Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
USE OF CYR61 IN THE TREATMENT AND DIAGNOSIS
OF HUMAN UTERINE LEIOMYOMAS
PRIORITY
This application claims priority under 35 U.S.C. ~ 119 from provisional patent
application Serial No. 60/236,887, filed September 29, 2001; which is hereby
incorporated by
reference in its entirety.
FIELD OF THE INVENTION
The present invention relates to methods of inhibiting uterine leiomyoma
proliferation and preventing fomnation of uterine leiomyomas, compounds and
compositions
that stimulate induction of the Cy~61 gene and compounds that increase Cyr61
activity. The
present invention also relates to methods of screening ligands that regulate
Cyr61 protein
expression. The invention further relates to methods of diagnosing patients
with uterine
leiomyomas associated with a downregulation of Cyr61 expression. The invention
also
describes antibodies and pharmaceutical compositions related thereto.
Transgenic animals
are also contemplated by the present invention.
BACKGROUND OF THE INVENTION
Uterine leiomyomas, or fibroids, are the most common tumors of the
reproductive
tract afflicting women between the ages of 30-55 years. Little is known of the
etiology and
mechanisms of pathogenesis in leiomyomas. Uterine leiomyomas are typically
defined as benign
tumors of the myometrial smooth muscle tissue. Leiomyoma cells are believed to
originate from
dedifferentiated smooth muscle cells in the myometrium that exhibit elevated
mitotic activity as
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
a result of clonal expansion (Rein and Nowak, Sem. Reprod. Endocrinol.,
1992,10:310-319).
Although considered to be a benign disease, uterine leiomyomas account for
greater than 30%
of all hysterectomies performed in the United States and pose a major health
concern among
women (framer, Sem. Reprod. Endocrinol., 1992, 10:320-324.).
An emerging group of growth factor-regulated immediate-early genes that play
a role in development, cell proliferation, and tumorogenesis belongs to the
CCN
(CTGF/Cyr61/CeflO/NOVH)family.
AlICCNproteins(1)displayalughdegreeofconservation
among family members and across species; (2) are cysteine-rich and
structurally similar to
extracellular matrix-associated molecules; (3) are composed of multifunctional
modular domains;
and (4) have been shown to mediate a variety of cell functions such as cell
adhesion, cell
migration, mitogenesis, cell survival, and differentiation (Law and Lam,
Experimental Cell Res,
1999, 248:44).
Cyr61 is a secreted, cysteine-rich heparin-binding CCN protein that associates
with the cell surface and the extracellular matrix. Specifically, Cyr61 has
been shown to be
involved in developmentally regulated processes including angiogenesis and
chondrogenesis.
The Cyr61 protein possesses many biochemical features that resemble the Wnt-1
protein and
other growth factors (Yang and Law, Cell Growth & DifF, 1991, 2:351). The
human Cyr61
protein is 381 amino acids in length with a molecular mass of about 42 kilo-
daltons (kDa). See
Figure 1 and PCT Application No. WO 97/339950. The human Cyr61 gene is
localized in the
short arm of chromosome 1 (1p22-31) (Charles et al., Oncogene, 1991, 8:23; Jay
et al.,
Oncogene, 1997,14:1753), and the gene was identified by differential
hybridization screening
of a cDNA library of senun-stimulated BALB/c3T3 fibroblasts (See Figure 2 and
Law and
Nathans, P.N.A.S., 1987, 84:1182). Comparison of the human and marine Cyr61
sequences
indicates that they are 91% similar (PCT Publication No. WO 97/339950). It was
previously
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-3-
shown that Cyr61 protein expression is upregulated in stage II invasive ductal
carcinoma breast
cancer (LT.S. Provisional Patent Application 60/213,182, filed June 21, 2000).
Integrins are oc: (3 heterodimeric transmembrane receptors that are non-
covalently
associated in the presence of divalent cations. Several integrins, but not
all, interact with
adhesive ligands through recognition of a canonical Arg-Gly-Asp (RGD) binding
motif present
in a subset of extracellular matrix proteins and can initiate signaling
pathways commonly shared
by growth factors or cytokines. Cyr6l, which lacks the RGD motif, has been
shown to bind
directly to two integrins: oc~(33 and a111,(33 (Kireeva et al., J. Biol.
Chem.,1998, 273:3090; Babic
et al., Mol. Cell. Biol.,1999,19:2958; Jedsadayanmata et al., J. Biol.
Chem.,1999, 274:24321).
Integrin a~(33 has been shown to be directly involved in angiogenesis ih vivo
and regulate tumor
metastasis. Therefore, the effects of Cyr61 as an angiogenic factor is
proposed to be mediated
in part by a~~33. Recent studies have shown that human platelets bind to Cyr61
in an activation
dependent manner via ocm,~33 (Jedsadayamnata et al., 1999). Murine Cyr61 has
been shown to
also bind x6(31, an integrin primarily expressed in fibroblasts, and heparin
sulfate proteoglycans
in a co-receptor fashion (Chen et al., J. Biol. Chem., 2000, 275:24953).
Binding to both
receptors is critical for fibroblast adhesion ih vitr°o. Mutagenesis
studies has identified the C-
terminal domain (a.a. 250-3 54) as absolutely required for binding to x6[31.
Thus, it is evident that
Cyr61 is an integrin ligand based on its location within the extracellular
matrix and its ability to
directly associate with them.
~ The present inventors have found that detection and regulation of Cyr61
expression and activities is useful in the prevention, diagnosis, and
treatment of uterine
leiomyomas.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-4-
SUMMARY OF THE INVENTION
The present invention provides methods for inhibiting uterine leiomyoma
proliferation. Methods can comprise increasing the level of mRNA encoding
Cyr6l, increasing
translation of Cyr61 mRNA, upregulating expression of Cyr61 protein,
increasing the activity
of Cyr61 protein, or increasing the level of Cyr61 protein in leiomyoma
tissues. The present
invention also provides methods for preventing uterine leiomyoma in normal
myometrial tissue.
Methods can comprise maintaining a uterine leiomyoma preventing level of mRNA
encoding
Cyr6l, translation activity of Cyr6l, expression of Cyr61 protein, activity of
Cyr61 protein, or
affinity of Cyr61 for basic fibroblast growth factor or heparin binding
epidermal growth factor.
These methods include, but are not limited to, delivery of the Cyr61 protein
to the
cell, adminstration of an expression vector encoding the Cyr61 protein, and
administration of
a therapeutically effective amount of a compound that modulates binding of
Cyr61 to
intracellular proteins (e.g., integrin receptors).
Also provided are antibodies that recognize a portion or all of the Cyr61
protein.
These antibodies may be polyclonal or monoclonal, chimeric or humanized,
and/or anti-idiotypic.
Preferably, these antibodies do not recognize or bind proteins that belong to
the same protein
family as Cyr6l.
The present invention further provides methods for diagnosing uterine
leiomyomas. Methods include those which comprise comparing the level of Cyr 61
in a cell in
suspect tissue to the level of Cyr61 in normal myometrium tissue that is
autologous to the suspect
tissue. A lower level of Cyr61 in the suspect tissue than in the normal tissue
indicates the
presence of uterine leiomyoma in the suspect tissue. The level of Cyr61 in
this method can be
determined by exposing the suspect and normal tissue to a Cyr61 antibody which
recognizes the
Cyr61 protein, and then comparing the amount of antibody bound by each tissue.
A lower level
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-5-
of bound antibody in the suspect tissue than in the normal tissue indicates
the presence of uterine
leiomyoma in the suspect tissue.
Methods for screening compounds that inhibit or prevent proliferation of
uterine
leiomyoma also are provided. These methods comprise comparing the amount of
Cyr61
expressed by leiomyoma cells exposed to a compound, to the amount of Cyr61
expressed by
uterine leiomyomas not exposed to the compound. A greater level of Cyr61
expressed in cells
exposed to the compound compared to cells not exposed to the compound
indicates that the
compound may inhibit or prevent uterine leiomyomas.
Transgenic non-human animals that have a uterus and that comprise DNA such
as, for example, human DNA, which can be induced to overexpress Cyr61 in the
uterus also are
contemplated by the present invention.
Methods for detecting the presence of uterine leiomyomas are also contemplated
in the present invention. These methods comprise comparing the level of Cyr61
mRNA or
protein from suspect uterine leiomyoma tissue to the level of Cyr61 mRNA or
protein from
normal myometrium tissue. A lower level of Cyr61 mRNA or protein in the
suspect uterine
leiomyoma tissue compared to the normal myometrium tissue indicates the
presence of uterine
leiomyoma.
A kit for diagnosing uterine leiomyoma is contemplated by the present
invention.
The kit includes an antibody that recognizes or binds to Cyr 61.
The present invention further contemplates expression vectors comprising the
nucleic acid depicted in Figure 6 operably associated with an expression
control sequence. In
specific embodiments, the expression control sequence may be an estrogen
response element or
a basic fibroblast growth factor response element. The heparin binding
epidermal growth factor
also regulates Cyr61 expression. Phas~rnaceutical compositions comprising the
vector or the
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-6-
protein and methods for preventing and inhibiting proliferation of uterine
leiomyomas using the
pharmaceutical compositions also are contemplated.
The present invention provides methods for inhibiting uterine leiomyomas
proliferation. Methods can comprise administering to a subj ect in need of
treatment an amount
of a compound effective to stimulate the synthesis of mRNA encoding Cyr6l, the
translation of
Cyr61 mRNA, the expression of Cyr6l, or the activity of Cyr61 protein. The
present invention
also contemplates increasing the total level of Cyr61 protein in leiomyoma
tissues. In certain
embodiments, compounds that inhibit uterine leiomyomas also downregulate the
synthesis of IGF
I and/or IGF II mRNA, translation of IGF I and/or IGF II mRNA, expression of
IGF I and/or IGF
II protein, the activity of IGF I and/or IGF II, the synthesis of basic
fibroblast growth factor
and/or heparin binding epidermal growth factor mRNA, translation of basic
fibroblast growth
factor and/or hepaxin binding epidermal growth factor mRNA, expression of
basic fibroblast
growth factor and/or heparin binding epidermal growth factor protein, or the
activity of basic
fibroblast growth factor and/or hepaxin binding epidermal growth factor.
The invention further provides methods for preventing uterine leiomyoma in
myometrial tissue. Methods include those which comprise administering to a
subject in need of
preventing uterine leiomyoma in myometrial tissue an amount of a compound
effective to
maintain a uterine leiomyoma preventing level of of mRNA encoding Cyr6l,
translation activity
of Cyr61 mRNA, expression of Cyr6l, or activity of Cyr61 protein in myometrial
tissues. In
certain embodiments, the compound decreases estrogen receptor activity.
The present invention further provides methods of preventing proliferation of
uterine leiomyomas, where the method comprises administering to a subject an
amount of a
compound effective to increase the affinity of Cyr61 protein for basic
fibroblast growth factor
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
or heparin binding epidermal growth factor. In certain embodiments, the
compound decreases
estrogen receptor activity.
Methods for preventing uterine leiomyomas also include those which comprise
administering to a subj ect in need of preventing uterine leiomyomas, an
amount of a compound
effective to also maintain a uterine leiomyoma preventing level of synthesis
of IGF I and/or IGF
II mRNA, translation of IGF I and/or IGF II mRNA, expression of IGF I and/or
IGF II protein,
or the activity of IGF I and/or IGF II. Methods for preventing uterine
leiomyomas include those
which comprise administering to a subj ect in need of preventing uterine
leiomyomas, an amount
of a compound also effective to maintain a uterine leiomyoma preventing level
of the synthesis
of basic fibroblast growth factor and/or heparin binding epidermal growth
factor mRNA,
translation of basic fibroblast growth factor and/or heparin binding epidermal
growth factor .
mRNA, expression of basic fibroblast growth factor and/or heparin binding
epidermal growth
factor protein, or the activity of basic fibroblast growth factor and/or
heparin binding epidermal
growth factor. In specific embodiments, synthesis of IGF I, IGF II, basic
fibroblast growth factor
and/or heparin binding epidermal growth factor mRNA is downregulated by
antisense nucleic
acids.
The present application also discloses methods to inhibiting or preventing
uterine
leiomyoma proliferation by administering to a subj ect a compound that
modulates Cyr61 binding
to integrin receptors.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1 (A)-(D). Identification of Cyr61 by RADE methodology and
confirmation by Northern Analysis. (A) Representative autoradiograph of 35S-
radiolabeled
cDNAs generated from total RNA ~ extracted from duplicate leiomyoma (L) and
matched
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
_g-
myometrial (M) tissues (n=4). (B) Representative northern blot of total RNA
isolated from
leiomyomas (L) and matched myometrial (M) tissues. Arrows indicate the
positions of the 2.4
kb major and the 3.5 lcb minor Cyr61 transcripts. (C) Membranes reprobed with
a 2.0 kb
radiolabeled mouse glyeraldehyde phosphate dehydrogenase (GAPDH) to verify
equivalent
sample loading. (D) Densimetric analysis of Cyr61 mRNA levels utilizing a
Molecular
Dynamics phosphorimager and image quantitation software. * Significant
decrease in levels
compared to myometrial controls.
Figures 2 (A)-(C). Analysis of Cyr61 protein expression in leiomyoma. (A)
Representative Western Blot of tissue protein extracts generated from
leiomyoma and matched
myometrial tissues. (B) Protein blots were subsequently reprobed with an anti-
actin monospecific
antibody to confirm equivalent protein loading. (C) Cyr61 protein levels
quantitated by
densitometric analysis utilizing a Biorad molecular imager. Values represent
the mean + SD for
10 patients. *Significant decrease in levels compared to myometrial controls.
Figures 3 (A)-(B). Differential expression of Cyr61 in multiple human tissues
(A) and human muscle tissue (B). Arrows indicate molecular weight markers in
kb.
Figures 4 (A)-(F). Suppression of Cyr61 expression in uterine leiomyoma
smooth muscle cells as determined by ih situ hybridization. Representative
dark field (A, B,
E and F) and bright field C and D) photomicrographs of the uterine myometrial
(A, C and E) and
leiomyoma (B, D and F) tissue sections. Arrows denote representative uterine
smooth muscle
cells that express Cyr61 transcripts (C). Sense radiolabeled cRNA probes gave
no signal above
background (E and F). Magnification = 200x (A, B, E and F) and 630x ~ and D).
Bars=15 ~.m
(A, B, E and F) and 5 ~,m C and D).
