL-p series) available from New England Biolabs. In a specific embodiment,
polynucleotides encoding TNFR-6 alpha and/or TNFR-6 beta polypeptides of the
invention
may be fused to the pelB pectate lyase signal sequence to increase the
efficiency of
46
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
expression and purification of such polypeptides in Gram-negative bacteria.
See, U.S. Patent
Nos. 5,576,195 and 5,846,818, the contents of which are herein incorporated by
reference in
their entireties.
[0117] Examples of signal peptides that may be fused to a polypeptide of the
invention in
order to direct its secretion in mammalian cells include; but are not limited
to, the MPIF-1
signal sequence (amino acids 1-21 of GenBank Accession number AAB51I34), the
stanniocalcin signal sequence (MLQNSAVLLLLVISASA, SEQ ID N0:29), and a
consensus
signal sequence (MPTWAWWLFLVLLLALWAPARG, SEQ ID N0:30). A suitable signal
sequence that may be used in conjunction with baculoviral expression systems
is the gp67
signal sequence, (amino acids 1-19 of GenBank Accession Number AAA72759).
[0118] A preferred fusion protein comprises a heterologous region from
immunoglobulin
that is useful to stabilize and purify proteins. For example, EP-A-0 464 533
(Canadian
counterpart 2045869) discloses fusion proteins comprising various portions of
constant
region of immunoglobulin molecules together with another human protein or part
thereof. In
many cases, the Fc part in a fusion protein is thoroughly advantageous for use
in therapy and
diagnosis and thus results, for example, in improved pharmacokinetic
properties (EP-A 0232
262). In preferred embodiments, the IgGl m(f) allele is used to generate Fc
fusion proteins of
the invention. In other embodiments, the IgG1 m(f) allele in which the
cysteine residue at
position 220 in the hinge region of the constant region is substituted with a
serine amino acid
residue is used. Alternatively, for some uses it would be desirable to be able
to delete the Fc
part after the fusion protein has been expressed, detected and purified in the
advantageous
manner described. This is the case when Fc portion proves to be a hindrance to
use in
therapy and diagnosis, for example when the fusion protein is to be used as
antigen for
immunizations. As an example, an enterokinase cleavage site between the
protein of the
invention and the fusion moiety (e.g. Fc constant region) may be engineered.
Subsequently,
the protein of the invention may be separated from the fusion moiety by
digestion with
enterokinase. In drug discovery, for example, human proteins, such as hIL-5
has been fused
with Fc portions for the purpose of high-throughput screening assays to
identify antagonists
of hIL-5. See, D. Bennett et al., J. Molecular Recognition 8:52-58 (1995) and
K. Johanson et
al., J. Biol. Chem. 270:9459-9471 (1995). In another example, preferred fusion
proteins of
the invention comprise a portion of an immunoglobulin light chain (i.e., a
portion of a kappa
47
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
or lambda light chain). In specific embodiments the fusion proteins of the
invention
comprise a portion of the constant region of a kappa or lambda light chain.
[0119] Polypeptides of the invention (including antibodies of the invention,
see below)
may also be fused to albumin (including but not limited to recombinant human
serum
albumin (HSA) (see, e.g., U.S. Patent No. 5,876,969, issued March 2, 1999, EP
Patent 0 413
622, and U.S. Patent No. 5,766,883, issued June 16, 1998, herein incorporated
by reference in
their entirety)), resulting in chimeric polypeptides. In a preferred
embodiment, polypeptides
(including antibodies) of the present invention (including fragments or
variants thereof) are
fused with the mature form of human serum albumin (i.e., amino acids 1 - 585
of human
serum albumin as shown in Figures 1 and 2 of EP Patent 0 322 094) which is
herein
incorporated by reference in its entirety. In another preferred embodiment,
polypeptides
and/or antibodies of the present invention (including fragments or variants
thereof) are fused
with polypeptide fragments comprising, or alternatively consisting of, amino
acid residues 1-
z of human serum albumin, where z is an integer from 369 to 419, as described
in U.S. Patent
5,766,883 herein incorporated by reference in its entirety. Polypeptides
and/or antibodies of
the present invention (including fragments or variants thereof) may be fused
to either the N-
or C-terminal end of the heterologous protein (e.g., immunoglobulin Fc
polypeptide or
human serum albumin polypeptide). Such human serum albumin TNFR-6 alpha and
TNFR-6
beta fusion proteins may be used therapeutically in accordance with the
invention, in the
same manner as, for example, the TNFR-6a- and TNFR-6(3- Fc fusion proteins
described
herein, below (see, e.g., Examples 22 and 23).
[0120] Other fusion proteins of the invention include fusion of TNFR-6 alpha
or TNFR-6
beta, or even TNFR-6 alpha-Fc fusion protein, TNFR-6 beta-Fc fusion protein,
TNFR-6
alpha-HSA fusion protein, or TNFR-6 beta-HSA fusion protein, fused to
glucoamylase (e.g.,
GenBank Accession Number P23176 or P04064). Nucleic acids encoding such fusion
proteins operably associated with appropriate regulatory sequences and/or
selectable markers
may be expressed in fungal cells including, for example, Saccharomyces species
such as S.
cerevisiae, Aspergillus species such as A. niger and Chrysosporium species
such as C.
lucknowense.
[0121] Exemplary fragments of TNFR-6 alpha, that may be fused to a
heterologous
polypeptide, for example, immunoglobulin Fc domain or human serum albumin
include, but
48
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
are not limited to, amino acid residues 1-299, 1-300, 23-300, 34-300, 30-300,
1-195, 1-221,
1-254, 1-271, 35-300, 42-300, 47-300, and 48-300 of SEQ ID N0:2. In preferred
embodiments, amino acid residues 30-300 of SEQ ID N0:2 are fused to an
immunoglobulin
Fc domain or human serum albumin.
[0122] In specific embodiments, the present invention provides TNFR-6 alpha
expression
constructs for expressing TNFR-6 alpha or fragments, variants or fusion
proteins thereof, in
which the polynucleotide encoding the TNFR-6 alpha polypeptide comprises axons
1, 2, and
3 of TNFR-6 alpha as well as the intervening introns, see for example SEQ ID
N0:27,
wherein axon 1 consists of nucleotides 425-560 of SEQ >D N0:27 and axon 2
consists of
nucleotides 756-1512 of SEQ ID N0:27. In particular embodiments, the above
expression
constructs comprising TNFR-6 alpha axons and introns may also be designed so
that the
TNFR-6 alpha protein will be expressed as a fusion protein (e.g., an Fc fusion
protein or a
human serum albumin fusion protein). The proteins expressed by these
expression
constructs are also encompassed by the present invention.
{0123] In other embodiments, the present invention provides TNFR-6 alpha
expression
constructs that express fragments of TNFR-6 alpha and/or TNFR-6 beta
containing the
cysteine rich domains (e.g., amino acid residues 1-195 of SEQ ID N0:2) either
alone or as a
fusion protein (e.g., an Fc fusion protein or a human serum albumin fusion
protein). The
proteins expressed by these expression constructs as well as polynucleotides
encoding the
proteins expressed by these expression constructs, are also encompassed by the
present
invention.
[0124] In other embodiments, the present invention provides TNFR-6 alpha
expression
constructs for expressing TNFR-6 alpha and/or TNFR-6 beta as a fusion protein
with TR2
(SEQ ID NO:3I, also described in International Publication Numbers W096/34095
and
W098/18824 which are herein incorporated by reference in their entireties). In
specific
embodiments, the present invention encompasses an expression vector for
expressing a TR2-
TNFR-6 alphaTR2 fusion protein comprising amino acids M1-S41 of TR2 (SEQ ID
N0:31)
fused to C48-S 195 of TNFR-6 alpha (SEQ )D N0:2) fused to S 186-A192 of TR2
(SEQ ID
NO:31). In other embodiments the TR2-TNFR-6 alpha-TR2 fusion protein is
additionally
fused to an immunoglobulin Fc region or to human serum albumin. The proteins
expressed
by these expression constructs as well as polynucleotides encoding the
proteins expressed by
these expression constructs, are also encompassed by the present invention.
49
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0125] In other embodiments, the present invention provides TNFR-6 alpha
expression
constructs for expressing TNFR-6 alpha fusions proteins in which the last 6
amino acids of
TNFR-6 alpha have been deleted and replaced with the amino acid sequence NIT.
Such
fusion proteins have the TNFR-6 alpha protein N-terminal of the fusion protein
moiety (e.g.,
an immunoglobulin Fc region or human serum albumin). The NIT sequence may
serve as a
glycosylation site. As a non-limiting mechanism, the carbohydrate moieties on
a
glycosylated TNFR-6 alpha (M1-E294 of SEQ ID N0:2)-NIT-fusion protein may mask
the
fusion protein junction and prevent cleavage of the protein in the host cell.
The TNFR-6
alpha (Ml-E294 of SEQ >D N0:2)-NIT-fusion proteins (glycosylated and non-
glycosylated)
are also encompassed by the present invention, as are polynucleotides encoding
the TNFR-6
alpha (M1-E294 of SEQ >D N0:2)-NIT-fusion proteins.
[0126] The present~invention encompasses TNFR-6 alpha proteins which contain
alanine-
160 to aspargine (A160N) and/or serine-186 to asparagine (S 186N) point
mutations. The
present invention also encompasses TNFR-6 alpha (A160N, S186N) fusion
polypeptides
(e.g., TNFR6- alpha (A160N, S186N) fused to an irnmunoglobulin Fc domain or to
human
serum albumin). Polynucleotides encoding these TNFR-6 alpha (A160N, S186N)
polypeptides (both fusion and non-fusion) as well as vectors comprising
polynucleotides
encoding these TNFR-6 alpha (A160N, S 186N) polypeptides, are also encompassed
by the
invention.
[0127] In other embodiments, the present invention provides TNFR-6 alpha
expression
constructs which comprise a polynucleotide encoding mammalian synthetic TNFR-6
alpha
(SEQ ID N0:32). In preferred embodiments, the present invention provides TNFR-
6 alpha
expression constructs which comprise a polynucleotide encoding mammalian
synthetic
TNFR-6 alpha (SEQ )D N0:32) operably linked to a heterologous regulatory
sequence. In
still other embodiments, the present invention provides TNFR-6 alpha
expression constructs
which comprise a polynucleotide encoding mammalian synthetic TNFR-6 alpha (SEQ
DJ
N0:32) fused in frame to a polynucleotide encoding a heterologous polypeptide,
such as a
polynucleotide encoding an immunoglobulin constant domain or human serum
albumin.
[0128] In other embodiments, the present invention provides TNFR-6 alpha
expression
constructs which comprise a polynucleotide encoding TNFR-6 alpha which has
been codon
optimized for expression in yeast (SEQ ID N0:33). In preferred embodiments,
the present
invention provides TNFR-6 alpha expression constructs which comprise
polynucleotide
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
encoding TNFR-6 alpha which has been codon optimized for expression in yeast
(SEQ ID
N0:33) operably linked to a heterologous regulatory sequence. In still other
embodiments,
the present invention provides TNFR-6 alpha expression constructs which
polynucleotide
encoding TNFR-6 alpha which has been codon optimized for expression in yeast
(SEQ ID
N0:33) fused in frame to a polynucleotide encoding a heterologous polypeptide
such as, a
polynucleotide encoding an immunoglobulin constant domain or human serum
albumin.
[0129] Proteins of the present invention include: products purified from
natural sources,
including bodily fluids, tissues and cells, whether directly isolated or
cultured; products of
chemical synthetic procedures; and products produced by recombinant techniques
from a
prokaryotic or eukaryotic host, including, for example, bacterial, yeast,
higher plant, insect
and mammalian cells. Depending upon the host employed in a recombinant
production
procedure, the polypeptides of the present invention may be glycosylated or
may be
non-glycosylated. In addition, polypeptides of the invention may also include
an initial
modified methionine residue, in some cases as a result of host-mediated
processes.
[0130] Proteins of the invention can be chemically synthesized using
techniques known
in the art (e.g., see Creighton, 1983, Proteins: Structures and Molecular
Prifzciples, W.H.
Freeman & Co., N.Y:, and Hunkapiller, M., et al., Nature 310:105-111 (1984)).
For
example, a peptide corresponding to a fragment of the complete TNFR (i.e.,
TNFR-hoc and/or
TNFR-6(3) polypeptides of the invention can be synthesized by use of a peptide
synthesizer.
Furthermore, if desired, nonclassical amino acids or chemical amino acid
analogs can be
introduced as a substitution or addition into the TNFR polypeptide sequence.
Non-classical
annino acids include, but are not limited to, to the D-isomers of the common
amino acids, 2,4-
diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-
amino butyric
acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-
amino propionic
acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline,
homocitrulline,
cysteic acid, t-butylglycine, t-butylalanine, phenylglycine,
cyclohexylalanine, b-alanine,
fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-
methyl amino
acids, Na-methyl amino acids, and amino acid analogs in general. Furthermore,
the amino
acid can be D (dextrorotary) or L (levorotary).
[0131] The TNFR-6 alpha and/or TNFR-6 beta proteins may be modified by either
natural processes, such as posttranslational processing, or by chemical
modification
51
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
techniques which are well known in the art. It will be appreciated that the
same type of
modification may be present in the same or varying degrees at several sites in
a given TNFR-
6 alpha and/or TNFR-6 beta protein. Also, a given TNFR-6 alpha and/or TNFR-6
beta
protein may contain many types of modifications. TNFR-6 alpha andlor TNFR-6
beta
proteins may be branched , for example, as a result of ubiquitination, and
they may be cyclic,
with or without branching. Cyclic, branched, and branched cyclic TNFR-6 alpha
and/or
TNFR-6 beta proteins may result from posttranslation natural processes or may
be made by
synthetic methods. Modifications include acetylation, acylation, ADP-
ribosylation,
amidation, covalent attachment of flavin, covalent attachment of a heme
moiety, covalent
attachment of a nucleotide or nucleotide derivative, covalent attachment of a
lipid or lipid
derivative, covalent attachment of phosphotidylinositol, cross-linking,
cyclization, disulfide
bond formation, demethylation, formation of covalent cross-links, formation of
cysteine,
formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation,
GPI anchor
formation, hydroxylation, iodination, methylation, myristoylation, oxidation,
pegylation,
proteolytic processing, phosphorylation, p'renylation, racemization,
selenoylation, sulfation,
transfer-RNA mediated addition of amino acids to proteins such as
arginylation, and
ubiquitination. (See, for instance, PROTEINS - STRUCTURE AND MOLECULAR
PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York
(1993);
POST- TRANSLATIONAL COVALENT, MODIFICATION OF PROTEINS, B. C.
Johnson, Ed., Academic Press, New York, pgs. 1-22 (1983); Seifter et al., Meth
Enzymol
182:626-646 (1990); Rattan et al., Ann NYAcad Sci 663:48-62 (1992).)
[0132] The invention encompasses TNFR-hoc and/or TNFR-6(3 proteins which are
differentially modified during or after translation, e.g., by glycosylation,
acetylation,
phosphorylation, amidation, derivatization by known protecting/blocking
groups, proteolytic
cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any
of numerous
chemical modifications may be carried out by known techniques, including but
not limited to,
pecific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain,
V8 protease,
NaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in
the presence of
tunicamycin; etc.
[0133] Additional post-translational modifications encompassed by the
invention include,
for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-
terminal or
52
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
C-terminal ends), attachment of chemical moieties to the amino acid backbone,
chemical
modifications of N-linked or O-linked carbohydrate chains, and addition or
deletion of an
N-terminal methionine residue as a result of procaryotic host cell expression.
The
polypeptides may also be modified with a detectable label, such as an
enzymatic, fluorescent,
isotopic or affinity label to allow for detection and isolation of the
protein.
[0134] The present invention further encompasses TNFR-6a and/or TNFR-6(3
polypeptides or fragments thereof conjugated to a diagnostic agent (e.g. a
detecable agent)
and/or therapeutic agent. Examples of detectable substances include various
enzymes,
prosthetic groups, fluorescent materials, luminescent materials,
bioluminescent materials,
radioactive materials, positron emitting metals using various positron
emission tomographies,
and nonradioactive paramagnetic metal ions. The detectable substance may be
coupled or
conjugated either directly to the polypeptide (or fragment thereof) or
indirectly, through an
intermediate (such as, for example, a linker known in the art) using
techniques known in the
art. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be
conjugated to
polypeptides for use as diagnostics and/or therapeutics according to the
present invention.
Examples of suitable enzymes include horseradish peroxidase, alkaline
phosphatase, beta-
galactosidase, or acetylcholinesterase; examples of suitable prosthetic group
complexes
include streptavidin/biotin and avidin/biotin; examples of suitable
fluorescent materials
include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an
example of a
luminescent material includes luminol; examples of bioluminescent materials
include
luciferase, luciferin, and aequorin; and examples of suitable radioactive
material include
iodine ('2'I '23I lzSl 131I) carbon ('4C) sulfur (35S) tritium (3H) indium
("'In "'In "3"'In "5"'In)
> > > > > > > > > > >
technetium (99Tc,99"'Tc), thallium (Z°'Ti), gallium (68Ga, 6'Ga),
palladium ('°'Pd), molybdenum
(99MO) xenon (133Xe) fluorine ('8F) 'S3Sm '"Lu 'S9Gd '49Pm '4°La mss
166H~ 9oY a~s~ is6Re
> > > > > > > > > > > > >
~asRe~ ~azPr~ losRh, and 9'Ru. A preferred radioisotope label is "'I. Another
preferred
radioactive label is 9°Y. Another preferred radioactive label is '3'I.
[0135] Further, TNFR-6a and/or TNFR-6(3 polypeptides or fragments or variants
thereof
may be conjugated to a therapeutic moiety such as a cytotoxin, e.g., a
cytostatic or cytocidal
agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters
such as, for
example, 2''Bi or other radioisotopes such as, for example, '°3Pd,
133Xe~ 13~I~ 6sGe, 5'Co, '~Zn,
53
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
asSr~ szP~ ssS~ 90~,~ issSm~ ~saGd~ ~6°yb~ siCr~ saMn~ ~sSe~ uaSn~
°oY~ n,Tln, issRe~ issReand'6~Ho. In
specific embodiments, TNFR-hoc and/or TNFR-6(3 polypeptides or fragments or
variants
thereof are attached to macrocyclic chelators useful for conjugating
radiometal ions,
including but not limited to, "'Lu, 9°Y, '6''Ho, and'S3Sm, to
polypeptides. In a preferred
embodiment, the radiometal ion associated with the macrocyclic chelators
attached to TNFR-
6oc and/or TNFR-6(3 polypeptides of the invention is "'In. In another
preferred embodiment,
the radiometal ion associated with the macrocyclic chelator attached to TNFR-
hoc and/or
TNFR-6(3 polypeptides of the invention is 9°Y. In specific embodiments,
the macrocyclic
chelator is 1,4,7,10-tetraazacyclododecane-N,N',N",N"'-tetraacetic acid
(DOTA). In other
specific embodiments, the DOTA is attached to the an antibody of the invention
or fragment
thereof via a linker molecule. Examples of linker molecules useful for
conjugating DOTA to
a polypeptide are commonly known in the art - see, for example, DeNardo et
al., Clin Cancer
Res. 4(10):2483-90, 1998; Peterson et al., Bioconjug. Chem. 10(4):553-7, 1999;
and
Zimmerman et al, Nucl. Med. Biol. 26(8):943-50, 1999 which are hereby
incorporated by
reference in their entirety. In addition U.S. Patents 5,652,361 and 5,756,065,
which disclose
chelating agents that may be conjugated to antibodies, and methods for making
and using
them, are hereby incorporated by reference in their entireties.
[0136] Techniques known in the art may be applied to label antibodies of the
invention.
Such techniques include, but are not limited to, the use of bifunctional
conjugating agents
(see e.g., U.S. Patent Nos. 5,756,065; 5,714,631; 5,696,239; 5,652,361;
5,505,931;
5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and
5,808,003; the
contents of each of which are hereby incorporated by reference in its
entirety) and direct
coupling reactions (e.g., Bolton-Hunter and Chloramine-T reaction).
[0137] Also provided by the invention are chemically modified derivatives of
TNF'R-hoc
and/or TNFR-6(3 which may provide additional advantages such as increased
solubility,
stability and circulating time of the polypeptide, or decreased immunogenicity
(see US Patent
Number 4,179,337). The chemical moieties for derivitization may be selected
from water
soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol
copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The
polypeptides may be
modified at random positions within the molecule, or at predetermined
positions within the
molecule and may include one, two, three or more attached chemical moieties.
54
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0138] The polymer may be of any molecular weight, and may be branched or
unbranched. For polyethylene glycol, the preferred molecular weight is between
about 1 kDa
and about 100 kDa (the term "about" indicating that in preparations of
polyethylene glycol,
some molecules will weigh more, some less, than the stated molecular weight)
for ease in
handling and manufacturing. Other sizes may be used, depending on the desired
therapeutic
profile (e.g., the duration of sustained release desired, the effects, if any
on biological
activity, the ease in handling, the degree or lack of antigenicity and other
known effects of the
polyethylene glycol to a therapeutic protein or analog). For example, the
polyethylene glycol
may have an average molecular weight of about 200, 500, 1000, 1500, 2000,
2500, 3000,
3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500,
10,000,
10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500,
15,000, 15,500,
16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000,
25,000, 30,000,
35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000,
85,000, 90,000,
95,000, or 100,000 kDa.
[0139] As noted above, the polyethylene glycol xilay have a branched
structure.
Branched polyethylene glycols are described, for example, in U.S. Patent No.
5,643,575;
Morpurgo et al., Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al.,
Nucleosides
Nucleotides 1:2745-2750 (1999); and Caliceti et al., Bioco~cjug. Chew. 10:638-
646 (1999),
the disclosures of each of which are incorporated herein by reference.
[0140] The polyethylene glycol molecules (or other chemical moieties) should
be
attached to the protein with consideration of effects on functional or
antigenic domains of the
protein. There are a number of attachment methods available to those skilled
in the art, e.g.,
EP 0 401 384, herein incorporated by reference (coupling PEG to G-CSF), see
also Malik et
al., Exp. Hematol. 20:1028-1035 (1992) (reporting pegylation of GM-CSF using
tresyl
chloride). For example, polyethylene glycol may be covalently bound through
amino acid
residues via a reactive group, such as, a free amino or carboxyl group.
Reactive groups are
those to which an activated polyethylene glycol molecule may be bound. The
amino acid
residues having a free amino group may include lysine residues and the N-
terminal amino
acid residues; those having a free carboxyl group may include aspartic acid
residues glutamic
acid residues and the C-terminal amino acid residue. Sulfhydryl groups may
also be used as a
reactive group for attaching the polyethylene glycol molecules. Preferred for
therapeutic
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
purposes is attachment at an amino group, such as attachment at the N-terminus
or lysine
group.
[0141] As suggested above, polyethylene glycol may be attached to proteins via
linkage
to any of a number of amino acid residues. For example, polyethylene glycol
can be linked to
a proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic
acid, or cysteine
residues. One or more reaction chemistries may be employed to attach
polyethylene glycol to
specific amino acid residues (e.g., lysine, histidine, aspartic acid, glutamic
acid, or cysteine)
of the protein or to more than one type of amino acid residue (e.g., lysine,
histidine, aspartic
acid, glutamic acid, cysteine and combinations thereof) of the protein.
[0142] One may specifically desire proteins chemically modified at the N-
terminus.
Using polyethylene glycol as an illustration of the present composition, one
may select from
a variety of polyethylene glycol molecules (by molecular weight, branching,
etc.), the
proportion of polyethylene glycol molecules to protein (or peptide) molecules
in the reaction
mix, the type of pegylation reaction to be performed, and the method of
obtaining the selected
N-terminally pegylated protein. The method of obtaining the N-terminally
pegylated
preparation (i.e., separating this moiety from other monopegylated moieties if
necessary) may
be by purification of the N-terminally pegylated material from a population of
pegylated
protein molecules. Selective proteins chemically modified at the N-terminus
modification
may be accomplished by reductive alkylation which exploits differential
reactivity of
different types of primary amino groups (lysine versus the N-terminal)
available for
derivatization in a particular protein. Under the appropriate reaction
conditions, substantially
selective derivatization of the protein at the N-terminus with a carbonyl
group containing
polymer is achieved.
[0143] As indicated above, pegylation of the proteins of the invention may be
accomplished by any number of means. For example, polyethylene glycol may be
attached to
the protein either directly or by an intervening linker. Linkerless systems
for attaching
polyethylene glycol to proteins are described in Delgado et al., Crit. Rev.
Tlzera. Drug
Carrier Sys. 9:249-304 (1992); Francis et al., Irzte~z. J. of Herzzatol. 68:1-
18 (1998); U.S.
Patent No. 4,002,531; U.S. Patent No. 5,349,052; WO 95/06058; and WO 98/32466,
the
disclosures of each of which are incorporated herein by reference.
56
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0144] One system for attaching polyethylene glycol directly to amino acid
residues of
proteins without an intervening linker employs tresylated MPEG, which is
produced by the
modification of monmethoxy polyethylene glycol (MPEG) using tresylchloride
(C1SOZCHzCF3). Upon reaction of protein with tresylated MPEG, polyethylene
glycol is
directly attached to amine groups of the protein. Thus, the invention includes
protein-
polyethylene glycol conjugates produced by reacting proteins of the invention
with a
polyethylene glycol molecule having a 2,2,2-trifluoreothane sulphonyl group.
[0145] Polyethylene glycol can also be attached to proteins using a number of
different
intervening linkers. For example, U.S. Patent No. 5,612,460, the entire
disclosure of which is
incorporated herein by reference, discloses urethane linkers for connecting
polyethylene
glycol to proteins. Protein-polyethylene glycol conjugates wherein the
polyethylene glycol is
attached to the protein by a linker can also be produced by reaction of
proteins with
compounds such as MPEG-succinimidylsuccinate, MPEG activated with
1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate, MPEG-p-
nitrophenolcarbonate, and various MPEG-succinate derivatives. A number
additional
polyethylene glycol derivatives and reaction chemistries for attaching
polyethylene glycol to
proteins are described in WO 98132466, the entire disclosure of which is
incorporated herein
by reference. Pegylated protein products produced using the reaction
chemistries set out
herein are included within the scope of the invention.
[0146] The number of polyethylene glycol moieties attached to each protein of
the
invention (i.e., the degree of substitution) may also vary. For example, the
pegylated proteins
of the invention may be linked, on average, to l, 2, 3, 4, 5, 6, 7, 8, 9, 10,
12, 15, 17, 20, or
more polyethylene glycol molecules. Similarly, the average degree of
substitution within
ranges such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11-13, 12-
14, 13-15, 14-16,
15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per protein
molecule. Methods
for determining the degree of substitution are discussed, for example, in
Delgado et al., Crit.
Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).
[4147] The TNFR proteins can be recovered and purified by known methods which
include, but are not limited to, ammonium sulfate or ethanol precipitation,
acid extraction,
anion or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic
interaction chromatography, affinity chromatography, hydroxylapatite
chromatography and
57
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
lectin chromatography. Most preferably, nigh performance liquid chromatography
("HPLC")
is employed for purification.
TNFR Proteins
[0148] The invention further provides for the proteins containing polypeptide
sequences
encoded by the polynucleotides of the invention.
[0149] The TNFR proteins of the invention may be in monomers or multimers
(i.e.,
dimers, trimers, tetramers, and higher multimers). Accordingly, the present
invention relates
to monomers and multimers of the TNFR proteins of the invention, their
preparation, and
compositions (preferably, pharmaceutical compositions) containing them. In
specific
embodiments, the polypeptides of the invention are monomers, dimers, trimers
or tetramers.
In additional embodiments, the multimers of the invention are at least dimers,
at least trimers,
or at least tetramers.
[0150] Multimers encompassed by the invention may be homomers or heteromers.
As
used herein, the term homomer, refers to a multimer containing only TNFR
proteins of the
invention (including TNFR fragments, variants, and fusion proteins, as
described herein).
These homomers may contain TNFR proteins having identical or different
polypeptide
sequences. In a specific embodiment, a homomer of the invention is a multimer
containing
only TNFR proteins having an identical polypeptide sequence. In another
specific
embodiment, a homomer of the invention is a multimer containing TNFR proteins
having
different polypeptide sequences. In specific embodiments, the multimer of the
invention is a
homodimer (e.g., containing TNFR proteins having identical or different
polypeptide
sequences) or a homotrimer (e.g., containing TNFR proteins having identical or
different
polypeptide sequences). In additional embodiments, the homomeric multimer of
the
invention is at least a homodimer, at least a homotrimer, or at least a
homotetramer.
[0151] As used herein, the term heteromer refers to a multimer containing
heterologous
proteins (i.e., proteins containing only polypeptide sequences that do not
correspond to a
polypeptide sequences encoded by the TNFR gene) in addition to the TNFR
proteins of the
invention. In a specific embodiment, the multimer of the invention is a
heterodimer, a
heterotrimer, or a heterotetramer. In additional embodiments, the heteromeric
multimer of
the invention is at least a heterodimer, at least a heterotrimer, or at least
a heterotetramer.
58
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0152] Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic
and/or covalent associations and/or may be indirectly linked, by for example,
liposome
formation. Thus, in one embodiment, multimers of the invention, such as, for
example,
homodimers or homotrimers, are formed when proteins of the invention contact
one another
in solution. In another embodiment, heteromultimers of the invention, such as,
for example,
heterotrimers or heterotetramers, are formed when proteins of the invention
contact
antibodies to the polypeptides of the invention (including antibodies to the
heterologous
polypeptide sequence in a fusion protein of the invention) in solution. In
other embodiments,
multimers of the invention are formed by covalent associations with andlor
between the
TNFR proteins of the invention. Such covalent associations may involve one or
more amino
acid residues contained in the polypeptide sequence of the protein ( e.g., the
polypeptide
sequence recited in SEQ ID N0:2 or SEQ ID N0:4, contained in the polypeptide
encoded by
the cDNA clone contained in ATCC Deposit No. 97810), contained in the
polypeptide
encoded by the cDNA clone contained in ATCC Deposit No. 97809). In one
instance, the
covalent associations are cross-linking between cysteine residues located
within the
polypeptide sequences of the proteins which interact in the native (i.e.,
naturally occurnng)
polypeptide. In another instance, the covalent associations are the
consequence of chemical
or recombinant manipulation. Alternatively, such covalent associations may
involve one or
more amino acid residues contained in the heterologous polypeptide sequence in
a TNFR
fusion protein. In one example, covalent associations are between the
heterologous sequence
contained in a fusion protein of the invention (see, e.g., US Patent Number
5,478,925). In a
specific example, the covalent associations are between the heterologous
sequence contained
in a TNFR-Fc fusion protein of the invention (as described herein). In another
specific
example, covalent associations of fusion proteins of the invention are between
heterologous
polypeptide sequences from another TNF family ligand/receptor member that is
capable of
forming covalently associated multimers, such as for example, oseteoprotegerin
(see, e.g.,
International application publication number WO 98/49305, the contents of
which are herein
incorporated by reference in its entirety). In another embodiment, two or more
TR6-alpha
and/or TR6-beta polypeptides of the invention are joined through peptide
linkers. Examples
include those peptide linkers described in U.S. Pat. No. 5,073,627 (hereby
incorporated by
reference). Proteins comprising multiple TR6-alpha and/or TR6-beta
polypeptides separated
by peptide linkers may be produced using conventional recombinant DNA
technology.
59
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0153] Another method for preparing multimer TR6-alpha and/or TR6-beta
polypeptides
of the invention involves use of TR6-alpha and/or TR6-beta polypeptides fused
to a leucine
zipper or isoleucine zipper polypeptide sequence. Leucine zipper and
isoleucine zipper
domains are polypeptides that promote multimerization of the proteins in which
they are
found. Leucine zippers were originally identified in several DNA-binding
proteins
(Landschulz et al., Science 240:1759, (1988)), and have since been found in a
variety of
different proteins. Among the known leucine zippers are naturally occurring
peptides and
derivatives thereof that dimerize or trimerize. Examples of leucine zipper
domains suitable
for producing soluble multimeric TR6-alpha and/or TR6-beta proteins are those
described in
PCT application WO 94110308, hereby incorporated by reference. Recombinant
fusion
proteins comprising a soluble TR6-alpha and/or TR6-beta polypeptide fused to a
peptide that
dimerizes or trimerizes in solution are expressed in suitable host cells, and
the resulting
soluble multimeric TR6-alpha and/or TR6-beta is recovered from the culture
supernatant
using techniques known in the art.
[0154] Certain members of the TNF family of proteins are believed to exist in
trimeric
form (Beutler and Huffel, Science 264:667, 1994; Banner et al., Cell 73:431,
1993). Thus,
trimeric TR6-alpha and/or TR6-beta may offer the advantage of enhanced
biological activity.
Preferred leucine zipper moieties are those that preferentially form trimers.
One example is a
leucine zipper derived from lung surfactant protein D (SPD), as described in
Hoppe et al.
(FEBS Letters 344:191, (1994)) and in U.S. patent application Ser. No.
08/446,922, hereby
incorporated by reference. Other peptides derived from naturally occurring
trimeric proteins
may be employed in preparing trimeric TR6-alpha and/or TR6-beta.
[0155] In further preferred embodiments, TR6-alpha or TR6-beta polynucleotides
of the
invention are fused to a polynucleotide encoding a "FLAG" polypeptide. Thus, a
TR6-alpha-
FLAG or a TR6-beta-FLAG fusion protein is encompassed by the present
invention. The
FLAG antigenic polypeptide may be fused to a TR6-alpha or a TR6-beta
polypeptide of the
invention at either or both the amino or the carboxy terminus. In preferred
embodiments, a
TR6-alpha-FLAG or a TR6-beta-FLAG fusion protein is expressed from a pFLAG-CMV-
5a
or a pFLAG-CMV-1 expression vector (available from Sigma, St. Louis, MO, USA).
See,
Andersson, S., et al., J. Biol. Cheni. 264:8222-29 (1989); Thomsen, D. R., et
al., Proc. Natl.
Acad. Sci. USA, 81:659-63 (1984); and Kozak, M., Nature 308:241 (1984) (each
of which is
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
hereby incorporated by reference). In further preferred embodiments, a TR6-
alpha-FLAG or
a TR6-beta-FLAG fusion protein is detectable by anti-FLAG monoclonal
antibodies (also
available from Sigma).
[0156] The multimers of the invention may be generated using chemical
techniques
known in the art. For example, proteins desired to be contained in the
multimers of the
invention may be chemically cross-linked using linker molecules and linker
molecule length
optimization techniques known in the art (see, e.g., US Patent Number
5,478,925, which is
herein incorporated by reference in its entirety). Additionally, multimers of
the invention
may be generated using techniques known in the art to form one or more inter-
molecule
cross-links between the cysteine residues located within the polypeptide
sequence of the
proteins desired to be contained in the multimer (see, e.g., US Patent Number
5,478,925,
which is herein incorporated by reference in its entirety). Further, proteins
of the invention
may be routinely modified by the addition of cysteine or biotin to the C
terminus or N-
terminus of the polypeptide sequence of the protein and techniques known in
the art may be
applied to generate multimers containing one or more of these modified
proteins (see, e.g.,
US Patent Number 5,478,925, which is herein incorporated by reference in its
entirety).
Additionally, techniques known in the art may be applied to generate liposomes
containing
the protein components desired to be contained in the multimer of the
invention (see, e.g., US
Patent Number 5,478,925, which is herein incorporated by reference in its
entirety).
[0157] Alternatively, multimers of the invention may be generated using
genetic
engineering techniques known in the art. In one embodiment, proteins contained
in
multimers of the invention are produced recombinantly using fusion protein
technology
described herein or otherwise known in the art (see, e.g., US Patent Number
5,478,925, which
is herein incorporated by reference in its entirety). In a specific
embodiment, polynucleotides
coding for a homodimer of the invention are generated by ligating a
polynucleotide sequence
encoding a polypeptide of the invention to a sequence encoding a linker
polypeptide and then
further to a synthetic polynucleotide encoding the translated product of the
polypeptide in the
reverse orientation from the original C-terminus to the N-terminus (lacking
the leader
sequence) (see, e.g., US Patent Number 5,478,925, which is herein incorporated
by reference
in its entirety). In another embodiment, recombinant techniques described
herein or
otherwise known in the art are applied to generate recombinant polypeptides of
the invention
which contain a transmembrane domain and which can be incorporated by membrane
61
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
reconstitution techniques into liposomes (see, e.g., US Patent Number
5,478,925, which is
herein incorporated by reference in its entirety).
[0158] In one embodiment, the invention provides isolated TNFR proteins
comprising,
or alternatively, consisting of, the amino acid sequence of the complete (full-
length) TNFR
polypeptide encoded by the cDNA contained in ATCC Deposit No. 97810, the amino
acid
sequence of the complete (full-length) TNFR polypeptide encoded by the cDNA
contained in
ATCC Deposit No. 97809, the amino acid sequence of the complete TNFR-6a
polypeptide
disclosed in Figure 1 (SEQ ID N0:2), the amino acid sequence of the complete
TNFR-6(3
polypeptide disclosed in Figure 2 (SEQ ID.N0:4), or a portion of the above
polypeptides.
[0159] In another embodiment, the invention provides isolated TNFR proteins
comprising, or alternatively consisting of, the amino acid sequence of the
mature TNFR
polypeptide encoded by the cDNA contained in ATCC Deposit No. 97810, the amino
acid
sequence of the mature TNFR polypeptide encoded by the cDNA contained in ATCC
Deposit
No. 97809, amino acid residues 31 to 300 of the TNFR-hoc sequence disclosed in
Figure 1
(SEQ ID NO:2), amino acid residues 31 to 170 of the TNFR-6(3 sequence
disclosed in
Figure2 (SEQ ID N0:4), or a portion (i.e., fragment) of the above
polypeptides.
[0160] Polypeptide fragments of the present invention include polypeptides
comprising
or alternatively, consisting of, an amino acid sequence contained in SEQ ID
N0:2, an amino
acid sequence contained in SEQ ID N0:4, an amino acid sequence encoded by the
cDNA
plasmid deposited as ATCC Deposit No. 97810, an amino acid sequence encoded by
the
cDNA plasmid deposited as ATCC Deposit No. 97809, or an amino acid sequence
encoded
by a nucleic acid which hybridizes (e.g., under stringent hybridization
conditions) to the
nucleotide sequence of the cDNA contained in ATCC Deposit No. 97810 and/or
97809, or
shown in Figures 1 and/or 2 (SEQ ID NO: l and SEQ 1D N0:3, respectively) or
the
complementary strand thereto. Polynucleotides that hybridize to these
polynucleotide
fragments are also encompassed by the invention. Protein fragments may be
"free-standing,"
or comprised within a larger polypeptide of which the fragment forms a part or
region, most
preferably as a single continuous region. Representative examples of
polypeptide fragments
of the invention, include, for example, fragments that comprise or
alternatively, consist of
from amino acid residues: 1 to 31, 32 to 50, 51 to 100, 101 to 150, 151 to
200, 201 to 250,
and/or 251 to 300 of SEQ ID NO:2. Additional representative examples of
polypeptide
62
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
fragments of the invention include polypeptide fragments that comprise, or
alternatively,
consist of from amino acids 1 to 31, 32 to 70, 70 to 100, 100 to 125, 126 to
150, andlor 151 to
170 of SEQ ID N0:4. Moreover, polypeptide fragments can be at least 10, 20,
30, 40, 50,
60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175 or 200 amino acids in
length.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
[0161] In specific embodiments, polypeptide fragments of the invention
comprise, or
alternatively consist of, amino acid residues: 100 to 150, 150 to 200, 200 to
300, 210 to 300,
220 to 300, 230 to 300, 240 to 300, 250 to 300, 260 to 300, 270 to 300, 280 to
300, and/or
290 to 300 as depicted in Figure 1 (SEQ ID N0:2). Polynucleotides encoding
these
polypeptides are also encompassed by the invention.
[0162] TNFR comprises two domains having different structural and functional
properties. The amino terminal domain spanning residues 30 to 196 of SEQ ID
N0:2 shows
homology to other members of the TNFR family, through conservation of four
cysteine rich
domains characteristic of TNFR families. Amino acid sequences contained in
each of the four
domains include amino acid residues 34 to 70, 73 to 113, 115 to 150, and 153
to 193, of SEQ
ID N0:2, respectively. The carboxy terminal domain, spanning amino acid
residues 197 to
300 of SEQ ID N0:2, has no significant homology to any known sequences. Unlike
a
number of other TNF receptor family members, TNFR appears to be exclusively a
secreted
protein and does not appear to be synthesized as a membrane associated form.
While the
amino terminal domain of TNFR appears to be required for biological activity
of TNFR, the
carboxy-terminal domain appears to be important for multimerization of TNFR.
[0163] In one embodiment, the polypeptides of the invention comprise, or
alternatively
consist of, amino acid residues 34 to 70, 73 to 113, 115 to 150, and 153 to
193, and/or 30-196
of SEQ ID N0:2. Polynucleotides encoding these polypeptides are also
encompassed by the
invention.
[0164] In another embodiment, the polypeptides of the invention comprise, or
alternatively consist of, amino acid residues 197 to 240, 241 to 270, 271-300,
and/or 197 to
300 of SEQ ID N0:2. Polynucleotides encoding these polypeptides are also
encompassed by
the invention. Since these polypeptide sequences are believed to be associated
with
multimerization of TNFR, proteins having one or more of these polypeptide
sequences would
be expected to form dimers, trimers and higher multimers, which may have
advantageous
properties, such as, increased binding affinity, greater stability, and longer
circulating half life
63
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
compared to monomeric forms. In a specific embodiment, the invention provides
for fusion
proteins comprising fusions of one or more of the above polypeptides to a
heterologous
sequence of a cell signaling molecule, such as a receptor, an extracellular
domain thereof, and
an active fragment, derivative, or analog of a receptor or an extracellular
domain. In a
preferred embodiment, heterologous sequences are selected from the family of
TNR-like
receptors. Such sequences preferably include functional extracellular ligand
binding domains
and lack functional transmembrane and/or cytoplasrnic domains. Such fusion
proteins are
useful for detecting molecules which interact with the fused heterologous
sequences and
thereby identifying potential new receptors and ligands. The fusion proteins
are also useful
for treatment of a variety of disorders, for example, those related to
receptor binding. In one
embodiment, fusion proteins of the invention comprising TNF/TNFR and TNF
receptor/TNFR sequences are used to treat TNF and TNF receptor mediated
disorders, such
as, inflammation, autoimmune diseases, cancer, and disorders associated with
excessive or
alternatively, reduced apoptosis.
[0165] Additional embodiments TNFR polypeptide fragments comprising, or
alternatively, consisting of, functional regions of polypeptides of the
invention, such as the
Gamier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions,
Chou-Fasman
alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle hydrophilic
regions, Eisenberg
alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Emini
surface-forming
regions and Jameson-Wolf regions of high antigenic index set out in Figure 4
(Table I) and
Figure 5 (Table 2) and as described herein. In a preferred embodiment, the
polypeptide
fragments of the invention are antigenic. The data presented in columns VIII,
IX, XIII, and
XIV of Tables I and II can be used to routinely determine regions of TNFR
which exhibit a
high degree of potential for antigenicity. Regions of high antigenicity are
determined from
the data presented in columns VIII, IX, XIII, and/or XIV by choosing values
which represent
regions of the polypeptide which are likely to be exposed on the surface of
the polypeptide in
an environment in which antigen recognition may occur in the process of
initiation of an
immune response. Among highly preferred fragments of the invention are those
that
comprise regions of TNFR that combine several structural features, such as
several (e.g., 1, 2,
3 or 4) of the features set out above. Polynucleotides encoding these
polypeptides are also
encompassed by the invention.
64
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0166] The present invention encompasses polypeptides comprising, or
alternatively
consisting of, an epitope of the polypeptide having an amino acid sequence of
SEQ ID NOS:2
and 4, respectively, or an epitope of the polypeptide sequence encoded by a
polynucleotide
sequence contained in deposited clone ATCC Deposit Number 97810 and 97809,
respectively, or encoded by a polynucleotide that hybridizes to the complement
of the
sequence of SEQ ID NOS:1 and 3, respectively, or contained in deposited clone
ATCC
Deposit Number 97810 and 97809, respectively, under stringent hybridization
conditions or
lower stringency hybridization conditions as defined supra. The present
invention further
encompasses polynucleotide sequences encoding an epitope of a polypeptide
sequence of the
invention (such as, for example, the sequence disclosed in SEQ ID NOS:1 and/or
3),
polynucleotide sequences of the complementary strand of a polynucleotide
sequence
encoding an epitope of the invention, and polynucleotide sequences which
hybridize to the
complementary strand under stringent hybridization conditions or lower
stringency
hybridization conditions defined supra.
[0167] The term "epitopes," as used herein, refers to portions of a
polypeptide having
antigenic or immunogenic activity in an animal, preferably a mammal, and most
preferably in
a human. In a preferred embodiment, the present invention encompasses a
polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An
"immunogenic epitope," as used herein, is defined as a portion of a protein
that elicits an
antibody response in an animal, as determined by any method known in the art,
for example,
by the methods for generating antibodies described infra. (See, for example,
Geysen et al.,
Proc. Natl. Acad. Sci. USA 81:3998-4002 (1983)). The term "antigenic epitope,"
as used '
herein, is defined as a portion of a protein to which an antibody can
immunospecifically bind
its antigen as determined by any method well known in the art, for example, by
the
immunoassays described herein. Immunospecific binding excludes non-specific
binding but
does not necessarily exclude cross-reactivity with other antigens. Antigenic
epitopes need
not necessarily be immunogenic.
[0168] Non-limiting examples of antigenic polypeptides or peptides that can be
used to
generate TNFR-specific antibodies include: a polypeptide comprising, or
alternatively
consisting of, amino acid residues from about Ala-31 to about Thr-46, from
about Phe-57 to
about Thr-117, from about Cys-132 to about Thr-175, from about Gly-185 to
about Thr-194,
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
from about Val-205 to about Asp-217, from about Pro-239 to about Leu-264, and
from about
Ala-283 to about Pro-298 in SEQ ID N0:2; and from about Ala-31 to about Thr-
46, from
about Phe-57 to about Gln-80, from about Glu-86 to about His-106, from about
Thr-108 to
about Phe-119, from about His-129 to about Val-138, and from about Gly-142 to
about Pro-
166 in SEQ m N0:4. These polypeptide fragments have been determined to bear
antigenic
epitopes of the TNFR-6 alpha and TNFR-6 beta polypeptides respectively, by the
analysis of
the Jameson-Wolf antigenic index, as shown in Figures 4 and 5, above.
[0169] Fragments that function as epitopes may be produced by any conventional
means.
(See, e.g., Houghten, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985), further
described in
U.S. Patent No. 4,631,211).
[0170] In the present invention, antigenic epitopes preferably contain a
sequence of at
least 4, at least 5, at least 6, at least 7, more preferably at least 8, at
least 9, at least 10, at least
15, at least 20, at least 25, and, most preferably, between about 15 to about
30 amino acids.
Preferred polypeptides comprising immunogenic or antigenic epitopes are at
least 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100'amino acid
residues in length.
Antigenic epitopes are useful, for example, to raise antibodies, including
monoclonal
antibodies, that specifically bind the epitope. Antigenic epitopes can be used
as the target
molecules in immunoassays. (See, fox instance, Wilson et al., Cell 37:767-778
(1984);
Sutcliffe et al., Science 219:660-666 (1983)).
[0171] Similarly, immunogenic epitopes can be used, for example, to induce
antibodies
according to methods well known in the art. (See, for instance, Sutcliffe et
al., supra; Wilson
et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle
et al., J. Gen.
Virol. 66:2347-2354 (1985). The polypeptides comprising one or more
immunogenic
epitopes may be presented for eliciting an antibody response together with a
carrier protein,
such as an albumin, to an animal system (such as, for example, rabbit or
mouse), or, if the
polypeptide is of sufficient length (at least about 25 amino acids), the
polypeptide may be
presented without a Garner. However, immunogenic epitopes comprising as few as
8 to 10
amino acids have been shown to be sufficient to raise antibodies capable of
binding to, at the
very least, linear epitopes in a denatured polypeptide (e.g., in Western
blotting).
[0172] Epitope-bearing polypeptides of the present invention may be used to
induce
antibodies according to methods well known in the art including, but not
limited to, in vivo
66
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
immunization, in vitro immunization, and phage display methods. See, e.g.,
Sutcliffe et al.,
supra; Wilson et al., supra, and Bittle et al., J. Ger. Virol., 66:2347-2354
(1985). If in vivo
immunization is used, animals may be immunized with free peptide; however,
anti-peptide
antibody titer may be boosted by coupling the peptide to a macromolecular
carrier, such as
keyhole limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides
containing
cysteine residues may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-
hydroxysuccinimide ester (MBS), while other peptides may be coupled to
carriers using a
more general linking agent such as glutaraldehyde.
[0173] Epitope bearing peptides of the invention may also be synthesized as
multiple
antigen peptides (MAPS), first described by J. P. Tam in Proc. Natl. Acad.
Sci. U.S.A.
85:5409 which is incorporated by reference herein in its entirety. MAPS
consist of multiple
copies of a specific peptide attached to a non-immunogenic lysine core. Map
peptides
usually contain four or eight copies of the peptide often referred to as MAP-4
or MAP-8
peptides. By way of non-limiting example, MAPS may be synthesized onto a
lysine core
matrix attached to a polyethylene glycol-polystyrene (PEG-PS) support. The
peptide of
interest is synthesized onto the lysine residues using 9-
fluorenylmethoxycarbonyl (Fmoc)
chemistry. For example, Applied Biosysterns (Foster City, CA) offers MAP
resins, such as,
for example, the Fmoc Resin 4 Branch and the Fmoc Resin 8 Branch which can be
used to
synthesize MAPS. Cleavage of MAPS from the resin is performed with standard
trifloroacetic
acid (TFA)-based cocktails known in the art. Purification of MAPs, except for
desalting, is
not necessary. MAP peptides may be used as an immunizing vaccine which elicits
antibodies
that recognize both the MAP and the native protein from which the peptide was
derived.
[0174] Epitope bearing polypeptides of the invention may be modified, for
example, by
the addition of amino acids at the amino- and/or carboxy- termini of the
peptide. Such
modifications may be performed, for example, to alter the conformation of the
epitope
bearing polypeptide such that the epitope will have a conformation 'more
closely related to the
structure of the epitope in the native protein. An example of a modified
epitope-bearing
polypeptide of the invention is a polypeptide in which one or more cysteine
residues have
been added to the polypeptide to allow for the formation of a disulfide bond
between two
cysteines, resulting in a stable loop structure of the epitope bearing
polypeptide under non-
reducing conditions. Disulfide bonds may form between a cysteine residue added
to the
67
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
polypeptide and a cysteine residue of the naturally occurring epitope, or may
form bewteen
two cysteines which have both been added to the naturally ocurring epitope
bearing
polypeptide. Additionally, it is possible to modify one or more amino acid
residues of the
naturally occurnng epitope bearing polypeptide by substituting them with
cysteines to
promote the formation of disulfide bonded loop structures. Cyclic thioether
molecules of
synthetic peptides may be routinely generated using techniques known in the
art and are
described in PCT publication WO 97/46251, incorporated in its entirety by
reference herein.
Other modifications of epitope-bearing polypeptides contemplated by this
invention include
biotinylation.
[0175] Animals such as, for example, rabbits, rats, and mice are immunized
with either
free or carrier-coupled peptides, or MAP peptides, for instance, by
intraperitoneal and/or
intradermal injection of emulsions containing about 100 micrograms of peptide
or earner
protein and Freund's adjuvant or any other adjuvant known for stimulating an
immune
response. Several booster injections may be needed, for instance, at intervals
of about two
weeks, to provide a useful titer of anti-peptide antibody that can be
detected, for example, by
ELISA assay using free peptide adsorbed to a solid surface. The titer of anti-
peptide
antibodies in serum from an immunized animal may be increased by selection of
anti-peptide
antibodies, for instance, by adsorption to the peptide on a solid support and
elution of the
selected antibodies according to methods well known in the art.
[0176] As one of skill in the art will appreciate, and as discussed above, the
polypeptides
of the present invention (e.g., those comprising an immunogenic or antigenic
epitope) can be
fused to heterologous polypeptide sequences. For example, polypeptides of the
present
invention (including fragments or variants thereof), may be fused with the
constant domain of
immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHl, CH2, CH3, or
any
combination thereof and portions thereof, resulting in chimeric polypeptides.
By way of
another non-limiting example, polypeptides and/or antibodies of the present
invention
(including fragments or variants thereof) may be fused with albumin (including
but not
limited to recombinant human 'serum albumin or fragments or variants thereof
(see, e.g., U.S.
Patent No. 5,876,969, issued March 2, 1999, EP Patent 0 413 622, and U.S.
Patent No.
5,766,883, issued June 16, 1998, herein incorporated by reference in their
entirety)). In a
preferred embodiment, polypeptides and/or antibodies of the present invention
(including
68
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
fragments or variants thereof) are fused with the mature form of human serum
albumin (i.e.,
amino acids 1- 585 of human serum albumin as shown in Figures 1 and 2 of EP
Patent 0 322
094) which is herein incorporated by reference in its entirety. In another
preferred
embodiment, polypeptides and/or antibodies of the present invention (including
fragments or
variants thereof) are fused with polypeptide fragments comprising, or
alternatively consisting
of; amino acid residues 1-z of human serum albumin, where z is an integer from
369 to 419,
as described in U.S. Patent 5,766,883 herein incorporated by reference in its
entirety.
Polypeptides and/or antibodies of the present invention (including fragments
or variants
thereof) may be fused to either the N- or C-terminal end of the heterologous
protein (e.g.,
immunoglobulin Fc polypeptide or human serum albumin polypeptide).
Polynucleotides
encoding fusion proteins of the invention are also encompassed by the
invention.
[0177] Such fusion proteins as those described above may facilitate
purification and may
increase half-life in vivo. This has been shown for chimeric proteins
consisting of the first
two domains of the human CD4-polypeptide and various domains of the constant
regions of
the heavy or light chains of mammalian immunoglobulins. See, e.g., EP 394,827;
Traunecker
et al., Nature, 331:84-86 (1988). IgG Fusion proteins that have a disulfide-
linked dimeric
structure due to the IgG portion desulfide bonds have also been found to be
more efficient in
binding and neutralizing other molecules than monomeric polypeptides or
fragments thereof
alone. See, e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 (1995).
Nucleic acids
encoding the above epitopes can also be recombined with a gene of interest as
an epitope tag
(e.g., the hemagglutinin ("HA") tag or flag tag) to aid in detection and
purification of the
expressed polypeptide. For example, a system described by Janknecht et al.
allows for the
ready purification of non-denatured fusion proteins expressed in human cell
lines (Janknecht
et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972- 897). In this system, the
gene of interest is
subcloned into a vaccinia recombination plasmid such that the open reading
frame of the gene
is translationally fused to an amino-terminal tag consisting of six histidine
residues. The tag
serves as a matrix-binding domain for the fusion protein. Extracts from cells
infected with
the recombinant vaccinia virus are loaded onto Niz+ nitriloacetic acid-agarose
column and
histidine-tagged proteins can be selectively eluted with imidazole-containing
buffers.
[0178] The techniques of gene-shuffling, motif shuffling, exon-shuffling,
and/or codon-
shuffling (collectively referred to as "DNA shuffling") may be employed to
modulate the
69
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
activities of TR6-alpha and/or TR6-beta thereby effectively generating
agonists and
antagonists of TR6-alpha and/or TR6-beta. See generally, U.S. Patent Nos.
5,605,793,
5,811,238, 5,830,721, 5,834,252, and 5,837,458, and Patten, P. A., et al.,
Curr. Opinion
Biotechfzol. 8:724-33 (1997); Harayama, S. Trends Biotechrzol. 16(2):76-82
(1998);
Hansson, L. O., et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo, M. M.
and Blasco, R.
Biotechniques 24(2):308-13 (1998) (each of these patents and publications are
hereby
incorporated by reference). In one embodiment, alteration of TR6-alpha andlor
TR6-beta
polynucleotides and corresponding polypeptides may be achieved by DNA
shuffling. DNA
shuffling involves the assembly of two or more DNA segments into a desired TR6-
alpha
and/or TR6-beta molecule by homologous, or site-specific, recombination. In
another
embodiment, TR6-alpha andlor TR6-beta polynucleotides and corresponding
polypeptides
may be alterred by being subjected to random mutagenesis by error-prone PCR,
random
nucleotide insertion or other methods prior to recombination. In another
embodiment, one or
more components, motifs, sections, parts, domains, fragments, etc., of TR6-
alpha and/or
TR6-beta may be recombined with one or more components, motifs, sections,
parts, domains,
fragments, etc. of one or more heterologous molecules. In preferred
embodiments, the
heterologous molecules are TNF-alph, TNF-beta, lymphotoxin-alpha, lymphotoxin-
beta, FAS
ligand, APRIL. In further preferred embodiments, the heterologous molecules
are any
member of the TNF family.
