Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
PROMOTER SEQUENCES
TECHNICAL FIELD
The present invention relates an isolated promoter region of the mammalian
transcription
s factor FOXC2. The invention also relates to screening methods for agents
modulating the
expression of FOXC2 and thereby being potentially useful for the treatment of
medical
conditions related to obesity. The invention further relates to a previously
unknown variant
of the human FOXCZ gene, derived via the use of an alternative promoter, which
produces
an additional exon that generates a distinct open reading frame via splicing.
The alternative
to gene encodes a variant of the FOXC2 transcription factor, which is lacking
a part of the
DNA-binding domain and consequently has a potential regulatory function.
BACKGROUND ART
~s More than half of the men and women in the United States, 30 years of age
and older, are
now considered overweight, and nearly one-quarter are clinically obese. This
high
prevalence has led to increases in the medical conditions that often accompany
obesity,
especially non-insulin dependent diabetes mellitus (NIDDM), hypertension,
cardiovascular
disorders, and certain cancers. Obesity results from a chronic imbalance
between energy
2o intake (feeding) and energy expenditure. To better understand the
mechanisms that lead to
obesity and to develop strategies in certain patient populations to control
obesity, there is a
need to develop a better underlying knowledge of the molecular events that
regulate the
differentiation ofpreadipocytes and stem cells to adipocytes, the major
component of
adipose tissue. p
The helix-loop-helix (HLH) family of transcriptional regulatory proteins are
key players in
a wide array of developmental processes (for a review, see Massari & Murre
(2000) Mol.
Cell. Biol. 20: 429-440). Over 240 HLH proteins have been identified to date
in organisms
ranging from the yeast Saccharoynyces cerevisiae to humans. Studies in Xenopus
laevis,
3o Drosophila melazzogaster~, and mice have convincingly demonstrated that HLH
proteins are
intimately involved in developmental events such as cellular differentiation,
lineage
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
commitment, and sex determination. In rnulticellular organsms, HLH factors are
required
for a multitude of important developmental processes, including neurogenesis,
myogenesis,
hematopoiesis, and pancreatic development.
s The winged helix / forkhead class of transcription factors is characterized
by a 100-amino
acid, monomeric DNA-binding domain. X-ray crystallography of the forkhead
domain
from HNF-3y has revealed a three-dimensional structure, the "winged helix", in
which two
loops (wings) are connected on the C-terminal side of the helix-loop-helix
(for reviews, see
Brennan, R.G. (1993) Cell 74: 773-776; and Lai, E. et al. (1993) Proc. Natl.
Acad. Sci.
io U.S.A.90:10421-10423).
The isolation of the mouse mesenchyme forkhead-1 (MFH-1) and the corresponding
human (FKHL14) chromosomal genes is disclosed by Miura, N. et al. (1993) FEBS
letters
326: 171-176; and (1997) Genomics 41: 489-492. The nucleotide sequences of the
mouse
is MFH-1 gene and the human FKHLl4 gene have been deposited with the
EMBL/GenBank
Data Libraries under accession Nos. Y08222 (SEQ ID NO: 5) and Y08223 (SEQ ID
NO:
8), respectively. A corresponding gene has been identified in Gallus gallus
(GenBank
accession numbers U37273 and U95823).
2o The International Patent Application WO 98/54216 discloses a gene encoding
a Forkhead-
Related Activator (FREAC)-11 (also known as 512), which is identical with the
polypeptide encoded by the human FKHL14 gene disclosed by Miura, supra. This
transcription factor is expressed in adipose tissue and involved in lipid
metabolism and
adipocyte differentiation (cf. Swedish patent application No. 0000531-4, filed
February 18,
2s 2000).
The nomenclature for the winged helix / forkhead transcription factors has
been
standardized and Fox (Forkhead Box has been adopted as the unified symbol
(I~aestner et
al. (2000) Genes ~z Development 14: 142-146; see also
htpp:llwww.biology.pornona.edul
3o fox). It has been agreed that the genes previously designated MFH-1 and
FKHL14 (as well
as FREAC-1 l and S 12) should be designated FOXC2.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
BRIEF DESCRIPTION OF THE DR.AWII~GS
Figure 1 shows the general structure of the human FOXC2 gene.
s Figure 2 illustrates the results from phylogenetic footprinting experiments.
Shown is the
fraction conserved (1.0 =100%) between mouse FoxC2 and human FOXC2 sequences
in
the alignment generated with Clustal. Solid (bold) line indicates the fraction
of the human
sequence which is identical to the mouse within a 200 by "window" over the
human
sequence in the alignment. The weak (dotted) line is set to -0.05 when the
sliding window
o contains human exon sequence and to -0.1 when the window is entirely
composed of exon
sequence. Regions containing local maxima or exceeding a conservation fraction
of 0.7 are
likely to be functional and are classified as "predicted regulatory regions".
Figure 3 illustrates the predicted "enhancer" region in the human FOXC2 gene.
Underlined
Is sequences indicate likely transcription factor binding sites. Boxed
sequence indicates exon
sequence.
Splice = sequence predicted as splice site in the alternatively spliced gene;
E-box-like = sequence resembling the "E-box" motif CANNTG known as a target
for DNA
binding proteins containing a helix-loop-helix domain (often associated with
the activation
20 of cell-type specific gene transcription during tissue differentiation; see
Massari & Murre
(2000) Mol. Cell. Biol. 20: 429-440)
Fo~khead like = sequence resembling binding site for the winged helix /
forkhead class of
transcription factors;
Ets-like = sequence resembling consensus binding site for ETS-domain
transcription factor
2s family (see Sharrocks et al. (1997) Int. J. Biochem. Cell Biol. 29, 1371-
1387).
Figure 4 illustrates the predicted "promoter" xegion in the human FOXC2 gene.
Underlined
sequence indicates exon sequences. Boxed sequences indicate conserved block
(potential
transcription factor binding sites).
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
DESCRIPTION OF THE INVENTION
According to the present invention, the partially known sequence (SEQ m NO: 8)
of
human FOXC2 gene has been extended. In the previously unknown region of the
gene,
differentially conserved regions, consistent with regulatory function, have
been identified.
Further, an alternative transcript has been identified, which includes the use
of at least two
exons. The putative regulatory enhancer is immediately adjacent to the newly
discovered
alternative exon, suggesting that it may play a role in the alternative
selection of transcript
classes.
0
Modulation of the FOXC2 regulation is expected to have therapeutic value in
type II
diabetes; obesity, hypercholesterolemia, and other cardiovascular diseases or
dyslipidemias.
~s Consequently, in a first aspect this invention provides an isolated human
FOXC2 promoter
region comprising a sequence selected from:
(a) the nucleotide sequence set forth as positions 1250 to 2235, such as
positions
1250 to 1749 or positions 1692 to 1703, in SEQ ID NO: 1, or a fragment thereof
exhibiting FOXCZ promoter activity;
20 (b) the complementary strand of (a); and
(c) nucleotide sequences capable of hybridizing, under stringent hybridization
conditions, to a nucleotide sequence as defined in (a) or (b).
"Promoter region" refers to a region of DNA that functions to control the
transcription of
2s one or more genes, and is structurally identified by the presence of a
binding site for DNA-
dependent RNA polymerase and of other DNA sequences on the same molecule which
interact to regulate promoter function.
An "isolated" nucleic acid is a nucleic acid molecule the structure of which
is not identical
3o to that of a naturally occurring nucleic acid or that of any fragment of a
naturally occurnng
genomic nucleic acid spanning more than one gene.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
"Stringent" hybridization conditions are hybridization in 6X SSC at about
45°C, followed
by one or more washes in 0.2X SSC, 0.1%SDS at 65°C.
Another aspect of the invention is a recombinant construct comprising the
human FOXC2
s promoter region as defined above. In the said recombinant construct, the
human FOXC2
promoter region can be operably linked to a nucleic acid molecule encoding a
detectable
product, such as the human FOXC2 gene, or a reporter gene. The term "operably
linked" as
used herein means functionally fusing a promoter with a structural gene in the
proper
frame to express the structural gene under control of the promoter. As used
herein, the term
to "reporter gene" means a gene encoding a gene product that can be identified
using simple,
inexpensive methods or reagents and that can be operably linked to the human
FOXC2
promoter region or an active fragment thereof. Reporter genes such as, for
example, a
luciferase, [3-galactosidase, alkaline phosphatase, or green fluorescent
protein reporter
gene, can be used to determine transcriptional activity in screening assays
according to the
is invention (see, for example, Goeddel (ed.), Methods Enzymol., Vol. 185, San
Diego:
Academic Press, Inc. (1990); see also Sambrook, supra).
The invention also provides a vector comprising the recombinant construct as
defined
above, as well as a host cell stably transformed with such a vector, or
generally with the
2o recombinant construct according to the invention. The term "vector" refers
to any carrier of
exogenous DNA that is useful for transferring the DNA to a host cell for
replication and/or
appropriate expression of the exogenous DNA by the host cell.
In another aspect, the invention provides a method for identif cation of an
agent regulating
2s FOXC2 promoter activity, said method comprising the steps: (i) contacting a
candidate
agent with a human FOXC2 promoter region as defined above; and (ii)
determining
whether said candidate agent modulates expression of the FOXC2 gene, such
modulation
being indicative for an agent capable of regulating FOXC2 promoter activity.
As used
herein, the term "agent" means a biological or chemical compound such as a
simple or
3o complex organic molecule, a peptide, a protein or an oligonucleotide.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
A transfection assay can be a particularly useful screening assay for
identifying an
effective agent modulating and/or regulating FOXC2 promoter activity. In a
transfection
assay, a nucleic acid containing a gene, e.g. a reporter gene, operably linked
to a human
FOXC2 promoter or an active fragment thereof, is transfected into the desired
cell type. A
s test level of reporter gene expression is assayed in the presence of a
candidate agent and
compared to a control level of expression. An effective agent is identified as
an agent that
results in a test level of expression that is different than a control level
of reporter gene
expression, which is the level of expression determined in the absence of the
agent.
Methods for transfecting cells and a variety of convenient reporter genes are
well known in
1o the art (see, for example, Goeddel (ed.), Methods Enzymol., Vol. 185, San
Diego:
Academic Press, Inc. (1990); see also Sambrook, supra). Consequently, the said
method
could e.g. comprising assaying reporter gene expression in a host cell, stably
transformed
with a recombinant construct comprising the htunan FOXC2 promoter, in the
presence and
absence of a candidate agent, wherein an effect on the test level of
expression as compared
is to control level of expression is indicative of an agent capable
ofregulating FOXC2
promoter activity.
Methods for identification of polypeptides regulating FOXC2 promoter activity
could
include various techniques known in the art, such as the yeast one-hybrid
system (see: Li &
2o Herskowitz (1993) Science 262, 1870-1874) to identify proteins binding
specific
sequences from the FOXC2 regulatory region, biochemical purification of
proteins which
bind to the regulatory region, the use of a "southwestern" cloning strategy
(see e.g. Hai et
al. (1989) Genes & Development 3: 2083-2090) in which a pool of bacteria
infected with a
"phage library" are induced to express the encoded protein and probed with
radioactive
2s DNA sequences from the FOXC2 regulatory regions to identify binding
proteins.
In a further aspect, the invention provides an isolated human FOXC2 enhancer
region
comprising a sequence selected from:
(a) the nucleotide sequence set forth as positions 216 to 475, such as
positions 223 to
30 231, positions 359 to 375, positions 378 to 402, or positions 403 to 423,
in SEQ ID
NO: 1, or a fragment thereof exhibiting FOXC2 enhancer activity;
(b) the complementary strand of (a); and
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
(c) nucleotide sequences capable of hybridizing, under stringent hybridization
conditions, to a nucleotide sequence as defined in (a) or (b).
"Enhancer region" refers to a region of DNA that functions to control the
transcriptions of
one or more genes.
As described above for the human FOXC2 promoter region, the invention further
provides
a recombinant construct comprising a human FOXC2 enhancer region, a vector
comprising
the said recombinant construct, as well as a host cell stably transformed with
said vector or
1o with said recombinant construct.
Further, the invention provides a method for identification of an agent
regulating FOXC2
enhancer activity, said method comprising the steps: (i) contacting a
candidate agent with
the human F~XC2 enhancer region as defined above; and (ii) determining whether
said
is candidate agent modulates expression of the FOXC2 gene, such modulation
being
indicative for an agent capable of regulating FOXC2 enhancer activity. It will
be
understood by the skilled person that known steps are available for performing
such a
method. For instance, a "panel" of constructs which include a variety of
mutations and
deletions can be used in order to associate a response with a specific
alteration of a single
2o base or subsegment of the regulatory apparatus. A simple panel might
include: enhancer
plus promoter, promoter only, enhancer plus a "minimal" promoter from a
distinct gene.
As mentioned above, a transfection assay, using a host cell stably transformed
with a
suitable recombinant construct, can be a particularly useful screening assay
for identifying
an effective agent.
In yet a further aspect, the invention provides a method for identification of
an agent
capable of regulating a mammalian FOXC2 promoter activity, said method
comprising the
steps (i) contacting a candidate agent with a marine FoxC2 promoter nucleotide
sequence
shown as positions 216 to 2235, such as positions 216 to 475 or positions 1250
to 2235, in
3o SEQ ID NO: S; and (ii) determining whether said candidate agent modulates
expression of
a mammalian FOXC2 gene, such modulation being indicative for an agent capable
of
regulating mammalian FOXC2 promoter activity.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
In another important aspect, the invention provides an isolated nucleic acid
molecule
selected from:
(a) nucleic acid molecules comprising a nucleotide sequence as shown in SEQ ID
NO: 3;
(b) nucleic acid molecules comprising a nucleotide sequence capable of
hybridizing, under
s stringent hybridization conditions, to a nucleotide sequence complementary
the
polypeptide coding region of a nucleic acid molecule as defined in (a) and
which codes for
a variant form of the FOXC2 transcription factor; and
(c) nucleic acid molecules comprising a nucleic acid sequence which is
degenerate as a
result of the genetic code to a nucleotide sequence as defined in (a) or (b)
and which codes
to for a variant form of the FOXC2 transcription factor.
In a preferred form of the invention, the said nucleic acid molecule has a
nucleotide
sequence identical with SEQ ID NO: 3 of the Sequence Listing. However, the
nucleic acid
molecule according to the invention is not to be limited strictly to the
sequence shown as
is SEQ ID NO: 3. Rather the invention encompasses nucleic acid molecules
carrying
modifications like substitutions, small deletions, insertions or inversions,
which
nevertheless encode proteins having substantially the biochemical activity of
the FOXC2
polypeptide according to the invention. Tncluded in the invention are
consequently nucleic
acid molecules, the nucleotide sequence of which is at least 90% homologous,
preferably
2o at least 95% homologous, with the nucleotide sequence shown as SEQ ID NO: 3
in the
Sequence Listing.