Figures 5 (A)-(G). Dysregulation of Cyr61 by 17(3-estradiol and basic
fibroblast growth factor (bFGF) ex vivo in leiomyomas. Figures (A)-(C)
represent fresh
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-9-
myometrial and figures (D)-(F) represent leiomyoma tissue specimens were
cultured ex vivo
either in the presence of ethanol vehicle, 10 nM 17(3-estradiol (E2), 10 nM
R5020, 10 ng/ml
bFGF, a combination of 10 nM EZ and 10 nM R5020,1 ~,M ICI 182,780, or a
combination of 10
nM EZ and 1 ~,M ICI 182,780. Membranes were reprobed with a GAPDH cDNA to
account for
equivalency in sample loading C and F). Arrows indicate the 2.4 kb major Cyr61
and 6.2 kb
ERa transcript. (G) represents calculated data. Values represent the mean + SD
for 8 patients.
*Significant increase in Cyr61 mRNA levels compared to untreated myometrial
tissues.
Figure 6. Nucleic acid sequence of Cyr6l.(SEQ ID NO:1)
Figure 7. Amino acid sequence of Cyr61 encoded by the nucleic acid
sequence of Figure 6. (SEQ ID N0:2; GenBank Accession Number AAB58319)
DETAILED DESCRIPTION OF THE INVENTION
The present invention describes methods of inhibiting uterine leiomyoma
proliferation, preventing uterine leiomyoma formation, diagnosing uterine
leiomyomas, and
screening for compounds which inhibit or prevent uterine leiomyomas. These
methods evaluate
or direct steroid and growth factor mediated regulation of Cy~61 transcription
and translation and
levels of Cyr61 protein in samples of interest. The present invention also
advantageously
provides for screening assays and kits. The assay system of the invention is
suitable for high
throughput screening, e.g., screening thousands of compounds per assay.
The present invention also provides Cyr61-specific antibodies, and related
methods of using these materials to detect the presence of Cyr61 proteins and
in screens for
agonists of Cyr61 for uterine leiomyomas.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-10-
General Definitions
The term "isolated" means that the referenced material is removed from the
environment in which it is normally found. Thus, an isolated biological
material can be free
of cellular components, i. e., components of the cells in which the material
is found or
produced. In the case of nucleic acid molecules, an isolated nucleic acid
includes a PCR
product, an isolated mRNA, a cDNA, or a restriction fragment. In another
embodiment, an
isolated nucleic acid is preferably excised from the chromosome in which it
may be found,
and more preferably is no longer joined to non-regulatory, non-coding regions,
or to other
genes, located upstream or downstream of the gene contained by the isolated
nucleic acid
molecule when found in the chromosome. In yet another embodiment, the isolated
nucleic
acid lacks one or more introns. Isolated nucleic acid molecules include
sequences inserted
into plasmids, cosmids, artificial chromosomes, and the like. Thus, in a
specific embodiment,
a recombinant nucleic acid is an isolated nucleic acid. An isolated protein
may be associated
with other proteins or nucleic acids, or both, with which it associates in the
cell, or with
cellular membranes if it is a membrane-associated protein. An isolated
organelle, cell, or
tissue is removed from the anatomical site in which it is found in an
organism. An isolated
material may be, but need not be, purified.
The term "purified" refers to material that has been isolated under conditions
that reduce or eliminate the presence of unrelated materials, i.e.,
contaminants, including
native materials from which the material is obtained. For example, a purified
protein is
preferably substantially free of other proteins or nucleic acids with which it
is associated in a
cell; a purified nucleic acid molecule is preferably substantially free of
proteins or other
unrelated nucleic acid molecules with which it can be found within a cell.
Purity can be
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-11-
evaluated by chromatography, gel electrophoresis, immunoassay, composition
analysis,
biological assay, and other methods known in the art.
A "sample" refers to a biological material which can be tested for the
presence
of Cyr61 protein or Cyr61 nucleic acids. Such samples can be obtained from
subjects, such
as humans and non-human animals, and include tissue, especially uterine
glands, biopsies,
blood and blood products; plural effusions; cerebrospinal fluid (CSF); ascites
fluid; and cell
culture.
The term "non-human animals" includes, without limitation, laboratory
animals such as mice, rats, rabbits, hamsters, guinea pigs, etc.; domestic
animals such as dogs
and cats; and, farm animals such as sheep, goats, pigs, horses, and cows.
The term "ability to elicit a response" includes the ability of a ligand to
agonize or antagonize receptor activity.
The term "transformed cell" refers to a modified host cell that expresses a
functional protein expressed from a vector encoding the protein of interest.
Any cell can be
used, but preferred cells are mammalian cells.
The term "assay system" is one or more collections of such cells, e.g., in a
microwell plate or some other culture system. To permit evaluation of the
effects of a test
compound on the cells, the number of cells in a single assay system is
sufficient to express a
detectable amounts of regulated Cyr61 mRNA or protein expression. The methods
of the
invention are particularly suitable for use in an assay system to test ligands
that modulate
transcription and translation of the Cy~61 gene.
A "test compound" is any molecule, such as, for example, an estrogen
compound, that can be tested for its ability to modulate Cyr61 expression
and/or activity.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-12-
The term "leiomyomas" refers to benign tumors composed of smooth muscle
and fibrous connective tissue. In a specific embodiment, the leiomyoma is
uterine
leiomyoma. Leiomyomas also may be referred to as fibroid tumors, fibromyomas,
fibromas,
fibroleiomyomas, fibroids, or myomas. The term "benign" refers to non-
cancerous growths.
The term "myometrium" or "myometrial layer" refers to the muscle layer of
the uterus.
Descriptions made herein relating to increasing the level of Cyr61 in an
organism or cell include, but are not limited to, methods that stimulate
transcription of Cy~61
DNA, stimulate translation of Cyr61 protein, stimulate processing of Cyr61
protein, modulate
binding of Cyr61 protein to cellular proteins (e.g., integrin receptors),
addition of exogenous
Cyr61 protein, or addition of vectors comprising nucleic acid sequences that
encode Cyr61
protein.
The Cyr61 of the present invention may be isolated, present, or detected in
various mammal sources, including mammal, e.g., human, bovine, porcine,
canine, and avian.
A preferred source of the present invention is human.
The term "inhibiting uterine leiomyoma proliferation" refers to decreasing the
rate of leiomyoma growth or fully stopping the growth. In a preferred
embodiment, the
decrease of leiomyoma growth is at least 20%, preferably at least 40%, and
more preferably at
least ~0%.
The term "uterine leiomyoma preventing level" refers to the amount needed to
inhibit formation of uterine leiomyoma in normal myometrial tissue.
The term "level" refers to a total amount per unit (e.g., cell) or a rate of
activity.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-13
The use of italics generally indicates a nucleic acid molecule (e.g., Cyr61
cDNA, gene, etc.); normal text generally indicates the polypeptide or protein.
Alternatively,
whether a nucleic acid molecule or a protein is indicated can be determined by
the content.
The term "amplification" of DNA refers to the use of polymerase chain
reaction (PCR) to increase the concentration of a particular DNA sequence
within a mixture
of DNA sequences. For a description of PCR see Saiki et al., Science, 239:487,
1988.
The term "sequence-specific oligonucleotides" refers to related sets of
oligonucleotides that can be used to detect allelic variations or mutations in
the Cyr61 gene.
The term "nucleic acid molecule" refers to the phosphate ester form of
ribonucleosides (RNA molecules) or deoxyribonucleosides (DNA molecules), or
any
phosphoester analogs, in either single stranded form, or a double-stranded
helix. Double
stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic
acid
molecule, and in particular DNA or RNA molecule, refers only to the primary
and secondary
structure of the molecule, and does not limit it to any particular tertiary
forms. Thus, this
term includes double-stranded DNA found, ihte~ alia, in lineax (e.g.,
restriction fragments) or
circular DNA molecules, plasmids, and chromosomes. In discussing the structure
of
particular double-stranded DNA molecules, sequences may be described according
to the
normal convention of giving only the sequence in the 5' to 3' direction along
the
nontranscribed strand of DNA (i.e., the strand having a sequence homologous to
the mRNA).
A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular
biological manipulation. Non-limiting examples of molecular biological
manipulation
include enzymatic phosphorylation, enzymatic de-phophorylation, enzymatic
digestion, and
ligation.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-14-
The terms "polynucleotide" or "nucleotide sequence" is a series of nucleotide
bases (also called "nucleotides") in DNA and RNA, and means any chain of two
or more
nucleotides. A nucleotide sequence typically carries genetic information,
including the
information used by cellular machinery to make proteins and enzymes. These
terms include
double or single stranded genomic and cDNA, RNA, any synthetic and genetically
manipulated polynucleotide, and both sense and anti-sense polynucleotide. This
includes
single- and double-stranded molecules, i.e., DNA-DNA, DNA-RNA and RNA-RNA
hybrids,
as well as "protein nucleic acids" (PNA) formed by conjugating bases to an
amino acid
backbone. This also includes nucleic acids containing modified bases, for
example thio-
uracil, thio-guanine and fluoro-uracil.
The polynucleotides may be flanked by natural regulatory (expression control)
sequences, or may be associated with heterologous sequences, including
promoters, internal
ribosome entry sites (IRES) and other ribosome binding site sequences,
enhancers, response
elements, suppressors, signal sequences, polyadenylation sequences, introns,
5'- and 3'- non-
coding regions, and the like. The nucleic acids may also be modified by many
means known
in the art. Non-limiting examples of such modifications include methylation,
"caps",
substitution of one or more of the naturally occurring nucleotides with an
analog, and
internucleotide modifications such as, for example, those with uncharged
linkages (e.g.,
methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.)
and with
charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).
Polynucleotides may
contain one or more additional covalently linked moieties, such as, for
example, proteins
(e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.),
intercalators (e.g.,
acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, iron,
oxidative metals,
etc.), and alkylators. The polynucleotides may be derivatized by formation of
a methyl or
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-15-
ethyl phosphotriester or an alkyl phosphoramidate linkage. Furthermore, the
polynucleotides
herein may also be modified with a label capable of providing a detectable
signal, either
directly or indirectly. Exemplary labels include radioisotopes, fluorescent
molecules, biotin,
and the like.
The term "host cell" means any cell of any organism that is selected,
modified,
transformed, grown, or used or manipulated in any way, for the production of a
substance by
the cell, for example the expression by the cell of a gene or RNA sequence, a
protein or an
enzyme. Host cells can further be used for screening or other assays, as
described ihfi°a.
Generally, a DNA sequence having instructions for a particular protein or
enzyme is "transcribed" into a corresponding sequence of RNA. The RNA sequence
in turn
is "translated" into the sequence of amino acids which form the protein or
enzyme. An
"amino acid sequence" is any chain of two or more amino acids. Each amino acid
is
represented in DNA or RNA by one or more triplets of nucleotides. Each triplet
forms a
codon, corresponding to an amino acid. The genetic code has some redundancy,
also called
degeneracy, meaning that most amino acids have more than one corresponding
codon.
A "coding sequence" or a sequence "encoding" an expression product, such as
a RNA, polypeptide, protein, or enzyme, is a nucleotide sequence that, when
expressed,
results in the production of that RNA, polypeptide, protein, or enzyme, i. e.,
the nucleotide
sequence encodes an amino acid sequence for that polypeptide, protein or
enzyme.
The term "gene", also called a "structural gene" means a DNA sequence that
codes for or corresponds to a particular sequence of amino acids which
comprise all or part of
one or more proteins or enzymes, and may or may not include regulatory DNA
sequences,
such as promoter sequences, which determine for example the conditions under
which the
gene is expressed. Some genes, which are not structural genes, may be
transcribed from
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-16-
DNA to RNA, but are not translated into an amino acid sequence. Other genes
may function
as regulators of structural genes or as regulators of DNA transcription.
A "promoter sequence" is a DNA regulatory region capable of binding a
secondary molecule which in a cell and initiating transcription of a coding
sequence.
A coding sequence is "under the control" or "operatively associated with" of
transcriptional and translational control sequences in a cell when RNA
polymerase transcribes
the coding sequence into mRNA, which is then trans-RNA spliced (if it contains
introns) and
translated into the protein encoded by the coding sequence.
The terms "express" and "expression" mean allowing or causing the
information in a gene or DNA sequence to become manifest, for example
producing a protein
by activating the cellular functions involved in transcription and translation
of a
corresponding gene or DNA sequence. A DNA sequence is expressed in or by a
cell to form
an "expression product" such as a protein. The expression product itself ,
e.g. the resulting
protein, may also be said to be "expressed" by the cell. An expression product
can be
characterized as intracellular, extracellular or secreted. The term
"intracellular" means
something that is inside a cell. The term "extracellular" means something that
is outside a
cell. A substance is "secreted" by a cell if it appears in significant measure
outside the cell,
from somewhere on or inside the cell.
The term "transfection" means the introduction of a foreign nucleic acid into
a
cell. The term "transformation" means the introduction of a "foreign" (i. e.
extrinsic or
extracellular) gene, DNA or RNA sequence to a host cell, so that the host cell
will express the
introduced gene or sequence to produce a desired substance, typically a
protein or enzyme
coded by the introduced gene or sequence. The introduced gene or sequence may
also be
called a "cloned" or "foreign" gene or sequence, may include regulatory or
control sequences,
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-17-
such as start, stop, promoter, signal, secretion, or other sequences used by a
cell's genetic
machinery. The gene or sequence may include nonfunctional sequences or
sequences with no
lcnowm function. A host cell that receives and expresses introduced DNA or RNA
has been
"transformed" and is a "transformant" or a "clone." The DNA or RNA introduced
to a host
cell can come from any source, including cells of the same genus or species as
the host cell,
or cells of a different genus or species.
The terms "vector", "cloning vector" and "expression vector" mean the vehicle
by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a
host cell, so
as to transform the host and promote expression (e.g. transcription and
translation) of the
introduced sequence. Vectors include plasmids, phages, viruses, etc.
A common type of vector is a "plasmid", which generally is a self contained
molecule of double-stranded DNA, usually of bacterial origin, that can readily
accept
additional (foreign) DNA and which can readily introduced into a suitable host
cell. A
plasmid vector often contains coding DNA and promoter DNA and has one or more
restriction sites suitable for inserting foreign DNA. A large number of
vectors, including
plasmid and fungal vectors, have been described for replication and/or
expression in a variety
of eukaryotic and prokaryotic hosts. Non-limiting examples include pI~K
plasmids
(Clonetech), pUC plasmids, pET plasmids (Novagen, Inc., Madison, WI), pRSET or
PREP
plasmids (Invitrogen, San Diego, CA), or pMAL plasmids (New England Biolabs,
Beverly,
MA), and many appropriate host cells, using methods disclosed or cited herein
or otherwise
known to those skilled in the relevant art. Recombinant cloning vectors will
often include
one or more replication systems for cloning or expression, one or more markers
for selection
in the host, e.g. antibiotic resistance, and one or more expression cassettes.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-1 ~-
A "cassette" refers to a DNA coding sequence or segment of DNA that codes
for an expression product that can be inserted into a vector at defined
restriction sites. The
cassette restriction sites are designed to ensure insertion of the cassette in
the proper reading
frame. Generally, foreign DNA is inserted at one or more restriction sites of
the vector DNA,
and then is carried by the vector into a host cell along with the
transmissible vector DNA. A
segment or sequence of DNA having inserted or added DNA, such as an expression
vector,
can also be called a "DNA construct."