(0179] Additionally, the techniques of gene-shuffling, motif-shuffling, axon-
shuffling,
and/or codon-shuffling (collectively referred to as "DNA shuffling") may be
employed to
modulate the activities of TNFR thereby effectively generating agonists and
antagonists of
TNFR. See gefzerally, U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721,
5,834,252, and
5,837,458, and Patten et al., Curr. Opirzio~z Biotech~2ol. 8:724-33 (1997);
Harayama, Trends
Bioteclzfzol. 16(2):76-82 (1998); Hansson et al., J. Mol. Biol. 287:265-76
(1999); and
Lorenzo and Blasco, Bioteclzfziques 24(2):308-13 (1998) (each of these patents
and
publications are hereby incorporated by reference). In one embodiment,
alteration of TNFR
polynucleotides and corresponding polypeptides may be achieved by DNA
shuffling. DNA
shuffling involves the assembly of two or more DNA segments into a desired
TNFR
molecule by homologous, or site-specific, recombination. In another
embodiment, TNFR
polynucleotides and corresponding polypeptides may be altered by being
subjected to random
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
mutagenesis by error-prone PCR, random nucleotide insertion or other methods
prior to
recombination. In another embodiment, one or moxe components, motifs,
sections, parts,
domains, fragments, etc., of TNFR may be recombined with one or more
components, motifs,
sections, parts, domains, fragments, etc. of one or more heterologous
molecules. In preferred
embodiments, the heterologous molecules are include, but axe not limited to,
TNF-alpha,
lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta (found in
complex
heterotrimer LT-alpha2-beta), OPGL, Fast, CD27L, CD30L, CD40L, 4-1BBL, DcR3,
OX40L, TNF-gamma (International Publication No. WO 96/14328), TRAIL, AIM-II
(International Publication No. WO 97/34911), APRIL (J. Exp. Med. 188(6):1185-
1190),
endokine-alpha (International Publication No. WO 98/07880), neutrokine alpha
(International
Publication No.W098/18921), TR6 (International Publication No. WO 98/30694),
OPG,
OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27,
CD40 and
4-IBB, TR2 (International Publication No. WO 96/34095), DR3 (International
Publication
No. WO 97/33904), DR4 (International Publication No. WO 98/32856), TR5
(International
Publication No. WO 98/30693), TR7 (International Publication No. WO 98/41629),
TRANK,
TR9 (International Publication No. WO 98/56892), TR10 (International
Publication No. WO
98/54202), 31X2 (International Publication No. WO 98/06842), and TR12, and
soluble
forms CD154, CD70, and CD153. In further preferred embodiments, the
heterologous
molecules are any member of the TNF family.
[0180] To improve or alter the characteristics of a TNFR polypeptide, protein
engineering may be employed. Recombinant DNA technology known to those skilled
in the
art can be used to create novel mutant proteins or "muteins" including single
or multiple
amino acid substitutions, deletions, additions or fusion proteins. Such
modified polypeptides
can show, e.g., enhanced activity or increased stability. In addition, they
may be purified in
higher yields and show better solubility than the corresponding natural
polypeptide, at least
under certain purification and storage conditions. For instance, for many
proteins, including
the extracellular domain of a membrane associated protein or the mature forms)
of a secreted
protein, it is known in the art that one or more amino acids may be deleted
from the N-
terminus or C-terminus without substantial loss of biological function. For
instance, Ron et
al., J. Biol. Chefn., 268:2984-2988 (1993) reported modified KGF proteins that
had heparin
binding activity even if 3, 8, or 27 amino-terminal amino acid residues were
missing.
71
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0181] In the present case, since the proteins of the invention are members of
the TNFR
polypeptide family, deletions of N-terminal amino acids up to the Cysteine at
position 49 of
SEQ ID NOS:2 and 4 (TNFR-6 alpha and TNFR-6 beta) may retain some biological
activity
such as, for example regulation of cellular proliferation and apoptosis (e.g.,
of lymphoid
cells), ability to bind Fas ligand (FasL), and ability to bind AIM-II.
Polypeptides having
further N-terminal deletions including the Cys-49 residue in SEQ ID NOS:2 and
4, would not
be expected to retain such biological activities because it is known that
these residues in a
TNFR-related polypeptide are required for forming a disulfide bridge to
provide structural
stability which is needed for receptor/ligand binding and signal transduction.
However, even
if deletion of one or more amino acids from the N-terminus of a protein
results in
modification of loss of one or more biological functions of the protein, other
functional
activities may still be retained. Thus, the ability of the shortened protein
to induce and/or
bind to antibodies which recognize the complete or mature TNFR or
extracellular domain of
TNFR protein generally will be retained when less than the majority of the
residues of the
complete TNFR, mature TNFR, or extracellular domain of TNFR are removed from
the
N-terminus. Whether a particular polypeptide lacking N-terminal residues of a
complete
protein retains such immunologic activities can readily be determined by
routine methods
described herein and otherwise known in the art.
[0182] Accordingly, the present invention further provides polypeptides
comprising. or
alternatively consisting of, one or more residues deleted from the amino
terminus of the
amino acid sequence of the TNFR shown in SEQ ID NOS:2 and 4, up to the
cysteine residue
at position number 49, and polynucleotides encoding such polypeptides. In
particular, the
present invention provides TNFR polypeptides comprising, or alternatively
consisting of, the
amino acid sequence of residues m-300 of Figure 1 (SEQ ID N0:2) and/or
residues n-170 of
Figure 2 (SEQ ID N0:4), where m and n are integers in the range of 1-49 and
where 49 is the
position of the first cysteine residue from the N-terminus of the complete
TNFR-hoc and
TNFR-6(3 polypeptides (shown in SEQ ID NOS:2 and 4, respectively) believed to
be
required for activity of the TNFR-6a and TNFR-6(3 proteins.
[0183] More in particular, the invention provides polynucleotides encoding
polypeptides
having (i.e., comprising) or alternatively consisting of, the amino acid
sequence of a member
selected from the group consisting of residues: 1-300, 2-300, 3-300, 4-300, 5-
300, 6-300, 7-
72
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
300, 8-300, 9-300, 10-300, 11-300, 12-300, 13-300, 14-300, 15-300, 16-300, 17-
300, 18-300,
19-300, 20-300, 21-300, 22-300, 23-300, 24-300, 25-300, 26-300, 27-300, 28-
300, 29-300,
30-300, 31-300, 32-300, 33-300, 34-300, 35-300, 36-300, 37-300, 38-300, 39-
300, 40-300,
41-300, 42-300, 43-300, 44-300, 45-300, 46-300, 47-300, 48-300, and 49-300 of
SEQ m
N0:2; and 1-170, 2-170, 3-170, 4-170, 5-170, 6-170, 7-170, 8-170, 9-170, 10-
170, 11-170,
12-170, 13-170, 14-170, 15-170, 16-170, 17-170, 18-170, 19-170, 20-170, 21-
170, 22-170,
23-170, 24-170, 25-170, 26-170, 27-170, 28-170, 29-170, 30-170, 31-170, 32-
170, 33-170,
34-170, 35-170, 36-170, 37-170, 38-170, 39-170, 40-170, 41-170, 42-170, 43-
170, 44-170,
45-170, 46-170, 47-170, 48-170, and 49-170 of SEQ ID N0:4. Polypeptides
encoded by
these polynucleotide fragments are also encompassed by the invention.
[4184] In a specific embodiment, the invention provides polynucleotides
encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence of a member
selected from the group consisting of residues: Val-30 to His-300 of SEQ >D
N0:2.
Polypeptides encoded by these polynucleotide fragments are also encompassed by
the
invention.
[0185] In other specific embodiments, the invention provides polynucleotides
encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence of a member
selected from the group consisting of residues: P-23 to H-300, and/or P-34 to
H-300 of SEQ
ID NO:2. Polypeptides encoded by these polynucleotides are also encompassed by
the
invention.
[0186] As mentioned above, even if deletion of one or more amino acids from
the
N-terminus of a protein results in modification of loss of one or more
biological functions of
the protein, other functional activities (e.g., biological activities) may
still be retained. Thus,
the ability of shortened TNFR muteins to induce and/or bind to antibodies
which recognize
the complete or mature forms of the polypeptides generally will be retained
when less than
the majority of the residues of the complete or mature polypeptide are removed
from the
N-terminus. Whether a particular polypeptide lacking N-terminal residues of a
complete
polypeptide retains such immunologic activities can readily be determined by
routine
methods described herein and otherwise known in the art. It is not unlikely
that a TNFR
mutein with a large number of deleted N-terminal amino acid residues may
retain some
biological or immunogenic activities. In fact, peptides composed of as few as
six TNFR
amino acid residues may often evoke an immune response.
73
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0187] Accordingly, the present invention further provides polypeptides having
one or
more residues deleted from the amino terminus of the TNFR-6a amino acid
sequence shown
in Figure 1 (i.e., SEQ ID N0:2), up to the arginine residue at position number
295 and
polynucleotides encoding such polypeptides. In particular, the present
invention provides
polypeptides comprising or alternatively consisting of, the amino acid of
residues n'-300 of
Figure 1 (SEQ ID N0:2), where n' is an integer from 49 to 295, corresponding
to the position
of the amino acid residue in Figure 1 (SEQ m N0:2).
[0188] More in particular, the invention provides polynucleotides encoding
polypeptides
comprising, or alternatively consisting of, the amino acid sequence of a
member selected
from the group consisting of residues of C-49 to H-300; A-50 to H-300; Q-51 to
H-300; C-52
to H-300; P-53 to H-300; P-54 to H-300; G-55 to H-300; T-56 to H-300; F-57 to
H-300;
V-58 to H-300; Q-59 to H-300; R-60 to H-300; P-61 to H-300; C-62 to H-300; R-
63 to
H-300; R-64 to H-300; D-65 to H-300; S-66 to H-300; P-67 to H-300; T-68 to H-
300; T-69
to H-300; C-70 to H-300; G-71 to H-300; P-72 to H-300; C-73 to H-300; P-74 to
H-300;
P-75 to H-300; R-76 to H-300; H-77 to H-300; Y-78 to H-300; T-79 to H-300; Q-
80 to
H-300; F-81 to H-300; W-S2 to H-300; N-83 to H-300; Y-84 to H-300; L-85 to H-
300; E-86
to H-300; R-87 to H-300; C-88 to H-300; R-89 to H-300; Y-90 to H-300; C-91 to
H-300;
N-92 to H-300; V-93 to H-300; L-94 to H-300; C-95 to H-300; G-96 to H-300; E-
97 to
H-300; R-98 to H-300; E-99 to H-300; E-100 to H-300; E-101 to H-300; A-102 to
H-300;
R-103 to H-300; A-104 to H-300; C-105 to H-300; H-106 to H-300; A-107 to H-
300; T-108
to H-300; H-109 to H-300; N-110 to H-300; R-111 to H-300; A-112 to H-300; C-
113 to
H-300; R-114 to H-300; C-115 to H-300; R-116 to H-300; T-117 to H-300; G-118
to H-300;
F-I19 to H-300; F-120 to H-300; A-121 to H-300; H-122 to H-300; A-123 to H-
300; G-124
to H-300; F-125 to H-300; C-126 to H-300; L-127 to H-300; E-128 to H-300; H-
129 to
H-300; A-130 to H-300; S-13I to H-300; C-132 to H-300; P-133 to H-300; P-134
to H-300;
G-135 to H-300; A-136 to H-300; G-137 to H-300; V-138 to H-300; I-139 to H-
300; A-140
to H-300; P-I4I to H-300; G-142 to H-300; T-143 to H-300; P-144 to H-300; S-
145 to
H-300; Q-146 to H-300; N-147 to H-300; T-148 to H-300; Q-149 to H-300; C-150
to H-300;
Q-I51 to H-300; P-152 to H-300; C-153 to H-300; P-154 to H-300; P-155 to H-
300; G-156
to H-300; T-157 to H-300; F-158 to H-300; S-159 to H-300; A-160 to H-300; S-
161 to
H-300; S-162 to H-300; S-163 to H-300; S-164 to H-300; S-165 to H-300; E-166
to H-300;
74
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Q-167 to H-300; C-168 to H-300; Q-169 to H-300; P-170 to H-300; H-171 to H-
300; R-172
to H-300; N-173 to H-300; C-174 to H-300; T-175 to H-300; A-176 to H-300; L-
177 to
H-300; G-178 to H-300; L-179 to H-300; A-180 to H-300; L-181 to H-300; N-182
to H-300;
V-183 to H-300; P-184 to H-300; G-185 to H-300; S-186 to H-300; S-187 to H-
300; S-188 to
H-300; H-189 to H-300; D-190 to H-300; T-191 to H-300; L-192 to H-300; C-193
to H-300;
T-194 to H-300; S-195 to H-300; C-196 to H-300; T-197 to H-300; G-198 to H-
300; F-199 to
H-300; P-200 to H-300; L-201 to H-300; S-202 to H-300; T-203 to H-300; R-204
to H-300;
V-205 to H-300; P-206 to H-300; G-207 to H-300; A-208 to H-300; E-209 to H-
300; E-210
to H-300; C-211 to H-300; E-212 to H-300; R-213 to H-300; A-214 to H-300; V-
215 to
H-300; I-216 to H-300; D-217 to H-300; F-218 to H-300; V-219 to H-300; A-220
to H-300;
F-221 to H-300; Q-222 to H-300; D-223 to H-300; I-224 to H-300; S-225 to H-
300; I-226 to
H-300; K-227 to H-300; R-228 to H-300; L-229 to H-300; Q-230 to H-300; R-231
to H-300;
L-232 to H-300; L-233 to H-300; Q-234 to H-300; A-235 to H-300; L-236 to H-
300; E-237
to H-300; A-238 to H-300; P-239 to H-300; E-240 to H-300; G-241 to H-300; W-
242 to
H-300; G-243 to H-300; P-244 to H-300; T-245 to H-300; P-246 to H-300; R-247
to H-300;
A-248 to H-300; G-249 to H-300; R-250 to H-300; A-251 to H-300; A-252 to H-
300; L-253
to H-300; Q-254 to H-300; L-255 to H-300; K-256 to H-300; L-257 to H-300; R-
258 to
H-300; R-259 to H-300; R-260 to H-300; L-261 to H-300; T-262 to H-300; E-263
to H-300;
L-264 to H-300; L-265 to H-300; G-266 to H-300; A-267 to H-300; Q-268 to H-
300; D-269
to H-300; G-270 to H-300; A-271 to H-300; L-272 to H-300; L-273 to H-300; V-
274 to
H-300; R-275 to H-300; L-276 to H-300; L-277 to H-300; Q-278 to H-300; A-279
to H-300;
L-280 to H-300; R-281 to H-300; V-282 to H-300; A-283 to H-300; R-284 to H-
300; M-285
to H-300; P-286 to H-300; G-287 to H-300; L-288 to H-300; E-289 to H-300; R-
290 to
H-300; S-291 to H-300; V-292 to H-300; R-293 to H-300; E-294 to H-300; and R-
295 to
H-300 of the TNFR-6a sequence shown in Figure 1 (SEQ ID N0:2). Polypeptides
encoded
by these polynucleotide fragments are also encompassed by the invention.
[0189] Similarly, many examples of biologically functional C-teimminal
deletion muteins
are known. For instanee, interferon gamma shows up to ten times higher
activities by
deleting 8-10 amino acid residues from the carboxy terminus of the protein
(Dobeli et al., J.
Biotechnology 7:199-216 (1988)). In the present case, since the protein of the
invention is a
member of the TNFR polypeptide family, deletions of C-terminal amino acids up
to the
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
cysteine at position I93 and 132 of SEQ ID NOS:2 and 4, respectively, may
retain some
functional activity, such as, for example, a biological activity (such as, for
example,
regulation of proliferation and apoptosis (e.g., of lymphoid cells, ability to
bind Fas ligand,
and ability to bind AIM-II)). Polypeptides having further C-terminal deletions
including the
cysteines at positions 193 and 132 of SEQ )17 NOS:2 and 4, respectively, would
not be
expected to retain such biological activities because it is known that these
residues in TNF
receptor-related polypeptides are required for forming disulfide bridges to
provide structural
stability which is needed for receptor binding.
[0190] However, even if deletion of one or more amino acids from the C-
terminus of a
protein results in modification or loss of one or more biological functions of
the protein; other
functional activities (e.g., biological activities, the ability to
multimerize, and the ability to
bind ligand (e.g., Fas ligand and AIM-II)) may still be retained. Thus, the
ability of the
shortened protein to induce andlor bind to antibodies which recognize the
complete or mature
form of the protein generally will be retained when less than the majority of
the residues of
the complete or mature form protein are removed from the C-terminus. Whether a
particular
polypeptide lacking C-terminal residues of a complete protein retains such
immunologic
activities can readily be determined by routine methods described herein and
otherwise
known in the art.
[0191] Accordingly, the present invention further provides polypeptides having
one or
more residues from the carboxy terminus of the amino acid sequence of TNFR-6
alpha and
TNFR-6 beta shown in SEQ ID NOS:2 and 4 up to the cysteine at position 193 and
132 of
SEQ ID NOS:2 and 4, respectively, and polynucleotides encoding such
polypeptides. In
particular, the present invention provides polypeptides comprising, or
alternatively consisting
of, the amino acid sequence of a member selected from the group consisting of
residues 1-y
and 1-z of the amino acid sequence in SEQ ID NOS:2 and 4, respectively, where
y is any
integer in the range of 193-300 and z is any integer in the range of 132-170.
Polynucleotides
encoding these polypeptides also are provided.
[0192] In certain preferred embodiments, the present invention provides
polypeptides
comprising, or alternatively, consisting of, the amino acid sequence of a
member selected
from the group consisting of residues 1-y' and 1-z' of the amino acid sequence
in SEQ ID
NOS:2 and 4, respectively, where y' is any integer in the range of 193-299 and
z' is any
76
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
integer in the range of 132-169. Polynucleotides encoding these polypeptides
also are
provided.
[0193] In additional preferred specific embodiments, the present invention
provides
polypeptides comprising, or alternatively consisting of, the amino acid
sequence of a member
selected from the group consisting of residues Pro-23 to His-300, Val-30 to
His-300, and
Pro-34 to His-300 of SEQ ID N0:2 and polypeptides having the amino acid
sequence of a
member selected from the group consisting of residues Pro-23 to Pro-170, Val-
30 to Pro-170,
and Pro-34 to His-Pro-170 of SEQ ID N0:4. As described herein, these
polypeptides may be
fused to heterologous polypeptide sequences. Polynucleotides encoding these
polypeptides
and these fusion polypeptides are also provided.
[0194] The invention also provides polypeptides having one or more amino acids
deleted
from both the amino and the carboxyl termini, which may be described generally
as having
residues m-y of SEQ ID N0:2 and n-z of SEQ ID N0:4, where m, n, y and z are
integers as
described above.
[0195] Also as mentioned above, even if deletion of one or more amino acids
from the
C-terminus of a protein results in modification or loss of one or more
biological functions of
the protein, other functional activities (e.g., biological activities, the
ability to form
homomultimers, and the ability to bind ligand (e.g., Fas ligand and AIM-II))
may still be
retained. For example, the ability of the shortened TNFR mutein to induce
and/or bind to
antibodies which recognize the complete or mature forms of the polypeptide
generally will be
retained when less than the majority of the residues of the complete or mature
polypeptide are
removed from the C-terminus. Whether a particular polypeptide lacking C-
terminal residues
of a complete polypeptide retains such immunologic activities can readily be
determined by
routine methods described herein and otherwise known in the art. It is not
unlikely that a
TNFR mutein with a large number of deleted C-terminal amino acid residues may
retain
some biological or immunogenic activities. In fact, peptides composed of as
few as six
TNFR amino acid residues may often evoke an immune response.
[0196] Accordingly, the present invention further provides polypeptides having
one or
more residues deleted from the carboxy terminus of the amino acid sequence of
the TNFR
polypeptide shown in Figure 1 (SEQ ID NO:2), up to the glycine residue at
position number
6, and polynucleotides encoding such polypeptides. In particular, the present
invention
provides polypeptides comprising, or alternatively consisting of, the amino
acid sequence of
77
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
residues 1-m' of Figure 1 (i.e., SEQ ID N0:2), where m' is an integer from 6
to 299,
corresponding to the position of the amino acid residue in Figure 1 (SEQ ID
N0:2).
[0197] More in particular, the invention provides polynucleotides encoding
polypeptides
comprising, or alternatively consisting of, the amino acid sequence of a
member selected
from the group consisting of residues M-1 to V-299; M-1 to P-298; M-1 to L-
297; M-1 to
F-296; M-1 to R-295; M-1 to E-294; M-1 to R-293; M-1 to V-292; M-1 to S-291; M-
1 to
R-290; M-1 to E-289; M-1 to L-288; M-1 to G-287; M-1 to P-286; M-1 to M-285; M-
1 to
R-284; M-1 to A-283; M-1 to V-282; M-1 to R-281; M-1 to L-280; M-1 to A-279; M-
1 to
Q-278; M-1 to L-277; M-1 to L-276; M-1 to R-275; M-1 to V-274; M-1 to L-273; M-
1 to
L-272; M-1 to A-271; M-1 to G-270; M-1 to D-269; M-1 to Q-268; M-1 to A-267; M-
1 to
G-266; M-1 to L-265; M-1 to L-264; M-1 to E-263; M-1 to T-262; M-1 to L-261; M-
1 to
R-260; M-1 to R-259; M-1 to R-258; M-1 to L-257; M-1 to K-256; M-1 to L-255; M-
1 to
Q-254; M-1 to L-253; M-1 to A-252; M-1 to A-251; M-1 to R-250; M-1 to G-249; M-
1 to
A-248; M-1 to R-247; M-1 to P-246; M-1 to T-245; M-1 to P-244; M-1 to G-243; M-
1 to
W-242; M-1 to G-241; M-1 to E-240; M-1 to P-239; M-1 to A-238; M-1 to E-237; M-
1 to
L-236; M-1 to A-235; M-1 to Q-234; M-1 to L-233; M-1 to L-232; M-1 to R-231; M-
1 to
Q-230; M-1 to L-229; M-1 to R-228; M-1 to K-227; M-1 to I-226; M-1 to S-225; M-
1 to
I-224; M-1 to D-223; M-1 to Q-222; M-1 to F-221; M-1 to A-220; M-1 to V-219; M-
1 to
F-218; M-1 to D-217; M-1 to I-216; M-1 to V-215; M-1 to A-214; M-1 to R-213; M-
1 to
E-212; M-1 to C-211; M-1 to E-210; M-1 to E-209; M-1 to A-208; M-1 to G-207; M-
1 to
P-206; M-1 to V-205; M-l.to R-204; M-1 to T-203; M-1 to S-202; M-1 to L-201; M-
1 to
P-200; M-1 to F-199; M-1 to G-198; M-1 to T-197; M-1 to C-196; M-1 to S-195; M-
1 to
T-194; M-1 to C-193; M-1 to L-192; M-1 to T-191; M-1 to D-190; M-1 to H-189; M-
1 to
S-188; M-1 to S-187; M-1 to S-186; M-1 to G-185; M-1 to P-184; M-1 to V-183; M-
1 to
N-182; M-1 to L-181; M-1 to A-180; M-1 to L-179; M-1 to G-178; M-1 to L-177; M-
1 to
A-176; M-1 to T-175; M-1 to C-174; M-1 to N-173; M-1 to R-172; M-1 to H-171; M-
1 to
P-170; M-1 to Q-169; M-1 to C-168; M-1 to Q-167; M-1 to E-166; M-1 to S-165; M-
1 to
S-164; M-1 to S-163; M-1 to S-162; M-1 to S-161; M-1 to A-160; M-1 to S-159; M-
1 to
F-158; M-1 to T-157; M-1 to G-156; M-1 to P-155; M-1 to P-154; M-1 to C-153; M-
1 to
P-152; M-1 to Q-151; M-1 to C-150; M-1 to Q-149; M-1 to T-148; M-1 to N-147; M-
1 to
Q-146; M-1 to S-145; M-1 to P-144; M-1 to T-143; M-1 to G-142; M-1 to P-141; M-
1 to
A-140; M-1 to I-139; M-1 to V-138; M-1 to G-137; M-1 to A-136; M-1 to G-135; M-
1 to
78
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
P-134; M-1 to P-133; M-1 to C-132; M-1 to S-131; M-1 to A-130; M-1 to H-129; M-
1 to
E-128; M-1 to L-127; M-1 to C-I26; M-1 to F-125; M-1 to G-124; M-1 to A-I23; M-
1 to
H-122; M-1 to A-121; M-1 to F-120; M-1 to F-119; M-1 to G-l I8; M-1 to T-117;
M-1 to
R-116; M-1 to C-115; M-1 to R-114; M-1 to C-113; M-1 to A-112; M-1 to R-111; M-
1 to
N-110; M-1 to H-I09; M-1 to T-108; M-1 to A-107; M-1 to H-106; M-1 to C-105; M-
1 to
A-104; M-1 to R-103; M-I to A-I02; M-1 to E-101; M-I to E-100; M-I to E-99; M-
1 to
R=98; M-1 to E-97; M-1 to G-96; M-1 to C-95; M-1 to L-94; M-1 to V-93; M-1 to
N-92; M-1
to C-91; M-1 to Y-90; M-1 to R-89; M-1 to C-88; M-1 to R-87; M-1 to E-86; M-1
to L-85;
M-1 to Y-84; M-1 to N-83; M-1 to W-82; M-1 to F-81; M-1 to Q-80; M-1 to T-79;
M-l to
Y-78; M-I to H-77; M-1 to R-76; M-I to P-75; M-1 to P-74; M-1 to C-73; M-1 to
P-72; M-1
to G-71; M-1 to C-70; M-1 to T-69; M-1 to T-68; M-1 to P-67; M-1 to S-66; M-1
to D-65;
M-1 to R-64; M-1 to R-63; M-1 to C-62; M-1 to P-61; M-1 to R-60; M-1 to Q-59;
M-1 to
V-58; M-1 to F-57; M-1 to T-56; M-1 to G-55; M-1 to P-54; M-1 to P-53; M-1 to
C-52; M-1
to Q-51; M-1 to A-50; M-1 to C-49; M-1 to V-48; M-1 to L-47; M-1 to R-46; M-1
to E-45;
M-1 to G-44; M-1 to T-43; M-1 to E-42; M-1 to A-41; M-1 to D-40; M-1 to R-39;
M-1 to
W-38; M-1 to P-37; M-1 to Y-36; M-1 to T-35; M-1 to P-34; M-1 to T-33; M-1 to
E-32; M-1
to A-31; M-1 to V-30; M-1 to G-29; M-1 to R-28; M-1 to V-27; M-1 to A-26; M-1
to P-25;
M-1 to V-24; M-1 to P-23; M-1 to L-22; M-1 to L-21; M-1 to A-20; M-1 to P-19;
M-1 to
L-18; M-1 to A-17; M-1 to L-16; M-1 to V-15; M-1 to L-14; M-1 to C-13; M-1 to
L-12; M-1
to L-11; M-1 to S-10; M-1 to L-9; M-1 to G-8; M-1 to P-7; and M-1 to G-6 of
the sequence
of the TFNR sequence shown in Figure 1 (SEQ )D N0:2). Polypeptides encoded by
these
polynucleotide fragments are also encompassed' by the invention.
[0198] In specific embodiments, the invention provides polynucleotides
encoding
polypeptides comprising or alternatively consisting of the amino acid sequence
of a member
selected from the group consisting of residues: M-1 to A-271, M-1 to Q-254
andlor M-1 to F-
221 of SEQ m N0:2. Polypeptides encoded by these polynucleotide fragments are
also
encompassed by the invention.
[0199] The invention also provides polypeptides having one or more amino acids
deleted
from both the amino and the carboxyl termini of a TNFR polypeptide, which may
be
described generally as having residues n'-m' of Figure 1 (i.e., SEQ m N0:2),
where n' and
m' are integers as described above.
79
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0200] In additional embodiments, the present invention provides polypeptides
comprising. or alternatively consisting of, the amino acid sequence of
residues 30-m3 of
Figure 1 (i.e., SEQ ID N0:2), where m3 is an integer from 36 to 299,
corresponding to the
position of the amino acid residue in Figure 1 (SEQ m N0:2). For example, the
invention
provides polynucleotides encoding polypeptides comprising, or alternatively
consisting of,
the amino acid sequence of a member selected from the group consisting of
residues V-30 to
V-299; V-30 to P-298; V-30 to L-297; V-30 to F-296; V-30 to R-295; V-30 to E-
294; V-30
to R-293; V-30 to V-292; V-30 to S-291; V-30 to R-290; V-30 to E-289; V-30 to
L-288; V-
30 to G-287; V-30 to P-286; V-30 to M-285; V-30 to R-284; V-30 to A-283; V-30
to V-282;
V-30 to R-281; V-30 to L-280; V-30 to A-279; V-30 to Q-278; V-30 to L-277; V-
30 to
L-276; V-30 to R-275; V-30 to V-274; V-30 to L-273; V-30 to L-272; V-30 to A-
271; V-30
to G-270; V-30 to D-269; V-30 to Q-268; V-30 to A-267; V-30 to G-266; V-30 to
L-265; V-
30 to L-264; V-30 to E-263; V-30 to T-262; V-30 to L-261; V-30 to R-260; V-30
to R-259;
V-30 to R-258; V-30 to L-257; V-30 to I~-256; V-30 to L-255; V-30 to Q-254; V-
30 to
L-253; V-30 to A-252; V-30 to A-251; V-30 to R-250; V-30 to G-249; V-30 to A-
248; V-30
to R-247; V-30 to P-246; V-30 to T-245; V-30 to P-244; V-30 to G-243; V-30 to
W-242; V-
30 to G-241; V-30 to E-240; V-30 to P-239; V-30 to A-238; V-30 to E-237; V-30
to L-236;
V-30 to A-235; V-30 to Q-234; V-30 to L-233; V-30 to L-232; V-30 to R-231; V-
30 to
Q-230; V-30 to L-229; V-30 to R-228; V-30 to K-227; V-30 to I-226; V-30 to S-
225; V-30 to
I-224; V-30 to D-223; V-30 to Q-222; V-30 to F-221; V-30 to A-220; V-30 to V-
2I9; V-30
to F-218; V-30 to D-217; V-30 to I-216; V-30 to V-215; V-30 to A-214; V-30 to
R-213; V-
30 to E-212; V-30 to C-211; V-30 to E-210; V-30 to E-209; V-30 to A-208; V-30
to G-207;
V-30 to P-206; V-30 to V-205; V-30 to R-204; V-30 to T-203; V-30 to S-202; V-
30 to
L-201; V-30 to P-200; V-30 to F-199; V-30 to G-198; V-30 to T-197; V-30 to C-
196; V-30
to S-195; V-30 to T-194; V-30 to C-193; V-30 to L-192; V-30 to T-191; V-30 to
D-190; V-
30 to H-189; V-3~ to S-188; V-30 to S-187; V-30 to S-186; V-30 to G-185; V-30
to P-184;
V-30 to V-183; V-30 to N-182; V-30 to L-181; V-30 to A-180; V-30 to L-179; V-
30 to
G-178; V-30 to L-177; V-30 to A-176; V-30 to T-175; V-30 to C-174; V-30 to N-
173; V-30
to R-172; V-30 to H-I71; V-30 to P-I70; V-30 to Q-169; V-30 to C-168; V-30 to
Q-167; V-
30 to E-166; V-30 to S-165; V-30 to S-164; V-30 to S-163; V-30 to S-162; V-30
to S-161; V-
30 to A-160; V-30 to S-159; V-30 to F-158; V-30 to T-157; V-30 to G-156; V-30
to P-155;
V-30 to P-154; V~30 to C-153; V-30 to P-152; V-30 to Q-151; V-30 to C-150; V-
30 to
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Q-149; V-30 to T-148; V-30 to N-147; V-30 to Q-146; V-30 to S-145; V-30 to P-
144; V-30
to T-143; V-30 to G-142; V-30 to P-141; V-30 to A-140; V-30 to I-139; V-30 to
V-138; V-30
to G-137; V-30 to A-136; V-30 to G-135; V-30 to P-134; V-30 to P-133; V-30 to
C-132; V-
30 to S-131; V-30 to A-130; V-30 to H-129; V-30 to E-128; V-30 to L-127; V-30
to C-126;
V-30 to F-125; V-30 to G-124; V-30 to A-123; V-30 to H-122; V-30 to A-121; V-
30 to
F-120; V-30 to F-119; V-30 to G-118; V-30 to T-117; V-30 to R-116; V-30 to C-
115; V-30
to R-114; V-30 to C-113; V-30 to A-112; V-30 to R-111; V-30 to N-110; V-30 to
H-109; V-
30 to T-108; V-30 to A-107; V-30 to H-106; V-30 to C-105; V-30 to A-104; V-30
to R-103;
V-30 to A-102; V-30 to E-101; V-30 to E-100; V-30 to E-99; V-30 to R-98; V-30
to E-97; V-
30 to G-96; V-30 to C-95; V-30 to L-94; V-30 to V-93; V-30 to N-92; V-30 to C-
91; V-30 to
Y-90; V-30 to R-89; V-30 to C-88; V-30 to R-87; V-30 to E-86; V-30 to L-85; V-
30 to Y-84;
V-30 to N-83; V-30 to W-82; V-30 to F-81; V-30 to Q-80; V-30 to T-79; V-30 to
Y-78; V-30
to H-77; V-30 to R-76; V-30 to P-75; V-30 to P-74; V-30 to C-73; V-30 to P-72;
V-30 to
G-71; V-30 to C-70; V-30 to T-69; V-30 to T-68; V-30 to P-67; V-30 to S-66; V-
30 to D-65;
V-30 to R-64; V-30 to R-63; V-30 to C-62; V-30 to P-61; V-30 to R-60; V-30 to
Q-59; V-30
to V-58; V-30 to F-57; V-30 to T-56; V-30 to G-55; V-30 to P-54; V-30 to P-53;
V-30 to
C-52; V-30 to Q-51; V-30 to A-50; V-30 to C-49; V-30 to V-48; V-30 to L-47; V-
30 to R-46;
V-30 to E-45; V-30 to G-44; V-30 to T-43; V-30 to E-42; V-30 to A-41; V-30 to
D-40; V-30
to R-39; V-30 to W-38; V-30 to P-37; and V-30 to Y-36 of the sequence of the
TFNR
sequence shown in Figure 1 (SEQ ID N0:2). Polypeptides encoded by these
polynucleotide
fragments are also encompassed by the invention. In specific embodiments, the
invention
provides polynucleotides encoding polypeptides comprising or alternatively
consisting of the
amino acid sequence of a member selected from the group consisting of
residues: V-30 to A-
271, V-30 to Q-254 and/or V-30 to F-221 of SEQ ID N0:2. Polypeptides encoded
by these
polynucleotides are also encompassed. by the invention. The present
application is also
directed to polynucleotides or polypeptides comprising, or alternatively,
consisting of, a
polynucleotide or polypeptide sequence at least 80%, 85%, 90%, 92%, 95%, 96%,
97°70, 98%
or 99% identical to a polypeptide or polypeptide sequence described above,
respectively. The
present invention also encompasses the above polynucleotide or polypeptide
sequences fused
to a heterologous polynucleotide or polypeptide sequence, respectively.
81
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0201] With respect to fragments of TNFR-6(3, as mentioned above, even if
deletion of
one or more amino acids from the N-terminus of a protein results in
modification of loss of
one or more biological functions of the protein, other functional activities
(e.g., biological
activities, the ability to multimerize, the ability to bind ligand (e.g., Fas
ligand andlor AIM-
II)) may still be retained. For example, the ability of shortened TNFR muteins
to induce
and/or bind to antibodies which recognize the complete or mature forms of the
polypeptides
generally will be retained when less than the majority of the residues of the
complete or
mature polypeptide are removed from the N-terminus. Whether a particular
polypeptide
lacking N-terminal residues of a complete polypeptide retains such immunologic
activities
can readily be determined by routine methods described herein and otherwise
known in the
art. It is not unlikely that a TNFR mutein with a large number of deleted N-
terminal amino
acid residues may retain some biological or immunogenic activities. In fact,
peptides
composed of as few as six TNFR amino acid residues may often evoke an immune
response.
[0202] Accordingly, the present invention further provides polypeptides
comprising, or
alternatively, consisting of, one or more residues deleted from the amino
terminus of the
TNFR-6(3 amino acid sequence shown in Figure 2 (i.e., SEQ ID N0:4), up to the
glycine
residue at position number 165 and polynucleotides encoding such polypeptides.
In
particular, the present invention provides polypeptides comprising, or
alternatively consisting
of, the amino acid sequence of residues n2-170 of Figure 2 (SEQ ID NO:4),
where n2 is an
integer from 2 to 165, corresponding to the position of the amino acid residue
in Figure 2
(SEQ ID NO:4).
[0203] More in particular, the invention provides polynucleotides encoding
polypeptides
comprising, or alternatively consisting of, the amino acid sequence of a
member selected
from the group consisting of residues of R-2 to P-170; A-3 to P-170; L-4 to P-
170; E-5 to
P-170; G-6 to P-170; P-7 to P-170; G-8 to P-170; L-9 to P-170; S-10 to P-170;
L-11 to
P-170; L-12 to P-170; C-13 to P-170; L-14 to P-170; V-15 to P-170; L-16 to P-
170; A-17 to
P-170; L-18 to P-170; P-19 to P-170; A-20 to P-170; L-21 to P-170; L-22 to P-
170; P-23 to
P-170; V-24 to P-170; P-25 to P-170; A-26 to P-170; V-27 to P-170; R-28 to P-
170; G-29 to
P-170; V-30 to P-170; A-31 to P-170; E-32 to P-170; T-33 to P-170; P-34 to P-
170; T-35 to
P-170; Y-36 to P-170; P-37 to P-170; W-38 to P-170; R-39 to P-170; D-40 to P-
170; A-41 to
P-170; E-42 to P-170; T-43 to P-170; G-44 to P-170; E-45 to P-170; R-46 to P-
170; L-47 to
82
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
P-170; V-48 to P-170; C-49 to P-170; A-50 to P-170; Q-51 to P-170; C-52 to P-
170; P-53 to
P-170; P-54 to P-170; G-55 to P-170; T-56 to P-170; F-57 to P-170; V-58 to P-
170; Q-59 to
P-170; R-GO to P-170; P-61 to P-170; C-62 to P-170; R-63 to P-170; R-G4 to P-
170; D-65 to
P-170; S-66 to P-170; P-67 to P-170; T-68 to P-170; T-69 to P-170; C-70 to P-
170; G-71 to
P-170; P-72 to P-I70; C-73 to P-170; P-74 to P-170; P-75 to P-170; R-76 to P-
170; H-77 to
P-I70; Y-78 to P-170; T-79 to P-170; Q-80 to P-170; F-81 to P-I70; W-82 to P-
170; N-83 to
P-170; Y-84 to P-170; L-85 to P-170; E-86 to P-170; R-87 to P-170; C-88 to P-
170; R-89 to
P-170; Y-90 to P-170; C-91 to P-170; N-92 to P-170; V-93 to P-170; L-94 to P-
170; C-95 to
P-170; G-96 to P-170; E-97 to P-170; R-98 to P-170; E-99 to P-170; E-100 to P-
170; E-101
to P-170; A-102 to P-170; R-103 to P-170; A-104 to P-170; C-105 to P-170; H-
106 to P-170;
A-107 to P-170; T-108 to P-170; H-109 to P-170; N-110 to P-170; R-111 to P-
170; A-112 to
P-170; C-113 to P-170; R-114 to P-170; C-I I5 to P-170; R-116 to P-I70; T-117
to P-170;
G-118 to P-170; F-119 to P-170; F-120 to P-170; A-121 to P-170; H-122 to P-
170; A-123 to
P-170; G-124 to P-170; F-125 to P-170; C-126 to P-170; L-127 to P-170; E-128
to P-170;
H-129 to P-170; A-130 to P-170; S-131 to P-170; C-132 to P-170; P-133 to P-
170; P-134 to
P-170; G-135 to P-170; A-136 to P-170; G-137 to P-170; V-138 to P-170; I-139
to P-170;
A-140 to P-170; P-141 to P-170; G-142 to P-170; E-143 to P-170; S-144 to P-
I70; W-145 to
P-170; A-146 to P-170; R-147 to P-170; G-148 to P-I70; G-149 to P-170; A-150
to P-170;
P-151 to P-170; R-152 to P-170; S-153 to P-170; G-154 to P-170; G-155 to P-
170; R-156 to
P-170; R-157 to P-170; C-158 to P-170; G-159 to P-170; R-160 to P-170; G-161
to P-170;
Q-162 to P-170; V-163 to P-170; A-164 to P-170; and G-165 to P-170 of the TNFR-
6(3
sequence shown in Figure 2 (SEQ ID N0:4). Polypeptides encoded by these
polynucleotide
fragments are also encompassed by the invention.
[0204] Also as mentioned above, even if deletion of one or more amino acids
from the
C-terminus of a protein results in modification of loss of one or more
biological functions of
the protein, other functional activities (e.g., biological activities, the
ability to multimerize,
ability to bind ligand (e.g., Fas ligand and/or AIM-II) may still be retained.
For example, the
ability of the shortened TNFR-6(3 mutein to induce and/or bind to antibodies
which recognize
the complete or mature forms of the polypeptide generally will be retained
when less than the
majority of the residues of the complete or mature polypeptide are removed
from the
C-terminus. Whether a particular polypeptide lacking C-terminal residues of a
complete
83
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
polypeptide retains such immunologic activities can readily be determined by
routine
methods described herein and otherwise known in the art. It is not unlikely
that a TNFR-6(3
mutein with a large number of deleted C-terminal amino acid residues may
retain some
biological or immunogenic activities. In fact, peptides composed of as few as
six TNFR-6(3
amino acid residues may often evoke an immune response.
[0205] Accordingly, the present invention further provides polypeptides
comprising, or
alternatively consisting of one or more residues deleted from the carboxy
terminus of the
amino acid sequence of the TNFR-6(3 polypeptide shown in Figure 2 (SEQ ID
N0:4), up to
the glycine residue at position number 6, and polynucleotides encoding such
polypeptides. In
particular, the present invention provides polypeptides comprising , or
alternatively
consisting of, the amino acid sequence of residues 1-m2 of Figure 2 (i.e., SEQ
ID N0:2),
where m2 is an integer from 6 to I69, corresponding to the position of the
amino acid residue
in Figure 2 (SEQ ID N0:4).
[0206] More in particular, the invention provides polynucleotides encoding
polypeptides
comprising, or alternatively consisting of, the amino acid sequence of a
member selected
from the group consisting of residues M-1 to A-169; M-1 to L-I68; M-1 to S-
167; M-1 to
P-166; M-1 to G-165; M-1 to A-164; M-1 to V-163; M-1 to Q-162; M-1 to G-161; M-
1 to
R-160; M-1 to G-159; M-1 to C-I58; M-1 to R-157; M-I to R-156; M-1 to G-155; M-
1 to
G-154; M-1 to S-153; M-1 to R-152; M-1 to P-151; M-1 to A-150; M-1 to G-149; M-
1 to
G-148; M-1 to R-I47; M-I to A-I46; M-1 to W-145; M-I to S-I44; M-1 to E-143; M-
I to
G-I42; M-1 to P-141; M-1 to A-140; M-1 to I-139; M-1 to V-138; M-1 to G-137; M-
1 to
A-I36; M-1 to G-135; M-1 to P-134; M-1 to P-133; M-1 to C-132; M-1 to S-131; M-
1 to
A-130; M-1 to H-129; M-1 to E-128; M-1 to L-127; M-1 to C-126; M-1 to F-125; M-
1 to
G-124; M-1 to A-123; M-1 to H-122; M-1 to A-121; M-1 to F-120; M-1 to F-119; M-
1 to
G-118; M-1 to T-117; M-1 to R-l I6; M-I to C-I15; M-1 to R-114; M-1 to C-113;
M-1 to
A-l I2; M-1 to R-l I I; M-1 to N-110; M-1 to H-I09; M-1 to T-108; M-I to A-
I07; M-I to
H-106; M-1 to C-105; M-1 to A-104; M-1 to R-103; M-1 to A-102; M-1 to E-101; M-
1 to
E-100; M-1 to E-99; M-1 to R-98; M-1 to E-97; M-1 to G-96; M-I to C-95; M-I to
L-94;
M-1 to V-93; M-1 to N-92; M-1 to C-91; M-1 to Y-90; M-1 to R-89; M-1 to C-88;
M-1 to
R-87; M-1 to E-86; M-I to L-85; M-1 to Y-84; M-1 fo N-83; M-1 to W-82; M-I to
F-81; M-1
to Q-80; M-1 to T-79; M-1 to Y-78; M-1 to H-77; M-1 to R-76; M-1 to P-75; M-1
to P-74;
84
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
M-1 to C-73; M-1 to P-72; M-1 to G-71; M-1 to C-70; M-1 to T-69; M-1 to T-68;
M-1 to
P-67; M-1 to S-66; M-1 to D-65; M-1 to R-64; M-1 to R-63; M-1 to C-62; M-1 to
P-61; M-1
to R-60; M-1 to Q-59; M-I to V-58; M-1 to F-57; M-1 to T-56; M-I to G-55; M-1
to P-54;
M-1 to P-53; M-1 to C-52; M-1 to Q-51; M-1 to A-50; M-1 to C-49; M-1 to V-48;
M-1 to
L-47; M-1 to R-46; M-1 to E-45; M-I to G-44; M-1 to T-43; M-1 to E-42; M-1 to
A-41; M-1
to D-40; M-1 to R-39; M-1 to W-38; M-1 to P-37; M-1 to Y-36; M-1 to T-35; M-1
to P-34;
M-1 to T-33; M-1 to E-32; M-1 to A-31; M-1 to V-30; M-1 to G-29; M-1 to R-28;
M-1 to
V-27; M-1 to A-26; M-1 to P-25; M-1 to V-24; M-1 to P-23; M-1 to L-22; M-1 to
L-21; M-1
to A-20; M-1 to P-19; M-1 to L-18; M-1 to A-17; M-1 to L-16; M-1 to V-15; M-1
to L-14;
M-1 to C-13; M-1 to L-12; M-1 to L-11; M-1 to S-10; M-1 to L-9; M-1 to G-8; M-
1 to P-7;
and M-1 to G-6 of the sequence of the TNFR-6(3 shown in Figure 2 (SEQ ID
N0:4).
Polypeptides encoded by these polynucleotide fragments are also encompassed by
the
invention.
[0207] The invention also provides polypeptides comprising. or alternatively
consisting
of, one or more amino acids deleted from both the amino and the carboxyl
termini of a
TNFR-6(3 polypeptide, which may be described generally as having residues nZ-
m2 of Figure
2 (i.e., SEQ ID N0:4), where n2 and m2 are integers as described above.
[0208] The present application is also directed to nucleic acid molecules
comprising, or
alternatively, consisting of, a polynucleotide sequence at least 90%, 92%,
95%, 96%, 97%,
98% or 99% identical to the polynucleotide sequence encoding a TNFR
polypeptide set forth
herein as m-y, n-z, n'-m', 30-m3, and/or n2-m'. In preferred embodiments, the
application is
directed to nucleic acid molecules comprising, or alternatively, consisting
of, a
polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%, 98% or 99°70
identical to the
polynucleotide sequences encoding polypeptides having the amino acid sequence
of the
specific N- and C-terminal deletions recited herein. The present invention
also encompasses
the above polynucleotide sequences fused to a heterologous polynucleotide
sequence.
Polypeptides encoded by these nucleic acids and/or polynucleotide sequences
are also
encompassed by the invention.
[0209) Also included are a nucleotide sequence encoding a polypeptide
consisting of a
portion of a complete TNFR amino acid sequence encoded by a cDNA clone
contained in
ATCC Deposit No. 97810, or 97809, where this portion excludes from 1 to about
49 amino
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
acids from the amino terminus of the complete amino acid sequence encoded by
the cDNA
clone contained in ATCC Deposit No. 97810 and 97809, respectively, or from 1
to about 107
or 58 amino acids from the carboxy terminus of the complete amino acid
sequence encoded
by the cDNA clone contained in ATCC Deposit No. 97810 and 97809, respectively,
or any
combination of the above amino terminal and carboxy terminal deletions, of the
complete
amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
97810 or
97809. Polypeptides encoded by all of the above polynucleotides are also
encompassed by
the invention.
[0210] In addition to terminal deletion forms of the protein discussed above,
it also will
be recognized by one of ordinary skill in the art that some amino acid
sequences of the TNFR
polypeptides can be varied without significant effect on the structure or
function of the
proteins. If such differences in sequence are contemplated, it should be
remembered that
there will be critical areas on the protein which determine activity.
[0211] Thus, the invention further includes variations of the TNFR
polypeptides which
show substantial TNFR polypeptide functional activity (e.g., immunogenic
activity,
biological activity) or which include regions of TNFR protein such as the
protein portions
discussed below. Such mutants include deletions, insertions, inversions,
repeats, and type
substitutions selected according to general rules known in the art so as have
little effect on
activity. For example, guidance concerning how to make phenotypically silent
amino acid
substitutions is provided in Bowie, J. U. et al., "Deciphering the Message in
Protein
Sequences: Tolerance to Amino Acid Substitutions," Sciefzce 247:1306-1310
(1990), wherein
the authors indicate that there are two main approaches for studying the
tolerance of an amino
acid sequence to change. The first method relies on the process of evolution,
in which
mutations are either accepted or rejected by natural selection. The second
approach uses
genetic engineering to introduce amino acid changes at specific positions of a
cloned gene
and selections or screens to identify sequences that maintain functionality.
As the authors
state, these studies have revealed that proteins are surprisingly tolerant of
amino acid
substitutions. The authors further indicate which amino acid changes are
likely to be
permissive at a certain position of the protein. For example, most buried
amino acid residues
require nonpolar side chains, whereas few features of surface side chains are
generally
conserved. Other such phenotypically silent substitutions are described in
Bowie, J. U. et
86
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
al., supra, and the references cited therein. Typically seen as conservative
substitutions are
the replacements, one for another, among the aliphatic amino acids Ala, Val,
Leu and Ile;
interchange of the hydroxyl residues Ser and Thr, exchange of the acidic
residues Asp and
Glu, substitution between the amide residues Asn and Gln, exchange of the
basic residues
Lys and Arg and replacements among the aromatic residues Phe, Tyr. Thus, the
fragment,
derivative or analog of the polypeptide of SEQ ID N0:2, 4 or 6, or that
encoded by a
deposited cDNA, may be (i) one in which one or more of the amino acid residues
are
substituted with a conserved or non-conserved amino acid residue (preferably a
conserved
amino acid residue) and such substituted amino acid residue may or may not be
one encoded
by the genetic code, or (ii) one in which one or moxe of the amino acid
residues includes a
substituent group, or (iii) one in which the mature or soluble extxacellular
polypeptide is
fused with another compound, such as a compound to increase the half-life of
the polypeptide
(for example, polyethylene glycol), or (iv) one in which the additional amino
acids (such as,
for example, an IgG Fc peptide fusion and/or an immunoglobulin light chain
constant region
peptide), a leader or secretory sequence, or a sequence which is employed for
purification of
the TNFR polypeptide) are fused to a TNFR polypeptide described herein. Such
fragments,
derivatives and analogs are deemed to be within the scope of those skilled in
the art from the
teachings herein.
[0212] Thus, the TNFR of the present invention may include one or more amino
acid
substitutions, deletions or additions, either from natural mutations or human
manipulation.
As indicated, changes are preferably of a minor nature, such as conservative
amino acid
substitutions that do not significantly affect the folding or activity of the
protein (see Table
III).
87
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
TABLE III. Conservative Amino Acid Substitutions.
Aromatic Phenylalanine
Tryptophan
Tyrosine
Hydrophobic ~ Leucine
Isoleucine
Valine
Polar Glutamine
Asparagine
Basic ~ Arginine
Lysine
Histidine
Acidic Aspartic Acid
Glutamic Acid
Small Alanine
Serine
Threonine
Methionine
Glycine
[0213j Amino acids in the TNFR proteins of the present invention that are
essential for
function can be identified by methods known in the art, such as site-directed
mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085
(1989)).
The latter procedure introduces single alanine mutations at every residue in
the molecule.
The resulting mutant molecules are then tested for functional activity such
as, for example,
88
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
ligandlreceptor (e.g., Fas ligand and/or AIM-II) receptor binding or ifz vitro
or irz vitro
proliferative activity.
[0214] Of special interest are substitutions of charged amino acids with other
charged or
neutral amino acids which may produce proteins with highly desirable improved
characteristics, such as less aggregation. Aggregation may not only reduce
activity but also
be problematic when preparing pharmaceutical formulations, because aggregates
can be
immunogenic (Pinckard et al., Clin. Exp. IrnmuTZOI. 2:331-340 (1967); Robbins
et al.,
Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug
Carrier Systems
10:307-377 (1993).
[0215] Replacement of amino acids can also change the selectivity of the
binding of a
ligand to cell surface receptors. For example, Ostade et al., Nature 361:266-
268 (1993)
describes certain mutations resulting in selective binding of TNF-a to only
one of the two
known types of TNF receptors. Sites that are critical for ligand-receptor
binding can also be
determined by structural analysis such as crystallization, nuclear magnetic
resonance or
photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992) and de
Vos et
al.Scierzce 255:306-312 (1992)).
[0216] Since TNFR-6 alpha and TNFR-6 beta are members of the TNF receptor-
related
protein family, to modulate rather than completely eliminate biological
activities of TNFR
preferably mutations are made in sequences encoding amino acids in the TNFR
conserved
extracellular domain, more preferably in residues within this region which are
not conserved
among members of the TNF receptor family. Also forming part of the present
invention are
isolated polynucleotides comprising nucleic acid sequences which encode the
above TNFR
mutants.
[0217] The polypeptides of the present invention are preferably provided in an
isolated
form, and preferably are substantially purified. A recombinantly produced
version of the
TNFR polypeptides can be substantially purified by the one-step method
described in Smith
and Johnson, Gene 67:31-40 (1988). Polypeptides of the invention also can be
purified from
natural or recombinant sources using anti-TNFR-6 alpha and TNFR-6 beta
antibodies of the
invention in methods which are well known in the art of protein purification.
[0218] The invention further provides isolated TNFR polypeptides comprising an
amino
acid sequence selected from the group consisting of: (a) the amino acid
sequence of a full-
89
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
length TNFR polypeptide having the complete amino acid sequence shown in SEQ m
N0:2
or 4 or as encoded by the cDNA clone contained in the plasmid deposited as
ATCC Deposit
No. 97810 or 97809; (b) the amino acid sequence of a mature TNFR polypeptide
having the
amino acid sequence at positions 31-300 in SEQ ID N0:2 or 31-170 in SEQ ll~
N0:4, or as
encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit
No. 97810
or 97809; or (c) the amino acid sequence of a soluble extracellular domain of
a TNFR
polypeptide having the amino acid sequence at positions 31 to 283 in SEQ ID
N0:2 or 31 to
166 in SEQ ID N0:4, or as encoded by the cDNA clone contained in the plasmid
deposited
as ATCC Deposit No. 97810 or 97809.
[0219] Further polypeptides of the present invention include polypeptides
which have at
least 90% similarity, more preferably at least 80%, 85%, 90%, 92%, or 95%
similarity, and
still more preferably at least 96%, 97%, 98% or 99% similarity to those
described above. The
polypeptides of the invention also comprise those which are at least 80%
identical, more
preferably at least 85%, 90%, 92% or 95% identical, still more preferably at
least 96%, 97%,
98% or 99% identical to the polypeptide encoded by the deposited cDNA (ATCC
Deposit
Nos. 97810 or 97809) or to the polypeptide of SEQ ID N0:2 or 4, and also
include portions
of such polypeptides with at least 30 amino acids and more preferably at least
50 amino acids.
[0220] By "% similarity" for two polypeptides is intended a similarity score
produced by
comparing the amino acid sequences of the two polypeptides using the ~Bestfit
program
(Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer
Group,
University Research Park, 575 Science Drive, Madison, WI 5371 I) and the
default settings
for determining similarity. Bestfit uses the local homology algorithm of Smith
and
Waterman (Advances in Applied Mathematics 2:482-489, 1981) to find the best
segment of
similarity between two sequences.
[022I] By a polypeptide having an amino acid sequence at Least, for example,
95%
"identical" to a reference amino acid sequence of a TNFR polypeptide is
intended that the
amino acid sequence of the polypeptide is identical to the reference sequence
except that the
polypeptide sequence may include up to five amino acid alterations per each
100 amino acids
of the reference amino acid of the TNFR polypeptide. In other words, to obtain
a polypeptide
having an amino acid sequence at least 80%, 85%, 90%, or 95% identical to a
reference
amino acid sequence, up to 5% of the amino acid residues in the reference
sequence may be
deleted or substituted with another amino acid, or a number of amino acids up
to 5% of the
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
total amino acid residues in the reference sequence may be inserted into the
reference
sequence. These alterations of the reference sequence may occur at the amino
or carboxy
terminal positions of the reference amino acid sequence or anywhere between
those terminal
positions, interspersed either individually among residues in the reference
sequence or in one
or more contiguous groups within the reference sequence.
[0222] As a practical matter, whether any particular polypeptide is at least
80%, 85%,
90%, 92%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid
sequence
shown in SEQ ID N0:2 or 4, or to an amino acid sequence encoded by the cDNA
contained
in the deposits having ATCC Deposit No. 97810, or 97809, or fragments thereof
(e.g., the
sequence of any of the polypeptides corresponding to N or C terminal deletions
of TNFR, as
described herein (e.g., the polypeptide having the sequence of amino acids 30
to 300 of SEQ
ID N0:2)) can be determined conventionally using known computer programs such
the
Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics
Computer Group, University Research Park, 575 Science Drive, Madison, WI
53711). When
using Bestfit or any other sequence alignment program to determine whether a
particular
sequence is, for instance, 95% identical to a reference sequence according to
the present
invention, the parameters are set, of course, such that the percentage of
identity is calculated
over the full length of the reference amino acid sequence and that gaps in
homology of up to
5% of the total number of amino acid residues in the reference sequence are
allowed.
