REACTIFS ET METHODES DIAGNOSTIQUES A BASE DE PSP94

PSP94 DIAGNOSTIC REAGENTS AND ASSAYS

Abrégé anglais

In the serum, PSP94 occurs as a free form or is associated with a
carrier protein. PSP94 in its bound form has been quantified in the
blood of prostate cancer patients and these measurements have shown
utility as evaluation of prognosis. The present invention identifies a
carrier protein to which PSP94 is bound (named PSP94-binding protein)
its purification process, its nucleic acid and amine acid sequence and
to the use of these sequences in the diagnosis and prognosis of PSP94
related disease. More particularly, the present invention discloses
improved diagnostic and prognostic assays as well as reagents useful
for the evaluation of conditions linked with abnormal or elevated
levels of PSP94, such as prostate cancer and benign prostatic
hyperplasia.

Revendications

WE CLAIM:
1. A polynucleotide comprising a member selected from the group
consisting of
a) a polynucleotide as forth in SEQ ID NO.: 1,
b) a polynucleotide as forth in SEQ ID NO.: 6,
c) a polynucleotide having sequence 1 to 1392 of SEQ ID
NO.:6,
d) a polynucleotide having sequence 1 to 1653 of SEQ ID
NO..:6,
e) a polynucleotide of a size between 10 and 2005 bases in
length identical in sequence to a contiguous portion of at
least 10 bases of the polynucleotide as set forth in SEQ
ID NO.: 1, and
f) a polynucleotide of a size between 10 and 1876 bases in
length identical in sequence to a continuous portion of at
least 10 bases of the polynucleotide as set forth in SEQ
ID NO.: 6.
2. The polynucleotide as defined in claim 1, wherein said
polynucleotide is as set forth in SEQ ID NO.:1.
3. The polynucleotide as defined in claim 1, wherein said
polynucleotide is as set forth in SEQ ID NO.: 6.
4. The polynucleotide as defined in claim 1, wherein said
polynucleotide is the has sequence 1 to 1392 of SEQ ID NO.:6.
5. The polynucleotide as defined in claim 1, wherein said
polynucleotide is the has sequence 1 to 1653 of SEQ ID NO.:6.
6. The polynucleotide as defined in claim 1, wherein said
polynucleotide is selected from the group consisting of a
polyribonucleotide, a polydeoxyribonucleotide, a modified
polyribonucleotide, a modified polydeoxyribonucleotide and a
complementary polynucleotide.
7. An isolated polypeptide selected from the group consisting of
a) a polypeptide as set forth in SEQ ID NO : 2,
b) a polypeptide as set forth in SEQ ID NO : 3,
c) a polypeptide as set forth in SEQ ID NO : 7,
104

d) a polypeptide as set forth in SEQ ID NO.: 8,
e) a polypeptide as set forth in SEQ ID NO.: 9,
f) a polypeptide of a size between 10 and 505 amino acids in
length identical to a contiguous portion of the same size
of SEQ ID NO.: 2,
g) a polypeptide of a size between 10 and 592 amino acids in
length identical to a contiguous portion of the same size
of SEQ ID NO.: 3,
h) a polypeptide of a size between 10 and 624 amino acids in
length identical to a contiguous portion of the same size
of SEQ ID NO.: 7,
i) a polypeptide analogue having at least 90 % of its amino
acid sequence identical to the amino acid sequence set
forth in SEQ ID NO.:2, in SEQ ID NO.:3, in SEQ ID NO.:7 in
SEQ ID NO.:8 or in SEQ ID NO.:9,
j) a polypeptide analog having at least 7% of its amino
acid sequence identical to the amino acid sequence set
forth in SEQ ID NO.: 2, in SEQ ID NO.:3, in SEQ ID NO.:7,
in SEQ ID NO: 8 or in SEQ ID NO.: 9,
k) a polypeptide analog having at least 50 % of its amino
acid sequence identical to the amino acid sequence set
forth in SEQ ID NO: 2 in SEQ ID NO.: 3, in SEQ ID NO.: 7, in
SEQ ID NO: 8 or in SEQ ID NO.: 9,
l) a polypeptide analogue having at least 90% of its amino
acid sequence identical to the amino acid sequence of
- a polypeptide of a length form between 10 and 505
contiguous amino acids of SEQ ID NO.: 2,
- a polypeptide of a length from between 10 and 592
contiguous amino acids of SEQ ID NO.: 3 or,
- a polypeptide of a length form between 10 and 624
contiguous amino acids of SEQ ID NO.: 7,
m) a polypeptide analogue having at least 70 % of its amino
acid sequence identical to the amino acid sequence of
- a polypeptide of a length from between 10 and 505
contiguous amino acids of SEQ ID NO.: 2,
- a polypeptide of a length form between 10 and 592
contiguous amino acids of SEQ ID NO.: 3 or,
- a polypeptide of a length from between 10 and 624
contiguous amino acids of SEQ ID NO.: 7,
n) a polypeptide analogue having at least 50% of its amino
acid sequence identical to the amino acid sequence of
105