The term "expression system" means a host cell and compatible vector under
suitable conditions, e.g. for the expression of a protein coded for by foreign
DNA carried by
the vector and introduced to the host cell. Common expression systems include
E. coli host
cells and plasmid vectors, insect host cells and Baculovi~us vectors, and
mammalian host
cells and vectors.
The term "heterologous" refers to a combination of elements not naturally
occurring. For example, heterologous DNA refers to DNA not naturally located
in the cell, or
in a chromosomal site of the cell. Preferably, the heterologous DNA includes a
gene foreign
to the cell. A heterologous expression regulatory element is a such an element
operatively
associated with a different gene than the one it is operatively associated
with in nature.
The term "autologous" refers a specimen that is derived from the same
individual. For example, autologous tissue refers to different tissue
specimens that obtained
from the same person. In a specific example, suspect uterine leiomyoma and
autologous
normal myometrium uterine refers to different uterine tissue samples obtained
from the same
individual.
The terms "mutant" and "mutation" mean any detectable change in genetic
material, e.g. DNA, or any process, mechanism, or result of such a change.
This includes
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-19-
gene mutations, in which the structure (e.g. DNA sequence) of a gene is
altered, any gene or
DNA arising from any mutation process, and any expression product (e.g.
protein or enzyme)
expressed by a modified gene or DNA sequence. The term "variant" may also be
used to
indicate a modified or altered gene, DNA sequence, enzyme, cell, etc., i. e.,
any lcind of
mutant.
A nucleic acid molecule is "hybridizable" to another nucleic acid molecule,
such as a cDNA, genomic DNA, or RNA, when a single stranded form of the
nucleic acid
molecule can anneal to the other nucleic acid molecule under the appropriate
conditions of
temperature and solution ionic strength (see Sambrook et al., supra). The
conditions of
temperature and ionic strength determine the "stringency" of the
hybridization. For
preliminary screening for homologous nucleic acids, low stringency
hybridization conditions,
corresponding to a Tm (melting temperature) of 55°C, can be used, e.g.,
Sx SSC, 0.1% SDS,
0.25% milk, and no formamide; or 30% formamide, Sx SSC, 0.5% SDS. Moderate
stringency hybridization conditions correspond to a higher T,r" e.g., 40%
formamide, with Sx
or 6x SCC. High stringency hybridization conditions correspond to the highest
Tm, e.g., 50%
formamide, Sx or 6x SCC. SCC is a O.15M NaCI, O.O15M Na-citrate. Hybridization
requires
that the two nucleic acids contain complementary sequences, although depending
on the
stringency of the hybridization, mismatches between bases are possible. The
appropriate
stringency for hybridizing nucleic acids depends on the length of the nucleic
acids and the
degree of complementation, variables well known in the art. The greater the
degree of
similarity or homology between two nucleotide sequences, the greater the value
of Tm for
hybrids of nucleic acids having those sequences. The relative stability
(corresponding to
higher Tm) of nucleic acid hybridizations decreases in the following order:
RNA:RNA,
DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length,
equations for
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-20-
calculating Tm have been derived (see Sambrook et al., supra, 9.50-9.51). For
hybridization
with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches
becomes more
important, and the length of the oligonucleotide determines its specificity
(see Sambrook et
al., supra, 11.7-11.8). A minimum length for a hybridizable nucleic acid is at
least about 10
nucleotides; preferably at least about 15 nucleotides; and more preferably the
length is at least
about 20 nucleotides.
In a specific embodiment, the term "standard hybridization conditions" refers
to a Tm of 55 ° C, and utilizes conditions as set forth above. In a
preferred embodiment, the Tm
is 60 ° C; in a more preferred embodiment, the Tm is 65 ° C. In
a specific embodiment, "high
stringency" refers to hybridization and/or washing conditions at 68°C
in 0.2xSSC, at 42°C in
50% formamide, 4xSSC, or under conditions that afford levels of hybridization
equivalent to
those observed under either of these two conditions.
The term "oligonucleotide" refers to a nucleic acid, generally of at least 10,
preferably at least 15, and more preferably at least 20 nucleotides,
preferably no more than
100 nucleotides, that is hybridizable to a genomic DNA molecule, a cDNA
molecule, or an
mRNA molecule encoding a genie, mRNA, cDNA, or other nucleic acid of interest.
Oligonucleotides can be labeled, e.g., with 32P-nucleotides or nucleotides to
which a label,
such as biotin, has been covalently conjugated. In one embodiment, a labeled
oligonucleotide
can be used as a probe to detect the presence of a nucleic acid. In another
embodiment,
oligonucleotides (one or both of which may be labeled) can be used as PCR
primers, either
for cloning full length or a fragment of Cyr6l, or to detect the presence of
nucleic acids
encoding Cyr61. Generally, oligonucleotides are prepared synthetically,
preferably on a
nucleic acid synthesizer.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-21-
The present invention provides antisense nucleic acids (including ribozymes),
which may be used to inhibit expression of Cyr61 or to localize Cyr61 mRNA or
DNA in a
cell. An "antisense nucleic acid" is a single stranded nucleic acid molecule
or oligonucleotide
which, on hybridizing under cytoplasmic conditions with complementary bases in
an RNA or
DNA molecule, inhibits the tatter's role. If the RNA is a messenger RNA
transcript, the
antisense nucleic acid is a countertranscript or mRNA-interfering
complementary nucleic
acid. As presently used, "antisense" broadly includes RNA-RNA interactions,
RNA-DNA
interactions, ribozymes and RNase-H mediated arrest. Antisense nucleic acid
molecules can
be encoded by a recombinant gene for expression in a cell (e.g., U.S. Patent
Nos. 5,814,500
and 5,811,234), or alternatively they can be prepared synthetically (e.g.,
U.S. Patent No.
5,780,607).
Leiomyomas
As mentioned above, the term "leiomyomas" refers to tumors that are
comprised of smooth muscle and fibrous connective tissue. It is proposed that
leiomyomas
result from somatic mutations of a single cell. Uterine leiomyomas refer to
tumors associated
with the uterus. Uterine leiomyomas can be classified based on the location of
the tumor and
the uterine layer that is affected. Location of uterine leiomyomas may be
categorized as (a)
cervical, (b) isthmic, or (c) corporal. Cervical uterine leiomyomas generally
grow towards
the vagina and may cause sinusiorragia and infection. Isthmic uterine
leiomyomas frequently
cause pain and urinary problems. Corporal uterine leiomyomas, the most common
location,
are frequently asymptomatic. Uterine leiomyomas may affect the (a) subserous,
(b)
submucous, or (c) intramural uterine layers. Intramural leiomyomas are the
most common
form of this tumor and occur within the walls of the uterus.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-22-
Epidemiological studies indicate that uterine leiomyomas are present in about
30% of women over the age of 30. Most women with leiomyomas are asymptomatic,
with
only 35-50% of affected patients experiencing problems. Some problems
associated with
uterine leiomyomas include, but are not limited to, abnormal uterine bleeding,
pain,
infertility, urinary symptoms, intestinal symptoms, and venous congestion.
Rapidly growing
leiomyomas may be an indication of transformation of the benign tumor to
malignancy.
Viral and Non-Viral Vectors
Preferred vectors, particularly for cellular assays i~ vitro and in vivo, are
viral
vectors, such as lentiviruses, retroviruses, herpes viruses, adenoviruses,
adeno-associated
viruses, vaccinia virus, baculovirus, and other recombinant viruses with
desirable cellular
tropism. Thus, a gene encoding a functional or mutant protein or polypeptide
domain
fragment thereof can be introduced in vivo, ex vivo, or ih vita°o using
a viral vector or through
direct introduction of DNA. Expression in targeted tissues can be effected by
targeting the
transgenic vector to specific cells, such as with a viral vector or a receptor
ligand, or by using
a tissue-specific promoter, or both. Targeted gene delivery is described in
PCT Publication
No. WO 95/28494.
Viral vectors commonly used for in vivo or ex vivo targeting and therapy
procedures are DNA-based vectors and retroviral vectors. Methods for
constructing and
using viral vectors are known in the art (see, e.g., Miller and Rosman,
BioTechniques, 1992,
7:980-990). Preferably, the viral vectors are replication-defective, that is,
they are unable to
replicate autonomously in the target cell. Preferably, the replication
defective virus is a
minimal virus, i. e., it retains only the sequences of its genome which are
necessary for
encapsulating the genome to produce viral particles.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-23-
DNA viral vectors include an attenuated or defective DNA virus, such as but
not limited to herpes simplex virus (HSV), papillomavirus, Epstein Barn virus
(EBV),
adenovirus, adeno-associated virus (AAV), and the like. Defective viruses,
which entirely or
almost entirely lack viral genes, are preferred. Defective virus is not
infective after
introduction into a cell. Use of defective viral vectors allows for
administration to cells in a
specific, localized area, without concern that the vector can infect other
cells. Thus, a specific
tissue can be specifically targeted. Examples of particular vectors include,
but are not limited
to, a defective herpes virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell.
Neurosci., 1991,
2:320-330), defective herpes virus vector lacking a glyco-protein L gene, or
other defective
herpes virus vectors (PCT Publication Nos. WO 94/21807 and WO 92/05263); an
attenuated
adenovirus vector, such as the vector described by Stratford-Perricaudet et
al. (J. Clin. Invest.,
1992, 90:626-630; see also La Salle et al. , Science, 1993, 259:988-990); and
a defective
adeno-associated virus vector (Samulski et al., J. Virol., 1987, 61:3096-3101;
Samulski et al.,
J. Virol., 1989, 63:3822-3828; Lebkowski et al., Mol. Cell. Biol., 1988,
8:3988-3996).
Various companies produce viral vectors commercially, including, but not
limited to, Avigen, Inc. (Alameda, CA; AAV vectors), Cell Genesys (Foster
City, CA;
retroviral, adenoviral, AAV vectors, and lentiviral vectors), Clontech
(retroviral and
baculoviral vectors), Genovo, Inc. (Sharon Hill, PA; adenoviral and AAV
vectors), Genvec
(adenoviral vectors), IntroGene (Leiden, Netherlands; adenoviral vectors),
Molecular
Medicine (retroviral, adenoviral, AAV, and herpes viral vectors), Norgen
(adenoviral
vectors), Oxford BioMedica (Oxford, United Kingdom; lentiviral vectors), and
Transgene
(Strasbourg, France; adenoviral, vaccinia, retroviral, and lentiviral
vectors).
Adehovirus vectors. Adenoviruses are eukaryotic DNA viruses that can be
modified to efficiently deliver a nucleic acid of the invention to a variety
of cell types.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-24-
Various serotypes of adenovirus exist. Of these serotypes, preference is
given, within the
scope of the present invention, to using type 2 or type 5 human adenoviruses
(Ad 2 or Ad 5)
or adenoviruses of animal origin (see PCT Publication No. WO 94/26914). Those
adenoviruses of animal origin which can be used within the scope of the
present invention
include adenoviruses of canine, bovine, murine (example: Mavl, Beard et al.,
Virology,
1990, 75-81), ovine, porcine, avian, and simian (example: SAV) origin.
Preferably, the
adenovirus of animal origin is a canine adenovirus, more preferably a CAV2
adenovirus (e.g.,
Manhattan or A26/61 strain, ATCC VR-800, for example). Various replication
defective
adenovirus and minimum adenovirus vectors have been described (PCT Publication
Nos.
WO 94/26914, WO 95/02697, WO 94/28938, WO 94/28152, WO 94/12649, WO 95/02697,
WO 96/22378). The replication defective recombinant adenoviruses according to
the
invention can be prepared by any technique known to the person skilled in the
art (Levrero et
al., Gene, 1991, 101:195; European Publication No. EP 185 573; Graham, EMBO
J., 1984,
3:2917; Graham et al., J. Gen. Virol., 1977, 36:59). Recombinant adenoviruses
are recovered
and purified using standard molecular biological techniques, which are well
known to one of
ordinary skill in the art.
Adeho-associated viruses. The adeno-associated viruses (AAV) axe DNA
viruses of relatively small size that can integrate, in a stable and site-
specific mamler, into the
genome of the cells which they infect. They are able to infect a wide spectrum
of cells
without inducing any effects on cellular growth, morphology or
differentiation, and they do
not appeax to be involved in human pathologies. The AAV genome has been
cloned,
sequenced and characterized. The use of vectors derived from the AAVs for
transferring
genes i~c vitro and ih vivo has been described (see, PCT Publication Nos. WO
91/18088 and
WO 93/09239; LT.S. Patent Nos. 4,797,368 and 5,139,941; European Publication
No. EP 488
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-25-
528). The replication defective recombinant AAVs according to the invention
can be
prepared by cotransfecting a plasmid containing the nucleic acid sequence of
interest flanked
by two AAV inverted terminal repeat (ITR) regions, and a plasmid carrying the
AAV
encapsidation genes (rep and cap genes), into a cell line which is infected
with a human
helper virus (for example an adenovirus). The AAV recombinants which are
produced are
then purified by standard techniques.
Retrovirus vectors. In another embodiment the gene can be introduced in a
retroviral vector, e.g., as described in U.S. Patent No. 5,399,346; Mann et
al., Cell, 1983,
33:153; U.S. Patent Nos. 4,650,764 and 4,980,289; Markowitz et al., J. Virol.,
1988,
62:1120; U.S. Patent No. 5,124,263; European Publication Nos. EP 453 242 and
EP178 220;
Bernstein et al., Genet. Eng.,1985, 7:235; McCormick, BioTechnology, 1985,
3:689; PCT
Publication No. WO 95/07358; and Kuo et al., Blood, 1993, 82:845. The
retroviruses are
integrating viruses that infect dividing cells. The retrovirus genome includes
two LTRs, an
encapsidation sequence and three coding regions (gag, pol and envy. In
recombinant
retroviral vectors, the gag, pol and ehv genes are generally deleted, in whole
or in part, and
replaced with a heterologous nucleic acid sequence of interest. These vectors
can be
constructed from different types of retrovirus, such as, HIV, MoMuLV ("marine
Moloney
leukaemia virus" MSV ("marine Moloney sarcoma virus"), HaSV ("Harvey sarcoma
virus");
SNV ("spleen necrosis virus"); RSV ("Rous sarcoma virus") and Friend virus.