[0223] In a specific embodiment, the identity between a reference (query)
sequence (a
sequence of the present invention) arid a subject sequence, also referred to
as a global
sequence alignment, is determined using the FASTDB computer program based on
the
algorithm of Brutlag et al.(Cofnp. App. Biosci. 6:237-245 (1990)). Preferred
parameters used
in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch
Penalty=1,
Joining Penalty=20, Randomization Group Length=0, Cutoff Score=l, Window
Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or
the
length of the subject amino acid sequence, whichever is shorter. According to
this
embodiment, if the subject sequence is shorter than the query sequence due to
N- or C-
terminal deletions, not because of internal deletions, a manual correction is
made to the
results to take into consideration the fact that the FASTDB program does not
account for N-
and C-terminal truncations of the subject sequence when calculating global
percent identity.
For subject sequences truncated at the N- and C-termini, relative to the query
sequence, the
91
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
percent identity is corrected by calculating the number of residues of the
query sequence that
are N- and C-terminal of the subject sequence, which are not matched/aligned
with a
corresponding subject residue, as a percent of the total bases of the query
sequence. A
determination of whether a residue is matched/aligned is determined by results
of the
FASTDB sequence alignment. This percentage is then subtracted from the percent
identity,
calculated by the above FASTDB program using the specified parameters, to
arnve at a final
percent identity score. This final percent identity score is what is used for
the purposes of
this embodiment. Only residues to the N- and C-termini of the subject
sequence, which are
not matched/aligned with the query sequence, are considered for the purposes
of manually
adjusting the percent identity score. That is, only query residue positions
outside the farthest
N- and C-terminal residues of the subject sequence. For example, a 90 amino
acid residue
subject sequence is aligned with a 100 residue query sequence to determine
percent identity.
The deletion occurs at the N-terminus of the subject sequence and therefore,
the FASTDB
alignment does not show a matching/alignment of the first 10 residues at the N-
terminus.
The 10 unpaired residues represent 10% of the sequence (number of residues at
the N- and C-
termini not matched/total number of residues in the query sequence) so 10% is
subtracted
from the percent identity score calculated by the FASTDB program. If the
remaining 90
residues were perfectly matched the final percent identity would be 90%. In
another
example, a 90 residue subject sequence is compared with a 100 residue query
sequence. This
time the deletions are internal deletions so there are no residues at the N-
or C-termini of the
subject sequence which are not matched/aligned with the query. In this case
the percent
identity calculated by FASTDB is not manually corrected. Once again, only
residue
positions outside the N- and C-terminal ends of the subject sequence, as
displayed in the
FASTDB alignment, which are not matched/aligned with the query sequence are
manually
corrected for. No other manual corrections are made for the purposes of this
embodiment.
[0224] The polypeptide of the present invention have uses which include, but
are not
limited to, as molecular weight markers on SDS-PAGE gels or on molecular sieve
geI
filtration columns using methods well known to those of skill in the art. As
described in
detail below, the polypeptides of the present invention can also be used to
raise polyclonal
and monoclonal antibodies, which are useful in assays for detecting TNFR
protein expression
as described below or as agonists and antagonists capable of enhancing or
inhibiting TNFR
protein function. Further, such polypeptides can be used in the yeast two-
hybrid system to
92
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
"capture" TNFR protein binding proteins which are also candidate agonists and
antagonists
according to the present invention. The yeast two hybrid system is described
in Fields and
Song, Nature 340:245-246 (1989).
Transgenics
[0225] The proteins of the invention can also be expressed in transgenic
animals.
Animals of any species, including, but not limited to, mice, rats, rabbits,
hamsters, guinea
pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates, e.g.,
baboons, monkeys,
and chimpanzees may be used to generate transgenic animals. In a specific
embodiment,
techniques described herein or otherwise known in the art, are used to express
polypeptides of
the invention in humans, as part of a gene therapy protocol.
[0226] Any technique known in the art may be used to introduce the transgene
(i.e.,
polynucleotides of the invention) into animals to produce the founder lines of
transgenic
animals. Such techniques include, but are not limited to, pronuclear
microinjection (Paterson
et al., Appl. Microbiol. Biotech~aol. 40:691-698 (1994); Carver et al.,
Biotechtaolagy (NY)
11:1263-1270 (1993); Wright et al., Biotechrvology (NY) 9:830-834 (1991); and
Hoppe et al.,
U.S. Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into germ
lines (Van der
Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts
or embryos; gene
targeting in embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation
of cells or embryos (Lo, Mol Cell. Biol. 3:1803-1814 (1983)); introduction of
the
polynucleotides of the invention using a gene gun (see, e.g., Ulmer et al.,
Science 259:1745
(1993); introducing nucleic acid constructs into embryonic pleuripotent stem
cells and
transferring the stem cells back into the blastocyst; and sperm-mediated gene
transfer
(Lavitrano et al., Cell 57:717-723 (1989)); etc. For a review of such
techniques, see Gordon,
"Transgenic Animals," Ihtl. Rev. Cytol. 115:171-229 (1989), which is
incorporated by
reference herein in its entirety. See also, U.S. Patent No. 5,464,764
(Capecchi, et al.,
Positive-Negative Selection Methods and Vectors); U.S. Patent No. 5,631,153
(Capecchi, et
al., Cells and Non-Human Organisms Containing Predetermined Genomic
Modifications and
Positive-Negative Selection Methods and Vectors for Making Same); U.S. Patent
No.
4,736,866 (Leder, et al., Transgenic Non-Human Animals); and U.S. Patent No.
4,873,191
(Wagner, et al., Genetic Transformation of Zygotes); each of which is hereby
incorporated by
93
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
reference in its entirety. Further, the contents of each of the documents
recited in this ,
paragraph is herein incorporated by reference in its entirety.
[0227] Any technique known in the art may be used to produce transgenic clones
containing polynucleotides of the invention, for example, nuclear transfer
into enucleated
oocytes of nuclei from cultured embryonic, fetal, or adult cells induced to
quiescence
(Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature 385:810-813
(1997)), each
of which is herein incorporated by reference in its entirety).
[0228] The present invention provides for transgenic animals that carry the
transgene in
all their cells, as well as animals which carry the transgene in some, but not
all their cells, i.e.,
mosaic animals or chimeric animals. The transgene may be integrated as a
single transgene
or as multiple copies such as in concatamers, e.g., head-to-head tandems or
head-to-tail
tandems. The transgene may also be selectively introduced into and activated
in a particular
cell type by following, for example, the teaching of Lasko et al. (Lasko et
al., Proc. Natl.
Acad. Sci. USA 89:6232-6236 (1992)). The regulatory sequences required for
such a cell-
type specific activation will depend upon the particular cell type of
interest, and will be
apparent to those of skill in the art. When it is desired that the
polynucleotide transgene be
integrated into the chromosomal site of the endogenous gene, gene targeting is
preferred.
Briefly, when such a technique is to be utilized, vectors containing some
nucleotide
sequences homologous to the endogenous gene are designed for the purpose of
integrating,
via homologous recombination with chromosomal sequences, into and disrupting
the function
of the nucleotide sequence of the endogenous gene. The transgene may also be
selectively
introduced into a particular cell type, thus inactivating the endogenous gene
in only that cell
type, by following, for example, the teaching of Gu et al.(Science 265:103-106
(1994)). The
regulatory sequences required for such a cell-type specific inactivation will
depend upon the
particular cell type of interest, and will be apparent to those of skill in
the art. The contents of
each of the documents recited in this paragraph is herein incorporated by
reference in its
entirety.
[0229] Once transgenic animals have been generated, the expression of the
recombinant
gene may be assayed utilizing standard techniques. Initial screening may be
accomplished by
Southern blot analysis or PCR techniques to analyze animal tissues to verify
that integration
of the transgene has taken place. The level of mRNA expression of the
transgene in the
94
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
tissues of the transgenic animals may also be assessed using techniques which
include, but
are not limited to, Northern blot analysis of tissue samples obtained from the
animal, in situ
hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of
transgenic gene-
expressing tissue may also be evaluated immunocytochemically or
immunohistochemically
using antibodies specific for the transgene product.
[0230] Once the founder animals are produced, they may be bred, inbred,
outbred, or
crossbred to produce colonies of the particular animal. Examples of such
breeding strategies
include, but are not limited to: outbreeding of founder animals with more than
one
integration site in order to establish separate lines; inbreeding of separate
lines in order to
produce compound transgenics that express the transgene at higher levels
because of the
effects of additive expression of each transgene; crossing of heterozygous
transgenic animals
to produce animals homozygous for a given integration site in order to both
augment
expression and eliminate the need for screening of animals by DNA analysis;
crossing of
separate homozygous lines to produce compound heterozygous or homozygous
lines; and
breeding to place the transgene on a distinct background that is appropriate
for an
experimental model of interest.
[0231] Female transgenic mice that secrete a TNFR-6 alpha and/or TNFR-6 beta
polypeptide in their milk may be generated using the pBCl Milk Expression
Vector Kit,
available from Invitrogen Corp. (Carlsbad, CA; Catalog Number K270-O1).
Transgenic mice
can be made using the pBCl vector according to protocols well-known in the
art. Milk may
be harvested from the nnice and TNFR-6 alpha and/or TNFR-6 beta polypeptides
purified
from the milk according to the manufacturer's instructions published in the
package insert
that accompanies the pBCI Milk Expression Vector Kit (Version B, 000829; 25-
0264).
[0232] Transgenic and "knock-out" animals of the invention have uses which
include,
but are not limited to, animal model systems useful in elaborating the
biological function of
TNFR polypeptides, studying conditions and/or disorders associated with
aberrant TNFR
expression, and in screening for compounds effective in ameliorating such
conditions and/or
disorders.
[0233] In further embodiments of the invention, cells that are genetically
engineered to
express the proteins of the invention, or alternatively, that are genetically
engineered not to
express the proteins of the invention (e.g., knockouts) are administered to a
patient ire vivo.
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Such cells may be obtained from the patient (i.e., animal, including human) or
an MHC
compatible donor and can include, but are not limited to fibroblasts, bone
marrow cells, blood
cells (e.g., lymphocytes), adipocytes, muscle cells, endothelial cells, etc.
The cells are
genetically engineered in vitro using recombinant DNA techniques to introduce
the coding
sequence of polypeptides of the invention into the cells, or alternatively, to
disrupt the coding
sequence and/or endogenous regulatory sequence associated with the
polypeptides of the
invention, e.g., by transduction (using viral vectors, and preferably vectors
that integrate the
transgene into the cell genome) or transfection procedures, including, but not
limited to, the
use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc.
The coding
sequence of the polypeptides of the invention can be placed under the control
of a strong
constitutive or inducible promoter or promoter/enhancer to achieve expression,
and
preferably secretion, of the polypeptides of the invention. The engineered
cells which
express and preferably secrete the polypeptides of the invention can be
introduced into the
patient systemically, e.g., in the circulation, or intraperitoneally.
Alternatively, the cells can
be incorporated into a matrix and implanted in the body, e.g., genetically
engineered
fibroblasts can be implanted as part of a skin graft; genetically engineered
endothelial cells
can be implanted as part of a lymphatic or vascular graft. (See, for example,
Anderson et
al.US Patent No. 5,399,349; and Mulligan & Wilson US Patent No. 5,460,959,
each of
which is incorporated by reference herein in its entirety).
[0234] When the cells to be administered are non-autologous or non-MHC
compatible
cells, they can be administered using well known techniques which pxevent the
development
of a host immune response against the introduced cells. For example, the cells
may be
introduced in an encapsulated form which, while allowing for an exchange of
components
with the immediate extracellular environment, does not allow the introduced
cells to be
recognized by the host immune system.
Antibodies
[0235) The present invention further relates to antibodies and T-cell antigen
receptors
(TCR) which immunospecifically bind a polypeptide, preferably an epitope, of
the present
invention (as determined by immunoassays well known in the art for assaying
specific
antibody-antigen binding). Antibodies of the invention include, but are not
limited to,
polyclonal, monoclonal, multispecific, human, humanized or chimeric
antibodies, single
96
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab
expression
library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id
antibodies to antibodies of
the invention), and epitope-binding fragments of any of the above. The term
"antibody," as
used herein, refers to immunoglobulin molecules and immunologically active
portions of
immunoglobulin molecules, i.e., molecules that contain an antigen binding site
that
immunospecifically binds an antigen. The immunoglobulin molecules of the
invention can
be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl,
IgG2, IgG3, IgG4,
IgAl and IgA2) or subclass of irnmunoglobulin molecule. In a preferred
embodiment, the
immunoglobulin is an IgGl isotype. In another preferred embodiment, the
immunoglobulin is
an IgG4 isotype.
[0236] Most preferably the antibodies are human antigen-binding antibody
fragments of
the present invention and include, but are not limited to, Fab, Fab' and
F(ab')2, Fd, single-
chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and
fragments
comprising either a VL or VH domain. Antigen-binding antibody fragments,
including
single-chain antibodies, may comprise the variable regions) alone or in
combination with the
entirety or a portion of the following: hinge region, CH1, CH2, and CH3
domains. Also
included in the invention are antigen-binding fragments also comprising any
combination of
variable regions) with a hinge region, CH1, CH2, and CH3 domains. The
antibodies of the
invention may be from any animal origin including birds and mammals.
Preferably, the
antibodies are human, murine, donkey, ship rabbit, goat, guinea pig, camel,
horse, or chicken.
As used herein, "human" antibodies include antibodies having the amino acid
sequence of a
human immunoglobulin and include antibodies isolated from human immunoglobulin
libraries or from animals transgenic for one or more human immunoglobulin and
that do not
express endogenous immunoglobulins, as described infra and, for example in,
U.S. Patent
No. 5,939,598 by Kucherlapati et al.
[0237] The antibodies of the present invention may be monospecific,
bispecific,
trispecific or of greater multispecificity. Multispecific antibodies may be
specific for
different epitopes of a polypeptide of the present invention or may be
specific for both a
polypeptide of the present invention as well as for a heterologous epitope,
such as a
heterologous polypeptide or solid support material. See, e.g., PCT
publications WO
93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol.
147:60-69
97
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
(1991); U.S. Patent Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920;
5,601,819; Kostelny et
al., J. Immunol. 148:1547-1553 (1992).
[0238] Antibodies of the present invention may be described or specified in
terms of the
epitope(s) or portions) of a polypeptide of the present invention that they
recognize or
specifically bind. The epitope(s) or polypeptide portions) may be specified as
described
herein, e.g., by N-ternninal and C-terminal positions, by size in contiguous
amino acid
residues, or listed in the Tables and Figures. Antibodies that specifically
bind any epitope or
polypeptide of the present invention may also be excluded. Therefore, the
present invention
includes antibodies that specifically bind polypeptides of the present
invention, and allows
for the exclusion of the same.
[0239] Antibodies of the present invention may also be described or specified
in terms of
their cross-reactivity. Antibodies that do not bind any other analog,
ortholog, or homolog of
a polypeptide of the present invention are included. Antibodies that bind
polypeptides with at
least 95°70, at least 90%, at least 85%, at least 80%, at least 75%, at
least 70°70, at least 6S%, at
least 60%, at least 55%, and at least 50% identity (as calculated using
methods known in the
art and described herein) to a polypeptade of the present invention are also
included in the
present invention. Antibodies that do not bind polypeptides with less than
95%, less than
90%, less than 85%, less than 80%, less than 75%, less than 70%, less than
65%, less than
60%, less than 55%, and less than 50% identity (as calculated using methods
known in the art
and described herein) to a polypeptide of the present invention are also
included in the
present invention. Further included in the present invention are antibodies
that bind
polypeptides encoded by polynucleotides which hybridize to a polynucleotide of
the present
invention under stringent hybridization conditions (as described herein).
Antibodies of the
present invention may also be described or specified in terms of their binding
affinity to a
polypeptide of the invention Preferred binding affinities include those with a
dissociation
constant or Kd less than 5 X 102 M, 10-2 M, 5 X 10-3 M, 103 M, 5 X 10-4 M, 10-
4 M, 5 X 10-5
M, or 10-5 M. More preferred binding affinities include those with a
dissociation constant or
Kd less than 5 X 10-6 M, 10~6M, 5 X 10-' M, 10' M, 5 X 10-$ M, or 10-$ M. Even
more
preferred binding affinities include those with a dissociation constant or Kd
less than 5 X 10-9
M, 10-9 M, 5 X 10-'° M, 10-'° M, 5 X 10-" M, 10-" M, 5 X 10-'z
M, 'o-'z M, 5 X 10'3 M, 10-'3 M,
X 10-'4 M, 10-'4 M, 5 X 10-'5 M, or 10-'S M.
98
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0240] The invention also provides antibodies that competitively inhibit
binding of an
antibody to an epitope of the invention as determined by any method known in
the art for
determining competitive binding, for example, the immunoassays described
herein. In
preferred embodiments, the antibody competitively inhibits binding to the
epitope by at least
90%, at least 80%, at least 70%, at least 60%, or at least 50%.
[0241] Antibodies of the present invention may act as agonists or antagonists
of the
polypeptides of the present invention. For example, the present invention
includes antibodies
which disrupt the receptor/ligand interactions with the polypeptides of the
invention either
partially or fully. The invention features both receptor-specific antibodies
and ligand-specific
antibodies. The invention also features receptor-specific antibodies which do
not prevent
ligand binding but prevent receptor activation. Receptor activation (i.e.,
signaling) may be
determined by techniques described herein or otherwise known in the art. For
example;
receptor activation can be determined by detecting the phosphorylation (e.g.,
tyrosine or
serine/threonine) of the receptor or its substrate by immunoprecipitation
followed by western
blot analysis (for example, as described supra). In specific embodiments,
antibodies. are
provided that inhibit ligand or receptor activity by at least 90%, at least
80%, at least 70%, at
least 60%, or at least 50% of the activity in absence of the antibody.
[0242] The invention also features receptor-specific antibodies which both
prevent ligand
binding and receptor activation as well as antibodies that recognize the
receptor-ligand
complex, and, preferably, do not specifically recognize the unbound receptor
or the unbound
ligand. Likewise, included in the invention are neutralizing antibodies which
bind the ligand
and prevent binding of the ligand to the receptor, as well as antibodies which
bind the Iigand,
thereby preventing receptor activation, but do not prevent the ligand from
binding the
receptor. Further included in the invention are antibodies which activate the
receptor. These
antibodies may act as receptor agonists, i.e., potentiate or activate either
all or a subset of the
biological activities of the ligand-mediated receptor activation. The
antibodies may be
specified as agonists, antagonists or inverse agonists for biological
activities comprising the
specific biological activities of the peptides of the invention disclosed
herein. The above
antibody agonists can be made using methods known in the art. See, e.g., PCT
publication
WO 96/40281; U.S. Patent No. 5,811,097; Deng et al., Blood 92(6):1981-1988
(1998); Chen,
et al., Cancer Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol.
161(4):1786-1794
(1998); Zhu et al., Cancer Res. 58(15):3209-3214 (1998); Yoon, et al., J.
Immunol.
99
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
160(7):3170-3179 (1998); Prat et al., J. Cell. Sci. 111(Pt2):237-247 (1998);
Pitard et al., J.
Immunol. Methods 205(2):177-190 (1997); Liautard et al., Cytolcine 9(4):233-
241 (1997);
Carlson et al., J. Biol. Chem. 272(17):11295-11301 (1997); Taryman et al.,
Neuron
14(4):755-762 (1995); Muller et al., Structure 6(9):1153-1167 (1998);
Bartunelc et al.,
Cytokine 8(1):14-20 (1996) (which are all incorporated by reference herein in
their
entireties).
[0243] Antibodies of the present invention may be used, for example, but not
limited to,
to purify, detect, and target the polypeptides of the present invention,
including both in vitro
and in vivo diagnostic and therapeutic methods. For example, the antibodies
have use in
immunoassays for qualitatively and quantitatively measuring levels of the
polypeptides of the
present invention in biological samples. See, e.g., Harlow et al., Antibodies:
A Laboratory
Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by
reference
herein in its entirety).
[0244] By way of another non-limiting example, antibodies of the invention may
be
administered to individuals as a form of passive immunization. Alternatively,
antibodies of
the present invention may be used for epitope mapping to identify the
epitope(s) bound by the
antibody. ~ Epitopes identified in this way may, in turn, for example, be used
as vaccine
candidates, i.e., to immunize an individual to elicit antibodies against the
naturally occuring
forms of TNFR-6 alpha andlor TNFR-6 beta.
[0245] As discussed in more detail below, the antibodies of the present
invention may be
used either alone or in combination with other compositions. The antibodies
may further be
recombinantly fused to a heterologous polypeptide at the N- or C-terminus or
chemically
conjugated (including covalent and non-covalent conjugations) to polypeptides
or other
compositions. For example, antibodies of the present invention may be
recombinantly fused
or conjugated to molecules useful as labels in detection assays and effector
molecules such as
heterologous polypeptides, drugs, or toxins. See, e.g., PCT publications WO
92/08495; WO
91/14438; WO 89/12624; IJ.S. Patent No. 5,314,995; and EP 396,387. Additional
antibodies
of the invention may be to albumin, as described above.
[0246] The antibodies of the invention include derivatives that are modified,
i.e, by the
covalent attachment of any type of molecule to the antibody such that covalent
attachment
does not prevent the antibody from generating an anti-idiotypic response. For
example, but
not by way of limitation, the antibody derivatives include antibodies that
have been modified,
100
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
e.g., by glycosylation, acetylation, pegylation, phosphylation, amidation,
derivatization by
known protecting/blocking groups, proteolytic cleavage, linkage to a cellular
ligand or other
protein, etc. Any of numerous chemical modifications may be carried out by
known
techniques, including, but not limited to specific chemical cleavage,
acetylation, formylation,
metabolic synthesis of tunicamycin, etc. Additionally, the derivative may
contain one or
more non-classical amino acids.
[0247] The antibodies of the present invention may be generated by any
suitable method
known in the art. Polyclonal antibodies to an antigen-of- interest can be
produced by various
procedures well known in the art. For example, a polypeptide of the invention
can be
administered to various host animals including, but not limited to, rabbits,
mice, rats, etc. to
induce the production of sera containing polyclonal antibodies specific for
the antigen.
Various adjuvants may be used to increase the immunological response,
depending on the
host species, and include but are not limited to, Freund's (complete and
incomplete), mineral
gels such as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and
potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and
corynebacterium parvum. Such adjuvants are also well known in the art.
[0248] Monoclonal antibodies can be prepared using a wide variety of
techniques known
in the art including the use of hybridoma, recombinant, and phage display
technologies, or a
combination thereof. For example, monoclonal antibodies can be produced using
hybridoma
techniques including those known in the art and taught, for example, in Harlow
et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed.
1988);
Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681
(Elsevier,
N.Y., 1981) (said references incorporated by reference in their entireties).
The term
"monoclonal antibody" as used herein is not limited to antibodies produced
through
hybridoma technology. The term "monoclonal antibody" refers to an antibody
that is derived
from a single clone, including any eukaryotic, prokaryotic, or phage clone,
and not the
method by which it is produced.
[0249] Methods for producing and screening for specific antibodies using
hybridoma
technology are routine and well-known in the art and are discussed in detail
in Example 11.
Briefly, mice can be immunized with a polypeptide of the invention or a cell
expressing such
peptide. Once an immune response is detected, e.g., antibodies specific for
the antigen are
101.
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
detected in the mouse serum, the mouse spleen is harvested and splenocytes
isolated. The
splenocytes are then fused by well-known techniques to any suitable myeloma
cells, for
example cells from cell line SP20 available from the ATCC. Hybridomas are
selected and
cloned by limited dilution. The hybridoma clones are then assayed by methods
known in the
art for cells that secrete antibodies capable of binding a polypeptide of the
invention. Ascites
fluid, which generally contains high levels of antibodies, can be generated by
immunizing
mice with positive hybridoma clones.
[0250] Another well known method for producing both polyclonal and monoclonal
human B cell lines is transformation using Epstein Barr Virus (EBV). Protocols
for
generating EBV-transformed B cell lines are commonly known in the art, such
as, for
example, the protocol outlined in Chapter 7.22 of Current Protocols in
Immunology, Coligan
et al., Eds., 1994, John Wiley & Sons, NY, which is hereby incorporated in its
entirety by
reference herein. The source of B cells for transformation is commonly human
peripheral
blood, but B cells for transformation may also be derived from other sources
including, but
not limited to, lymph nodes, tonsil, spleen, tumor tissue, and infected
tissues. Tissues are
generally made into single cell suspensions prior to EBV transformation.
Additionally, steps
may be taken to either physically remove or inactivate T cells (e.g., by
treatment with
cyclosporin A) in B cell-containing samples, because T cells from individuals
seropositive
for anti-EBV antibodies can suppress B cell immortalization by EBV. In
general, the sample
containing human B cells is innoculated with EBV, and cultured for 3-4 weeks.
A typical
source of EBV is the culture supernatant of the B95-8 cell line (ATCC #VR-
1492). Physical
signs of EBV transformation can generally be seen towards the end of the 3-4
week culture
period. By phase-contrast microscopy, transformed cells may appear large,
clear, hairy and
tend to aggregate in tight clusters of cells. Initially, EBV lines are
generally polyclonal.
However, over prolonged periods of cell cultures, EB V lines may become
monoclonal or
polyclonal as a result of the selective outgrowth of particular B cell clones.
Alternatively,
polyclonal EBV transformed lines may be subcloned (e.g., by limiting dilution
culture) or
fused with a suitable fusion partner and plated at limiting dilution to obtain
monoclonal B cell
lines. Suitable fusion partners for EBV transformed cell lines include mouse
myeloma cell
lines (e.g., SP2/0, X63-Ag8.653), heteromyeloma cell lines (human x mouse;
e.g, SPAM-8,
SBC-H20, and CB-F7), and human cell lines (e.g., GM 1500, SKO-007, RPMI 8226,
and
KR-4). Thus, the present invention also provides a method of generating
polyclonal or
102
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
monoclonal human antibodies against polypeptides of the invention or fragments
thereof,
comprising EBV-transformation of human B cells.
[0251] Accordingly, the present invention provides methods of generating
monoclonal
antibodies as well as antibodies produced by the method comprising culturing a
hybridoma
cell secreting an antibody of the invention wherein, preferably, the hybridoma
is generated by
fusing splenocytes isolated from a mouse immunized with an antigen of the
invention with
myeloma cells and then screening the hybridomas resulting from the fusion for
hybridoma
clones that secrete an antibody able to bind a polypeptide of the invention.
[0252] Antibody fragments that recognize specific epitopes may be generated by
known
techniques. For example, Fab and F(ab~2 fragments of the invention may be
produced by
proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain
(to
produce Fab fragments) or pepsin (to produce F(ab~2 fragments). F(ab~2
fragments contain
the variable region, the light chain constant region and the CHl domain of the
heavy chain.
[0253] For example, the antibodies of the present invention can also be
generated using
various phage display methods known in the art. In phage display methods,
functional
antibody domains are displayed on the surface of phage particles which carry
the
polynucleotide sequences encoding them. In a particular, such phage can be
utilized to
display antigen-binding domains expressed from a repertoire or combinatorial
antibody
library (e.g., human or murine). Phage expressing an antigen binding domain
that binds the
antigen of interest can be selected or identified with antigen, e.g., using
labeled antigen or
antigen bound or captured to a solid surface or bead. Phage used in these
methods are
typically filamentous phage including fd and M13 binding domains expressed
from phage
with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused
to either the
phage gene III or gene VIII protein. Examples of phage display methods that
can be used to
make the antibodies of the present invention include those disclosed in
Brinkman et al., J.
Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-
I86
(1995); I~ettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et
al., Gene 187 9-
18 (1997); Burton et al., Advances in Immunology 57:191-280 (1994); PCT
application No.
PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO
92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Patent Nos.
5,698,426;
5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698;
5,427,908;
103
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is
incorporated
herein by reference in its entirety.
[0254] As described in the above references, after phage selection, the
antibody coding
regions from the phage can be isolated and used to generate whole antibodies,
including
human antibodies, or any other desired antigen binding fragment, and expressed
in any
desired host, including mammalian cells, insect cells, plant cells, yeast, and
bacteria, e.g., as
described in detail below. For example, techniques to recombinantly produce
Fab, Fab' and
F(ab~2 fragments can also be employed using methods known in the art such as
those
disclosed in PCT publication WO 92/22324; Mullinax et al., BioTechniques
12(6):864-869
(1992); and Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science
240:1041-1043
(1988) (said references incorporated by reference in their entireties).
[0255] Examples of techniques which can be used to produce single-chain Fvs
and
antibodies include those described in U.S. Patents 4,946,778 and 5,258,498;
Huston et al.,
Methods in Enzymology 203:46-88 (1991); Shu et. al., PNAS 90:7995-7999 (1993);
and
Skerra et al., Science 240:1038-1040 (1988). For some uses, including afz vivo
use of
antibodies in humans and in vitro detection assays, it may be preferable to
use chimeric,
humanized, or human antibodies. A chimeric antibody is a molecule in which
different
portions of the antibody are derived from different animal species, such as
antibodies having
a variable region derived from a murine monoclonal antibody and a human
immunoglobulin
constant region. Methods for producing chimeric antibodies are known in the
art. See e.g.,
Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986);
Gillies et al.,
(1989) J. Immunol. Methods 125:191-202; U.S. Patent Nos. 5,807,715; 4,816,567;
and
4,816397, which are incorporated herein by reference in their entireties.
Humanized
antibodies are antibody molecules from non-human species antibody that binds
the desired
antigen having one or more complementarity determining regions (CDRs) from the
non-
human species and framework regions from a human immunoglobulin molecule.
Often,
framework residues in the human framework regions will be substituted with the
corresponding residue from the CDR donor antibody to alter, preferably
improve, antigen
binding. These framework substitutions are identified by methods well known in
the art, e.g.,
by modeling of the interactions of the CDR and framework residues to identify
framework
residues important for antigen binding and sequence comparison to identify
unusual
framework residues at particular positions. (See, e.g., Queen et al., U.S.
Patent No.
104
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated
herein by
reference in their entireties.) Antibodies can be humanized using a variety of
techniques
known in the art including, for example, CDR-grafting (EP 239,400; PCT
publication WO
91109967; U.S. Patent Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or
resurfacing
(EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991);
Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska, et al.,
PNAS 91:969-973
(1994)), and chain shuffling (U.S. Patent No. 5,565,332).
[0256] Completely human antibodies are particularly desirable for therapeutic
treatment
of human patients. Human antibodies can be made by a variety of methods known
in the art
including phage display methods described above using antibody libraries
derived from
human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and
4,716,111; and
PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO
96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein
by
reference in its entirety.
[0257] Human antibodies can also be produced using transgenic mice which are
incapable of expressing functional endogenous immunoglobulins, but which can
express
human immunoglobulin genes. For example, the human heavy and light chain
immunoglobulin gene complexes may be introduced randomly or by homologous
recombination into mouse embryonic stern cells. Alternatively, the human
variable region,
constant region, and diversity region may be introduced into mouse embryonic
stem cells in
addition to the human heavy and light chain genes. The mouse heavy and light
chain
immunoglobulin genes may be rendered non-functional separately or
simultaneously with the
introduction of human immunoglobulin loci by homologous recombination. In
particular,
homozygous deletion of the JH region prevents endogenous antibody production.
The
modified embryonic stem cells are expanded and microinjected into blastocysts
to produce
chimeric mice. The chimeric mice are then bred to produce homozygous offspring
that
express human antibodies. The transgenic mice are immunized in the normal
fashion with a
selected antigen, e.g., all or a portion of a polypeptide of the invention.
Monoclonal
antibodies directed against the antigen can be obtained from the immunized,
transgenic mice
using conventional hybridoma technology. The human immunoglobulin transgenes
harbored
by the transgenic mice rearrange during B cell differentiation, and
subsequently undergo class
switching and somatic mutation. Thus, using such a technique, it is possible
to produce
105
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of
this technology
for producing human antibodies, see Lonbeig and Huszar (1995, Int. Rev.
Immunol. 13:65-
93). For a detailed discussion of this technology for producing human
antibodies and human
monoclonal antibodies and protocols for producing such antibodies; see, e.g.,
PCT
publications WO 98/24893; WO 96!34096; WO 96/33735; U.S. Patent Nos.
5,413,923;
5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,939,598;
6,075,181;
and 6,114,598, which are incorporated by reference herein in their entirety.
In addition,
companies such as Abgenix, Inc. (Freemont, CA) and Genpharm (San Jose, CA) can
be
engaged to provide human antibodies directed against a selected antigen using
technology
similar to that described above.
[0258] Completely human antibodies which recognize a selected epitope can be
generated using a technique referred to as "guided selection." In this
approach a selected
non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the
selection of a
completely human antibody recognizing the same epitope. (Jespers et aL,
Bio/technology
12:899-903 (1988)).
[0259] Further, antibodies to the polypeptides of the invention can, in turn,
be utilized to
generate anti-idiotype antibodies that "mimic" polypeptides of the invention
using techniques
well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J.
7(5):437-444;
(1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)). For example,
antibodies which
bind to and competitively inhibit polypeptide multimerization and/or binding
of a polypeptide
of the invention to a ligand can be used to generate anti-idiotypes that
"mimic" the
polypeptide multimerization and/or binding domain and, as a consequence, bind
to and
neutralize polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of
such anti-idiotypes can be used in therapeutic regimens to neutralize
polypeptide ligand. For
example, such anti-idiotypic antibodies can be used to bind a polypeptide of
the invention
and/or to bind its ligands/receptors, and thereby activate or block TNFR
mediated inhibition
of apoptosis.
Polynucleotides Encoding Antibodies
[0260] The invention further provides polynucleotides comprising a nucleotide
sequence
encoding an antibody of the invention and fragments thereof. The invention
also
106
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
encompasses polynucleotides that hybridize under stringent or lower stringency
hybridization
conditions, e.g., as defined supra, to polynucleotides that encode an
antibody, preferably, that
specifically binds to a polypeptide of the invention, preferably, an antibody
that binds .to a
polypeptide having the amino acid sequence of SE(~ ID N0:2 or 4.
[0261] The polynucleotides may be obtained, and the nucleotide sequence of the
polynucleotides determined, by any method known in the art. For example, if
the nucleotide
sequence of the antibody is known, a polynucleotide encoding the antibody may
be
assembled from chemically synthesized oligonucleotides (e.g., as described in
I~utmeier et
al., BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of
overlapping
oligonucleotides containing portions of the sequence encoding the antibody,
annealing and
ligation of those oligonucleotides, and than amplification of the ligated
oligonucleotides by
PCR.
[0262] Alternatively, a polynucleotide encoding an antibody may be generated
from
nucleic acid from a suitable source. If a clone containing a nucleic acid
encoding a particular
antibody is not available, but the sequence of the antibody molecule is known,
a nucleic acid
encoding the immunoglobulin may be obtained from a suitable source (e.g., an
antibody
cDNA library, or a cDNA library generated from, or nucleic acid, preferably
poly A+ RNA,
isolated from, any tissue or cells expressing the antibody, such as hybridoma
cells selected to
express an antibody of the invention) by PCR amplification using synthetic
primers
hybridizable to the 3' and 5' ends of the sequence or by cloning using an
oligonucleotide
probe specific for the particular gene sequence to identify, e.g., a cDNA
clone from a cDNA
library that encodes the antibody. Amplified nucleic acids generated by PCR
may then be
cloned into replicable cloning vectors using any method well known in the art.
[0263] Once the nucleotide sequence and corresponding amino acid sequence of
the
antibody is determined, the nucleotide sequence of the antibody may be
manipulated using
methods well known in the art for the manipulation of nucleotide sequences,
e.g.,
recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for
example, the
techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory
Manual, 2d
Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al.,
eds., 1998,
Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both
incorporated by reference herein in their entireties ), to generate antibodies
having a different
107
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
amino acid sequence, for example to create amino acid substitutions,
deletions, and/or
insertions.
[0264] In a specific embodiment, the amino acid sequence of the heavy and/or
light chain
variable domains may be inspected to identify the sequences of the
complementarity
determining regions (CDRs) by methods that are well know in the art, e.g., by
comparison to
known amino acid sequences of other heavy and light chain variable regions to
determine the
regions of sequence hypervariability. Using routine recombinant DNA
techniques, one or
more of the CDRs may be inserted within framework regions, e.g., into human
framework
regions to humanize a non-human antibody, as described supra. The framework
regions may
be naturally occurring or consensus framework regions, and preferably human
framework
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479 (1998) for a
listing of human
framework regions). Preferably, the polynucleotide generated by the
combination of the
framework regions and CDRs encodes an antibody that specifically binds a
polypeptide of
the invention. Preferably, as discussed supra, one or more amino acid
substitutions may be
made within the framework regions, and, preferably, the amino acid
substitutions improve
binding of the antibody to its antigen. Additionally, such methods may be used
to make
amino acid substitutions or deletions of one or more variable region cysteine
residues
participating in an intrachain disulfide bond to generate antibody molecules
lacking one or
more intrachain disulfide bonds. Other alterations to the polynucleotide are
encompassed by
the present invention and within the skill of the art.
[0265] In addition, techniques developed for the production of "chimeric
antibodies"
(Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855; Neuberger et al.,
1984, Nature
312:604-608; Takeda et al., 1985, Nature 314:452-454) by splicing genes from a
mouse
antibody molecule of appropriate antigen specificity together with genes from
a human
antibody molecule of appropriate biological activity can be used. As described
supra, a
chimeric antibody is a molecule in which different portions are derived from
different animal
species, such as those having a variable region derived from a murine mAb and
a human .
immunoglobulin constant region, e.g., humanized antibodies.
[0266] Alternatively, techniques described for the production of single chain
antibodies
(U.S. Patent No. 4,694,778; Bird, 1988, Science 242:423- 42; Huston et al.,
1988, Proc. Natl.
Acad. Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334:544-54) can be
adapted to
produce single chain antibodies. Single chain antibodies are formed by linking
the heavy
108
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
and light chain fragments of the Fv region via an amino acid bridge, resulting
in a single
chain polypeptide. Techniques for the assembly of functional Fv fragments in
E. coli may
also be used (Skerra et al., 1988, Science 242:1038- 1041).
Methods of Producing Antibodies
[0267] The antibodies of the invention can be produced by any method known in
the art
for the synthesis of antibodies, in particular, by chemical synthesis or
preferably, by
recombinant expression techniques. Methods of producing antibodies include,
but are not
limited to, hybridoma technology, EBV transformation, and other methods
discussed herein
as well as through the use recombinant DNA technology, as discussed below.
[0268] Recombinant expression of an antibody of the invention, or fragment,
derivative
or analog thereof, e.g., a heavy or light chain of an antibody of the
invention, requires
construction of an expression vector containing a polynucleotide that encodes
the antibody.
Once a polynucleotide encoding an antibody molecule or a heavy or light chain
of an
antibody, or portion thereof (preferably containing the heavy or light chain
variable domain),
of the invention has been obtained, the vector for the production of the
antibody molecule
may be produced by recombinant DNA technology using techniques well known in
the art.
Thus, methods for preparing a protein by expressing a polynucleotide
containing an antibody
encoding nucleotide sequence are described herein. Methods which are well
known to those
skilled in the art can be used to construct expression vectors containing
antibody coding
sequences and appropriate transcriptional and translational control signals.
These methods _
include, for example, in vitro recombinant DNA techniques, synthetic
techniques, and in
vivo genetic recombination. The invention, thus, provides replicable vectors
comprising'a
nucleotide sequence encoding an antibody molecule of the invention, or a heavy
or light
chain thereof, or a heavy or light chain variable domain, operably linked to a
promoter. Such
vectors may include the nucleotide sequence encoding the constant region of
the antibody
molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036;
and
U.S. Patent No. 5,122,464) and the variable domain of the antibody may be
cloned into such
a vector for expression of the entire heavy or light chain.
[0269] The expression vector is transferred to a host cell by conventional
techniques and
the transfected cells are then cultured by conventional techniques to produce
an antibody of
109 .
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
the invention. Thus, the invention includes host cells containing a
polynucleotide encoding
an antibody of the invention, or a heavy or light chain thereof, operably
linked to a
heterologous promoter. In preferred embodiments for the expression of double-
chained
antibodies, vectors encoding both the heavy and light chains may be co-
expressed in the host
cell for expression of the entire immunoglobulin molecule, as detailed below.
[0270] A variety of host-expression vector systems may be utilized to express
the
antibody molecules of the invention. Such host-expression systems represent
vehicles by
which the coding sequences of interest may be produced and subsequently
purified, but also
represent cells which may, when transformed or transfected with the
appropriate nucleotide
coding sequences, express an antibody molecule of the invention in situ. These
include but
are not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors
containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia)
transformed with
recombinant yeast expression vectors containing antibody coding sequences;
insect cell
systems infected with recombinant virus expression vectors (e.g., baculovirus)
containing
antibody coding sequences; plant cell systems infected with recombinant virus
expression
vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed
with recombinant plasmid expression vectors (e.g., Ti plasmid) containing
antibody coding
sequences; or mammalian cell systems (e.g., COS, CIIO, BHK, 293, 3T3 cells)
harboring
recombinant expression constructs containing promoters derived from the genome
of
mammalian cells (e.g., metallothionein promoter) or from mammalian viruses
(e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably,
bacterial cells such
as Escherichia coli, and more preferably, eukaryotic cells, especially for the
expression of
whole recombinant antibody molecule, are used for the expression of a
recombinant antibody
molecule. For example, mammalian cells such as Chinese hamster ovary cells
(CHO), in
conjunction with a vector such as the major intermediate early gene promoter
element from
human cytomegalovirus is an effective expression system for antibodies
(Foecking et al.,
1986, Gene 45:101; Cockett et al., 1990, Bio/Technology 8:2).
[0271] In bacterial systems, a number of expression vectors may be
advantageously
selected depending upon the use intended for the antibody molecule being
expressed. For
example, when a large quantity of such a protein is to be produced, for the
generation of
pharmaceutical compositions of an antibody molecule, vectors which direct the
expression of
110
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
high levels of fusion protein products that are readily purified may be
desirable. Such vectors
include, but are not limited, to the E. coli expression vector pUR278 (Rather
et al., 1983,
EMBO J. 2:1791), in which the antibody coding sequence may be ligated
individually into
the vector in frame with the lac Z coding region so that a fusion protein is
produced; pIN
vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke &
Schuster,
1989, J. Biol. Chem. 24:5503-5509); and the Iike. pGEX vectors may also be
used to express
foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
In general,
such fusion proteins are soluble and can easily be purified from Iysed cells
by adsorption and
binding to a matrix glutathione-agarose beads followed by elution in the
presence of free
glutathione. The pGEX vectors are designed to include thrombin or factor Xa
protease
cleavage sites so that the cloned target gene product can be released from the
GST moiety.
[0272] In an insect system, Autographa californica nuclear polyhedrosis virus
(AcNPV)
is used as a vector to express foreign genes. The virus grows in Spodoptera
frugiperda cells.
The antibody coding sequence may be cloned individually into non-essential
regions (for
example the polyhedrin gene) of the virus and placed under control of an AcNPV
promoter
(for example the polyhedrin promoter).
[0273] In mammalian host cells, a number of viral-based expression systems may
be
utilized. In cases where an adenovirus is used as an expression vector, the
antibody coding
sequence of interest may be ligated to an adenovirus transcription/translation
control
complex, e.g., the late promoter and tripartite leader sequence. This chimeric
gene may then
be inserted in the adenovirus genome by in vitro or in vivo recombination.
Insertion in a non-
essential region of the viral genome (e.g., region EI or E3) will result in a
recombinant virus
that is viable and capable of expressing the antibody molecule in infected
hosts. (e.g., see
Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81:355-359). Specific
initiation signals
may also be required for efficient translation of inserted antibody coding
sequences. These
signals include the ATG initiation codon and adjacent sequences. Furthermore,
the initiation
codon must be in phase with the reading frame of the desired coding sequence
to ensure
translation of the entire insert. These exogenous translational control
signals and initiation
codons can be of a variety of origins, both natural and synthetic. The
efficiency of expression
may be enhanced by the inclusion of appropriate transcription enhancer
elements,
transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol.
153:51-544).
111
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0274] In addition, a host cell strain may be chosen which modulates the
expression of
the inserted sequences, or modifies and processes the gene product in the
specific fashion
desired. Such modifications (e.g., glycosylation) and processing (e.g.,
cleavage) of protein
products may be important for the function of the protein. Different host
cells have
characteristic and specific mechanisms for the post-translational processing
and modification
of proteins and gene products. Appropriate cell lines or host systems can be
chosen to
ensure the correct modification and processing of the foreign protein
expressed. To this end,
eukaryotic host cells which possess the cellular machinery for proper
processing of the
primary transcript, glycosylation, and phosphorylation of the gene product may
be used.
Such mammalian host cells include but are not limited to CHO, VERY, BHI~,
Hela, COS,
MDCK, 293, 3T3, WI38, and in particular, breast cancer cell lines such as, for
example,
BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such
as, for
example, CRL7030 and Hs578Bst.
[0275] For long-term, high-yield production of recombinant proteins, stable
expression is
preferred. For example, cell lines which stably express the antibody molecule
may be
engineered. Rather than using expression vectors which contain viral origins
of replication,
host cells can be transformed with DNA controlled by appropriate expression
control
elements (e.g., promoter, enhancer, sequences, transcription terminators,
polyadenylation
sites, etc.), and a selectable marker. Following the introduction of the
foreign DNA,
engineered cells may be allowed to grow for 1-2 days in an enriched media, and
then are
switched to a selective media. The selectable marker in the recombinant
plasmid confers
resistance to the selection and allows cells to stably integrate the plasmid
into their
chromosomes and grow to form foci which iri turn can be cloned and expanded
into cell lines.
This method may advantageously be used to engineer cell Iines which express
the antibody
molecule. Such engineered cell Iines may be particularly useful in screening
and evaluation
of compounds that interact directly or indirectly with the antibody molecule.
[0276] A number of selection systems may be used, including but not limited to
the
herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223),
hypoxanthine-
guanine phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc. Natl.
Acad. Sci. USA
48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell
22:817) genes can
be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite
resistance can be
used as the basis of selection for the following genes: dhfr, which confers
resistance to
112
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
methotrexate (Wigler et al., 1980, Natl. Acad. Sci. USA 77:357; O~Iare et al.,
1981, Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic
acid
(Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which
confers resistance
to the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu, 1991,
Biotherapy
3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan,
1993,
Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-
217;
May, 1993, TIB TECH 11(5):155-215); and hygro, which confers resistance to
hygromycin
(Santerre et al., 1984, Gene 30:147). Methods commonly known in the art of
recombinant
DNA technology which can be used are described in Ausubel et al. (eds.), 1993,
Current
Protocols in Molecular Biology, John Wiley & Sons, NY; I~riegler, 1990, Gene
Transfer and
Expression, A Laboratory Manual, Stockton Press, NY; and in Chapters 12 and
13,
Dracopoli et al. (eds), 1994, Current Protocols in Human Genetics, John Wiley
& Sons, NY.;
Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1, which are incorporated by
reference
herein in their entireties.
[0277] The expression levels of an antibody molecule can be increased by
vector
amplification (for a review, see Bebbington and Hentschel, The use of vectors
based on gene
amplification for the expression of cloned genes in mammalian cells in DNA
cloning, VoL3.
(Academic Press, New York, 1987)). When a marker in the vector system
expressing
antibody is amplifiable, increase in the level of inhibitor present in culture
of host cell will
increase the number of copies of the marker gene. Since the amplified region
is associated
with the antibody gene, production of the antibody will also increase (Grouse
et al., 1983,
Mol. Cell. Biol. 3:257).
[0278] Vectors which use glutamine synthase (GS) or DHFR as the selectable
markers
can be amplified in the presence of the drugs methionine sulphoximine or
methotrexate,
respectively. An advantage of glutamine synthase based vectors are the
availabilty of cell
lines (e.g., the murine myeloma cell line, NSO) which are glutamine synthase
negative. It is
also possible to amplify vectors that utilize glutamine synthase selection in
glutamine
synthase expressing cells (e.g., Chinese Hamster Ovary (CHO) cells), however,
by providing
additional inhibitor to prevent the functioning of the endogenous gene. A
glutamine synthase
expression system and components thereof are detailed in PCT publications:
W087/04462;
W086/05807; W089/01036; W089/10404; and W091/06657 which are hereby
incorporated
in their entireties by reference herein. Additionally, glutamine synthase
expression vectors
113
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
can be obtained from Lonza Biologics, Inc. (Portsmouth, NH). Expression and
production of
monoclonal antibodies using a GS expression system in murine myeloma cells is
described in
Bebbington et al., Bioltechfzology 10:169(1992) and in Biblia and Robinson
Biotechzzol.
Prog. 11:1 (1995) which are herein incorporated by reference.
[0279] The host cell may be co-transfected with two expression vectors of the
invention,
the first vector encoding a heavy chain derived polypeptide and the second
vector encoding a
light chain derived polypeptide. The two vectors may contain identical
selectable markers
which enable equal expression of heavy and light chain polypeptides.
Alternatively, a single
vector may be used which encodes both heavy and Iight chain polypeptides. In
such
situations, the light chain should be placed before the heavy chain to avoid
an excess of toxic
free heavy chain (Proudfoot, 1986, Nature 322:52; Kohler, 1980, Proc. Natl.
Acad. Sci. USA
77:2197). The coding sequences for the heavy and light chains may comprise
cDNA or
genomic DNA.
[0280] Once an antibody molecule of the invention has been recombinantly
expressed, it
may be purified by any method known in the art for purification of an
immunoglobulin
molecule, for example, by chromatography (e.g., ion exchange, affinity,
particularly by
affinity for the specific antigen after Protein A, and sizing column
chromatography),
centrifugation, differential solubility, or by any other standard technique
for the purification
of proteins.
Antibody conjugates
[0281] The present invention encompasses antibodies recombinantly fused or
chemically
conjugated (including both covalently and non-covalently conjugations) to a
polypeptide (or
portion thereof, preferably at least 10, 20 or 50 amino acids of the
polypeptide) of the present
invention to generate fusion proteins. The fusion does not necessarily need to
be direct, but
may occur through linker sequences. The antibodies may be specific for
antigens other than
polypeptides (or portion thereof, preferably at least 10, 20 or 50 amino acids
of the
polypeptide) of the present invention. For example, antibodies may be used to
target the
polypeptides of the present invention to particular cell types, either in
vitro or in vivo, by
fusing or conjugating the polypeptides of the present invention to antibodies
specific for
particular cell surface receptors. Antibodies fused or conjugated to the
polypeptides of the
114
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
present invention may also be used in in vitro immunoassays and purification
methods using
methods known in the art. See e.g., Harbor et al., supra, and PCT publication
WO 93/21232;
EP 439,095; Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Patent
5,474,981; Gillies
et al., PNAS 89:1428-1432 (1992); Fell et al., J. Immunol. 146:2446-
2452(1991), which are
incorporated by reference in their entireties.
[0282] The present invention further includes compositions comprising the
polypeptides
of the present invention fused or conjugated to antibody domains other than
the variable
regions. For example, the polypeptides of the present invention may be fused
or conjugated
to an antibody Fc region, or portion thereof. The antibody portion fused to a
polypeptide of
the present invention may comprise the constant region, hinge region, CH1
domain, CH2
domain, and CH3 domain or any combination of whole domains or portions
thereof. The
polypeptides may also be fused or conjugated to the above antibody portions to
form
multimers. For example, Fc portions fused to the polypeptides of the present
invention can
form dimers through disulfide bonding between the Fc portions. Higher
multimeric forms
can be made by fusing the polypeptides to portions of IgA and IgM. Methods for
fusing or
conjugating the polypeptides of the present invention to antibody portions are
known in the
art. See, e.g., U.S. Patent Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053;
5,447,851;
5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570;
Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et
al., J.
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci. USA
89:11337-
11341(1992) (said references incorporated by reference in their entireties).
[0283] As discussed, supra, the polypeptides of the present invention may be
fused or
conjugated to the above antibody portions to increase the in vivo half life of
the polypeptides
or for use in immunoassays using methods known in the art. Further, the
polypeptides of the
present invention may be fused or conjugated to the above antibody portions to
facilitate
purification. One reported example describes chimeric proteins consisting of
the first two
domains of the human CD4-polypeptide and various domains of the constant
regions of the
heavy or light chains of mammalian immunoglobulins. (EP 394,827; Traunecker et
al.,
Nature 331:84-86 (1988). The polypeptides of the present invention fused or
conjugated to
an antibody having disulfide- linked dimeric structures (due to the IgG) may
also be more
efficient in binding and neutralizing other molecules, than the monomeric
secreted protein or
protein fragment alone. (Fountoulakis et al., J. Biochem. 270:3958-3964
(1995)). In many
115
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis,
and thus can
result in, for example, improved pharmacokinetic properties. (EP A 232,262).
Alternatively,
deleting the Fc part after the fusion protein has been expressed, detected,
and purified, would
be desired. For example, the Fc portion may hinder therapy and diagnosis if
the fusion
protein is used as an antigen for immunizations. In drug discovery, for
example, human
proteins, such as hIL-5, have been fused with Fc portions for the puzpose of
high-throughput
screening assays to identify antagonists of hIL-5. (See, D. Bennett et al., J.
Molecular
Recognition 8:52-58 (1995); K. Johanson et al., J. Biol. Chem. 270:9459-9471
(1995)0.
[0284] Moreover, the antibodies or fragments thereof of the present invention
can be
fused to marker sequences, such as a peptide to facilitates their
purification. In preferred
embodiments, the marker amino acid sequence is a hexa-histidine peptide, such
as the tag
provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA,
91311),
among others, many of which are commercially available. As described in Gentz
et al., Proc.
Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides
for
convenient purification of the fusion protein. Other peptide tags useful for
purification
include, but are not limited to, the "HA" tag, which corresponds to an epitope
derived from
the influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and
the "flag" tag.
[0285] The present invention further encompasses antibodies or fragments
thereof
conjugated to a diagnostic or therapeutic agent. The antibodies can be used
diagnostically to,
for example, monitor the development or progression of a tumor as part of a
clinical testing
procedure to, e.g., determine the efficacy of a given treatment regimen.
Detection can be
facilitated by coupling the antibody to a detectable substance. Examples of
detectable
substances include various enzymes, prosthetic groups, fluorescent materials,
luminescent
materials, bioluminescent materials, radioactive materials, positron emitting
metals using
various positron emission tomographies, and nonradioactive paramagnetic metal
ions. See,
for example, U.S. Patent No. 4,741,900 for metal ions which can be conjugated
to antibodies
for use as diagnostics according to the present invention. Examples of
suitable enzymes
include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group complexes include
streptavidin/biotin and avidin/biotin; examples of suitable fluorescent
materials include
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine
116
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent
material includes
luminol; examples of bioluminescent materials include luciferase, luciferin,
and aequorin;
and exam les of suitable radioactive material include iodine lzlh lz3h lzsh
131 la.
p ( n, carbon ( C),
sulfur (3sS), tritium (3H), indium (111In, llzln, 113mIn~ llsmln), technetium
(~~TC,~~j"TC),
thallium (z°1Ti), gallium (68Ga, 67Ga), palladium (lo3Pd), molybdenum
(~~Mo), xenon (133Xe),
fluorine (1sF), ls3Sm~ 177Lu~ ls9Gd~ l4~Pm~ l4oLa~ l7sYb~ 166Ho~ ~o~,~ a7Sc~
la6Re~ IBSRe~ lazPr,
losRh, and ~7Ru.
[0286] Further, an antibody or fragment thereof may be conjugated to a
therapeutic
moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a
therapeutic agent or a
radioactive metal ion, e.g., alpha-emitters such as, for example, 213Bi or
other radioisotopes
such as, for example, lo3Pd, 133Xe~ 131I' 68Ge~ 57C~~ 65zri, 85sr, 32P~ 355
90Y~ ls3sm~ ls3Gd,
l6~Yb, slCr, s4Mn, 7sSe, 113Sn, 9oY, 117Tin, 186Re, 188Re and 166Ho. In
specific embodiments, an
antibody or fragment thereof is attached to macrocyclic chelators useful for
chelating
radiometal ions, including but not limited to, 177Lu, ~°Y, 166Ho, and
ls3Sm, to polypeptides. In
a preferred embodiment, the radiometal ion associated with the macrocyclic
chelators
attached to antibodies of the invention is 111In. In another preferred
embodiment, the
radiometal ion associated with the macrocyclic chelator attached to antibodies
of the
invention is 9°Y. In specific embodiments, the macrocyclic chelator is
1,4,7,10-
tetraazacyclododecane-N,N',N",N"'-tetraacetic acid (DOTA). In other specific
embodiments,
the DOTA is attached to the an antibody of the invention or fragment thereof
via a linker
molecule. Examples of linker molecules useful for conjugating DOTA to a
polypeptide are
commonly known in the art - see, for example, DeNardo et al., Clin Cancer Res.
4(10):2483-
90, 1998; Peterson et al., Bioconjug. Chem. 10(4):553-7, 1999; and Zimmerman
et al, Nucl.
Med. Biol. 26(8):943-50, 1999 which are hereby incorporated by reference in
their entirety.
In addition U.S. Patents 5,652,361 and 5,756,065, which disclose chelating
agents that may
be conjugated to antibodies, and methods for making and using them, are hereby
incorporated
by reference in their entireties.
[0287] A cytotoxin or cytotoxic agent includes any agent that is detrimental
to cells.
Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide,
emetine,
mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin,
doxorubicin,
daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin,
actinomycin D, 1-
117
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine,
propranolol, and
puromycin and analogs or homologs thereof. Therapeutic agents include, but are
not limited
to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine,
cytarabine, 5-
fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa
chlorambucil,
melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and cis- dichlorodiamine
platinum (II)
(DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and
doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin),
bleomycin,
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine and
vinblastine).