- a polypeptide of a length from between 10 and 505
contiguous amino acids of SEQ ID NO.:2,
- a polypeptide of a length from between 10 and 592
contiguous amino acids of SEQ ID NO.:3 or,
- a polypeptide of a length from between 10 and 624
contiguous amino acids of SEQ ID NO.:7.
8. A polypeptide as defined in claim 7, wherein said polypeptide is
as set forth SEQ ID NO.: 2.
9. A polypeptide as defined in claim 7, wherein said polypeptide is
as set forth SEQ ID NO.: 3.
10. A polypeptide as defined in claim 7, wherein said
polypeptide is as set forth SEQ ID NO.:7.
11. A polypeptide as defined in claim 7, wherein said
polypeptide is as set forth SEQ ID NO.: 8.
12. A polypeptide as defined in claim 7, wherein said
polypeptide is as set forth SEQ ID NO.: 9.
13. An immunizing composition including;
a) a vector comprising a polynucleotide as defined in claim 1
and;
b) a diluent or buffer.
14. An immunizing composition as defined in claim 13, further
comprising as adjuvant.
15 An immunizing composition as defined in claim 14, further
comprising PSP94, a PSP94 variant, a PSP94 fragment, a
polynucleotide encoding PSP94, a polynucleotide encoding a PSP94
variant, a polynucleotide encoding a PSP94 fragment and
combination thereof.
16. An immunizing composition comprising;
a) a polypeptide as defined in claim 7, and;
b) a diluent or buffer.
106

17. ~An immunizing composition as defined in claim 16, further
comprising an adjuvant.
18. ~An immunizing composition as defined in claim 16, further
comprising PSP94, a PSP94 variant, a PSP94 fragment, a
polynucleotide encoding PSP94, a polynucleotide encoding a PSP94
variant, a polynucleotide encoding a PSP94 fragment and
combination thereof.
19. A method of generating an antibody to a polypeptide, said
method comprising administering to a mammal, an immunizing
composition as defined in claim 15.
20. A method of generating an antibody to a polypeptide, said
method comprising administering to a mammal, an immunizing
composition as defined in claim 18.
21. A cell that has incorporated at least one of the
polynucleotide defined in claim 1.
22. A cell that has incorporated at least one of the
polypeptide defined in claim 7.
23. A cell expressing at least one of the polypeptide defined
in claim 7.
24. The use of a polynucleotide as defined in claim 1, in the
diagnosis or prognosis of a condition linked with elevated
levels of PSP94 or PSP94-binding protein.
25. The use as defined in claim 24, wherein said
polynucleotide is as set forth in SEQ ID NO.:1.
26. The use as defined in claim 24, wherein said
polynucleotide is as set forth in SEQ ID NO.:6.
27. The use as defined in claim 24, wherein said
polynucleotide has sequence 1 to 1392 of SEQ ID NO.:6.
28. The use as defined in claim 24, wherein said
polynucleotide has sequence 1 to 1653 of SEQ ID NO.:6.
107

29. ~The use of a polypeptide as defined in claim 7 in the
diagnosis or prognosis of a condition linked with elevated
levels of PSP94 or PSP94 binding protein.
30. ~The use as defined in claim 29, wherein said polypeptide
is selected from the group consisting of SEQ ID NO.: 2, SEQ ID
NO.: 3, SEQ ID NO.: 7, SEQ ID NO.: 8 and SEQ ID NO.: 9.
31. ~The monoclonal antibody produced by the hybridoma cell
line deposited to the ATCC under Patent Deposit No.: PTA-4242
and antigen binding fragments thereof.
32. ~The monoclonal antibody produced by the hybridoma cell
line deposited to the ATCC under Patent Deposit No.: PTA-4243
and antigen binding fragment thereof.
33. ~The hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4242.
34. ~The hybridoma cell line, deposited to the ATCC under Patent
Deposit No.: PTA-4243.
35. ~A method for measuring, in a sample, the amount of a
polypeptide selected from the group consisting of SEQ ID NO.: 2,
SEQ ID NO.: 3, SEQ ID NO.: 7, SEQ ID NO.: 8 and SEQ ID NO.: 9 or
combination thereof, said method comprising contacting said
sample with a molecule able to recognize said polypeptide.
36. ~The method of claim 35, wherein said molecule is an
antibody selected from the group consisting of the monoclonal
antibody produced by the hyhridoma cell line deposited to the
ATCC under Patent Deposit No.: PTA-4242 and the monoclonal
antibody produced by the hybridoma cell lines deposited to the
ATCC under Patent deposit No.: PTA-4243.
37. ~The method of claim 35, wherein said molecule is PSP94 and
analogues thereof.
108

38. ~The method of claim 35, further comprising detecting a
signal from a label that is provided by said molecule or by a
second molecule carrying said label.
39. The method of claim 38, wherein the signal obtained for
the sample is compared with a signal obtained for a control
sample containing a known amount of at least one polypeptide
selected from the group consisting of SEQ ID NO.: 2, SEQ ID
No.:3, SEQ ID NO.:7, SEQ ID NO.:8 and SEQ ID NO.: 9 or
combination thereof.
40. ~A method for measuring, in a sample, the amount of a
polypeptide selected from the group consisting of SEQ ID NO.: 2,
SEQ ID NO.:3, SEQ ID NO. 7, SEQ ID NO.:8 and SEQ ID NO.:9 or
combination thereof that is not bound to PSF94, said method
comprising;
a) removing, from said sample, a complex formed by PSP94 and
any one of the polypeptide selected from the group
consisting of SEQ ID NO.:2, SEQ ID NO:3, SEQ ID NO.:7,
SEQ ID NO.:8 and SEQ ID NO.:9, generating a complex-free
sample, and;
b) contacting said complex-free sample with an antibody able
to recognize any one of the polypeptide selected from the
group consisting of SEQ ID NO.: 2, SEQ ID NO.:3, SEQ ID
NO.:7, SEQ ID NO.:8 and SEQ ID NO.:9.
41. The method of claim 40, wherein said antibody is selected
from the group consisting of the monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4242 and the monoclonal antibody produced by
the hybridoma cell the deposited to the ATCC under Patent
Deposit No.: PTA-4243.
42. The method of claim 40, further comprising detecting a
signal from a label than is provided by said antibody or by a
second molecule carrying said label.
43. The method of claim 42, wherein the signal obtained for
the sample is compared with signal obtained for a control sample
containing a known amount of a polypeptide selected from the
109