Included in the invention is also a nucleic acid molecule which nucleotide
sequence is
degenerate, because of the genetic code, to the nucleotide sequence shown as
SEQ ID NO:
2s 3. A sequential grouping of three nucleotides, a "colon", codes for one
amino acid. Since
there are 64 possible colons, but only 20 natural amino acids, most amino
acids are coded
for by more than one colon. This natural "degeneracy", or "redundancy", of the
genetic
code is well known in the art. It will thus be appreciated that the nucleotide
sequence
shown in the Sequence Listing is only an example within a large but definite
group of
so sequences which will encode the variant FOXC2 polypeptide.
The invention includes an isolated polypeptide encoded by the nucleic acid as
defined
above. In a preferred form, the said polypeptide has an amino acid sequence
according to
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
SEQ ID NO: 4 of the Sequence Listing. However, the polypeptide according to
the
invention is not to be limited strictly to a polypeptide with an amino acid
sequence
identical with SEQ ID NO: 4 in the Sequence Listing. Rather the invention
encompasses
polypeptides carrying modifications like substitutions, small deletions,
insertions or
inversions, which polypeptides nevertheless have substantially the biological
activities of
the variant FOXC2 polypeptide.
An "isolated" polypeptide is substantially free of cellular material or other
contaminating
proteins from the cell or tissue source from which the protein is derived, or
substantially
io free from chemical precursors or other chemicals when chemically
synthesized.
In one embodiment, the polypeptide includes an amino acid sequence that is at
least about
70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the amino acid sequence
of
SEQ ID NO: 4.
is
A further aspect of the invention is a vector comprising the nucleic acid
molecule
according to the invention. The said vector can e.g. be a replicable
expression vector,
which carries and is capable of mediating the expression of a DNA molecule
according to
the invention. In the present context the term "replicable" means that the
vector is able to
2o replicate in a given type of host cell into which is has been introduced.
Examples of
vectors are viruses such as bacteriophages, cosmids, plasmids and other
recombination
vectors. Nucleic acid molecules are inserted into vector genomes by methods
well known
in the art.
2s Included in the invention is also a cultured host cell harboring a vector
according to the
invention. Such a host cell can be a prokaryotic cell, a unicellular
eukaryotic cell or a cell
derived from a multicellular organism. The host cell can thus e.g. be a
bacterial cell such as
an E. coli cell; a cell from yeast such as Saccharomyces cervisiae or Pichia
pastoris, or a
mammalian cell. The methods employed to effect introduction of the vector into
the host
3o cell are standard methods well known to a person familiar with recombinant
DNA
methods.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
In yet another aspect, the invention includes a method for identifying an
agent capable of
regulating expression of the nucleic acid molecule as defined above, said
method
comprising the steps (i) contacting a candidate agent with the said nucleic
acid molecule;
and (ii) determining whether said candidate agent modulates expression of the
said nucleic
acid molecule.
In another aspect the invention provides an antisense oligonucleotide having a
sequence
capable of specifically hybridizing to RNA transcribed by the alternatively
spliced nucleic
acid molecule shown as SEQ m NO: 3, so as to prevent translation of the said
RNA.
o Antisense nucleic acids (preferably 10 to 20 base-pair oligonucleotides)
capable of
specifically binding to control sequences for the alternatively spliced FOXC~
gene are
introduced into cells, e.g. by a viral vector or colloidal dispersion system
such as a
liposome. The antisense nucleic acid binds to the target nucleotide sequence
in the cell and
prevents transcription and/or translation of the target sequence.
Phosphorothioate and
~s methylphosphonate antisense oligonucleotides are specifically contemplated
for
therapeutic use by the invention. Suppression of expression of the
alternatively spliced
FOXC2 gene, at either the transcriptional or translational level, is useful to
generate
cellular or animal models for diseases/conditions related to lipid metabolism.
2o In yet another aspect, the invention provides a method for the
identification of polypeptides
which bind to nucleotide sequences involved in the biological pathway
regulating lipid
metabolism and/or adipocyte differentiation, comprising the steps of
(a) transfecting a host cell line with a human FOXC2 nucleotide sequence
linked to a
reporter gene, such as a gene encoding Green Fluorescent Protein (GFP) (for a
review, see
2s e.g. Galbraith et al. (1999) Methods in Cell Biology 58: 315-341);
(b) transfecting the said host cell line with a variety of human cDNA
sequences, e.g.
sequences included in a cDNA library;
(c) identifying and isolating cells, e.g. by FAGS cells sorting, having an
altered level of
expression of the said reporter gene, which is indicative that the polypeptide
encoded by
3o the added cDNA up- or downregulates at least one gene involved in the
biological pathway
regulating lipid metabolism and/or adipocyte differentiation;
(d) recovering cDNA from the cells isolated in step (c), by standard
procedures, e.g. PCR
or a CRE-LOX mediated procedure (see e.g. Sauer (1998) Methods 14: 381-392);
and
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
11
(e) identifying the polypeptide expressed by the cDNA recovered in step (d),
e.g. by
sequencing the cDNA and comparing the obtained sequence against sequence
databases.
Throughout this description the terms "standard protocols" and "standard
procedures",
when used in the context of molecular biology techniques, are to be understood
as
protocols and procedures found in an ordinary laboratory manual such as:
Current
Protocols in Molecular Biology, editors F. Ausubel et al., John Wiley and
Sons, Inc. 1994,
or Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A
laboratory manual,
2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1989.
0
EXAMPLES
EXAMPLE 1: Computational identification of FOXC2 genomic sequences
s
The sequences present in the GenBank database (http:llwww.ncbi.ralm.nih.gov)
were
screened for sequence similarity to the human FOXC2 cDNA sequence (GenBank
accession number NM 00521 (SEQ ID NO: 9)). The BLAST algorithm (Altschul et
al.
(1997) Nucleic Acids Res. 25:3389-3402) was used for determining sequence
identity.
2o Software for performing BLAST analyses is publicly available through the
National Center
for Biotechnology Information (http:llwww.ncbi.nlm.nih.gov). A working draft
genomic
sequence in 25 unordered pieces, from the Homo sapiens chromosome 16 clone
RP11-
46309 (GenBank accession number AC009108; Version 6; GI:7689930; released 4
May
2000), was selected for further studies.
Regions in sequence AC009108 matching portions of the FOXC~ cDNA sequence
NM 005251were combined using the PHRAP software, developed at the University
of
Washington (http:llwww.genome.Washington.edulUWGClanalysistoolslphrap.htm).
Two
contigs of 9780 by (positions 116445 to 126224 in GenBank AC009108.6) and 3784
by
(positions 42927 to 46710 in GenBank AC0091108.6), respectively, were
assembled to
generate a human FOXC2 genomic fragment of 13451 bp.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
12
The ClustalW multiple sequence alignment program, version I.8 (Thompson et al.
(1994)
Nucleic Acids Research 22: 4673-4680), was then used to identify the human
FOXC2
extended genomic DNA sequence of 6458 by (SEQ m NO: 1 ) by comparison with the
mouse cDNA sequence X74040 (SEQ LD NO: 6). First, a 6459 by sequence,
corresponding
s to positions 1500-7958 in the 13451 by sequence, was selected. Positions 1-
2285 in this
6459 by sequence corresponded to 44426-46710 in AC009108.6, while positions
2151-
6459 corresponded to positions 126224-121916 (reverse complement taken) in
AC009108.6. The overlap of positions 2151-2285 allowed for the contigs to be
joined by
the assembly program. The G residue in position 2655 was considered to be a
sequencing
to error and was removed, which resulted in the 6458 by sequence set forth as
SEQ ID NO: 1.
The open reading frame in SEQ ID NO: 1 encodes a polypeptide (SEQ ID NO: 2)
identical
with the known human FOXC2 polypeptide shown as SEQ ID NO:10.
is EXAMPLE 2: Identification of potential regulatory sequences in the human
and mouse
FOXC2 genomic sequences
In phylvgenetic footprinting (for a review, see Duret & Bucher (1997) Current
Opinion in
Structural Biology 7(3): 399-406) sequences are aligned and a regional
sequence identity is
2o determined for each window of a fixed, arbitrary length. This allows the
identification of
potential regulatory regions in genomic sequences. Non-exon sequences that are
conserved
over the course of evolution are likely to perform regulatory roles.
Phylogenetic
footprinting was performed as described in Wasserman & Fickett (1998) J. Mol.
Biol. 278,
167-181, based on an alignment generated with the ClustalW multiple sequence
alignment
2s program, version 1.8 (Thompson et al. (1994) Nucleic Acids Research 22:
4673-4680),
with default parameters adjusted to a gap opening penalty of 20 and a gap
extension
penalty of 0.2. The human (SEQ ID NO: 1) and mouse (SEQ >D NO: 5) genomic
sequences were aligned. Percentage identity was plotted for each contiguous
200 by
segment of the human gene to identify segments differentially conserved (in
comparison to
so adjoining sequences) (Fig. 2).
In addition to segments of the published exon sequence, two differentially
conserved
regions or "footprints" were identified in the human gene. Both of these
regions are local
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
13
maxima and contain segments which exceed 70% nucleotide identity between the
human
and mouse genomic sequences. One region, shown as positions 1250 to 2235, in
particular
positions 1250 to 1749, in SEQ ID NO: 1, immediately adjacent to the published
exon
region, is likely to contain the transcription start site and proximal
promoter regulatory
sequences (Fig. 4). Another region, shown as positions 216 to 475 in SEQ ID
NO: 1,
approximately 1700 by distal from the transcription start site, is likely to
function as some
form of regulatory region (either enhancer or repressor) (Fig. 3). (A
schematic overview of
the extended FOXC2 gene is shown in Fig. l .)
o Further analysis of these regulatory regions identified short segments of
higher
conservation between the mouse and human genes, suggesting that these specific
segments
function as transcription factor binding sites. The TRANSFAC transcription
factor database
(http:llt~ahsfac.gbfde) (see Wingender et al. (2000) Nucleic Acids Research
28(1): 316-
319) was screened for matches to known transcription factors. Consensus sites
(identifiers
~s 805066; 805067; 805068; and 805069) were found to match sequences conserved
between the human FOXC2 and mouse FoxC2 genes. This suggests the presence of
multiple forkhead-like binding sites in the distal regulatory enhancer, and
potential auto-
regulation of FOXC2 by its protein product.
2o The same analysis was performed with reference to 200 by contiguous
segments of the
mouse FoxC2 genomic sequence (SEQ m NO: 5). The following conserved regions
were
identified: 190 to 420; 1070 to 1645; and 5580 to 5875. They correlate to the
regions
indicated above for the human sequence and should be considered orthologous
regions.
E~MPLE 3: Identification of an alternative human FOXC2 cDNA sequence
BLASTN screening of the dbEST database from GenBank, using the human FOXC2
cDNA (SEQ m NO: 9) as a query sequence, revealed several ESTs overlapping
containing
o portions of the available cDNA. A specialized tool, est genome
(http:llwww.sange~.ac.uk),
for the prediction of exon boundaries using ESTs was applied to compare the
EST
sequences to the genomic sequences (See Mott, R. (1997) Computer Applications
in the
Biosciences 13(4): 477-478). Two classes of ESTs were observed: sequences
extending
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
14
into the 3'-untranslated region and sequences revealing an alternative first
exon spliced to
a junction internal to the previously described first exon.
Specifically, it was found that the nucleotides in positions 33 to 182 in the
EST with
s accession no. AW271272 (SEQ m NO: 11) were identical to positions 66 to 2I5
in the
extended FOXC2 genomic sequence (SEQ ID NO: 1), and that positions 183 to 327
in
SEQ ID NO: 11 were identical to positions 2516 to 2660 in SEQ ID NO: 1.
Similarly,
positions 5 to 55 in the EST with accession no. AW793237 (SEQ m NO: 12) were
identical to positions 165 to 215 in the extended FOXC2 gertomic sequence (SEQ
ID NO:
1), and positions 56 to 157 in SEQ m NO: 12 were identical to positions 2516
to 2607 in
SEQ 1D NO: 1. These results revealed an alternative splicing pattern in the
human FO.XC2
gene. According to this splicing pattern, an alternative gene sequence (SEQ >D
NO: 3) is
derived by joining the regions shown as positions 1-215 and 2516-6458 in SEQ m
NO: 1.
Alternative splicing patterns are known to regulate the synthesis of a variety
of peptides
is and proteins. It may result in proteins with an entirely different function
or in dysfunctional
or inhibitory splice products (for a review, see McKeown (1992) Armu. Rev.
Cell. Biol. 8:
133-155).
The amino acids corresponding to positions 1 to 94 in the published FOXC2
transcription
2o factor (SEQ II? NO: 10) are missing in protein encoded by the spliced
variant generated
from the alternative promoter (SEQ ID NO: 4). Consequently, the entire region
N-terminal
of the DNA binding domain and a portion of the DNA-binding domain
(corresponding to
positions 72-94 in SEQ ID NO: 2) are not present in the splice variant. It is
postulated that
this truncation leads to a protein, which has a deficient "forkhead" DNA-
binding region,
2s and thus has a potential inhibitory function on the biological activities
of the FOXC2
protein. This truncated FOXC2 protein may have a role in regulation of FOXC2,
and an
involvement in adipocyte differentiation and adipogenesis.
3o EXAMPLE 4: Cloning and sequencing of the FOXC2 promoter
The DNA region corresponding to nucleotide 176 to nucleotide 2233 (SEQ 1D NO.
1
version 2) has been cloned using nested PCR on human genomic DNA. The PCR was
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
performed according the HerculaseTM protocol (Stratagene catalog #600260;
http:llwww.stratagehe.comlpc~llae~culase.htm) and with the inclusion of 8-10%
DMSO.
In the initial reaction, the 5'-primer I~RKX131 (CCATTGCCTTCTAGTCGCCTCC) was
s used together with the 3'-primer KRKX133 (CGTTGGGGTCGGACACGGAGTA) using
250 ng Clontech Genomic DNA # 6550-1 as template. The nested reaction was
performed
on 1/100 of the initial PCR reaction using the 5'-primer KRI~Xl32
(GGTACCTACGCAGCCGATGAACAGCCA) and the 3'-primer KRKX134
(GCTAGCGCTGCTTCCGAGACGGCTCG). After the second PCR, the product was
o analyzed by electrophoresis in a 1.2% agarose gel, and a PCR product of the
expected size
was obtained and extracted for ligation into a TOPO PCR2.1 vector (Invitrogen,
Carlsbad,
CA) by standard cloning procedures and thereafter sequenced. The PCR reaction
and
cloning procedure was repeated in two parallel separate experiments, and
sequence data
from the two separate reactions were compared with the bioinformatically
assembled
~s sequence.