[0288] Techniques known in the art may be applied to label polypeptides and
antibodies
(as well as fragments and variants of polypetides and antibodies) of the
invention. Such
techniques include, but are not limited to, the use of bifunctional
conjugating agents (see e.g.,
U.S. Patent Nos. 5,756,065; 5,714,631; 5,696,239; 5,652,361; 5,505,931;
5,489,425;
5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and 5,808,003; the
contents of each
of which are hereby incorporated by reference in its entirety) and direct
coupling reactions
(e.g., Bolton-Hunter and Chloramine-T reaction).
[0289] The conjugates of the invention can be used for modifying a given
biological
response, the therapeutic agent or drug moiety is not to be construed as
limited to classical
chemical therapeutic agents. For example, the drug moiety may be a protein or
polypeptide
possessing a desired biological activity. Such proteins may include, for
example, a toxin
such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein
such as tumor
necrosis factor, a-interferon,13-interferon, nerve growth factor, platelet
derived growth factor,
tissue plasminogen activator, a thrombotic agent or an anti- angiogenic agent,
e.g.,
angiostatin or endostatin; or, biological response modifiers such as, for
example,
lymphokines, interleukin-1 ("IL-1 "), interleukin-2 ("IL-2"), interleukin-6
("IL-6"),
granulocyte macrophase colony stimulating factor ("GM-CSF"), granulocyte
colony
stimulating factor ("G-CSF"), or other growth factors.
[0290] Antibodies may also be attached to solid supports, which are
particularly useful
for immunoassays or purification of the target antigen. Such solid supports
include, but are
not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene,
polyvinyl chloride or
polypropylene.
118
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0291] Techniques for conjugating such therapeutic moiety to antibodies are
well known,
see, e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs
In Cancer
Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56
(Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery",
in Controlled
Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker,
Inc. 1987);
Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review",
in
,,
Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et
al. (eds.), pp.
475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic
Use Of
Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer
Detection
And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and
Thorpe et al.,
"The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev.
62:119-58 (1982).
[0292] Alternatively, an antibody can be conjugated to a second antibody to
form an
antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980,
which is
incorporated herein by reference in its entirety.
[0293] An antibody, with or without a therapeutic moiety conjugated to it,
administered
alone or in combination with cytotoxic factors) andlor cytokine(s) can be used
as a
therapeutic.
Assays For Antibody Binding
[0294] The antibodies of the invention may be assayed for immunospecific
binding by
any method known in the art. The immunoassays which can be used include but
are not
limited to competitive and non-competitive assay systems using techniques such
as western
blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay),
"sandwich"
immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion
precipitin
reactions, immunodiffusion assays, agglutination assays, complement-fixation
assays,
immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to
name
but a few. Such assays are routine and well known in the art (see, e.g.,
Ausubel et al, eds,
1994, Current Protocols in Molecular Biology, Vol. l, John Wiley & Sons, Inc.,
New York,
which is incorporated by reference hereim in its entirety). Exemplary
immunoassays are
described briefly below (but are not intended by way of limitation).
119
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0295] Immunoprecipitation protocols generally comprise lysing a population of
cells in a
lysis buffer such as RIPA buffer (1% NP-40 or Triton X- 100, 1% sodium
deoxycholate,
0.1 % SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH 7.2, 1 % Trasylol)
supplemented
with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium
vanadate), adding the antibody of interest to the cell lysate, incubating for
a period of time
(e.g., 1-4 hours) at 4° C, adding protein A and/or protein G sepharose
beads to the cell lysate,
incubating for about an hour or more at 4° C, washing the beads in
lysis buffer and
resuspending the beads in SDS/sample buffer. The ability of the antibody of
interest to
immunoprecipitate a particular antigen can be assessed by, e.g., western blot
analysis. One
of skill in the art would be knowledgeable as to the parameters that can be
modified to
increase the binding of the antibody to an antigen and decrease the background
(e.g., pre-
clearing the cell lysate with sepharose beads). For further discussion
regarding
immunoprecipitation protocols see, e.g., Ausubel et aI, eds, 1994, Current
Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
[0296] Western blot analysis generally comprises preparing protein samples,
electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20%
SDS-PAGE
depending on the molecular weight of the antigen), transfernng the protein
sample from the
polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon,
blocking the
membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing
the
membrane in washing buffer (e.g., PBS-Tween 20), blocking the membrane with
primary
antibody (the antibody of interest) diluted in blocking buffer, washing the
membrane in
washing buffer, blocking the membrane with a secondary antibody (which
recognizes the
primaiy antibody, e.g., an anti-human antibody) conjugated to an enzymatic
substrate (e.g.,
horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
32P or 125I)
diluted in blocking buffer, washing the membrane in wash buffer, and detecting
the presence
of the antigen. One of skill in the art would be knowledgeable as to the
parameters that can
be modified to increase the signal detected and to reduce the background
noise. For further
discussion regarding western blot protocols see, e.g., Ausubel et al, eds,
1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.x.1.
[0297] ELISAs comprise preparing antigen, coating the well of a 96 well
microtiter plate
with the antigen, adding the antibody of interest conjugated to a detectable
compound such
as an enzymatic substrate (e.g., horseradish peroxidase or alkaline
phosphatase) to the well
I20
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
and incubating for a period of time, and detecting the presence of the
antigen. In ELISAs the
antibody of interest does not have to be conjugated to a detectable compound;
instead, a
second antibody (which recognizes the antibody of interest) conjugated to a
detectable
compound may be added to the well. Further, instead of coating the well with
the antigen,
the antibody may be coated to the well. In this case, a second antibody
conjugated to a
detectable compound may be added following the addition of the antigen of
interest to the
coated well. One of skill in the art would be knowledgeable as to the
parameters that can be
modified to increase the signal detected as well as other variations of ELISAs
known in the
art. For further discussion regarding ELISAs see, e.g., Ausubel et al, eds,
1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
11.2.1.
[0298] The binding affinity of an antibody to an antigen and the off-rate of
an antibody-
antigen interaction can be determined by competitive binding assays. One
example of a
competitive binding assay is a radioimmunoassay comprising the incubation of
labeled
antigen (e.g., 3H or 125I) with the antibody of interest in the presence of
increasing amounts
of unlabeled antigen, and the detection of the antibody bound to the labeled
antigen. The
affinity of he antibody of interest for a particular antigen and the binding
off rates can be
determined from the data by scatchard plot analysis. Competition with a second
antibody
can also be determined using radioimmunoassays. In this case, the antigen is
incubated with
antibody of interest is conjugated to a labeled compound (e.g., 3H or 125I) in
the presence of
increasing amounts of an unlabeled second antibody.
Therapeutic Uses
[0299] The present invention is further directed to antibody-based therapies
which
involve administering antibodies of the invention to an animal, preferably a
mammal, and
most preferably a human, patient for treating one or more of the described
disorders.
Therapeutic compounds of the invention include, but are not limited to,
antibodies of the
invention (including fragments, analogs and derivatives thereof as described
herein) and
nucleic acids encoding antibodies of the invention (including fragments,
analogs and
derivatives thereof as described herein). The antibodies of the invention can
be used to treat
or prevent diseases and disorders associated with aberrant expression and/or
activity of a
polypeptide of the invention, including, but not limited to, diseases and/or
disorders such as
121
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
autoimmune diseases and/or deficiencies, as discussed herein. The treatment
andlor
prevention of diseases and disorders associated with aberrant expression
and/or activity of a
polypeptide of the invention includes, but is not limited to, alleviating
symptoms associated
with those diseases and disorders. Antibodies of the invention may be provided
in
pharmaceutically acceptable compositions as known in the art or as described
herein.
[0300] A summary of the ways in which the antibodies of the present invention
may be
used therapeutically includes binding polynucleotides or polypeptides of the
present
invention locally or systemically in the body or by direct cytotoxicity of the
antibody, e.g. as
mediated by complement (CDC) or by effector cells (ADCC). Some of these
approaches are
described in more detail below. Armed with the teachings provided herein, one
of ordinary
skill in the art will know how to use the antibodies of the present invention
for diagnostic,
monitoring or therapeutic purposes without undue experimentation.
[0301] The antibodies of this invention may be advantageously utilized in
combination
with other monoclonal or chimeric antibodies, or with lymphokines or
hematopoietic growth
factors (such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to
increase the number
or activity of effector cells which interact with the antibodies.
[0302] The antibodies of the invention may be administered alone or in
combination with
other types of treatments (e.g., radiation therapy, chemotherapy, hormonal
therapy,
immunotherapy, anti-retroviral agents, and anti-tumor agents). Generally,
administration of
products of a species origin or species reactivity (in the case of antibodies)
that is the same
species as that of the patient is preferred. Thus, in a preferred embodiment,
human
antibodies, fragments derivatives, analogs, or nucleic acids, are administered
to a human
patient for therapy or prophylaxis.
[0303] It is preferred to use high affinity and/or potent in vivo inhibiting
and/or
neutralizing antibodies against polypeptides or polynucleotides of the present
invention,
fragments or regions thereof, for both immunoassays directed to and therapy of
disorders
related to polynucleotides or polypeptides, including fragments thereof, of
the present
invention. Such antibodies, fragments, or regions, will preferably have an
affinity for
polynucleotides or polypeptides, including fragments thereof. Preferred
binding affinities
include those with a dissociation constant or I~d less than 5 X 10-6 M, 10-6
M, 5 X 10-7 M,
10-7 M, 5 X 10-8 M, 10-8 M, 5 X 10-9 M, 10-9 M, 5 X 10-10 M, 10-10 M, 5 X 10-
11 M, 10-
122
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
11 M, 5 X 10-12 M, 10-12 M, 5 X 10-13 M, 10- 13 M, 5 X 10-14 M, 10-14 M, 5 X
10-15 M,
and 10-15 M.
Gene Therapy
[0304] In a specific embodiment, nucleic acids comprising sequences encoding
antibodies or functional derivatives thereof, are administered to treat,
inhibit or prevent a
disease or disorder associated with aberrant expression and/or activity of a
polypeptide of the
invention, by way of gene therapy. Gene therapy refers to therapy performed by
the
administration to a subject of an expressed or expressible nucleic acid. In
this embodiment of
the invention, the nucleic acids produce their encoded protein that mediates a
therapeutic
effect.
[0305] Any of the methods for gene therapy available in the art can be used
according to
the present invention. Exemplary methods are described below.
[0306] For general reviews of the methods of gene therapy, see Goldspiel et
al., 1993,
Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev,
1993,
Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932;
and
Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIBTECH
11(5):155-215). Methods commonly known in the art of recombinant DNA
technology which
can be used are described in Ausubel et al. (eds.), 1993, Current Protocols in
Molecular
Biology, John Wiley & Sons, NY; and Kriegler, 1990, Gene Transfer and
Expression, A
Laboratory Manual, Stockton Press, NY.
[0307] In a preferred aspect, the compound comprises nucleic acid sequences
encoding an
antibody, said nucleic acid sequences being part of expression vectors that
express the
antibody or fragments or chimeric proteins or heavy or light chains thereof in
a suitable host.
In particular, such nucleic acid sequences have promoters operably linked to
the antibody
coding region, said promoter being inducible or constitutive, and, optionally,
tissue- specific.
In another particular embodiment, nucleic acid molecules are used in which the
antibody
coding sequences and any other desired sequences are flanked by regions that
promote
homologous recombination at a desired site in the genome, thus providing for
intrachromosomal expression of the antibody nucleic acids (Koller and
Smithies, 1989, Proc.
Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al., 1989, Nature 342:435-438).
In specific
123
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
embodiments, the expressed antibody molecule is a single chain antibody;
alternatively, the
nucleic acid sequences include sequences encoding both the heavy and light
chains, or
fragments thereof, of the antibody.
[0308] Delivery of the nucleic acids into a patient may be either direct, in
which case the
patient is directly exposed to the nucleic acid or nucleic acid- carrying
vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in vitro, then
transplanted into
the patient. These two approaches are known, respectively, as in vivo or ex
vivo gene
therapy.
[0309] In a specific embodiment, the nucleic acid sequences are directly
administered in
vivo, where it is expressed to produce the encoded product. This can be
accomplished by
any of numerous methods known in the art, e.g., by constructing them as part
of an
appropriate nucleic acid expression vector and administering it so that they
become
intracellular, e.g., by infection using defective or attenuated retrovirals or
other viral vectors
(see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by
use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating
with lipids or
cell-surface receptors or transfecting agents, encapsulation in liposomes,
microparticles, or
microcapsules, or by administering them in linkage to a peptide which is known
to enter the
nucleus, by administering it in linkage to a ligand subject to receptor-
mediated endocytosis
(see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432) (which can be used
to target
cell types specifically expressing the receptors), etc. In another embodiment,
nucleic acid-
ligand complexes can be formed in which the ligand comprises a fusogenic viral
peptide to
disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation.
In yet another
embodiment, the nucleic acid can be targeted in vivo for cell specific uptake
and expression,
by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180
dated April 16,
1992 (Wu et al.); WO 92/22635 dated December 23, 1992 (Wilson et al.);
W092120316
dated November 26, 1992 (Findeis et al.); W093/14188 dated July 22, 1993
(Clarke et al.),
WO 93/20221 dated October 14, 1993 (Young)). Alternatively, the nucleic acid
can be
introduced intracellularly and incorporated within host cell DNA for
expression, by
homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci.
USA
86:8932-8935; Zijlstra et al., 1989, Nature 342:435-438).
[0310] In a specific embodiment, viral vectors that contains nucleic acid
sequences
encoding an antibody of the invention are used. For example, a retroviraI
vector can be used
124
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
(see Miller et al., 1993, Meth. Enzymol. 217:581-599). These retroviral
vectors have been to
delete retroviral sequences that are not necessary for packaging of the viral
genome and
integration into host cell DNA. The nucleic acid sequences encoding the
antibody to be used
in gene therapy are cloned into one or more vectors, which facilitates
delivery of the gene
into a patient. More detail about retroviral vectors can be found in Boesen et
al., 1994,
Biotherapy 6:291-302, which describes the use of a retroviral vector to
deliver the mdrl gene
to hematopoietic stem cells in order to make the stem cells more resistant to
chemotherapy.
Other references illustrating the use of retroviral vectors in gene therapy
are: Clowes et al.,
1994, J. Clin. Invest. 93:644-651; Kiem et al., 1994, Blood 83:1467-1473;
Salmons and
Gunzberg, 1993, Human Gene Therapy 4:129-141; and Grossman and Wilson, 1993,
Curr.
Opin. in Genetics and Devel. 3:110-114.
[0311] Adenoviruses are other viral vectors that can be used in gene therapy.
Adenoviruses are especially attractive vehicles for delivering genes to
respiratory epithelia.
Adenoviruses naturally infect respiratory epithelia where they cause a mild
disease. Other
targets for adenovirus-based delivery systems are Liver, the central nervous
system,
endothelial cells, and muscle. Adenoviruses have the advantage of being
capable of infecting
non-dividing cells. Kozarsky and Wilson, 1993, Current Opinion in Genetics and
Development 3:499-503 present a review of adenovirus-based gene therapy. Bout
et al.,
1994, Human Gene Therapy 5:3-10 demonstrated the use of adenovirus vectors to
transfer
genes to the respiratory epithelia of rhesus monkeys. Other instances of the
use of
adenoviruses in gene therapy can be found in Rosenfeld et aL, 1991, Science
252:431-434;
Rosenfeld et al., 1992, Cell 68:143- 155; Mastrangeli et al., 1993, J. Clin.
Invest. 91:225-234;
PCT Publication W094/12649; and Wang, et al., 1995, Gene Therapy 2:775-783. In
a
preferred embodiment, adenovirus vectors are used.
[0312] Adeno-associated virus (AAV) has also been proposed for use in gene
therapy
(Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; U.S. Patent No.
5,436,146).
[0313] Another approach to gene therapy involves transferring a gene to cells
in tissue
culture by such methods as electroporation, Iipofection, calcium phosphate
mediated
transfection, or viral infection. Usually, the method of transfer includes the
transfer of a
selectable marker to the cells. The cells are then placed under selection to
isolate those cells
that have taken up and are expressing the transferred gene. Those cells are
then delivered to a
patient.
125
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0314] In this embodiment, the nucleic acid is introduced into a cell prior to
administration in vivo of the resulting recombinant cell. Such introduction
can be carried out
by any method known in the art, including but not limited to transfection,
electroporation,
microinjection, infection with a viral or bacteriophage vector containing the
nucleic acid
sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated
gene
transfer, spheroplast fusion, etc. Numerous techniques are known in the art
for the
introduction of foreign genes into cells (see, e.g., Loeffler and Behr, 1993,
Meth. Enzymol.
217:599-618; Cohen et al., 1993, Meth. Enzymol. 217:618-644; Cline, 1985,
Pharmac. Ther.
29:69-92) and may be used in accordance with the present invention, provided
that the
necessary developmental and physiological functions of the recipient cells are
not disrupted.
The technique should provide for the stable transfer of the nucleic acid to
the cell, so that the
nucleic acid is expressible by the cell and preferably heritable and
expressible by its cell
progeny.
[0315] The resulting recombinant cells can be delivered to a patient by
various methods
known in the art. Recombinant blood cells (e.g., hematopoietic stem or
progenitor cells) are
preferably administered intravenously. The amount of cells envisioned for use
depends on
the desired effect, patient state, etc., and can be determined by one skilled
in the art.
[0316] Cells into which a nucleic acid can be introduced for purposes of gene
therapy
encompass any desired, available cell type, and include but are not limited to
epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes;
blood cells such as
Tlymphocytes, Blymphocytes, monocytes, macrophages, neutrophils, eosinophils,
megakaryocytes, granulocytes; various stem or progenitor cells, in particular
hematopoietic
stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord
blood,
peripheral blood, fetal liver, etc.
[0317] In a preferred embodiment, the cell used for gene therapy is autologous
to the
patient.
[0318] In an embodiment in which recombinant cells are used in gene therapy,
nucleic
acid sequences encoding an antibody are introduced into the cells such that
they are
expressible by the cells or their progeny, and the recombinant cells are then
administered in
vivo for therapeutic effect. In a specific embodiment, stem or progenitor
cells are used. Any
stem andlor progenitor cells which can be isolated and maintained in vitro can
potentially be
used in accordance with this embodiment of the present invention (see e.g. PCT
Publication
126
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
WO 94/08598, dated April 28, 1994; Stemple and Anderson, 1992, Cell 71:973-
985;
Rheinwald, 1980, Meth. Cell Bio. 21A:229; and Pittellcow and Scott, 1986, Mayo
Clinic
Proc. 61:771 ).
[0319] Iri a specific embodiment, the nucleic acid to be introduced for
purposes of gene
therapy comprises an inducible promoter operably linked to the coding region,
such that
expression of the nucleic acid is controllable by controlling the presence or
absence of the
appropriate inducer of transcription.
Demonstration of Therapeutic or Prophylactic Activity
[0320] The compounds or pharmaceutical compositions of the invention are
preferably
tested in vitro, and then in vivo for the desired therapeutic or prophylactic
activity, prior to
use in humans. For example, in vitro assays to demonstrate the therapeutic or
prophylactic
utility of a compound or pharmaceutical composition include, the effect of a
compound on a
cell line or a patient tissue sample. The effect of the compound or
composition on the cell
line and/or tissue sample can be determined utilizing techniques known to
those of skill in the
art including, but not limited to, rosette formation assays and cell lysis
assays. In accordance
with the invention, in vitro assays which can be used to determine whether
administration of
a specific compound is indicated, include in vitro cell culture assays in
which a patient tissue
sample is grown in culture, and exposed to or otherwise administered a
compound, and the
effect of such compound upon the tissue sample is observed.
Therapeutie/Prophylactic Administration and Composition
[0321] The invention provides methods of treatment, inhibition and prophylaxis
by
administration to a subject of an effective amount of a compound or
pharmaceutical
composition of the invention, preferably an antibody of the invention. In a
preferred aspect,
the compound is substantially purified (e.g., substantially free from
substances that limit its
effect or produce undesired side-effects). The subject is preferably an
animal, including but
not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc.,
and is preferably
a mammal, and most preferably human.
[0322] Formulations and methods of administration that can be employed when
the
compound comprises a nucleic acid or an immunoglobulin are described above;
additional
127
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
appropriate formulations and routes of administration can be selected from
among those
described herein below.
[0323] Various delivery systems are known and can be used to administer a
compound of
the invention, e.g., encapsulation in liposomes, microparticles,
microcapsules, recombinant
cells capable of expressing the compound, receptor-mediated endocytosis (see,
e.g., Wu and
Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of a nucleic acid as
part of a
retroviral or other vector, etc. Methods of introduction include but are not
limited to
intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous,
intranasal, epidural,
and oral routes. The compounds or compositions may be administered by any
convenient
route, for example by infusion or bolus injection, by absorption through
epithelial or
mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.)
and may be
administered together with other biologically active agents. Administration
can be systemic
or local. In addition, it may be desirable to introduce the pharmaceutical
compounds or
compositions of the invention into the central nervous system by any suitable
route,
including intraventricular and intrathecal injection; intraventricular
injection may be
facilitated by an intraventricular catheter, for example, attached to a
reservoir, such as an
Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use
of an
inhaler or nebulizer, and formulation with an aerosolizing agent.
[0324] In a specific embodiment, it may be desirable to administer the
pharmaceutical
compounds or compositions of the invention locally to the area in need of
treatment; this
may be achieved by, for example, and not by way of limitation, local infusion
during surgery,
topical application, e.g., in conjunction with a wound dressing after surgery,
by injection, by
means of a catheter, by means of a suppository, or by means of an implant,
said implant
being of a porous, non-porous, or gelatinous material, including membranes,
such as sialastic
membranes, or fibers. Preferably, when administering a protein, including an
antibody, of
the invention, care must be taken to use materials to which the protein does
not absorb.
[0325] In another embodiment, the compound or composition can be delivered in
a
vesicle, in particular a liposorrie (see Langer,1990, Science 249:1527-1533;
Treat et al., in
Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler
(eds.), Liss, New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 317-
327; see
generally ibid.)
128
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0326] In yet another embodiment, the compound or composition can be delivered
in a
controlled release system. In one embodiment, a pump may be used (see Langer,
supra;
Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980,
Surgery 88:507;
Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment,
polymeric materials
can be used (see Medical Applications of Controlled Release, Langer and Wise
(eds.), CRC
Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug
Product Design and
Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and
Peppas, J.,
1983, Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985,
Science
228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989,
J.Neurosurg.
71:105). In yet another embodiment, a controlled release system can be placed
in proximity
of the therapeutic target, i.e., the brain, thus requiring only a fraction of
the systemic dose
(see, e.g., Goodson, in Medical Applications of Controlled Release, supra,
vol. 2, pp. 115-
138 (1984)).
[0327] Other controlled release systems are discussed in the review by Langer
(1990,
Science 249:1527-1533).
[0328] In a specific embodiment where the compound of the invention is a
nucleic acid
encoding a protein, the nucleic acid can be administered in vivo to promote
expression of its
encoded protein, by constructing it as part of an appropriate nucleic acid
expression vector
and administering it so that it becomes intracellular, e.g., by use of a
retroviral vector (see
U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle
bombardment
(e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface
receptors or
transfecting agents, or by administering it in linkage to a homeobox- like
peptide which is
known to enter the nucleus (see e.g., Joliot et al., 1991, Proc. Natl. Acad.
Sci. USA 88:1864-
1868), etc. Alternatively, a nucleic acid can be introduced intracellularly
and incorporated
within host cell DNA for expression, by homologous recombination.
[0329] The present invention also provides pharmaceutical compositions. Such
compositions comprise a therapeutically effective amount of a compound, and a
pharmaceutically acceptable carrier. In a specific embodiment, the term
"pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or a state
government or
listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for
use in
animals, and more particularly in humans. The term "carrier" refers to a
diluent, adjuvant,
excipient, or vehicle with which the therapeutic is administered. Such
pharmaceutical
129
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
carriers can be sterile liquids, such as water and oils, including those of
petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil,
sesame oil and the
like. Water is a preferred carrier when the pharmaceutical composition is
administered
intravenously. Saline solutions and aqueous dextrose and glycerol solutions
can also be
employed as liquid carriers, particularly for injectable solutions. Suitable
pharmaceutical
excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice,
flour, chalk, silica gel,
sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim
milk, glycerol,
propylene, glycol, water, ethanol and the like. The composition, if desired,
can also contain
minor amounts of wetting or emulsifying agents, or pH buffering agents. These
compositions can take the form of solutions, suspensions, emulsion, tablets,
pills, capsules,
powders, sustained-release formulations and the like. The composition can be
formulated as
a suppository, with traditional binders and carriers such as triglycerides.
Oral formulation
can include standard carriers such as pharmaceutical grades of mannitol,
lactose, starch,
magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
Examples of
suitable pharmaceutical Garners are described in "Remington's Pharmaceutical
Sciences" by
E.W. Martin. Such compositions will contain a therapeutically effective amount
of the
compound, preferably in purified form, together with a suitable amount of
carrier so as to
provide the form for proper administration to the patient. The formulation
should suit the
mode of administration.
[0330] In a preferred embodiment, the composition is formulated in accordance
with
routine procedures as a pharmaceutical composition adapted for intravenous
administration
to human beings. Typically, compositions for intravenous administration are
solutions in
sterile isotonic aqueous buffer. Where necessary, the composition may also
include a
solubilizing agent and a local anesthetic such as lignocaine to ease pain at
the site of the
injection. Generally, the ingredients are supplied either separately or mixed
together in unit
dosage form, for example, as a dry lyophilized powder or water free
concentrate in a
hermetically sealed container such as an ampoule or sachette indicating the
quantity of active
agent. Where the composition is to be administered by infusion, it can be
dispensed with an
infusion bottle containing sterile pharmaceutical grade water or saline. Where
the
composition is administered by injection, an ampoule of sterile water for
injection or saline
can be provided so that the ingredients may be mixed prior to administration.
130
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0331] The compounds of the invention can be formulated as neutral or salt
forms.
Pharmaceutically acceptable salts include those formed with anions such as
those derived
from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those
formed with
cations such as those derived from sodium, potassium, ammonium, calcium,
ferric
hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine,
procaine, etc.
[0332] The amount of the compound of the invention which will be effective in
the
treatment, inhibition and prevention of a disease or disorder associated with
aberrant
expression and/or activity of a polypeptide of the invention can be determined
by standard
clinical techniques. In addition, in vitro assays may optionally be employed
to help identify
optimal dosage ranges. The precise dose to be employed in the formulation will
also depend
on the route of administration, and the seriousness of the disease or
disorder, and should be
decided according to the judgment of the practitioner and each patient's
circumstances.
Effective doses may be extrapolated from dose-response curves derived from in
vitro or
animal model test systems.
[0333] For antibodies, the dosage administered to a patient is typically 0.1
mg/kg to 100
mglkg of the patient's body weight. Preferably, the dosage administered to a
patient is
between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10
mg/kg of the patient's body weight. Generally, human antibodies have a longer
half life
within the human body than antibodies from other species due to the immune
response to the
foreign polypeptides. Thus, lower dosages of human antibodies and less
frequent
administration is often possible. Further, the dosage and frequency of
administration of
antibodies of the invention may be reduced by enhancing uptake and tissue
penetration (e.g.,
into the brain) of the antibodies by modifications such as, for example,
lipidation.
[0334] The invention also provides a pharmaceutical pack or kit comprising one
or more
containers filled with one or more of the ingredients of the pharmaceutical
compositions of
the invention. Optionally associated with such containers) can be a notice in
the form
prescribed by a governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects approval by the
agency of
manufacture, use or sale for human administration.
Diagnosis and Imaging
131
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0335] Labeled antibodies, and derivatives and analogs thereof, which
specifically bind to
a polypeptide of interest can be used for diagnostic purposes to detect,
diagnose, or monitor
diseases and/or disorders associated with the aberrant expression and/or
activity of a
polypeptide of the invention. The invention provides for the detection of
aberrant expression
of a polypeptide of interest, comprising (a) assaying the expression of the
polypeptide of
interest in cells or body fluid of an individual using one or more antibodies
specific to the
polypeptide interest and (b) comparing the level of gene expression with a
standard gene
expression level, whereby an increase or decrease in the assayed polypeptide
gene expression
level compared to the standard expression level is indicative of aberrant
expression.
[0336] The invention provides a diagnostic assay for diagnosising a disorder,
comprising
(a) assaying the expression of the polypeptide of interest in cells or body
fluid of an
individual using one or more antibodies specific to the polypeptide interest
and (b) comparing
the level of gene expression with a standard gene expression level, whereby an
increase or
decrease in the assayed polypeptide gene expression level compared to the
standard
expression level is indicative of a particular disorder. With respect to
cancer, the presence of
a relatively..high amount of transcript in biopsied tissue from an individual
may indicate a
predisposition for the development of the disease, or may provide a means for
detecting the
disease prior to the appearance of actual clinical symptoms. A moxe definitive
diagnosis of
this type may allow health professionals to employ preventative measures or
aggressive
treatment earlier thereby preventing the development or further progression of
the cancer.
[0337] Assaying TR6-alpha and/or TR6-beta polypeptide levels in a biological
sample
can occur using antibody-based techniques. Antibodies of the invention can be
used to assay
protein levels in a biological sample using classical immunohistological
methods known to
those of skill in the art (e.g., see Jalkanen, M., et al., J. Cell. Biol.
101:976-985 (1985);
Jalkanen, M., et al., J. Cell . Biol. 105:3087-3096 (1987)). Other antibody-
based methods
useful for detecting protein gene expression include immunoassays, such as the
enzyme
linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable
antibody
assay labels are known in the art and include enzyme labels, such as, glucose
oxidase, and
radioisotopes, such as iodine ('3'I, '25h Izsh '2'I), carbon ('4C), sulfur
(35S), tritium (3H), indium
(115mIn' n3mln, "ZIn, "'In), and technetium (99Tc, 99mTC), thallium
(z°'Ti), gallium (6gGa, 6'Ga),
palladium ('°3Pd), molybdenum (99Mo), xenon ('33Xe), fluorine ('$F),
'S3Sm, "'Lu, 'S9Gd, '49Pm,
132
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
iaoLa~ nsYb~ 166H0' ~oy~ a~Sc~ ls~Re, '$$Re, '~ZPr, '°sRh, 9'Ru;
luminescent labels, such as luminol;
and fluorescent labels, such as fluorescein and rhodamine, and biotin.
[0338] Techniques known in the art may be applied to label antibodies of the
invention.
Such techniques include, but are not limited to, the use of bifunctional
conjugating agents
(see e.g., U.S. Patent Nos. 5,756,065; 5,714,631; 5,696,239; 5,652,361;
5,505,931;
5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and
5,808,003; the
contents of each of which are hereby incorporated by reference in its
entirety).
[0339] One aspect of the invention is the detection and diagnosis of a disease
or disorder
associated with aberrant expression of a polypeptide of the interest in an
animal, preferably a
mammal and most preferably a human. In one embodiment, diagnosis comprises: a)
administering (for example, parenterally, subcutaneously, or
intraperitoneally) to a subject an.
effective amount of a labeled molecule which specifically binds to the
polypeptide of
interest; b) waiting for a time interval following the administering for
permitting the labeled
molecule to preferentially concentrate at sites in the subject where the
polypeptide is
expressed (and for unbound labeled molecule to be cleared to background
level); c)
determining background level; and d) detecting the labeled molecule in the
subject, such that
detection of labeled molecule above the background level indicates that the
subject has a
particular disease or disorder associated with aberrant expression of the
polypeptide of
interest. Background level can be determined by various methods including,
comparing the
amount of labeled molecule detected to a standard value previously determined
for a
particular system.
[0340] It will be understood in the art that the size of the subject and the
imaging system
used will determine the quantity of imaging moiety needed to produce
diagnostic images. In
the case of a radioisotope moiety, for a human subject, the quantity of
radioactivity injected
will normally range from about 5 to 20 millicuries of 99mTc. The labeled
antibody or
antibody fragment will then preferentially accumulate at the location of cells
which contain
the specific protein. In vivo tumor imaging is described in S.W. Burchiel et
al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments."
(Chapter 13
in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B.
A.
Rhodes, eds., Masson Publishing Inc. (1982).
[0341] Depending on several variables, including the type of Iabe1 used and
the mode of
administration, the time interval following the administration for permitting
the labeled
133
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
molecule to preferentially concentrate at sites in the subject and for unbound
labeled
molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours
or 6 to 12 hours.
In another embodiment the time interval following administration is 5 to 20
days or 5 to 10
days.
[0342] In an embodiment, monitoring of the disease or disorder is carried out
by
repeating the method for diagnosing the disease or disease, for example, one
month after
initial diagnosis, six months after initial diagnosis, one year after initial
diagnosis, etc.
[0343] Presence of the labeled molecule can be detected in the patient using
methods
known in the art for in vivo scanning. These methods depend upon the type of
label used.
Skilled artisans will be able to determine the appropriate method for
detecting a particular
label. Methods and devices that may be used in the diagnostic methods of the
invention
include, but are not limited to, computed tomography (CT), whole body scan
such as position
emission tomography (PET), magnetic resonance imaging (M1ZI), and sonography.
[0344] In a specific embodiment, the molecule is labeled with a radioisotope
and is
detected in the patient using a radiation responsive surgical instrument
(Thurston et al., U.S.
Patent No. 5,441,050). In another embodiment, the molecule is labeled with a
fluorescent
compound and is detected in the patient using a fluorescence responsive
scanning
instrument. In another embodiment, the molecule is labeled with a positron
emitting metal
and is detected in the patent using positron emission-tomography. In yet
another
embodiment, the molecule is labeled with a paramagnetic label and is detected
in a patient
using magnetic resonance imaging (MRI).
Kits
[0345] The present invention provides kits that can be used in the above
methods. In one
embodiment, a kit comprises an antibody of the invention, preferably a
purified antibody, in
one or more containers. In a specific embodiment, the kits of the present
invention contain a
substantially isolated polypeptide comprising an epitope which is specifically
immunoreactive with an antibody included in the kit. Preferably, the kits of
the present
invention further comprise a control antibody which does not react with the
polypeptide of
interest. In another specific embodiment, the kits of the present invention
contain a means
for detecting the binding of an antibody to a polypeptide of interest (e.g.,
the antibody may be
134
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
conjugated to a detectable substrate such as a fluorescent compound, an
enzymatic substrate,
a radioactive compound or a luminescent compound, or a second antibody which
recognizes
the first antibody may be conjugated to a detectable substrate).
[0346] In another specific embodiment of the present invention, the kit is a
diagnostic lcit
for use in screening serum containing antibodies specific against
proliferative and/or
cancerous polynucleotides and polypeptides. Such a kit may include a control
antibody that
does not react with the polypeptide of interest. Such a kit rnay include a
substantially
isolated polypeptide antigen comprising an epitope which is specifically
immunoreactive
with at least one anti-polypeptide antigen antibody. Further, such a kit
includes means for
detecting the binding of said antibody to the antigen (e.g., the antibody may
be conjugated to
a fluorescent compound such as fluorescein or rhodamine which can be detected
by flow
eytometiy). In specific embodiments, the lit may include a recornbinantly
produced or
chemically synthesized polypeptide antigen. The polypeptide antigen of the kit
may also be
attached to a solid support.
[0347] In a more specific embodiment the detecting means of the above-
described kit
includes a solid support to which said polypeptide antigen is attached. Such a
kit may also
include a non-attached reporter-labeled anti-human antibody. In this
embodiment, binding of
the antibody to the polypeptide antigen can be detected by binding of the said
reporter-
labeled antibody.
[0348] In an additional embodiment, the invention includes a diagnostic kit
for use in
screening serum containing antigens of the polypeptide of the invention. The
diagnostic kit
includes a substantially isolated antibody specifically immunoreactive with
polypeptide or
polynucleotide antigens, and means for detecting the binding of the
polynucleotide or
polypeptide antigen to the antibody. In one embodiment, the antibody is
attached to a solid
support. In a specific embodiment, the antibody may be a monoclonal antibody.
The
detecting means of the kit may include a second, labeled monoclonal antibody.
Alternatively, or in addition, the detecting means may include a labeled,
competing antigen.
[0349] In one diagnostic configuration, test serum is reacted with a solid
phase reagent
having a surface-bound antigen obtained by the methods of the present
invention. After
binding with specific antigen antibody to the reagent and removing unbound
serum
components by washing, the reagent is reacted with reporter-labeled anti-human
antibody to
bind reporter to the reagent in proportion to the amount of bound anti-antigen
antibody on the
135
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
solid support. The reagent is again washed to remove unbound labeled antibody,
and the
amount of reporter associated with the reagent is determined. Typically, the
reporter is an
enzyme which is detected by incubating the solid phase in the presence of a
suitable
fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).
[0350] The solid surface reagent in the above assay is prepared by known
techniques for
attaching protein material to solid support material, such as polymeric beads,
dip sticks, 96-
well plate or filter material. These attachment methods generally include non-
specific
adsorption of the protein to the support or covalent attachment of the
protein, typically
through a free amine group, to a chemically reactive group on the solid
support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin
coated plates can
be used in conjunction with biotinylated antigen(s).
[0351] Thus, the invention provides an assay system or kit for carrying out
this diagnostic
method. The kit generally includes a support with surface- bound recombinant
antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound anti-antigen
antibody.
Immune System-Related Disorders
Diagnosis
[0352] The present inventors have discovered that TNFR-6 alpha and TNFR-6 beta
are
expressed in hematopoietic and transformed tissues. For a number of immune
system-related
disorders, substantially altered (increased or decreased) levels of TNFR gene
expression can
be detected in immune system tissue or other cells or bodily fluids (e.g.,
sera and plasma)
taken from an individual having such a disorder, relative to a "standard" TNFR
gene
expression level, that is, the TNFR expression level in immune system tissues
or other cells
or bodily fluids from an individual not having the immune system disorder.
Thus, the
invention provides a diagnostic method useful during diagnosis of an immune
system
disorder, which involves measuring the expression level of the gene encoding
the TNFR
protein in immune system tissue or other cells or body fluid from an
individual and
comparing the measured gene expression level with a standard TNFR gene
expression level,
whereby an increase or decrease in the gene expression level compared to the
standard is
indicative of an immune system disorder.
136
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0353] In particular, it is believed that certain tissues in mammals with
cancer (e.g.,
colon, breast and lung cancers) have elevated copy numbers of TNFR genes
and/or express
significantly elevated levels of the TNFR protein and mRNA encoding the TNFR
when
compared to a corresponding "standard" level. Further, it is believed that
elevated levels of
the TNFR protein can be detected in certain cells or body fluids (e.g., sera
and plasma) from
mammals with such a cancer when compared to sera from mammals of the same
species not
having the cancer.
[0354] Thus, the invention provides a diagnostic method useful during
diagnosis of an
immune system disorder, including cancers which involves measuring the
expression level of
the gene.encoding the TNFR protein in immune system tissue or other cells or
body fluid
from an individual and comparing the measured gene expression level with a
standard TNFR
gene expression level, whereby an increase or decrease in the gene expression
level compared
to the standard is indicative of an immune system disorder.
[0355] Where a diagnosis of a disorder in the immune system including
diagnosis of a
tumor has already been made according to conventional methods, the present
invention is
useful as a prognostic indicator, whereby patients exhibiting depressed gene
expression will
experience a worse clinical outcome relative to patients expressing the gene
at a level nearer
the standard level.
[0356] By "assaying the expression level of the gene encoding a TNFR protein"
is
intended qualitatively or quantitatively measuring or estimating the level of
the TNFR-6a
and/or TNFR-6(3 protein or the level of the mRNA encoding the TNFR-6a and/or
TNFR-6~3
protein in a first biological sample either directly (e.g., by determining or
estimating absolute
protein level or mRNA level) or relatively (e.g., by comparing to the TNFR
protein level or
mRNA level in a second biological sample). Preferably, the TNFR protein level
or mRNA
level in the first biological sample is measured or estimated and compared to
a standard
TNFR protein level or mRNA level, the standard being taken from a second
biological
sample obtained from an individual not having the disorder or being determined
by averaging
levels from a population of individuals not having a disorder of the immune
system. As will
be appreciated in the art, once standard TNFR protein levels or mRNA levels
are known, they
can be used repeatedly as a standard for comparison.
137
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0357] By "biological sample" is intended any biological sample obtained from
an
individual, body fluid, cell line, tissue culture, or other source which
contains TNFR protein
or mRNA. As indicated, biological samples include body fluids (such as sera,
plasma, urine,
synovial fluid and spinal fluid) which contain free extracellular domains) (or
soluble
form(s)) of a TNFR protein, immune system tissue, and other tissue sources
found to express
complete TNFR, mature TNFR, or extracellular domain of a TNFR. Methods for
obtaining
tissue biopsies and body fluids from mammals are well known in the art. Where
the
biological sample is to include mRNA, a tissue biopsy is the preferred source.
[0358] The invention also contemplates the use of a gene of the present
invention for
diagnosing mutations in a TNFR gene. For example, if a mutation is present in
one of the
genes of the present invention, conditions would result from a lack of
production of the
receptor polypeptides of the present invention. Further, mutations which
enhance receptor
polypeptide activity would lead to diseases associated with an over expression
of the receptor
polypeptide, e.g., cancer. Mutations in the genes can be detected by comparing
the sequence
of the defective gene with that of a normal one. Subsequently one can verify
that a mutant
gene is associated with a disease condition or the susceptibility to a disease
condition. That
is, a mutant gene which leads to the underexpression of the receptor
polypeptides of the
present invention would be associated with an inability of TNFR to inhibit Fas
ligand and/or
AIM-II mediated apoptosis, and thereby result in irregular cell proliferation
(e.g., tumor
growth).
[0359] Other immune system disorders which may be diagnosed by the foregoing
assays
include, but are not limited to, hypersensitivity, allergy, infectious
disease, graft-host disease,
Immunodificiency, autoimmune diseases and the like.
[0360] Individuals carrying mutations in the genes of the present invention
may be
detected at the DNA level by a variety of techniques. Nucleic acids used for
diagnosis may
0
be obtained from a patient's cells, such as from blood, urine, saliva and
tissue biopsy among
other tissues. The genomic DNA may be used directly for detection or may be
amplified
enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to
analysis.
RNA or cDNA may also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid of the instant invention can be used to
identify and analyze
mutations in the human genes of the present invention. For example, deletions
and insertions
can be detected by a change in the size of the amplified product in comparison
to the normal
138
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
genotype. Point mutations can be identified by hybridizing amplified DNA to
radiolabeled
RNA or alternatively, radiolabeled antisense DNA sequences of the present
invention.
Perfectly matched sequences can be distinguished from mismatched duplexes by
RNase A
digestion or by differences in melting temperatures. Such a diagnostic would
be particularly
useful for prenatal or even neonatal testing.
[0361] Sequence differences between the reference gene and "mutants" may be
revealed
by the direct DNA sequencing method. In addition, cloned DNA segments may be
used as
probes to detect specific DNA segments. The sensitivity of this method is
greatly enhanced
when combined with PCR. For example, a sequencing primer used with double
stranded
PCR product or a single stranded template molecule generated by a modified PCR
product.
The sequence determination is performed by conventional procedures with
radiolabeled
nucleotides or by automatic sequencing procedures with fluorescent tags.
[0362] Sequence changes at the specific locations may be revealed by nuclease
protection
assays, such as RNase and S 1 protection or the chemical cleavage method (for
example,
Cotton et al., PNAS, 85:4397-4401 (1985)).
[0363] Assaying TNFR protein levels in a biological sample can occur using
antibody-based techniques. For example, TNFR protein expression in tissues can
be studied
with classical immunohistological methods (Jalkanen, M., et al., J. Cell.
Biol. 101: 976-985
(1985); Jalkanen, M., et al., J. Cell . Biol. 105:3087-3096 (1987)). Other
antibody-based
methods useful for detecting TNFR gene expression include immunoassays, such
as the
enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
Suitable
antibody assay labels are known in the art and include enzyme labels, such as,
glucose
oxidase, and radioisotopes, such as iodine ('z5h 12'I), carbon ('4C), sulfur
(355), tritium (3H),
indium ("ZIn), and technetium (99"'Tc), and fluorescent labels, such as
fluorescein and
rhodamine, and biotin.
[0364] In addition to assaying TNFR protein levels in a biological sample
obtained from
an individual, TNFR proteins can also be detected ifz vivo by imaging.
Antibody labels or
markers for in vivo imaging of TNFR proteins include those detectable by X-
radiography,
NMR or ESR. For X-radiography, suitable labels include radioisotopes such as
barium or
cesium, which emit detectable radiation but are not overtly harmful to the
subject. Suitable
markers for NMR and ESR include those with a detectable characteristic spin,
such as
139
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
deuterium, which may be incorporated into the antibody by labeling of
nutrients for the
relevant hybridoma.
[0365] A TNFR-specific antibody or antibody fragment which has been labeled
with an
appropriate detectable imaging moiety , such as a radioisotope (for example,
'3'I, "ZIn, 99"'Tc,
('3'I '25I '23I '2'I) carbon ('4C) sulfur (35S) tritium (3H) indium
("5'°In "3'°In "ZIn "'In) and
> > > > > > > > > > >
technetium (99Tc, 99"'Tc), thallium (Z°'Ti), gallium (68Ga, 6'Ga),
palladium ('°3Pd), molybdenum
(99Mo) xenon ('33Xe) fluorine ('$F) 'S3Sm "'Lu 'S9Gd '49Pm 'ø°La "Syb
I6eHo g°1, a~sc ls6Re
> > > > > > > > > > > > >
'$$Re, '42Pr, '°SRh, 9'Ru), a radio-opaque substance, or a material
detectable by nuclear
magnetic resonance, is introduced (for example, parenterally, subcutaneously
or
intraperitoneally) into the mammal to be examined for immune system disorder.
It will be
understood in the art that the size of the subject and the imaging system used
will determine
the quantity of imaging moiety needed to produce diagnostic images. In the
case of a
radioisotope moiety, for a human subject, the quantity of radioactivity
injected will normally
range from about 5 to 20 millicuries of 99"'Tc. The labeled antibody or
antibody fragment will
then preferentially accumulate at the location of cells which contain TNFR
protein. h2 vivo
tumor imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of
Radiolabeled Antibodies and Their Fragments" (Chapter 13 in Tumor Inaagirag:
The
Radiochemical Detectiofz of Cancer, S.W. Burchiel and B. A. Rhodes, eds.,
Masson
Publishing Inc. (1982)).
Treatment
[0366] The Tumor Necrosis Factor (TNF) family ligands are known to be among
the
most pleiotropic cytokines, inducing a large number of cellular responses,
including
cytotoxicity, anti-viral activity, immunoregulatory activities, and the
transcriptional
regulation of several genes (Goeddel, D.V. et al., "Tumor Necrosis Factors:
Gene Structure
and Biological Activities," Symp. Quant. Biol. 51:597-609 (1986), Cold Spring
Harbor;
Beutler, B., and Cerami, A., Annu. Rev. Biochem. 57:505-518 (1988); Old, L.J.,
Sci. AnT.
258:59-75 (1988); Fiers, W., FEBS Lett. 285:199-224 (1991)). The TNF-family
ligands
induce such various cellular responses by binding to TNF-family receptors.
[0367] TNFR-6 alpha and/or TNFR-6 beta polynucleotides and polypeptides of the
invention may be used in developing treatments for any disorder mediated
(directly or
140
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
indirectly) by defective, or insufficient amounts of TNFR-6 alpha andlor TNFR-
6 beta .
TNFR-6 alpha and/or TNFR-6 beta polypeptides may be administered to a patient
(e.g.,
mammal, preferably human) afflicted with such a disorder. Alternatively, a
gene therapy
approach may be applied to treat such disorders. Disclosure herein of TNFR-6
alpha and/or
T'NFR-6 beta nucleotide sequences permits the detection of defective TNFR-6
alpha and/or
TNFR-6 beta genes, and the replacement thereof with normal TNFR-6 alpha and/or
TNFR-6
beta -encoding genes. Defective genes may be detected in in vitro diagnostic
assays, and by
comparison of a TNFR-6 alpha and/or TNFR-6 beta nucleotide sequence disclosed
herein
with that of a TNFR-6 alpha and/or TNFR-6 beta gene derived frorri a patient
suspected of
harboring a defect in this gene.
[0368] In another embodiment, the polypeptides of the present invention are
used as a
research tool for studying the biological effects that result from inhibiting
Fas ligand/TNFR-6
alpha andlor TNFR-6 beta and/or AIM-II interactions on different cell types.
TNFR-6 alpha
and/or TNFR-6 beta polypeptides also may be employed in ifa vitro assays for
detecting Fas
ligand, AIM-II, or TNFR-6 alpha and/or TNFR-6 beta or the interactions
thereof.
[0369] In another embodiment, a purified TNFR-6 alpha and/or TNFR-6 beta
polypeptide of the invention is used to inhibit binding of Fas ligand and/or
AIM-II to
endogenous cell surface Fas ligand and/or AIM-II receptors. Certain ligands o~
the TNF
family (of which Fas ligand and AIM-II are members) have been reported to bind
to more
than one distinct cell surface receptor protein. AIM-II likewise is believed
to bind multiple
cell surface proteins. By binding Fas ligand and/or AIM-II, soluble TNFR-6
alpha and/or
TNFR-6 beta polypeptides of the present invention may be employed to inhibit
the binding
of Fas ligand and/or AIM-II not only to endogenous TNFR-6 alpha and/or TNFR-6
beta, but
also to Fas ligand and AIM-II receptor proteins that are distinct from TNFR-6
alpha and/or
TNFR-6 beta. Thus, in another embodiment, TNFR-6 alpha and/or TNFR-6 beta is
used to
inhibit a biological activity of Fas ligand and/or AIM-II, in in vitro or in
vivo procedures. By
inhibiting binding of Fas ligand and/or AIM-II to cell surface receptors, TNFR-
6 alpha and/or
TNFR-6 beta polypeptides of the invention also inhibit biological effects that
result from the
binding of Fas ligand and/or AIM-II to endogenous receptors. Various forms of
TNFR-6
alpha and/or TNFR-6 beta may be employed, including, for example, the above-
described
TNFR-6 alpha and/or TNFR-6 beta fragments, derivatives, and variants that are
capable of
141
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
binding Fas ligand and/or AIM-II. In a preferred embodiment, a soluble TNFR-6
alpha and/or
TNFR-6 beta polypeptide of the invention is administered to inhibit a
biological activity of
Fas ligand and/or AIM-II, e.g., to inhibit Fas ligand-mediated and/or AIM-II-
mediated
apoptosis of cells susceptible to such apoptosis.
[0370] In a further embodiment, a TNFR-6 alpha andlor TNFR-6 beta polypeptide
of the
invention is administered to a mammal to treat a Fas ligand-mediated and/or
AIM-
II-mediated disorder. Such Fas ligand-mediated andlor AIM-II-mediated (e.g., a
human)
disorders include conditions caused (directly or indirectly) or exacerbated by
Fas ligand
and/or ATM-II.
[0371] There are numerous autoimmune diseases in which FasL/Fas interactions
play a
role. In patients experiencing GVHD, serum levels of Fast were abnormally high
as was the
number of FasL+ T cells . The CNS plaques from patients with MS have been
shown to
express high levels of Fas and Fast. This is particularly significant since
Fas and Fast
expression is normally absent in the mature CNS. As with NOD mice, patients
with IDDM
have a superabundance of FasL+ T cells associated with their islet cells. As
evidence of
FasL/Fas mediated cell killing, patients with chronic renal failure have been
reported to have
a 50 fold increase in the number of apoptotic nephrons compared to normal.
This has been
ascribed to renal tubule epithelial cell expression of both Fast and Fas,
leading to cellular
fratricide . In the joints of rheumatoid arthritic patients, activated T cells
expressing Fast are
seen in conjunction with Fas expressing chondrocytes. In ulcerative colitis
(UC), Fas
expression is observed on colonic epithelial cells, and Fast on lamina propria
lymphocytes.
This lead to the observation that Fast positive lymphocytes are present only
in the lamina
propria of UC patients with active lesions but not in tissues from inactive UC
patients.
[0372] Two clinical indications in which the role of Fast-mediated killing is
most
apparent are myelodisplastic syndrome (MDS) and the neutropenia associated
with large
granular lymphocyte (LGL) leukemia. In MDS, bone marrow hematopoetic cells
suffer an
abnormally high level of apoptosis, associated with the upregulation of bone
marrow Fas
expression and lymphocyte Fast expression . The neutropenia seen in patients
with LGL
leukemia has been attributed to the high levels of circulating serum Fast.
When leukemic
LGL serum was incubated ifa vitro for 24 hours with normal neutrophils, the
degree of
apoptosis significantly increased above that of cells incubated with normal
serum.
142
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0373] As described in detail in Example 22, below, TNFR6-Fc is a potent
inhibitor
Fast-mediated killing. Thus, the Fast-associated disorders listed above may be
treated
and/or prevented, in accordance with the invention, through administration of
the TNFR6-
containing polypeptides and polynucleotides desribed herein.
[0374] Suitable animal models for examining the effectiveness of TNFR6 in
treating
disease include but are not limited to mouse models of graft versus host
disease (GVI~),
murine allergic encephalomyelitis (EAE), an assay used as a central nervous
system (CNS)
model of multiple sclerosis (MS); non-obese diabetic (NOD) mouse model of
insulin-
dependant diabetes mellitus (IDDM), which is characterized by FasL* T cell
destruction of
islet cells, while Fas NOD mice fail to develop diabetes. NOD mice can also be
used to
model Sjogren's disease, since apoptosis in the salivary and lacrimal glands
of these mice has
been reported. In a mouse model of chronic renal failure, ROP-Os/+ mice
developed
spontaneous tubular atrophy and renal failure correlated with upregulation of
Fas and Fast in
these tissues. The invention encompasses the treatment and prevention of the
human
disesases corresonding to these animal models, through administration of the
TNFR6
polypeptides and polynucleotides of the present invention.
[0375] In addition, TNFR6 binds to LIGHT (TL3), a regulator of T cell funtion.
As
detailed in Example 23, below, TNFR6-Fc can ameliorate the effects of
transplantation,
including the inhibition of transplant or graft rejection and the inhibition
of graft versus host
disease (GVHD). The methods encompass the treatment of graft rejection or GVHD
wherein
the grafted tissue or organ is one or more of a variety of tissues and/or
organs, including, but
not limted to, heart, lung, kidney, liver, pancreas, islet cells, bone marrow,
and skin. Such
methods of preventing Fast-mediated killing or ameliorating the effects of
transplantation
may be carried out, in accordance with the present invention, using TNFR6-
human serum
albumin fusions, in lieu of Fc fusions.
[0376] Cells which express a TNFR polypeptide and have a potent cellular
response to
TNFR-6a and TNFR-6(3 ligands include lymphocytes, endothelial cells,
keratinocytes, and
prostate tissue. By "a cellular response to a TNF-family ligand" is intended
any genotypic,
phenotypic,,and/or morphologic change to a cell, cell line, tissue, tissue
culture or patient that
is induced by a TNF-family ligand. As indicated, such cellular responses
include not only
normal physiological responses to TNF-family ligands, but also diseases
associated with
143
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
increased apoptosis or the inhibition of apoptosis. Additionally, as described
herein, TNFR
polypeptides of the invention bind Fas ligand and AIM-II and consequently
block Fas ligand
and AIM-II mediated apoptosis. Apoptosis-programmed cell death is a
physiological
mechanism involved in the deletion of B and/or T lymphocytes of the immune
system, and its
disregulation can lead to a number of different pathogenic processes (J.C.
Ameisen AIDS
8:1197-1213 (1994); P.H. Kramner et al., Curr. Opin. Immunol. 6:279-289
(1994)).
[0377] Diseases associated with increased cell survival, or the inhibition of
apoptosis,
include cancers (such as follicular lymphomas, carcinomas with p53 mutations,
and hormone-
dependent tumors, including, but not limited to colon cancer, cardiac tumors,
pancreatic
cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal
cancer, testicular
cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma,
osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast
cancer,
prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders
(such as,
multiple sclerosis, Sjogren's syndrome, Grave's disease, Hashimoto's
thyroiditis,
autoimmune diabetes, biliary cirrhosis, Behcet's disease, Crohn's disease,
polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis (e.g.,
proliferative
glomerulonephritis), autoimmune gastritis, autoimmune thrombocytopenic
purpura, and
rheumatoid arthritis) and viral infections (such as herpes viruses, pox
viruses and
adenoviruses), inflammation, graft vs. host disease (acute and/or chronic),
acute graft
rejection, and chronic graft rejection. In preferred embodiments, TNFR
polynucleotides,
polypeptides, and/or antagonists of the invention are used to inhibit growth,
progression,
and/or metastasis of cancers, in particular those listed above.
[0378] Additional diseases or conditions associated with increased cell
survival include,
but are not limited to, progression, and/or metastases of malignancies and
related disorders
such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia,
acute
myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic,
monocytic,
and erythroleukernia)) and chronic leukemias (e.g., chronic myelocytic
(granulocytic)
leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas
(e.g.,
Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's
macroglobulinemia, heavy chain disease, and solid tumors including, but not
limited to,
sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma,
chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma,
144
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma,
Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer,
breast
cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell
carcinoma,
adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma,
papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma,
bronchogenic
carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma,
choriocarcinoma, seminoma,
embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small
cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma,
astrocytoma,
medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma,
acoustic
neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma.