group consisting of SEQ ID NO,: 2, SEQ ID NO.:3, SEQ ID NO.:7,
SEQ ID NO.:8 and SEQ ID NO.:9.
44. The use of an antibody selected from the group consisting
of a monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4240, a
monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4241, a
monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4242 and a
monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4243, for
evaluating the amount of SEQ ID NO.:2, SEQ ID NO.: 3 SEQ ID
NO.:7, SEQ ID NO.:8 and :SEQ ID NO.:9 or combination thereof.
45. The use of a molecule selected from the group consisting
of a polypeptide as set forth in SEQ ID NO.: 2, SEQ ID NO.: 3,
SEQ ID NO.:7, SEQ ID NO.:8 and SEQ ID NO.:9, a monoclonal
antibody produced by the hybridoma cell line deposited to the
ATCC under Patent Deposit NO.: PTA-4240, a monoclonal antibody
produced by the hybridoma cell line deposited to the ATCC under
Patent Deposit No.: PTA-4241, a monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4242 and a monoclonal antibody produced by the
hybridoma cell line deposited to the ATCC under Patent Deposit
No.: PTA-4243, for evaluating the amount of PSP94 or for the
diagnostic of a condition linked with abnormal or elevated
levels of PSP94.
46. The use as defined in claim 45, wherein said condition is
selected from the group consisting of prostate cancer, stomach
cancer, breast cancer, endometrial cancer, ovarian cancer, other
cancers of epithelial secretion and benign prostate hyperplasia.
47. An antibody conjugate comprising a first moiety and a
second moiety, said first moiety being selected from the group
consisting of a monoclonal antibody produced by the hybridoma
cell line deposited to the ATCC under Patent Deposit No.: PTA-
4240, a monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4241, a
monoclonal antibody produced by the hybridoma cell line
110

deposited to the ATCC under Patent Deposit No.: PTA-4242 and
monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4243 and
said second moiety being selected from the group consisting of a
pharmaceutical agent, a solid support, a reporter molecule, a
group carrying a reporter molecule, a chelating agent, an
acylating agent, a cross-linking agent, and a targeting group.
48. ~The conjugate of claim 47, wherein said solid support is
selected form the group consisting of carbohydrates, liposomes,
lipids, colloidal gold, microparticles, microcapsules,
microemulsions, and the matrix of an affinity column.
49. ~The conjugate of claim 47, wherein said reporter molecule
is selected from the group consisting of a fluorophore, a
chromophore, a dye, an enzyme, a radioactive molecule and a
molecule of a binding/ligand complex.
50. ~The conjugate of claim 47, wherein said pharmaceutical
agent is selected from the group of a toxin, a drug and a pro-
drug.
51. ~A kit for use in evaluating the amount of PSP94 or for the
diagnosis of a condition linked with abnormal or elevated levels
of PSP94 comprising a container having a molecule able to
recognize PSP94.
52. ~The kit of claim 51, wherein said molecule is selected
from the group consisting of a monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4240, a monoclonal antibody produced by the
hybridoma cell line deposited to the ATCC under Patent Deposit
No.: PTA-4241, a monoclonal antibody produced by the hybridoma
cell line deposited to the ATCC under Patent Deposit No.: PTA-
4242, a monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4243 and the
antibody conjugate of claim 47.
53. ~The kit of claim 51, wherein said molecule is selected
from the group consisting of the polypeptide set forth in SEQ ID
NO.:2, the polypeptide set forth in SEQ ID NO.:3, the
111

polypeptide set forth in SEQ ID NO.:7, the polypeptide set forth
in SEQ ID NO.:8 and the polypeptide set forth in SEQ ID NO.:9.
54. The kit of claim 53, further comprising a container having
an antibody able to recognize a polypeptide selected from the
group consisting of the polypeptide set forth in SEQ ID NO.:2,
the polypeptide set forth in SEQ ID NO.:3, the polypeptide set
forth in SEQ ID NO.:7, the polypeptide set forth in SEQ ID NO.:8
and the polypeptide set forth in SEQ ID NO.:9.
55. The kit of claim 54, wherein said antibody is selected
from the group consisting of a monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4243 and a monoclonal antibody produced by the
hybridoma cell line deposited to the ATCC under Patent Deposit
No.: PTA-4242
56. A method for preparing a polypeptide selected from the
group consisting of the polypeptide set forth in SEQ ID NO.:2,
the polypeptide set forth in SEQ ID NO.:3, the polypeptide set
forth in SEQ ID NO.:7, the polypeptide set forth in SEQ ID NO.:8
and the polypeptide set forth in SEQ ID NO.:9 comprising:
a) cultivating a host cell under conditions which provide for
the expression of said polypeptide by the cell; and
b) recovering the polypeptide by one or more purification
step.
57. The method of claim 56, wherein said purification step
either alone or in combination is selected from the group
consisting of ammonium sulfate precipitation, size exclusion
chromatography, affinity chromatography, and ion-exchange
chromatography.
58. A method for preparing a polypeptide selected from the
group consisting of the polypeptide set forth in SEQ ID NO.:2,
the polypeptide set forth in SEQ ID NO.:3, the polypeptide set
forth in SEQ ID NO.:7, the polypeptide set forth in SEQ ID NO.:
8, the polypeptide set forth in SEQ ID NO.:9 and combination
thereof, comprising:
112