A DNA region containing the promoter (Fig. 4) corresponding to nt1179 to 2233
(SEQ ID
NO: 1, version 2) was has been cloned using nested PCR in the same manner as
described
above. In the initial reaction, the 5'-primer KRI~X136
(GGTACCCCCCGAGCCTGGAAACTCCCT) was used together with the 3'-primer
KRI~X134 (GCTAGCGCTGCTTCCGAGACGGCTCG) using 250 ng genomic DNA as a
template. The PCR reaction and cloning procedure was repeated in four parallel
separate
experiments, and sequence data from the four separate reactions were compared
with the
bioinformatically assembled sequence.
EXAMPLE 5: Tissue expression profiling of the alternative transcript
A reverse transcriptase PCR (RT-PCR) approach was used in order to detect
expression of
3o the alternative transcript in human adipose tissue and human primary
adipocytes. RNA
samples from human adipose tissue (Invitrogen, D6005-Ol) and primary
adipocytes (Zen-
Bio, SA75, RNA prepared according to the Trizol protocol)) were analyzed. RT-
PCR was
performed according to SMART RACE protocol (Clontech). First strand cDNA
synthesis
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
16
was made using a oligo dT primer provided in the SMART RACE kit. For PCR
amplification of the alternative transcript, nested 5' primer specific for the
alternative
transcript was used (initial PCR step ROLX56 5'ATG AAC AGC CAG GAA GGG TGC
AAG G3' and nested primer ROLXS~ 5'ACA GCC AGG AAG GGT GCA AGG AAA
s C3') while the nested 3' primers anneals to sequence common for both the
alternative and
the normal transcript (initial PCR step ROLX57 5'GAA GCT GCC GTT CTC GAA CAT
GTT G 3' and nested primer ROLX59 5'GTA GGA GTC CGG GTC CAG GGT CCA G
3' ). PCR was performed using the SMART RACE protocol. The primers anneal to
sequence on either side of the suggested splice site. Thus a PCR product of
the expected
to size of 223 by was obtained when amplifying cDNA derived from the
alternative
transcript, while amplification of contaminating genomic DNA containing the
intron
sequence yielded a PCR product of much larger size. Using this approach,
expression of
the alternative transcript was detected in human adipose tissue and primary
adipocytes.
Expression of the alternative gene product (SEQ m NO: 4) in adipocytes and
adipose
is tissue may be indicative of a regulatory function in this cell type.
EXAMPLE 6: Mapping of the 5'-UTR of the alternative exon using cDNA walking.
2o A cDNA walling method was used in order to map the 5'-UTR of the
alternative exon. °
Human adipose total RNA was obtained from Invitrogen (D6005-01). First strand
5'
RACE cDNA was synthesized according to standard procedure as described in the
Clontech manual. The cDNA was amplified according to the manual but using gene
specific primers. The 3'-PCR primers used in all reactions anneals to a
sequence at the 3'-
2s end of the splice site. Amplification of contaminating genomic DNA yields a
PCR product
of a larger size, as this would contain the intron sequence. The 5'-PCR
primers anneals to
sequence upstreaan of the putative initiation codon of the alternative exon,
with
approximate 100 by intervals. PCR products were subsequently cloned using TA
cloning
in a TOPO vector (Invitrogen) according to manual, and sequenced using
standard
3o procedure.
In the PCR reaction yielding the longest PCR product nested 5'-primers were
used (initial
PCR step 5'-GCGTTCGGCTCACTGACTTACAAGGT-3' and nested primer 5'-
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
17
GGAAGTGTCTCTCTCACCTTTTCTGTCTTGA-3') together with nested 3'-primers
(initial PCR step 5'-GAAGCTGCCGTTCTCGAACATGTTG-3' and nested primer 5'-
GTAGGAGTCCGGGTCCAGGGTCCAG-3'). This results in a PCR product of 878 by
(SEQ >D NO: 13) containing the predicted sequence. PCR using primers annealing
to
sequence 5' of GCGTTCGGCTCACTGACTTACAAGGT does not yield a detectable
PCR product. These results suggest that the transcription initiation site fox
the alternative
transcript is located at least 878 by upstream of the suggested translational
start. Position
692 in SEQ m NO: 13 corresponds to position 1 in SEQ ID NO: 3.
io
EXAMPLE 7: Functional analysis
The identified regulatory regions are analyzed to determine their impact on
the
transcription of the FOXC2 gene or a reporter gene substituted for FOXC2. A
PCR
~s reaction is performed to isolate the promoter region adjacent to the
published exon
sequence, possibly including the sequences extending to the beginning of the
ATG
encoding the first methionine. This PCR product is cloned into a reporter
plasmid adjacent
to a reporter gene (e.g. luciferase). The upstream regulatory region, i.e.
regions containing
both upstream and promoter proximal sequences, or these sequences bearing
artificially
2o induced differences, axe cloned in a similar manner. These constructs axe
transfected into a
cell culture model system and the level/activity of the protein encoded by the
reporter gene
is determined. This would provide information on the function of the
identified regions,
and used to assess the impact of the different regions on transcriptional
regulation.
Similarly, the upstream regulatory region, a region containing both upstream
and promoter
2s proximal sequences, or these sequences bearing artificially induced
differences can be
cloned and used to assess the impact of these regions on the transcription of
the reporter
gene.
3o EXAMPLE 8: Reporter gene assay to identify modulating compounds
Reporter gene assays are well known as tools to signal transcriptional
activity in cells. (For
a review of chemiluminescent and bioluminescent reporter gene assays, see
Bronstein et al.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
18
(1994) ,Analytical Biochemistry 219, 169-181.) For instance, the photoprotein
luciferase
provides a useful tool for assaying for modulators of promoter activity. Cells
are
transiently transfected with a reporter construct which includes a gene for
the luciferase
protein downstream from the FOXC2 promoter and enhancer region, or fragments
thereof
regulating the FOXC2 activity. Luciferase activity may be quantitatively
measured using
e.g. luciferase assay reagents that are commercially available from Promega
(Madison,
WI]. Differences in luminescence in the presence versus the absence of a
candidate
modulator compound axe indicative of modulatory activity.
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
19
TABLE I
Summary of FOXC2 sequences
SEQ ID NO: GenBank Description
accession no.
1 Human FOXC2 extended genomic DNA sequence
2 Human FOXCZ polypeptide sequence
(Identical with SEQ ID NO: 10)
3 Human FOXC2 DNA sequence
Alternative splicing
4 Human polypeptide sequence
Alternative open reading frame
Y08222 Mouse MHF-1 (FoxC2) genornic DNA sequence
(CDS 2070 - 3554)
6 X74040 Mouse MHF-1 (FoxC2) cDNA sequence
7 Mouse MHF-1 (FoxC2) polypeptide sequence
8 Y08223 Human FKHL14 (FOXC2) genomic DNA sequence
(CDS 1197 - 2702)
9 NM_005251 Human FKFILl4 (FOXC2) cDNA sequence
Human FKHLl4 (FOXC2) polypeptide sequence
11 AW 271272 Human EST
12 AW 793237 Human EST
13 5'-UTR of the alternative splice variant
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
TABLE II
Summary of features in human ~OXC2 sequences shown as SEQ ID NOs: 1 and 3
Feature Positions
SEQ ID NO: 1
First exon according to the alternative transcript1 - 215
- Untranslated region 1- 186
- Region coding for 5'-part of alternative 187 - 215
protein
Alternative first exon splice site 215 - 216
Predicted enhancer region 216 - 475
- E-box-like region 223 - 231
- Forkhead-like region 359 - 375
- Forkhead-like region 378 - 402
- Ets-like region 403 - 423
Predicted promoter region 1250 -1749
- Forkhead-like region 1692 -1703
First exon according to the published form 1746 - 4629
of the transcript
- Untranslated region 1746 - 2234
- Polypeptide coding region 2235 - 3740
- Region coding for DNA-binding domain 2448 - 2735
Second exon according to the alternative 2516 - 4629
transcript
- Portion of polypeptide used in alternative2516 - 3740
transcript
- Untranslated region 3741- 4629
SEQ D7 NO: 3
Polypeptide coding region (5' of splice site)187 - 215
Polypeptide coding region (3' of splice site)216 - 1437
- Region coding for truncated portion of 216 - 435
protein
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
1
SEQUENCE LISTING
<110> Biovitrum AB
<120> Promoter Sequences °
<130> 00298
<140>
<141>
<160> 12
<170> PatentIn Ver. 2.1
<210> 1
<2l1> 6458
<212> DNA
<2l3> Homo Sapiens
<220>
<221> CDS
<222> (2235) . . (3740)
<400> 1
cctttggctt tgaattgatc aggagacaaa gataatgcat ctacattttc gtcttctgtt 60
cttttattgg aaataagtgg CaCgCCCCat tgCCttCtag tCgCCtCCCC gaagcgaaga 120
ggccgaagcg aagaggcctg gtgggttgtc tcaacatcct tttgctgaga atcgaatacg 180
cagccgatga acagccagga agggtgcaag gaaacctgaa atacaaatgt tctccctgaa 240
gCCCtCttCC CtgCCCaaCC agaCCagCaa CttCCaaaat tCtgCCCgtg tttagCCttg 300
ttaaaggggt gtctcactcc ttcagggaaa gtgggaaaag gggatctgat tattgaggtg 360
tggaaggaat aaataatcag tccacaaata aacaaactgt ccgggattcc tagagggaag 420
gagaaatcct tgaaggagat ccaagtcgct ccaggtctgc ctgccgaata atatcatccc 480
gaagggatct tgaaccgttt gcaatcaacc gctcacccag tcttcccacg gagcgcgctc 540
cctaactcac cctacccacc caacaaaaca aaaaaaaggc tgaaatatag aaaagcaact 600
tggaggctcc cagggggacg ttgccaggag caggaggcag ggacagcgcc ctagggtcgg 660
tgttagcggc cggcgccggc ctgggccacg ggaaacgtcc acgcttggtg cccgcggtgc 720
gcggcgctca ttgcgcgcgc cttcgagcca agcccccgcg gaaaacaggc tcgggtttct 780
cctcgcaggg cccaggaact cggctctgcc tggcccgggt gggtcgctgc attgtcccgg 840
tcttctggga gtgcggggtc agcttgttag agggaatttc tacctgggaa aagggagacg 900
agtttcgaag ctgaagttgg taggctgcga gtgtccacgc gggagacgaa agggggaaat 960
agcagagtca cttcaccctt ttccccaaac cccacaaaac tgctcgcagc gacgcggatg 1020
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
2
atctaccgaa ttccccgcga attcggagga ttaagttgtc agtcagcacg ttgctacctt 1080
cccctctatg cactccgctg cctggctcct cggcggggag cgagggaaac tcagtttgta 1140
gggtttacct ctaaaacctc gataggttat ccttgacgac cccgagcctg gaaactccct 1200
gttgatgatt aattatttga ttaaataagt ataacatcca ggagaggccc tgccattcca 1260
atccagcgcg tttgcttttg aatccattac acctgggccc ccataattag gaaatctaat 1320