[0379] Diseases associated with increased apoptosis include AIDS;
neurodegenerative
disorders (such as Alzheimer's disease, Parlunson's disease, Amyotrophic
lateral sclerosis,
Retinitis pigmentosa, Cerebellar degeneration and brain tumor or prior
associated disease);
autoimmune disorders (such as, multiple sclerosis, Sjogren's syndrome, Grave's
disease
Hashimoto's thyroiditis, autoimmune diabetes, biliary cirrhosis, Sehcet's
disease, Crohn's
disease, polymyositis, systemic lupus erythematosus, immune-related
glomerulonephritis
(e.g., proliferative glomerulonephritis), autoimmune gastritis,
thrombocytopenic purpura, and
rheumatoid arthritis) myelodysplastic syndromes (such as aplastic anemia),
graft vs. host
disease (acute and/or chronic), ischemic injury (such as ischemic cardiac
injury and that
caused by myocardial infarction, stroke and reperfusion injury), liver injury
or disease (e.g.,
hepatitis related liver injury, cirrhosis, ischemia/reperfusion injury,
cholestosis (bile duct
injury) and liver cancer); toxin-induced liver disease (such as that caused by
alcohol), septic
shock, ulcerative colitis, cachexia and anorexia. In preferred embodiments,
TNFR
polynucleotides, polypeptides and/or agonists are used to treat or prevent the
diseases and
disorders listed above.
[0380] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to treat and/or prevent glomerulonephritis. In a further
embodiment,
TNFR polynucleotides, polypeptides, or agonists of the invention are used to
treat and/or
prevent chronic glomerulonephritis and/or cell/tissue damage (e.g., glomerular
cell death)
and/or medical conditions associated with this disease. In a further
nonexclusive
embodiment, TNFR polynucleotides, polypeptides, or agonists of the invention
are used to
145
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
treat and/or prevent proliferative glomerulonephritis and/or cell/tissue
damage (e.g.,
glomerular cell death) and/or medical conditions associated with this disease.
[0381] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used treat or prevent biliary cirrhosis and/or medical
conditions associated with
this disease.
[0382] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used treat or prevent disease, such as, for example, alcoholic
liver disease
and/or medical conditions associated with this disease (e.g., cirrhosis).
[0383] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to treat and/or prevent graft vs host disease. In a
specific embodiment
TNFR polynucleotides, polypeptides, or agonists of the invention are used to
treat (e.g.,
reduce) or prevent tissue or cell damage or destruction (e.g., lymphoid cell
depletion
associated with graft vs host disease) and/or other medical conditions
associated with this
disease. In another non exclusive specific embodiment, the TNFR
polynucleotides,
polypeptides, or agonists of the invention are used to treat (e.g., reduce)
and/or prevent
diarrhea during graft vs host disease.
(0384] In a specific embodiment, TNFR polynucleotides, polypeptides, and/or
agonists or
antagonists of the invention are used to treat and/or prevent Sjogren's
diesease andlor to
reduce tissuelcell damage or destruction (e.g., damage or destruction of
salivary and/or
lacrimal tissues) and/or other medical conditions associated with this
disease.
[0385] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to treat and/or prevent multiple sclerosis and/or to reduce
tissue damage or
destruction (such as, for example, neurological tissue (e.g., CNS tissue)
damage or
destruction) and/or lesions or other medical conditions associated with this
disease.
[0386] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists,
including antibody and antibody fragments, of the invention are used to treat
andlor prevent
Alzheimer's disease and/or to reduce tissue damage or destruction (e.g.,
damage or
destruction of neurological tissue or cells) and/or medical conditions
associated with this
disease.
(0387] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to treat, prevent Parkinson's disease and/or to reduce
tissue damage or
146
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
destruction (e.g., damage or destruction of neurological tissue or cells, such
as, for example
neuronal cells) and/or medical conditions associated with this disease.
[0388] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used before, during, immediately after, and/or after a stroke to
treat, prevent, or
reduce damage of cells or tissue (such as, for example, neurological tissue)
and/or medical
conditions associated with stroke.
[0389] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to treat, prevent, or reduce ischemic injury (such as, for
example, ischemic
cardiac injury) and/or medical conditions associated with ischemic injury. In
a specific
embodiment, TNFR polynucleotides, polypeptides, or agonists of the invention
are used
before, during, immediately after, and/or after a heart attack to treat,
prevent, or reduce
ischemic cardiac injury.
[0390] In another specific embodiment, TNFR polynucleotides, polypeptides,
andlor
agonists of the invention are used to treat or prevent myelodysplastic
syndromes (MDS)
and/or medical conditions associated with MDS.
[0391] In another specific embodiment, TNFR polynucleotides, polypeptides, or
agonists
of the invention are used to increase circulating blood cell numbers in
patients suffering from
cytopenia, lymphopenia andlor anemia.
[0392] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to treat and/or prevent Hashimoto's thyroiditis and/or to
reduce destruction
or damage of tissue or cells (e.g., thyroid gland) and/or to treat or prevent
medical conditions
associated with this disease.
[0393] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to treat (e.g., reduce) and/or prevent autoimmune gastritis
andlor medical
conditions associated with this disease.
[0394] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to treat and/or prevent ulcerative colitis and/or
cell/tissue damage (e.g.,
ulceration in the colon) and/or medical conditions associated with this
disease.
[0395] In a specific embodiment, TNFR polynucleotides, polypeptides, and/or
agonists or
antagonists of the invention are used to treat and/or prevent rheumatoid
arthritis and/or
medical conditions associated with this disease.
147
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0396] Additionally, a number of cancers secrete Fast which binds Fas positive
T cells
and kills them. Any cancer which expresses Fast could therefor be a target for
treatment by
TNFR and TNFR agonists of the invention. Such cancers include, but are not
limited to,
malignant myeloma, leulcemia and lymphoma.
(0397] Many of the pathologies associated with HIV are mediated by apoptosis,
including
HIV-induced nephropathy and HIV encephalitis. Thus, in additional preferred
embodiments,
TNFR polynucleotides, polypeptides, andJor TNFR agonists of the invention are
used to treat
or prevent AIDS and pathologies associated with AIDS. Another embodiment of
the present
invention is directed to the use of TNFR-6 alpha and/or TNFR-6 beta (e.g., TR6-
alpha-
andlor TR6-beta- Fc or albumin fusion proteins) to reduce Fas ligand and/or
AIM-
II-mediated death of T cells in HIV-infected patients.
[0398] The state of Immunodificiency that defines AIDS is secondary to a
decrease in the
number and function of CD4+ T-lymphocytes. Recent reports estimate the daily
loss of CD4+
T cells to be between 3.5 X 10' and 2 X 109 cells (Wei X., et al., Nature
373:117-122 (1995)).
One cause of CD4+ T cell depletion in the setting of HIV infection is believed
to be HIV-
induced apoptosis (see, for example, Meyaard et al., Science 257:217-219,
(1992); Groux et
al., J Exp. Med., 175:331, (1992); and Oyaizu et al., in Cell Activation afad
Apoptosis in HIV
IfZfection, Andrieu and Lu, Eds., Plenum Press, New York, 1995, pp. 101-114).
Indeed, HIV-
induced apoptotic cell death has been demonstrated not only in vitro but also,
more
importantly, in infected individuals (Ameisen, J.C., AIDS 8:1197-1213 (1994) ;
Finkel, T.H.,
and Banda, N.K., Curr. Opih. Immunol. 6:605-615(1995); Muro-Cacho, C.A. et
al., J.
Immunol. 154:5555-5566 (1995)). Furthermore, apoptosis and CD4+ T-lymphocyte
depletion
is tightly correlated in different animal models of AIDS (Brunner, T., et al.,
Nature 373:441-
444 (1995); Gougeon, M.L., et al., AIDS Res. Hum. Retroviruses 9:553-563
(1993)) and,
apoptosis is not observed in those animal models in which viral replication
does not result in
AIDS (Gougeon, M.L. et al., AIDS Res. Hufo. Retroviruses 9:553-563 (1993)).
Further data
indicates that uninfected but primed or activated T lymphocytes from HIV-
infected
individuals undergo apoptosis after encountering the Fas Ligand. Using
monocytic cell lines
that result in death following HIV infection, it has been demonstrated that
infection of U937
cells with HIV results in the de novo expression of Fas ligand and that Fas
ligand mediates
HIV-induced apoptosis (Badley, A.D. et al., J. Virol. 70:199-206 (1996)).
Further the TNF-
148
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
family ligand was detectable in uninfected macrophages and its expression was
upregulated
following HIV infection resulting in selective billing of uninfected CD4 T-
lymphocytes
(Badley, A.D et al., J. Virol. 70:199-206 (1996)). Further, additional studies
have implicated
Fas-mediated apoptosis in loss of T cells in HIV individuals (I~atsikis et
al., J. Exp. Med.
181:2029-2036, 1995).
[0399] Thus, by the invention, a method for treating HIV individuals is
provided which
involves administering TNFR and/or TNFR agonists of the present invention to
reduce
selective killing of CD4 T-lymphocytes. Modes of administration and dosages
are discussed
in detail below.
[0400] It is also possible that T cell apoptosis occurs through multiple
mechanisms.
Further at least some of the T cell death seen in HIV patients may be mediated
by AIM-II.
While not wishing to be bound by theory, such Fas ligand and/or AIM-II-
mediated T cell
death is believed to occur through the mechanism known as activation-induced
cell death
(AICD).
[0401] Activated human T cells are induced to undergo programmed cell death
(apoptosis) upon triggering through the CD3/T cell receptor complex, a process
termed
activated-induced cell death (AICD). AICD of CD4 T cells isolated from HIV-
Infected
asymptomatic individuals has been reported (Groux et al., supra). Thus, AICD
may play a
role in the depletion of CD4+ T cells and the progression to AIDS in HIV-
infected
individuals. Thus, the present invention provides a method of inhibiting Fas
ligand-mediated
and/or AIM-II-mediated T cell death in HIV patients, comprising administering
a TNFR-6
alpha and/or TNFR-6 beta polypeptide of the invention to the patients. In one
embodiment,
the patient is asymptomatic when treatment with TNFR-6 alpha and/or TNFR-6
beta
commences. If desired, prior to treatment, peripheral blood T cells may be
extracted from an
HIV patient, and tested for susceptibility to Fas ligand-mediated and/or AIM-
II-mediated cell
death by conventional procedures. In one embodiment, a patient's blood or
plasma is
contacted with TNFR-6 alpha and/or TNFR-6 beta ex vivo. The TNFR-6 alpha
and/or TNFR-
6 beta may be bound to a suitable chromatography matrix known in the art by
conventional
procedures. The patient's blood or plasma flows through a chromatography
column
containing TNFR-6 alpha and/or TNFR-6 beta polypeptides of the invention bound
to the
matrix, before being returned to the patient. The immobilized TNFR-6 alpha
and/or TNFR-6
149
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
beta binds Fas ligand and/or AIM-II, thus removing Fas ligand and/or AIM-II
protein from
the patient's blood.
[0402] In additional embodiments a TNFR-6 alpha and/or TNFR-6 beta polypeptide
of
the invention may be administered in combination with other inhibitors of T
cell apoptosis.
For example, at least some of the T cell death seen in HIV patients is
believed to be mediated
by TRAIL (International application publication number WO 97/01633 hereby
incorporated
by reference). Thus, for example, a patient susceptible to both Fas ligand
mediated and
TRAIL mediated T cell death may be treated with both an agent that blocks
TRAIL/TRAIL-
receptor interactions and an agent that blocks Fas-ligand/Fas interactions.
Suitable agents
that may be administered with the polynucleotides and/or polypeptides of the
invention to
block binding of TRAIL to TRAIL receptors include, but are not limited to,
soluble TRAIL
receptor polypeptides (e.g., a soluble form of OPG, DR4 (International
application
publication number WO 98/32856); TR5 (International application publication
number WO
98/30693); DR5 (International application publication number WO 98/41629);
TR10
(International application publication number WO 98!54202)); multimeric forms
of soluble
TRAIL receptor polypeptides; and TRAIL receptor antibodies that bind the TRAIL
receptor
without transducing the biological signal that results in apoptosis, anti-
TRAIL antibodies that
block binding of TRAIL to one or more TRAIL receptors, and muteins of TRAIL
that bind
TRAIL receptors but do not transduce the biological signal that results in
apoptosis.
Preferably, the antibodies employed according to this method are monoclonal
antibodies.
[0403] Suitable agents, which also block binding of Fas-ligand to Fas that may
be
administered with the polynucleotides and polypeptides of the present
invention include, but
are not limited to, soluble Fas polypeptides; multimeric forms of soluble Fas
polypeptides
(e.g., dimers of sFas/Fc); anti-Fas antibodies that bind Fas without
transducing the biological
signal that results in apoptosis; anti-Fas-ligand antibodies that block
binding of Fas-ligand to
Fas; and muteins of Fas-ligand that bind Fas but do not transduce the
biological signal that
results in apoptosis. Examples of suitable agents for blocking Fas-L/Fas
interactions,
including blocking anti-Fas monoclonal antibodies, are described in
International application
publication number WO 95/10540, hereby incorporated by reference.
[0404] Suitable agents that may be administered with the polynucleotides
and/or
polypeptides of the invention to block binding of AIM-II to AIM-II receptors
include, but are
not limited to, soluble AIM-II receptor polypeptides (e.g., a soluble form of
TR2
150
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
(International application publication number WO 96/34095); LT beta receptor;
and TR8
(International application publication number WO 98/54201)); multimeric forms
of soluble
AIM-II receptor polypeptides; and AIM-II receptor antibodies that bind the AIM-
II receptor
without transducing the biological signal that results in apoptosis, anti-AIM-
II antibodies that
block binding of AIM-II to one or more AIM-II receptors, and muteins of AIM-II
that bind
AIM-II receptors but do not transduce the biological signal that results in
apoptosis.
Preferably, the antibodies employed according to this method are monoclonal
antibodies.
[0405] In rejection of an allograft, the immune system of the recipient animal
has not
previously been primed to respond because the immune system for the most part
is only
primed by environmental antigens. Tissues from other members of the same
species have not
been presented in the same way that, for example, viruses and bacteria have
been presented.
In the case of allograft rejection, immunosuppressive regimens are designed to
prevent the
immune system from reaching the effector stage. However, the immune profile of
xenograft
rejection may resemble disease recurrence more than allograft rejection. In
the case of
disease recurrence, the immune system has already been activated, as evidenced
by
destruction of the native islet cells. Therefore, in disease recurrence the
immune system is
already at the effector stage. Antagonists of the present invention are able
to suppress the
immune response to both allografts and xenografts because lymphocytes
activated and
differentiated into effector cells will express the TNFR polypeptide, and
thereby are
susceptible to compounds which enhance TNFR activity. Thus, the present
invention further
provides a method for creating immune privileged tissues. Antagonist of the
invention can
further be used in the treatment of Inflammatory Bowel-Disease.
[0406] TNFR polynucleotides, polypeptides, and agonists of the invention may
also be
used to suppress immune responses. In one embodiment, the TNFR
polynucleotides,
polypeptides, and agonists of the invention are used to minimize untoward
effects associated
with transplantation. In a specific embodiment, the TNFR polynucleotides,
polypeptides, and
agonists of the invention are used to suppress Fas mediated immune responses
(e.g., in a
manner similar to an irnmunosuppressant such as, for example, rapamycin or
cyclosporin).
In another specific embodiment, the TNFR polynucleotides, polypeptides, and
agonists of the
invention are used to suppress AIM-II mediated immune responses.
[0407] Additionally, both graft rejection and graft vs. host disease are in
part triggered by
apoptosis. Accordingly, an additional preferred embodiment, TNFR
polynucleotides,
151
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
polypeptides, and/or TNFR agonists of the invention are used to treat and
prevent and/or
reduce graft rejection. In a further preferred embodiment, TNFR
polynucleotides,
polypeptides, and/or TNFR agonists of the invention are used to treat and
prevent and/or
reduce graft vs. host disease.
[0408] Additionally, TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides,
and/or agonists may be used to treat or prevent graft rejection (e.g.,
xenograft and allograft
rejection (e.g, acute allograft rejection)) and/or medical conditions
associated with graft
rejection. In a specific embodiment, TNFR-6 alpha andlor TNFR-6 beta
polypeptides,
polynucleotides, and/or agonists of the invention are used to treat or prevent
acute allograft
rejection andlor medical conditions associated with acute allograft rejection.
In a further
specific embodiment, TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides,
and/or agonists of the invention are used to treat or prevent acute allograft
rejection of a
kidney and/or medical conditions associated with acute allograft rejection of
a kidney.
[0409] Fas ligand is a type II membrane protein that induces apoptosis by
binding to Fas.
Fas ligand is expressed in activated T cells, and works as an effector of
cytotoxic
lymphocytes. Molecular and genetic analysis of Fas and Fas ligand have
indicated that mouse
lymphoproliferation mutation (lpr) and generalized lymphoproliferative disease
(gld) are
mutations of Fas and Fas ligand respectively. The lpr of gld mice develop
lymphadenopathy,
and suffer from autoimmune disease. Based on these phenotypes and other
studies, it is
believed that the Fas system is involved in the apoptotic process during T-
cell development,
specifically peripheral clonal deletion or activation-induced suicide of
mature T cells. In
addition to the activated lymphocytes, Fas is expressed in the liver, heart
and lung.
Administration of agonistic anti-Fas antibody into mice has been shown to
induce apoptosis
in the liver and to quickly kill the mice, causing liver damage. These
findings indicate that the
Fas system plays a role not only in the physiological process of lymphocyte
development, but
also in the cytotoxic T-lymphocyte-mediated disease such as fulminant
hepatitis andlor
hepatitis resulting from viral infection or toxic agents. As discussed herein,
TNFR-6 alpha
and/or TNFR-6 beta binds Fas ligand, and thus functions as an antagonist of
Fas-ligand
mediated activity. Accordingly, the TNFR-6 alpha and/or TNFR-6 beta
polypeptides and/or
polynucleotides of the invention, and/or agonists thereof, may be used to
treat or prevent
lymphoproliferative disorders (e.g., lymphadenopathy and others described
herein),
autoimmune disorders (e.g., autoimmune diabetes, systemic lupus erythematosus,
Grave's
152
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
disease, Hashimoto's thyroiditis, immune-related glomerulonephritis,
autoimmune gastritis,
autoimmune thrombocytopenic purpura, multiple sclerosis, rheumatoid arthritis,
and others
described herein), and/or liver disease (e.g., acute and chronic hepatitis,
and cirrhosis).
[0410] In a specific embodimen, TNFR polynucleotides, polypeptides, and/or
agonists of
the invention are used to treat or prevent hepatitis and/or tissue/cell damage
or destruction
and/or medical conditions associated with hepatitis. In a specific embodiment
TNFR
polynucleotides, polypeptides, and/or agonists of the invention are used to
treat or prevent
fulminant hepatitis and/or medical conditions associated with fulminant
hepatitis.
[0411] In a specific embodiment, TNFR polynucleotides, polypeptides;, and/or
agonists of
the invention are used to treat or prevent systemic lupus erythematosus (SLE)
and/or
tissue/cell damage or destruction and/or medical conditions associated with
SLE. In a further
specific embodiment, TNFR polynucleotides, polypeptides, and/or agonists of
the invention
are used to treat or prevent skin lesions in SLE patients.
[0412] In a specific embodiment, TNFR polynucleotides, polypeptides, and/or
agonists of
the.invention are used to treat or prevent insulin-dependent diabetes mellitus
and/or
tissue/cell damage or destruction and/or medical conditions associated with
insulin-dependent
diabetes mellitus. In a further specific embodiment, TNFR polynucleotides,
polypeptides,
and/or agonists of the invention are prior to, during, or immediately after
the onset of diabetes
to reduce or prevent damage to islet cells and/or to reduce exogenous insulin
requirement.
[0413] In a specific embodiment TNFR polynucleotides, polypeptides, and/or
agonists of
the invention are used to treat or prevent toxic epidermal necrolysis (TEN)
and/or tissue/cell
damage or destruction, and/or medical conditions associated with TEN. In a
further specific
embodiment, TNFR polynucleotides, polypeptides, and/or agonists of the
invention are used
to treat or prevent Lyell's syndrome.
[0414] Hepatitis virus (e.g., Hepatitis B virus and Hepatitis C virus) is a
major causative
agent of chronic liver disease. In Hepatitis infection, Fas expression in
hepatocytes is up-
regulated in accordance with the severity of liver inflammation. When
Hepatitis virus-
specific T cells migrate into hepatocytes and recognize the viral antigen via
the T cell
receptor, they become activated and express Fas ligand that can transduce the
apoptotic death
signal to Fas-bearing hepatocytes. Thus, the Fas system plays an important
role in liver cell
injury by viral hepatitis. Accordingly, in specific embodiments, the TNFR-6
alpha and/or
TNFR-6 beta polypeptides and/or polynucleotides of the invention and/or
agonists or
153
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
antagonists thereof, are used to treat or prevent hepatitis resulting from
viral infection (e.g.,
infection resulting form Hepatitis B virus or Hepatitis C virus infection). In
one
embodiment, a patient's blood or plasma is contacted with TNFR-6 alpha and/or
TNFR-6
beta polypeptides of the invention ex vivo. The TNFR-6 alpha and/or TNFR-6
beta may be
bound to a suitable chromatography matrix by conventional procedures.
According to this
embodiment, the patient's blood or plasma flows through a chromatography
column
containing TNFR-6 alpha and/or TNFR-6 beta bound to the matrix, before being
returned to
the patient. The immobilized TNFR-6 alpha and/or TNFR-6 beta binds Fas-ligand,
thus
removing Fas-ligand protein from the patient's blood.
[0415] In a specific embodiment, TNFR-6 alpha andlor TNFR-6 beta polypeptides,
polynucleotides, andlor agonists or antagonists of the invention may be used
to treat or
prevent renal failure (e.g., chronic renal failure), and/or tissuelcell damage
or destruction
(e.g., tubular epithelial cell deletion) and/or medical conditions associated
with renal failure.
[0416] In a specific embodiment, TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides, and/or agonists or antagonists of the invention may be used
to regulate (i.e.,
stimulate or inhibit) bone growth. In specific embodiments TNFR-6 alpha and/or
TNFR-6
beta polypeptides, polynucleotides, and/or agonists or antagonists of the
invention are used to
stimulate bone growth. Specific diseases or conditions that may be treated or
prevented with
the compositions of the invention include, but are not limited to, bone
fractures, and defects,
and disorders which result in weakened bones such as osteoporosis,
osteomalacia, and age-
related loss of bone mass.
[0417] TNFR-6 alpha and/or TNFR-6 beta polypeptides or polynucleotides
encoding
TNFR-6 alpha and/or TNFR-6 beta of the invention, and/or agonists or
antagonists thereof
may be used to treat or prevent cardiovascular disorders, including peripheral
artery disease,
such as limb ischemia.
[0418] Cardiovascular disorders include cardiovascular abnormalities, such as
arterio-
arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations,
congenital heart
defects, pulmonary atresia, and Scimitar Syndrome. Congenital heart defects
include aortic
coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart,
dextrocardia, patent
ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left
heart syndrome,
levocardia, tetralogy of fallot, transposition of great vessels, double outlet
right ventricle,
tricuspid atresia, persistent truncus arteriosus, and heart septal defects,
such as
154
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
aortopulmonary septal defect, endocardial cushion defects, Lutembacher's
Syndrome, trilogy
of Fallot, ventricular heart septal defects.
[0419] Cardiovascular disorders also include heart disease, such as
atherosclerosis,
arrhythmias, carcinoid heart disease, high cardiac output, low cardiac output,
cardiac
tamponade, endocarditis (including bacterial), heart aneurysm, cardiac arrest,
congestive
heart failure (e.g., chronic congestive heart failure), congestive
cardiomyopathy, paroxysmal
dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left
ventricular
hypertrophy, right ventricular hypertrophy, post-infarction heart rupture,
ventricular septal
rupture, heart valve diseases, myocardial diseases, myocardial ischemia,
pericardial effusion,
pericarditis (including constrictive and tuberculous), pneumopericardium,
postpericardiotomy
syndrome, pulmonary fibrosis, pulmonary heart disease, rheumatic heart
disease, ventricular
dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar
Syndrome,
cardiovascular syphilis, and cardiovascular tuberculosis.
[0420] In a specific embodiment, TNFR-6 alpha and/or TNFR-6 beta
polynucleotides,
polypeptides, or agonists of the invention may be used to treat and/or prevent
chronic
congestive heart failure and/or medical conditions associated chronic
congestive heart failure.
[0421] In another specific embodiment, TNFR-6 alpha andlor TNFR-6 beta
polynucleotides, polypeptides, or agonists of the invention may be used to
treat and/or
prevent pulmonary injury or disease (e.g., pulmonary fibrosis and chronic
obstructive
pulmonary diseases, such as, for example, emphysema and chronic bronchitis),
and/or
tissue/cell damage or destruction (e.g., alveolar wall and/or bronchiolar wall
destruction)
and/or medical conditions associated with pulmonary injury or disease.
[0422] Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial
flutter, bradycardia,
extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block,
long QT
syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation
syndrome, Wolff Parkinson-White syndrome, sick sinus syndrome, tachycardias,
and
ventricular fibrillation. Tachycardias include paroxysmal tachycardia,
supraventricular
tachycardia, accelerated idioventricular rhythm, atrioventricular nodal
reentry tachycardia,
ectopic atrial tachycardia, ectopic functional tachycardia, sinoatrial nodal
reentry tachycardia,
sinus tachycardia, Torsades de Pointes, and ventricular tachycardia.
[0423] Heart valve disease include aortic valve insufficiency, aortic valve
stenosis, hear
murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve
prolapse, mitral valve
155
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve
insufficiency,
pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency,
and tricuspid valve
stenosis.
[0424] Myocardial diseases include alcoholic cardiomyopathy, congestive
cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis,
pulmonary
subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy,
endocardial
fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, myocardial
reperfusion injury, and
myocarditis.
[0425] Myocardial ischemias include coronary disease, such as angina pectoris,
coronary
aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm,
myocardial
infarction and myocardial stunning.
[0426] Cardiovascular diseases also include vascular diseases such as
aneurysms,
angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease,
Klippel-
Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic
diseases,
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive
diseases, arteritis,
enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic
angiopathies, diabetic
retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-
occlusive
disease, hypertension, hypotension, ischemia, peripheral vascular diseases,
phlebitis,
pulmonary veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal
vein
occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia,
atacia
telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose
veins, varicose
ulcer, vasculitis, and venous insufficiency.
[0427] Aneurysms include dissecting aneurysms, false aneurysms, infected
aneurysms,
ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms,
heart
aneurysms, and iliac aneurysms.
[0428] Arterial occlusive diseases include arteriosclerosis, intermittent
claudication,
carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion,
Moyamoya disease,
renal artery obstruction, retinal artery occlusion, and thromboangiitis
obliterans.
[0429] Cerebrovascular disorders include carotid artery diseases, cerebral
amyloid
angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis,
cerebral
arteriovenous malformation, cerebral artery diseases, cerebral embolism and
thrombosis,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral
hemorrhage,
156
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
epidural hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral
infarction,
cerebral ischemia (including transient), subclavian steal syndrome,
periventricular
leukomalacia, vascular headache, cluster headache, migraine, and
vertebrobasilar
insufficiency.
[0430] Embolisms include air embolisms, amniotic fluid embolisms, cholesterol
embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and
thromoboembolisms. Thromboses include coronary thrombosis, hepatic vein
thrombosis,
retinal vein occlusion, carotid artery thrombosis, sinus thrombosis,
Wallenberg's syndrome,
and thrombophlebitis.
[0431] Ischemia includes cerebral ischemia, ischemic colitis, compartment
syndromes,
anterior compartment syndrome, myocardial ischemia, reperFusion injuries, and
peripheral
limb ischemia. Vasculitis includes aortitis, arteritis, Behcet's Syndrome,
Churg-Strauss
Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans,
hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous
vasculitis, and
Wegener's granulomatosis.
[0432] In one embodiment, TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides and/or agonists or antagonists of the invention are used to
treat or prevent
thrombotic microangiopathies. One such disorder is thrombotic thrombocytopenic
purpura
(TTP) (Kwaan, H.C., Semin. Hematol. 24:71 (1987); Thompson et al., Blood
80:1890
(1992)). Increasing TTP-associated mortality rates have been reported by the
U.S. Centers for
Disease Control (Torok et al., A»a. J. Hematol. 50:84 (1995)). Plasma from
patients afflicted
with TTP (including HIV+ and HIV- patients) induces apoptosis of human
endothelial cells
of dermal microvascular origin, but not large vessel origin (Laurence et al.,
Blood 87:3245
(1996)). Plasma of TTP patients thus is thought to contain one or more factors
that directly or
indirectly induce apoptosis. An anti-Fas blocking antibody has been shown to
reduce TTP
plasma-mediated apoptosis of microvascular endothelial cells (Lawrence et al.,
Bload
87:3245 (1996); hereby incorporated by reference). Accordingly, Fas ligand
present in the
serum of TTP patients is likely to play a role in inducing apoptosis of
microvascular
endothelial cells. Another thrombotic microangiopathy is hemolytic-uremic
syndrome (HLTS)
(Moake, J.L., Lancet, 343:393, (I994); Melnyk et al., (AYCh. Intent. Med.,
155:2077, (1995);
Thompson et al., supra). Thus, in one embodiment, the invention is directed to
use of
157
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
TNFR-6 alpha and/or TNFR-6 beta to treat or prevent the condition that is
often referred to as
"adult HUS" (even though it can strike children as well). A disorder known as
childhoodldiarrhea-associated HLJS differs in etiology from adult HUS. In
another
embodiment, conditions characterized by clotting of small blood vessels may be
treated using
TNFR-6 alpha andlor TNFR-6 beta polypeptides and/or polynucleotides of the
invention.
Such conditions include, but are not limited to, those described herein. For
example, cardiac
problems seen in about 5-10°l0 of pediatric AIDS patients are believed
to involve clotting of
small blood vessels. Breakdown of the microvasculature in the heart has been
reported in
multiple sclerosis patients. As a further example, treatment of systemic lupus
erythematosus
(SLE) is contemplated. In one embodiment, a patient's blood or plasma is
contacted with
TNFR-6 alpha andlor TNFR-6 beta polypeptides of the invention ex vivo. The
TNFR-6 alpha
and/or TNFR-6 beta may be bound to a suitable chromatography matrix using
techniques
known in the art. According to this embodiment, the patient's blood or plasma
flows through
a chromatography column containing TNFR-6 alpha and/or TNFR-6 beta bound to
the
matrix, before being returned to the patient. The immobilized TNFR-6 alpha
and/or TNFR-6
beta binds Fas ligand andlor AIM-II, thus removing Fas ligand protein from the
patient's
blood. Alternatively, TNFR-6 alpha and/or TNFR-6 beta may be administered i3a
vivo to a
patient afflicted with a thrombotic microangiopathy. In one embodiment, a TNFR-
6 alpha
and/or TNFR-6 beta polynucleotide or polypeptide of the invention is
administered to the
patient. Thus, the present invention provides a method for treating a
thrombotic
microangiopathy, involving use of an effective amount of a TNFR-6 alpha and/or
TNFR-6
beta polypeptide of the invention. A TNFR-6 alpha and/or TNFR-6 beta
polypeptide may be
employed in in vivo or ex vivo procedures, to inhibit Fas ligand-mediated
and/or AIM-II-
mediated damage to (e.g., apoptosis of) microvascular endothelial cells.
[0433] TNFR-6 alpha and/or TNFR-6 beta polypeptides and polynucleodies of the
invention may be employed in conjunction with other agents useful in treating
a particular
disorder. For example, in an ira vitro study reported by Laurence et al.(Blood
87:3245, 1996),
some reduction of TTP plasma-mediated apoptosis of microvascular endothelial
cells was
achieved by using an anti-Fas blocking antibody, aurintricarboxylic acid, or
normal plasma
depleted of cryoprecipitate. Thus, a patient may be treated in combination
with an additional
agent that inhibits Fas-ligand-mediated apoptosis of endothelial cells such
as, for example, an
158
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
agent described above. In one embodiment, TNFR-6 alpha andlor TNFR-6 beta
polypeptides
of the invention and an anti-FAS blocking antibody are administered to a
patient afflicted
with a disorder characterized by thrombotic microanglopathy, such as TTP or
HLTS.
Examples of blocl~ing monoclonal antibodies directed against Fas antigen
(CD95) are
described in International Application publication number WO 95/10540, hereby
incorporated by reference.
[0434] The naturally occurring balance between endogenous stimulators and
inhibitors of
angiogenesis is one in which inhibitory influences predominate. Rastinejad et
al., Cell
56:345-355 (1989). In those rare instances in which neovascularization occurs
under normal
physiological conditions, such as wound healing, organ regeneration, embryonic
development, and female reproductive processes, angiogenesis is stringently
regulated and
spatially and temporally delimited. Under conditions of pathological
angiogenesis such as
that characterizing solid tumor growth, these regulatory controls fail.
Unregulated
~angiogenesis becomes pathologic and sustains progression of many neoplastic
and non-
neoplastic diseases. A number of serious diseases are dominated by abnormal
neovascularization including solid tumor growth and metastases, arthritis,
some types of eye
disorders, and psoriasis. See, e.g., reviews by Moses et al., Biotech. 9:630-
634 (1991);
Folkman et al., N. Engl. J. Med., 333:1757-1763 (1995); Auerbach et al., J.
Microvasc. Res.
29:401-411 (1985); Folkman, Advances in Cancer Research, eds. Klein and
Weinhouse,
Academic Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol. 94:715-
743
(1982); and Folkman et al., Science 221:719-725 (1983). In a number of
pathological
conditions, the process of angiogenesis contributes to the disease state. For
example,
significant data have accumulated which suggest that the growth of solid
tumors is dependent
on angiogenesis. Folkman and Klagsbrun, Sciefice 235:442-447 (1987).
[0435] The present invention provides for treatment of diseases or disorders
associated
with neovascularization by administration of the TNFR-6 alpha and/or TNFR-6
beta
polynucleotides and/or polypeptides of the invention. Malignant and metastatic
conditions
which can be treated with the polynucleotides and polypeptides of the
invention include, but
are not limited to, malignancies, solid tumors, and cancers described herein
and otherwise
known in the art (for a review of such disorders, see Fishman et al.,
Medicine, 2d Ed., J. B.
Lippincott Co., Philadelphia (1985)):
159
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0436] Ocular disorders associated with neovascularization which can be
treated with the
TNFR-6 alpha and/or TNFR-6 beta polynucleotides and polypeptides of the
present invention
(including TNFR agonists and/or antagonists) include, but are not limited to:
neovascular
glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia,
uveitis, retinopathy of
prematurity macular degeneration, corneal graft neovascularization, as well as
other eye
inflammatory diseases, ocular tumors and diseases associated with choroidal or
iris
neovascularization. See, e.g., reviews by Waltman et al., Am. J. Ophthal.
X5:704-710 (1978)
and Gartner et al., Suf-v. Ophthal. 22:291-312 (1978).
[0437] In another embodiment, TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides and/or agonists or antagonists of the invention are used to
stimulate
differentiation and/or survival of photoreceptor cells and/or to treat or
prevent diseases,
disorders, or conditions associated with decreased number, differentiation
and/or survival of
photoreceptor cells.
[0438] Additionally, disorders which can be treated with the TNFR-6 alpha
and/or
TNFR-6 beta polynucleotides and polypeptides of the present invention
(including TNFR
agonist and/or antagonists) include, but are not limited to, hemangioma,
arthritis, psoriasis,
angiofibroma, atherosclerotic plaques, delayed wound healing, granulations,
hemophilic
joints, hypertrophic scars, nonunion fractures, Osler-Weber syndrome, pyogenic
granuloma,
scleroderma, trachoma, and vascular adhesions.
[0439] In additional embodiments, TNFR-6 alpha and/or TNFR-6 beta
polynucleotides,
polynucleotides and/or other compositions of the invention (e.g., TNFR-6 alpha
and/or
TNFR-6 beta Fc- or albumin- fusion proteins or anti-TNFR-6 alpha and/or anti-
TNFR-6 beta
antibodies) are used to treat or prevent diseases or conditions associated
with allergy and/or
inflammation.
[0440] As demonstrated in Example 24 below, it has been shown that TR6-alpha
and
TR6-beta interact with TNF-gamma-beta, a TNF ligand family member described in
detail in
International Publication Numbers W096/14328, WO00/66608, and WO00/08139. TNF-
gamma-beta is a proinflammatory molecule as evidenced by its ability to induce
T cell
proliferation and secretion of Interferon-gamma and GM-CSF by T cells. TNF-
gamma-beta
is also able to enhance an in vivo mixed lymphocyte reaction (MLR) as measured
by the
parent-into-Fl model of acute graft vs. host disease in which C57BL/6 splenic
T cells are
160
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
transferred into (BALB/c x C57BL/6) Fl mice. Thus, the ability of TNFR-6 alpha
to bind
TNF-gamma-beta and to prevent TNF-gamma-beta induced activities (see Example
24)
suggests that TNFR-6 alpha and or TNF-6beta polynucIeotides and polypeptides
are useful as
inhibitors of TNF-gamma-beta function.
[0441] In specific embodiments, TNFR-6 alpha and/or TNFR-6 beta
polynucleotides and
polypeptides and fragments or variants thereof (e.g. soluble forms of TNFR-6
alpha such as
TNFR-6 alpha Fc fusion proteins or TNFR-6 alpha albumin fusion proteins) are
useful for the
prevention, diagnosis and treatment of inflammation and/or inflammatory
diseases and
disorders. In particular embodiments, the present invention provides a method
of diagnosing,
diagnosing, treating, preventing or ameliorating inflammatory diseases or
disorders
comprising or alternatively consisting of, administering to an animal,
preferably a human, in
which such treatment, prevention or amelioration is desired, a TNFR-6 alpha
and/or TNFR-6
beta polynucleotide or polypeptide or a fragment or variant thereof (e.g.
soluble forms of
TNFR-6 alpha and/or TNFR-6 beta such as a TNFR-6 alpha and/or TNFR-6 beta Fc-
or
albumin-fusion protein) in an amount effective to treat prevent or ameliorate
the
inflammatory disease or disorder. In specific embodiments, the inflammatory
disease or
disorder is inflammatory bowel disease. In specific embodiments, the
inflammatory disease
or disorder is encephalitis. In specific embodiments, the inflammatory disease
or disorder is
atherosclerosis. In specific embodiments, the inflammatory disease or disorder
is psoriasis.
The present invention further provides compositions comprising the TNFR-6
alpha and/or
TNFR-6 beta polynucleotide or polypeptide or a fragment or variant thereof
(e.g. soluble
forms of TNFR-6 alpha and/or TNFR-6 beta such as a TNFR-6 alpha and/or TNFR-6
beta
Fc- or albumin-fusion protein) and a Garner for use in the above-described
method of
diagnosing, treating, preventing or ameliorating inflammatory diseases and
disorders.
[0442] In specific embodiments, the present invention provides a method of
diagnosing,
treating, preventing or ameliorating inflammation comprising or alternatively
consisting of,
administering to an animal, preferably a human, in which such treatment,
prevention or
amelioration is desired, a TNFR-6 alpha and/or TNFR-6 beta polynucleotide or
polypeptide
or a fragment or variant thereof (e.g. soluble forms of TNFR-6 alpha and/or
TNFR-6 beta
such as a TNFR-6 alpha and/or TNFR-6 beta Fc- or albumin-fusion protein) in an
amount
effective to treat prevent or ameliorate the inflammation. The present
invention further
provides compositions comprising a TNFR-6 alpha and/or TNFR-6 beta
polynucleotide or
161
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
polypeptide or a fragment or variant thereof (e.g. soluble forms of TNFR-6
alpha and/or
TNFR-6 beta such as a TNFR-6 alpha and/or TNFR-6 beta Fc- or albumin-fusion
protein)
and a carrier for use in the above-described method of diagnosing, treating,
preventing or
ameliorating inflammation.
[0443] In specific embodiments, the present invention provides a method of
diagnosing,
treating, preventing or ameliorating graft versus host disease (GVI~)
comprising or
alternatively consisting of, administering to an animal, preferably a human,
in which such
treatment, prevention or amelioration is desired, a TNFR-6 alpha and/or TNFR-6
beta
polynucleotide or polypeptide or a fragment or variant thereof (e.g. soluble
forms of TNFR-6
alpha and/or TNFR-6 beta such as a TNFR-6 alpha and/or TNFR-6 beta Fc- or
albumin-
fusion protein) in an amount effective to treat prevent or ameliorate the
GVHD. The present
invention further provides compositions comprising a TNFR-6 alpha and/or TNFR-
6 beta
polynucleotide or polypeptide or a fragment or variant thereof (e.g. soluble
forms of TNFR-6
alpha and/or TNFR-6 beta such as a TNFR-6 alpha and/or TNFR-6 beta Fc- or
albumin-
fusion protein) and a carrier for use in the above-described method of
diagnosing, treating,
preventing or ameliorating GVHD. .
[0444] In other embodiments, the present invention provides a method of
diagnosing,
treating, preventing or ameliorating autoimmune diseases and disorders
comprising or
alternatively consisting of, administering to an animal, preferably a human,
in which such
treatment, prevention or amelioration is desired, a TNFR-6 alpha andlor TNFR-6
beta
polynucleotide or polypeptide or a fragment or variant thereof (e.g. soluble
forms of TNFR-6
alpha and/or TNFR-6 beta such as a TNFR-6 alpha and/or TNFR-6 beta Fc- or
albunnin-
fusion protein) in an amount effective to treat prevent or ameliorate the
autoimmune disease
or disorder. In specific embodiments, the autoimmune disease or disorder is
systemic lupus
erythematosus. In specific embodiments, the autoimmune disease or disorder is
arthritis,
particularly rheumatoid arthritis. In specific embodiments, the autoimmune
disease or
disorder is multiple sclerosis. In specific embodiments, the autoimmune
disease or disorder
is Crohn's disease. In specific embodiments, the autoimmune disease or
disorder is
autoimmune encephalitis. The present invention further provides compositions
comprising a
TNFR-6 alpha and/or TNFR-6 beta polynucleotide or polypeptide or a fragment or
variant
thereof (e.g. soluble forms of TNFR-6 alpha and/or TNFR-6 beta such as a TNFR-
6 alpha
and/or TNFR-6 beta Fc- or albumin-fusion protein) and a carrier for use in the
above-
162
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
described method of diagnosing, treating, preventing or ameliorating
autoimmune diseases
and disorders.
[0445] In specific embodiments, the present invention provides a method of
diagnosing,
treating, preventing or ameliorating allergy or asthma comprising or
alternatively consisting
of, administering to an animal, preferably a human, in which such treatment,
prevention or
amelioration is desired, a TNFR-6 alpha andlor TNFR-6 beta polynucleotide or
polypeptide
or a fragment or variant thereof (e.g. soluble forms of TNFR-6 alpha and/or
TNFR-6 beta
such as a TNFR-6 alpha andlor TNFR-6 beta Fc- or albumin-fusion protein) or
fragment or
variant thereof in an amount effective to treat prevent or ameliorate the
allergy or asthma.
The present invention further provides compositions comprising a TNFR-6 alpha
and/or
TNFR-6 beta polynucleotide or polypeptide or a fragment or variant thereof
(e.g. soluble
forms of TNFR-6 alpha and/or TNFR-6 beta such as a TNFR-6 alpha and/or TNFR-6
beta
Fc- or albumin-fusion protein) and a Garner for use in the above-described
method of
diagnosing, treating, preventing or ameliorating allergy or asthma.
[0446] The present invention further encompasses methods and compositions for
reducing T cell activation, comprising, or alternatively consisting of;
contacting an effective
amount of a TNFR-6 alpha and/or TNFR-6 beta polypeptide or a fragment or
variant thereof
(e.g. soluble forms of TNFR-6 alpha and/or TNFR-6 beta such as a TNFR-6 alpha
and/or
TNFR-6 beta Fc- or albumin-fusion protein) with cells of hematopoietic origin,
wherein the
effective amount of the TNFR-6 alpha and/or TNFR-6 beta polypeptide or a
fragment or
variant thereof (e.g. soluble forms of TNFR-6 alpha and/or TNFR-6 beta such as
a TNFR-6
alpha and/or TNFR-6 beta Fc- or albumin-fusion protein) reduces T cell
activation. In
preferred embodiments, the cells of hematopoietic origin are T cells. In other
preferred
embodiments, the effective amount of a TNFR-6 alpha and/or TNFR-6 beta
polypeptide or a
fragment or variant thereof (e.g. soluble forms of TNFR-6 alpha andlor TNFR-6
beta such as
a TNFR-6 alpha and/or TNFR-6 beta Fc- or albumin-fusion protein) reduces TNF-
gamma-
alpha and/or TNF-gamma beta induced T cell activation.
[0447] The present invention further encompasses methods and compositions for
reducing T cell activation comprising, or alternatively consisting of,
administering to an
animal, preferably a human, in Which such reduction is desired, a TNFR-6 alpha
and/or
TNFR-6 beta polynucleotide or polypeptide or a fragment or variant thereof
(e.g. soluble
forms of TNFR-6 alpha and/or TNFR-6 beta such as a TNFR-6 alpha andlor TNFR-6
beta
163
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Fc- or albumin-fusion protein) or fragment or variant thereof in an amount
effective to reduce
T cell activation. The present invention further provides compositions
comprising a TNFR-6
alpha and/or TNFR-6 beta polynucleotide or polypeptide or a fragment or
variant thereof (e.g.
soluble forms of TNFR-6 alpha and/or TNFR-6 beta such as a TNFR-6 alpha and/or
TNFR-6
beta Fc- or albumin-fusion protein) and a carrier for use in the above-
described method of
reducing T cell activation.
[0448] In a specific embodiment TNFR polynucleotides, polypeptides and/or
agonists or
antagonists thereof may be used to treat or prevent thyroid-associated
opthalmopathy and/or
tissue/cell damage or destruction, and/or medical conditions associated with
thyroid-
associated opthalmopathy.
[0449] In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the
invention are used to prolong protein expression after gene therapy by
inhibiting or reducing
elimination of transgene expressing cells.
[0450] In further embodiments, the TNFR-6 alpha and/or TNFR-6 beta
polynucleotides
and/or polynucleotides, and/or agonists or antagonists thereof, are used to
promote wound
healing.
[0451] Polynucleotides and/or polypeptides of the invention and/or agonists
and/or
antagonists thereof are useful in the diagnosis and treatment or prevention of
a wide range of
diseases and/or conditions. Such diseases and conditions include, but are not
limited to,
cancer (e.g., immune cell related cancers, breast cancer, prostate cancer,
ovarian cancer,
follicular lymphoma, cancer associated with mutation or alteration of p53,
brain tumor,
bladder cancer, uterocervical cancer, colon cancer, colorectal cancer, non-
small cell
carcinoma of the lung, small cell carcinoma of the lung, stomach cancer,
etc.),
lymphoproliferative disorders (e.g., lymphadenopathy), microbial (e.g., viral,
bacterial, etc.)
infection (e.g., HIV-1 infection, HIV-2 infection, herpesvirus infection
(including, but not
limited to, HSV-1, HSV-2, CMV, VZV, HHV'-6, HHV-7, EBV), adenovirus infection,
poxvirus infection, human papilloma virus infection, hepatitis infection
(e.g., HAV, HBV,
HCV, etc.), Helicobacter pylori infection, invasive Staphylococcia, etc.),
parasitic infection,
nephritis, bone disease (e.g., osteoporosis), atherosclerosis, pain,
cardiovascular disorders
(e.g., neovascularization, hypovascularization or reduced circulation (e.g.,
ischemic disease
(e.g., myocardial infarction, stroke, etc.))), AIDS, allergy, inflammation,
neurodegenerative
disease (e.g., Alzheimer's disease, Parkinson's disease, amyotrophic lateral
sclerosis,
164
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
pigmentary retinitis, cerebellar degeneration, etc.), graft rejection (acute
and chronic), graft
vs. host disease, diseases due to osteomyelodysplasia (e.g., aplastic anemia,
etc.), joint tissue
destruction in rheumatism, liver disease (e.g., acute and chronic hepatitis,
liver injury, and
cirrhosis), autoimmune disease (e.g., multiple sclerosis, rheumatoid
arthritis, systemic lupus
erythematosus, immune complex glomerulonephritis, autoimmune diabetes,
autoimmune
thrombocytopenic purpura, Grave's disease, Hashimoto's thyroiditis, etc.),
cardiomyopathy
(e.g., dilated cardiomyopathy), diabetes, diabetic complications (e.g.,
diabetic nephropathy,
diabetic neuropathy, diabetic retinopathy), influenza, asthma, psoriasis,
glomerulonephritis,
septic shock, and ulcerative colitis.
[0452] Polynucleotides and/or polypeptides of the invention and/or agonists
and/or
antagonists thereof are useful in promoting angiogenesis, regulating
hematopoiesis and
wound healing (e.g., wounds, burns, and bone fractures).
[0453] Polynucleotides and/or polypeptides of the invention and/or agonists
and/or
antagonists thereof are also useful as an adjuvant to enhance immune
responsiveness to
specific antigen, anti-viral immune responses.
[0454] More generally, polynucleotides and/or polypeptides of the invention
and/or
agonists and/or antagonists thereof are useful in regulating (i.e., elevating
or reducing)
immune response. For example, polynucleotides and/or polypeptides of the
invention may be
useful in preparation or recovery from surgery, trauma, radiation therapy,
chemotherapy, and
transplantation, or may be used to boost immune response and/or recovery in
the elderly and
immunocompromised individuals. Alternatively, polynucleotides and/or
polypeptides of the
invention and/or agonists and/or antagonists thereof are useful as
immunosuppressive agents,
for example in the treatment or prevention of autoimmune disorders. In
specific
embodiments, polynucleotides and/or polypeptides of the invention are used to
treat or
prevent chronic inflammatory, allergic or autoimmune conditions, such as those
described
herein or are otherwise known in the art.
[0455] In one aspect, the present invention is directed to a method for
enhancing
apoptosis induced by a TNF-family ligand, which involves administering to a
patient
(preferably a human) a TNFR antagonists (e.g., an anti-TNFR antibody or TNFR
polypeptide
fragment). Preferably, the TNFR antagonist is administered to treat a disease
or condition
wherein increased cell survival is exhibited. Antagonists of the invention
include soluble
forms of TNFR and monoclonal antibodies directed against the TNFR polypeptide.
165
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0456] By "antagonist" is intended naturally occurnng and synthetic compounds
capable
of enhancing or potentiating apoptosis. By "agonist" is intended naturally
occurring and
synthetic compounds capable of inhibiting apoptosis. Whether any candidate
"agonist" or
"antagonist" of the present invention can inhibit or enhance apoptosis can be
determined
using art-known TNF-family ligandlreceptor cellular response assays, including
those
described in more detail below.
[0457] One such screening procedure involves the use of melanophores which are
transfected to express the receptor of the present invention. Such a screening
technique is
described in International application publication number WO 92/01810,
published February
6, 1992. Such an assay may be employed, for example, for screening for a
compound which
inhibits (or enhances) activation of the receptor polypeptide of the present
invention by
contacting the melanophore cells which encode the receptor with both a TNF-
family Iigand
and the candidate antagonist (or agonist). Inhibition or enhancement of the
signal generated
by the ligand indicates that the compound is an antagonist or agonist of the
ligand/receptor
signaling pathway.
[0458] Other screening techniques include the use of cells which express the
receptor (for
example, transfected CHO cells) in a system which measures extracellular pH
changes caused
by receptor activation, for example, as described in Sciefice 246:181-296
(October 1989). Fox
example, compounds may be contacted with a cell which expresses the receptor
polypeptide
of the present invention and a second messenger response, e.g., signal
transduction or pH
changes, may be measured to determine whether the potential compound activates
or inhibits
the xeceptor.
[0459] Another such screening technique involves introducing RNA encoding the
receptor into Xenopus oocytes to transiently express the receptor. The
receptor oocytes may
then be contacted with the receptor ligand and a compound to be screened,
followed by
detection of inhibition or activation of a calcium signal in the case of
screening for
compounds which are thought to inhibit activation of the receptor.
[0460] Another screening technique involves expressing in cells a construct
wherein the
receptor is linked to a phospholipase C or D. Such cells include endothelial
cells, smooth
muscle cells, embryonic kidney cells, etc. The screening may be accomplished
as
166
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
hereinabove described by detecting activation of the receptor or inhibition of
activation of the
receptor from the phospholipase signal.
[0461] Another method involves screening for compounds which inhibit
activation of the
receptor polypeptide of the present invention antagonists by determining
inhibition of binding
of labeled ligand to cells which have the receptor on the surface thereof.
Such a method
involves transfecting a eukaryotic cell with DNA encoding the receptor such
that the cell
expresses the receptor on its surface and contacting the cell with a compound
in the presence
of a labeled form of a known ligand. The ligand can be labeled, e.g., by
radioactivity. The
amount of labeled ligand bound to the receptors is measured, e.g., by
measuring radioactivity
of the receptors. If the compound binds to the receptor as determined by a
reduction of
labeled ligand which binds to the receptors, the binding of labeled ligand to
the receptor is
inhibited.
[0462] Further screening assays for agonist and antagonist of the present
invention are
described in Tartaglia, L.A., and Goeddel, D.V., J. Biol. C7Zefn. 267(7):4304-
4307(1992).
[0463] Thus, in a further aspect, a screening method is provided for
determining whether
a candidate agonist or antagonist is capable of enhancing or inhibiting a
cellular response to a
TNF-family Iigand. The method involves contacting cells which express the TNFR
polypeptide with a candidate compound and a TNF-family ligand, assaying a
cellular
response, and comparing the cellular response to a standard cellular response,
the standard
being assayed when contact is made with the ligand in absence of the candidate
compound,
whereby an increased cellular response over the standard indicates that the
candidate
compound is an agonist of the ligand/receptor signaling pathway and a
decreased cellular
response compared to the standard indicates that the candidate compound is an
antagonist of
the ligand/receptor signaling pathway. By "assaying a cellular response" is
intended
qualitatively or quantitatively measuring a cellular response to a candidate
compound and/or
a TNF-family ligand (e.g., determining or estimating an increase or decrease
in T cell
proliferation or tritiated thymidine labeling). By the invention, a cell
expressing the TNFR
polypeptide can be contacted with either an endogenous or exogenously
administered TNF-
family ligand.
[0464] Agonist according to the present invention include naturally occurring
and
synthetic compounds such as, fox example, TNF family Iigand peptide fragments,
167
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
transforming growth factor, neurotransmitters (such as glutamate, dopamine, N
methyl-D-
aspartate), tumor suppressors (p53), cytolytic T cells and antimetabolites.
Preferred agonists
include chemotherapeutic drugs such as, for example, cisplatin, doxorubicin,
bleomycin,
cytosine arabinoside, nitrogen mustard, methotrexate and vincristine. Others
include ethanol
and -amyloid peptide. (Sciefzce 267:1457-1458 (1995)). Further preferred
agonists include
polyclonal and monoclonal antibodies raised against the TNFR polypeptide, or a
fragment
thereof. Such agonist antibodies raised against a TNF-family receptor are
disclosed in
Tartaglia, L.A., et al., Proc. Natl. Acad. Sci. ZISA 88:9292-9296 (1991); and
Tartaglia,
L.A., and Goeddel, D.V., J. Biol. Chem. 267 (7):4304-4307 (1992) See, also,
International
application publication number WO 94/09137.
[0465] Antagonists according to the present invention include naturally
occurring and
synthetic compounds such as, for example, the CD40 ligand, neutral amino
acids, zinc,
estrogen, androgens, viral genes (such as Adenovirus EIB, Baculovirus p35 and
IAP, Cowpox
virus crrnA, Epstein-Barr virus BHRFl, LMP-1, African swine fever virus LMWS-
HL, and
Herpesvirus y1 34.5), calpain inhibitors, cysteine protease inhibitors, and
tumor promoters
(such as PMA, Phenobarbital, and -Hexachlorocyclohexane). Other antagonists
include
polyclonal and monoclonal antagonist antibodies raised against the TNFR
polypeptides or a
fragment thereof. Such antagonist antibodies raised against a TNF-family
receptor are
described in Tartaglia, L.A., and Goeddel, D.V., J. Biol. ClZem. 267(7):4304-
4307 (1992) and
Tartaglia, L.A. et al., Cell 73:213-216 (1993). See, also, International
application publication
number WO 94/09137.
[0466] In specific embodiments, antagonists according to the present invention
are
nucleic acids corresponding to the sequences contained in TNFR, or the
complementary
strand thereof, and/or to nucleotide sequences contained in the deposited
clones (ATCC
Deposit Nos. 97810 and 97809). In one embodiment, antisense sequence is
generated
internally by the organism, in another embodiment, the antisense sequence is
separately
administered (see, for example, O'Connor, J., Neurochem. 56:560 (1991) and
Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC Press,
Boca Raton,
FL (1988). Antisense technology can be used to control gene expression through
antisense
DNA or RNA, or through triple-helix formation. Antisense techniques are
discussed for
example, in Okano, J., Neuroclaenz. 56:560 (1991); Oligodeoxynucleotides as
Antisense
168
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix
formation is
discussed in, for instance, Lee et al., Nucleic Acids Research 6:3073 (1979);
Gooney et al.,
Science 241:456 (1988); and Dervan et al., Science 251:1300 (1991). The
methods are based
on binding of a polynucleotide to a complementary DNA or RNA.
[0467] Fox example, the 5' coding portion of a polynucleotide that encodes the
mature
polypeptide of the present invention may be used to design an antisense RNA
oligonucleotide
of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed
to be
complementary to a region of the gene involved in transcription thereby
preventing
transcription and the production of the receptor. The antisense RNA
oligonucleotide
hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule
into receptor
polypeptide.