Suitable
packaging cell lines have been described in the prior art, in particular the
cell line PA317
(LJ.S. Patent No. 4,861,719); the PsiCRIP cell line (PCT Publication No. WO
90/02806) and
the GP+envAm-12 cell line (PCT Publication No. WO 89/07150). In addition, the
recombinant retroviral vectors can contain modifications within the LTRs for
suppressing
transcriptional activity as well as extensive encapsidation sequences which
may include a part
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-26-
of the gag gene (Bender et al., J. Virol., 1987, 61:1639). Recombinant
retroviral vectors are
purified by standard techniques lcnown to those having ordinary slcill in the
art.
Retroviral vectors can be constructed to function as infectious particles or
to
undergo a single round of transfection. In the former case, the virus is
modified to retain all
of its genes except for those responsible for oncogenic transformation
properties, and to
express the heterologous gene. Non-infectious viral vectors are manipulated to
destroy the
viral packaging signal, but retain the structural genes required to package
the co-introduced
virus engineered to contain the heterologous gene and the packaging signals.
Thus, the viral
particles that are produced are not capable of producing additional virus.
Retrovirus vectors can also be introduced by DNA viruses, which permits one
cycle of retroviral replication and amplifies tranfection efficiency (see PCT
Publication Nos.
WO 95/22617, WO 95/26411, WO 96/39036 and WO 97/19182).
Lentivivus vectors. In another embodiment, lentiviral vectors can be used as
agents for the direct delivery and sustained expression of a transgene in
several tissue types,
including brain, retina, muscle, liver and blood. The vectors can efficiently
transduce
dividing and nondividing cells in these tissues, and maintain long-term
expression of the gene
of interest. For a review, see, Naldini, Curr. Opin. Biotechnol., 1998, 9:457-
63; see alsa
Zufferey, et al., J. Virol., 1998, 72:9873-80). Lentiviral packaging cell
lines are available and
known generally in the art. They facilitate the production of high-titer
lentivirus vectors for
gene therapy. An example is a tetracycline-inducible VSV-G pseudotyped
lentivirus
packaging cell line that can generate virusparticles at titers greater than
106 IU/ml for at least
3 to 4 days (Kafri, et al., J. Virol., 1999, 73: 576-584). The vector produced
by the inducible
cell line can be concentrated as needed for efficiently transducing non-
dividing cells in vitro
and i~c vivo.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-27-
lVosZ-viral veetors. In another embodiment, the vector can be introduced ih
vivo by lipofection, as naked DNA, or with other transfection facilitating
agents (peptides,
polymers, etc.). Synthetic cationic lipids can be used to prepare liposomes
for in vivo
transfection of a gene encoding a marker (Felgner, et. al., Proc. Natl. Acad.
Sci. U.S.A., 1987,
84:7413-7417; Felgner and Ringold, Science, 1989, 337:387-388; see Mackey, et
al., Proc.
Natl. Acad. Sci. U.S.A., 1988, 85:8027-8031; Ulmer et al., Science, 1993,
259:1745-1748).
Useful lipid compounds and compositions for transfer of nucleic acids are
described in PCT
Patent Publication Nos. WO 95/18863 and WO 96/17823, and in U.S. Patent No.
5,459,127.
Lipids may be chemically coupled to other molecules for the purpose of
targeting (see
Mackey, et. al., su~ara). Targeted peptides, e.g., hormones or
neurotransmitters, and proteins
such as antibodies, or non-peptide molecules could be coupled to liposomes
chemically.
Other molecules are also useful for facilitating transfection of a nucleic
acid ih
vivo, such as a cationic oligopeptide (e.g., PCT Patent Publication No. WO
95/21931),
peptides derived from DNA binding proteins ( e.g., PCT Patent Publication No.
WO 96/25508), or a cationic polymer (e.g., PCT Patent Publication No. WO
95/21931).
It is also possible to introduce the vector in vivo as a naked DNA plasmid.
Naked DNA vectors for gene therapy can be introduced into the desired host
cells by methods
known in the art, e.g., electroporation, microinjection, cell fusion, DEAE
dextran, calcium
phosphate precipitation, use of a gene gun, or use of a DNA vector transporter
(see, e.g., Wu
et al., J. Biol. Chem., 1992, 267:963-967; Wu and Wu, J. Biol. Chem., 1988,
263:14621-14624; Canadian Patent Application No. 2,012,31 l; Williams et al.,
Proc. Natl.
Acad. Sci. USA, 1991, 88:2726-2730). Receptor-mediated DNA delivery approaches
can
also be used (Curiel et al., Hum. Gene Ther., 1992, 3:147-154; Wu and Wu, J.
Biol. Chem.,
1987, 262:4429-4432). U.S. Patent Nos. 5,580,859 and 5,589,466 disclose
delivery of
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-28
exogenous DNA sequences, free of transfection facilitating agents, in a
mammal. Recently, a
relatively low voltage, high efficiency ih vivo DNA transfer technique, termed
electrotransfer,
has been described (Mir et al., C.P. Acad. Sci., 1988, 321:893; PCT
Publication Nos. WO
99101157; WO 99/01158; WO 99/01175).
Antibodies and Antisense Constructs
The present invention describes antibodies that may be used to detect the
presence of Cyr61 in cells and specifically in leiomyoma cells such as uterine
leiomyomas.
Additionally, the antibodies (e.g., anti-idiotypic antibodies) may be used to
inhibit
proliferation or prevent formation of uterine leiomyomas. Antibodies used in
treatment
regimens may be conjugated to pharmaceutically active compounds.
According to the invention, Cyr61 polypeptides produced recombinantly or by
chemical synthesis, and fragments or other derivatives, may be used as an
immunogen to
generate antibodies that recognize the Cyr61 polypeptide or portions thereof.
The portion of
the polypeptide used as an immunogen may be specifically selected to modulate
immunogenicity of the developed antibody. Such antibodies include, but are not
limited to,
polyclonal, monoclonal, humanized, chimeric, single chain, Fab fragments, and
an Fab
expression library. An antibody that is specific for human Cyr61 may recognize
a wild-type
or mutant form of Cyr61. Preferably, the antibody does not recognize or bind
to a protein that
belongs to the same protein family as Cyr6l. In a specific embodiment, the
antibody is
comprised of at least 8 amino acids, preferably from 8-10 amino acids, and
more preferably
from 15-30 amino acids. Preferred antibodies are produced to, but not limited
to, the amino
acids 371-381 of Cyr61 (as depicted in Figure 7). Preferably, the antibody
recognizes or
binds amino acids on the Cyr61 polypeptide that are consecutive.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-29-
Various procedures known in the art may be used for the production of
polyclonal antibodies to polypeptides, derivatives, or analogs. For the
production of
antibody, various host animals, including but not limited to rabbits, mice,
rats, sheep, goats,
etc, can be immunized by injection with the polypeptide or a derivative (e.g.,
fragment or
fusion protein). The polypeptide or fragment thereof can be conjugated to an
immunogenic
carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH).
Various
adjuvants may be used to increase the immunological response, depending on the
host
species, including but not limited to Freund's (complete and incomplete),
mineral gels such as
aluminum hydroxide, surface active substances such as lysolecithin, pluronic
polyols,
polyanions, peptides, oil emulsions, KLH, dinitrophenol, and potentially
useful human
adjuvants such as BCG (bacille Calmette-Gue~i~c) and Co~yhebacte~ium~aa~vum.
Monoclonal antibodies directed toward a Cyr61 polypeptide, fragment, analog,
or derivative thereof, may be prepared by any technique that provides for the
production of
antibody molecules by continuous cell lines in culture may be used. These
include but are not
limited to the hybridoma technique originally developed by Kohler and Milstein
(Nature
256:495-497, 1975), as well as the trioma technique, the human B-cell
hybridoma technique
(Kozbor et al., Immunology Today 4:72, 1983; Cote et al., Proc. Natl. Acad.
Sci. U.S.A.
80:2026-2030, 1983), and the EBV-hybridoma technique to produce human
monoclonal
antibodies (Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R.
Liss, Inc., pp.
77-96, 1985). "Chimeric antibodies" may be produced (Morrison et al., J.
Bacteriol. 159:870,
1984; Neuberger et al., Nature 312:604-608, 1984; Takeda et al., Nature
314:452-454, 1985)
by splicing the genes from a non-human antibody molecule specific for a
polypeptide together
with genes from a human antibody molecule of appropriate biological activity.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-30-
In the production and use of antibodies, screening for or testing with the
desired antibody can be accomplished by techniques known in the art, e.g.,
radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), "sandwich"
immunoassays, immunoradiometric assays, gel diffusion precipitin reactions,
immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope
labels, for example), western blots, precipitation reactions, agglutination
assays (e.g., gel
agglutination assays, hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, and immunoelectrophoresis assays,
etc.
The foregoing antibodies can be used in methods known in the art relating to
the localization and activity of the polypeptide, e.g., for Western blotting,
imaging the
polypeptide ih situ, measuring levels thereof in appropriate physiological
samples, etc. using
any of the detection techniques mentioned above or known in the art. Such
antibodies can
also be used in assays for ligand binding, e.g., as described in U.S. Patent
No. 5,679,582.
Antibody binding generally occurs most readily under physiological conditions,
e.g., pH of
between about 7 and 8, and physiological ionic strength. The presence of a
carrier protein in
the buffer solutions stabilizes the assays. While there is some tolerance of
perturbation of
optimal conditions, e.g., increasing or decreasing ionic strength,
temperature, or pH, or
adding detergents or chaotropic salts, such perturbations will decrease
binding stability.
In a specific embodiment, antibodies that agonize the activity of Cyr61
polypeptide can be generated. In particular, intracellular single chain Fv
antibodies can be
used to regulate Cyr61. Such antibodies can be tested using the assays
described below for
identifying ligands.
In another specific embodiment, the antibodies of the present invention are
anti-idiotypic antibodies. These antibodies recognize and or bind to other
antibodies present
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-31
in the system. The anti-idiotypic antibodies may be monoclonal, polyclonal,
chimeric,
humanized. Additionally, the antibodies may be conjugated to apharmaceutically
active
compound. In a specific embodiment, the pharmaceutically active compound is
calicheamicin.
In another specific embodiment, antibodies such as, but not limited to, anti-
idiotypic, are conjugated to a secondary component, such as, for example, a
small molecule,
polypeptide, or polynucleotide. The conjugation may be produced through a
chemical
modification of the antibody, which conjugates the antibody to the secondary
component.
The conjugated antibody will allow for targeting of the secondary component,
such as, for
example, an antibiotic to the site of interest. The secondary component may be
of any size or
length. In a specific embodiment, the secondary component is a
pharmaceutically active
compound. The pharmaceutically active compound can be, but is not limited to,
an anti-
leiomyoma agent or calicheamicin.
A fiu-ther aspect of this invention relates to the use of antibodies, as
discussed
sup~cz, for targeting a pharmaceutical compound or a Cyr61 peptide. In this
embodiment,
antibodies against Cyr61 axe used to present specific compounds to tumorous
cells. The
compounds, preferably an anti-tumor agent, when conjugated to the antibodies
are referred to
as targeted compounds or targeted agents. Methods for generating such target
compounds
and agents are known in the art. Exemplary publications on target compounds
and their
preparation are set forth in U.S. Patent Nos. 5,053,934; 5,773,001; and
6,015,562.
Any desired agent having activity against cancer cells may be employed in
generating the targeted agent. Examples of such compounds are discussed in
U.S. Patent No.
6,015,562. See specifically U.S. PatentNos. 4,971,198; 5,079,233; 4,539,203;
4,554,162;
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-32-
4,675,187; and 4,837,206. These publications refer to anti-tumor agents and
antibiotics
which may be used as the pharmaceutical compound of the target.
The present invention provides antisense nucleic acids (including ribozymes),
which may be used to inhibit or prevent expression of Cyr61 by repressing
proteins,
particularly proteins that suppress Cyr61 effects on cell proliferation.
Antisense nucleic acids
that increase the total level of Cyr61 also may be used to modulate binding of
Cyr61 to
intracellular proteins (e.g., integrin receptors). Additionally, antisense
nucleic acids also may
be used as a diagnostic tool to determine alterations in Cyr61 transcription
and/or translation
in samples that are suspected of comprising uterine leiomyomas.
An "antisense nucleic acid" is a single stranded nucleic acid molecule or
oligonucleotide which, on hybridizing under cytoplasmic conditions with
complementary
bases in an RNA or DNA molecule, inhibits the tatter's role. In a preferred
embodiment, the
antisense nucleic acid is at least about 10 nucleotides; preferably at least
about 15
nucleotides; and more preferably the length is at least about 20 nucleotides.
If the RNA is a
messenger RNA transcript, the antisense nucleic acid is a countertranscript or
mRNA-
interfering complementary nucleic acid. As presently used, "antisense" broadly
includes
RNA-RNA interactions, RNA-DNA interactions, ribozymes and RNase-H mediated
arrest.
Antisense nucleic acid molecules can be encoded by a recombinant gene for
expression in a
cell (e.g., U.S. Patent Nos. 5,814,500 and 5,811,234), or alternatively they
can be prepared
synthetically (e.g., U.S. Patent No. 5,780,607). Also contemplated are vectors
which include
these oligonucleotides or anti-sense constructs.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-33-
Compounds
Ovariafz Steroids
An "ovarian steroid" refers to a class of hormonal substances that are
secreted
from the reproductive organs, specifically the ovaries, including, but not
limited to, estrogen
and progesterone.
Estrogen compounds are described, for example, in the 11th edition of
"Steroids" from Steraloids Inc., Wilton N. H.. Non-steroidal estrogens
described therein are
included, as well. Other compounds included are derivatives, metabolites, and
precursors.
Also included are mixtures of more than one compound. Examples of such
mixtures are
provided in Table II of U.S. Patent No. 5,554,601 (see column 6). Examples of
estrogens
either alone or in combination with other agents are provided, e.g., in U.S.
Patent No.
5,554,601.
(3-estrogen is the (3-isomer of estrogen compounds. a-estrogen is the a-isomer
of estrogen components. The term "estradiol" is either a- or (3-estradiol
unless specifically
identified.
The term "E2 " is synonymous with 17[3-estradiol.
Progesterone compounds are described, for example, in the 9t'' edition of "The
Pharmacological Basis of Therapeutics" from McGraw-Hill, New York, NY.