a) collecting one or more biological sample containing said
polypeptide; and,
b) recovering the polypeptide by one or more purification
step.
59. The method of claim 58, wherein said purification step
either alone or in combination is selected from the group
consisting of ammonium sulfate precipitation, size exclusion
chromatography, affinity chromatography, and ion-exchange
chromatography.
60. The method of claim 58, wherein said purification step
comprises;
a) adding ammonium sulfate to said biological sample,
b) performing ion-exchange chromatography
c) performing affinity-chromatography using a PSP94-
conjugated affinity matrix,
d) performing size-exclusion chromatography, and
e) recovering a fraction containing a substantially pure
PSP94-binding protein.
61. The method of claim 58, wherein said biological sample is
a serum sample, a plasma sample, a blood sample and a cell
lyzate sample.
62. A process for the purification of a PSP94-binding protein
from a sample comprising:
a) adding ammonium sulfate to said sample in a manner
as to provide precipitation of a PSP94-binding
protein,
b) centrifuging the mixture of step a) to recover
precipitated proteins,
113

c) resuspending said precipitated proteins,
d) performing ion-exchange chromatography to recover a
fraction of proteins containing a PSP94-binding
protein,
e) performing affinity-chromatography using a PSP94-
conjugated affinity matrix to recover a fraction of
proteins containing a PSP94-binding protein,
f) performing size exclusion chromatography to recover
a fraction of proteins containing a PSP94-binding
protein and;
g) recovering a fraction containing a substantially
pure PSP94-binding protein.
63. The process of claim 62, wherein said sample is human male
serum.
64. The process of claim 62, wherein the precipitation of a
PSP94-binding protein is effected by adding ammonium
sulfate to a final concentration of up to 47%.
65. The process of claim 62, wherein said ion-exchange
chromatography is performed by using an anion-exchange
chromatography matrix.
66. The process of claim 62, wherein said PSP94-binding
protein is a polypeptide defined in SEQ ID NO.:2, the
consisting of the polypeptide defined in SEQ ID NO.:2, the
polypeptide defined in SEQ ID NO.:3, the polypeptide
defined in SEQ ID NO.:7, the polypeptide defined in SEQ ID
NO.:8 and the polypeptide defined in SEQ ID NO.:9.
67. The product obtained from the process of claim 62.
68. An antibody able to recognize a PSP94 epitope that is
available even when PSP94 is bound to another polypeptide.
114

69. The antibody as defined in claim 68, wherein said
polypeptide is selected from the group consisting of SEQ ID NO.:
2, SEQ ID NO.: 3, SEQ ID NO.: 7, SEQ ID NO.:8 and SEQ ID NO.:9.
70. An antibody as defined in claim 68, wherein said antibody
is the monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit NO.: PTA-4241.
71. A hybridoma cell line producing the antibody defined in
claim 68.
72. The monoclonal antibody produced by the hybridoma cell
line deposited to the ATCC under Patent Deposit No.: PTA-4240
and antigen binding fragments thereof.
73. The monoclonal antibody produced by the hybridoma cell
line deposited to the ATCC under Patent Deposit No.: PTA-4241
and antigen binding fragments thereof.
74 The hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4240.
75. The hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4241.
76. A method for remolding PSP94 from a sample, said method
comprising;
a) contacting said sample with a molecule able to bind to
PSP94, and;
b) recuperating a sample free of PSP94.
77. The method of claim 76, wherein said molecule is selected
from the group consisting of SEQ ID NO.: 2, SEQ ID NO.:3, SEQ ID
NO.: 7, SEQ ID NO.:8, SEQ ID NO.:9, a monoclonal antibody
produced by the hybridoma cell line deposited to the ATCC under
Patent Deposit No.: PTA-4240 and a monoclonal antibody produced
by the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4241.
115

78. The method of claim 76, wherein said sample is selected
from the group consisting of blood, plasma, serum, urine,
seminal fluid, cell culture media and cell lyzate.
79. A method for removing a complex formed by PSP94 and any
one of the polypeptide defined in SEQ ID NO: 2, SEQ ID NO.:3,
SEQ ID NO.:7, SEQ ID NO.:8 or SEQ ID NO.: 9 and combination
thereof from a sample, said method comprising;
a) contacting said sample with an antibody able to recognize
an exposed epitope of said complex, and;
b) recuperating a sample free of said complex.
80. The method of claim 79, wherein said antibody is selected
from the group consisting of a monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4241, a monoclonal antibody produced by the
hybridoma cell line deposited to the ATCC under Patent Deposit
No.: PTA-4242 and a monoclonal antibody produced by the
hybridoma cell line deposited to the ATCC under Patent Deposit
No.: PTA-4243.
81. The method of claim 79, wherein said antibody is the
monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4243.
82. A method for measuring, in a sample, the total amount of
PSP94, said method comprising contacting said sample with an
antibody able to recognize PSP94 oven when PSP94 is bound to
another polypeptide.
83. The method of claim 82, wherein said antibody is the
monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit No.: PTA-4241.
84. The method of claim 82, further comprising detecting a
signal from a label that is provided by said antibody or by a
second molecule carrying said label.
85. The method of claim 84, wherein the signal obtained for
the sample is compared with signal obtained for a control sample
116