tattcgcttc atcactcatt aataagaaaa atgtcccagg atcattgcta cttacaaggt 1380
ctttgggaga gatattttac tctattaatc cattctattt tatatttcaa attgattttt 1440
tttaacagag gaaagtggct atctttttgt tttgggcatg tgggcccatt caccaaaatg 1500
tgatcataaa ataaatttta ataagatata actttttaaa aagttttcaa gtgaagacgg 1560
agtcgccgcg gaggccgggg cggcggggtc ttagagccga cggattcctg cgctcctcgc 1620
cccgattggc gCCggaCtCC tctcagctgc cgggtgattg gctcaaagtt ccgggagggg 1680
gcgtggcccg aggaaagtaa aaactcgctt tcagcaagaa gacttttgaa acttttccca 1740
atccctaaaa gggacttggc ctctttttct gggctcagcg gggcagccgc tcggaccccg 1800
gcgcgctgac cctcggggct gccgattcgc tgggggcttg gagagcctcc tgcgcccctc 1860
ctcgcgcggg ccgagggtcc accttggtcc ccaggccgcg gcgtctccgc tgggtccgcg 1920
gccgcccgcc tgcccgcgct gccgccgccg ggtcctggag ccagcgagga gcggggecgg 1980
cgctgcgctt gcccggggcg CgCCCtCCag gatgCCgatC CgCCCggtCC gctgaaagcg 2040
cgcgcccctg ctcggcccga gcgacgacga ccgcgcaccc tcgccccgga ggctgccagg 2100
agaccggggc cgcccctccc gCtCCCC'tCC tCtCCCCCtC tggCtCtCtC gCgCtCtCt C 2160
gctctcaggg CCCCCCtCgC tcccccggcc gcagtccgtg cgcgagggcg ccggcgagcc 2220
gtctcggaag cage atg cag gcg cgc tae tcc gtg tcc gac ccc aac gcc 2270
Met Gln Ala Arg Tyr Ser Val Ser Asp Pro Asn Ala
1 5 10
ctg gga gtg gtg ccc tae ctg age gag cag aat tae tae egg get gcg 2318
Leu Gly Val Val Pro Tyr Leu Ser Glu Gln Asn Tyr Tyr Arg Ala Ala
15 20 25
ggc age tae ggc ggc atg gcc age ccc atg ggc gtc tat tcc ggc cac 2366
Gly Ser Tyr Gly Gly Met Ala Ser Pro Met Gly Val Tyr Ser Gly His
30 35 40
ccg gag cag tae age gcg ggg atg ggc cgc tcc tae gcg ccc tae cac 2414
Pro Glu Gln Tyr Ser Ala Gly Met Gly Arg Ser Tyr Ala Pro Tyr His
45 50 55 60
cac cac cag ccc gcg gcg cct aag gac ctg gtg aag ccg ccc tae age 2462
His His Gln Pro Ala Ala Pro Lys Asp Leu Val Lys Pro Pro Tyr Ser
65 70 75
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
3
tac atc gcg ctc atc acc atg gcc atc cag aac gcg ccc gag aag aag 2510
Tyr Ile Ala Leu Ile Thr Met Ala Ile Gln Asn A1a Pro Glu Lys Lys
80 85 90
atc acc ttg aac ggc atc tac cag ttc atc atg gac cgc ttc ccc ttc 2558
Ile Thr Leu Asn Gly Ile Tyr Gln Phe Ile Met Asp Arg Phe Pro Phe
95 100 105
tac cgg gag aac aag cag ggc tgg cag aac agc atc cgc cac aac ctc 2606
Tyr Arg Glu Asn Lys Gln Gly Trp Gln Asn Ser Ile Arg His Asn Leu
110 115 120
tcgctc aacgagtgcttc gtcaaggtg CCCCgC gacgacaag aagccc 2654
SerLeu AsnGluCysPhe ValLysVal ProArg AspAspLys LysPro
125 130 135 140
ggcaag ggcagttactgg accctggac ccggac tcctacaac atgttc 2702
GlyLys GlySerTyrTrp ThrLeuAsp ProAsp SerTyrAsn MetPhe
145 150 155
gagaac ggcagcttcctg cggcgccgg cggcgc ttcaaaaag aaggac 2750
GluAsn GlySerPheLeu ArgArgArg ArgArg PheLysLys LysAsp
160 165 170
gtgtcc aaggagaaggag gagcgggcc cacctc aaggagccg cccccg 2798
ValSer LysGluLysGlu GluArgAla HisLeu LysGluPro ProPro
175 180 185
gcggcg tccaagggcgCC CCggCCaCC CCCCaC Ctagcggac gCCCCC 2846
AlaAla SerLysGlyAla ProAlaThr ProHis LeuAlaAsp AlaPro
190 195 200
aaggag gccgagaagaag gtggtgatc aagagc gaggcggcg tccccg 2894
LysGlu AlaGluLysLys ValValIle LysSer GluAlaAla SerPro
205 210 215 220
gcgctg ccggtcatcacc aaggtggag acgctg agccccgag agcgcg 2942
AlaLeu ProVa1IleThr LysValGlu ThrLeu SerProGlu SerAla
225 230 235
ctgcag ggcagcccgcgc agcgcggcc tccacg cccgccggc tCCCCC 2990
LeuGln GlySerProArg SerAlaAla SerThr ProAlaGly SerPro
240 245 250
gacggt tcgctgccggag caccacgcc gcggcg cccaacggg ctgcct 3038
AspGly SerLeuProGlu HisHisAla AlaAla ProAsnGly LeuPro
255 260 265
ggcttc agcgtggagaac atcatgacc ctgcga acgtcgccg ccgggc 3086
GlyPhe SerValGluAsn IleMetThr LeuArg ThrSerPro ProGly
270 275 280
ggagag ctgagcccgggg gccggacgc gcgggc ctggtggtg ccgccg 3134
GlyGlu LeuSerProGly A1aGlyArg AlaGly LeuValVal ProPro
285 290 295 300
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
4
ctggcg ctgccatac gccgccgcg ccgcccgcc gcctacggc cagccg 3182
LeuAla LeuProTyr AlaAlaAla ProProAla AlaTyrGly GlnPro
305 310 315
tgcget cagggcctg gaggccggg gccgccggg ggctaccag tgcagc 3230
CysAla GlnGlyLeu GluAlaGly AlaAlaGly GlyTyrGln CysSer
320 325 330
atgcga gcgatgagc ctgtacacc ggggccgag cggccggcg cacatg 3278
MetArg AlaMetSer LeuTyrThr GlyAlaGlu ArgProAla HisMet
335 340 345
tgcgtc ccgcccgcc ctggacgag gccctctcg gaccacccg agcggc 3326
CysVal ProProAla LeuAspGlu AlaLeuSer AspHisPro SerGly
350 355 360
cccacg tcgcccctg agcgetctc aacctcgcc gccggccag gagggc 3374
ProThr SexProLeu SerAlaLeu AsnLeuAla AlaGlyGln GluGly
365 370 375 380
gcgctc gccgccacg ggccaccac caccagcac cacggccac caccac 3422
AlaLeu AlaAlaThr GlyHisHis HisGlnHis HisGlyHis HisHis
385 390 395
ccgcag gcgccgecg cccccgccg getccccag ccccagccg acgccg 3470
ProGln AlaProPro ProProPro AlaProGln ProGlnPro ThrPro
400 405 410
cagccc ggggccgcc gcggcgcag gcggcctcc tggtatctc aaccac 3518
GlnPro GlyAlaAla AlaAlaGln AlaAlaSer TrpTyrLeu AsnHis
415 420 425
agcggg gacctgaac cacctcccc ggccacacg ttcgcggcc cagcag 3566
SerGly AspLeuAsn HisLeuPro GlyHisThr PheAlaAla GlnGln
430 435 440
caaact ttccccaac gtgcgggag atgttcaac tcccaccgg ctgggg 3614
GlnThr PheProAsn ValArgGlu MetPheAsn SerHisArg LeuGly
445 450 455 460
attgag aactcgacc ctcggggag tcccaggtg agtggcaat gccagc 3662
I1eGlu AsnSerThr LeuGlyGlu SerGlnVal SerGlyAsn AlaSer
465 470 475
tgc cag ctg ccc tac aga tcc acg ccg cct ctc tat cgc cac gca gcc 3710
Cys Gln Leu Pro Tyr Arg Ser Thr Pro Pro Leu Tyr Arg His Ala Ala
480 485 490
CCC tac tcc tac gac tgc acg aaa tac tga cgtgtcccgg gacctcccct 3760
Pro Tyr Ser Tyr Asp Cys Thr Lys Tyr
495 500
ccccggcccg ctccggcttc gcttcccagc cccgacccaa ccagacaatt aaggggctgc 3820
agagacgcaa aaaagaaaca aaacatgtcc accaaccttt tctcagaccc gggagcagag 3880
agcgggcacg ctagccccca gccgtctgtg aagagcgcag gtaactttaa ttcgccgccc 3940
cgtttctggg atcccaggaa acccctccaa agggacgcag cccaacaaaa tgagtattgg 4000
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
tcttaaaatc cccctcccct accaggacgg ctgtgctgtg ctcgacctga gctttcaaaa 4060
gttaagttat ggacccaaat cccatagcga gcccctagtg actttctgta ggggtcccca 4120
taggtgtatg ggggtctcta tagataatat atgtgctgtg tgtaatttta aatttctcca 4180
accgtgctgt acaaatgtgt ggatttgtaa tcaggctatt ttgttgttgt tgttgttgtt 4240
cagagccatt aatataatat ttaaagttga gttcactgga taagtttttc atcttgccca 4300
accatttcta actgccaaat tgaattcaag aaaccgatgt gggttttgtt tcctgtacaa 4360
ttatgagata taattctttt tcccattgta ggtcttttac aaaacaagaa aataatttat 4420
ttttttgttg gtggataaag aagtcaagta tctgatactt tttatttaca aagtgtgatg 4480
gttttgtata gtaggttcca ccctgagtat tcctaaaaga aaaaaaaaaa aaaagcttaa 4540
aaactctaac ttcatctgtg tttgtcttac gtggtcttaa tcgttgtact taccttaaaa 4600
taaacccatg ttgttttttc tgcccaaagt ttggacagtg tgtttgtgtt gttgcatttt 4660
ttacaaacga ggtgtgtttg caaacccacc tgctttgatt atttttgtta cacaggtggg 4720
tatatgtgta gacacataaa aacgaccaga gaataggagc acacacctgc tgtcttgttt 4780
agtgacagaa aaaggctttt gattaatttt aaaatcccac tctaggattt tttcttttcg 4840
agaaaccgcc cagttggagg gggctgcctg aaggaccgga ccatgagttt gccgtgatgc 4900
attttcttaa atgcacaaaa acatgctaat tgtcaaaaca aacagtgcca ctccatctca 4960
gtgtccagcc gtccccagtt taggaggtga aggaagggaa gaataaacat ttcccgtttg 5020
ctaactgcaa cccagggtga gtcctgcttt cccccgattt tataaaattt gagcctcttt 5080
gcctgcttta atagttttcc agagaatttg aactgggcca atgaaggtct gaaggggacg 5140
gattttctag cgtttgatat ccatCCCCCt tagcggccag atcagagggg aatttcagac 5200
tttattactt ctcaatgtca tgtctaaatc tacaccctca tcgcagtgaa aaattttaaa 5260
acctcattac ccttcaaaaa taatttatga tatttttaga gttctaaatt caagtttttc 5320
aatatgttaa ataatagaga ttattttttg ttttcaatgt taatatctcg tcttttacat 5380
ttttaatagt aacatagttt ttgtgaaatg tagctgacga aatggcttta ttatctattt 5440
caatggctga agtccaccac tcccctgctg gcctctatgt gtgaatttgg ggaccaaagc 5500
ttcatcaatt cccaccccag caggtgagct gtaccttgct aatgctgaag ttctttgtga 5560
gcttaacgtt tcaagaccag atgattttgc taaaggtgat tttgcttgat gcagtggcgc 5620
tgaacgtaac ccgggtgttt ttgtcgtgtt gttttcaaca tggcacttta tctccacgct 5680
atgttgaaat agaattaggg gaagcttaaa gcataataat tgtccccaca tgtgcaacac 5740
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
6
agactctttc aatctgtggc cccagaggtg gcacacagtt aagacttggc ggctgtctca 5800
ttctttttca taatgtgcgg gttcccgggt gtccgggtgc tagactttca gcaggcccca 5860
ggccagacgg gctttggttg agtgaacagg aggaggaagt taaggaggta ggggtgggga 5920
gagaccctct ccaagctgca gaagaaggtg gcccaagctc cttgcctgcg tctgccgtga 5980
tggtttcatt ttacttctgc tcgcttcatg ctatttgccc caggagaaga ggagagtatt 6040
ccagacggta agcgagctgg ctttttccct tccctagacg ttttaaagaa atctttctga 6100
aagcttgccc tcatcgtaag ctttgaaacc gttggtgtcc tgttagtggc gagggctgag 6160
agacacgcgg agaaataaag gagagcgacg gtgtggctga gagcccccag gtctgctgtt 6220
gaaactaagc tgggcttttg cacctttagg aagccttttt aaagaagtcc tgctgtgtgg 6280
gggccggaag cccaagtgag tgggccttgt ggaggttatc gggaggggtc tttaccactc 6340
cttggggaac gtgggcaacg gggggattgt atctgaagct ttattcaggt cttcggcggc 6400
agcagagtgg agaaccaggc ccttagtgtg tagcggcctg gggattttgg gactcatc 6458
<210> 2
<211> 501
<212> PRT
<213> Homo Sapiens
<400> 2
Met Gln Ala Arg Tyr Ser Val Ser Asp Pro Asn Ala Leu Gly Val Val
1 5 10 15
Pro Tyr Leu Ser Glu Gln Asn Tyr Tyr Arg Ala Ala Gly Ser Tyr Gly
20 25 30
Gly Met Ala Ser Pro Met Gly Val Tyr Ser Gly His Pro Glu Gln Tyr
35 40 45
Ser Ala Gly Met Gly Arg Ser Tyr Ala Pro Tyr His His His Gln Pro
50 55 60
Ala Ala Pro Lys Asp Leu Val Lys Pro Pro Tyr Ser Tyr Ile Ala Leu
65 70 75 80
Ile Thr Met Ala Ile Gln Asn Ala Pro Glu Lys Lys Ile Thr Leu Asn
85 90 95
Gly Ile Tyr Gln Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn
100 105 110
Lys Gln Gly Trp Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu
115 120 125
Cys Phe Val Lys Val Pro Arg Asp Asp Lys Lys Pro G1y Lys Gly Ser
130 135 l40
Tyr Trp Thr Leu Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser
145 150 155 160
Phe Leu Arg Arg Arg Arg Arg Phe Lys Lys Lys Asp Val Ser Lys Glu
165 170 175
Lys Glu Glu Arg Ala His Leu Lys Glu Pro Pro Pro Ala Ala Ser Lys
180 185 190
Gly Ala Pro Ala Thr Pro His Leu Ala Asp Ala Pro Lys Glu Ala Glu
195 200 205
Lys Lys Val Val Ile Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val
210 215 220
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
7
Ile Thr Lys Val Glu Thr Leu Ser Pro Glu Ser Ala Leu Gln Gly Ser
225 230 235 240
Pro Arg Ser Ala Ala Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu
245 250 255
Pro Glu His His Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val
260 265 270
Glu Asn Ile Met Thr Leu Arg Thr Ser Pro Pro Gly Gly Glu Leu Ser