[0468] In one embodiment, the TNFR antisense nucleic acid of the invention is
produced
intracellularly by transcription from an exogenous sequence. For example, a
vector or a
portion thereof, is transcribed, producing an antisense nucleic acid (RNA) of
the invention.
Such a vector would contain a sequence encoding the TNFR antisense nucleic
acid. Such a
vector can remain episomal or become chromosomally integrated, as long as it
can be
transcribed to produce the desired antisense RNA. Such vectors can be
constructed by
recombinant DNA technology methods standard in the art. Vectors can be
plasmid, viral, or
others know in the art, used for replication and expression in vertebrate
cells. Expression of
the sequence encoding TNFR, or fragments thereof, can be by any promoter known
in the art
to act in vertebrate, preferably human cells. Such promoters can be inducible
or constitutive.
Such promoters include, but are not Limited to, the SV40 early promoter region
(Bernoist and
Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long
terminal repeat of
Rous sarcoma virus (Yamamoto et al., Cell 22:787-797 (1980), the herpes
thymidine
promoter (Wagner et al., P~-oc. Natl. Acad. Sci. U.S.A. 75:1441-1445 (1981),
the regulatory
sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42
(1982)), etc.
[0469] The antisense nucleic acids of the invention comprise a sequence
complementary
to at least a portion of an RNA transcript of a TNFR gene. However, absolute
complementarity, although preferred, is not xequired. A sequence
"complementary to at least
a portion of an RNA," referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a stable duplex;
in the case
169
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
of double stranded TNFR antisense nucleic acids, a single strand of the duplex
DNA may
thus be tested, or triplex formation may be assayed. The ability to hybridize
will depend on
both the degree of complementarity and the length of the antisense nucleic
acid Generally,
the larger the hybridizing nucleic acid, the more base mismatches with a TNFR
RNA it may
contain and still form a stable duplex (or triplex as the case may be). One
skilled in the art
can ascertain a tolerable degree of mismatch by use of standard procedures to
determine the
melting point of the hybridized complex.
[0470] Oligonucleotides that are complementary to the 5' end of the message,
e.g., the 5'
untranslated sequence up to and including the AUG initiation codon, should
work most
efficiently at inhibiting translation. However, sequences complementary to the
3'
untranslated sequences of mRNAs have been shown to be effective at inhibiting
translation of
mRNAs as well. See generally, Wagner, R., Nature 372:333-335 (1994). Thus,
oligonucleotides complementary to either the 5'- or 3'- non- translated, non-
coding regions of
the TNFR shown in Figures 1 and 2 could be used in an antisense approach to
inhibit
translation of endogenous TNFR mRNA. Oligonucleotides complementary to the 5'
untranslated region of the mRNA should include the complement of the AUG start
codon.
Antisense oligonucleotides complementary to mRNA coding regions are less
efficient
inhibitors of translation but could be used in accordance with the invention.
Whether
designed to hybridize to the 5'-, 3'- or coding region of TNFR mRNA, antisense
nucleic acids
should be at least six nucleotides in length, and are preferably
oligonucleotides ranging from
6 to about 50 nucleotides in length. In specific aspects the oligonucleotide
is at least 10
nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50
nucleotides.
[0471] The polynucleotides of the invention can be DNA or RNA or chimeric
mixtures or
derivatives or modified versions thereof, single-stranded or double-stranded.
The
oligonucleotide can be modified at the base moiety, sugar moiety, or
phosphate~backbone, for
example, to improve stability of the molecule, hybridization, etc. The
oligonucleotide may
include other appended groups such as peptides (e.g., for targeting host cell
receptors ih vivo),
or agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., Proe.
Natl. Acad. Sci. U.S.A. 86:6553-6556 (1989); Lemaitre et al., Proc. Natl.
Acad. Sci. 84:648-
652 (1987); PCT Publication No. W088/09810; published December 15, 1988) or
the blood-
brain barrier (see, e.g., PCT Publication No. W089/10134, published April 25,
1988),
170
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
hybridization-triggered cleavage agents. (See, e.g., I~rol et al.,
BioTechniques 6:958-976
(1988)) or intercalating agents. (See, e.g., Zon, Pl2arni. Res. 5:539-549
(1988)). To this end,
the oligonucleotide may be conjugated to another molecule, e.g., a peptide,
hybridization
triggered cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
[0472] The antisense oligonucleotide may comprise at least one modified base
moiety
which is selected from the group including, but not limited to, 5-
fluorouracil, 5-bromouracil,
5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-
adenine,
7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-
D-mannosylqueosine, 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-
methylthio-N6-
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine,
2-thiocytosine, S-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-
methyluracil, uracil-
5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-
thiouracil, 3-(3-amino-
3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
[04'73] The antisense oligonucleotide may also comprise at least one modified
sugar
moiety selected from the group including, but not limited to, arabinose, 2-
fluoroarabinose,
xylulose, and hexose.
[0474] In yet another embodiment, the antisense oligonucleotide comprises at
least one
modified phosphate backbone selected from the group including, but not limited
to, a
phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a
formacetal or
analog thereof.
[0475] In yet another embodiment, the antisense oligonucleotide is an a-
anomeric
oligonucleotide. An oc-anomeric oligonucleotide forms specific double-stranded
hybrids with
complementary RNA in which, contrary to the usual 13-units, the strands run
parallel to each
other (Gautier et al., Nucl. Acids Res. 15:6625-6641 (1987)). The
oligonucleotide is a 2ø-0-
methylribonucleotide (moue et al., Nucl. Acids Res. 15:6131-6148 (1987)), or a
chimeric
RNA-DNA analogue (moue et al., FEBS Lett. 215:327-330 (1987)).
171
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0476] Polynucleotides of the invention may be synthesized by standard methods
known
in the art, e.g. by use of an automated DNA synthesizer (such as are
commercially available
from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides
may be synthesized by the method of Stein et al. (Nucl. Acids Res. 16:3209
(1988)),
methylphosphonate oligonucleotides can be prepared by use of controlled pore
glass polymer
supports (Satin et al., Proc. Nat!. Acad. Sci. U.S.A. 85:7448-7451 (1988)),
etc.
[0477] ~ While antisense nucleotides complementary to the TNFR coding region
sequence
could be used, those complementary to the transcribed untranslated region are
most preferred.
[0478] Potential antagonists according to the invention also include catalytic
RNA, or a
ribozyme (See, e.g., International application publication number WO 90!11364,
published
October 4, 1990; Sarver et al, Science 247:1222-1225 (1990). While ribozymes
that cleave
mRNA at site specific recognition sequences can be used to destroy TNFR mRNAs,
the use
of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at
locations
dictated by flanking regions that form complementary base pairs with the
target mRNA. The
sole requirement is that the target mRNA have the following sequence of two
bases: 5'-UG-
3'. The construction and production of hammerhead ribozymes is well known in
the art and
is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988).
There are
numerous potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of
TNFR-hoc (Figure 1, SEQ ID NO:1) and TNFR-6(3 (Figure 2, SEQ ID N0:3).
Preferably, the
ribozyme is engineered so that the cleavage recognition site is located near
the 5' end of the
TNFR mRNA; i.e., to increase efficiency and minimize the intracellular
accumulation of non-
functional mRNA transcripts.
[0479] As in the antisense approach, the ribozymes of the invention can be
composed of
modified oligonucleotides (e.g. for improved stability, targeting, etc.) and
should be delivered
to cells which express TNFR in vivo. DNA constructs encoding the ribozyme may
be
introduced into the cell in the same manner as described above for the
introduction of
antisense encoding DNA. A preferred method of delivery involves using a DNA
construct
"encoding" the ribozyme under the control of a strong constitutive promoter,
such as, for
example, pol III or pol II promoter, so that transfected cells will produce
sufficient quantities
of the ribozyme to destroy endogenous TNFR messages and inhibit translation.
Since
172
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
ribozymes unlike antisense molecules, are catalytic, a lower intracellular
concentration is
required for efficiency.
[0480] Endogenous gene expression can also be reduced by inactivating or
"knocking
out" the TNFR gene and/or its promoter using targeted homologous
recombination. (E.g., see
Smithies et al., Nature 317:230-234 (1985); Thomas & Capecchi, Cell 51:503-512
(1987);
Thompson et al., Cell 5:313-321 (1989); each of which is incorporated by
reference herein in
its entirety). For example, a mutant, non-functional polynucleotide of the
invention (or a
completely unrelated DNA sequence) flanked by DNA homologous to the endogenous
polynucleotide sequence (either the coding regions or regulatory regions of
the gene) can be
used, with or without a selectable marker and/or a negative selectable marker,
to transfect
cells that express polypeptides of the invention in vivo. In another
embodiment, techniques
known in the art are used to generate knockouts in cells that contain, but do
not express the
gene of interest. Insertion of the DNA construct, via targeted homologous
recombination,
results in inactivation of the targeted gene. Such approaches are particularly
suited in
research and agricultural fields where modifications to embryonic stem cells
can be used to
generate animal offspring with an inactive targeted gene (e.g., see Thomas &
Capecchi 1987
and Thompson 1989, supra). However this approach can be routinely adapted for
use in
humans provided the recombinant DNA constructs are directly administered or
targeted to the
required site irc vivo using appropriate viral vectors that will be apparent
to those of skill in
the art. The contents of each of the documents recited in this paragraph is
herein incorporated
by reference in its entirety.
[0481] Antibodies according to the present invention may be prepared by any of
a variety
of standard methods using TNFR immunogens of the present invention. Such TNFR
immunogens include the TNFR protein shown in Figures 1 and 2 (SEQ ID NO:2 and
SEQ ID
N0:4, respectively) (which may or may not include a leader sequence) and
polypeptide
fragments of TNFR comprising the ligand binding and/or extracellular domains
of TNFR.
[0482] Polyclonal and monoclonal antibody agonists or antagonists according to
the
present invention can be raised according to the methods disclosed herein and
and/or known
in the art, such as, for example, those methods described in Tartaglia and
Goeddel, J. Biol.
Chena. 267(7):4304-4307(1992); Tartaglia et al., Cell 73:213-216 (1993), and
International
application publication number WO 94/09137 (the contents of each of these
three
173
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
applications are herein incorporated by reference in their entireties), and
are preferably
specific to polypeptides of the invention having the amino acid sequence of
SEQ ID N0:2
and/or SEQ ID N0:4. Antibodies according to the present invention may be
prepared by any
of a variety of methods described herein, and known in the art.
[0483] Further antagonist according to the present invention include soluble
forms of
TNFR, e.g., TNFR fragments that include the ligand binding domain from the
extracellular
region of the full length receptor. Such soluble forms of the receptor, which
may be naturally
occurring or synthetic, antagonize TNFR mediated signaling by competing with
the cell
surface TNFR for binding to TNF-family ligands and/or antagonize TNFR mediated
inhibition of apoptosis by, for example, disrupting the ability of TNFR to
multimerize and/or
to bind to and thereby neutralize apoptosis inducing ligands, such as, for
example, Fas ligand
and AIM-IL. Thus, soluble forms of the receptor that include the ligand
binding domain are
novel cytokines capable of reducing TNFR-mediated inhibition of tumor necrosis
induced by
TNF-family ligands. Other such cytokines are known in the art and include Fas
B (a soluble
form of the mouse Fas receptor) that acts physiologically to limit apoptosis
induced by Fas
ligand (Hughes, D.P. and Crispe, LN., J. Exp. Med. 182:1395-1401 (1995)).
[0484] Proteins and other compounds which bind the extracellular domains are
also
candidate agonist and antagonist according to the present invention. Such
binding
compounds can be "captured" using the yeast two-hybrid system (Fields and
Song, Nature
340:245-246 (1989)). A modified version of the yeast two-hybrid system has
been described
by Roger Brent and his colleagues (Gyuris, J. et al., Cell 75:791-803 (1993);
Zervos, A.S. et
al., Cell 7:223-232 (1993)).
[0485] By a "TNF-family ligand" is intended naturally occurring, recombinant,
and
synthetic ligands that are capable of binding to a member of the TNF receptor
family and
inducing the ligand/receptor signaling pathway. Members of the TNF ligand
family include,
but are not limited to, the TNFR-6a & -6(3 ligands, TNF-oc , lymphotoxin-a (LT-
a , also
known as TNF-(3 ), LT-(3, Fast, CD40, CD27, CD30, 4-1BB, OX40, TRAIL, AIM-lI,
and
nerve growth factor (NGF).
174
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Formulation and Administration
[0486] The TNFR polypeptide composition will be formulated and dosed in a
fashion
consistent with good medical practice, taking into account the clinical
condition of the
individual patient (especially the side effects of treatment with TNFR-hoc or -
6(3 polypeptide
alone), the site of delivery of the TNFR polypeptide composition, the method
of
administration, the scheduling of administration, and other factors known to
practitioners.
The "effective amount" of TNFR polypeptide for purposes herein is thus
determined by such
considerations.
[0487] As a general proposition, the total pharmaceutically effective amount
of TNFR
polypeptide administered parenterally per dose will be in the range of about 1
~.g/kg/day to 10
mg/kg/day of patient body weight, although, as noted above, this will be
subject to
therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day,
and most
preferably for humans between about 0.01 and 1 mglkg/day for the hormone. If
given
continuously, the TNFR polypeptide is typically administered at a dose rate of
about 1
~,g/kg/hour to about 50 ~,g/kg/hour, either by I-4 injections per day or by
continuous
subcutaneous infusions, for example, using a mini-pump. An intravenous bag
solution may
also be employed. The length of treatment needed to observe changes and the
interval
following treatment for responses to occur appears to vary depending on the
desired effect.
[0488] Effective dosages of the compositions of the present invention to be
administered
may be determined through procedures well known to those in the art which
address such
parameters as biological half life, bioavailability, and toxicity. Such
determination is well
within the capability of those skilled in the art, especially in light of the
detailed disclosure
provided herein.
[0489] Bioexposure of an organism to TNFR-6cc or -6j3 polypeptide during
therapy may
also play an important role in determining a therapeutically and/or
pharmacologically
effective dosing regime. Variations of dosing such as repeated administrations
of a relatively
low dose of TNFR-6a or -6(3 polypeptide for a relatively long period of time
may have an
effect which is therapeutically and/or pharmacologically distinguishable from
that achieved
with repeated administrations of a relatively high dose of TNFR-hoc or -6(3
polypeptide for a
relatively short period of time.
175
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0490] Using the equivalent surface area dosage conversion factors supplied by
Freireich,
E. J., et al. (Cancer Che~i.otherapy Reports 50(4):219-44 (1966)), one of
ordinary skill in the
art is able to conveniently convert data obtained from the use of TNFR-hoc or -
6(3
polypeptide in a given experimental system into an accurate estimation of a
pharmaceutically
effective amount of TNFR-6cc or -6(3 polypeptide to be administered per dose
in another
experimental system. Experimental data obtained through the administration of
TNFR6-Fc in
mice (see, for instance, Example 21) may converted through the conversion
factors supplied
by Freireich, et al., to accurate estimates of pharmaceutically effective
doses of TNFR-6 in
rat, monkey, dog, and human. The following conversion table (Table IV) is a
summary of the
data provided by Freireich, et al. Table IV gives approximate factors for
converting doses
expressed in terms of mglkg from one species to an equivalent surface area
dose expressed as
mg/kg in another species tabulated.
Table IV. Equivalent Surface Area Dosage Conversion Factors.
--TO--
Mouse Rat Monkey Dog Human
--FROM-- (20g,) (1500 (3.5kg~(8k~) (60kg)
Mouse 1 1/2 1/4 1/6 1/12
Rat 2 1 ~ 1/2 1/4 1/7
Monkey 4 2 1 3/5 1/3
Dog 6 4 5/3 1 1/2
Human 12 7 3 2 1
[0491] Thus, for example, using the conversion factors provided in Table IV, a
dose of 50
mg/kg in the mouse converts to an appropriate dose of 12.5 mg/kg in the monkey
because (50
mg/kg) x (1/4) = 12.45 mg/kg. As an additional example, doses of 0.02, 0.08,
0.8, 2, and 8
mg/kg in the mouse equate to effect doses of 1.667 micrograms/kg, 6.67
micrograms/kg, 66.7
micrograms/kg, 166.7 micrograrns/kg, and 0.667 mg/kg, respectively, in the
human.
[0492] TNFR-6 alpha and/or TNFR-6 beta polypeptides of the invention may be
administered using any method known in the art, including, but not limited to,
direct needle
176
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
injection at the delivery site, intravenous injection, topical administration,
catheter infusion,
biolistic injectors, particle accelerators, gelfoam sponge depots, other
commercially available
depot materials, osmotic pumps, oral or suppositorial solid pharmaceutical
formulations,
decanting or topical applications during surgery, aerosol delivery. Such
methods are known
in the art. TNFR-6 alpha and/or TNFR-6 polypeptides of the invention may be
administered
as part of a pharmaceutical composition, described in more detail below.
Methods of
delivering TNFR-6 alpha and/or TNFR-6 beta polynucleotides of the invention
are known in
the art and described in more detail herein.
[0493] Pharmaceutical compositions containing the TNFR of the invention may be
administered orally, rectally, parenterally, intracistemally, intravaginally,
intraperitoneally,
topically (as by powders, ointments, drops or transdermal patch), bucally, or
as an oral or
nasal spray. By "pharmaceutically acceptable carrier" is meant a non-toxic
solid, semisolid
or liquid filler, diluent, encapsulating material or formulation auxiliary of
any type. The
composition, if desired, can also contain minor amounts of wetting or
emulsifying agents, or
pH buffering agents. These compositions can take the form of solutions,
suspensions,
emulsion, tablets, pills, capsules, powders, sustained-release formulations
and the like. The
term "parenteral" as used herein refers to modes of administration which
include intravenous,
intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular
injection and
infusion.
[0494] The TNFR polypeptide is also suitably administered by sustained-release
systems.
Suitable examples of sustained-release compositions include suitable polymeric
materials
(such as, fox example, semi-permeable polymer matrices in the form of shaped
articles, e.g.,
films, or mirocapsules), suitable hydrophobic materials (for example as an
emulsion in an
acceptable oil) or ion exchange resins, and sparingly soluble derivatives
(such as, for
example, a sparingly soluble salt).
[0495] Sustained-release matrices include polylactides (U.S. Pat. No.
3,773,919, EP
58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U.
et al.,
Biopoly~riers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (R.
Langer et al., J.
Bioyned. Mater. Res. 15:167-277 (1981), and R. Langer, Chem. Tech. 12:98-105
(1982)),
ethylene vinyl acetate (R. Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric
acid (EP
133,988).
177
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0496] In a preferred embodiment, compositions of the invention are formulated
in a
biodegradable, polymeric drug delivery system, for example as described in
U.S. Patent Nos.
4,938,763; 5,278,201; 5,278,202; 5,324,519; 5,340,849; and 5,487,897 and in
International
Publication Numbers W001/35929, WO00/24374, and WO00/06117 which are hereby
incorporated by reference in their entirety. In specific preferred embodiments
the
compositions of the invention are formulated using the ATRIGEL~ Biodegradable
System of
Atrix Laboratories, Inc. (Fort Collins, Colorado).
[0497] Examples of biodegradable polymers which can be used in the formulation
of
compositions of the invention include, but are not limited to, polylactides,
polyglycolides,
polycaprolactones, polyanhydrides, polyamides, polyurethanes, polyesteramides,
polyorthoesters, polydioxanones, polyacetals, polyketaIs, polycarbonates,
polyorthocarbonates, polyphosphazenes, polyhydroxybutyrates,
polyhydroxyvalerates,
polyalkylene oxalates, polyalkylene succinates, poly(malic acid), poly(amino
acids),
poly(methyl vinyl ether), poly(maleic anhydride), polyvinylpyrrolidone,
polyethylene glycol,
polyhydroxycellulose, chitin, chitosan, and copolymers, terpolymers, or
combinations or
mixtures of the above materials. The preferred polymers are those that have a
lower degree of
crystallization and are more hydrophobic. These polymers and copolymers are
more soluble
in the biocompatible solvents than the highly crystalline polymers such as
polyglycolide and
chitin which also have a high degree of hydrogen-bonding. Preferred materials
with the
desired solubility parameters are the polylactides, polycaprolactones, and
copolymers of these
with glycolide in which there are more amorphous regions to enhance
solubility. . In specific
preferred embodiments, the biodegradable polymers which can be used in the
formulation of
compositions of the invention are poly(lactide-co-glycolides). Polymer
properties such as
molecular weight, hydrophobicity, and lactide/glycolide ratio may be modified
to obtain the
desired drug release profile (See, e.g., Ravivarapu et al., Journal of
Pharmaceutical Sciences
89:732-741 (2000), which is hereby incorporated by reference in its entirety).
[0498] It is also preferred that the solvent for the biodegradable polymer be
non-toxic,
water miscible, and otherwise biocompatible. Examples of such solvents
include, but are not
limted to, N-methyl-2-pyrrolidone, 2-pyrrolidone, C2 to C6 alkanols, C1 to C15
alchohols,
dils, triols, and tetraols such as ethanol, glycerine propylene glycol,
butanol; C3 to C15 alkyl
ketones such as acetone, diethyl ketone and methyl ethyl ketone; C3 to C15
esters such as
methyl acetate, ethyl acetate, ethyl lactate; alkyl ketones such as methyl
ethyl ketone, C1 to
178
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
C15 amides such as dimethylformamide, dimethylacetamide and caprolactam; C3 to
C20
ethers such as tetrahydrofuran, or solketal; tweens, triacetin, propylene
carbonate,
decylmethylsulfoxide, dimethyl sulfoxide, oleic acid, 1-dodecylazacycloheptan-
2-one, Other
preferred solvents are benzyl alchohol, benzyl benzoate, dipropylene glycol,
tributyrin, ethyl
oleate, glycerin, glycofural, isopropyl myristate, isopropyl palmitate, oleic
acid, polyethylene
glycol, propylene carbonate, and triethyl citrate. The most preferred solvents
are N-methyl-2-
pyrrolidone, 2-pyrrolidone, dimethyl sulfoxide, triacetin, and propylene
carbonate because of
the solvating ability and their compatibility.
[0499] Additionally, formulations comprising compositions of the invention and
a
biodegradable polymer may also include release-rate modification agents and/or
pore-
forming agents. Examples of release-rate modification agents include, but are
not limited to,
fatty acids, triglycerides, other like hydrophobic compounds, organic
solvents, plasticizing
compounds and hydrophilic compounds. Suitable release rate modification agents
include, for
example, esters of mono-, di-, and tricarboxylic acids, such as 2-ethoxyethyl
acetate, methyl
acetate, ethyl acetate, diethyl phthalate, dimethyl phthalate, dibutyl
phthalate, dimethyl
adipate, dimethyl succinate, dimethyl oxalate, dimethyl citrate, triethyl
citrate, acetyl tributyl
citrate, acetyl triethyl citrate, glycerol triacetate, di(n-butyl) sebecate,
and the like;
polyhydroxy alcohols, such as propylene glycol, polyethylene glycol, glycerin,
sorbitol, and
the like; fatty acids; triesters of glycerol, such as triglycerides,
epoxidized soybean oil, and
other epoxidized vegetable oils; sterols, such as cholesterol; alcohols, such
as C<sub>6</sub> -
C<sub>l2</sub> alkanols, 2-ethoxyethanol, and the like. The release rate
modification agent may be
used singly or in combination with other such agents. Suitable combinations of
release rate
modification agents include, but are not limited to, glycerin/propylene
glycol,
sorbitol/glycerine, ethylene oxide/propylene oxide, butylene glycol/adipic
acid, and the like.
Preferred release rate modification agents include, but are not limited to,
dimethyl citrate,
triethyl citrate, ethyl heptanoate, glycerin, and hexanediol. Suitable pore-
forming agents that
may be used in the polymer composition include, but are not limited to, sugars
such as
sucrose and dextrose, salts such as sodium chloride and sodium carbonate,
polymers such as
hydroxylpropylcellulose, carboxymethylcellulose, polyethylene glycol, and
polyvinylpyrrolidone. Solid crystals that will provide a defined pore size,
such as salt or
sugar, are preferred.
179
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0500] In specific preferred embodiments the compositions of the invention are
formulated using the BEMATM BioErodible Mucoadhesive System, MCATM
MucoCutaneous
Absorption System, SMPTM Solvent MicroParticle System, or BCPTM BioCompatible
Polymer System of Atrix Laboratories, Inc. (Fort Collins, Colorado). In other
specific
embodiments, compositions of the invention are formulated using the ProLease~
sustained
release sytem available from Alkermes, Inc. (Cambridge, MA).
[0501] Sustained-release compositions also include liposomally entrapped
compositions
of the invention (see generally, Langer, Scieface 249:1527-1533 (1990); Treat
et al., in
Liposon2es i~2 the Therapy of Ifzfectious Disease and Cancer, Lopez-Berestein
and Fidler
(eds.), Liss, New York, pp. 317 -327 and 353-365 (1989)).. Liposomes
containing TNFR
polypeptides my be prepared by methods known per se: DE 3,218,121; Epstein et
al., Proc.
Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad.
Sci. (USA)
77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641;
Japanese
Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324.
Ordinarily,
the liposomes are of the small (about 200-800 Angstroms) unilamellar type in
which the lipid
content is greater than about 30 mol. percent cholesterol, the selected
proportion being
adjusted for the optimal TNFR polypeptide therapy.
[0502] In yet an additional embodiment, the compositions of the invention are
delivered
by Way of a pump (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng.
14:201 (1987);
Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med.
321:574 (1989)).
[0503] Other controlled release systems are discussed in the review by Langer
(Scietzce
249:1527-1533 (1990)).
[0504] For parenteral administration, in one embodiment, the TNFR polypeptide
is
formulated generally by mixing it at the desired degree of purity, in a unit
dosage injectable
form (solution, suspension, or emulsion), with a pharmaceutically acceptable
earner, i.e., one
that is non-toxic to recipients at the dosages and concentrations employed and
is compatible
with other ingredients of the formulation. For example, the formulation
preferably does not
include oxidizing agents and other compounds that are known to be deleterious
to
polypeptides.
[0505] Generally,. the formulations are prepared by contacting the TNFR
polypeptide
uniformly and intimately with liquid carriers or finely divided solid carriers
or both. Then, if
180
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
necessary, the product is shaped into the desired formulation. Preferably the
carrier is a
parenteral carrier, more preferably a solution that is isotonic with the blood
of the recipient.
Examples of such carrier vehicles include water, saline, Ringer's solution,
and dextrose
solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also
useful herein, as
well as liposomes.
[0506] The carrier suitably contains minor amounts of additives such as
substances that
enhance isotonicity and chemical stability. Such materials are non-toxic to
recipients at the
dosages and concentrations employed, and include buffers such as phosphate,
citrate,
succinate, acetic acid, and other organic acids or their salts; antioxidants
such as ascorbic
acid; low molecular weight (less than about ten residues) polypeptides, e.g.,
polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins;
hydrophilic
polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic
acid, aspartic
acid, or arginine; monosaccharides, disaccharides, and other carbohydrates
including
cellulose or its derivatives, glucose, manose, or dextrins; chelating agents
such as EDTA;
sugar alcohols such as mannitol or sorbitol; counterions such as sodium;
and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
[0507] The TNFR polypeptide is typically formulated in such vehicles at a
concentration
of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to
8. It will be
understood that the use of certain of the foregoing excipients, carriers, or
stabilizers will
result in the formation of TNFR polypeptide salts.
[050$] TNFR polypeptides to be used for therapeutic administration must be
sterile.
Sterility is readily accomplished by filtration through sterile filtration
membranes (e.g., 0.~
micron membranes). Therapeutic TNFR polypeptide compositions generally are
placed into
a container having a sterile access port, for example, an intravenous solution
bag or vial
having a stopper pierceable by a hypodermic injection needle.
[0509] TNFR polypeptides ordinarily will be stored in unit or mufti-dose
containers, for
example, sealed ampoules or vials, as an aqueous solution or as a lyophilized
formulation for
reconstitution. As an example of a lyophilized formulation, 10-ml vials are
filled with 5 ml
of sterile-filtered 1% (w/v) aqueous TNFR polypeptide solution, and the
resulting mixture is
lyophilized. The infusion solution is prepared by reconstituting the
lyophilized TNFR
polypeptide using bacteriostatic Water-for-Injection.
181
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0510] The invention also provides a pharmaceutical pack or kit comprising one
or more
containers filled with one or more of the ingredients of the pharmaceutical
compositions of
the invention. Associated with such containers) can be a notice in the form
prescribed by a
governmental agency regulating the manufacture, use or sale of pharmaceuticals
or biological
products, which notice reflects approval by the agency of manufacture, use or
sale for human
administration. In addition, the polypeptides of the present invention may be
employed in
conjunction with other therapeutic compounds.
[0511] The compositions of the invention may be administered alone or in
combination
with other therapeutic agents, including but not limited to, chemotherapeutic
agents, anti-
opportunistic infection agents, antivirals, antibiotics, steroidal and non-
steroidal anti-
inflammatories, immunosuppressants, conventional immunotherapeutic agents and
cytokines.
Combinations may be administered either concomitantly, e.g., as an admixture,
separately but
simultaneously or concurrently; or sequentially. This includes presentations
in which the
combined agents are administered together as a therapeutic mixture, and also
procedures in
which the combined agents are administered separately but simultaneously,
e.g., as through
separate intravenous lines into the same individual. Administration "in
combination" further
includes the separate administration of one of the compounds or agents given
first, followed
by the second.
[0512] In one embodiment, the compositions of the invention are administered
in
combination with other members of the TNF family. TNF, TNF-related or TNF-like
molecules that may be administered with the compositions of the invention
include, but are
not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also
known as
TNF-beta), LT-beta (found in complex heterotrimer LT-alpha2-beta), OPGL,
CD27L,
CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma International application
publication
number WO 96/14328), AIM-I (International application publication number WO
97/33899),
AIM-II (International application publication number WO 97/34911), APRIL (J.
Exp. Med.
188(6):1185-1190), endokine-alpha (International Publication No. WO 98/07880),
OPG, and
neutrokine-alpha (International application publication number WO 98/18921),
TWEAK,
OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27,
CD40 and
4-IBB, TR2 (International application publication number WO 96/34095), DR3
(International
Publication No. WO 97/33904), DR4 (International application publication
number WO
98/32856), TR5 (International application publication number WO 98/30693), TR7
I82
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
(International application publication number WO 98/41629), TRANK, TR9
(International
application publication number WO 98/56892), TR10 (International application
publication
number WO 98/54202),312C2 (International application publication number WO
98/06842),
and TR12.
[0513] Conventional nonspecific immunosuppressive agents, that may be
administered in
combination with the compositions of the invention include, but are not
limited to, steroids,
cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone,
prednisone,
azathioprine, FK-506, I5-deoxyspergualin, and other immunosuppressive agents
that act by
suppressing the function of responding T cells.
[0514] In specific embodiments, compositions of the invention are administered
in
combination with immunosuppressants. Immunosuppressants preparations that may
be
administered with the compositions of the invention include, but are not
limited to,
ORTHOCLONET"" (OKT3), SANDIIVVIMUNET""/NEORALT""/SANGDYAT"~ (cyclosporin),
PROGRAFT"~ (tacrolimus), CELLCEPTT"" (mycophenolate), Azathioprine,
glucorticosteroids,
and RAPAMCTNET"" (sirolimus). In a specific embodiment, irilmunosuppressants
may be
used to prevent rejection of organ or bone marrow transplantation.
[0515] In certain embodiments, compositions of the invention are administered
in
combination with antiretroviral agents, nucleoside reverse transcriptase
inhibitors, non-
nucleoside reverse transcriptase inhibitors, andlor protease inhibitors.
Nucleoside reverse
transcriptase inhibitors that may be administered in combination with the
compositions of the
invention, include, but are not limited to, RETROVIRT"" (zidovudine/AZT),
VIDEXT"'
(didanosine/ddI), HIVIDT"" (zalcitabine/ddC), ZERITT"" (stavudine/d4T),
EPIVIRT""
(lamivudine/3TC), and COMBIVIRT"' (zidovudine/lamivudine). Non-nucleoside
reverse
transcriptase inhibitors that may be administered in combination with the
compositions of the
invention, include, but are not limited to, VIRAMUNET"" (nevirapine),
RESCRIPTORT"'
(delavirdine), and SUSTIVAT"~ (efavirenz). Protease inhibitors that may be
administered in
combination with the compositions of the invention, include, but are not
limited to,
CRIXIVANT"" (indinavir), NORVll2T"~ (ritonavir), INVIRASET"' (saquinavir), and
VIRACEPTT~~ (nelfinavir). In a specific embodiment, antiretroviral agents,
nucleoside
reverse transcriptase inhibitors, non-nucleoside reverse transcriptase
inhibitors, and/or
183
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
protease inhibitors may be used in any combination with compositions of the
invention to
treat AIDS and/or to prevent or treat HIV infection.
[0516] In other embodiments, compositions of the invention may be administered
in
combination with anti-opportunistic infection agents. Anti-opportunistic
agents that may be
administered in combination with the compositions of the invention, include,
but axe not
limited to, TRINIETHOPRIM-SULFAMETHOXAZOLET"', DAPSONET"",
PENTAMIDINET"", ATOVAQUONET"", ISONIAZIDT"", RIFAMPIN~M, PYRAZINAMIDET"",
ETHAMBUTOLT"", RIFABUTINT"", CLARITHROMYCINT"", AZITHROMYCINT"",
GANCICLOVIRT"", FOSCARNETTM, CIDOFOVIRT"", FLUCONAZOLET"",
ITRACONAZOLET"~, I~ETOCONAZOLEr"", ACYCLOVIRT~~, FAMCICOLVIRTM,
PYRIMETHAMINETM, LEUCOVORINT"", NEUPOGENTM (filgrastim/G-CSF), and
LEUKINET"" (sargramostim/GM-CSF). In a specific embodiment, compositions of
the
invention are used in any combination with TRIIUVIETHOPRIM-
SULFAMETHOXAZOLET"',
DAPSONET"~, PENTAMIDINET"", and/or ATOVAQUONETM to prophylactically treat or
prevent an opportunistic Pfaeumocystis carafaii pneumonia infection. In
another specific
embodiment, compositions of the invention are used in any combination with
ISONIAZIDT"~,
RIFAMPINT"", PYRAZINAM1DET"~, and/or ETHAMBUTOLT"" to prophylactically treat
or
prevent an opportunistic Mycobacterium avium complex infection. In another
specific
embodiment, compositions of the invention are used in any combination with
RIFABUTINT"',
CLARITHROMYCINT"", and/or AZITHROMYCINT"~ to prophylactically treat or prevent
an
opportunistic Mycobacterium tuberculosis infection. In another specific
embodiment,
compositions of the invention are used in any combination with GANCICLOVIRT"",
FOSCARNETT"", andlor CIDOFOVIRTM to prophylactically treat or prevent an
opportunistic
cytomegalovirus infection. In another specific embodiment, compositions of the
invention
are used in any combination with FLUCONAZOLET"", ITRACONAZOLET"', and/or
KETOCONAZOLET"~ to prophylactically treat or prevent an opportunistic fungal
infection.
In another specific embodiment, compositions of the invention are used in any
combination
with ACYCLOV1RT"~ and/or FAMCICOLVIRT"' to prophylactically treat or prevent
an
opportunistic herpes simplex virus type I and/or type II infection. In another
specific
embodiment, compositions of the invention are used in any combination with
184
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
PYRIIVIETHAN>INET"' and/or LEUCOVORINTM to prophylactically treat or prevent
an
opportunistic Toxoplasfna gondii infection. In another specific embodiment,
compositions of
the invention are used in any combination with LEUCOVORINT"' and/or NEUPOGENTM
to
prophylactically treat or prevent an opportunistic bacterial infection.
[0517] In a further embodiment, the compositions of the invention are
administered in
combination with an antiviral agent. Antiviral agents that may be administered
with the
compositions of the invention include, but are not limited to, acyclovir,
ribavirin, amantadine,
and remantidine
[0518] In a further embodiment, the compositions of the invention are
administered in
combination with an antibiotic agent. Antibiotic agents that may be
administered with the
compositions of the invention include, but are not limited to, amoxicillin,
aminoglycosides,
beta-lactam (glycopeptide), beta-lactamases, Clindamycin, chloramphenicol,
cephalosporins,
ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones, macrolides,
metronidazole,
penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines,
trimethoprim,
trimethoprim-sulfamthoxazole, and vancomycin.
[0519] In an additional embodiment, the compositions of the invention are
administered
alone or in combination with an anti-inflammatory agent. Anti-inflammatory
agents that may
be administered with the compositions of the invention include, but are not
limited to,
glucocorticoids and the nonsteroidal anti-inflammatories, aminoarylcarboxylic
acid
derivatives, arylacetic acid derivatives, arylbutyric acid derivatives,
arylcarboxylic acids,
arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid
derivatives,
thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-
hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome,
difenpiramide, ditazol,
emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol,
paranyline,
perisoxal, pifoxime, proquazone, proxazole, and tenidap.
[0520] In another embodiment, compostions of the invention are administered in
combination with a chemotherapeutic agent. Chemotherapeutic agents that may be
administered with the compositions of the invention include, but are not
limited to, antibiotic
derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin);
antiestrogens
(e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FLJ, methotrexate,
floxuridine,
interferon alpha-2b, glutamic acid, plicarnycin, mercaptopurine, and 6-
thioguanine); cytotoxic
185
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside,
cyclophosphamide,
estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and
vincristine
sulfate); hormones (e.g., medroxyprogesterone, estramustine phosphate sodium,
ethinyl
estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate,
chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g.,
mephalen,
chorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and
combinations
(e.g., bethamethasone sodium phosphate); and others (e.g., dicarbazine,
asparaginase,
mitotane, vincristine sulfate, vinblastine sulfate, and etoposide).
[0521] In a specific embodiment, compositions of the invention are
administered in
combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and
prednisone) or
any combination of the components of CHOP. In another embodiment, compositions
of the
invention are administered in combination with Rituximab. In a further
embodiment,
compositions of the invention are administered with Rituxmab and CHOP, or
Rituxmab and
any combination of the components of CHOP.
[0522] In an additional embodiment, the compositions of the invention are
administered
in combination with cytokines. Cytokines that may be administered with the
compositions of
the invention include, but are not limited to, GM-CSF, G-CSF, IL2, IL3, ILA~,
IL5, IL6, TL7,
IL10, TL12, TL13, IL15, anti-CD40, CD40L, IFN-alpha, IFN-beta, IFN-gamma, TNF-
alpha,
and TNF-beta. In another embodiment, compositions of the invention may be
administered
with any interleukin, including, but not limited to, IL-lalpha, IL-lbeta, IL-
2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-8, IL-9, IL-10, IL.-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL,-
17, 1L-18, IL-19,
IL-20, and IL-21. In a preferred embodiment, the compositions of the invention
are
administered in combination with TNF-alpha. In another preferred embodiment,
the
compositions of the invention are administered in combination with IFN-alpha.
[0523] In an additional embodiment, the compositions of the invention are
administered
in combination with angiogenic proteins. Angiogenic proteins that may be
administered with
the compositions of the invention include, but are not limited to, Glioma
Derived Growth
Factor (GDGF), as disclosed in European Patent Number EP-399816; Platelet
Derived
Growth Factor-A (PDGF-A), as disclosed in European Patent Number EP-682110;
Platelet
Derived Growth Factor-B (PDGF-B), as disclosed in European Patent Number EP-
282317;
Placental Growth Factor (P1GF), as disclosed in International Publication
Number WO
186
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
92/06194; Placental Growth Factor-2 (P1GF-2), as disclosed in Hauser et al.,
Gorwth Factors,
4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as disclosed in
International
Publication Number WO 90113649; Vascular Endothelial Growth Factor-A (VEGF-A),
as
disclosed in European Patent Number EP-506477; Vascular Endothelial Growth
Factor-2
(VEGF-2), as disclosed in International Publication Number WO 96/39515;
Vascular
Endothelial Growth Factor B-186 (VEGF-B 186), as disclosed in International
Publication
Number WO 96/26736; Vascular Endothelial Growth Factor-D (VEGF-D), as
disclosed in
International Publication Number WO 98/02543; Vascular Endothelial Growth
Factor-D
(VEGF-D), as disclosed in International Publication Number WO 98/07832; and
Vascular
Endothelial Growth Factor-E (VEGF-E), as disclosed in German Patent Number
DE19639601. The above mentioned references are incorporated herein by
reference herein.
[0524] In an additional embodiment, the compositions of the invention are
administered
in combination with Fibroblast Growth Factors. Fibroblast Growth Factors that
may be
administered with the compositions of the invention include, but are not
limited to, FGF-l,
FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-
12,
FGF-13, FGF-14, and FGF-15.
[0525] In additional embodiments, the compositions of the invention are
administered in
combination with other therapeutic or prophylactic regimens, such as, for
example, radiation
therapy.
Chromosome Assays
[0526] The nucleic acid molecules of the present invention are also valuable
for
chromosome identification. The sequence is specifically targeted to and can
hybridize with a
particular location on an individual human chromosome. Moreover, there is a
current need
for identifying particular sites on the chromosome. Few chromosome marking
reagents based
on actual sequence data (repeat polymorphisms) are presently available for
marking
chromosomal location. The mapping of DNAs to chromosomes according to the
present
invention is an important first step in correlating those sequences with genes
associated with
disease.
[0527] In certain preferred embodiments in this regard, the cDNAs herein
disclosed are
used to clone genomic DNA of a TNFR protein gene. This can be accomplished
using a
variety of well known techniques and libraries, which generally are available
commercially.
187
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
The genomic DNA then is used for ira situ chromosome mapping using well known
techniques for this purpose.
[0528] In addition, in some cases, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3'
untranslated region of the gene is used to rapidly select primers that do not
span more than
one exon in the genomic DNA, thus complicating the amplification process.
These primers
are then used for PCR screening of somatic cell hybrids containing individual
human
chromosomes. Fluorescence in situ hybridization ("FISH") of a cDNA clone to a
metaphase
chromosomal spread can be used to provide a precise chromosomal location in
one step. This
technique can be used with probes from the cDNA as short as 50 or 60 bp. For a
review of
this technique, see Verma et al., Hurnafa Chromosomes: A Maf2ual Of Basic
Techniques,
Pergamon Press, New York (1988).
[0529] Once a sequence has been mapped to a precise chromosomal location, the
physical
position of the sequence on the chromosome can be correlated with genetic map
data. Such
data are found, for example, in V. McKusick, Me~deliafa Inheritance In Mah,
available
on-line through Johns Hopkins University, Welch Medical Library. The
relationship between
genes and diseases that have been mapped to the same chromosomal region are
then
identified through linkage analysis (coinheritance of physically adjacent
genes).
[0530] Next, it is necessary to determine the differences in the cDNA or
genomic
sequence between affected and unaffected individuals. If a mutation is
observed in some or
all of the affected individuals but not in any normal individuals, then the
mutation is likely to
be the causative agent of the disease.
[0531] Having generally described the invention, the same will be more readily
understood by reference to the following examples, which are provided by way
of illustration
and are not intended as limiting.
Examples
Example 1: Expression and Puri,~cation of TNFR-B alpha and TNFR-6 beta in E.
coli
[0532] The bacterial expression vector pQE60 is used for bacterial expression
in this
example (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311). pQE60 encodes
ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of
replication ("ori"),
188
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
an IPTG inducible promoter, a ribosome binding site ("RBS"), six codons
encoding histidine
residues that allow affinity purification using nickel-nitrilo-tri-acetic acid
("Ni-NTA")
affinity resin sold by QIAGEN, Inc., supra, and suitable single restriction
enzyme cleavage
sites. These elements are arranged such that a DNA fragment encoding a
polypeptide may be
inserted in such as way as to produce that polypeptide with the six His
residues (i.e., a "6 X
His tag") covalently linked to the carboxyl terminus of that polypeptide.
However, in this
example, the polypeptide coding sequence is inserted such that translation of
the six His
codons is prevented and, therefore, the polypeptide is produced with no 6 X
His tag.
[0533] The DNA sequences encoding the desired portions of TNFR-6 alpha and
TNFR-6
beta proteins comprising the mature forms of the TNFR-6 alpha and TNFR-6 beta
amino
acid sequences are amplified from the deposited cDNA clones using PCR
oligonucleotide
primers which anneal to the amino terminal sequences of the desired portions
of the TNFR-
6oc or -6(3 proteins and to sequences in the deposited constructs 3' to the
cDNA coding
sequence. Additional nucleotides containing restriction sites to facilitate
cloning in the
pQE60 vector are added to the 5' and 3' sequences, respectively.
[0534] For cloning the mature form of the TNFR-6cc protein, the 5' primer has
the
sequence 5' CGCCCATGGCAGAAACACCCACCTAC 3' (SEQ ID N0:19) containing the
underlined NcoI restriction site. One of ordinary skill in the art would
appreciate, of course,
that the point in the protein coding sequence where the 5' primer begins may
be varied to
amplify a desired portion of the complete protein shorter or longer than the
mature form. The
3' primer has the sequence 5' CGCAAGCTTCTCTTTCAGTGCAAGTG 3' (SEQ ID
N0:20) containing the underlined HindllI restriction site. For cloning the
mature form of the
TNFR-6/3 protein, the 5' primer has the sequence of SEQ m N0:19 above, and the
3' primer
has the sequence 5' CGCAAGCTTCTCCTCAGCTCCTGCAGTG 3' (SEQ ID N0:21)
containing the underlined HindIII restriction site.
[0535] The amplified TNFR-6 alpha and TNFR-6 beta DNA fragments and the vector
pQE60 are digested with NcoI and HindIII and the digested DNAs are then
ligated together.
Insertion of the TNFR-6 alpha and TNFR-6 beta DNA into the restricted pQE60
vector
places the TNFR-6 alpha and TNFR-6 beta protein coding region including its
associated
stop codon downstream from the TPTG-inducible promoter and in-frame with an
initiating
189
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
AUG. The associated stop codon prevents translation of the six histidine
codons downstream
of the insertion point.
[0536] The ligation mixture is transformed into competent E. cola cells using
standard
procedures such as those described in Sambrook et al., Molecular Clofzirzg: a
Laboratory
Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
(1989). E.
coli strain Ml5/rep4, containing multiple copies of the plasmid pREP4, which
expresses the
lac repressor and confers kanamycin resistance ("Kanr"), is used in carrying
out the
illustrative example described herein. This strain, which is only one of many
that are suitable
for expressing TNFR-6a or -6(3 protein, is available commercially from QIAGEN,
Inc.,
supra. Transformants are identified by their. ability to grow on LB plates in
the presence of
ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and
the identity
of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
[0537] Clones containing the desired constructs are grown overnight ("O/N") in
liquid
culture in LB media supplemented with both ampicillin (100 lcg/ml) and
kanamycin (25
~,g/ml). The O/N culture is used to inoculate a large culture, at a dilution
of approximately
1:25 to 1:250. The cells are grown to an optical density at 600 nm ("OD600")
of between 0.4
and 0.6. isopropyl-13-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration
of 1 mM to induce transcription from the lac repressor sensitive promoter, by
inactivating the
lacT repressor. Cells subsequently are incubated further for 3 to 4 hours.
Cells then are
harvested by centrifugation.
[0538] To purify the TNFR-6 alpha and TNFR-6 beta polypeptide, the cells are
then
stirred for 3-4 hours at 4° C in 6M guanidine-HCI, pH 8. The cell
debris is removed by
centrifugation, and the supernatant containing the TNFR-6 alpha and TNFR-6
beta is
dialyzed against 50 mM Na-acetate buffer pH 6, supplemented with 200 mM NaCI.
Alternatively, the protein can be successfully refolded by dialyzing it
against 500 mM NaCI,
20% glycerol, 25 mM Tris/HCl pH 7.4, containing protease inhibitors. After
renaturation the
protein can be purified by ion exchange, hydrophobic interaction and size
exclusion
chromatography. Alternatively, an affinity chromatography step such as an
antibody column
can be used to obtain pure TNFR-6 alpha and TNFR-6 beta protein. The purified
protein is
stored at 4° C or frozen at -80° C.
190
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0539] The following alternative method may be used to purify TNFR-6cx or -6
j3
expressed in E coli when it is present in the form of inclusion bodies. Unless
otherwise
specified, all of the following steps are conducted at 4-10°C.
[0540] Upon completion of the production phase of the E. coli fermentation,
the cell
culture is cooled to 4-10°C and the cells are harvested by continuous
centrifugation at 15,000
rpm (Heraeus Sepatech). On the basis of the expected yield of protein per unit
weight of cell
paste and the amount of purified protein required, an appropriate amount of
cell paste, by
weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA,
pH 7.4.
The cells are dispersed to a homogeneous suspension using a high shear mixer.
[0541] The cells ware then lysed by passing the solution through a
micrafluidizer
(Microfuidics, Corp. or APV Gaulin, Inc.) twice at 4000-6000 psi. The
homogenate is then
mixed with NaCI solution to a final concentration of 0.5 M NaCI, followed by
centrifugation
at 7000 xg for 15 min. The resultant pellet is washed again using 0.5M NaCl,
100 mM Tris,
50 mM EDTA, pH 7.4. .
[0542] The resulting washed inclusion bodies are solubilized with 1.5 M
guanidine
hydrochloride (GnHCI) for 2-4 hours. After 7000 xg centrifugation for 15 min.,
the pellet is
discarded and the TNFR-6a or -6(3 polypeptide-containing supernatant is
incubated at 4°C
overnight to allow further GnHCI extraction.
[0543] Following high speed centrifugation (30,000 x g) to remove insoluble
particles,
the GnHCI solubilized protein is refolded by quickly mixing the GnHCl extract
with 20
volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM NaCI, 2 mM EDTA by
vigorous stirring. The refolded diluted protein solution is kept at 4°C
without mixing for 12
hours prior to further purification steps.
[0544] To clarify the refolded TNF receptor polypeptide solution, a previously
prepared
tangential filtration unit equipped with 0.16 ~tm membrane filter with
appropriate surface area
(e.g., FiItron), equilibrated with 40 mM sodium acetate, pH 6.0 is employed.
The filtered
sample is loaded onto a cation exchange resin (e.g., Poros HS-50, Perseptive
Biosystems).
The column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM,
500
mM, 1000 mM, and 1500 mM NaCI in the same buffer, in a stepwise manner. The
absorbance at 280 mm of the effluent is continuously monitored. Fractions are
collected and
further analyzed by SDS-PAGE.
191
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0545] Fractions containing the TNF receptor polypeptide are then pooled and
mixed
with 4 volumes of water. The diluted sample is then loaded onto a previously
prepared set of
tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak
anion
(Poros CM-20, Perseptive Biosystems) exchange resins. The columns are
equilibrated with
40 mM sodium acetate, pH 6Ø Both columns are Washed with 40 mM sodium
acetate, pH
6.0, 200 mM NaCI. The CM-20 column is then eluted using a 10 column volume
linear
gradient ranging from 0.2 M NaCI, 50 mM sodium acetate, pH 6.0 to 1.0 M NaCI,
50 mM
sodium acetate, pH 6.5. Fractions are collected under constant AZSO monitoring
of the
effluent. Fractions containing the TNFR-6a or -6(3 polypeptide (determined,
for instance, by
16% SDS-PAGE) are then pooled.
[0546] The resultant TNF receptor polypeptide exhibits greater than 95% purity
after the
above refolding and purification steps. No major contaminant bands are
observed from
Commassie blue stained 16% SDS-PAGE gel when 5 ~,g of purified protein is
loaded. The
purified protein is also tested for endotoxin/LPS contamination, and typically
the LPS content
is less than 0.1 ng/ml according to LAL assays.
Exafnple 2: Cloning and Expression of TNFR-6 alpha and TNFR-6 beta proteins in
a
Baculovirus Expression System
[0547] In this illustrative example, the plasmid shuttle vector pA2 is used to
insert the
cloned DNA encoding complete protein, including its naturally associated
secretory signal
(leader) sequence, into a baculovirus to express the mature TNFR-6a or -6(3
protein, using
standard methods as described in Summers et al., A Manual of Methods fog
Baculovirus
Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental
Station
Bulletin No. 1555 (197). This expression vector contains the strong polyhedrin
promoter of
the Autographa califon2ica nuclear polyhedrosis virus (AcMNPV) followed by
convenient
restriction sites such as BamHI, Xba I and Asp7lS. The polyadenylation site of
the simian
virus 40 ("SV40") is used for efficient polyadenylation. For easy selection of
recombinant
virus, the plasmid contains the beta-galactosidase gene from E. coli under
control of a weak
Drosophila promoter in the same orientation, followed by the polyadenylation
signal of the
polyhedrin gene. The inserted genes are flanked on both sides by viral
sequences for cell-
mediated homologous recombination with wild-type viral DNA to generate a
viable virus that
express the cloned polynucleotide.
192
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0548] Many other baculovirus vectors could be used in place of the vector
above, such
as pAc373, pVL94I and pAcIMl, as one skilled in the art would readily
appreciate, as long
as the construct provides appropriately located signals for transcription,
translation, secretion
and the Iilce, including a signal peptide and an in-frame AUG as required.
Such vectors are
described, for instance, in Luckow et al., Virology 170:31-39 (1989).
[0549] The cDNA sequence encoding the full length TNFR-6a, or -6(3 protein in
a
deposited clone, including the AUG initiation codon and the naturally
associated leader
sequence shown in SEQ ID N0:2 or 4 is amplified using PCR oligonucleotide
primers
corresponding to the 5' and 3' sequences of the gene. The 5' primer for TNFR-6
alpha and
TNFR-6 beta has the sequence
5' CGCGGATCCGCCATCATGAGGGCGTGGAGGGGCCAG 3' (SEQ ID N0:22)
containing the underlined BamHI restriction enzyme site. All of the previously
described
primers encode an efficient signal for initiation of translation in eukaryotic
cells, as described
by Kozak, M., J. Mol. Biol. 196:947-950 (1987). The 3' primer for TNFR-6a has
the
sequence 5' CGCGGTACCCTCTTTCAGTGCAAGTG 3' (SEQ DJ N0:23) containing the
underlined Asp718 restriction site. The 3' primer for TNFR-6(3 has the
sequence
5' CGCGGTACCCTCCTCAGCTCCTGCAGTG 3' (SEQ ID N0:24) containing the
underlined Asp718 restriction site.
[0550] The amplified fragment is isolated from a l% agarose gel using a
commercially
available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment then is
digested with
the appropriate restriction enzyme for each of the primers used, as specified
above, and again
is purified on a 1 % agarose gel.
[0551] The plasmid is digested with the same restriction enzymes and
optionally, can be
dephosphorylated using calf intestinal phosphatase, using routine procedures
known in the
art. The DNA is then isolated from a 1% agarose gel using a commercially
available kit
("Geneclean" BIO 101 Inc., La Jolla, Ca.).
[0552] The fragment and dephosphorylated plasmid are Iigated together with T4
DNA
ligase. E. coli HB 101 or other suitable E. coli hosts such as XL-1 Blue
(Statagene Cloning
Systems, La Jolla, CA) cells are transformed with the ligation mixture and
spread on culture
plates. Bacteria are identified that contain the plasmid with the human TNF
receptor gene by
digesting DNA from individual colonies using the enzymes used immediately
above and then
193
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
analyzing the digestion product by gel electrophoresis. The sequence of the
cloned fragment
is confirmed by DNA sequencing. This plasmid is designated herein pA2-TNFR-hoc
or
pA2TNFR-6(3 (collectively pA2-TNFR).
[0553] Five ~,g of the plasmid pA2-TNFR is co-transfected with 1.0 ~,g of a
commercially
available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA",
Pharmingen, San
Diego, CA), using the lipofection method described by Felgner et al., PYOC.
Natl. Acad. Sci.
USA 84: 7413-7417 (197). One,ug of BaculoGoldTM virus DNA and 5 ~,g of the
plasmid
pA2-TNFR are mixed in a sterile well of a microtiter plate containing 50 ~.I
of serum-free
Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards,' 10 ~ul
Lipofectin
plus 90 p1 Grace's medium are added, mixed and incubated for 15 minutes at
room
temperature. Then the transfection mixture is added drop-wise to Sf9 insect
cells (ATCC
CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum.
The plate is then incubated for 5 hours at 27° C. The transfection
solution is then removed
from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal
calf serum is
added. Cultivation is then continued at 27° C for four days.
[0554] After four days the supernatant is collected and a plaque assay is
performed, as
described by Summers and Smith, supra. An agarose gel with "Blue Gal" {Life
Technologies
Inc., Gaithersburg) is used to allow easy identification and isolation of gal-
expressing clones,
which produce blue-stained plaques. (A detailed description of a "plaque
assay" of this type
can also be found in the user's guide for insect cell culture and
baculovirology distributed by
Life Technologies Inc., Gaithersburg, page 9-10). After appropriate
incubation, blue stained
plaques are picked with the tip of a micropipettor {e.g., Eppendorf). The agar
containing the
recombinant viruses is then resuspended in a microcentrifuge tube containing
200 p1 of
Grace's medium and the suspension containing the recombinant baculovirus is
used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these
culture dishes are
harvested and then they are stored at 4° C.
[0555] To verify the expression of the TNF receptor gene Sf9 cells are grown
in Grace's
medium supplemented with 10% heat-inactivated FBS. The cells are infected with
the
recombinant baculovirus at a multiplicity of infection ("MOI") of about 2. If
radiolabeled
proteins are desired, 6 hours later the medium is removed and is replaced with
SF900 II
medium minus methionine and cysteine (available from Life Technologies Inc.,
Rockville,
194
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
MD). After 42 hours, 5 p,Ci of 35S-methionine and 5 p,Ci 35S-cysteine
(available from
Amersham) are added. The cells are further incubated for 16 hours and then are
harvested by
centrifugation. The proteins in the supernatant as well as the intracellular
proteins are
analyzed by SDS-PAGE followed by autoradiography (if radiolabeled).