containing a known amount of PSP94, PSP94 fragments, variants or
analogues thereof.
86. An improved method for measuring the amount of free PSP94
in a sample, said method comprising;
a) removing a complex formed by PSP94 and any one of the
polypeptide selected from the group consisting of SEQ ID
NO.: 2, SEQ ID NO. 3, SEQ ID NO.:7, SEQ ID NO.:8 and SEQ
ID NO.:9 and combination thereof, generating a complex-
free sample
b) contacting said complex-free sample with an antibody able
to recognize PSP94
87. The method of claim 86, wherein said antibody is selected
from the group consisting of the monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4240 and the monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4241.
88. The method of claim 86, further comprising detecting a
signal from a label that is provided by said antibody or by a
second molecule carrying said label.
89. The method of claim 88, wherein the signal obtained for
the sample is compared with signal obtained for a control sample
containing a known amount of PSP94.
90. An improved method for measuring the amount of free PSP94
in a sample, said method comprising contacting said sample with
an antibody able to recognize PSP94.
91. The method of claim 90, wherein said antibody is selected
from the group consisting of the monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4240 and the monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC: under Patent
Deposit No.: PTA-4241.
117

92. The method of claim 90, further comprising detecting a
signal from a label that is provided by said antibody or by a
second molecule carrying said label.
93. The method of claim 92, wherein the signal obtained for
the sample is compared with signal obtained for a control sample
containing a known amount of PSP94.
94. A method for measuring the level of total PSP94 in a
sample, the method comprising using a first and a second
antibody able to bind to PSP94 even when PSP94 is bound to a
polypeptide and wherein said first and second antibody binds to
a different PSP94 epitope.
95. A method for measuring the levels of PSP94 in a sample
said method comprising contacting said sample with an antibody
that is able to recognize PSP94 in its free and bound form.
96. The method of claim 95, wherein said antibody is the
monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit NO.: PTA-4241.
97. A method for measuring total PSP94 in a sample, the method
comprising using a first and a second antibody, wherein said
first antibody is able to bind to PSP94 even when PSP94 is bound
to another polypeptide and wherein said second antibody is able
to bind to P5P94 and to displace any one of the polypeptide
selected from the group consisting of SEQ ID NO.:2, SEQ ID
NO.:3, SEQ ID NO.:9, SEQ ID NO.:8 and SEQ ID NO.:9 from a
complex formed by PSP94 and said polypeptide.
98. The method of claim 97, wherein said first antibody is the
monoclonal antibody produced by the hybridoma cell line
deposited to the APCC under Patent Deposit NO.: PTA-4241.
99. The method of claim 97, wherein said second antibody is
the monoclonal antibody produced by the hybridoma cell line
deposited to the ATCC under Patent Deposit NO.: PTA-4240.
100. The use of a molecule selected from the group consisting
of the polypeptide as set forth in SEQ ID NO.:2, SEQ ID NO.:3.
118

SEQ ID NO.:7, SEQ ID NO.:8 or SEQ ID NO,: 9, a monoclonal
antibody produced by the nybridoma cell line deposited to the
ATCC under Patent Deposit No.: PTA-4240, a monoclonal antibody
produced by the hybridoma cell line deposited to the ATCC under
Patent Deposit No.: PTA-4241, a monoclonal antibody produced by
the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4242 and a monoclonal antibody produced by the
hybridoma cell line deposited to the ATCC under Patent Deposit
No.: PTA-4243,), for evaluating the amount of PSP94, PSP94
variants and analogues thereof in a sample.
101. The use of a PSP94 antibody for the treatment of a
condition associated with a elevated levels of PSP94.
102. The use as defined in claim 101, wherein said antibody is
selected from the group consisting of a monoclonal antibody
produced by the hybridoma cell line deposited to the ATCC under
Patent Deposit No.: PTA-4240 and a monoclonal antibody produced
by the hybridoma cell line deposited to the APCC under Patent
Deposit No.: PTA-4241.
103. The use of a PSP94 antibody in the manufacture of a
medicament for the treatment of a condition associated with
elevated levels o PSP94
104. The use as defined in claim 103, wherein said antibody is
selected from the group consisting of a monoclonal antibody
produced by the hybridoma cell line deposited to the ATCC under
Patent Deposit No.: PTA-4240 and a monoclonal antibody produced
by the hybridoma cell line deposited to the ATCC under Patent
Deposit No.: PTA-4241.
119

Description

CA 02426589 2003-05-O1
PSP94 DIAGNOSTIC REAGENTS AND ASSAYS
FIELD OF THE INVENTION
This invention relates to new i=olypeptides able to bind PSP94 (PSP94-
blnding protein!, as well a~~ m:cleic acid and amino acid sequences,
and the ~.~se of r_hese sequences in t: he diagnosis and prognosis of
di.seas:=s .
This invention also rel.atc~s to imps-ovec9 diagnosr_ic assays, kit and
reagents such as ant: ibodie:s ab E: t o recognize P:7P94 or a PSP94-binding
protei n.
IS
BACKGROUND OF THE INVENTION
The prostate gland, which is f<~un~: exclusivel.y in male mammals,
produces several componenr.s of semen and blood and several regulatory
peptides. The prostate g::_and ~.vomprises ~>tromal and epithelial cells,
the latter group eonsisticig of coiumnarw secretory cells and basal
r:onsecretory cells. A, prc~life at: i«n of t here basal cells as well as
stromal cells give., rise ::o be~:ic~~_ prost<rtic hyperi~lasia (BPH) , which
~s one common prostates dir~ease. .<,raother co:TUnon pro>state disease is
prostate adenocarcinoma (CaP) , wtra.ch i.s the most common of the fatal
pathophysioiogical prostate ca:c:ers, and involves ~x malignant
t=ransformation of epithelial cells in tr:e peripheraxl region of the
prostate gland. Prostati'~ ade:nocarcinon~a and 'benign prostatic
i:yperp,'~as:ia are two common pro:>tate diseases, whi.cr have a high rage
3() c~f in<~ic'3er'ice Ln the' aging human male population.
;jppro~_i:na~el.y c>ne <3ut of every four males above the age of 55 suffers
arom a prostate disease of som<-. form or another. .prostate cancer is
the second most: conunon cause o:= cancer related dea:_h in elderly men,
3~ w:ith approximately i8~>, 000 cases ci agno:3ed and abo at: 39, 000 deaths
reporr.e~:i ecnr:ually :iri t:he Unite._i States.
5t:udies of the various substan~~es synthesized and secreted by norma=L,
bemgm and c.anc:erous prostates carried out in order to gain an
~(~ :nderw~tanciing <:f the pathoaenesis of r.he various prostate diseases
-revea:~ ;-.hat certain of these :substances may be use:! as
7