275 280 285
Pro Gly Ala Gly Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro
290 295 300
Tyr Ala Ala Ala Pro Pro Ala Ala Tyr Gly Gln Pro Cys Ala Gln Gly
305 310 315 320
Leu Glu Ala Gly A1a Ala Gly Gly Tyr Gln Cys Ser Met Arg Ala Met
325 330 335
Ser Leu Tyr Thr Gly Ala Glu Arg Pro Ala His Met Cys Val Pro Pro
340 345 350
Ala Leu Asp Glu Ala Leu Ser Asp His Pro Ser Gly Pro Thr Ser Pro
355 360 365
Leu Ser Ala Leu Asn Leu Ala Ala Gly Gln Glu Gly Ala Leu Ala Ala
370 375 380
Thr Gly His His His Gln His His Gly His His His Pro Gln Ala Pro
385 390 395 400
Pro Pro Pro Pro Ala Pro Gln Pro Gln Pro Thr Pro Gln Pro Gly Ala
405 410 415
Ala Ala Ala Gln A1a Ala Ser Trp Tyr Leu Asn His Ser Gly Asp Leu
420 425 430
Asn His Leu Pro Gly His Thr Phe Ala Ala Gln Gln Gln Thr Phe Pro
435 440 445
Asn Val Arg Glu Met Phe Asn Ser His Arg Leu Gly Ile Glu Asn Ser
450 455 460
Thr Leu Gly Glu Ser G1n Val Ser Gly Asn Ala Ser Cys Gln Leu Pro
465 470 475 480
Tyr Arg Ser Thr Pro Pro Leu Tyr Arg His Ala Ala Pro Tyr Ser Tyr
485 490 495
Asp Cys Thr Lys Tyr
500
<210> 3
<211> 4158
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (187)..(1437)
<400> 3
cctttggctt tgaattgatc aggagacaaa gataatgcat ctacattttc gtcttctgtt 60
cttttattgg aaataagtgg CaCgCCCCat tgCCttCtag tCgCCtCCCC gaagcgaaga 120
ggccgaagcg aagaggcctg gtgggttgtc tcaacatcct tttgctgaga atcgaatacg 180
cagccg atg aac agc cag gaa ggg tgc aag gaa acc ttg aac ggc atc 228
Met Asn Ser Gln Glu Gly Cys Lys Glu Thr Leu Asn Gly Ile
1 5 10
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
8
tac cag ttc atc atg gac cgc ttc ccc ttc tac cgg gag aac aag cag 276
Tyr Gln Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn Lys Gln
15 20 25 30
ggc tgg cag aac agc atc cgc cac aac ctc tcg ctc aac gag tgc ttc 324
Gly Trp Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu Cys Phe
35 40 45
gtc aag gtg CCC CgC gac gac aag aag ccc ggc aag ggc agt tac tgg 372
Val Lys Val Pro Arg Asp Asp Lys Lys Pro Gly Lys Gly Ser Tyr Trp
50 55 60
acc ctg gac ccg gac tcc tac aac atg ttc gag aac ggc agc ttc ctg 420
Thr Leu Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser Phe Leu
65 70 75
cgg cgc cgg cgg cgc ttc aaa aag aag gac gtg tcc aag gag aag gag 468
Arg Arg Arg Arg Arg Phe Lys Lys Lys Asp Val Ser Lys Glu Lys Glu
80 85 90
gag cgg gcc cac ctc aag gag ccg ccc ccg gcg gcg tcc aag ggc gcc 516
Glu Arg Ala His Leu Lys Glu Pro Pro Pro Ala Ala Ser Lys Gly Ala
95 100 105 110
CCg gCC aCC CCC CaC Cta gcg gac gcc ccc aag gag gcc gag aag aag 564
Pro Ala Thr Pro His Leu Ala Asp Ala Pro Lys Glu Ala Glu Lys Lys
115 120 125
gtg gtg atc aag agc gag gcg gcg tcc ccg gcg ctg ccg gtc atc acc 612
Val Val Ile Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val Ile Thr
130 135 140
aag gtg gag acg ctg agc ccc gag agc gcg ctg cag ggc agc ccg cgc 660
Lys Val Glu Thr Leu Ser Pro Glu Ser Ala Leu Gln Gly Ser Pro Arg
145 150 155
agc gcg gcc tcc acg ccc gcc ggc tcc ccc gac ggt tcg ctg ccg gag 708
Ser Ala Ala Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu Pro Glu
160 165 170
cac cac gcc gcg gcg ccc aac ggg ctg cct ggc ttc agc gtg gag aac 756
His His Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val Glu Asn
175 180 185 190
atc atg acc ctg cga acg tcg ccg ccg ggc gga gag ctg agc ccg ggg 804
Ile Met Thr Leu Arg Thr Ser Pro Pro Gly Gly Glu Leu Ser Pro Gly
195 200 205
gcc gga cgc gcg ggc ctg gtg gtg ccg ccg ctg gcg ctg cca tac gcc 852
Ala Gly Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro Tyr Ala
210 215 220
gcc gcg ccg ccc gcc gcc tac ggc cag ccg tgc get cag ggc ctg gag 900
Ala Ala Pro Pro Ala Ala Tyr Gly Gln Pro Cys A1a Gln Gly Leu Glu
225 230 235
gcc ggg gcc gcc ggg ggc tac cag tgc agc atg cga gcg atg agc ctg 948
Ala Gly Ala Ala Gly Gly Tyr Gln Cys Ser Met Arg Ala Met Ser Leu
240 245 250
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
9
tacacc ggggccgag cggccggcg cacatgtgc gtcccgccc gccctg 996
TyrThr GlyAlaGlu ArgProAla HisMetCys ValProPro AlaLeu
255 260 265 270
gacgag gccctctcg gaccacccg agcggcccc acgtcgccc ctgagc 1044
AspGlu AlaLeuSer AspHisPro SerGlyPro ThrSerPro LeuSer
275 280 285
getctc aacctcgcc gccggccag gagggcgcg ctcgccgcc acgggc 1092
AlaLeu AsnLeuAla AlaGlyGln GluGlyAla LeuAlaAla ThrGly
290 295 300
CdCCdC C2.CCagCaC CaCggCCaC CdCCdCCCg caggcgCCg CCgCCC 1140
HisHis HisGlnHis.HisGlyHis HisHisPro GlnAlaPro ProPro
305 310 315
ccgccg getccccag ccccagccg acgccgcag cccggggcc gccgcg 1188
ProPro AlaProGln ProGlnPro ThrProGln ProGlyAla AlaAla
320 325 330
gcgcag gcggcctcc tggtatctc aaccacagc ggggacctg aaccac 1236
AlaGln AlaAlaSer TrpTyrLeu AsnHisSer GlyAspLeu AsnHis
335 340 345 350
CtCCCC ggccacacg ttcgcggcc cagCagCad aCtttCCCC aaCgtg 1284
LeuPro GlyHisThr PheAlaAla GlnGlnGln ThrPhePro AsnVal
355 360 365
cgggag atgttcaac tcccaccgg ctggggatt gagaactcg accctc 1332
ArgGlu MetPheAsn SerHisArg LeuGlyIle GluAsnSer ThrLeu
370 375 380
ggggag tcccaggtg agtggcaat gccagctgc cagctgccc tacaga 1380
GlyGlu SerGlnVal SerGlyAsn AlaSerCys GlnLeuPro TyrArg
385 390 395
tCCaCg CCgCCtCtC tatCgCC2.CgCagCCCCC taCtCCtaC gaCtgC 1428
SerThr ProProLeu TyrArgHis AlaAlaPro TyrSerTyr AspCys
400 405 410
acgaaa tactgacgtgtcc 1477
cgggacctcc
cctccccggc
ccgetccggc
ThrLys Tyr
415
ttcgcttccc agccccgacc caaccagaca attaaggggc tgcagagacg caaaaaagaa 1537
acaaaacatg tccaccaacc ttttctcaga cccgggagca gagagcgggc acgctagccc 1597
ccagccgtct gtgaagagcg caggtaactt taattcgccg CCCCgtttCt gggatCCCag 1657
gaaaCCCCtC caaagggacg cagcccaaca aaatgagtat tggtcttaaa atccccctcc 7_717
cctaccagga cggctgtgct gtgctcgacc tgagctttca aaagttaagt tatggaccca 1777
aatcccatag cgagccccta gtgactttct gtaggggtcc ccataggtgt atgggggtct 1837
ctatagataa tatatgtgct gtgtgtaatt ttaaatttct ccaaccgtgc tgtacaaatg 1897
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
tgtggatttg taatcaggct attttgttgt tgttgttgtt gttcagagcc attaatataa 1957
tatttaaagt tgagttcact ggataagttt ttcatcttgc ccaaccattt ctaactgcca 2017
aattgaattc aagaaaccga tgtgggtttt gtttcctgta caattatgag atataattct 2077
ttttcccatt gtaggtcttt tacaaaacaa gaaaataatt tatttttttg ttggtggata 2137
aagaagtcaa gtatctgata ctttttattt acaaagtgtg atggttttgt atagtaggtt 2197
ccaccctgag tattcctaaa agaaaaaaaa aaaaaaagct taaaaactct aacttcatct 2257
gtgtttgtct tacgtggtct taatcgttgt acttacctta aaataaaccc atgttgtttt 2317
ttctgcccaa agtttggaca gtgtgtttgt gttgttgcat tttttacaaa cgaggtgtgt 2377
ttgcaaaccc acctgctttg attatttttg ttacacaggt gggtatatgt gtagacacat 2437
aaaaacgacc agagaatagg agcacacacc tgctgtcttg tttagtgaca gaaaaaggct 2497
tttgattaat tttaaaatcc cactctagga ttttttcttt tcgagaaacc gcccagttgg 2557
agggggctgc ctgaaggacc ggaccatgag tttgccgtga tgcattttct taaatgcaca 2617
aaaacatgct aattgtcaaa acaaacagtg ccactccatc tcagtgtcca gccgtcccca 2677
gtttaggagg tgaaggaagg gaagaataaa catttcccgt ttgctaactg caacccaggg 2737
tgagtcctgc tttcccccga ttttataaaa tttgagcctc tttgcctgct ttaatagttt 2797
tccagagaat ttgaactggg ccaatgaagg tctgaagggg acggattttc tagcgtttga 2857
tatccatccc ccttagcggc cagatcagag gggaatttca gactttatta cttctcaatg 2917
tcatgtctaa atctacaccc tcatcgcagt gaaaaatttt aaaacctcat tacccttcaa 2977
aaataattta tgatattttt agagttctaa attcaagttt ttcaatatgt taaataatag 3037
agattatttt ttgttttcaa tgttaatatc tcgtctttta catttttaat agtaacatag 3097
tttttgtgaa atgtagctga cgaaatggct ttattatcta tttcaatggc tgaagtccac 3157
cactcccctg ctggcctcta tgtgtgaatt tggggaccaa agcttcatca attcccaccc 3217
cagcaggtga gctgtacctt gctaatgctg aagttctttg tgagcttaac gtttcaagac 3277
cagatgattt tgctaaaggt gattttgctt gatgcagtgg cgctgaacgt aacccgggtg 3337
tttttgtcgt gttgttttca acatggcact ttatctccac gctatgttga aatagaatta 3397
ggggaagctt aaagcataat aattgtcccc acatgtgcaa cacagactct ttcaatctgt 3457
ggccccagag gtggcacaca gttaagactt ggcggctgtc tcattctttt tcataatgtg 3517
cgggttcccg ggtgtccggg tgctagactt tcagcaggcc ccaggccaga cgggctttgg 3577
ttgagtgaac aggaggagga agttaaggag gtaggggtgg ggagagaccc tctccaagct 3637
gcagaagaag gtggcccaag ctccttgcct gcgtctgccg tgatggtttc attttacttc 3697
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
11
tgctcgcttc atgctatttg ccccaggaga agaggagagt attccagacg gtaagcgagc 3757
tggctttttc ccttccctag acgttttaaa gaaatctttc tgaaagcttg ccctcatcgt 3817
aagctttgaa accgttggtg tcctgttagt ggcgagggct gagagacacg cggagaaata 3877
aaggagagcg acggtgtggc tgagagcccc caggtctgct gttgaaacta agctgggctt 3937
ttgcaccttt aggaagcctt tttaaagaag tcctgctgtg tgggggccgg aagcccaagt 3997
gagtgggcct tgtggaggtt atcgggaggg gtctttacca ctccttgggg aacgtgggca 4057
acggggggat tgtatctgaa gctttattca ggtcttcggc ggcagcagag tggagaacca 4117
ggcccttagt gtgtagcggc ctggggattt tgggactcat c 4158
<210> 4
<211> 417
<212> PRT
<213> Homo Sapiens
<400> 4
Met Asn Ser Gln Glu Gly Cys Lys Glu Thr Leu Asn Gly Ile Tyr Gln
1 5 10 15
Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn Lys Gln Gly Trp
20 25 30
Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu Cys Phe Val Lys
35 40 45
Val Pro Arg Asp Asp Lys Lys Pro Gly Lys Gly Ser Tyr Trp Thr Leu
50 55 60
Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser Phe Leu Arg Arg
65 70 75 80
Arg Arg Arg Phe Lys Lys Lys Asp Val Ser Lys Glu Lys Glu Glu Arg
85 90 95
Ala His Leu Lys Glu Pro Pro Pro Ala Ala Ser Lys Gly Ala Pro Ala
100 105 110
Thr Pro His Leu Ala Asp Ala Pro Lys Glu Ala Glu Lys Lys Val Val
115 120 125
Ile Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val Ile Thr Lys Val
130 135 140
Glu Thr Leu Ser Pro Glu Ser Ala Leu Gln Gly Ser Pro Arg Ser Ala
145 150 155 160
Ala Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu Pro Glu His His
165 170 175
Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val Glu Asn Ile Met
180 185 190
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
12
Thr Leu Arg Thr Ser Pro Pro Gly Gly Glu Leu Ser Pro Gly Ala Gly
195 200 205
Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro Tyr Ala Ala Ala
210 215 220
Pro Pro Ala Ala Tyr Gly Gln Pro Cys Ala Gln Gly Leu Glu Ala Gly
225 230 235 240
Ala Ala Gly Gly Tyr Gln Cys Ser Met Arg Ala Met Ser Leu Tyr Thr
245 250 255
Gly Ala Glu Arg Pro Ala His Met Cys Val Pro Pro Ala Leu Asp Glu
260 265 270
Ala Leu Sex Asp His Pro Ser Gly Pro Thr Ser Pro Leu Ser Ala Leu
275 280 285
Asn Leu Ala Ala Gly Gln Glu Gly Ala Leu Ala Ala Thr Gly His His
290 295 300
His Gln His His Gly His His His Pro Gln Ala Pro Pro Pro Pro Pro
305 310 315 320