Progestin
compounds, for example, include progestins containing the 21- carbon skeleton
and the 19-
carbon (19-nortestosterone) skeleton. Non-steroidal progestin compounds,
derivatives,
precursors, and metabolites are also contemplated herein.
Preferably, a non-feminizing estrogen compound is used herein. Non-
feminizing estrogen compounds refers to compounds that do not produce effects
that cause a
subject to take on feminine characters. Such a compound has the advantage of
not causing
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-34-
uterine hypertrophy and other undesirable side effects, and thus, can be used
at a higher
effective dosage. Examples of non-feminizing estrogen include Raloxifene
(Evista; Eli
Lilly), Tamoxifen (Nolvadex; Astra Zeneca), and other selective estrogen
receptor
modulators.
Growth faetors
Growth factors are a class of proteins that are involved in stimulation of
cell
division. These proteins interact with cell surface receptors to induce
transcription factors to
promote cell survival. Growth factor receptors signal through the Ras pathway,
a highly
conserved signal transduction pathway. The Ras pathway functions to promote
cell survival
in radiation therapy, and genetic changes in this pathway which produce
constitutively
activate intracellular survival pathways are often associated with the
development of cancer.
Growth factors also include, for example, small molecule compounds that
interact with growth factor receptors to produce the same effects as observed
with growth
factor peptides. Other compounds included are derivatives, metabolites, and
precursors of
endogenous growth factors. In specific embodiments of the present invention,
specific growth
factors that are used include, but axe not limited to, epidermal growth
factor, heparin binding
epidermal growth factor, and basic fibroblastic growth factor.
Assa~ystem
Any cell assay system that allows for assessing functional activities of Cyr61
agonists or antagonists, steroid, non-steroid, and growth factor receptor
agonists and
antagonists is contemplated by the present invention. In a specific
embodiment, the assay can
be used to identify compounds that interact with specific isoforms of the
steroid receptor to
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-35-
regulate Cyr61 transcription and translation, which can be evaluated by
assessing the effects
of a test compound, which modulates Cyr61 mRNA transcription, Cyr61
translation, or
Cyr61 activity.
Any convenient method permits detection of the expressed product. For
example, the invention encompasses Northern blot analysis for detecting Cyr61
mRNA
product. The methods comprise, for example, the steps of fractionating total
cellular RNA on
an agarose gel, transferring RNA to a solid support membrane, and detecting a
DNA-RNA
complex with a labeled DNA probe, wherein the DNA probe is specific for a
particular
nucleic acid sequence of Cyr61 under conditions in which a stable complex can
form between
the DNA probe and RNA components in the sample. Such complexes may be detected
by
using any suitable means known in the art, such as, for example, ECL and
fluorescence,
wherein the detection of a complex indicates the presence of Cyr61 in the
sample.
Typically, immunoassays use either a labeled antibody or a labeled antigenic
component (e.g., that competes with the antigen in the sample for binding to
the antibody).
Suitable labels include without limitation enzyme-based, fluorescent,
chemiluminescent,
radioactive, or dye molecules. Assays that amplify the signals from the probe
are also known,
such as, for example, those that utilize biotin and avidin, and enzyme-labeled
immunoassays,
such as ELISA assays.
In Vitro Screenih~ Methods
Candidate agents are added to ih vitro cell cultures of host cells, prepared
by
known methods in the art, and the level of Cyr61 mRNA and/or protein is
measured. Various
ih vitro systems can be used to analyze the effects of a new compound on Cyr61
transcription
and translation. Preferably, each experiment is performed more than once, such
as, for
example, in triplicate at multiple different dilutions of compound.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-36-
The host cell screening system of the invention permits two kinds of assays:
direct activation assays (agonist screen) and inhibition assays (antagonist
screen). An agonist
screen involves detecting changes in the level of expression of the gene by
the host cell
contacted with a test compound; generally, gene expression increases. If the
Cy~61 gene is
expressed, the test compound has stimulated Cy~61 transcription via receptor
interaction.
An antagonist screen involves detecting expression of the reporter gene by the
host cell when contacted with a compound that regulates expression of Cy~6l.
If Cyr61
expression is decreased, the test compound is a candidate antagonist. If there
is no change or
an increase in expression of the reporter gene, the test compound is not an
effective
antagonist.
The assay system described here also may be used in a high-throughput
primary screen for agonists and antagonists, or it may be used as a secondary
functional
screen for candidate compounds identified by a different primary screen, e.g.,
a binding assay
screen that identifies compounds that interact with the receptor and affect
Cyr61
transcription.
In T~ivo Testing Using Transgehic Animals
Transgenic animals, and preferably mammals, can be prepared for evaluating
the molecular mechanisms of Cyr61. Preferably, for evaluating compounds for
use in human
therapy, the animals are "humanized" with respect to Cyr61. Such mammals
provide
excellent models for screening or testing drug candidates. The term
"transgenic" usually
refers to animal whose germ line and somatic cells contain the transgene of
interest, i.e.,
Cy~6l. However, transient transgenic animals can be created by the ex vivo or
i~c vivo
introduction of an expression vector of the invention. Both types of
"transgenic" animals are
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-3 7-
contemplated for use in the present invention, e.g., to evaluate the effect of
a test compound
on Cyr61 or Cyf°61 activity.
Thus, human Cyr6l, "knock-in" mammals can be prepared for evaluating the
molecular biology of this system in greater detail than is possible with human
subjects. It is
also possible to evaluate compounds or diseases on "knockout" animals, e.g.,
to identify a,
compound that can compensate for a defect in Cyr61 or Cy~61 activity. Both
technologies
permit manipulation of single units of genetic information in their natural
position in a cell
genome and to examine the results of that manipulation in the background of a
terminally
differentiated organism.
Although rats and mice, as well as rabbits, are most frequently employed as
transgenic animals, particularly for laboratory studies of protein function
and gene regulation
ivy vivo, any animal can be employed in the practice of the invention.
A "knock-in" mammal is a mammal in which an endogenous gene is
substituted with a heterologous gene (Roemer et al., New Biol. 3:331, 1991).
Preferably, the
heterologous gene or regulation system is "knocked-in" to a locus of interest,
either the
subject of evaluation(in which case the gene may be a reporter gene; see
Elefanty et al., Proc
Natl Acad Sci USA 95:11897,1998) of expression or function of a homologous
gene, thereby
linking the heterologous gene expression to transcription from the appropriate
promoter. This
can be achieved by homologous recombination, transposon (Westphal and Leder,
Curr Biol
7:530, 1997), using mutant recombination sites (Araki et al., Nucleic Acids
Res 25:868,
1997) or PCR (Zhang and Henderson, Biotechniques 25:784, 1998). See also,
Coffman,
Semin. Nephrol. 17:404, 1997; Esther et al., Lab. Invest. 74:953, 1996;
Murakami et al.,
Blood Press. Suppl. 2:36, 1996.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-3 8
A "knockout mammal" is an mammal (e.g., mouse) that contains within its
genome a specific gene that has been inactivated by the method of gene
targeting (see, e.g.,
U.S. Patent Nos. 5,777,195 and 5,616,491). A knockout mammal includes both a
heterozygote knoclcout (i.e., one defective allele and one wild-type allele)
and a homozygous
mutant. Preparation of a knockout mammal requires first introducing a nucleic
acid construct
that will be used to suppress expression of a particular gene into an
undifferentiated cell type
termed an embryonic stem cell. This cell is then injected into a maxmnalian
embryo. A
marrunalian embryo with an integrated cell is then implanted into a foster
mother for the
duration of gestation. Zhou, et czl. (Genes and Development, 9:2623-34, 1995)
describes
PPCA knock-out mice.
The term "knockout" refers to partial or complete suppression of the
expression of at least a portion of a protein encoded by an endogenous DNA
sequence in a
cell. The term "knockout construct" refers to a nucleic acid sequence that is
designed to
decrease or suppress expression of a protein encoded by endogenous DNA
sequences in a
cell. The nucleic acid sequence used as the knockout construct is typically
comprised of (1)
DNA from some portion of the gene (exon sequence, intron sequence, andlor
promoter
sequence) to be suppressed and (2) a marker sequence used to detect the
presence of the
knockout construct in the cell. The knockout construct is inserted into a
cell, and integrates
with the genomic DNA of the cell in such a position so as to prevent or
interrupt transcription
of the native DNA sequence. Such insertion usually occurs by homologous
recombination
(i.e., regions of the knockout construct that are homologous to endogenous DNA
sequences
hybridize to each other when the knockout construct is inserted into the cell
and recombine so
that the knockout construct is incorporated into the corresponding position of
the endogenous
DNA). The knockout construct nucleic acid sequence may comprise (1) a full or
partial
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-3 9
sequence of one or more exons and/or introns of the gene to be suppressed, (2)
a full or
partial promoter sequence of the gene to be suppressed, or (3) combinations
thereof.
Typically, the knockout construct is inserted into an embryonic stem cell (ES
cell) and is
integrated into the ES cell genomic DNA, usually by the process of homologous
recombination. This ES cell is then injected into, and integrates with, the
developing embryo.
However, the invention does not require any particular method for preparing a
transgenic
animal.
Generally, for homologous recombination, the DNA will be at least about 1
kilobase (kb) in length and preferably 3-4 kb in length, thereby providing
sufficient
complementary sequence for recombination when the construct is introduced.
Transgenic
constructs can be introduced into the genomic DNA of the ES cells, into the
male pronucleus
of a fertilized oocyte by microinjeciton, or by any methods known in the art,
e.g., as described
in U.S. Patent Nos. 4,736,866 and 4,870,009, and by Hogan et al., Ti~a~sgehic
Animals: A
Laboratory Manual, 1986, Cold Spring Harbor. A transgenic founder animal can
be used to
breed other transgenic animals; alternatively, a transgenic founder may be
cloned to produce
other transgenic animals.
Included within the scope of this invention is a mammal in which two or more
genes have been knocked out or knocked in, or both. Such mammals can be
generated by
repeating the procedures set forth herein for generating each knockout
construct, or by
breeding to mammals, each with a single gene knocked out, to each other, and
screening for
those with the double knockout genotype.
Regulated knockout animals can be prepared using various systems, such as
the tet-repressor system (see U.S. Patent No. 5,654,168) or the Cre-Lox system
(see U.S.
Patent Nos. 4,959,317 and 5,801,030).
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-40-
Cloning and Expression of Cyr61
The present invention contemplates analysis and isolation any antigenic
fragments of Cyr61 from any source, preferably human. It further contemplates
expression of
functional or mutant Cyr61 protein for evaluation, diagnosis, or therapy.
Conventional molecular biology, microbiology, and recombinant DNA
techniques within the skill of the art may be employed in the use of this
invention. Such
techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch
& Maniatis,
Molecular Cloning: A Labo~ato~y Manual, Second Edition (1989) Cold Spring
Harbor
Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et al.,
1989"); DNA
Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985),
Oligonucleotide
Syv~thesis (M.J. Gait ed. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J.
Higgins eds.
(1985)]; Ti~ausc~iption And Ti°anslatiovc [B.D. Hames & S.J. Higgins,
eds. (1984)]; Animal
Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL
Press, (1986)];
B.Perbal, A Practical Guide To Molecular Clohiv~g (1984); F.M. Ausubel et al.
(eds.),
Cu~rev~t Protocols iu Molecular Biology, John Wiley & Sons, Inc. (1994).
Methods of Inhibiting Uterine Leiomyoma Proliferation
According to the present invention, upregulation of Cyr61 mRNA or protein
can be used to inhibit the proliferation of a Cyr61 associated disease, such
as uterine
leiomyomas. The present invention provides for methods that inhibit
proliferation of uterine
leiomyomas by administering to a subject a therapeutically effective amount of
a compound
that stimulates the synthesis of mRNA encoding Cyr6l, the translation of Cyr61
mRNA, the
expression of Cyr61 protein, or the activity of Cyr61 in leiomyoma tissues.
The present
invention further provides for methods that inhibit proliferation of uterine
leiomyomas by
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-41-
increasing the total level of Cyr61 protein in the cell. These methods
include, but are not
limited to, delivery of the Cyr61 protein to the cell, administration of an
expression vector
encoding the Cyr61 protein, and administration of a therapeutically effective
amount of a
compound that modulates binding of Cyr61 to intracellular proteins (e.g.,
integrin receptors).
The compound may be formulated into a pharmaceutical composition (described
below) for
administration to the subject. The present invention provides for methods that
inhibit
proliferation of uterine leiomyomas by administering to a subject a
therapeutically effective
amount of recombinant DNA to stimulate Cyr61 protein expression or recombinant
Cyr61
protein. In a specific embodiment, inhibition of the proliferation of uterine
leiomyoma is
observed when proliferation is decreased by at least 20%, preferably by at
least 40%, and
more preferably by at least 80%.
Levels of IGF I, IGF II, bFGF, and HB-EGF are upregulated in leiomyomas,
such as, for example, uterine leiomyomas. The decrease of Cyr61 in leiomyomas
may
augment the activity of IGFs and growth factors, and thus these molecules may
be more
effective in stimulating cell proliferation. Therefore, a further embodiment
of the present
invention contemplates methods for stimulates the synthesis of mRNA encoding
Cyr6l, the
translation of Cyr61 mRNA, the expression of Cyr61 protein, or the activity of
Cyr61 and
decreasing the synthesis of mRNA, the translation of mRNA, the expression of,
or the activity
of IGF I, IGF II, bFGF, HB-EGF, or any combination thereof.
The effective amounts of the compounds of the present invention may vary
according to a variety of factors such as the individual's condition, weight,
sex and age and
the mode of administration. This amount of a compound can be determined
experimentally
by methods well-known in the art such as by establishing a matrix of dosages
and frequencies
and assigning a group of experimental subjects to each point-in the matrix.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-42-
Methods of Preventing Uterine Leiomyoma Formation
According to the present invention, Cyr61 protein expression is higher in
autologous myometrial tissue compared to uterine leiomyoma tissue. The present
invention
provides for methods that prevent formation of uterine leiomyomas by
administering to a
subject a therapeutically effective amount of a compound that stimulates the
synthesis of
mRNA encoding Cyr6l, the translation of Cyr61 mRNA, the expression of Cyr61
protein, or
the activity of Cyr61. The present invention further provides for methods that
prevent
formation of uterine leiomyomas by increasing the total level of Cyr61 protein
in the cell.