[0556] Microsequencing of the amino acid sequence of the amino terminus of
purified
protein may be used to determine the amino terminal sequence of the mature
form of the TNF
receptor protein.
Example 3: Cloning and Expression of TNFR-6 alpha and TNFR-6 beta irz
Mafnmaliafz
Cells
[0557] A typical mammalian expression vector contains the promoter element,
which
mediates the initiation of transcription of mRNA, the protein coding sequence,
and signals
required for the termination of transcription and polyadenylation of the
transcript. Additional
elements include enhancers, Kozak sequences and intervening sequences flanked
by donor
and acceptor sites for RNA splicing. Highly efficient transcription can be
achieved with the
early and late promoters from SV40, the long terminal repeats (LTRs) from
Retroviruses,
e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV).
However,
cellular elements can also be used (e.g., the human actin promoter). Suitable
expression
vectors for use in practicing the present invention include, for example,
vectors such as pSVL
and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC
37146) and pBCI2MI (ATCC 67109). Mammalian host cells that could be used
include,
human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos
7. and
CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
[0558] Alternatively, the gene can be expressed in stable cell lines that
contain the gene
integrated into a chromosome. The co-transfection with a selectable marker
such as dhfr, gpt,
neomycin, hygromycin allows the identification and isolation of the
transfected cells.
[0559] The transfected gene can also be amplified to express large amounts of
the
encoded protein. The DHFR (dihydrofolate reductase) marker is useful to
develop cell lines
that carry several hundred or even several thousand copies of the gene of
interest. Another
useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al.,
Biochena J.
227:277-279 (1991); Bebbington et al., BiolTechhology 10:169-175 (1992)).
Using these
markers, the mammalian cells are grown in selective medium and the cells with
the highest
195
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
resistance are selected. These cell lines contain the amplified genes)
integrated into a
chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for the
production
of proteins.
[0560] The expression vectors pCl and pC4 contain the strong promoter (LTR) of
the
Rous Sarcoma Virus (Cullen et al., Molecular afad Cellular Biology, 438-447
(March, 1985))
plus a fragment of the CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)).
Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, XbaI
and Asp718,
facilitate the cloning of the gene of interest. The vectors contain in
addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin gene.
Example 3(a): Clorairzg and Expression in COS Cells
[0561] The expression plasmid, pTNFR-a-HA and -6(3-HA, is made by cloning a
portion
of the cDNA encoding the mature form of the TNF receptor protein into the
expression vector
pcDNAI/Amp or pcDNAIII (which can be obtained from Invitrogen, Inc.).
[0562] The expression vector pcDNAI/amp contains: (1) an E. coli origin of
replication
effective for propagation in E. coli and other prokaryotic cells; (2) an
ampicillin resistance
gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin
of replication
for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40
intron; (5)
several codons encoding a hemagglutinin fragment (i.e., an "HA" tag to
facilitate
purification) followed by a termination codon and polyadenylation signal
arranged so that a
cDNA can be conveniently placed under expression control of the CMV promoter
and
operably linked to the SV40 intron and the polyadenylation signal by means of
restriction
sites in the polylinker. The HA tag corresponds to an epitope derived from the
influenza
hemagglutinin protein described by Wilson et al., Celt 37: 767 (1984). The
fusion of the HA
tag to the target protein allows easy detection and recovery of the
recombinant protein with
an antibody that recognizes the HA epitope. pcDNAIII contains, in addition,
the selectable
neomycin marker.
[0563] A DNA fragment encoding the complete TNF receptor polypeptide is cloned
into
the polylinker region of the vector so that recombinant protein expression is
directed by the
CMV promoter. The plasmid construction strategy is as follows. The TNF
receptor cDNA
of a deposited clone is amplified using primers that contain convenient
restriction sites, much
196
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
as described above for construction of vectors for expression of a TNF
receptor in E. coli.
Suitable primers can easily be designed by those of ordinary skill in the art.
[0564] The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested
with XbaI and EcoRI and then ligated. The ligation mixture is transformed into
E. coli strain
SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines
Road, La
Jolla, CA 92037), and the transformed culture is plated on ampicillin media
plates which then
are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is
isolated from
resistant colonies and examined by restriction analysis or other means for the
presence of the
fragment encoding the TNFR-oc and -6(3 polypeptides.
[0565] For expression of recombinant TNFR-a and -6(3, COS cells are
transfected with
an expression vector, as described above, using DEAF-DEXTRAN, as described,
for
instance, in Sambrook et al., Molecular Cloniiag.~ a Laboratory Manual, Cold
Spring
Laboratory Press, Cold Spring Harbor, New York (1989). Cells are incubated
under
conditions for expression of TNFR by the vector.
[0566] Expression of the pTNFR-a-HA and -6~3-HA fusion protein is detected by
radiolabeling and immunoprecipitation, using methods described in, for example
Harlow et
al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory
Press, Cold
Spring Harbor, New York (1988). To this end, two days after transfection, the
cells are
labeled by incubation in media containing 35S-cysteine for 8 hours. The cells
and the media
are collected, and the cells are washed and the lysed with detergent-
containing RIPA buffer:
150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as
described by Wilson et al.cited above. Proteins are precipitated from the cell
lysate and from
the culture media using an HA-specific monoclonal antibody. The precipitated
proteins then
are analyzed by SDS-PAGE and autoradiography. An expression product of the
expected .
size is seen in the cell lysate, which is not seen in negative controls.
Example 3(b): Cloning and Expression in CHO Cells
[0567] The vector pC4 is used for the expression of TNFR-6 alpha and TNFR-6
beta
polypeptides. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC
Accession No.
37146). The plasmid contains the mouse DHFR gene under control of the SV40
early
promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity
that are
transfected with these plasmids can be selected by growing the cells in a
selective medium
197
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
(alpha minus MEM, Life Technologies) supplemented with the chemotherapeutic
agent
methotrexate. The amplification of the DHFR genes in cells resistant to
methotrexate (MTX)
has been well documented (see, e.g., Alt, F. W., Kellems, R. M., Bertino, J.
R., and Schimke,
R. T., 1978, J. Biol. Clzem. 253:1357-1370, Hamlin, J. L. and Ma, C. 1990,
Bioclzem. et
Bioplzys. Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology 9:64-
68). Cells grown in increasing concentrations of MTX develop resistance to the
drug by
overproducing the target enzyme, DHFR, as a result of amplification of the
DHFR gene. If a
second gene is linked to the DHFR gene, it is usually co-amplified and over-
expressed. It is
known in the art that this approach may be used to develop cell lines carrying
more than
1,000 copies of the amplified gene(s). Subsequently, when the methotrexate is
withdrawn,
cell lines are obtained which contain the amplified gene integrated into one
or more
chromosomes) of the host cell.
[0568] Plasmid pC4 contains for expressing the gene of interest the strong
promoter of
the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al.,
Molecular and
Cellular Biology, March 1985:438-447) plus a fragment isolated from the
enhancer of the
immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell
41:521-530
(1985)). Downstream of the promoter are the following single restriction
enzyme cleavage
sites that allow the integration of the genes: BamHI, Xba I, and Asp718.
Behind these
cloning sites the plasmid contains the 3' intron and polyadenylation site of
the rat
preproinsulin gene. Other high efficiency promoters can also be used for the
expression, e.g.,
the human 13-actin promoter, the SV40 early or late promoters or the long
terminal repeats
from other retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and Tet-On
gene
expression systems and similar systems can be used to express the TNF receptor
polypeptide
in a regulated way in mamnnalian cells (Gossen, M., & Bujard, H., Proc. Natl.
Acad. Sci. IJSA
89:5547-5551 (1992)). For the polyadenylation of the mRNA other signals, e.g.,
from the
human growth hormone or globin genes can be used as well. Stable cell lines
carrying a gene
of interest integrated into the chromosomes can also be selected upon co-
transfection with a
selectable marker such as gpt, 6418, or hygromycin. It is advantageous to use
more than
one selectable marker in the beginning, e.g., G4I8 plus methotrexate.
[0569] The plasmid pC4 is digested with the restriction enzymes appropriate
for the
specific primers used to amplify the TNF receptor of choice as outlined below
and then
198
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
dephosphorylated using calf intestinal phosphates by procedures known in the
art. The vector
is then isolated from a 1% agarose gel.
[0570] The DNA sequence encoding the TNF receptor polypeptide is amplified
using
PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the
desired portion
of the gene. The S' primer for TNFR-6 alpha and TNFR-6 beta containing the
underlined
BamHI site, has the following sequence:
5' CGCGGATCCGCCATCATGAGGGGGTGGAGGGGCCAG 3' (SEQ ID N0:22). The 3'
primer for TNFR-6cx has the sequence 5' CGCGGTACCCTCTTTCAGTGCAAGTG 3'
(SEQ >D N0:23) containing the underlined Asp718 restriction site. The 3'
primer for TNFR-
6(3 has the sequence 5' CGCGGTACCCTCCTCAGCTCCTGCAGTG 3' (SEQ ID N0:24)
containing the underlined Asp718 restriction site.
[0571] The amplified fragment is digested with the endonucleases which will
cut at the
engineered restriction sites) and then purified again on a 1% agarose gel. The
isolated
fragment and the dephosphorylated vector are then ligated with T4 DNA ligase.
E. coli
HB 101 or XL-1 Blue cells are then transformed and bacteria are identified
that contain the
fragment inserted into plasmid pC4 using, for instance, restriction enzyme
analysis.
[0572] Chinese hamster ovary cells lacking an active DHFR gene are used for
transfection. Five pg of the expression plasmid pC4 is cotransfected with 0.5
~,g of the
plasmid pSVneo using lipofectin (Felgner et al., supra). The plasmid pSV2-neo
contains a
dominant selectable marker, the neo gene from Tn5 encoding an enzyme that
confers
resistance to a group of antibiotics including G4I8. The cells are seeded in
alpha minus
MEM supplemented with 1 mg/ml 6418. After 2 days, the cells are trypsinized
and seeded
in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented
with 10,
25, or 50 ng/ml of metothrexate plus 1 mg/ml 6418. After about 10-14 days
single clones
are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using
different
concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). Clones
growing
at the highest concentrations of methotrexate are then transferred to new 6-
well plates
containing even higher concentrations of methotrexate (1 ~.M, 2 l.~M, 5 p.M,
10 mM, 20 mM).
The same procedure is repeated until clones are obtained which grow at a
concentration of
100 - 200 ,uM. Expression of the desired gene product is analyzed, for
instance, by SDS-
199
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
PAGE and Western blot or by reversed phase HPLC analysis.
Example 4: Tissue distribution of TNF receptor mRNA expression
[0573] Northern blot analysis is carried out to examine TNFR-6cc or -6(3 gene
expression
in human tissues, using methods described by, among others, Sambrook et al.,
cited above.
A cDNA probe containing the entire nucleotide sequence of a TNF receptor
protein (SEQ ID
NO:1 or 3) is labeled with 32P using the rediprimeTM DNA labeling system
(Amersham Life
Science), according to manufacturer's instructions. After labeling, the probe
is purified using
a CHROMA SPIN-100TM column (Clontech Laboratories, Inc.), according to
manufacturer's
protocol number PT1200-1. The purified labeled probe is then used to examine
various
human tissues for TNF receptor mRNA.
[0574] Multiple Tissue Northern (MTN) blots containing various human tissues
(H) or
human immune system tissues (IM) are obtained from Clontech and are examined
with the
labeled probe using ExpressHybTM hybridization solution (Clontech) according
to
manufacturer's protocol number PT1190-1. Following hybridization and washing,
the blots
are mounted and exposed to film at -70° C overnight, and films
developed according to
standard procedures.
[0575] It will be clear that the invention may be practiced otherwise than as
particularly
described in the foregoing description and examples. Numerous modifications
and variations
of the present invention are possible in light of the above teachings and,
therefore, are within
the scope of the appended claims.
[0576]
Exafnple 5: Gene Therapy Using Endogenous TNFR-6 Gene
[0577] Another method of gene therapy according to the present invention
involves
operably associating the endogenous TNFR (i.e., TNFR-6) sequence with a
promoter via
homologous recombination as described, for example, in U.S. Patent No.
5,641,670, issued
June 24, 1997; International application publication number WO 96129411,
published
September 26, 1996; International application publication number WO 94/12650,
published
August 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989);
and Zijlstra
et al., Nature 342:435-438 (1989). This method involves the activation of a
gene which is
present in the target cells, but which is not expressed in the cells, or is
expressed at a lower
200
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
level than desired. Polynucleotide constructs are made which contain a
promoter and
targeting sequences, which are homologous to the 5' non-coding sequence of
endogenous
TNFR-6, flanl~ing the promoter. The targeting sequence will be sufficiently
near the 5' end of
TNFR-6 so the promoter will be operably linlced to the endogenous sequence
upon
homologous recombination. The promoter and the targeting sequences can be
amplified
using PCR. Preferably,the amplified promoter contains distinct restriction
enzyme sites on
the 5' and 3' ends. Preferably, the 3' end of the first targeting sequence
contains the same
restriction enzyme site as the 5' end of the amplified promoter and the 5' end
of the second
targeting sequence contains the same restriction site as the 3' end of the
amplified promoter.
[0578] The amplified promoter and the amplified targeting sequences are
digested with
the appropriate restriction enzymes and subsequently treated with calf
intestinal phosphatase.
The digested promoter and digested targeting sequences are added together in
the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation
of the two fragments. The construct is size fractionated on an agarose gel
then purified by
phenol extraction and ethanol precipitation.
[0579] In this Example, the polynucleotide constructs are administered as
naked
polynucleotides via electroporation. However, the polynucleotide constructs
may also be
administered with transfection-facilitating agents, such as liposomes, viral
sequences, viral
particles, precipitating agents, etc. Such methods of delivery are known in
the art.
[0580] Once the cells are transfected, homologous recombination will take
place which
results in the promoter being operably linked to the endogenous TNFR-6
sequence. This
results in the expression of TNFR-6 in the cell. Expression may be detected by
immunological staining, or any other method known in the art.
[0581] Fibroblasts are obtained from a subject by skin biopsy. The resulting
tissue is
placed in DMEM + 10% fetal calf serum. Exponentially growing or early
stationary phase
fibroblasts are trypsinized and rinsed from the plastic surface with nutrient
medium. An
aliquot of the cell suspension is removed for counting, and the remaining
cells are subjected
to centrifugation. The supernatant is aspirated and the pellet is resuspended
in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCI, 5 mM KCI, 0.7 mM Na2
HP04, 6 mM dextrose). The cells are recentrifuged, the supernatant aspirated,
and the cells
resuspended in electroporation buffer containing 1 mg/ml acetylated bovine
serum albumin.
201
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
The final cell suspension contains approximately 3XI06 cells/ml.
Electroporation should be
performed immediately following resuspension.
[0582] Plasmid DNA is prepared according to standard techniques. For example,
to
construct a plasmid for targeting to the TNFR-6 locus, plasmid pUCl8 (MBI
Fermentas,
Amherst, NY) is digested with HindIII. The CMV promoter is amplified by PCR
with an
XbaI site on the 5' end and a BamHI site on the 3' end. Two TNFR-6 non-coding
sequences
are amplified via PCR: one TNFR-6 non-coding sequence (TNFR-6 fragment 1) is
amplified
with a HindIII site at the 5' end and an Xba site at the 3' end; the other
TNFR-6 non-coding
sequence (TNFR-6 fragment 2) is amplified with a BamHI site at the 5'end and a
HindIII site
at the 3' end. The CMV promoter and TNFR-6 fragments are digested with the
appropriate
enzymes (CMV promoter - XbaI and BamHI; TNFR-6 fragment 1 - Xbal; TNFR-6
fragment
2 - BamHI) and ligated together. The resulting ligation product is digested
with IiindIII, and
ligated with the HindIII-digested pUCl8 plasmid.
[0583] Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap
(Bio- Rad).
The final DNA concentration is generally at least 120 ,ug/ml. 0.5 ml of the
cell suspension
(containing approximately 1.5.X106 cells) is then added to the cuvette, and
the cell suspension
and DNA solutions are gently mixed. Electroporation is performed with a Gene-
Pulser
apparatus (Bio-Rad). Capacitance and voltage are set at 960 E,~F and 250-300
V, respectively.
As voltage increases, cell survival decreases, but the percentage of surviving
cells that stably
incorporate the introduced DNA into their genome increases dramatically. Given
these
parameters, a pulse time of approximately 14-20 mSec should be observed.
[0584] Electroporated cells are maintained at room temperature for
approximately 5 min,
and the contents of the cuvette are then gently removed with a sterile
transfer pipette. The
cells are added directly to 10 ml of prewarmed nutrient media (DMEM with 15%
calf serum)
in a 10 cm dish and incubated at 37°C. The following day, the media is
aspirated and
replaced with 10 ml of fresh media and incubated for a further 16-24 hours.
[0585] The engineered fibroblasts are then injected into the host, either
alone or after
having been grown to confluence on cytodex 3 microcarrier beads. The
fibroblasts now
produce the protein product. The fibroblasts can then be introduced into a
patient as
described above.
Example 6: Effect of TNFR in treating graft versus-host disease in mice
202
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0586] The invention also encompasses a method for the treatment of refractory
/severe
acute GVHD in patients comprising administering to the patients (preferably
human), TNFR
polypeptides or TNFR agonists of the invention.
[0587] An analysis of the use of soluble TNFR polypeptides of the invention
(e.g.,
TNFR-6) to treat graft-versus-host disease (GVHD) is performed through the use
of a
C57BL/6 parent into (BALB/c X C57BL/6) F1 mouse model. This parent into Fl
mouse
model is a well-characterized and reproducible animal model of GVHD in bone
marrow
transplant patients, which is well known to one of ordinary skill in the art
(see, e.g.,
Gleichemann et al, Inzmacnol Today 5:324, 1984, which is herein incorporated
by reference
in its entirety). Soluble TNFR is expected to bind to Fast and inhibit Fast-
mediated
apoptosis, which plays a critical pathogenic role in the hepatic, cutaneous
and lymphoid
organ damage observed in this animal model of GVHD (Baker et al, J. Exp. Med.
183:2645,
(1996); Charles et al, J. Inzrrzuszol. 157:5387, (1996); and Hattori et al,
Blood 91:4051,
(1998), each of which is herein incorporated by reference in its entirety).
[0588] Initiation of the GVHD condition is induced by the intravenous
injection of ~1-3 x
10$ spleen cells from C57BL/6 mice into (BALB/c X C57BL/6) F1 mice (both are
available
from Jackson Lab, Bar Harbor, Maine). Groups of 6 to 8 mice receive either 0.1
to 5.0 mg/kg
of TNFR or human IgG isotype control intraperitoneally or intradermally on
every other day
following the injection of spleen cells. The effect of TNFR on liver enzyme
release in the
sera, an indicator of liver damage, is analyzed twice per week for at least 3
weeks. When
there is a significant amount of liver enzymes being detected in human IgG-
treated mice, the
animals are sacrificed for histological evaluation of the relative degree of
tissue damage in the
liver, spleen, skin and intestine, and for the therapeutic effect TNFR has
elicited on these
organs.
[0589] The ability of TNFR to ameliorate systems associated with
refractory/severe acute
GVHD is indicated by a reduction of liver enzyme release in the sera, tissue
damage and/or
reduced cachexia, loss of body weight andlor lethality when compared to the
control.
[0590] Finally, TNFR- and human IgG-treated animals undergo a clinical
evaluation
every other day to assess cachexia, body weight and lethality.
[0591] TNFR in combination therapy with TNF-cc inhibitors may also be examed
in this
GVHD marine model.
203
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Exaf~aple 7: TNFR-6a (DcR3) suppresses AIM 11 f~aediated apoptosis
Background
[0592] The members of the tumor necrosis factor (TNF) family axe involved in
regulating
diverse biological activities such as regulation of cell proliferation,
differentiation, cell
survival, cell death, cytokine production, lymphocyte co-stimulation,
immunoglobulin
secretion, and isotype switching (Armitage, R., Curr. Opin. Immunol. 6, 407-
413 (1994);
Tewari, M. et al., Curr. Opiu. Genet. Dev. 6, 39-44 (1996)). Receptors in this
family share a
common structural motif in their extracellular domains consisting of multiple
cysteine-rich
repeats of approximately 30 to 40 amino acids (Gruss, H.-J., et al., Blood 85,
3378-3404
(1995)). While TNFR1, CD95/Fas/APO-1, DR3/TRAMP/APO-3, DR4/TRAIL-Rl/APO-2,
DR5/TRAII,-R2, and DR6 receptors contain a conserved intracellular motif of 30
- 40 amino
acids called death domain, associated with the activation of apoptotic
signaling pathways,
other members which contain a low sequence identity in the intracellular
domains, stimulate
the transcription factors NF-KB and AP-1 (Armitage, R., Curr. Opitz.
Imf~iufiol. 6, 407-413
(1994); Tewari, M. et al., Curr. Opi~z. Genet. Dev. 6, 39-44 (1996); Gruss, H.-
J. et al.,
Blood 85, 3378-3404 (1995)).
[0593] Most TNF receptors contain functional cytoplasrnic domain and they
include
TNFRl (Loetscher, H et al., Cell 61, 351-356 (1990); Schall, T. J., et al.,
Cell 61, 361-370
(1990)), TNFR2 (Smith, C. A., et al., Science 248, 1019-1023 (1990)),
lymphotoxin [3
receptor (LT(3R) (Baens, M., et al., Ge~aomics 16, 214-218 (1993)), 4-1BB
(Kwon, B. S., et
al., Proe. Natl. Acad. Sci. USA 86, 1963-1967 (1989)), HVEM/TR2/ATAR (Kwon, B.
S.,
et al., J. Biol. Chem. 272, 14272-14276 (1997); Montgomery, R. L, et al., Cell
87, 427-436
(1996); Hsu, H., et al., J. Biol. Chem. 272, 13471-13474 (1997)), NGFR
(Johnson, D., et al.,
Cell 47, 545-554 (1986)), CD27 (Van Lier, R. A., et al., J. Immuhol. 139, 1589-
1596
(1987)), CD30 (Durleorp, H., et al., Cell 68, 421-427 (1992)), CD40
(Banchexeau, J., et al.,
Cell 68, 421-427 (1994)), OX40 (Mallett, S., et al., EMBO J. 9, 1063-1068
(1990)), Fas (Itoh,
N., et al., Cell 66, 233-243 (1991)), DR3/TRAMP (Chinnaiyan, A. M., et al.,
Sciefzce 274,
990-992 (1996)), DR4/TRAIL-R1 (Pan, G., et al.,. Sciefzce 276, 11I-I13
(1996)),
DR5/TRAIL-R2 (Pan, G., et al., Science 277, 815-818) (1997), and RANK
(Anderson, D. et
al., Nature 390, 175-179 (1997)). Some members of the TNFR superfamily do not
have
204
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
cytoplasmic domains and are secreted, such as osteoprotegerin (OPG) (Simmonet,
et al., Cell
89, 309-319 (1997)), or linked to the membrane through a glycophospholipid
tail, such as
TRID/DcRl/TRAIL-R3 (Degli-Esposti, M. A., et al., J. Exp. Med. 186, 1165-1170
(1997);
Sheridan, J. P., et al., Science 277, 818-821 (1997)). Viral open reading
frames encoding
soluble TNFRs have also been identified, such as SFV-T2 (Smith, C. A., et al.,
Science 248,
1019-1023 (1990)), Va53 (Howad, S. T., et al., Virology 180, 633-647 (I99I)),
G4RG (Hu,
F. Q., et al., Virology 204, 343-356 (1994)), and crmB (Gruss, H.-J, et al.,
Blood 85, 3378-
3404 (1995)).
[0594] By searching an expressed sequence tag (EST) database, a new member of
the
TNFR superfamily was identified, named TNFR-6a, and was characterized as a
soluble
cognate ligand for AIM-II and FasL/CD95L. AIM-II and Fast mediate the
apoptosis, which
is the most common physiological form of cell death and occurs during
embryonic
development, tissue remodeling, immune regulation and tumor regression.
[0595] AIM-II is highly induced in activated T lymphocytes and macrophages.
AIM-II
was characterized as a cellular ligand for HVEM/TR2 and LT(3R (Mauri, D. N.,
et al.,
Ifnmujzity 8, 21-30 (1998)). HVEM/TR2 is a receptor for herpes simplex virus
type 1 (HSV-
1) entry into human T lymphoblasts. Soluble form of HVEM/TR2-Fc and antibodies
to
HVEM/TR2 were shown to inhibit a mixed lymphocyte reaction, suggesting a role
for this
receptor or its ligand in T lymphocyte proliferation (Kwon, B. et al., J.
Biol. Chem. 272,
14272-14276 (1997); Mauri, D. N., et al., Immunity , 21-30 (1998); Harrop, J.
A., et al., J.
Immufzol. 161, 1786-1794 (1998)). The level of LT(3R expression is prominent
on epithelial
cells but is absent in T and B lymphocytes. Signaling via LT(3R triggers cell
death in some
adenocarcinomas (Browning, J. L., et al., J. Exp. Med. 183, 867-878 (1996)).
AIM-II
produced by activated lymphocytes could evoke immune modulation from
hematopoietic
cells expressing only HVEM/TR2, and induce apoptosis of tumor cells, which
express both
LT[3R and HVEM/TR2 receptors (Zhai, Y., et al., J. Clin. Invest. 102, 1142-
1151 (1998);
Harrop, J. A., et al., J. Biol. Claem. 273, 27548-27556 (1998)).
(0596] Fast is one of the major effectors of cytotoxic T lymphocytes and
natural killer
cells. It is also involved in the establishment of peripheral tolerance, in
the activation-induced
cell death of lymphocytes. Moreover, expression of Fast in nonlymphoid and
tumor cells
contributes to the maintenance of immune privilege of tissues by preventing
the infiltration of
205
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Fas-sensitive lymphocytes (Nagata, S., Cell 88, 355-365 (1997)). Fast is also
processed and
shed from the surface of human cell (Schneider, P., et al., J. Exp. Med. 187,
1205-1213
(1998)).
[0597] Here, we demonstrate that TNFR-hoc, a new member of the TNFR
superfamily
binds AIM-II and Fast. Therefore TNFR-6a, may act as an inhibitor in AIM-II -
induced
tumor cell death by blocking AIM-II interaction with its receptors.
Materials and Methods
Identification and cloning of new members of the TNFR superfam.ily.
[0598] An EST cDNA database, obtained from more than 600 different cDNA
libraries,
was screened for sequence homology with the cysteine-rich motif of the TNFR
superfamily,
using the blastn and tblastn algorithms. Three EST clones containing an
identical open
reading frame whose amino acid sequence showed significant homology to TNFR-II
were
identified from cDNA libraries of human normal prostate and pancreas tumor. A
full-length
TNFR-6 alpha cDNA clone encoding an intact N-terminal signal peptide was
obtained from a
human normal prostate library.
RT-PCR analysis.
[0599] For RT-PCR analysis, total RNA was isolated using Trizol (GIBCO) from
various
human cell lines before and after stimulation with PMA/Ionomycin or LPS. RNA
was
converted to cDNA by reverse transcription and amplified for 35 cycles by PCR.
Primers
used for amplification of the TNFR-6 alpha fragment are according to the
sequence of TNFR-
6 alpha. (3-actin was used as an internal control for RNA integrity. PCR
products were run on
2°7o agarose gel, stained with ethidium bromide and visualized by LTV
illumination.
Recombinant proteit2 production and purification.
[0600] The recombinant TNFR-6 alpha protein was produced with hexa-histidine
at the
C-terminus. TNFR-6 alpha-(His) encoding the entire TNFR-G alpha protein was
amplified by
PCR. For correctly oriented cloning, a HindIII site on the 5' end of the
forward primer (5'-
AGACCCAAGCTTCCTGCTCCA GCAAGGACCATG-3':SEQ ID N0:25) and a BamHI
site on the 5' end of the reverse primer (5'-
AGACGGGATCCTTAGTGGTGGTGGTGGTGGTGCAC
206
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0601] AGGGAGGAAGCGCTC-3':SEQ m N0:26) were created. The amplified
fragment was cut with HindIII/BamHI and cloned into mammalian expression
vector, pCEP4
(Invitrogen). The TNFR-6 alpha-(His)/pCEP4 plasmid was stably transfected into
HEK 293
EBNA cells to generate recombinant TNFR-6 alpha-(His). Serum free culture
media from
cells transfected TNFR-6 alpha-(His)/pCEP4 were passed through Ni-column
(Novagen).
The column eluents were fractionated by SDS-PAGE and TNFR-6 alpha-(His) was
detected
by western blot analysis using the anti-poly(His)6 antibody (Sigma).
[0602] Production of HVEM/TR2-Fc, LT(3R-Fc and Flag-tagged soluble AIM-II
(soluble
AIM-II) fusion proteins were previously described (Zhai, Y., et al., J. Clih.
Invest. 102,
1142-1151(1998)). Fc fusion protein-containing supernatants were filtered and
trapped onto
protein-G Sepharose beads. Flag-tagged soluble AIM-II proteins were purified
with anti-Flag
mAb affinity column.
I~iniufaoprecipitatioa.
[0603] TNFR-6 alpha-(His) was incubated overnight with various Flag-tagged
Iigands of
TNF superfamily and anti-Flag agarose in binding buffer (150 mM NaCI, 0.1% NP-
40,
0.25% gelatin, 50 mM HEPES, pH 7.4) at 4°C, and then precipitated. The
bound proteins
were resolved by 12.5% SDS-PAGE and detected by western blot with HRP-
conjugated anti-
poly(His)6 or anti-human IgGl antibodies.
Cell-bindiiag assay.
[0604] For cell-binding assays, HEK 293 EBNA cells were stably transfected
using
calcium phosphate method with pCEP4/full sequence of AIM-II cDNA or pCEP4
vector
alone. After selection with Hygromycin B, cells were harvested with ImM EDTA
in PBS and
incubated with TNFR-6 alpha-(His), HVEM/TR2-Fc, or LT(3R-Fc for 20 minutes on
ice. For
detecting Fc-fusion protein, cells were stained with FITC-conjugated goat anti-
human IgG.
To detect TNFR-6 alpha binding, cells were stained with anti-poly(His)6 and
FITC
conjugated goat anti-mouse IgG consecutively. The cells were analyzed by
FACScan (Becton
Dickinson).
Cytotoxicity Assay.
[0605] Cytotoxicity assays using HT29 cells were carried out as described
previously
(Browning, J. L., et al., J. Exp. Med. 183, 867-878 (1996)). Briefly, 5000
HT29 cells were
seeded in 96-well plates with 1% FBS, DMEM and treated with soluble AIM-II (10
ng/ml)
207
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
and 10 units/ml human recombinant interferon-'y (IFN-'y). Serial dilutions of
TNFR-6 alpha-
(His) were added in quadruplicate to microtiter wells. Cells treated with IFN-
~ and soluble
AIM-II were incubated with various amounts of TNFR-6 alpha-(His) for 4 days
before the
addition of [3H]thymidine for the last 6 h of culture. Cells were harvested,
and thymidine
incorporation was determined using a liquid scintillation counter.
Results and Discussion
TNFR-6 alpha is a raew rnernber of the TNFR superfamily
[0606] TNFR-6 alpha was identified by searching an EST database. Three clones
containing an identical open reading frame were identified from cDNA libraries
of human
normal prostate and pancreas tumor. A full-length TNFR-6 alpha cDNA encoding
an intact
N-terminal signal peptide was obtained from a human normal prostate library.
The open
reading frame of TNFR-6 alpha encodes 300 amino acids. To determine the N-
terminal
amino acid sequence of mature TNFR-6 alpha, hexa-histidine tagged TNFR-6 alpha
was
expressed in mammalian cell expression system and the N-terminal amino acid
sequence
were determined by peptide sequencing. The N-terminal sequence of the
processed mature
TNFR-6 alpha-(His) started from amino acid 30, indicating that the first 29
amino acids
constituted the signal sequence. Therefore, the mature protein of TNFR-6 alpha
was
composed of 271 amino acids with no transmembrane region. There was one
potential N-
linked glycosylation site (Asn173) in TNFR-6 alpha. Like OPG (Simmonet, W. et
al., Cell
89, 309-319 (1997)), the predicted protein was a soluble, secreted protein and
the
recombinant TNFR-6 alpha expressed in mammalian cells was ~40 kD as estimated
on
polyacrylamide gel. Alignment of the amino sequences of TNFR-I, TNFR-II, 4-
1BB,
TR2/HVEM, LTJ3R, TRIIOPG and TNFR-6 alpha illustrated the existence of a
potential
cysteine-rich motif. TNFR-6 alpha contained two perfect and two imperfect
cysteine-rich
motifs and its amino acid sequence was remarkably similar to TR1/OPG amino
acid
sequence. TNFR-6 alpha shares ~30% sequence homology with OPG and TNFR-II.
mRNA expression
[0607] We analyzed expression of TNFR-6 alpha mRNA in human multiple tissues
by
Northern blot hybridization. Northern blot analyses indicated that TNFR-6
alpha mRNA was
~1.3 kb in length and was expressed predominantly in lung tissue and
colorectal
adenocarcinoma cell line SW480. RT-PCR analyses were performed to determine
the
208
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
expression patterns of TNFR-6 alpha in various cell lines. TNFR-6 alpha
transcript was
detected weakly in most hematopoietic cell lines. The expression of TNFR-6
alpha was
induced upon activation in Jurkat T leukemia cells. Interestingly, TNFR-6
alpha mRNA was
constitutively expressed in endothelial cell line, HUVEC at high level.
Idefztification of the ligand for TNFR-6 alpha
[0608] To identify the ligand for TNFR-6 alpha, several Flag-tagged soluble
proteins of
TNF ligand family members were screened for binding to recombinant TNFR-6
alpha-(His)
protein by immuno-precipitation. TNFR-6 alpha-(His) selectively bound AIM-II-
Flag and
Fast-Flag among Flag-tagged soluble TNF ligand members tested. This result
indicates that
TNFR-6 alpha binds at least two ligands, AIM-II and Fast. AIM-II exhibits
significant
sequence homology with the C-terminal receptor-binding domain of Fast (31
°Io) but soluble
AIM-II is unable to bind to Fas (Mauri, D. N., et al., Imfnuzzity 8, 21-30
(1998); Zhai, Y., et
al., J. Clirz. Invest. 102, 1142-1151 (1998)). They may have a similar binding
epitope for
TNFR-6 alpha binding.
[0609] Previously, Zhai and Harrop (Zhai, Y., et al., J. Clirz. Invest. 102,
1142=1151
(1998); Harrop, J. A., et al., J. Biol. Chefn. 273, 27548-27556 (1998))
reported the
biological functions of AIM-II and its possible mechanisms of action as a
ligand for
HVEM/TR2 andlor LT[3R. AIM-II is expressed in activated T cells. AIM-II, in
conjunction
with serum starvation or addition of IFN-y, inhibits the cell proliferation in
tumor cells,
MDA-MB-231 and HT29.
[0610] To determine whether TNFR-6 alpha might act as an inhibitor to AIM-II
interactions with HVEM/TR2 or LT(3R, TNFR-6 alpha-(His) was used as a
competitive
inhibitor in AIM-II-HVEM/TR2 interaction. When AIM-II was immunoprecipitated
with
HVEM/TR2-Fc in the presence of TNFR-6 alpha-(His), HVEM/TR2-Fc binding to AIM-
II
was decreased competitively by TNFR-6 alpha-(His) but TNFR-6 alpha-(His)
binding to
AIM-II was not changed by HVEM/TR2-Fc. Furthermore, the binding of MM/TR2-Fc
(6
nM) or LT(3R (6 nM) was completely inhibited by 20 nM of TNFR-6 alpha-(His)
protein in
immunoprecipitation assays. These results support the notion that TNFR-6 alpha
may act as a
strong inhibitor of AIM-II function through HVEMlTR2 and LT(3R.
Biyzding of TNFR-6 alpha-(His) to AIM-II-transfected cells
209
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0611] To determine whether TNFR-6 alpha binds to AIlVZ..II expressed on cell
surface,
we performed binding assay using AIM-II-transfected HEK 293 EBNA cells by flow
cytometry. AIM-II-transfected HEK 293 EBNA cells were stained significantly by
TNFR-6
alpha-(His) as well as by HVEM/TR2-Fc and LT(3R-Fc. No binding was detected by
HVEM/TR2-Fc or LT(3R-Fc on pCEP4 vector-transfected HEK 293 EBNA cells.
Furthermore, control isotype did not bind to AIM-II-transfected HEK 293 EBNA
cells, and
any of above fusion proteins did not bind to vector-transfected cells,
confirming the
specificity of these bindings. These bindings indicate that TNFR-6 alpha can
bind to both
soluble and membrane-bound forms of AIM-II.
TNFR-6 alpha if2hibits AIM-11-i.saduced cytotoxicity iya HT29 cells
[0612] Browning et al.(J. Exp. Med. 183, 867-878 (1996)) have shown that Fas
activation leads to rapid cell death (12-24h) whereas LT(3R takes 2-3 days in
induction of
apoptosis for colorectal adenocarcinoma cell line, HT29. Zhai et al. (J. Clin.
Invest. 102,
1142-1151 (1998)) also reported that AIM-II leads to the death of the cells
expressing both
LT(3R and HVEMlTR2 but not the cells expressing only the LT(3R or HVEM/TR2
receptor.
Both HVEM/TR2 and LT[3R are involved cooperatively in AIM-II-mediated killing
of HT29
cells (Zhai, Y., et al., J. Clin. hevest. 102, 1142-1151(1998)).
[0613] To determine whether binding of TNFR-6 alpha inhibits AIM-II-mediated
cytotoxicity, HT29 cells were incubated with 10 ng/ml of soluble AIM-II and
IFN-'y (10
U/ml) in the presence of 200 ng/ml of LT(3R-Fc or TNFR-6 alpha-(His). TNFR-6
alpha-(His)
blocked significantly the AIM-II-mediated cell killing. Cells were also
incubated with soluble
AIM-II and/or IFN-'y in the presence of varying concentration of TNFR-6 alpha-
(His). TNFR-
6 alpha-(His) blocked soluble AIM-II-induced cell death in a dose-dependent
manner. Taken
together, TNFR-6 alpha appears to act as a natural inhibitor of AIM-II-induced
tumor cell
killing. The data also suggest that TNFR-6 alpha contributes to immune evasion
of tumors.
[0614] AIM-II interaction with HVEM/TR2 and/or LT(3R may trigger the distinct
biological events, such as T cell proliferation, blocking of HVEM-dependent
HSV1 infection
and anti-tumor activity (Mauri, D. N., et al., IrnnZUreity 8, 21-30 (1998);
Zhai, Y., et al., J.
Clira. Ifavest. 102, 1142-1151 (1998); Harrop, J. A., et al., J. Biol. Chem.
273, 27548-27556
(1998)). TNFR-6 alpha may act as an inhibitor of AIM-II interaction and may
play diverse
21'0
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
roles in different cell types. TNFR-6 alpha may act as a decoy receptor and
contribute to
immune evasion both in slow and rapid tumor cell death, that are mediated by
AIM-II and/or
Fast mediated apoptosis pathway.
[0615] FiUVEC cells constitutively expressed TNFR-6 alpha in RT-PCR analysis.
AIM-
II and Fast have been known to be expressed in activated T cells. Therefore
TNFR-6 alpha
and its ligands may be important for interactions between activated T
lymphocytes and
endothelium. TNFR-6 alpha may be involved in activated T cell trafficking as
well as
endothelial cell survival.
Exafnple 8: Activation-induced Apoptosis Assay
[0616] Activation-induced apoptosis is assayed using SupT-13 T leukemia cells
and is
measured by cell cycle analysis. The assay is performed as follows. SupT-13
cells are
maintained in RPMI containing 10% FCS in logarithmic growth (about 1 x 106).
Sup-T13
cells are seeded in wells of a 24 well plate at 0.5 x 1061m1, 1 ml/well. AIM
II protein or Fas
Ligand protein (0.01, 0.1, 1, 10, 100, 1000 ng/ml) or buffer control is added
to the wells and
the cells are incubated at 37°C for 24 hours in the presence or absence
of the TNFR
polypeptides of the invention. The wells of another 24 well plate are prepared
with or
without anti-CD3 antibody by incubating purified BC3 mAb at a concentration of
10 p,g/ml
in sterile-filtered 0.05M bicarbonate buffer, pH 9.5 or buffer alone in wells
at 0.5 ml/well.
The plate is incubated at 4°C overnight. The wells of antibody coated
plates are washed 3
times with sterile PBS, at 4°C. The treated Sup-T13 cells are
transfered to the antibody
coated wells and incubated for 18 hrs., at 37°C. Apoptosis is measured
by cell cycle analysis
using propidium iodide and flow cytometry. Proliferation of treated cells is
measured by
taking a total of 300 ~,l of each treatment well and delivering in to
triplicate wells (100
~,l/well) of 96 well plates. To each well add 20 ~ul/well 3H-thymidine (0.5
p.Cil20 p,1, 2
Ci/mM) and incubate 18 hr., at 37°C. Harvest and count 3H-thymidine
uptake by the cells.
This measurement may be used to confirm an effect on apoptosis if observed by
other
methods. The positive controls for the assay is Anti-CD3 crosslinking alone,
Fas Ligand
alone, and/or AIM-II alone. In addition, profound and reproducible apoptosis
in this line
using anti-Fas monoclonal antibody (500 ng/ml in soluble form-IgM mAb) has
been
demonstrated. The negative control for the assay is medium or buffer alone.
Also,
211
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
crosslinking with another anti-CD3 mAB (OI~T3) has been shown to have no
effect. TNFR
agonists according to the invention will demonstrate a reduced apoptosis when
compared to
the treatment of the Sup-T13 cells with AIM-II or Fas Ligand in the absence of
the TNFR
agonist. TNFR antagonists of the invention can be identified by combining TNFR
polypeptides having Fas Ligand or AIM-II binding affinity (e.g., mature TNFR)
with the
TNFR polypeptide to be tested and contacting this combination in solution with
AIM-II or
Fas Ligand and the Sup-T13 cells. The negative control for this assay is a
mixture containing
the mature TNFR, Sup-T13 cells, and AIM-II or Fas Ligand (Fast) alone. Samples
containing TNFR antagonists of the invention will demonstrate increased
apoptosis when
compared to the negative control.
[0617] If an effect is observed by cell cycle analysis the cells can be
further stained for
the TITNEL assay for flow cytometry or with Annexin V, using techniques well
known to
those skilled in the art.
Example 9: Blocking of Fas ligand Mediated Apoptosis of Jnrkat T cells by
TNFR6
alpha-Fc
Methods.
[0618] Jurkat T-cells which express the Fas receptor were treated either with
sFas ligand
alone or with sFas ligand in combination with Fas-Fc, or TNFR6 alpha-Fc
(corresponding to
the full length TNFR 6 alpha protein (amino acids 1-300 of SEQ ID N0:2) fused
to an Fc
domain, as described herein). The sFas ligand protein utilized was obtained
from Alexis
Corporation and contains a FLAG epitope tag at its N-terminus. As it has been
demonstrated
previously that cross-linking of Fas ligand utilizing the monoclonal Flag
epitope enhances
significantly the ability of Fas ligand to mediate apoptosis, the Flag
antibody was included in
this study. Specifically, 106 Jurkat cells (RPMI + 5%serum) were treated with
Fas ligand
(Alexis) (20ng/ml) and anti-Flag Mab (200ng/ml) and then incubated at
37°C for 16 hrs.
When TNFR6 alpha -Fc was included in the assay, the receptor was preincubated
with the
Fas ligand and anti-Flag Mab for 15 mins.
Results
[0619] After incubation, cells were harvested, resuspended in PBS and
subjected to Flow
Cytometric Analyses (Table V). In the absence of Fas ligand (FasL),
approximately 1% of
212
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
cells appear to be undergoing apoptosis as measured by high annexin staining
and poor
propidium iodide staining (Table IV). Treatment with soluble Fas ligand alone
resulted in an
approximate 7-fold increase in the number of apoptotic cells which as expected
could be
blocked in the presence of Fas-Fc. Similar to Fas-Fc, TNFR6 alpha -Fc was also
capable of
blocking Fas mediated apoptosis with the blocking by TNFR6 alpha-Fc observed
in a dose
dependent manner over three logarithmic scales (Table V). The ability of TNFR6
alpha -Fc to
block Fas mediated killing of Jurkat cells was also determined in a cell death
assay (Figures
7A-B). In this assay, cells were again treated with combinations of Fas ligand
and TNFR6
alpha-Fc for 16 hrs. To measure the levels of viable cells after treatment,
cells were incubated
for 5 hrs with 10% ALOMAR blue and examined spectrophotometrically at OD 570nm-
630nm. Treatment with Fas ligand resulted in a 50% decrease in cell viability
(Figures 7A-
B). The decrease in cell viability can be overcome by either Fas-Fc or TNFR6
alpha -Fc but
not TR5-Fc (Figures 7A-B), confirming the ability of TNFR6 alpha to interfere
with Fas
ligand mediated activity. The ability of TNFR6 alpha -Fc at both 100 ng/ml and
at 10 ng/ml
to block Fas ligand mediated activity in this assay is statistically different
(p < 0.05) than
when no TNFR6 alpha -Fc is added (Figures 7A-B). Furthermore, the ability of
TNFR6 alpha
-Fc to block Fas ligand mediated cell death and apoptosis appears to be as
efficient with Fas-
Fc (Table V and Figures 7A-B).
Table V. FACS Analysis revealing blocking of Fas ligand mediated apoptosis:
[0620] 106Jurkat cells (RPMI + 5% serum) were treated with Fas ligand
(Allexis; 20
ng/ml) and anti-FLAG (200 ng/ml) and then incubated at 37° C for 16
hours. When Fc
receptor was included in the assay, the receptor was preincubated with the Fas
ligand and
anti-FLAG Mab for 15 minutes. After incubation, cells were harvested,
resuspended in PBS
and subjected to Flow Cytometric Analyses.
Treatment % Cells undergoing apoptosis
Control (buffer) 1.24
Fast (20 ng) 8.87
Fast (20 ng)+ Fas-Fc (100 ng) 1.78
213
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Fast (20 ng)+ TNFR6 alpha-Fc (100 ng) 1.24
Fast (20 ng)+ TNFR6 alpha-Fc (10 ng) 2.79
Fast (20 ng)+ TNFR6 alpha-Fc (1 ng) 7.95
Fast (20 ng)+ TNFR6 alpha -Fc (0.1 ng) 8.58
Cottclusiofts.
[0621] TNFR6 alpha-Fc appears to block Fas ligand mediated apoptosis of Jurkat
cells in
a dose dependent manner as effectively as Fas ligand.
Exafnple 10: Protein Fusiorzs of TNFR-6 alptza and/or TNFR-6 beta
[0622] TNFR-6 alpha andlor TNFR-6 beta polypeptides of the invention are
optionally
fused to other proteins. These fusion proteins can be used for a variety of
applications. For
example, fusion of TNFR-6 alpha and/or TNFR-6 beta polypeptides to His-tag, HA-
tag,
protein A, IgG domains, and maltose binding protein facilitates purification.
(See EP A
394,827; Traunecker, et al., Nature 331:84-86 (1988).) Similarly, fusion to
IgG-1, IgG-3,
and albumin increases the halflife time itz vivo. Nuclear localization signals
fused to TNFR-6
alpha and/or TNFR-6 beta polypeptides can target the protein to a specific
subcellular
localization, while covalent heterodimer or homodimers can increase or
decrease the activity
of a fusion protein. Fusion proteins can also create chimeric molecules having
more than one
function. Finally, fusion proteins can increase solubility and/or stability of
the fused protein
compared o the non-fused protein. All of the types of fusion proteins
described above can be
made using techniques known in the art or by using or routinely modifying the
following
protocol, which outlines the fusion of a polypeptide to an IgG molecule.
[0623] Briefly, the human Fc portion of the IgG molecule can be PCR amplified,
using
primers that span the 5' and 3' ends of the sequence described below. These
primers also
preferably contain convenient restriction enzyme sites that will facilitate
cloning into an
expression vector, preferably a mammalian expression vector.
[0624] For example, if the pC4 (Accession No. 209646) expression vector is
used, the
human Fc portion can be ligated into the BamHI cloning site. Note that the 3'
BamHI site
should be destroyed. Next, the vector containing the human Fc portion is re-
restricted with
BamHI, linearizing the vector, and TNFR-6 alpha and/or TNFR-6 beta
polynucleotide,
214
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
isolated by the PCR protocol described in Example 1, is ligated into this
BamHI site. Note
that the polynucleotide is cloned without a stop codon, otherwise a fusion
protein will not be
produced.
[0625] If the naturally occurring signal sequence is used to produce the
secreted protein,
pC4 does not need a second signal peptide. Alternatively, if the naturally
occurring signal
sequence is not used, the vector can be modified to include a heterologous
signal sequence.
(See, e.g., International application publication number WO 96/34891.)
Human IgG Fc region:
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAATTCGAGGGTGCACCGTC
AGTC
TTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGGTGGTGGACGTAA
GCCA
CGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAG
CAGT
ACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAA
GGTC
TCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACA
CCCT
GCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGACATC
GCCG
TGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTT
CCTC
TACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGC
ACAA
CCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT
(SEQ ID N0:27)
Example 11: Productiou of an Antibody
Hybridoma Technology
[0626] The antibodies of the present invention can be prepared by a variety of
methods.
(See, Current Protocols, Chapter 2.) As one example of such methods, cells
expressing TR6-
alpha and/or TR6-beta are administered to an animal to induce the production
of sera
containing polyclonal antibodies. In a preferred method, a preparation of TR6-
alpha and/or
TR6-beta protein is prepared and purified to render it substantially free of
natural
contaminants. Such a preparation is then introduced into an animal in order to
produce
polyclonal antisera of greater specific activity.
[0627] Monoclonal antibodies specific for protein TR6-alpha and/or TR6-beta
are
prepared using hybridoma technology. (Kohler et al., Nature 256:495 (1975);
Kohler et al.,
Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976);
Hammerling et
al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-
681 (1981)).
In general, an animal (preferably a mouse) is immunized with TR6-alpha and/or
TR6-beta
polypeptide or, more preferably, with a secreted TR6-alpha and/or TR6-beta
polypeptide-
215
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
expressing cell. Such polypeptide-expressing cells are cultured in any
suitable tissue culture
medium, preferably in Earle's modified Eagle's medium supplemented with 10%
fetal
bovine serum (inactivated at about 56°C), and supplemented with about
10 g/1 of nonessential
amino acids, about 1,000 U/ml of penicillin, and about 100 pg/ml of
streptomycin.
[0628] The splenocytes of such mice are extracted and fused with a suitable
myeloma cell
line. Any suitable myeloma cell line may be employed in accordance with the
present
invention; however, it is preferable to employ the parent myeloma cell line
(SP20), available
from the ATCC. After fusion, the resulting hybridoma cells are selectively
maintained in
HAT medium, and then cloned by limiting dilution as described by Wands et al.
(Gastroenterology 80:225-232 (198I). The hybridoma cells obtained through such
a
selection are then assayed to identify clones which secrete antibodies capable
of binding the
TR6-alpha and/or TR6-beta polypeptide.
[0629] Alternatively, additional antibodies capable of binding to TR6-alpha
and/or TR6-
beta polypeptide can be produced in a two-step procedure using anti-idiotypic
antibodies.
Such a method makes use of the fact that antibodies are themselves antigens,
and therefore, it
is possible to obtain an antibody which binds to a second antibody. In
accordance with this
method, protein specific antibodies are used to immunize an animal, preferably
a mouse. The
splenocytes of such an animal are then used to produce hybridoma cells, and
the hybridoma
cells are screened to identify clones which produce an antibody whose ability
to bind to the
TR6-alpha and/or TR6-beta protein-specific antibody can be blocked by TR6-
alpha and/or
TR6-beta. Such antibodies comprise anti-idiotypic antibodies to the TR6-alpha
and/or TR6-
beta protein-specific antibody and are used to immunize an animal to induce
formation of
further TR6-alpha and/or TR6-beta protein-specific antibodies.
[0630] For in vivo use of antibodies in humans, an antibody is "humanized".
Such
antibodies can be produced using genetic constructs derived from hybridoma
cells producing
the monoclonal antibodies described above. Methods for producing chimeric and
humanized
antibodies are known in the art and are discussed infra. (See, for review,
Morrison, Science
229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et al., U.S.
Patent No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494; Neuberger
et al., WO
8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312:643 (1984);
Neuberger
et al., Nature 314:268 (1985).)
216
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Isolation Of Antibody Fragments Directed Against TR6-alpha and/or TR6-beta
From
A Library Of scFvs
[0631] Naturally occurring V-genes isolated from human PBLs are constructed
into a
library of antibody fragments which contain reactivities against TR6-alpha
and/or TR6-beta
to which the donor may or may not have been exposed (see e.g., U.S. Patent
5,885,793
incorporated herein by reference in its entirety).
[0632] Rescue of the Library. A library of scFvs is constructed from the RNA
of human
PBLs as described in PCT publication WO 92/01047. To rescue phage displaying
antibody
fragments, approximately 109 E. coli harboring the phagemid are used to
inoculate 50 ml of
2xTY containing 1 % glucose and 100 ~,glml of ampicillin (2xTY-AMP-GLU) and
grown to
an O.D. of 0.8 with shaking. Five ml of this culture is used to innoculate 50
ml of 2xTY-
AMP-GLU, 2 x 108 TU of delta gene 3 helper (M13 delta gene III, see PCT
publication WO
92/01047) are added and the culture incubated at 37°C for 45 minutes
without shaking and
then at 37°C for 45 minutes with shaking. The culture is centrifuged at
4000 r.p.m. for 10
min. and the pellet resuspended in 2 liters of 2xTY containing 100 ~,g/ml
ampicillin and 50
ug/ml kanamycin and grown overnight. Phage are prepared as described in PCT
publication
WO 92/01047.
[0633] M13 delta gene III is prepared as follows: M13 delta gene III helper
phage does
not encode gene III protein, hence the phage(mid) displaying antibody
fragments have a
greater avidity of binding to antigen. Infectious M13 delta gene III particles
are made by
growing the helper phage in cells harboring a pUC 19 derivative supplying the
wild type gene
III protein during phage morphogenesis. The culture is incubated for 1 hour at
37° C without
shaking and then for a further hour at 37°C with shaking. Cells are
spun down (IEC-Centra
8,400 r.p.m. for 10 min), resuspended in 300 ml 2xTY broth containing 100 ~,g
ampicillin/ml
and 25 ~,g kanamycin/ml (2xTY-AMP-KAN) and grown overnight, shaking at
37°C. Phage
particles are purified and concentrated from the culture medium by two PEG-
precipitations
(Sambrook et al., 1990), resuspended in 2 ml PBS and passed through a 0.45 ,um
filter
(Minisart NML; Sartorius) to give a final concentration of approximately 1013
transducing
units/ml (ampicillin-resistant clones).
[0634] Panning of the Library. Immunotubes (Nunc) are coated overnight in PBS
with 4
ml of either 100 ~,g/ml or 10 ~,g/ml of a polypeptide of the present
invention. Tubes are
blocked with 2% Marvel-PBS for 2 hours at 37°C and then washed 3 times
in PBS.
217
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Approximately 1013 TLT of phage is applied to the tube and incubated for 30
minutes at
room temperature tumbling on an over and under turntable and then left to
stand for another
1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with
PBS.
Phage are eluted by adding 1 ml of 100 mM triethylamine and rotating 15
minutes on an
under and over turntable after which the solution is immediately neutralized
with 0.5 ml of
1.0M Tris-HCl, pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli
TGl by
incubating eluted phage with bacteria for 30 minutes at 37°C. The E.
coli are then plated on
TYE plates containing 1 % glucose and 100 pg/ml ampicillin. The resulting
bacterial library
is then rescued with delta gene 3 helper phage as described above to prepare
phage for a
subsequent round of selection. This process is then repeated for a total of 4
rounds of affinity
purification with tube-washing increased to 20 times with PBS, 0.1% Tween-20
and 20 times
with PBS for rounds 3 and 4.
[0635] Characterization of Binders. Eluted phage from the 3rd and 4th rounds
of
selection are used to infect E. coli HB 2151 and soluble scFv is produced
(Marks, et al.,
1991) from single colonies for assay. ELISAs are performed with microtitre
plates coated
with either 10 pg/ml of the polypeptide of the present invention in 50 mM
bicarbonate pH
9.6. Clones positive in ELISA are further characterized by PCR fingerprinting
(see, e.g., PCT
publication WO 92/01047) and then by sequencing.
Example 12: Method of Determining Alterations in the TNFR-6 alpha and/or
TNFR-6 beta Gene
[0636] RNA is isolated from entire families or individual patients presenting
with a
phenotype of interest (such as a disease). cDNA is then generated from these
RNA samples
using protocols known in the art. (See, Sambrook.) The cDNA is then used as a
template for
PCR, employing primers surrounding regions of interest in SEQ ID NO:1.
Suggested PCR
conditions consist of 35 cycles at 95° C for 30 seconds; 60-120 seconds
at 52-58° C; and 60-
120 seconds at 70° C, using buffer solutions described in Sidransky,
D., et al., Science
252:706 ( 1991 ).