Ala Pro Gln Pro Gln Pro Thr Pro Gln Pro Gly Ala Ala Ala Ala Gln
325 330 335
Ala Ala Ser Trp Tyr Leu Asn His Ser Gly Asp Leu Asn His Leu Pro
340 345 350
Gly His Thr Phe Ala Ala Gln Gln Gln Thr Phe Pro Asn Val Arg Glu
355 360 365
Met Phe Asn Ser His Arg Leu Gly Ile Glu Asn Ser Thr Leu Gly Glu
370 375 380
Ser Gln Val Ser Gly Asn Ala Ser Cys Gln Leu Pro Tyr Arg Ser Thr
385 390 395 400
Pro Pro Leu Tyr Arg His Ala Ala Pro Tyr Ser Tyr Asp Cys Thr Lys
405 410 415
Tyr
<210> 5
<211> 6021
<212> DNA
<213> Mus musculus
<220>
<221> exon
<222> (1649)..(4348)
<300>
<308> GenBank/Y08222
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
13
<309> 1997-05-14
<300>
<301> Miura, N
<303> Genomics
<304> 41
<306> 489-492
<307> 1997
<400> 5
ctcgagtcaa aggtagcaca cataaaacct attttgctgc ttcggtacgt caagcaatgc 60
cactaaagtt tcctcacccg ccaaagctga aacagtgagt tctaatctct caaagccttt 120
tgccgaaaat ctaaaggggg tggggggcta tggtggtggc gtgggggggg ggtcggagaa 180
gaagaaagac tgagacaaat gttttatctg tcgccttctt ccctacccaa ccggaccaac 240
aacttccaga aggttctgcg aggcatagag ccattccgta gggacatctc ggtgcttctg 300
aggaagcgga ccgagcaggg atccgatgac gactggagat gttgaaggaa taaataccag 360
tccacaaata aacaaactgt ccccgggatt cctagaggga aggagcacgc ttgaaggtcg 420
gggaactccg agtcgctgtg cgtcaaggtt ggcataaaat taaaaaaaaa aaaagtcctt 480
cagttaccag gccctctaag gagcccctgg tcctcagctc accttatcaa aactcagtaa 540
aacaaacagc ctgaaataca gtcaatttac aggatcccaa agatgctgac cgcggagtgg 600
gacccacgcc gggccccggc aacagctagg gaagcgggtc cgaggctaca cagtgccgcg 660
ctcctttgcg tttccagtga cgaagccggc gatggagtgc aggcttggag ctccccacgc 720
cgaacgggga caccagctcc cgggggctgg ctgccttgtc ctaacctcca gacagcgctt 780
tcataggtgg ggagaaggga gaggccggga tggatggcag ggaaagctag ccctcgtcta 840
tgcgggagag gagaccagga aagcaacagt tgggttcacg cgcttccctg aaccccacga 900
aattgtttgg aggactcaga tggatcacct aagtagcagc gaagacgaag gaccaatggt 960
tCCttaggtg ttaCCttccc agtttggcat tcccactaag CCttCCCtCC CagCCCgaCC 102
ccgtcgtgaa ggggagagga accgaattct ccaacccggc ctcctttgtg ggctcttcct 1080
caacctggaa gcgtcctgtg aattatccat cactgcattc aacaggccct acacgctcag 1140
tccgtttgct ctgaacccat tacaactagg ccccgataat taagaaatct aattattcgc 1200
ctcttcatcc attaataata ataaaaaaaa aatctccagg ctctttccta cttacaaggt 1260
cttgggggca aatctctgcc caacttcatc aattcgatgt tatatttcaa actaaacttc 1320
tttttatttt ccaaaggaac agggttttta atttttgctc tggacacgtg gtctcgttaa 1380
acaaaatgtg ataataaaat aaaattttat aagatgtaac tcatttttaa aagtcctcaa 1440
gttaacttga gctggggggg ggggagatct ggctaagagc atctgggtct tagagccgac 1500
ggattcaggc gctcctcgtt ttgattggtg ccatccttct cgcagctgcc agatgattgg 1560
tgcaaacttc ctggaggggg cgcggcctga agaaagtaaa aactcgcttt gagccagaag 1620
acttttgaaa cttttcccaa tccctaaaag ggactttgct tctttttccg ggctcggccg 1680
cgcagcctct ccggacccta gctcgctgac gctgcgggct gcagttctcc tggcggggcc 1740
cgagagccgc tgtctccttt tctagcactc ggaagggctg gtgtcgctcc acggtcgcgc 1800
gtggcgtctg tgccgccagc tcagggctgc cacccgccaa gccgagagtg cgcggccagc 1860
ggggccgcct gccgtgcacc cttcaggatg ccgatccgcc cggtcggctg aacccgagcg 1920
ccggcgtctt ccgcgcgtgg accgcgaggc tgccccgagt cggggctgcc tgcatcgctc 1980
cgtcccttcc tgctctcctg ctccgggcct cgctcgccgc gggccgcagt cggtgcgcgc 2040
aggcggcgac cgggcgtctg ggacgcagca tgcaggcgcg ttactcggta tcggacccca 2100
acgccctggg agtggtaccc tatttgagtg agcaaaacta ctaccgggcg gccggcagct 2160
acggcggcat ggccagcccc atgggcgtct actccggcca cccggagcag tacggcgccg 2220
gcatgggccg ctcctacgcg CCCtaCCaCC aCCagCCCgC ggcgcccaag gacctggtga 2280
agccgcccta cagctatata gcgctcatca ccatggcgat ccagaacgcg ccagagaaga 2340
agatcactct gaacggcatc taccagttca tcatggaccg tttccccttc taccgcgaga 2400
acaagcaggg ctggcagaac agcatccgcc acaacctgtc actcaatgag tgcttcgtga 2460
aagtgccgcg cgacgacaag aagccgggca agggcagcta ctggacgctc gacccggact 2520
cctacaacat gttcgagaat ggcagcttcc tgcggcggcg gcggcgcttc aagaagaagg 2580
atgtgcccaa ggacaaggag gagcgggccc acctcaagga gccgccctcg accacggcca 2640
agggcgctcc gacagggacc ccggtagctg acgggcccaa ggaggccgag aagaaagtcg 2700
tggttaagag cgaggcggcg tcccccgcgc tgccggtcat caccaaggtg gagacgctga 2760
gccccgaggg agcgctgcag gccagtccgc gcagcgcatc ctccacgccc gcaggttccc 2820
cagacggctc gctgccggag caccacgccg cggcgcctaa cgggctgccc ggcttcagcg 2880
tggagaccat catgacgctg cgcacgtcgc ctccgggcgg cgatctgagc ccagcggccg 2940
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
14
cgcgcgccgg cctggtggtg ccaccgctgg cactgccata cgccgcagcg ccacccgccg 3000
cttacacgca gccgtgcgcg cagggcctgg aggctgcggg ctccgcgggc taccagtgca 3060
gtatgcgggc tatgagtctg tacaccgggg ccgagcggcc cgcgcacgtg tgcgttccgc 3120
ccgcgctgga cgaggctctg tcggaccacc cgagcggccc cggctccccg ctcggcgccc 3180
tcaacctcgc agcgggtcag gagggcgcgt tgggggcctc gggtcaccac caccagcatc 3240
aCggCCaCCt CCaCCCgCag gCgCCaCCgC CCgCCCCgCa gCCCCCtCCC gcgccgcagc 3300
CCgCCaCCCa ggCCaCCtCC tggtatctga accacggcgg ggacctgagc cacctccccg 3360
gccacacgtt tgcaacccaa cagcaaactt tccccaacgt ccgggagatg ttcaactcgc 3420
accggctagg actggacaac tcgtccctcg gggagtccca ggtgagcaat gcgagctgtc 3480
agctgcccta tcgagctacg CCgtCCCtCt aCCgCCaCgC agccccctac tcttacgact 3540
gcaccaaata ctgaggctgt ccagtccgct ccagccccag gaccgcaccg gcttcgcctc 3600
ctccatggga accttcttcg acggagccgc agaaagcgac ggaaagcgcc cctctctcag 3660
aaccaggagc agagagctcc gtgcaactcg caggtaactt atccgcagct cagtttgaga 3720
tctcagcgag tccctctaag ggggatgcag cccagcaaaa cgaaatacag attttttttt 3780
taattccttc ccctacccag atgctgcgcc tgctcccttg gggcttcata gattagctta 3840
tggaccaaac ccatagggac ccctaatgac ttctgtggag attctccacg ggcgcaagag 3900
gtctctccgg ataaggtgcc ttctgtaaac gagtgcggat ttgtaaccag gctattttgt 3960
tcttgcccag agcctttaat ataatattta aagttgtgtc cactggataa ggtttcgtct 4020
tgcccaactg ttactgccaa attgaattca agaaacgtgt gtgggtcttt tctccccacg 4080
tcaccatgat aaaataggtc cctccccaaa ctgtaggtct tttacaaaac aagaaaataa 4140
tttatttttt tgttgttgtt ggataacgaa attaagtatc ggatactttt aatttaggaa 4200
gtgcatggct ttgtacagta gatgccatct ggggtattcc aaaaacacac caaaagactt 4260
taaaatttca atctcacctg tgtttgtctt atgtgatctc agtgttgtat ttaccttaaa 4320
ataaacccgt gttgtttttc tgcccaaagt tcggacagag tctttgtgtt cttgaatttt 4380
aaaagggaaa ttgtagtaag ccagttgtga ttgatttttg tgatgcaggt tggcctggta 4440
acgtggatgc atatacaggt tacaggacga tggagctctc gattagtaat agaaggggct 4500
cttgatttgt tgaactatcc cgtcctgaga tatttttgtt ttctgctcga ggtaatctga 4560
gaaactgttc tccatccaca cacggacagg gctgcctgag ggcaacgtcc tgctggcctg 4620
ttaacgaaat gctttgcggg atgcagaaaa ctgttgccaa ttgtcaaaac aaaatggtgt 4680
caccctgtct cggtgtccag ctgtcctctg ttagagggga gaaaccgaga aaggacaaac 4740
ggcctgcagc ttgctaacct cagcgtagca ggagcctggg tgagtgctcg gctccctcca 4800
tttccttaga tgcggacttg ttgcccctgt tggcgtttta agagtgccag caagaagcaa 4860
agagggttgg taggtctctg gtatttaact gccggctttg ggatcagatt agaagtgaat 4920
ttcagtctga tttatttctt aatttgggct ttaaatattt tactccggcg tggtggaaaa 4980
agaagccact gtgcgcctcc agcatgatat tttagcgctg aaatggctct ggttttcagc 5040
atgctaagta acaggagatt atttttcttt tgattcttgt atttcatttc tttaaaaaaa 5100
aaaaaggaaa tagatcggga caaactctct aaaatgtacc tggctggctg gggtggggtc 5160
cttaccaatc tgctgcctga aagatacagc ttcagcacag gcctgcgtgt tggactttag 5220
gcatatcatg gattcccacg ccagttggta acctggactg tgctaatgga agttctttct 5280
gcacagaaca tgtaggccag gaggaggcag ggacccggga ggggggtgga ctttgcaggt 5340
catctgctta gcttagtggt ggccacgggt taacacgtat atagtgttac tgtttgaaac 5400
tccaagtttt atatctgtgc tgttttgatg tagaatttgg ggaggttcct gatgatacta 5460
ccctacccgt gtatgtaaga cagtctttca acctgcagtg ccagaatgtg acccacactt 5520
cagtatcttc cataaagtgg ggggactaag aactggacag gggtgctgtg gaggggggca 5580
ggccaggtgt atcttggttc ctgagcagag cagagagctt aggaaggggt cgggagatct 5640
ctggttcctc ccaacactgg tttcattttg catggctctc ttcaaacctc ttgccccagg 5700
agaagcgagc tttgtccaag ccagctggct cgctcctttc ccagatgttt taggggcctc 5760
cctgaaagct tgccctcctc ttaagattca gaactcctga cccagggaaa gataggaggc 5820
tttgtggatg ggagcttttt tttaaagagg accgttctcg ttctcaagta ggtagctaga 5880
gagaagcccc ctggagcagg ccctacttgt gactgtcagg gaacccaggt tgtgttgtag 5940
gcttttccca ggcctcccag agcagcggtg tgaaaaaatg cggtcctggg aaaagttggt 6000
ctggggtgtt gcttcctcga g 6021
<210> 6
<211> 2712
<212> DNA
<213> Mus musculus
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
<220>
<221> CDS
<222> (422)..(1906)
<300>
<308> GenBank/Y08222
<309> 1997-05-14
<300>
<301> Miura, N
<303> Genomics
<304> 41
<306> 489-492
<307> 1997
<400> 6
agggactttg cttctttttc cgggctcggc cgcgcagcct CtCCggaCCC tagctcgctg 60
acgctgcggg ctgcagttct cctggcgggg cccgagagcc gctgtctcct tttctagcac 120
tcggaagggc tggtgtcgct ccacggtcgc gcgtggcgtc tgtgccgcca gctcagggct 180
gccacccgcc aagccgagag tgcgcggcca gcggggccgc ctgccgtgca cccttcagga 240
tgCCgatCCg cccggtcggc tgaacccgag cgccggcgtc ttccgcgcgt ggaccgcgag 300
gctgccccga gtcggggctg cctgcatcgc tccgtccctt cctgctctcc tgctccgggc 360
ctcgctcgcc gcgggccgca gtcggtgcgc gcaggcggcg accgggcgtc tgggacgcag 420
c atg cag gcg cgt tac tcg gta tcg gac ccc aac gcc ctg gga gtg gta 469
Met Gln Ala Arg Tyr Ser Val Ser Asp Pro Asn Ala Leu Gly Val Val
1 5 10 15
ccc tat ttg agt gag caa aac tac tac cgg gcg gcc ggc agc tac ggc 517
Pro Tyr Leu Ser Glu Gln Asn Tyr Tyr Arg Ala Ala Gly Ser Tyr Gly
25 30
ggc atg gcc agc ccc atg ggc gtc tac tcc ggc cac ccg gag cag tac 565
Gly Met Ala Ser Pro Met Gly Val Tyr Ser Gly His Pro Glu Gln Tyr
35 40 45
ggc gcc ggc atg ggc cgc tcc tac gcg ccc tac cac cac cag ccc gcg 613
Gly Ala Gly Met Gly Arg Ser Tyr Ala Pro Tyr His His Gln Pro Ala
50 55 60
gcg ccc aag gac ctg gtg aag ccg ccc tac agc tat ata gcg ctc atc 661
Ala Pro Lys Asp Leu Val Lys Pro Pro Tyr Ser Tyr Ile Ala Leu Ile
65 70 75 80
acc atg gcg atc cag aac gcg cca gag aag aag atc act ctg aac ggc 709
Thr Met Ala Ile Gln Asn Ala Pro Glu Lys Lys Ile Thr Leu Asn Gly
85 90 95
atc tac cag ttc atc atg gac cgt ttc ccc ttc tac cgc gag aac aag 757
Tle Tyr Gln Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn Lys
100 105 110
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
16
cag ggc tgg cag aac agc atc cgc cac aac ctg tca ctc aat gag tgc 805
Gln Gly Trp Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu Cys
115 120 125
ttc gtg aaa gtg ccg cgc gac gac aag aag ccg ggc aag ggc agc tac 853
Phe Val Lys Val Pro Arg Asp Asp Lys Lys Pro Gly Lys Gly Ser Tyr
130 135 140
tgg acg ctc gac ccg gac tcc tac aac atg ttc gag aat ggc agc ttc 901
Trp Thr Leu Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser Phe
145 150 155 160