These methods include, but are not limited to, delivery of the Cyr61 protein
to the cell,
administration of an expression vector encoding the Cyr61 protein, and
administration of a
therapeutically effective amount of a compound that modulates binding of Cyr61
to
intracellular proteins (e.g., integrin receptors). The compound may be
formulated into a
pharmaceutical composition (described below) for administration to the
subject. The present
invention provides for methods that prevent formation of uterine leiomyomas by
administering to a subject a therapeutically effective amount of recombinant
DNA to
stimulate Cyr61 protein expression or recombinant Cyr61 protein.
As previous reports have shown, levels of IGF I, IGF II, bFGF, and HB-EGF
are upregulated in leiomyomas, such as, for example, uterine leiomyomas. The
decrease of
Cyr61 in leiomyomas may augment the activity of IGFs and growth factors, and
thus these
molecules may be more effective in stimulating cell proliferation. Therefore,
a further
embodiment of the present invention contemplates methods to stimulate the
synthesis of
mRNA encoding Cyr6l, the translation of Cyr61 mRNA, the expression of Cyr61
protein, or
the activity of Cyr61 and/or decreasing the synthesis of mRNA, the translation
of mRNA, the
expression of, or the activity of IGF I, IGF II, bFGF, HB-EGF, or any
combination thereof.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-43-
The effective amounts of these compounds may vary according to a variety of
factors such as the individual's condition, weight, sex and age and the mode
of
administration. This amount of test compound can be determined experimentally
by methods
well-known in the art such as by establishing a matrix of dosages and
frequencies and
assigning a group of experimental subjects to each point in the matrix.
Methods of Dia nosis
According to the present invention, decreased levels of Cyr61 mRNA or
protein as compared to levels normally expressed in myometrial tissues can be
detected to
diagnose a Cyr61 associated disease, such as uterine leiomyomas. In the
present invention,
the level of Cyr61 mRNA or protein in suspect tissue is compared to the level
of Cyr61
mRNA or protein present in normal myometrial tissue obtained from the same
individual
(i. e., autologous myometrial tissue). A lower level of Cyr61 protein and
Cyr61 mRNA in the
suspect tissue compared to the normal tissue indicates the presence of uterine
leiomyoma.
Preferably, Cyr61 mRNA level or Cyr61 protein levels in the suspect tissue is
equal to or
greater than 3 fold lower than in normal tissue. More preferably the level is
from about 9 to
about 10 fold lower than in normal tissue. Lower levels may be used to develop
treatment
regimens that also include at least two treatment methods in addition to the
Cyr61 related
treatments disclosed herein. Levels of Cyr61 mRNA and Cyr61 protein in suspect
tissues are
compared to normal tissues by normalizing the level of additional mRNAs and
proteins (e.g.,
GAPDH) present in the cells.
The various methods for detecting such decreased levels of Cyr61 mRNA or
protein expression include, but are not limited to, Northern blots, i~c situ
hybridization studies,
Western blots, ELISA, radioimmunoassay,"sandwich" immunoassays,
immunoradiometric
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-44-
assays, gel diffusion precipitation reactions, immunodiffusion assays, i~ situ
immunoassays
(using colloidal gold, enzyme or radioisotope labels, for example),
precipitation reactions,
complement fixation assays, immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc.
Nucleic Acid Assays
The DNA may be obtained from any cell source. DNA is extracted from the
cell source or body fluid using any of the numerous methods that are known in
the art. It will
be understood that the particular method used to extract DNA will depend on
the nature of
the source. Generally, the minimum amount of DNA to be extracted for use in
the present
invention is about 25 pg (corresponding to about 5 cell equivalents of a
genome size of 4 x
109 base pairs). Sequencing methods are described in detail, supra.
In another alternate embodiment, RNA is isolated from biopsy tissue using
methods known to those of ordinary skill in the art such as, for example,
guanidium
thiocyanate-phenol-chloroform extraction (Chomocyznski et al., Anal. Biochem.,
162:156,
1987). The isolated RNA is then subjected to coupled reverse transcription and
amplification
by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers
that are
specific for a selected site. Conditions for primer annealing are chosen to
ensure specific
reverse transcription and amplification; thus, the appearance of an
arriplification product is
diagnostic of the presence of a particular genetic variation. In another
embodiment, RNA is
reverse-transcribed and amplified, after which the amplified sequences are
identified by, e.g.,
direct sequencing. In still another embodiment, cDNA obtained from the RNA can
be cloned
and sequenced to identify a mutation.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-45-
Protein Assays
In an alternate embodiment, tissue is obtained from a subject. Antibodies that
are capable of specifically binding to Cyr61 are then contacted with samples
of the tissue to
determine the presence or absence of a Cyr61 polypeptide specified by the
antibody. The
antibodies may be polyclonal or monoclonal, but preferably are monoclonal.
Measurement of
specific antibody binding to cells may be accomplished by any known method,
e.g.,
quantitative flow cytometry, enzyme-linked or fluorescence-linked immunoassay,
Western
analysis, and the like. Generally, the minimum amount of protein to be
extracted, for
immunoassays, for use in the present invention is about 20 fig.
Immunoassay technology, e.g., as described in U.S. Patent Nos. 5,747,274 and
5,744,358, and particularly solid phase "chromatographic" format immunoassays,
are
preferred for detecting proteins in blood or blood fractions.
Pharmaceutical Compositions
The test compounds, salts thereof, antibodies, proteins, expression vectors
and
antisense constructs may be formulated into pharmaceutical compositions. The
pharmaceutical composition comprises a therapeutically or stimulating
effective amount of at
least one of the above. This can be an amount effective to increase Cyr61
expression or
activity, transcrption of the Cyf 61 gene, or the Cyr61 protein within the
targeted cells.
Compositions can comprise Cyr61 protein or fragments of the protein. Fragments
of the
Cyr61 protein will preferably retain the functional activities associated with
the full length
protein. In a specific embodiment, the C-terminal region of the Cyr61 protein
may be altered,
deleted, or mutated to increase or decrease Cyr61 protein expression or
function.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-46
The pharmaceutical compositions also typically include a pharmaceutically
acceptable carrier (or dosing vehicle), such as ethanol, glycerol, water, and
the like.
Examples of such carriers and methods of formulation are described in
Remington's
Pharmaceutical Sciences, 18th edition (1990), Mack Publishing Company.
The pharmaceutical composition may also include other additives, such as a
flavorant, a sweetener, a preservative, a dye, a binder, a suspending agent, a
colorant, a
disintegrant, an excipient, a diluent, a lubricant, a plasticizer, or any
combination of any of
the foregoing. Suitable binders include, but are not limited to, starch;
gelatin; natural sugars,
such as glucose and beta-lactose; corn sweeteners; natural and synthetic gums,
such as acacia,
tragacanth, and sodium alginate; carboxymethylcellulose; polyethylene glycol;
waxes; and the
like. Suitable lubricants include, but are not limited to, sodium oleate,
sodium stearate,
magnesium steaxate, sodium benzoate, sodium acetate, sodium chloride and the
like. Suitable
disintegrators include, but are not limited to, starch, methyl cellulose,
agar, bentonite, xanthan
gum and the like.
Suitable salts of the test compounds include, but are not limited to, acid
addition salts, such as those made with acids, such as hydrochloric,
hydrobromic, hydroiodic,
perchloric, sulfuric, nitric, a phosphoric, acetic, propionic, glycolic,
lactic pyruvic, malonic,
succinic, malefic, fumaric, malic, tartaric, citric, benzoic, carbonic
cinnamic, mandelic,
methanesulfonic, ethanesulfonic, hydroxyethanesulfonic, benezenesulfonic, p-
toluene
sulfonic, cyclohexanesulfamic, salicyclic, p-aminosalicylic, 2-phenoxybenzoic,
and
2-acetoxybenzoic acid; and salts made with saccharin. Other suitable salts of
the compounds
include, but are not limited to, alkali metal salts, such as sodium and
potassium salts; alkaline
earth metal salts, such as calcium and magnesium salts; and salts formed with
organic
ligands, such as quaternary ammonium salts.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-47
Representative salts include, but are not limited to, acetate,
benzenesulfonate,
benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, calcium
edetate, camsylate,
carbonate, chloride, clavulanate, citrate, dihydrochloride, edetate,
edisylate, estolate, esylate,
fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate,
hexylresorcinate,
hydrabamine, hydrobromide, hydrochloride, hydroxynaphthoate, iodide,
isothionate, lactate,
lactobionate, laurate, malate, maleate, mandelate, mesylate, methylbromide,
methylnitrate,
methylsulfate, mutate, napsylate, nitrate, N-methylglucamine ammonium salt,,
oleate,
pamoate (embonate), palmitate, pantothenate, phosphate/diphosphate,
polygalacturonate,
salicylate, stearate, sulfate, subacetate, succinate, tannate, tartrate,
teoclate, tosylate,
triethiodide and valerate salts of the compounds of the present invention.
The present invention includes prodrugs of the test compounds. Prodrugs
include, but are not limited to, functional derivatives of the test compounds
of the present
invention which are readily convertible ih vivo into the Compounds of the
present invention.
Conventional procedures for the selection and preparation of suitable prodrug
derivatives are
described, for example, in "Design of Prodrugs", ed. H. Bundgaard, Elsevier,
1985.
The pharmaceutical compositions may be formulated as unit dosage forms,
such as tablets, pills, capsules, boluses, powders, granules, sterile
parenteral solutions or
suspensions, sterile LV. solutions, sterile LM. solutions, sterile
intrauterine solutions, elixirs,
tinctures, metered aerosol or liquid sprays, drops, ampoules, autoinjector
devices or
suppositories for oral, parenteral, intranasal, occular, mucosal, transdermal,
bucal, topical,
sublingual or rectal administration or for administration by inhalation or
insufflation, for
example. The unit dosage form may be in a form suitable for sustained or
delayed release,
such as, for example, an insoluble salt of the compound, e.g. a decanoate
salt, adapted to
provide a depot preparation for intramuscular injection.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-48-
Solid unit dosage forms may be prepared by mixing the compound of the
present invention with a pharmaceutically acceptable carrier and any other
desired additives
to form a solid preformulation composition. Examples of suitable additives for
solid unit
dosage forms include, but are not limited to, starches, such as corn starch;
lactose; sucrose;
sorbitol; talc; stearic acid; magnesium steaxate; dicalcium phosphate; gums,
such as vegetable
gums; and pharmaceutical diluents, such as water. The solid preformulation
composition is
typically mixed until a homogeneous mixture of the compound of the present
invention and
the additives is formed, i. e., until the compound is dispersed evenly
throughout the
composition, so that the composition may be readily subdivided into equally
effective unit
dosage forms. The solid preformulation composition is then subdivided into
unit dosage
forms of the type described above.
Tablets or pills can also be coated or otherwise compounded to form a unit
dosage form which has prolonged action, such as time release and sustained
release unit
dosage forms. For example, the tablet or pill can comprise an inner dosage and
an outer
dosage component, the latter being in the form of an envelope over the former.
The two
components can be separated by an enteric layer which serves to resist
disintegration in the
stomach and permits the inner component to pass intact into the duodenum or to
be delayed in
release. The compound may be released immediately upon admiustration or may be
formulated such that the compound is released in a sustained manner over a
specified time
.20 course, such as, for example, 2-12 hours.
Liquid unit dosage forms include, but are not limited to, aqueous solutions;
suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions
with edible oils,
such as cottonseed oil, sesame oil, coconut oil or peanut oil, as well as
elixirs and similar
pharmaceutical vehicles. Suitable dispersing and suspending agents for aqueous
suspensions
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-49
include, but are not limited to, synthetic and natural gums, such as
tragacanth, acacia,
alginate, dextran, sodium carboxymethylcellulose, methylcellulose, polyvinyl-
pyrrolidone and
gelatin.
Suitable pharmaceutically acceptable carriers for topical preparations
include,
but are not limited to, alcohols, aloe vera gel, allantoin, glycerine, vitamin
A and E oils,
mineral oil, PPG2 myristyl propionate, and the like. Such topical preparations
may be liquid
drenches, alcoholic solutions, topical cleansers, cleansing creams, skin gels,
skin lotions, and
shampoos in cream or gel formulations (including, but not limited to aqueous
solutions and
suspensions). Typically, these topical preparations contain a suspending
agent, such as
bentonite, and optionally, an antifoaming agent. Generally, topical
preparations contain from
about 0.005 to about 10% by weight and preferably from about 0.01 to about 5%
by weight of
the compound, based upon 100% total weight of the topical preparation.
Pharmaceutical compositions of the present invention for administration
parenterally, and in particular by injection, typically include an inert
liquid carrier, such as
water; vegetable oils, including, but not limited to, peanut oil, cotton seed
oil, sesame oil, and
the like; and organic solvents, such as solketal, glycerol formal and the
like. A preferred
liquid carrier is vegetable oil. These pharmaceutical compositions may be
prepared by
dissolving or suspending the compound of the present invention in the liquid
carrier.
Generally, the pharmaceutical composition for parenteral administration
contains from about
0.005 to about 10% by weight of the compound of the present invention, based
upon 100%
weight of total pharmaceutical composition.
The compounds of the present invention can also be administered in the form
of liposome delivery systems, such as small unilamellar vesicles, large
unilamellar vesicles
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-50
and multilamellar vesicles. Liposomes can be formed from a variety of
phospholipids, such
as cholesterol, stearylamine or phosphatidylcholines.
Compounds of the present invention may also be delivered by the use of
monoclonal antibodies as individual carriers to which the compound molecules
are coupled.
The compounds of the present invention may also be coupled with soluble
polymers as
targetable drug carriers. Such polymers include, but are not limited to,
polyvinylpyrrolidone,
pyran copolymer, polyhydroxypropylmethacrylamidephenol,
polyhydroxyethylaspartamidephenol, and polyethyleneoxideopolylysine
substituted with
palmitoyl residues. Furthermore, the compounds of the present invention may be
coupled to
biodegradable polymers for controlling the release of the compound, for
example, polylactic
acid, polyepsilon caprolactone, polyhydroxy'butyric acid, polyorthoesters,
polyacetals,
polydihydropyrans, polycyanoacrylates and cross-linked or amphipathic block
copolymers of
hydrogels.
The pharmaceutical compositions of the present invention may be
administered to an animal, preferably a human being, in need thereof to
stimulate Cyr61
transcription or expression such as, for example, through activation of a
steroid or growth
factor receptor, or the like.
The effective amounts of the active agents and active metabolites of the
active
agents of the pharmaceutical composition of the present invention may vary
according to a
variety of factors such as the individual's condition, weight, sex and age and
the mode of
administration. This amount of test compound can be determined experimentally
by methods
well-known in the art such as by establishing a matrix of dosages and
frequencies and
assigning a group of experimental subjects to each point in the matrix.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-51-
The compound of the present invention may be administered alone at
appropriate dosages defined by routine testing in order to obtain optimal
activity while
minimizing any potential toxicity. In addition, co-administration or
sequential administration
of other active agents may be desirable.