CA 02426589 2003-05-O1
i:nmunohistochemical tmmor markc-rs in the diagnosis of prostate
disease. PhE: thrc-,e predominant proteins or polypept:ides secreted by a
normal prostate gland are: (1) Prostatic Acid Phosphatase (PAP); (2)
Prostate Specific Antigen (1?SA; and, (31 Prc>state Secretory Protein
of 94 amino acids (PSP94), which is also known as Prostatic Inhibin
Peptide ( P LF 1 , Hurnar. Seminal P.: alma InhiY>in i HSPI ) , or_ ~ -
microsemxr_oprotem !(3-MSPt, ancwhich is hereinafter referred to as
F~SP94.
1~~ PSP94 is a simple non--glyc:osylr:t:ed cysteine--ric)n protein, and
constitutes orie of ~hree yredoiainant proteins fount; in human seminal
fluid a.l.ong with Prostate Spec: f=i~~ Antic~f:~n (PSA) arid Prostate Acid
Phospnatase tPAPi. PSP94 has « mol.ecular° weight of 10.7 kDa, and
the
complete ami no acid sequenic~~ o t~:uis prot~>>in has a1 ready been
decer:r.ined. T'he cDNA and gene for PSP94 have been cloned and
c;haracteri.zed (Ulv~,>ack, ~'t a.1. ; F3~ochent. Bic>phys. Res. Comm.,
7.64:1:510, 1989; Green, et al. , Bioohem. Biophys. Res. Comm. , 167:1184,
1.990) . Immunochemi.cal and in . :iti.~ hybriciizat:ion techniques have shown
that PSP94 is located predomin<intiy in prostate epithelial cells. It
2() -.s also present, however, in a variety of other secvretory epithelial
<:eiis (Weiber, et al., Am_ J. ~athol., 13'7:593, 19~a0). PSP94 has been
shown r.c> rye express>ed in ;~rost.:t.e adenoc:arcinoma cc~l.l line, LNCap
!Yang, 4ot al.. J. tlrol., 160:2:?40, 1998). As well. an inhibitory
effect c>f exogenous PSP94 on tamor cell drowt=h has been observed both
.ir. via~o and in vitro IGar~~e, e.: al. , Prostate, 22::'.25, 1993;
I:~okeshwar, et al., cancer Res. 53:4855, 1993), ~,~u<tgesting that PSP94
c°ould be a negative regulator nor prostate carcino.na growth via
l riteract icm with cognate recepr ora on tumor c:e1 is .
.~() Nat:ivE:e PSF%94 has been sho n t.o have' a therapeutic ceffecr in the
treatment of hormone refractory prostate cancer ;and potentially other
prostate incl:ications) . F'or example>, 1?SP94 expression within prostate
cancer is known to decrease as tumor grade and agressivity increases.
'f'umor PSP94 expression is s,tirr.ziarE:d upc;~n anti-androgen treatment,
particularly lm high grade turr:ors. United States Patent No. 5,428,
i;7i1 (:~heth A. R_ et al . , i.ssue<:i 1995-06-2'7) , incorporated herein by
~~etert~nce, <xescrxbes pharmaceutical preparations camprising native
t?SP 94 used .in the m- l tr o ants m--mvo l nhi'bit~ on of prostate,
gastrointestinal acrd breast tumor growth. These pharmaceutical
4() preparations include eitY~er native PS:P94 alone or a mixture of native
PSP94 and an anticancer drug ~:uch as, for example, mitomycin,
3