ctg cgg cgg cgg cgg cgc ttc aag aag aag gat gtg ccc aag gac aag 949
Leu Arg Arg Arg Arg Arg Phe Lys Lys Lys Asp Val Pro Lys Asp Lys
165 170 175
gag gag cgg gcc cac ctc aag gag ccg ccc tcg acc acg gcc aag ggc 997
Glu Glu Arg Ala His Leu Lys Glu Pro Pro Ser Thr Thr Ala Lys Gly
180 185 190
get ccg aca ggg acc ccg gta get gac ggg ccc aag gag gcc gag aag 1045
Ala Pro Thr Gly Thr Pro Val Ala Asp Gly Pro Lys Glu Ala Glu Lys
195 200 205
aaa gtc gtg gtt aag agc gag gcg gcg tcc ccc gcg ctg ccg gtc atc 1093
Lys Val Val Val Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val Ile
210 215 220
acc aag gtg gag acg ctg agc ccc gag gga gcg ctg cag gcc agt ccg 1141
Thr Lys Val Glu Thr Leu Ser Pro Glu Gly Ala Leu Gln Ala Ser Pro
225 230 235 240
cgc agc gca tcc tcc acg ccc gca ggt tcc cca gac ggc tcg ctg ccg 1189
Arg Ser Ala Ser Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu Pro
245 250 255
gag cac cac gcc gcg gcg cct aac ggg ctg ccc ggc ttc agc gtg gag 1237
Glu His His Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val G1u
260 265 270
acc atc atg acg ctg cgc acg tcg cct ccg ggc ggc gat ctg agc cca 1285
Thr Ile Met Thr Leu Arg Thr Ser Pro Pro Gly Gly Asp Leu Ser Pro
275 280 285
gcg gcc gcg cgc gcc ggc ctg gtg gtg cca ccg ctg gca ctg cca tac 1333
Ala Ala Ala Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro Tyr
290 295 300
gcc gca gcg cca ccc gcc get tac acg cag ccg tgc gcg cag ggc ctg 1381
Ala Ala Ala Pro Pro Ala Ala Tyr Thr Gln Pro Cys Ala Gln Gly Leu
305 310 315 320
gag get gcg ggc tcc gcg ggc tac cag tgc agt atg cgg get atg agt 1429
Glu Ala Ala Gly Ser Ala Gly Tyr Gln Cys Ser Met Arg Ala Met Ser
325 330 335
ctg tac acc ggg gcc gag cgg ccc gcg cac gtg tgc gtt ccg ccc gcg 1477
Leu Tyr Thr Gly Ala Glu Arg Pro Ala His Val Cys Val Pro Pro Ala
340 345 350
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
17
ctg gac gag get ctg tcg gac cac ccg agc ggc ccc ggc tcc ccg ctc 1525
Leu Asp Glu Ala Leu Ser Asp His Pro Ser Gly Pro Gly Ser Pro Leu
355 360 365
ggc gcc ctc aac ctc gca gcg ggt cag gag ggc gcg ttg ggg gcc tcg 1573
Gly Ala Leu Asn Leu Ala Ala Gly Gln Glu Gly Ala Leu Gly Ala Ser
370 375 380
ggt cac cac cac cag Cat CdC ggc cac ctC CaC ccg cag gcg CCa ccg 1621
Gly His His His Gln His His Gly His Leu His Pro Gln Ala Pro Pro
385 390 395 400
CCC gcc ccg Cag CCC CCt CCC gCg CCg Cag CCC gCC aCC Cag gCC aCC 1669
Pro Ala Pro Gln Pro Pro Pro Ala Pro Gln Pro Ala Thr Gln Ala Thr
405 410 415
tcc tgg tat ctg aac cac ggc ggg gac ctg agc cac ctc ccc ggc cac 1717
Ser Trp Tyr Leu Asn His Gly Gly Asp Leu Ser His Leu Pro Gly His
420 425 430
acg ttt gca acc caa cag caa act ttc ccc aac gtc cgg gag atg ttc 1765
Thr Phe Ala Thr Gln Gln Gln Thr Phe Pro Asn Val Arg Glu Met Phe
435 440 445
aac tcg cac cgg cta gga ctg gac aac tcg tcc ctc ggg gag tcc cag 1813
Asn Ser His Arg Leu Gly Leu Asp Asn Ser Ser Leu Gly Glu Ser Gln
450 455 460
gtg agc aat gcg agc tgt cag ctg ccc tat cga get acg ccg tcc ctc 1861
Val Ser Asn Ala Ser Cys Gln Leu Pro Tyr Arg Ala Thr Pro Ser Leu
465 470 475 480
tac cgc cac gca gcc ccc tac tct tac gac tgc acc aaa tac tga 1906
Tyr Arg His A1a Ala Pro Tyr Ser Tyr Asp Cys Thr Lys Tyr
485 490 495
ggctgtccag tccgctccag ccccaggacc gcaccggctt cgcctcctcc atgggaacct 1966
tcttcgacgg agccgcagaa agcgacggaa agcgcccctc tctcagaacc aggagcagag 2026
agctccgtgc aactcgcagg taacttatcc gcagctcagt ttgagatctc agcgagtccc 2086
tctaaggggg atgcagccca gcaaaacgaa atacagattt tttttttaat tccttcccct 2146
acccagatgc tgcgcctgct cccttggggc ttcatagatt agcttatgga ccaaacccat 2206
agggacccct aatgacttct gtggagattc tccacgggcg caagaggtct ctccggataa 2266
ggtgccttct gtaaacgagt gcggatttgt aaccaggcta ttttgttctt gcccagagcc 2326
tttaatataa tatttaaagt tgtgtccact ggataaggtt tcgtcttgcc caactgttac 2386
tgccaaattg aattcaagaa acgtgtgtgg gtcttttctc cccacgtcac catgataaaa 2446
taggtccctc cccaaactgt aggtctttta caaaacaaga aaataattta tttttttgtt 2506
gttgttggat aacgaaatta agtatcggat acttttaatt taggaagtgc atggctttgt 2566
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
18
acagtagatg ccatctgggg tattccaaaa acacaccaaa agactttaaa atttcaatct 2626
cacctgtgtt tgtcttatgt gatctcagtg ttgtatttac cttaaaataa acccgtgttg 2686
tttttctgcc caaaaaaaaa aaaaaa 2712
<210> 7
<211> 494
<212> PRT
<213> Mus musculus
<400> 7
Met Gln Ala Arg Tyr Ser Val Ser Asp Pro Asn Ala Leu Gly Val Val
1 5 10 15
Pro Tyr Leu Ser Glu Gln Asn Tyr Tyr Arg Ala Ala Gly Ser Tyr Gly
20 25 30
Gly Met Ala Ser Pro Met Gly Val Tyr Ser Gly His Pro Glu Gln Tyr
35 40 45
Gly Ala Gly Met Gly Arg Ser Tyr Ala Pro Tyr His His Gln Pro Ala
50 55 60
Ala Pro Lys Asp Leu Val Lys Pro Pro Tyr Ser Tyr Ile Ala Leu Ile
65 70 75 80
Thr Met Ala Ile Gln Asn Ala Pro Glu Lys Lys Ile Thr Leu Asn Gly
85 90 95
Tle Tyr Gln Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn Lys
100 105 110
Gln Gly Trp Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu Cys
115 120 125
Phe Val Lys Val Pro Arg Asp Asp Lys Lys Pro Gly Lys Gly Ser Tyr
130 135 140
Trp Thr Leu Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser Phe
145 150 155 160
Leu Arg Arg Arg Arg Arg Phe Lys Lys Lys Asp Val Pro Lys Asp Lys
165 170 175
Glu Glu Arg Ala His Leu Lys Glu Pro Pro Ser Thr Thr Ala Lys Gly
180 185 190
Ala Pro Thr Gly Thr Pro Val Ala Asp Gly Pro Lys Glu Ala Glu Lys
195 200 205
Lys Val Val Val Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val Ile
210 215 220
Thr Lys Val Glu Thr Leu Ser Pro Glu Gly Ala Leu Gln Ala Ser Pro
225 230 235 240
Arg Ser Ala Ser Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu Pro
245 250 255
Glu His His Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val Glu
260 265 270
Thr Ile Met Thr Leu Arg Thr Ser Pro Pro Gly Gly Asp Leu Ser Pro
275 280 285
Ala Ala Ala Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro Tyr
290 295 300
Ala Ala Ala Pro Pro Ala Ala Tyr Thr Gln Pro Cys Ala Gln Gly Leu
305 310 315 320
G1u Ala Ala Gly Ser Ala Gly Tyr Gln Cys Ser Met Arg Ala Met Ser
325 330 335
Leu Tyr Thr Gly Ala Glu Arg Pro Ala His Val Cys Val Pro Pro Ala
340 345 350
Leu Asp Glu Ala Leu Ser Asp His Pro Ser Gly Pro Gly Ser Pro Leu
355 360 365
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
19
Gly Ala Leu Asn Leu Ala Ala Gly Gln Glu Gly Ala Leu Gly Ala Ser
370 375 380
Gly His His His Gln His His Gly His Leu His Pro Gln Ala Pro Pro
385 390 395 400
Pro Ala Pro Gln Pro Pro Pro Ala Pro Gln Pro Ala Thr Gln Ala Thr
405 410 415
Ser Trp Tyr Leu Asn His Gly Gly Asp Leu Ser His Leu Pro Gly His
420 425 430
Thr Phe Ala Thr Gln Gln Gln Thr Phe Pro Asn Val Arg Glu Met Phe
435 440 445
Asn Ser His Arg Leu Gly Leu Asp Asn Ser Ser Leu Gly Glu Ser Gln
450 455 460
Val Ser Asn Ala Ser Cys Gln Leu Pro Tyr Arg Ala Thr Pro Ser Leu
465 470 475 480
Tyr Arg His Ala Ala Pro Tyr Ser Tyr Asp Cys Thr Lys Tyr
485 490
<210> 8
<211> 3289
<212> DNA
<213> Homo sapiens
<300>
<301> Miura, N
<303> Genomics
<304> 41
<306> 489-492
<307> 1997
<300>
<308> GenBank/Y08223
<309> 1997-05-14
<400> 8
gaattcggag gattaagttg tcagtcagca cgttgctacc ttcCCCtcta tgcactccgc 60
tgcctggctc ctcggcgggg agcgagggaa actcagtttg tagggtttac ctctaaaacc 120
tcgataggtt atccttgacg accccgagcc tggaaactcc ctgttgatga ttaattattt 180
gattaaataa gtataacatc caggagaggc cctgccattc caatccagcg cgtttgcttt 240
tgaatccatt acacctgggc ccccataatt aggaaatcta attattcgct tcatcactca 300
ttaataagaa aaatgtccca ggatcattgc tacttacaag gtctttggga gagatatttt 360
actctattaa tccattctat tttatatttc aaattgattt tttttaacag aggaaagtgg 420
ctatcttttt gttttgggca tgtgggccca ttcaccaaaa tgtgatcata aaataaattt 480
taataagata taacttttta aaaagttttc aagtgaagac ggagtcgccg cggaggccgg 540
ggcggcgggg tcttagagcc gacggattcc tgcgctcctc gccccgattg gcgccggact 600
cctctcagct gccgggtgat tggctcaaag ttccgggagg gggcgtggcc cgaggaaagt 660
aaaaactcgc tttcagcaag aagacttttg aaacttttcc caatccctaa aagggacttg 720
gcctcttttt ctgggctcag cggggcagcc gctcggaccc cggcgcgctg accctcgggg 780
ctgccgattc gctgggggct tggagagcct cctgcgcccc tcctcgcgcg ggccgagggt 840
ccaccttggt ccccaggccg CggCgtCtCC gctgggtccg cggccgcccg cctgcccgcg 900
ctgccgccgc cgggtcctgg agccagcgag gagcggggcc ggcgctgcgc ttgcccgggg 960
cgcgccctcc aggatgccga tccgcccggt ccgctgaaag cgcgcgcccc tgctcggccc 1020
gagcgacgac gaccgcgcac cctcgccccg gaggctgcca ggagaccggg gccgcccctc 1080
CCgCt CCCCt CCtCtCCCCC tCtggCtCtC tCgCgCtCtC tCgCtCtCag ggcccccctc 1140
gctcccccgg ccgcagtccg tgcgcgaggg cgccggcgag ccgtctcgga agcagcatgc 1200
aggcgcgcta ctccgtgtcc gaccccaacg ccctgggagt ggtgccctac ctgagcgagc 1260
agaattacta ccgggctgcg ggcagctacg gcggcatggc cagccccatg ggcgtctatt 1320
CCggCCaCCC ggagcagtac agcgcgggga tgggccgctc ctacgcgccc taccaccacc 1380
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
accagcccgc ggcgcctaag gacctggtga agccgcccta cagctacatc gcgctcatca 1440
ccatggccat ccagaacgcg cccgagaaga agatcacctt gaacggcatc taccagttca 1500
tcatggaccg cttccccttc taccgggaga acaagcaggg ctggcagaac agcatccgcc 1560
acaacctctc gctcaacgag tgcttcgtca aggtgccccg cgacgacaag aagcccggca 1620
agggcagtta ctggaccctg gacccggact cctacaacat gttcgagaac ggcagcttcc 1680
tgcggcgccg gcggcgcttc aaaaagaagg acgtgtccaa ggagaaggag gagcgggccc 1740
acctcaagga gccgcccccg gcggcgtcca agggcgcccc ggccaccccc cacctagcgg 1800
acgcccccaa ggaggccgag aagaaggtgg tgatcaagag cgaggcggcg tccccggcgc 1860
tgccggtcat caccaaggtg gagacgctga gccccgagag cgcgctgcag ggcagcccgc 1920
gcagcgcggc ctccacgccc gccggctccc ccgacggttc gctgccggag caccacgccg 1980
cggcgcccaa cgggctgcct ggcttcagcg tggagaacat catgaccctg cgaacgtcgc 2040
cgccgggcgg agagctgagc ccgggggccg gacgcgcggg cctggtggtg ccgccgctgg 2100
cgctgccata cgccgccgcg CCgCCCgCCg cctacggcca gccgtgcgct cagggcctgg 2160
aggccggggc cgccgggggc taccagtgca gcatgcgagc gatgagcctg tacaccgggg 2220
ccgagcggcc ggcgcacatg tgcgtcccgc ccgccctgga cgaggccctc tcggaccacc 2280
cgagcggccc cacgtcgccc ctgagcgctc tcaaCCtCgC CgCCggCCag,gagggCgCgC 2340
tCgCCgCCaC gggccaccac caccagcacc acggccacca ccacccgcag gcgccgccgc 2400
ccccgccggc tccccagccc cagccgacgc cgcagcccgg ggccgccgcg gcgcaggcgg 2460
cctcctggta tctcaaccac agcggggacc tgaaccacct ccccggccac acgttcgcgg 2520
cccagcagca aactttcccc aacgtgcggg agatgttcaa ctcccaccgg ctggggattg 2580
agaactcgac cctcggggag tcccaggtga gtggcaatgc cagctgccag ctgccctaca 2640
gatccacgcc gcctctctat cgccacgcag ccccctactc ctacgactgc acgaaatact 2700
gacgtgtccc gggacctccc Ct CCCCggCC CgCtCCggCt tCgCttCCCa gccccgaccc 2760