[0637] PCR products are then sequenced using primers labeled at their 5' end
with T4
polynucleotide kinase, employing SequiTherm Polymerase. (Epicentre
Technologies). The
intron-exon borders of selected exons of TNFR-6 alpha andlor TNFR-6 beta are
also
218
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
determined and genomic PCR products analyzed to confirm the results. PCR
products
harboring suspected mutations in TNFR-6 alpha and/or TNFR-6 beta is then
cloned and
sequenced to validate the results of the direct sequencing.
[0638] PCR products of TNFR-6 alpha andlor TNFR-6 beta are cloned into T-
tailed
vectors as described in Holton, T.A. and Graham, M.W., Nucleic Acids Research,
19:1156
(1991) and sequenced with T7 polymerase (United States Biochemical). Affected
individuals
are identified by mutations in TNFR-6 alpha and/or TNFR-6 beta not present in
unaffected
individuals.
[0639] Genomic rearrangements are also observed as a method of determining
alterations
in the TNFR-6 alpha and/or TNFR-6 beta gene. Genomic clones isolated using
techniques
known in the art are nick-translated with digoxigenindeoxy-uridine 5'-
triphosphate
(Boehringer Manheim), and FISH performed as described in Johnson, et al.,
Methods Cell
Baol. 35:73-99 (1991). Hybridization with the labeled probe is carried out
using a vast excess
of human cot-1 DNA for specific hybridization to the TNFR-6 alpha and/or TNFR-
6 beta
genomic locus.
[0640] Chromosomes are counterstained with 4,6-diamino-2-phenylidole and
propidium
iodide, producing a combination of C- and R-bands. Aligned images for precise
mapping are
obtained using a triple-band filter set (Chroma Technology, Brattleboro, VT)
in combination
with a cooled charge-coupled device camera (Photometrics, Tucson, A2) and
variable
excitation wavelength filters. (Johnson, et al., Genet. Anal. Tech. Appl.,
8:75 (1991).) Image
collection, analysis and chromosomal fractional length measurements are
performed using the
ISee Graphical Program System. (Inovision Corporation, Durham, NC.) Chromosome
alterations of the genomic region of TNFR-6 alpha and/or TNFR-6 beta
(hybridized by the
probe) are identified as insertions, deletions, and translocations. These TNFR-
6 alpha and/or
TNFR-6 beta alterations are used as a diagnostic marker for an associated
disease.
Exanzple 13: Method of Detecting Abnormal Levels of TNFR-6 alpha and/or TNFR-6
beta in a Biological Sample
[0641] TNFR-6 alpha andlor TNFR-6 beta polypeptides can be detected in a
biological
sample, and if an increased or decreased level of TNFR-6 alpha and/or TNFR-6
beta is
detected, this polypeptide is a marker for a particular phenotype. Methods of
detection are
219
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
numerous, and thus, it is understood that one skilled in the art can modify
the following assay
to fit their particular needs.
[0642] For example, antibody-sandwich ELISAs are used to detect TNFR-6 alpha
and/or
TNFR-6 beta in a sample, preferably a biological sample. Wells of a microtiter
plate are
coated with specific antibodies to TNFR-6 alpha and/or TNFR-6 beta, at a final
concentration
of 0.2 to 10 ug/ml. The antibodies are either monoclonal or polyclonal and are
produced
using technique known in the art. The wells are blocked so that non-specific
binding of
TNFR-6 alpha and/or TNFR-6 beta to the well is reduced.
[0643] The coated wells are then incubated for > 2 hours at RT with a sample
containing
TNFR-6 alpha and/or TNFR-6 beta. Preferably, serial dilutions of the sample
should be used
to validate results. The plates are then washed three times With deionized or
distilled water to .
remove unbounded TNFR-6 alpha and/or TNFR-6 beta.
[0644] Next, 50 u1 of specific antibody-alkaline phosphatase conjugate, at a
concentration
of 25-400 ng, is added and incubated for 2 hours at room temperature. The
plates are again
washed three times with deionized or distilled water to remove unbounded
conjugate.
[0645] 75 u1 of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl
phosphate
(NPP) substrate solution is then added to each well and incubated 1 hour at
room temperature
to allow cleavage of the substrate and flourescence. The flourescence is
measured by a
microtiter plate reader. A standard curve is prepared using the experimental
results from
serial dilutions of a control sample with the sample concentration plotted on
the X-axis (log
scale) and fluorescence or absorbance on the Y-axis (linear scale). The TNFR-6
alpha and/or
TNFR-6 beta polypeptide concentration in a sample is then interpolated using
the standard
curve based on the measured flourescence of that sample.
Example 14: Method of Treating Decreased Levels of TNFR-6 alpha and/or TNFR-6
beta
[0646] The present invention relates to a method for treating an individual in
need of a
decreased level of TNFR-6 alpha and/or TNFR-6 beta biological activity in the
body
comprising, administering to such an individual a composition comprising a
therapeutically
effective amount of TNFR-6 alpha and/or TNFR-6 beta antagonist. Preferred
antagonists for
use in the present invention are TNFR-6 alpha and/or TNFR-6 beta-specific
antibodies.
[0647] Moreover, it will be appreciated that conditions caused by a decrease
in the
standard or normal expression level of TNFR-6 alpha and/or TNFR-6 beta in an
individual
220
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
can be treated by administering TNFR-6 alpha and/or TNFR-6 beta, preferably in
a soluble
and/or secreted form. Thus, the invention also provides a method of treatment
of an
individual in need of an increased level of TNFR-6 alpha and/or TNFR-6 beta
polypeptide
comprising administering to such an individual a pharmaceutical composition
comprising an
amount of TNFR-6 alpha and/or TNFR-6 beta to increase the biological activity
level of
TNFR-6 alpha and/or TNFR-6 beta in such an individual.
[0648] For example, a patient with decreased levels of TNFR-6 alpha and/or
TNFR-6
beta polypeptide receives a daily dose 0.1-100 ug/kg of the polypeptide for
six consecutive
days. Preferably, the polypeptide is in a soluble and/or secreted form.
Exafnple I5: Metlaod of TYeating Increased Levels of TNFR-6 alpha andlov TNFR-
6 beta
[0649] The present invention also relates to a method for treating an
individual in need of
an increased level of TNFR-6 alpha and/or TNFR-6 beta biological activity in
the body
comprising administering to such an individual a composition comprising a
therapeutically
effective amount of TNFR-6 alpha and/or TNFR-6 beta or an agonist thereof.
[0650] Antisense technology is used to inhibit production of TNFR-6 alpha
and/or
TNFR-6 beta. This technology is one example of a method of decreasing levels
of TNFR-6
alpha and/or TNFR-6 beta polypeptide, preferably a soluble and/or secreted
form, due to a
variety of etiologies, such as cancer.
[0651] For example, a patient diagnosed with abnormally increased levels of
TNFR-6
alpha and/or TNFR-6 beta is administered intravenously antisense
polynucleotides at 0.5, 1.0,
1.5, 2.0 and 3.0 mg/kg day for 21 days. This treatment is repeated after a 7-
day rest period if
the is determined to be well tolerated.
Example 16: Method of Ti-eatynent Using Gene Therapy - Ex ~vo
[0652] One method of gene therapy transplants fibroblasts, which are capable
of
expressing oluble and/or mature TNFR-6 alpha and/or TNFR-6 beta polypeptides,
onto a
patient. Generally, fibroblasts are obtained from a subject by skin biopsy.
The resulting
tissue is placed in tissue-culture medium and separated into small pieces.
Small chunks of
the tissue are placed on a wet surface of a tissue culture flask,
approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight and left
at room
temperature over night. After 24 hours at room temperature, the flask is
inverted and the
221
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
chunks of tissue remain fixed to the bottom of the flask and fresh media
(e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin) is added. The flasks are
then incubated at
37 degree C for approximately one week.
[0653] At this time, fresh media is added and subsequently changed every
several days.
After an additional two weeks in culture, a monolayer of fibroblasts emerge.
The monolayer
is trypsinized and scaled into larger flasks.
[0654] pMV-7 (Kirschmeier, P.T. et al., DNA, 7:219-25 (1988)), flanked by the
long
terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI
and HindIII
and subsequently treated with calf intestinal phosphatase. The linear vector
is fractionated on
agarose gel and purified, using glass beads.
[0655] The cDNA encoding TNFR-6 alpha and/or TNFR-6 beta can be amplified
using
PCR primers which correspond to the 5' and 3' end encoding sequences
respectively.
Preferably, the 5' primer contains an EcoRI site and the 3' primer includes a
HindIII site.
Equal quantities of the Moloney murine sarcoma virus linear backbone and the
amplified
EcoRI and IiindIII fragment are added together, in the presence of T4 DNA
ligase. The
resulting mixture is maintained under conditions appropriate for ligation of
the two
fragments. The ligation mixture is then used to transform E. coli HB 101,
which are then
plated onto agar containing kanamycin for the purpose of confirming that the
vector contains
properly inserted TNFR-6 alpha and/or TNFR-6 beta.
[0656] The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue
culture
to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf
serum
(CS), penicillin and streptomycin. The MSV vector containing the TNFR-6 alpha
and/or
TNFR-6 beta gene is then added to the media and the packaging cells transduced
with the
vector. The packaging cells now produce infectious viral particles containing
the TNFR-6
alpha and/or TNFR-6 beta gene (the packaging cells are now referred to as
producer cells).
[0657] Fresh media is added to the transduced producer cells, and
subsequently, the
media is harvested from a 10 cm plate of confluent producer cells. The spent
media,
containing the infectious viral particles, is filtered through a millipore
filter to remove
detached producer cells and this media is then used to infect fibroblast
cells. Media is
removed from a sub-confluent plate of fibroblasts and quickly replaced with
the media from
the producer cells. This media is removed and replaced with fresh media. If
the titer of virus
222
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
is high, then virtually all fibroblasts will be infected and no selection is
required: If the titer
is very low, then it is necessary to use a retroviral vector that has a
selectable marker, such as
neo or his. Once the fibroblasts have been efficiently infected, the
fibroblasts are analyzed to
determine whether TNFR-6 alpha and/or TNFR-6 beta protein is produced.
[0658] The engineered fibroblasts are then transplanted onto the host, either
alone or after
having been grown to confluence on cytodex 3 microcan~er beads.
Example 17: Method of Treatment Using GefZe Therapy - I~ ~vo
[0659] Another aspect of the present invention is using in vivo gene therapy
methods to
treat disorders, diseases and conditions. The gene therapy method relates to
the introduction
of naked nucleic acid (DNA, RNA, and antisense DNA or RNA) TNFR-6 alpha and/or
TNFR-6 beta sequences into an animal to increase or decrease the expression of
the TNFR-6
alpha and/or TNFR-6 beta polypeptide. The TNFR-6 alpha and/or TNFR-6 beta
polynucleotide may be operatively linked to a promoter or any other genetic
elements
necessary for the expression of the TNFR-6 alpha and/or TNFR-6 beta
polypeptide by the
target tissue. Such gene therapy and delivery techniques and methods are known
in the art,
see, for example, International Application publication number W090/11092,
International
Application publication number W098/11779; US Patent NO. 5693622, 5705151,
5580859;
Tabata H. et al., Cardiovasc. Res. 35:470-479 (1997); Chao J. et al.,
Phannacol. Res. 35:517-
522 (1997); Wolff J.A. Neuronauscul. Disord. 7:314-318 (1997); Schwartz B. et
al., Gene
Ther. 3:405-411 (1996); Tsurumi Y. et al., Circulation 94:3281-3290 (1996)
(incorporated
herein by reference).
[0660] The TNFR-6 alpha and/or TNFR-6 beta polynucleotide constructs may be
delivered by any method that delivers injectable materials to the cells of an
animal, such as,
injection into the interstitial space of tissues (heart, muscle, skin, lung,
liver, intestine and the
like). The TNFR-6 alpha and/or TNFR-6 beta polynucleotide constructs can be
delivered in a
pharmaceutically acceptable liquid or aqueous carrier.
[0661] The term "naked" polynucleotide, DNA or RNA, refers to sequences that
are free
from any delivery vehicle that acts to assist, promote, or facilitate entry
into the cell,
including viral sequences, viral particles, liposome formulations, lipofectin
or precipitating
agents and the like. However, the TNFR-6 alpha and/or TNFR-6 beta
polynucleotides may
223
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
also be delivered in liposome formulations (such as those taught in Felgner
P.L. et a1.(1995)
Ann. NY Acad. Sci. 772:126-139 and Abdallah B. et a1.(1995) Biol. Cell 85(1):1-
7) which
can be prepared by methods well known to those skilled in the art.
[0662] The TNFR-6 alpha and/or TNFR-6 beta polynucleotide vector constructs
used in
the gene therapy method are preferably constructs that will not integrate into
the host genome
nor will they contain sequences that allow for replication. Any strong
promoter known to
those skilled in the art can be used for driving the expression of DNA. Unlike
other gene
therapies techniques, one major advantage of introducing naked nucleic acid
sequences into
target cells is the transitory nature of the polynucleotide synthesis in the
cells. Studies have
shown that non-replicating DNA sequences can be introduced into cells to
provide production
of the desired polypeptide for periods of up to six months.
[0663] The TNFR-6 alpha and/or TNFR-6 beta polynucleotide construct can be
delivered
to the interstitial space of tissues within the an animal, including of
muscle, skin, brain, lung,
liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage,
pancreas, kidney,
gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous
system, eye, gland, and
connective tissue. Interstitial space of the tissues comprises the
intercellular fluid,
mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic
fibers in the
walls of vessels or chambers, collagen fibers of fibrous tissues, or that same
matrix within
connective tissue ensheathing muscle cells or in the lacunae of bone. It is
similarly the space
occupied by the plasma of the circulation and the lymph fluid of the lymphatic
channels.
Delivery to the interstitial space of muscle tissue is preferred for the
reasons discussed below.
They may be conveniently delivered by injection into the tissues comprising
these cells.
They are preferably delivered to and expressed in persistent, non-dividing
cells which are
differentiated, although delivery and expression may be achieved in non-
differentiated or less
completely differentiated cells, such as, for example, stem cells of blood or
skin fibroblasts.
Tn vivo muscle cells are particularly competent in their ability to take up
and express
polynucleotides.
[0664] For the naked TNFR-6 alpha and/or TNFR-6 beta polynucleotide injection,
an
effective dosage amount of DNA or RNA will be in the range of from about 0.05
g/kg body
weight to about 50 mg/kg body weight. Preferably the dosage will be from about
0.005
mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5
mg/kg. Of
224
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
course, as the artisan of ordinary skill will appreciate, this dosage will
vary according to the
tissue site of injection. The appropriate and effective dosage of nucleic acid
sequence can
readily be determined by those of ordinary slcill in the art and may depend on
the condition
being treated and the route of administration. The preferred route of
administration is by the
parenteral route of injection into the interstitial space of tissues. However,
other parenteral
routes may also be used, such as, inhalation of an aerosol formulation
particularly for
delivery to lungs or bronchial tissues, throat or mucous membranes of the
nose. In addition,
naked TNFR-6 alpha and/or TNFR-6 beta polynucleotide constructs can be
delivered to
arteries during angioplasty by the catheter used in the procedure.
[0665] The dose response effects of injected TNFR-6 alpha and/or TNFR-6 beta
polynucleotide in muscle in vivo is determined as follows. Suitable TNFR-6
alpha andlor
TNFR-6 beta template DNA for production of mRNA coding for TNFR-6 alpha andlor
TNFR-6 beta polypeptide is prepared in accordance with a standard recombinant
DNA
methodology. The template DNA, which may be either circular or linear, is
either used as
naked DNA or complexed with liposomes. The quadriceps muscles of mice are then
injected
with various amounts of the template DNA.
[0666] Five to six week old female and male Balb/C mice are anesthetized by
intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is
made on the
anterior thigh, and the quadriceps muscle is directly visualized. The TNFR-6
alpha and/or
TNFR-6 beta template DNA is injected in 0.1 ml of carrier in a 1 cc syringe
through a 27
gauge needle over one minute, approximately 0.5 cm from the distal insertion
site of the
muscle into the knee and about 0.2 cm deep. A suture is placed over the
injection site for
future localization, and the skin is closed with stainless steel clips.
[0667] After an appropriate incubation time (e.g., 7 days) muscle extracts are
prepared by
excising the entire quadriceps. Every fifth ,15 um cross-section of the
individual quadriceps
muscles is histochemically stained for TNFR-6 alpha and/or TNFR-6 beta protein
expression.
A time course for TNFR-6 alpha andlor TNFR-6 beta protein expression may be
done in a
similar fashion except that quadriceps from different mice are harvested at
different times.
Persistence of TNFR-6 alpha and/or TNFR-6 beta DNA in muscle following
injection may be
determined by Southern blot analysis after preparing total cellular DNA and
HIRT
supernatants from injected and control mice. The results of the above
experimentation in
225
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
mice can be use to extrapolate proper dosages and other treatment parameters
in humans and
other animals using TNFR-6 alpha and/or TNFR-6 beta naked DNA.
Example 18: Rescue of Isclzernia iu Rabbit Lower Limb Model
[0668] To study the in vivo effects of TNFR-6 alpha andlor TNFR-6 beta on
ischemia, a
rabbit hindlimb ischemia model is created by surgical removal of one femoral
arteries as
described previously (Takeshita, S. et al., Am J. Pathol 147:1649-1660
(1995)). The excision
of the femoral artery results in retrograde propagation of thrombus and
occlusion of the
external iliac artery. Consequently, blood flow to the ischemic limb is
dependent upon
collateral vessels originating from the internal iliac artery (Takeshita, et
al., A112 J. Pat7ZOl
147:1649-1660 (1995)). An interval of 10 days is allowed for post-operative
recovery of
rabbits and development of endogenous collateral vessels. At 10 day post-
operatively (day
0), after performing a baseline angiogram, the internal iliac artery of the
ischemic limb is
transfected with 500 mg naked TNFR-6 alpha andlor TNFR-6 beta expression
plasmid by
arterial gene transfer technology using a hydrogel-coated balloon catheter as
described
(Riessen, R. et al., Hum Gene Ther. 4:749-758 (1993); Leclerc, G. et al., J.
Clifz. havest. 90:
936-944 (1992)). When is used in the treatment, a single bolus of 500 mg
protein or control
is delivered into the internal iliac artery of the ischemic limb over a period
of 1 min. through
an infusion catheter. On day 30, various parameters are measured in these
rabbits: (a) BP
ratio - The blood pressure ratio of systolic pressure of the ischemic limb to
that of normal
limb; (b) Blood Flow and Flow Reserve - Resting FL: the blood flow during
undilated
condition and Max FL: the blood flow during fully dilated condition (also an
indirect measure
of the blood vessel amount) and Flow Reserve is reflected by the ratio of max
FL: resting FL;
(c) Angiographic Score - This is measured by the angiogram of collateral
vessels. A score is
determined by the percentage of circles in an overlaying grid that with
crossing opacified
arteries divided by the total number m the rabbit thigh; (d) Capillary density
- The number of
collateral capillaries determined in light microscopic sections taken from
hindlimbs.
[0669] The studies described in this example test activity in TNFR-6 proteins.
However,
one skilled in the art could easily modify the exemplified studies to test the
activity of
polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TNFR-6
alpha and/or
TNFR-6 beta.
226
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
Example 19: Diabetic Mouse and Glucocorticoid-Impaired Wou>zd Healing Models
Diabetic db+ldb+ Mouse Model.
[0670] To demonstrate that TNFR-6 accelerates the healing process, the
genetically
diabetic mouse model of wound healing is used. The full thickness wound
healing model in
the db+/db+ mouse is a well characterized, clinically relevant and
reproducible model of
impaired wound healing. Healing of the diabetic wound is dependent on
formation of
granulation tissue and re-epithelialization rather than contraction (Gartner,
M.H. et al., J.
Surg. Res. 52:389 (1992); Greenhalgh, D.G. et al., Am. J. Pathol. 136:1235
(1990)).
[0671] The diabetic animals have many of the characteristic features observed
in Type iI
diabetes mellitus. Homozygous (db+/db+) mice are obese in comparison to their
normal
heterozygous (db+/+m) littermates. Mutant diabetic (db+/db+) mice have a
single autosomal
recessive mutation on chromosome 4 (db+) (Coleman et al.Proc. Natl. Acad. Sci.
USA
77:283-293 (1982)). Animals show polyphagia, polydipsia and polyuria. Mutant
diabetic
mice (db+/db+) have elevated blood glucose, increased or normal insulin
levels, and
suppressed cell-mediated immunity (Mandel et al., J. Immuzzol. 120:1375
(1978); Debray-
Sachs, M. et al., Clih. Exp. Isnmufzol. 51 (1 ):1-7 (1983); Leiter et al., Am.
J. of Pathol. 114:46-
55 (1985)). Peripheral neuropathy, myocardial complications, and microvascular
lesions,
basement membrane thickening and glomerular filtration abnormalities have been
described
in these animals (Norido, F. et al., Exp. Neurol. 83(2):221-232 (1984);
Robertson et al.,
Diabetes 29(1):60-67 (1980); Giacomelli et al., Lab Invest. 40(4):460-473
(1979); Coleman,
D.L., Diabetes 31 (Suppl):1-6 (1982)). These homozygous diabetic mice develop
hyperglycemia that is resistant to insulin analogous to human type II diabetes
(Mandel et al.,
J. Immunol. 120:1375-1377 (1978)).
[0672] The characteristics observed in these animals suggests that healing in
this model
may be similar to the healing observed in human diabetes (Greenhalgh, et al.,
Am. J. of
Pathol. 136:1235-1246 (1990)).
[0673] Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-
diabetic
(db+/+m) heterozygous littermates are used in this study (Jackson
Laboratories). The
animals are purchased at 6 weeks of age and were 8 weeks old at the beginning
of the study.
Animals are individually housed and received food and water ad libitum. All
manipulations
227
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
are performed using aseptic techniques. The experiments are conducted
according to the
rules and guidelines of Human Genome Sciences, Inc. Institutional Animal Care
and Use
Committee and the Guidelines for the Care and Use of Laboratory Animals.
[0674] Wounding protocol is performed according to previously reported methods
(Tsuboi, R. and Rifkin, D.B., J. Exp. Med. 172:245-251 (1990)). Briefly, on
the day of
wounding, animals are anesthetized with an intraperitoneal injection of
Avertin (0.01
mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in deionized
water. The
dorsal region of the animal is shaved and the skin washed with 70% ethanol
solution and
iodine. The surgical area is dried with sterile gauze prior to wounding. An 8
mm full-
thickness wound is then created using a Keyes tissue punch. Immediately
following
wounding, the surrounding skin is gently stretched to eliminate wound
expansion. The
wounds are left open for the duration of the experiment. Application of the
treatment is given
topically for 5 consecutive days commencing on the day of wounding. Prior to
treatment,
wounds are gently cleansed with sterile saline and gauze sponges.
[0675] Wounds are visually examined and photographed at a fixed distance at
the day of
surgery and at two day intervals thereafter. Wound closure is determined by
daily
measurement on days 1-5 and on day 8. Wounds are measured horizontally and
vertically
using a calibrated Jameson caliper. Wounds are considered healed if
granulation tissue is no
longer visible and the wound is covered by a continuous epithelium.
[0676] TNFR-6 alpha and/or TNFR-6 beta is administered using at a range
different
doses of TNFR-6 protein, from 4mg to 500mg per wound per day for 8 days in
vehicle.
Vehicle control groups received 50mL of vehicle solution.
[0677] Animals are euthanized on day 8 with an intraperitoneal injection of
sodium
pentobarbital (300mg/kg). The wounds and surrounding skin are then harvested
for histology
and immunohistochemistry. Tissue specimens are placed in 10% neutral buffered
formalin in
tissue cassettes between biopsy sponges for further processing.
[0678] Three groups of 10 animals each (5 diabetic and 5 non-diabetic
controls) are
evaluated: 1) Vehicle placebo control, 2) TNFR-6 alpha and/or TNFR-6 beta.
[0679] Wound closure is analyzed by measuring the area in the vertical and
horizontal
axis and obtaining the total square area of the wound. Contraction is then
estimated by
establishing the differences between the initial wound area (day 0) and that
of post treatment
228
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
(day 8). The wound area on day 1 was 64mmz, the corresponding size of the
dermal punch.
Calculations were made using the following formula:
[0680] [Open area on day 8] - [Open area on day 1] / [Open area on day 1]
[0681]
[0682] Specimens are fixed in 10% buffered formalin and paraffin embedded
blocks are
sectioned perpendicular to the wound surface (Smm) and cut using a Reichert-
Jung
microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross-
sections of
bisected wounds. Histologic examination of the wounds are used to assess
whether the
healing process and the morphologic appearance of the repaired skin is altered
by treatment
with TNFR-6. This assessment included verification of the presence of cell
accumulation,
inflammatory cells, capillaries, fibroblasts, re-epithelialization and
epidermal maturity
(Greenhalgh, D.G. et al., Am. J. Patlzol. 136:1235 (1990)). A calibrated lens
micrometer is
used by a blinded observer.
[0683] Tissue sections are also stained immunohistochemically with a
polyclonal rabbit
anti-human keratin antibody using ABC Elite detection system. Human skin is
used as a
positive tissue control while non-immune IgG is used as a negative control.
Keratinocyte
growth is determined by evaluating the extent of reepithelialization of the
wound using a
calibrated lens micrometer.
[0684] Proliferating cell nuclear antigen/cyclin (PCNA) in skin specimens is
demonstrated by using anti-PCNA antibody (1:50) with an ABC Elite detection
system.
Human colon cancer served as a positive tissue control and human brain tissue
is used as a
negative tissue control. Each specimen included a section with omission of the
primary
antibody and substitution with non-immune mouse IgG. Ranking of these sections
is based
on the extent of proliferation on a scale of 0-8, the lower side of the scale
reflecting slight
proliferation to the higher side reflecting intense proliferation.
[0685] Experimental data are analyzed using an unpaired t test. A p value of <
0:05 is
considered significant.
B. Steroid Impaired Rat Model
229
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0686] The inhibition of wound healing by steroids has been well documented in
various
in vitro and in vivo systems (Wahl, S.M. Glucocorticoids and Wound healing.
In: Anti-
Inflammatory Steroid Action: Basic and Clinical Aspects. 280-302 (1989); Wahl,
S.M. et
al., J. Inamunol. 115: 476-481 (1975); Werb, Z. et al., J. Exp. Med. 147:1684-
1694 (1978)).
Glucocorticoids retard wound healing by inhibiting angiogenesis, decreasing
vascular
permeability (Ebert, R.H., et al., An. Ifitem. Med. 37:701-705 (1952)),
fibroblast
proliferation, and collagen synthesis (Beck, L.S. et al., Growth Factors. 5:
295-304 (1991);
Haynes, B.F. et al., J. Clin. Isavest. 61: 703-797 (1978)) and producing a
transient reduction
of circulating monocytes (Haynes, B.F., et al., J. Clin. Invest. 61: 703-797
(1978); Wahl, S.
M., "Glucocorticoids and wound healing", In: Antiinflammatory Steroid Action:
Basic and
Clinical Aspects, Academic Press, New York, pp. 280-302 (1989)). The systemic
administration of steroids to impaired wound healing is a well establish
phenomenon in rats
(Beck, L.S. et al., Growth Factors. 5: 295-304 (1991); Haynes, B.F., et al.,
J. Clin. If2vest.
61: 703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing", IfZ:
Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press,
New York,
pp. 280-302 (1989); Pierce, G.F. et al., Proe. Natl. Acad. Sci. USA 86: 2229-
2233 (1989)).
[0687] To demonstrate that TNFR-6 alpha and/or TNFR-6 beta can accelerate the
healing
process, the effects of multiple topical applications of TNFR-6 on full
thickness excisional
skin wounds in rats in which healing has been impaired by the systemic
administration of
methylprednisolone is assessed.
[0688] Young adult male Sprague Dawley rats weighing 250-300 g (Charles River
Laboratories) are used in this example. The animals are purchased at 8 weeks
of age and
were 9 weeks old at the beginning of the study. The healing response of rats
is impaired by
the systemic administration of methylprednisolone (l7mg/kg/rat
intramuscularly) at the time
of wounding. Animals are individually housed and received food and water ad
libitum. All
manipulations are performed using aseptic techniques. This study is conducted
according to
the rules and guidelines of Human Genome Sciences, Inc. Institutional Animal
Care and Use
Committee and the Guidelines for the Care and Use of Laboratory Animals.
[0689] The wounding protocol is followed according to section A, above. On the
day of
wounding, animals are anesthetized with an intramuscular injection of ketamine
(50 mg/kg)
and xylazine (5 mg/kg). The dorsal region of the animal is shaved and the skin
washed with
230
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
70% ethanol and iodine solutions. The surgical area is dried with sterile
gauze prior to
wounding. An 8 mm full-thickness wound is created using a I~eyes tissue punch.
The
wounds are left open for the duration of the experiment. Applications of the
testing materials
are given topically once a day for 7 consecutive days commencing on the day of
wounding
and subsequent to methylprednisolone administration. Prior to treatment,
wounds are gently
cleansed with sterile saline and gauze sponges.
[0690] Wounds are visually examined and photographed at a fixed distance at
the day of
wounding and at the end of treatment. Wound closure is determined by daily
measurement on
days 1-5 and on day 8. Wounds are measured horizontally and vertically using a
calibrated
Jameson caliper. Wounds are considered healed if granulation tissue was no
longer visible
and the wound is covered by a continuous epithelium.
[0691] TNFR-6 alpha and/or TNFR-6 beta is administered using at a range
different
doses of TNFR-6 protein, from 4mg to 500mg per wound per day for 8 days in
vehicle.
Vehicle control groups received 50mL of vehicle solution.
[0692] Animals are euthanized on day 8 with an intraperitoneal injection of
sodium
pentobarbital (300mg/kg). The wounds and surrounding skin are then harvested
for
histology. Tissue specimens are placed in 10% neutral buffered formalin in
tissue cassettes
between biopsy sponges for further processing.
[0693] Four groups of 10 animals each (5 with methylprednisolone and 5 without
glucocorticoid) were evaluated: 1) Untreated group 2) Vehicle placebo control
3) TNFR-6
treated groups.
[0694] Wound closure is analyzed by measuring the area in the vertical and
horizontal
axis and obtaining the total area of the wound. Closure is then estimated by
establishing the
differences between the initial wound area (day 0) and that of post treatment
(day 8). The
wound area on day 1 was 64mmZ, the corresponding size of the dermal punch.
Calculations
were made using the following formula:
[0695]
[0696] [Open area on day 8] - [Open area on day 1] / [Open area on day 1]
[0697]
[0698] Specimens are fixed in 10% buffered formalin and paraffin embedded
blocks are
sectioned perpendicular to the wound surface (5mm) and cut using an Olympus
microtome.
Routine hematoxylin-eosin (H&E) staining was performed on cross-sections of
bisected
231
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
wounds. Histologic examination of the wounds allows assessment of whether the
healing
process and the morphologic appearance of the repaired skin was improved by
treatment with
TNFR-6 alpha and/or TNFR-6 beta. A calibrated lens micrometer is used by a
blinded
observer to determine the distance of the wound gap.
[0699] Experimental data are analyzed using an unpaired t test. A p value of <
0.05 is
considered significant.
[0700] The studies described in this example test activity in TNFR-6 protein.
However,
one skilled in the art could easily modify the exemplified studies to test the
activity of
polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TNFR-6
alpha and/or
TNFR-6 beta.
Example 20: Lyfnplzadema Animal Model
[0701] The purpose of this experimental approach is to create an appropriate
and
consistent lymphedema model for testing the therapeutic effects of in
lymphangiogenesis and
re-establishment of the lymphatic circulatory system in the rat hind limb.
Effectiveness is
measured by swelling volume of the affected limb, quantification of the amount
of lymphatic
vasculature, total blood plasma protein, and histopathology. Acute lymphedema
is observed
for 7-10 days. Perhaps more importantly, the chronic progress of the edema is
followed for
up to 3-4 weeks.
[0702] Prior to beginning surgery, blood sample is drawn for protein
concentration
analysis. Male rats weighing approximately ~350g are dosed with Pentobarbital.
Subsequently, the right legs are shaved from knee to hip. The shaved area is
swabbed with
gauze soaked in 70% EtOH. Blood is drawn for serum total protein testing.
Circumference
and volumetric measurements are made prior to injecting dye into paws after
marking 2
measurement levels (0.5 cm above heel, at mid-pt of dorsal paw). The
intradermal dorsum of
both right and left paws are injected with 0.05 ml of 1% Evan's Blue.
Circumference and
volumetric measurements are then made following injection of dye into paws.
[0703] Using the knee joint as a landmark, a mid-leg inguinal incision is made
circumferentially allowing the femoral vessels to be located. Forceps and
hemostats are used
to dissect and separate the skin flaps. After locating the femoral vessels,
the lymphatic vessel
that runs along side and underneath the vessels) is located. The main
lymphatic vessels in
this area are then electrically coagulated or suture ligated.
232
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0704] Using a microscope, muscles in back of the leg (near the semitendinosis
and
adductors) are bluntly dissected. The popliteal lymph node is then located.
[0705] The 2 proximal and 2 distal lymphatic vessels and distal blood supply
of the
popliteal node are then and ligated by suturing. The popliteal lymph node, and
any
accompanying adipose tissue, is then removed by cutting connective tissues.
[0706] Care is taken to control any mild bleeding resulting from this
procedure. After
lymphatics are occluded, the skin flaps are sealed by using liquid skin
(Vetbond) (AJ Buck).
The separated skin edges are sealed to the underlying muscle tissue while
leaving a gap of
~0.5 cm around the leg. Skin also may be anchored by suturing to underlying
muscle when
necessary.
[0707] To avoid infection, animals are housed individually with mesh (no
bedding).
Recovering animals are checked daily through the optimal edematous peak, which
typically
occurred by day 5-7. The plateau edematous peak are then observed. To evaluate
the
intensity of the lymphedema, the circumference and volumes of 2 designated
places on each
paw are measured before operation and daily for 7 days. The effect plasma
proteins on
lymphedema is determined and whether protein analysis is a useful testing
perameter is also
investigated. The weights of both control and edematous limbs are evaluated at
2 places.
Analysis is performed in a blind manner.
[0708] Circumference Measurements: Under brief gas anesthetic to prevent limb
movement, a cloth tape is used to measure limb circumference. Measurements are
done at
the ankle bone and dorsal paw by 2 different people and the readings are
averaged. Readings
are taken from both control and edematous limbs.
[0709] Volumetric Measurements: On the day of surgery, animals are
anesthetized with
Pentobarbital and are tested prior to surgery. For daily volumetrics animals
are under brief
halothane anesthetic (rapid immobilization and quick recovery), both legs are
shaved and
equally marked using waterproof marker on legs. Legs are first dipped in
water, then dipped
into instrument to each marked level then measured by Buxco edema
software(Chen/Victor).
Data is recorded by one person, while the other is dipping the limb to marked
area.
[0710] Blood-plasma protein measurements: Blood is drawn, spun, and serum
separated
prior to surgery and the conclusion to the experiment to measure for total
protein and Ca2+
comparison.
233
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0711] Limb Weight Comparison: After drawing blood, the animal is prepared for
tissue
collection. The limbs were amputated using a quillitine, then both
experimental and control
legs were cut at the ligature and weighed. A second weighing is done as the
tibio-cacaneal
joint is disarticulated and the foot is weighed.
[0712] Histological Preparations: The transverse muscle located behind the
knee
(popliteal) area is dissected and arranged in a metal mold, filled with
freezeGel, dipped into
cold methylbutane, placed into labeled sample bags at - 80 degree C until
sectioning. Upon
sectioning, the muscle was observed under fluorescent microscopy for
lymphatics. Other
immuno/histological methods are currently being evaluated.
[0713] The studies described in this example test activity in TNFR-6 proteins.
However,
one skilled in the art could easily modify the exemplified studies to test the
activity of
polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TNFR-6
alpha and/or
TNFR-6 beta.
[0714] It will be clear that the invention may be practiced otherwise than as
particularly
described in the foregoing description and examples. Numerous modifications
and variations
of the present invention are possible in light of the above teachings and,
therefore, are within
the scope of the appended claims.
Example 21: TNFR6-Fc Inhibits Fast mediated toxicity in a CouA Mouse Model of
Liver
lujury
[0715] The intravenous administration of Concanavalin A to mice activates T
lymphocytes and induces both apoptotic and necrotic cell death of hepatocytes,
mimicking
aspects of the pathophysiology of chronic active hepatitis (Tiegs et al., J.
Clin. Invest. 90:
196. (1992)). Fas-Fc protein, a dimeric form of Fas expected to inhibit Fas
ligand activity,
has been reported to reduce liver injury in this model via inhibition of Fas
ligand
demonstrating an involvement of Fas pathway in the pathology (I~sontini et
al., J Immunol.;
60(8):4082-4089 (1998)).
Validation of model:
[0716] To validate the ConA mouse model, Con A was administered intravenously
to
Balb/c mice at 10, 15, and 20 mg/kg dose of ConA along with placebo or Fas-Fc
at 97.5
microgramslmouse. 10 Balb/c mice were used per treatment group. The mice were
234
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
sacrificed 22 hours after treatment, serum collected and biochemical analysis
performed using
a Clinical Chemistry Analyzer ILAB900 (Instrumentation Laboratory) to
determine the levels
of the liver specific transaminases, alanine aminotransferase (ALT) and
aspartate
aminotransferase (AST), which are released in the serum upon liver damage
((Tiegs et al., J.
Clin. Invest. 90: 196. (1992)). The administration of FasFc at a dose of 97.5
micrograms/mouse (about 5 mg/kg) was found to significantly inhibit the
elevated liver
enzymes at ConA doses of 10 and 15 mg/kg but not at 20 mg/kg (data not shown),
thus
validating the model.
[0717] Balb/C mice were injected intravenously with ConA (15 mg/kg) together
with or
without a three log dose of TNFR6-Fc (0.6, 6. 60 ug/mouse). The TNFR6-Fc
fusion protein
used in this example corresponds to the full length TNFR-6 alpha polypeptide
sequence
(amino acids 1-300 of SEQ IDN0:2) fused to an Fc domain. 10 Balb/c mice were
used per
treatment group. The mice were sacrificed 22 hours after treatment and serum
levels of ALT
and AST were determined using a Clinical Chemistry Analyzer ILAB900
(Instrumentation
Laboratory). The administration of TNFR6-Fc significantly inhibited both ALT
and AST
levels at the highest dose tested (60 micrograms/mouse, 3 mg/kg) by 50% (data
not shown).
Thus TNFR6-Fc significantly reduced ConA induced serum AST and ALT in a dose
response fashion.
Effect of TNFR6-Fc oh CorzA induced apoptotic events ifz the liver
[0718] Since the elevation in serum liver enzyme levels reflects both
apoptotic and non-
apoptotic pathways of hepatocyte destruction, a more critical determination of
the extent of
liver injury can be derived via direct measurement of apoptotic events. Thus
apoptosis was
analyzed using whole liver cell suspensions isolated from mice treated with
TNFR6-Fc and
Con A. Three independent markers of apoptosis were assessed on the same
sample. These
include changes in surface expression of phosphatidylserine, measurements of
DNA damage,
and caspase activation.
[0719] Balb/C mice were injected intravenously with ConA (15 mg/kg) together
with or
without a three log dose of TNFR6-Fc (0.6, 6. 60 ug/mouse). CeII suspensions
were isolated
from the livers of 3 mice/group and liver cells were isolated by placing the
intact liver tissue
on a 70 ~,m cell strainer and teased apart with the stopper of a 5cc syringe
using RPMI
1640/10% FBS. To remove red blood cells and large piece of tissue debris, the
filtered cell
235
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
suspension was layered over lymphocyte separation medium (density 1.0770
g/ml). The
interface layer was collected, washed and the cells were counted. Prior to
FACS analysis, the
cell suspension was refiltered over a 40 ~,m filter.
[0720] For measurement of Annexin V binding (an indicator of apoptosis), cells
were
first incubated with fluorochrome-conjugated monoclonal antibodies CD45
CyChrome and
B220 or anti-TCR(3 PE (Pharmingen, San Diego, CA). Cells were washed with
binding buffer
(Pharmingen) then incubated with Annexin V FITC (Pharmingen). Stained cells
were
acquired and analyzed using a Becton Dickinson FACScan (Becton Dickinson, San
Jose,
CA). Only CD45 positive events were collected. Cells staining brightly for
B220 and
Annexin V were considered apoptotic B cells; cells staining brightly for anti-
TCR(3 and
Annexin V were considered apoptotic T cells.
[0721] The level of DNA degradation (another hallmark of apoptosis) was
determined by
Terminal UTP nick-end labeling (TLTNEL) which measures this degradation by
using TdT
enzyme to add FITC-labeled dUTP to the 3' ends of nicked DNA using the Apo-
DIRECT kit
(Pharmingen) according to manufacturer's directions. Briefly, cells were fixed
in 1%
paraformaldhyde, washed in PBS and then fixed with ice-cold 70°Io
ethanol. Cells were
washed twice in washing buffer, then incubated with staining solution
containing TdT
enzyme and dUTP-FITC at 37°C for one hour. Cells were washed twice with
rinsing buffer,
re-suspended in propidium iodide~solution and acquired on the FACScan. For
analysis, an
electronic gate was set on singlet events, and cells staining brightly for
dUTP-FITC were
considered apoptotic cells.
[0722] To determine the presence of the active form of caspase-3 (an early
indicator of
apoptosis) cells were incubated in IC FIX (BioSource International, Camarillo,
CA), washed
twice in PBS, then permeablized with IC PERM (BioSource). Cells were incubated
with 5
~.g rabbit anti-caspase-3 PE (Pharmingen) in IC PERM, washed in IC PERM, then
washed
twice with PBS. Cells were acquired on the FACScan and analyzed for PE mean
fluorescence.
[0723] For all three indicators of apoptosis, TNFR6-Fc inhibited apoptosis in
livers of
mice as compared to mice treated with Con A alone (Table VI). iJsing DNA
damage as a
marker and TUNEL analysis, a dose-dependent trend of inhibition with TR6-Fc
was
236
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
observed. These data support a role for TNFR6-Fc in inhibition of apoptosis in
ConA-
induced hepatitis.
Table VI. Apoptosis of liver cells isolated from TNFR6-Fc-treated mice.l
Percent % Apoptotic Cells measured by:
Annexin Annexin
Treatment Tunel Caspase-3 V/TcR(3 VB220
Untreated Control 18.7 2.0 6.1
Con A (15 mg/kg) 24.4 35.2 7.0 12.2
Control
TNFR6-Fc (0.6 ~.g/mouse)15.6 22.7 3.5 6.3
TNFR6-Fc (6.0 ~.g/mouse)13.6 22.5 2.3 2.9
TNFR6-Fc (60 p,g/mouse)9.5 20.3 3.0 4.2
lLiver cell suspensions were analyzed for apoptosis using one of three
independent
measures. DNA degradation was measured using TUNEL staining; caspase
activation by
the analysis of the active form of caspase-3; and annexin V staining of
surface membrane
changes. Cell suspensions were isolated from the livers of 3 mice/group and
pooled. The
resulting pooled suspension was used to perform each analysis. For Annexin-V
staining,
only liver CD45+ cells were acquired and Annexin-V staining assessed on cells
contained
for B220 or TcR(3.
Conclusion:
237
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0724] The findings that TNFR6-Fc reduced both ConA induced serum AST and ALT
levels and ConA induced liver cell apoptosis supports the therapeutic
application of TNFR-6
alpha and TNFR-6 beta polypeptides of the invention for the treatment and/or
prevention of
hepatitis and other forms of liver injury.
Example 22: Irt Vitro arid In Vivo Iftltibitiost of Fast Mediated Killing by
TNFR-6 alpha
[0725] Fas (CD95/Apol) and Fas ligand (FasL/CD95L), are a pair of pro-
apoptotic
mediators of the TNF receptor and ligand family that induce apoptosis upon
receptor/ligand
engagement. Fas/FasL-mediated apoptosis is a normal and important homeostatic
mechanism
useful in the down-regulation of hyper-immune responses and the deletion of
activated
lymphocytes. Fas/FasL-induced apoptosis is also important in host protection
and
surveillance, preventing damage to immune privileged sites, and eliminating
virus-infected
or transformed cells. While necessary for normal physiological processes,
unregulated
apoptosis mediated by the Fas/FasL system is implicated in organ-specific
tissue injury both
in experimental animal models and several human disease states.
[0726] This example describes the synthesis and biological activity of a TNFR-
6 alpha
(in this Example, hereinafter "TR6") fusion protein produced using the full
length coding
region of TR6 and an Fc domain of IgGl. Biochemical and biological
characterization of this
TR6 -Fc form revealed it to, not only bind Fast and inhibit apoptosis in-
vitro, but also to
block the mortality associated with iv injection of cross-linked Fast into
Fas+ mice. This is
the first demonstration of TR6 -mediated inhibition of Fast activity in an ih-
vivo model.
These results show the therapeutic potential of TR6 -Fc in diseases where
Fas/FasL is
implicated in mediating organ damage.
Methods of Example 22
Afzimals
[0727] Female Balb/c mice (20-25 g) were obtained from Charles River
Laboratories
(Raleigh, NC). Female MLR/lpr mice (30-35 g) were obtained from Jackson
Laboratories
(Bar Harbor, Maine). Mice were housed five per cage, and kept under standard
conditions for
one week before being used in experiments. The animals were maintained
according to
238
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
National Research Council standards for the care and use of laboratory
animals. The animal
protocols used in this study were reviewed and approved by the HGS
Institutional Animal
Care and Use Committee.
Human TR6-Fc, TR6-Lion Fc afid Fas-Fc Expression vectors
[072$] Cells infected with baculovirus clone, pA2Fc:TR6 (Ml-H300), were grown
in
media containing 1% ultra low IgG serum. Conditioned culture supernatant (20L)
was
adjusted to pH 7.0, filtered through 0.22 micron filter and loaded on a
Protein A column
(BioSepra Ceramic HyperD) previously conditioned with 20 mM phosphate buffer
with 0.5
M NaCI, pH7.2. The column was washed with 15 CV of 20 mM phosphate buffer
containing
0.5 M NaCI, pH 7.2, and followed by 5 CV of 0.1 M citric acid (pH 5.0). TR6-Fc
eluted with
0.1 M citric acid (pH 2.4) / 20% glycerol, and fractions were neutralized with
1M Tris-HCI,
pH 9.2. The human TR6-Fc positive fractions were determined by SDS-PAGE. The
peak
fractions were pooled and concentrated using an Amicon concentrator. The TR6-
Fc
concentrate was then loaded onto a Superdex 200 column containing PBS
containing 0.5 M
NaCI (Pharmacia) and TR6-Fc positive fractions determined by non-reducing SDS-
PAGE.
The TR6-Fc positive fractions eluting as disulfide-linked dimers were pooled
and further
concentrated with CentriPlus 10K cutoff spin concentrators.
[0729] The TR6-Fc protein bound to the Protein A resin contained both
disulfide-linked
Fc dirners and higher disulfide-linked aggregates. Aggregates were removed by
Superdex
200 size-exclusion chromatography. The typical yield for TR6-Fc was ~2mg/L
culture
supernatant having a purity of 98% by Reverse-Phase HPLC assay and 92% by N-
terminal
sequence assay. The N-terminus started at residue Val 30. The pure protein
behaved as
disulfide linked dimer and was biologically active as it bound Fast in a
BIAcore assay to a
degree comparable to Fas-Fc.
[0730] To confirm purity, TR6-Fc protein was blotted to a ProBlott membrane
cartridge
(PE Biosystems, Inc). After staining with Ponceau S (0.2% in 4% acetic acid),
the membrane
was placed in a "Blot Cartridge", and subjected to N-terminal amino acid
sequence analysis
using a model ABI-494 sequencer (PE Biosystems, Inc.) and the Gas-phase Blot
cycles.
Proteins were subject to reverse-phase HPLC (Beckmann) analysis to access
purity. In the
case of Fas-Fc the N-terminus was deblocked using pyroglutamate aminopeptidase
( )
followed by N-terminal sequence analysis.
239
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0731] Human Fas(M1-6169)-Fc fusion protein was purified from CHO conditioned
media by capture on a Poros 50 Protein A affinity column with elution at O.1M
citrate pH 2.0
as described for TR6-Fc. Further puriifcation was effected by size separation
on a Superdex-
200 gel filtration resin in PBS/glycerol. N-terminal sequence of Fas-Fc was
blocked and
protein identity was confirmed post digestion with pyroglutamate
aminopeptidase to deblock
the N-terminus and 16% SDS-PAGE, respectively. The protein behaved as
disulfide linked
dimer as expected for a Fc fusion protein.
BIAcore Chip Preparation and Analysis
[0732] The extra-cellular portion of Fast (Oncogene Research Products), amino
acids
103-281, were dialyzed against lOmM sodium acetate buffer, pH 5 and a BIAcore
flow cell
prepared having 2020 RU of Fast. TR6-Fc and Fas-Fc fusion proteins were
analyzed at 5
ug/mL in 50 uL HBS buffer and were injected onto the Fast chip at a flow rate
of 15 u1 per
minute. After injection of the sample the flow cell was equilibrated with HBS
and amount of
net bound protein determined.
Irc vitro soluble human Fast mediated cytotoxicity
[0733] The HT-29 cell line, a human colon adenocarcinoma cell line obtained
from the
ATCC (code ATCC HTB-38) is sensitive to Fast mediated cytotoxicity, presumably
through
activation of its Fas receptor. HT-29 cells were grown in D-MEM/10% FBS/2 mM
Glutamine/pen/strep. To measure FLAG-Fast induced cytotoxicity, target cells
were
trypsinized, washed and plated in a 96-well plate at 50,000 cells/well. HT-29
cells were
treated with cross-linked FLAG-Fast + FLAG antibody (1 ng/ml), or with cross-
linked
FLAG-Fast in combination with Fas-Fc, or TR6. Although uncross-linked Fast can
induce
cytotoxity in this assay, antibody cross-linking of Fast via its FLAG domain
significantly
enhances the ability of Fast to mediate apoptosis, and thus the FLAG antibody
was included.
The final volume in each well was 200 u1. After 5 days of culture, the plate
was harvested and
20 u1 of Alamar Blue reagent added. To assess final viability, cells were
incubated for four
hours and the plate analyzed in a CytoFluor fluorescence plate reader with
excitation of 530
nm and emission of 590 nm.
[0734] The Jurkat human T cell line, which also expresses the Fas receptor,
and is
sensitive to Fast, was tested in an in vitro cytotoxicity assay similar to
that used on HT-29
240
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
cells. In addition, Jurkat cells were evaluated by FACS analysis in an
apoptosis assay. Jurkat
cells (RPMI + 5 % serum) were seeded at 50,000 cells per well were then
treated with FLAG-
FasL and anti-FLAG mouse monoclonal antibody (200ng/ml) and incubated at 37C
for 16 hrs
to induce apoptosis. When TR6 or Fas-Fc was included in the assay, the decoy
receptor
protein was pre-incubated with Fast and anti-FLAG antibody for 15 mins. To
determine the
degree of apoptosis, cells were harvested, stained with annexin and propidium
iodide and
evaluated using FACS analysis.
Ifa vitro meynbrane bound ~rzurine Fast mediated cytotoxicity
[0735] To analyze the in vitro killing of Fas+ target cells by murine Fast,
murine effector
L929 cells ( 2.5 x 105 cells/well) were transfected with murine Fast and
incubated with Fas+
murine A20 target cells (5 x 103 cells/well) .labeled with Eu DTPA. After an
18 hour
incubation at an effectoraarget cell ratio of 50:1, cells were centrifuged ,
and °7o release of Eu
DTPA quantified as a measure of cell death.
In vivo cross-lifZked FLAG-Fast induced ynoYtality
[0736] Soluble human FLAG-Fast was synthesized at HGS. To induce cross-
linking,
Fast was incubated with FLAG antibody (Sigma, St Louis, MO) and injected iv
into mice
following a variation of the procedure used by Schneider et al. Fc-fusion
proteins were
injected iv or sc at various time points prior to Fast injection, and
mortality recorded over
time. Liver samples one centimeter square, were fixed in 10°Io neutral
buffered formalin for
24 hours, then transferred to 70 percent methanol until time for embedding in
paraffin.
Sections were stained with H&E, and evaluated histologically. Blood was drawn
from the
heart and used in the measurement of serum AST and ALT levels.
Statistics
[0737] Statistical difference between groups was determined using a Student's
unpaired t
test. Error bars represent S.E.M.
Results of Exam 1p a 22
BIAcore af~alysis of TR6-Fc bindihg to Fast
241
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
[0738] BIAcore chip technology provides the opportunity to identify and
characterize
ligands that bind to a given receptor, in this case TR6. The protein ligand
can be
immobilized and challenged with TR6 to calculate relative binding units (RU).
Conversely,
the TR6 receptor can be immobilized and exposed to various ligands to identify
proteins with
an affinity for the TR6 receptor.
[0739] BIAcore technology was used to determine if human TR6-Fc displayed any
binding to human Fast immobilized on a BIAcore chip. The results indicated
that TR6-Fc
bound to Fast with the same affinity as the Fas receptor, approximately 100
RU. As a
control, TR6-Fc interaction with another TNF ligand, BLyS, was examined. No
significant
binding was found.
[0740] To show the specificity of TR6-Fc for Fast, soluble FLAG-Fast was used
to
compete with the immobilized Fast for binding of TR6-Fc. Increasing
concentrations of
Fast-Flag were able to inhibit binding of TR6-Fc to immobilized Fast. At a
concentration of
8 ug/ml, Fast-Flag inhibited binding of TR6-Fc (2 ug/ml) by 50 percent. When
17 ug/mI of
Fast-Flag was used, inhibition rose to 75 percent.
[0741] When TR6-Fc was immobilized, and trimerized FLAG-Fast used as the
soluble
protein, the Kd of TR6-Fc was 4.6 x 10-9 M, similar to the 7.4 x 10-9 M Kd for
FasFc. TR6
without the Fc portion had a fourfold reduction in affinity for Fast-Flag with
a Kd of 1.7 x
10-8 M.
In vitro effect of TR6 otz soluble human Fast mediated cytotoxicity
[0742] The results of this experiment demonstrate the ability of TR6 to block
cross-linked
FLAG-Fast mediated HT-29 cell death. FLAG-Fast induced HT-29 cytotoxity in a
dose-
dependent manner, with the maximal effect at a concentration between 1 and 10
ng/ml. In
the presence of TR6-Fc (1 ug/ml), Fast failed to induce cell killing, in
agreement with the
proposed decoy receptor function of TR6. Unlike TR6-Fc, Fas-Fc did not totally
abrogate
FLAG-Fast mediated cell,death, but did shift the cytotoxicity curve about 10
fold to the
right. TR6-non-Fc also inhibited Fast mediated killing, but was not as potent
as the Fc
fusion protein. A number of other members of the TNF receptor family, such as
TNFRI-Fc,
LTBR-Fc, TR2-Fc, TR4-Fc, TR7-Fc, TR8-Fc, TR9-Fc, TR10-Fc and TR11-Fc were also
tested in this assay and failed to block Fast induced killing of HT-29 cells.
In a different
242
CA 02420593 2003-02-24
WO 02/18622 PCT/USO1/26396
cytotoxity assay involving the eponymous TNF family member, TR6-Fc failed to
inhibit
TNFa-induced killing of L929 target cells.
[0743] The ability of TR6 to block antibody cross-linked FLAG-Fast killing izz
vitro was
also observed using human Jurkat cells in a similar cytotoxicity assay.
Treatment with Fast
at 10 ng/ml resulted in an 80°7o decrease in cell viability as measured
by fluorescence at
5301590. Fas-Fc as well as TR6-Fc and non-Fc significantly reduced Fast-
induced
cytotoxicity whether the decoy receptor level was kept constant and Fast
increased, or the
Fast level kept constant and the decoy receptor increased. In both assay
systems TR6-Fc
appeared to be at least 100 fold more potent than Fas-Fc.
[0744] In another Jurkat cell assay, treatment with FLAG-Fast resulted in an
approximate 7-fold increase in the number of apoptotic cells over untreated
controls, as
measured by FACS analysis of annexin staining. Fast-mediated apoptosis was
significantly
reduced in a dose dependant fashion in the presence of TR6-Fc or Fas-Fc.
Izz vitro effect of TR6 orz zrzeznbrane bound murine Fast mediated
cytotoxicity
[0745] In an assay using Fas+ murine A20 target cells labeled with Eu DTPA,
TR6-Fc at
a concentration of 10 ng/ml, completely inhibited killing by murine L929 cells
transfected
with murine Fast. In this assay, the ICSO for both TR6-Fc and non-Fc was
approximately 1
ng/ml. The potency of TR6 in this assay was 100 fold greater than that of Fas-
Fc, which had
an ICSO of approximately 100 ng/ml. This assay demonstrated that the human TR6
protein
was capable of recognizing, binding to, and blocking, the cytotoxic activity
of murine Fast.
The izz vivo effect of TR6-Fc ozz FLAG-Fast-izzduced zrzortality in mice
[0746] Female Balb/c mice (n=20) were injected iv with 13 ug of FLAG-Fast
mixed
with 50 ug of murine antibody to FLAG. Half of the mice also received an iv
injection of 96
ug of TR6-Fc, one hour prior to administration of cross-linked FLAG-Fast.
Since TR6-Fc
has a molecular weight of about 60,000 compared to 18,500 for FLAG-Fast, this
resulted in
a TR6-Fc:FLAG-Fast molar ratio of 2.3:1. However, each molecule of TR6-Fc is
capable of
binding two molecules of Fast.
[0747] Within one hour of Fast injection, all the mice injected only with
cross-linked
FLAG-Fast were dead. The hypotension was so great, that no blood could be
obtained for
243
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
~~ TTENANT LES PAGES 1 A 243
NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 243
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