CA 02426589 2003-05-O1
idalubicin, cisplatin, 5-fluoreurac:il, met~hotrexate, adriamycin and
d.aunomycin. In addition, flue ?herapeutic effect of recornhinant human
PSP94 (r'rruPSP94> and polyf>eptice analogue:> such as PCK3145 has been
described in Canadian Pate~nr_: Application too. : 2, 359, 650 (incorporated
S :her a:. i_: by reference) .
Immunohistoc:lemical studies an<_ irm;estlg<ztic>ns at the level of mRNA
have shown that t:he prostrate l:; a major :;ounce of PSP94. PSP94 is
involved is the feedback :vontrc~l of, and acts t~.~ suppress secretion
l~) of, circulating fo2iicle-:~t.imu_atng hormone (FSH) both in-vitro and
in-viva in adult male rata. P>P94 acts k>ot.h at. the pituitary as well
as at the prostate sire s~_nce .i>ot~t. are pr-ovi<led wittn receptor sites
for PSP94. PSP94 r,as bee~i dem~mstrated t:o suppres:> the biosynthesis
and release of FSH from the ra. pituitary as well. as to possibly
1~ affect tare synthessis/secrcetron of an F'SH--li.tce peptide by the
prostate.
These findings suggest th~it th~-. e1 1 ects of PSP94 or, tumor growth in
~;~ivo, could bEe attributed to t ~e r~=duction in serur, FSH levels.
H.ecently, it has been shown th.rt 1?SP94 concentrations in serum of
patients with BPH or t:.aP ~3re s_gn:ificant:Ly h_gher than normal. The
u.ignest serum concentration of PSP94 observed in normal men is
approxmnately 40 ng~ml, wi5ile _rr rncen with either BI7Ii or CaP, serum
c-:cncert.aticlris of PSP94 have b-een <::bserved up to 400 ng/ml.
?1 :In the serum, PSP94 occurs as a free tunbound) fona or bound form
associated with a carrier prot~~in(s) of unknown identity. PSP94 in its
bound form (state) eras been c~u.:~nti.fied in the blood of prostate cancer
patients ant; these measurement: have been analyzed nor their utility
as progruostic e!ava.lnation (Eauman, i~.S., et al., "fhe Prostate J. 2:9~6-
~~) i.0i, ~OCiO; huar~, ,J.W. US patent 6, 107, 103; wu, B. ~». a1 ; ~7 Cell .
I3iochem. ,'6:'71--83, 1999) . It was suggested that measurements of the
free and bound forms of PSP94 .are Likely tc: have a greater clinical
reievanc:e in: several areas of prostate cancer than measurements of the
free corm aa.one. In addi..ti.on, it. was demonstrated that measurement;>
3~ c.W both forms of PSP94 al lows an accurate f,~redp ct;ion of relapse free
Lmter~ra.:. : n post--r,xdi.otherapy prostate cant°er. However current
ass~~y
nor PSPy4 measurement, such as the on~~ described in U.S. Patent No,:
:1,107,103 rely on a purification step for separating bound and free
forms of the protein and there fore la~~k the sinuplicit:y necessary for a
4O uaefu''~ a~n~l efficient ~tomnneici~,I assay.
4

CA 02426589 2003-05-O1
SUL~ARY OF THE INVENTION
Methods for evaluating (qrantit:yinq) levels of PSP94 (free or bound
forms of PSP94 as well as tota'. PSP94) are described herein. The
1_reser.t invention relates to a.~tibudies having specificity for PSP99
car a PSP94-binding protei;i and :impr:oved diagnostic and prognostic
assays, 'rrybridomas, kits .end r~eagor~ts thoreof_.
1(1 .in addit_ icon, t=he carrier prote in (=~ ) to which PSP94 is bound is
described, identifved and char.zctec-ized in the pre:>ent application.
:)ue t;.> ; is ab:il ity r~o be :~ssoc.i_ate< with PSP!a4, a ?SP94-binding
prote~.nts) arid reiawed antibodies may have an impa~:,t: on the biological
IS arctiv~.t-1 of PSP94 and may therefore be used herein as a diagnostic and
progn<ost is marker of (PSF~94-reLatc:d) disease.
'This ::.nverrti.on therefore relates to polypeptides (3EQ ID N0.:2, SEQ ID
~d0.:~s, SEQ .D NO.:'7, ;;EQ ID N0.:8, SEQ :TD N0.:9) i~aentified herein as
7(y z.y'~F,g~ .bln<iing l~rotn~in(s) , purif:LCaLion process, nu. leie acid
and amino
acid :~ecruence and the use of these sequences in the diagnosis, and
prognosis of diseases (e. g., x:rostate cancer. or diseases characteri:~ed
by abrrormtil or elevated level:> of PSP94 and/or follicle stimulating
hormone (I~'SH) and/or abncrmal or elevated levels of a PSP94-binding
2~ prote:.n l .
,n a ~irs~: aspect; r_he presenr invention promdes a ~e.g., isolated)
po~yn-lc~eotide :;e.g., encodinc: a fSP94-binding protein), which may
~::ornprisE~ a ;necnLoer- seiectEd fr~_~rn tpe gro~zp consisting of
a) a polynucleotide ~:s set. forth i.n SEQ ID NO.: 1,
b) a polynucleotide ~;s set forth in SEQ ID NO.: 6,
a polyr_ucleot i<ie Laving sequen<:e 1 to 1:392 of SEQ ID
N0.:6,
a polynucleoti<ie laving sequence 1 to 1653 of SEQ ID
~'i NO.:. ,
es a polynucleot ice < f a size L>etween 10 and 2005 (or 2004)
bases in len<tth icient~cal in sequence to a contiguous
port=ior: of at Lea:;t: 10 bases oi: the pc.lynucleotide as set
forth l n SEQ ID Nc? . : 1 , and
41) f) a polynucleoric:~e «f a size between 10 and 1876 (or 1875)
bases in len<tth i<ienti.cal in sequence t:o a contiguous