The daily dosage of the compounds of the present invention may be varied
over a wide range. For oral administration, the pharmaceutical compositions
are preferably
provided in the form of scored or unscored tablets for the symptomatic
adjustment of the
dosage to the patient to be treated. The dosage amount may be adjusted when
combined with
other active agents as described above to achieve desired effects. On the
other hand, unit
dosage forms of these various active agents may be independently optimized and
combined to
achieve a synergistic result wherein the pathology is reduced more than it
would be if either
active agent were used alone.
Advantageously, the pharmaceutical compositions may be administered in a
single daily dose, or the total daily dosage may be administered in divided
doses of two, three
or four times daily.
For combination treatment with more than one active agent, where the active
agents are in separate dosage formulations, the active agents can be
administered
concurrently, or they each can be administered at separately staggered times.
Gene Therany
The lack of Cyr61 expression in leiomyomas may also be due to allelic loss or
alterations of chromosome 1p22-p31 in which the gene is located, abrogation of
the estrogen
or growth factor-signalling pathway, and/or mutations of the ER and growth
factor response
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-52-
elements contained within the promoter region. Providing the host with an
alternative copy
of Cyr61 may overcome any mutations in the gene that may be naturally
occurring.
In a specific embodiment, vectors comprising a sequence encoding a Cyr61 of
the invention are administered to treat or prevent a disease or disorder
associated with the
lack of expression of a functional Cyr61 protein or expression of a mutated
Cyr61.
Any of the methods for gene therapy available in the art can be used according
to the present invention. Exemplary methods are described below.
For general reviews of the methods of gene therapy, see, Goldspiel et al.,
Clinical Pharmacy, 1993, 12:488-505; Wu and Wu, Biotherapy, 1991, 3:87-95;
Tolstoshev,
Ann. Rev. Pharmacol. Toxicol., 1993, 32:573-596; Mulligan, Science, 1993,
260:926-932;
and Morgan and Anderson, Ann. Rev. Biochem., 1993, 62:191-217; May, TIBTECH,
1993,
11:155-215). Methods commonly known in the art of recombinant DNA technology
that can
be used are described in Ausubel et al., (eds.), 1993, Current Protocols in
Molecular Biology,
John Wiley & Sons, NY; I~riegler, 1990, Gene Transfer and Expression, A
Laboratory
Manual, Stockton Press, NY; and in Chapters 12 and 13, Dracopoli et al.,
(eds.), 1994,
Current Protocols in Human Genetics, John Wiley & Sons, NY. Vectors suitable
for gene
therapy are described above.
In one aspect, the therapeutic vector comprises a nucleic acid that expresses
Cyr61 in a suitable host. In particular, such a vector has a promoter
operationally linked to
the coding sequence for Cyr61. The promoter can be inducible or constitutive
and,
optionally, tissue-specific. In specific embodiments of the present invention,
the promoters
are the estrogen response element or the fibroblast growth factor response
element. In
another embodiment, a nucleic acid molecule is used in which the antibody
coding sequences
and any other desired sequences are flanked by regions that promote homologous
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-53-
recombination at a desired site in the genome, thus providing for
intrachromosomal
expression of Cyr61 (Koller and Smithies, Proc. Natl. Acad. Sci. USA, 1989,
86:8932-8935;
Zijlstra et al., Nature, 1989, 342:435-438).
Delivery of the vector into a patient may be either direct, in which case the
patient is directly exposed to the vector or a delivery complex, or indirect,
in which case, cells
are first transformed with the vector ih vitro then transplanted into the
patient. These two
approaches are known, respectively, as ih vivo and ex vivo gene therapy.
In a specific embodiment, the vector is directly administered in vivo, where
it
enters the cells at the organism and mediates expression of Cyr61. This can be
accomplished
by any of numerous methods known in the art, e.g., by constructing it as part
of an
appropriate expression vector and admiustering it so that it becomes
intracellular, e.g., by
infection using a defective or attenuated retroviral or other viral vector
(see, U. S. Patent No.
4,980,286), or by direct injection of naked DNA, or by use of microparticle
bombardment
(e.g., a gene gun; Biolistic, Dupont); or coating with lipids or cell-surface
receptors or
transfecting agents, encapsulation in biopolymers (e.g., poly-*-1-*4-N-
acetylglucosamine
polysaccharide; see, U.S. Patent No. 5,635,493), encapsulation in liposomes,
microparticles,
or microcapsules; by administering it in linkage to a peptide or other ligand
known to enter
the nucleus; or by administering it in linkage to a ligand subject to receptor-
mediated
endocytosis (see, e.g., Wu and Wu, J. Biol. Chem., 1987, 62:4429-4432), etc.
In another
embodiment, a nucleic acid -ligand complex can be formed in which the ligand
comprises a
fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to
avoid lysosomal
degradation. In yet another embodiment, the nucleic acid can be targeted ih
vivo for cell
specific uptake and expression, by targeting a specific receptor (see, e.g.,
PCT Publication
Nos. WO 92/06180, WO 92/22635, WO 92/20316 and WO 93/14188). Alternatively,
the
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-54-
nucleic acid can be introduced intracellularly and incorporated within host
cell DNA for
expression by homologous recombination (Koller and Smithies, Proc. Natl. Acad.
Sci.
U.S.A., 1989, 86:8932-8935; Zijlstra, et al., Nature, 1989, 342:435-438).
These methods are
in addition to those discussed above in conjunction with "Viral and Non-viral
Vectors".
Alternatively, single chain antibodies can also be administered, for example,
by expressing nucleotide sequences encoding single-chain antibodies within the
target cell
population by utilizing, for example, techniques such as those described in
Marasco et al.
Proc. Natl. Acad Sci. USA, 1993, 90:7889-7893).
The form and amount of therapeutic nucleic acid envisioned for use depends
on the type of disease and the severity of the desired effect, patient state,
etc., and can be
determined by one skilled in the art.
EXAMPLES
The present invention will be better understood by reference to the following
Examples, which are provided by way of exemplification and not by way of
limitation.
Matef°ials Anti-Cyr61 polyclonal antisera were generated at the
Louisiana State University
Medical Center Core Facilities (Baton Rouge, LA) to amino acids 371-381
(RLFNDIHKFRD; SEQ ID N0:3) of human Cyr61 (Figure 7; SEQ ID NO:2) protein. A
cysteine was added to the N-terminus for coupling to carrier proteins.
Peptides were
synthesized using an automated phase peptide synthesizer using 9-
fluorenyhnethyloxycarbonyl (Fmoc) chemistry (PE biosystems 9050 +). A Waters
Delta Prep
400 preparative chromatography system, with a C18 Phenomenex Jupiter column
(250 x
21.20 mm, 10~, diameter) equipped with a photo diode array detector was used
to purify the
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-5 S-
peptide. A flow rate, through the column, in excess of 100 mL/min purified
about 40.0-500
mgs of peptide. The identity and purity of the antigenic peptide was evaluated
using a PE
Biosystem DE-MALDI mass spectrometer. Peptide was subsequently coupled to
heyhole-
limpet hemocyanin and mixed with an equal volume of Complete and Incomplete
Feund's
. Adjuvant.
The mixture was then injected into female New Zealand white rabbits (200 ~g
antigen and adjuvant mixture/rabbit). On days 14 and 28, rabbits were
administered a booster
injection that was the same size as the initial injection. On day 38, blood
from rabbits was
tested using an ELISA (using a StrepavidinBiotin system) for antibody
presence. If an
increased antibody titer is required, rabbits were administered a booster
injection that was the
same sample size as the initial injection on day 42. Serum was collected from
the rabbits on
day 52 and frozen.. Polyclonal antibodies were affinity purified by attaching
the antigen to a
stationary phase (Sulfo-Link Resin, Pierce) using the side chain of cysteine.
Approximately
30 mL of serum was loaded through the column and then washed out to remove non-
binding
proteins. Antibodies were eluted with 3.5 M MgCl2/ethyl glycol. Eluted
proteins are
dialyzed and then concentrated to approximately 1 mg/mL. Concentration is
determined by
OD at 280 mm.
17[3-estradiol (E2) was purchased from Sigma-Aldrich (St. Louis, Missouri),
the progesterone receptor agonist, 85020, was obtained from NEN Life Science
Product, Inc.
(Boston, Massachusetts), bFGF was purchased from R 8c D Systems, Inc.
(Minneapolis,
Minnesota) and the ER antagonist ICI 182,780 was generously provided by Zeneca
Pharmaceuticals (Wilmington, Delaware).
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-56
Stud subiects av~d~tissue~~ocu~emev~t Uterine leiomyomas and matched
myometrial
specimens were obtained according to protocols approved by the Institutional
Review Boards
following routine hysterectomy at the Department of Obstetrics and Gynecology,
Pennsylvania Hospital. Tissue samples were provided from patients between the
ages of 38
to 53 (median age = 45) who were not on hormone replacement therapy nor
prescribed
gonadotropin releasing hormone agonists (n=38). All but one patient had
experienced normal
menstrual cycles prior to surgery. Tissue specimens were immediately frozen in
liquid
nitrogen following hysterectomies for total RNA isolation or fixed in 10%
neutral-buffered
formalin for i~c situ hybridization. Tissues for ex vivo culturing were placed
in phenol-red
free DMEM/Ham's F12 media (Gibco BRL, Rockville, Maryland) containing 100 U/ml
penicillin, 100 mg/ml streptomycin, and 250 ng/ml amphotericine B as a
fungizone and
transported on ice.
Identification of re Mated ~eues using rapid analysis of di~'fereutial
exp~essioh RAI~E~.
BADE was performed as previously reported (Liang P, Pardee AB. 1997. Methods
Ih
Molecular Biology. Humana Press, page150). Briefly, total RNA isolated from
matched
leiomyoma and myometrial tissues (n=4) was used for BADE analysis and each RNA
sample
was analyzed in duplicate. Synthesis of cDNAs was accomplished by using
p(dT)1g
oligonuceotides ending with either A, G, or C. Following cDNA synthesis, genes
were
amplified using a combination of random oligomers, appropriate p(dT)18
downstream
primers, and 35S labeled dATP. The resulting products were amplified in
duplicates,
separated on SDS polyacrylamide sequencing gels and detected by
autoradiography. After
the procedure was repeated, candidate cDNA fragments were extracted from
polyacrylamide
gel slices and amplified by PCR using the appropriate pair of the primers.
Amplified
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-57-
products were resolved by agarose gel electrophoresis, subcloned into pBR322,
sequenced
using ABI 377/373 sequencers and were analyzed using BLASTN software (Altschul
et al.
Nucleic Acids Research, 1997, 25:3389-3402).
BADE analysis of total RNA demonstrated decreased expression of a 410
nucleotide cDNA fragment in 4 out of 4 leiomyoma specimens compared to matched
myometrial controls (Figure 1A). Sequence analysis using BLASTN software
demonstrated
that the cDNA fragment was 96% homologous to the C-terminal portion of human
Cyr61.
Northern blotting, or Cy~61 and ER a Total cellular RNA was isolated from
myometrial and
leiomyoma tissue homogenates by guanidium isothiocynate lysis followed by
phenol/chloroform extraction. Subsequently, total cellular RNA (20 fig) was
subjected to
electrophoresis in a 1% agarose gel containing 1 M formaldehyde. Separated RNA
transcripts were transferred onto nylon membranes by capillary electrophoresis
and
subsequently prehybridized at 60 °C in RapidHyb hybridization solution
(Amersham,
Arlington Heights, Illinois). A 0.41 kb human Cyr61 cDNA fragment was
radiolabeled with
[oc-3zP]-dCTP (3,000 Ci/mmol) using the random-primer technique (Rediprime II,
Amersham) and used as the hybridization probe. The radiolabeled probe (1x106
cpm/ml) was
hybridized to membranes for 4 h at 60 °C. Membranes were washed twice
in lxSSPE (0.15
M NaCI, 1 ~M EDTA, and 0.01 M sodium phosphate, pH 7.4) and 0.1% SDS for 15
min at
°C, followed by a final wash in O.IxSSPE and 0.1% SDS for 5 min at 60
°C. For estrogen
20 receptor oc (ERoc) expression, membranes were reprobed with a 1.96 kb human
ERcc cDNA
(1.96 kb full length coding region) that was radiolabeled with [a-3zP]-dCTP
(3,OOOCi/mmol),
hybridized and washed as described above. Relative levels of Cyr61 were
normalized to
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) after reprobing membranes
with a 3zP-
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-58-
radiolabeled oligonucleotide according to manufacturers protocol (endlabeling
kit,
GibcoBRL, Rockville, Maryland).
Northern analysis using total RNA isolated from 10 patients was performed.
Cyr61 transcripts were markedly diminished in leiomyoma specimens when
compared to
autologous myometrium in 10 out of 10 patients (Figure 1B) studied. The
decrease in Cyr61
mRNA, normalized to GAPDH mRNA levels, was greater than 9 fold compared to the
high
basal levels present in autologous myometrium (Figure 1D).
Pr~oteih extraction aid immunoblottin~ fog Cyr~61 Tissue protein extracts were
prepared from
leiomyoma and matched myometrial tissue specimens by homogenization in 50 mM
Tris,
pH8.0, 250 mM NaCI, 1.0 % Nonidet P-40, 1.0% Trtion-X 100, 2% SDS, 0.5%
deoxycholate, 1 mM EDTA, and a protease inhibitor cocktail containing 10
~,g/ml pepstatin,
aprotinin, and leupeptin (Sigma, St. Louis, Missouri). Protein extracts (20
p,g) were subjected
to SDS-polyacrylamide gel electrophoresis under reducing conditions in 10% bis-
acrylamide
and electrophoretically transferred to polyvinyl difluoride membrane
(Immobilon-P, Biorad,
Redding, California). Membranes were blocked with 5% dry milk on TBS/0.1%
Tween-20
(TBST), and incubated with anti-Cyr61 pAb (10 ~g/ml). Primary antibody binding
was
detected using a donkey anti-rabbit IgG antibody conjugated to horseradish
peroxidase (HRP)
and an enhanced chemiluminescence detection system (Amersham). In order to
normalize
protein levels, Cyr61 western blots were subsequently reprobed with a pan-
actin monoclonal
antibody (Sigma) and detected with a donkey anti-mouse secondary antibody
conjugated to
HRP.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-59-
Immunoblot analysis of whole cell lysates generated from leiomyoma and
matched myometrial controls demonstrated a greater than 10 fold decrease in
Cyr61 protein
levels in 10 out of 10 patients studied (Figure 2A and C).