aaccagacaa ttaaggggct gcagagacgc aaaaaagaaa caaaacatgt ccaccaacct 2820
tttctcagac ccgggagcag agagcgggca cgctagcccc cagccgtctg tgaagagcgc 2880
aggtaacttt aattcgccgc cccgtttctg ggatcccagg aaacccctcc aaagggacgc 2940
agcccaacaa aatgagtatt ggtcttaaaa tccccctccc ctaccaggac ggctgtgctg 3000
tgctcgacct gagctttcaa aagttaagtt atggacccaa atcccatagc gagcccctag 3060
tgactttctg taggggtccc cataggtgta tgggggtctc tatagataat atatgtgctg 3120
tgtgtaattt taaatttctc caaccgtgct gtacaaatgt gtggatttgt aatcaggcta 3180
ttttgttgtt gttgttgttg ttcagagcca ttaatataat atttaaagtt gagttcactg 3240
gataagtttt tcatcttgcc caaccatttc taactgccaa attgaattc 3289
<210> 9
<211> 1506
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(1506)
<300>
<308> GenBank/NM_005251
<309> 1999-12-23
<400> 9
atg cag gcg cgc tac tcc gtg tcc gac ccc aac gcc ctg gga gtg gtg 48
Met Gln Ala Arg Tyr Ser Val Ser Asp Pro Asn Ala Leu Gly Val Val
1 5 10 15
ccc tac ctg agc gag cag aat tac tac cgg get gcg ggc agc tac ggc 96
Pro Tyr Leu Ser Glu Gln Asn Tyr Tyr Arg Ala Ala Gly Ser Tyr Gly
20 25 30
ggc atg gcc agc ccc atg ggc gtc tat tcc ggc cac ccg gag cag tac 144
Gly Met Ala Ser Pro Met Gly Val Tyr Ser Gly His Pro Glu Gln Tyr
35 40 45
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
21
agc gcg ggg atg ggc cgc tcc tac gcg ccc tac cac cac cac cag ccc 192
Ser Ala Gly Met Gly Arg Ser Tyr Ala Pro Tyr His His His Gln Pro
50 55 60
gcg gcg cct aag gac ctg gtg aag ccg ccc tac agc tac atc gcg ctc 240
Ala Ala Pro Lys Asp Leu Val Lys Pro Pro Tyr Ser Tyr Ile Ala Leu
65 70 75 80
atc acc atg gcc atc cag aac gcg ccc gag aag aag atc acc ttg aac 288
Ile Thr Met Ala Ile Gln Asn Ala Pro Glu Lys Lys Ile Thr Leu Asn
85 90 95
ggc atc tac cag ttc atc atg gac cgc ttc ccc ttc tac cgg gag aac 336
Gly Ile Tyr G1n Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn
100 105 110
aag cag ggc tgg cag aac agc atc cgc cac aac ctc tcg ctc aac gag 384
Lys Gln Gly Trp Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu
115 120 125
tgc ttc gtc aag gtg ccc cgc gac gac aag aag ccc ggc aag ggc agt 432
Cys Phe Val Lys Val Pro Arg Asp Asp Lys Lys Pro Gly Lys Gly Ser
130 135 140
tac tgg acc ctg gac ccg gac tcc tac aac atg ttc gag aac ggc agc 480
Tyr Trp Thr Leu Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser
145 150 155 160
ttc ctg cgg cgc cgg cgg cgc ttc aaa aag aag gac gtg tcc aag gag 528
Phe Leu Arg Arg Arg Arg Arg Phe Lys Lys Lys Asp Val Ser Lys Glu
165 170 175
aag gag gag cgg gcc cac ctc aag gag ccg ccc ccg gcg gcg tcc aag 576
Lys Glu Glu Arg Ala His Leu Lys Glu Pro Pro Pro Ala Ala Ser Lys
180 185 190
ggc gCC CCg gCC aCC CCC CaC Cta gcg gac gcc ccc aag gag gcc gag 624
Gly Ala Pro Ala Thr Pro His Leu Ala Asp Ala Pro Lys Glu Ala Glu
195 200 205
aag aag gtg gtg atc aag agc gag gcg gcg tcc ccg gcg ctg ccg gtc 672
Lys Lys Val Val Ile Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val
210 215 220
atc acc aag gtg gag acg ctg agc ccc gag agc gcg ctg cag ggc agc 720
Ile Thr Lys Val Glu Thr Leu Ser Pro Glu Ser Ala Leu Gln Gly Ser
225 230 235 240
ccg cgc agc gcg gcc tcc acg ccc gcc ggc tcc ccc gac ggt tcg ctg 768
Pro Arg Ser Ala Ala Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu
245 250 255
ccg gag cac cac gcc gcg gcg ccc aac ggg ctg cct ggc ttc agc gtg 816
Pro Glu His His Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val
260 265 270
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
22
gag aac atc atg acc ctg cga acg tcg ccg ccg ggc gga gag ctg agc 864
Glu Asn Ile Met Thr Leu Arg Thr Ser Pro Pro Gly Gly Glu Leu Ser
275 280 285
ccg ggg gcc gga cgc gcg ggc ctg gtg gtg ccg ccg ctg gcg ctg cca 912
Pro Gly Ala Gly Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro
290 295 300
tac gcc gcc gcg ccg CCC gcc gcc tac ggc cag ccg tgc get cag ggc 960
Tyr Ala Ala Ala Pro Pro Ala Ala Tyr Gly Gln Pro Cys Ala Gln Gly
305 310 315 320
ctg gag gcc ggg gcc gcc ggg ggc tac cag tgc agc atg cga gcg atg 1008
Leu Glu Ala Gly Ala Ala Gly Gly Tyr Gln Cys Ser Met Arg Ala Met
325 330 335
agc ctg tac acc ggg gcc gag cgg ccg gcg cac atg tgc gtc ccg ccc 1056
Ser Leu Tyr Thr Gly Ala Glu Arg Pro Ala His Met Cys Val Pro Pro
340 345 350
gcc ctg gac gag gcc ctc tcg gac cac ccg agc ggc ccc acg tcg ccc 1104
Ala Leu Asp Glu Ala Leu Ser Asp His Pro Ser Gly Pro Thr Ser Pro
355 360 365
ctg agc get ctc aac ctc gcc gcc ggc cag gag ggc gcg ctc gcc gcc 1152
Leu Ser Ala Leu Asn Leu Ala Ala Gly Gln Glu Gly Ala Leu Ala Ala
370 375 380
acg ggc cac cac cac cag CaC cac ggc cac cac cac ccg cag gcg ccg 1200
Thr Gly His His His Gln His His Gly His His His Pro Gln Ala Pro
385 390 395 400
CCg CCC CCg ccg get CCC Cag CCC Cag CCg acg ccg cag CCC ggg gcc 1248
Pro Pro Pro Pro Ala Pro Gln Pro Gln Pro Thr Pro Gln Pro Gly Ala
405 410 415
gcc gcg gcg cag gcg gcc tcc tgg tat ctc aac cac agc ggg gac ctg 1296
Ala Ala Ala Gln Ala Ala Ser Trp Tyr Leu Asn His Ser Gly Asp Leu
420 425 430
aac cac ctc ccc ggc cac acg ttc gcg gcc cag cag caa act ttc ccc 1344
Asn His Leu Pro Gly His Thr Phe Ala Ala Gln Gln Gln Thr Phe Pro
435 440 445
aac gtg cgg gag atg ttc aac tcc cac cgg ctg ggg att gag aac tcg 1392
Asn Val Arg Glu Met Phe Asn Ser His Arg Leu Gly Ile Glu Asn Ser
450 455 460
acc ctc ggg gag tcc cag gtg agt ggc aat gcc agc tgc cag ctg ccc 1440
Thr Leu Gly Glu Ser Gln Val Ser Gly Asn Ala Ser Cys Gln Leu Pro
465 470 475 480
tac aga tcc acg ccg cct ctc tat cgc cac gca gcc ccc tac tcc tac 1488
Tyr Arg Ser Thr Pro Pro Leu Tyr Arg His Ala Ala Pro Tyr Ser Tyr
485 490 495
gac tgc acg aaa tac tga 1506
Asp Cys Thr Lys Tyr
500
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
23
<210> 10
<211> 501
<212> PRT
<213> Homo Sapiens
<400> 10
Met Gln Ala Arg Tyr Ser Val Ser Asp Pro Asn Ala Leu Gly Val Val
1 5 10 15
Pro Tyr Leu Ser G1u Gln Asn Tyr Tyr Arg Ala Ala Gly Ser Tyr Gly
20 25 30
Gly Met Ala Ser Pro Met Gly Val Tyr Ser Gly His Pro Glu G1n Tyr
35 40 45
Ser Ala Gly Met Gly Arg Ser Tyr Ala Pro Tyr His His His Gln Pro
50 55 60
Ala Ala Pro Lys Asp Leu Val Lys Pro Pro Tyr Ser Tyr Ile Ala Leu
65 70 75 80
Ile Thr Met Ala Ile Gln Asn Ala Pro Glu Lys Lys Ile Thr Leu Asn
85 90 95
Gly Ile Tyr Gln Phe Ile Met Asp Arg Phe Pro Phe Tyr Arg Glu Asn
100 105 110
Lys Gln Gly Trp Gln Asn Ser Ile Arg His Asn Leu Ser Leu Asn Glu
115 120 125
Cys Phe Val Lys Val Pro Arg Asp Asp Lys Lys Pro Gly Lys Gly Ser
130 135 140
Tyr Trp Thr Leu Asp Pro Asp Ser Tyr Asn Met Phe Glu Asn Gly Ser
145 l50 155 160
Phe Leu Arg Arg Arg Arg Arg Phe Lys Lys Lys Asp Val Ser Lys Glu
165 170 175
Lys Glu Glu Arg Ala His Leu Lys Glu Pro Pro Pro Ala Ala Ser Lys
180 185 190
Gly Ala Pro Ala Thr Pro His Leu Ala Asp Ala Pro Lys Glu Ala Glu
195 200 205
Lys Lys Val Val Ile Lys Ser Glu Ala Ala Ser Pro Ala Leu Pro Val
210 215 220
Ile Thr Lys Val Glu Thr Leu Ser Pro Glu Ser Ala Leu Gln Gly Ser
225 230 235 240
Pro Arg Ser Ala Ala Ser Thr Pro Ala Gly Ser Pro Asp Gly Ser Leu
245 250 255
Pro Glu His His Ala Ala Ala Pro Asn Gly Leu Pro Gly Phe Ser Val
260 265 270
Glu Asn Ile Met Thr Leu Arg Thr Ser Pro Pro Gly Gly Glu Leu Ser
275 280 285
Pro Gly Ala Gly Arg Ala Gly Leu Val Val Pro Pro Leu Ala Leu Pro
290 295 300
Tyr A1a Ala Ala Pro Pro Ala Ala Tyr Gly Gln Pro Cys Ala Gln Gly
305 310 315 320
Leu Glu Ala Gly Ala Ala Gly Gly Tyr Gln Cys Ser Met Arg Ala Met
325 330 335
Ser Leu Tyr Thr Gly Ala Glu Arg Pro Ala His Met Cys Val Pro Pro
340 345 350
Ala Leu Asp Glu Ala Leu Ser Asp His Pro Ser Gly Pro Thr Ser Pro
355 360 365
Leu Ser Ala Leu Asn Leu Ala Ala Gly Gln Glu Gly Ala Leu Ala Ala
370 375 380
Thr Gly His His His Gln His His Gly His His His Pro Gln Ala Pro
385 390 395 400
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
24
Pro Pro Pro Pro Ala Pro Gln Pro Gln Pro Thr Pro Gln Pro Gly Ala
405 410 415
Ala Ala Ala Gln Ala Ala Ser Trp Tyr Leu Asn His Ser Gly Asp Leu
420 425 430
Asn His Leu Pro Gly His Thr Phe Ala Ala Gln Gln Gln Thr Phe Pro
435 440 445
Asn Val Arg Glu Met Phe Asn Ser His Arg Leu Gly Ile Glu Asn Ser
450 455 460
Thr Leu Gly Glu Ser Gln Val Ser Gly Asn Ala Ser Cys Gln Leu Pro
465 470 475 480
Tyr Arg Ser Thr Pro Pro Leu Tyr Arg His Ala Ala Pro Tyr Ser Tyr
485 490 495
Asp Cys Thr Lys Tyr
500
<210> 11
<211> 327
<212> DNA
<213> Homo sapiens
<300>
<308> GenBankjAW271272
<309> 2000-01-03
<300>
<301> Strausberg, Robert
<303> Trends Genet.
<304> 16
<305> 3
<306> 103-106
<307> 2000
<400> 11
ttttttttac attttcgtct tctgttcttg tgattggaaa taagtggcac gCCCCattgC 60
cttctagtcg cctccccgaa gcgaagaggc cgaagcgaag aggcctggtg ggttgtctca 120
acatcctttt gctgagaatc gaatacgcag ccgatgaaca gccaggaagg gtgcaaggaa 180
accttgaacg gcatctacca gttcatcatg gaccgcttcc ccttctaccg ggagaacaag 240
cagggctggc agaacagcat ccgccacaac ctctcgctca acgagtgctt cgtcaaggtg 300
ccccgcgacg acaagaagcc cggcaag 327
<210> 12
<211> 147
<212> DNA
<213> Homo sapiens
<300>
<308> GenBank/AW793237
<309> 2000-05-16
<300>
<301> Dias Neto, E
<303> Proc. Natl. Acad. Sci. U.S.A.
<304> 97
<306> 3491-3496
<307> 2000
CA 02421620 2003-03-05
WO 02/27008 PCT/SE01/02098
<400> 12
ccgtctgaga atcgaatacg cagccgatga acagccagga agggtgcaag gaaaccttga 60
acggcatcta ccagttcatc atggaccgct tccccttcta ccgggagaac aagcagggct 120
ggcagaacag catccgccac aacctct 147
<210> 13
<211> 878
<212> DNA
<213> Homo Sapiens
<400> 13
gtCtCtCtCa CCttttCtgt cttgatgaga cgaatttctt tCCCCtCCCC ttttCCtttC 60
tttggggcgg gggagggtgg ataatatatt gggcgactcg atttaggtgt ttgtttgttt 120
gtttgtttgt ttccccagat gacattggtt taaaccggga cacccttgtg aatacaaacg 180
taggcagcaa ctgccatttt ggaatttatt ttttcatagt ccttagctat tttaggtttt 240
gctgtgataa agctgtttct ctctctctct ctctctcaca cacacacaca cacccctcgt 300
aaaagcagag taaataatat tcctccagga agcctacagg ctgaggagtg tttcttgatc 360
aatagtttgc atttccagta aaatcgtgac acgaactcag tgtgcctgtc atgcgctgca 420
ggagaagggc actttttgct agtccttttt tttttttaag ctagatgcgg aaatactagc 480
ttattaaaaa taataaagtc atggtgggag tttagggttg gggcagaaag ctcaaatcat 540
ttgcctgtga gctgagaact gggcagcttt attttacttt gtttcaaaga aagaagaaaa 600
aggatcaggt tagaaaaaga gcccagaata ctcataaaaa caatgtttca gaagtggaat 660
attcaaggta aaggaacctg atttgtagct tccctttggc tttgaattga tcaggagaca 720
aagataatgc atctacattt tcgtcttctg ttcttttatt ggaaataagt ggcacgcccc 780
attgccttct agtcgcctcc ccgaagcgaa gaggccgaag cgaagaggcc tggtgggttg 840
tctcaacatc cttttgctga gaatcgaata cgcagccg 878