In situ hybridization For riboprobe synthesis, a 0.28 kb human Cyr61 cDNA
fragment was
positionally cloned into the EcoRI and Hind III sites of pGEM4Zf plasmid
(Promega Corp,
Madison, Wisconsin) to generate pGEM4Zf/Cyr6l. Radiolabeled 35S-UTP sense and
antisense cRNA transcripts were transcribed i~r vitr°o with T3 and T7
RNA polymerases,
respectively, using the Gemini Riboprobe system (Promega). Ih situ
hybridization was
performed as described previously, using formalin-fixed leiomyoma and matched
myometrial
specimens. Briefly, processed slides were hybridized overnight with 100-150 ~l
of an
antisense or sense (control) riboprobe at 4.7 x 106 DPM/slide in 50% formamide
hybidization
mixture including 5% dextran sulfate and 200 mM dithiothreitol (DTT) at 55
°C in a
humidified chamber containing 50% formamide/600 mM NaCI. Slides were washed
three
times at room temperature in 2 x SSG (0.3 M NaCI, 0.03 M sodium citrate, pH
7.0)/10 mM
DTT, followed by RNase A (20 ~,g/ml) treatment for 30 minutes at 37 °C,
and washed for 15
min in 0.1 x SSC at room temperature. Slides were further washed at 65
°C with O.lx SSC
and dehydrated with a graded series of alcohol:ammonium acetate (70%, 95%, and
100%).
Air-dried slides were exposed to X-ray film (Amersham) for 3 days for
preliminary
examination and then dipped in NTB2 nuclear emulsion (Eastman Kodak,
Rochester, New
York) diluted 1:1 with 600 mM ammonium acetate. Slides were exposed for 31
days in light-
tight, black desiccated boxes, photographically processed, stained in cresyl
violet and
coverslipped.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-60-
A relatively high level of Cyr61 expression was observed in spleen when
compared to the uterus (Figure 3A). Furthermore, in addition to the uterine
myometrium,
analysis of other human muscle tissues revealed high basal expression in
skeletal muscle,
heart and bladder while relatively lower levels were detected in colon, small
intestine,
stomach, and prostate (Figure 3B). Therefore, high constitutive expression of
Cyr61 appears
to be a characteristic feature of organs such as the heart, bladder, and
uterus that are
comprised primarily of smooth and skeletal muscle cells. In order to determine
the precise
cell types in which Cyr61 is expressed in the uterus, additional in situ
hybridization
experiments were performed. In 6 out of 6 patients high levels of Gyr61 mRNA
were
detected in myometrial cells (Figures 4 A and C). However, Cyr61 transcripts
were
dramatically decreased in leiomyoma smooth muscle cells (Figures 4 B and D)
from the same
6 patients. The signal from control slides hybridized with the sense probe
gave no apparent
signals (Figure 4 E and F). High basal levels of Cyr61 transcripts were also
observed in
stromal but not vascular endothelial or glandular epithelial cells in the
uterus (data not
shown). High basal expression of Cyr61 is primarily confined to uterine smooth
muscle cells
in healthy myometrium while in leiomyomas it is absent.
Tissue tr°eatmeht with sex steroids avid ~~wth factors Tissue specimens
obtained as
described above were immediately minced into 1-2 mm pieces using sterilized
scalpels and
forceps and placed in phenol-red free DMEM/Ham's F 12 containing antifungal
and antibiotic
agents only. Samples were treated ex vivo with either 10 nM E2, 10 nM R5020, a
combination of 10 nM EZ and 10 nM R5020, 1 ~M ICI 182,780 (ICI), a combination
of 10
nM Ez and 1 ~.M ICI 10 ng/ml bFGF, 10% charcoal stripped serum (CSS), or
ethanol vehicle
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-61-
for 1 h at 37 °C under 95% air/5% COZ. Treated tissue specimens were
harvested and snap
frozen in liquid nitrogen prior to RNA isolation and Northern blotting.
Freshly obtained leiomyoma and matched myometrial explants (n=8) were
treated ex vivo with 10 nM E2, 10 nM 85020, or a combination of 10 nM EZ and
10 nM
85020. As a positive control, explants were stimulated with 10 ng/ml bFGF
which induces
Cyr61 in cell types such as marine and human fibroblasts (Nathans et al. Cold
Spring Harbor
Symp. Quant. Biol., 1988, 53:893-900). E2 treatment resulted in a greater than
2 fold increase
in Cyr61 transcript levels within 1 h in myometrial tissue, whereas the
synthetic progesterone
receptor agonist, 85020, had no effect on Cyr61 expression, nor did it
synergize with EZ
(Figures 5 A and G). The EZ mediated induction of Cyr61 was ER dependent as it
was
completely inhibited by the pure ER antagonist, ICI 182,780 (Figure SA).
Furthermore,
Cyr61 expression was enhanced greater than 3 fold when myometrial explants
were treated
with either bFGF (Figures SA and G) or serum (data not shown) for 1 h.
However, neither EZ
nor bFGF was able to upregulate Cyr61 in leiomyoma tissues as observed in
myometrial
controls (Figures 5 D and G). The latter phenomenon was not due to the lack of
ERa expression which was consistently 2 fold higher in leiomyoma explants when
compared
to autologous myometrium (Figures SB and E). Therefore, in addition to bFGF
and serum,
Cyr61 is rapidly induced by 17[3-estradiol in human mymometrial tissue but not
in
leiomyoma tumors.
Protocol fog Sy~tlzesis ahd Purification o~fRecombihant Human Cy~6l. The SmaI-
HindIII
fragement (nucleotides 100-1649) of the human Cyr61 cDNA, which encompasses
the entire
open reading frame, was cloned into pBlueBac4 bacluovirus expression vector
(Invitrogen).
Recombinant baculovirus clones were obtained, plaque-purified and amplified
through three
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-62-
passages of S~3 insect cell infection as described (Summers and Smith, Tex.
Ag~ic. Exp. Sth.
Bull.: 1555: 1-55 (1997)). Sf cells were seeded at 2-3 x 106 cells/P150 in
serum-free s~00-II
medium as monolayer cultures and were seeded at 2-3 x 106 cells/P150 in serum-
free s~00-II
medium as monolayer cultures and were infected with 5 plaque forming units
(PFU) of
recombinant virus per cell. The conditioned medium (comprising recombinant
human Cyr61
protein) was collected 48 and 96 h post-infection, cleared by centrifugation
(15,000 x g for 5
minutes) and adjusted to SOmM morpholineethansulfonic acid (MES), pH=6.0 1mM
phenylmethylsulfonyl fluoride (PMSF) and 1mM EDTA, pH=8. The medium was mixed
with Sepharose S beads equilibrated with loading buffer (50mM MES, pH 6.0 1mM
PMSF,
150mM NaCI) at Sml of Sepharose S/SOOmI of conditioned medium and the proteins
were
allowed to bind to the Sepharose S in a batch at 4°C overnight with
gentle stirring.
Sepharose S beads were collected by sedimentation without stirring for 20 min.
and applied
to a column. The column was washed with six volumes of the loading buffer
adjusted to
0.3M NaCI and the bound proteins were eluted from the column with a step
gradient of NaCI
(0.4-0.8M) in the loading buffer.
Statistical analysis Values derived from densitometric measurements of RNA
bands detected
on Northern blots were analyzed using SAS statistical software (SAS Inc.,
Cary, North
Carolina) for significance using an one-way analysis of variance (ANOVA) for a
factorial
experimental design. The multicomparison significance level for the one-factor
analysis of
vaxiance was 0.05. If significance was achieved by one-way analysis, post-
ANOVA
comparison of means was performed using Scheffe' F tests (Norman and Streiner,
Biostatistics The Base Essevctials. St. Louis, Missouri: Mosby Press, 1994,
58pp).
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
-63-
The patents, applications, test methods, and publications mentioned herein are
hereby incorporated by reference in their entirety.
Many variations of the present invention will suggest themselves to those
skilled in the art in light of the above detailed description. All such
obvious variations are
within the full intended scope of the appended claims.
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
1/3
SEQUENCE LISTING
<110> American Home Products Corporation
Zhang, 2himing
Sampath, Deepak
Zhu, Yuan
Winnekar, Richard
<120> Use of Cyr61 in the treatment and
diagnosis of human uterine leiomyomas
<130> AM100352
<140> TBA
<141> Concurrently Herewith
<150> 60/236,887
<151> 2000-09-29
<160> 3
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 1418
<212> DNA
<213> Homo Sapien
<400> 1
gggcgggcccaccgcgacac cgcgccgccaccccgaccccgctgcgcacg gcctgtccgc 60
tgcacaccagcttgttggcg tcttcgtcgccgcgctcgccccgggctact cctgcgcgcc 120
acaatgagctcccgcatcgc cagggcgctcgccttagtcgtcacccttct ccacttgacc 180
aggctggcgctctccacctg ccccgctgcctgccactgccccctggaggc gcccaagtgc 240
gcgccgggagtcgggctggt ccgggacggctgcggctgctgtaaggtctg cgccaagcag 300
ctcaacgaggactgcageaa aacgcagccctgcgaccacaccaaggggct ggaatgcaac 360
ttcggcgccagctccaccgc tctgaaggggatctgoagagctcagtcaga gggcagaccc 420
tgtgaatataactecagaat ctaccaaaacggggaaagtttccagcccaa ctgtaaacat 480
cagtgcacatgtattgatgg cgccgtgggctgcattcctctgtgtcccca agaactatct 540
ctccccaacttgggctgtcc caaccctcggctggtcaaagttaccgggca gtgctgcgag 600
gagtgggtctgtgacgagga tagtatcaaggaccccatggaggaccagga cggcctcctt 660
ggcaaggagctgggattcga tgcctccgaggtggagttgacgagaaacaa tgaattgatt 720
gcagttggaaaaggcagctc actgaagcggctccctgtttttggaatgga gcctcgcatc 780
ctatacaaccctttacaagg ccagaaatgtattgttcaaacaacttcatg gtcccagtgc 840
tcaaagacctgtggaactgg tatctccacacgagttaccaatgacaaccc tgagtgccgc 900
cttgtgaaagaaacccggat ttgtgaggtgcggccttgtggacagccagt gtacagcagc 960
ctgaaaaagggcaagaaatg cagcaagaccaagaaatcccccgaaccagt caggtttact 1020
tacgctggatgtttgagtgt gaagaaataccggcccaagtactgcggttc ctgcgtggac 1080
ggccgatgctgcacgcccca gctgaccaggactgtgaagatgcggttccg ctgcgaagat 1140
ggggagacattttccaagaa cgtcatgatgatccagtcctgcaaatgcaa ctacaactgc 1200
~
ccgcatgccaatgaagcagc gtttcccttctacaggctgttcaatgacat tcacaaattt 1260
agggactaaatgctacctgg gtttccagggcacacctagacaaacaaggg agaagagtgt 1320
cagaatcagaatcatggaga aaatgggcgggggtggtgtgggtgatggga ctcattgtag 1380
aaaggaagccttctcattct tgaggagcattaaggtat 1418
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
<210>2
<211>381
<212>PRT
<213>Homo Sapien
2/3
<400> 2
Met Ser Ser Arg Ile Ala Arg Ala Leu Ala Leu Val Val Thr Leu Leu
1 5 10 15
His Leu Thr Arg Leu Ala Leu Ser Thr Cys Pro Ala Ala Cys His Cys
20 25 30
Pro Leu Glu Ala Pro Lys Cys Ala Pro Gly Val Gly Leu Val Arg Asp
35 40 45
Gly Cys Gly Cys Cys Lys Val Cys Ala Lys Gln Leu Asn Glu Asp Cys
50 55 60
Ser Lys Thr G1n Pro Cys Asp His Thr Lys Gly Leu Glu Cys Asn Phe
65 70 75 80
Gly Ala Ser Ser Thr Ala Leu Lys Gly Ile Cys Arg Ala Gln Ser Glu
85 90 95
Gly Arg Pro Cys Glu Tyr Asn Ser Arg Ile Tyr Gln Asn Gly Glu Ser
100 105 110
Phe Gln Pro Asn Cys Lys His Gln Cys Thr Cys Ile Asp Gly Ala Val
115 120 125
Gly Cys Ile Pro Leu Cys Pro Gln Glu Leu Ser Leu Pro Asn Leu Gly
130 135 140
Cys Pro Asn Pro Arg Leu Val Lys Val Thr Gly Gln Cys Cys Glu Glu
145 150 155 160
Trp Val Cys Asp Glu Asp Ser Ile Lys Asp Pro Met Glu Asp Gln Asp
165 170 175
Gly Leu Leu Gly Lys Glu Leu Gly Phe Asp Ala Ser Glu Val Glu Leu
180 185 190
Thr Arg Asn Asn Glu Leu Ile Ala Val Gly Lys Gly Ser Ser Leu Lys
195 200 205
Arg Leu Pro Val Phe Gly Met Glu Pro Arg Ile Leu Tyr Asn Pro Leu
210 215 220
Gln Gly Gln Lys Cys Ile Val Gln Thr Thr Ser Trp Ser Gln Cys Ser
225 ~ 230 235 240
Lys Thr Cys Gly Thr Gly Ile Ser Thr Arg Val Thr Asn Asp Asn Pro
245 250 255
Glu Cys Arg Leu Val Lys Glu Thr Arg Ile Cys Glu Val Arg Pro Cys
260 265 270
Gly Gln Pro Val Tyr Ser Ser Leu Lys Lys Gly Lys Lys Cys Ser Lys
275 280 285
Thr Lys Lys Ser Pro Glu Pro Val Arg Phe Thr Tyr Ala Gly Cys Leu
290 295 ~ 300
Ser Val Lys Lys Tyr Arg Pro Lys Tyr Cys Gly Ser Cys Val Asp Gly
305 310 315 320
Arg Cys Cys Thr Pro Gln Leu Thr Arg Thr Val Lys Met Arg Phe Arg
325 330 335
Cys Glu Asp Gly Glu Thr Phe Ser Lys Asn Val Met Met Ile Gln Ser
340 345 350
Cys Lys Cys Asn Tyr Asn Cys Pro His Ala Asn Glu Ala Ala Phe Pro
355 360 365
Phe Tyr Arg Leu Phe Asn Asp Ile His Lys Phe Arg Asp
370 375 380
CA 02423413 2003-03-25
WO 02/026193 PCT/USO1/30783
3/3
<210> 3
<211> 11
<212> PRT
<213> Homo Sapien
<400> 3
Arg Leu Phe Asn Asp Ile His Lys Phe Arg Asp
1 5 10