CA 02426589 2003-05-O1
portior of at l~aasi Iii bases of t:he polynucleot.ide as set
forth ir: SEQ :=D NO :: e, .
~i-t:e pclynucieotide may preferawly tae the polynucleotide as set forth
..n SEA ID NC~.:? or the po~ynuc'~eotude as set forth rn SEQ ID NO.:n or
t:he polynuclec:>tide l:a~~ing sequ=;ncee 1 to 1392 of SE~? ID N0.:6 or a
holym:c~leatide: having seq ence :1, t.m 1653 of ~EQ ID N0.:6. The
pclynucleotide~ of t:he pre:~ent nverution may harticrrlarly be chosen
based ors the ability of the en-oded protein r_o bind PSP94. It is to
1U lae understood here--n that SEQ LD ado>.: 1 may be considered an analogue
c;f SE~:~ ID NC?.: 6.
ir, a second aspect, the presen~:~ ~rrvent:ion provides polypeptides and
~olypept:ides analogues such as fcr example,
17 a polypeptide as set for~~h :in ShQ ID NO.: 2,
a polypeptide as set for;~h in SEQ :ID NO.: 3,
a polypeptide as set forth in SEQ ID NO.: 7,
;i. l
a polypeptide as set forth in SE.Q ID NO.: 8,
a polypeptide as se:t forth in S:EQ ID NO.: 9,
a polypeptide of a size between 10 and 505 amino acids in length
identical to a contiguo~~s portion of the same size of SEQ ID
N0.:2,
a polypept:ide of a s:~ze between 1.i) and 592 amino acids in length
3() identical to a cont iduo~;~; portion of t: he sane size of SEQ ID
NO.:3,
a polypeptide of a size between 10 and 624 amino acids in length
identical t.c~ a cont.iguou:~ portion of the same size of SEQ ID
~1 NC7 . : ? ,
a poiypeptide analogue :caving at least 90 $ of its amino acic.
sequence ide~nt:ical. to t:re~ amino acid ~aequence set forth in SE;Q
ID NO: 2, in SE:Q I1) N0. .3, In SF:Q ID rd0.:'l, in SEQ 7.D N0: 8 or
4d) ~n SE;Q ID N0. :9,
6

CA 02426589 2003-05-O1
a pclypeptide amaio~.~ havl.ng <at leeast 7() ~ of i.ts amino acid
sequence identical ;~o th.~ amino acid sequence set forth in SEQ
I:D NO: '' , in SEQ _TD N0. : .i , rrt SE:Q ID NO. : 7 , :n SEQ ID N0: 8 or
-_.. ~EQ ID N0.:9,
7
a pc:lypeptidee analog havi_:ng at least 50 ~ of. its amino acid
sequence ident ical tc tYu:~ amino ac id sequencf, set forth in SEQ
ID N0: 2 it SEQ ID NG.:3, in SEQ LD NO.:'7, i_r SEQ ID N0: 8 or in
SEQ II) NO . : 9 ,
1 ~~
a poljJpeptide analogue having at least 90 ~ ~z its amino acid
sequence i.denticai to t:f;e amino acid sequence of
-a polypeptid~~ o~ a length from b=e t:ween 10 and 505
contiguous amino acids of SEQ ID X0.:2,
1~ -a polypeptide of a :Length from between 10 and 592
cont.igucus ar,:.ino acids of SEQ ID N0.:3 or,
-a polypeptice of a l.engtt~. from between 10 and 624
cont. iguc~u~s arr.ino acids of SEQ ID N0. : 7 ,
O) a polypeptic9e analogue ;av.ing at least 70 ~ of its amino acid
sequence identical to the amino ac.:id sequence of
-a polyi.~eptic~e of a length from between 10 and 505
cont. iguc~us arwino acids of SEQ ID NO. :2,
-ax;~olyr>epti<i.e r>f a Length fr<am k:,etween 10 and 592
:1 c:onT:igua:~us arui.no acids of :;EQ ID N0.:3 or,
-a ~>olypepti~;e of a length from between 10 and 624
contiguous amino acids of SEQ ID N0.:7,
a polypeptide analogue caving at leasr,: 50 ~ of its amino acic
sc~c~uen<.:e .identical to t rc~ aminc> acid :>equenc::cy of
-a polyi~epti~.ie of a lengtkr from koetween 10 and 5C)5
c:ontigutous a:avnc~ acids of SEQ ID N0.:2,
--a polyueptiie o~ a length from between 10 and 59~
contiguous a:n:inci acids of SEQ ID N0. :3 or,
.3~ a pollrpeptide of a length from between 10 and 624
contiguous anino acids of SEQ TD NO.:i.
1:n accordance with the present irnvention, the polypeptide may
preferably be the polypeptide as set forth SEQ ~D NO.: 2, the
U pelypeptde as set_ fortt! SEQ ID NO.: 3; the polypeptide as set fort=h
SE'.Q ~D N(?. :'?, the polypeptidE- as set forth SEQ ID N0.:8 or the

CA 02426589 2003-05-O1
polypeptide as set Lorth SEQ I) NU.:9. 'the poLypei>tide of the present
:;avert; -con tttay part :.eularly be .ePtose:n based on its a'k~ility to bind
eSP94. It :s t.c bea understood herein that SEQ ID _cJCr.: ~ and SEQ ID
bd0. : : rr~ay be cons.ldered ~nalo Iue:~ of SEQ ID N0. : . SEQ iD N0. : $
1 and Sf~Q Ii:> rJO. : 9 may also be c.:>as idere<i analogues of SEQ ID N0.
:7.
:n an additional aspect, tre present invention pro.~ides an immunizing
:-ompo;>it icon including, for. example, a vector comprising a
~>olynucieotade as defined herein. It is sometimes preferable to have
~~° ,.< ~;oi.y~n~.~c.eotide of at lea~;t '<?i bases in length of <-~
desired sequence
s~rtc~ d polypeptide of 7 amine acids (encoded by a 21 base pair
polyn~.ic.Leot.ide sequence) l;; often associated with the major
histocomp~~tibil.it:y complex (Mht=) during antigen presentation. The
vecto:Y ma~~ c.~omprise, for a}:amX~le, a polynu<vleot:ide selected from th~~
1~ group consisting of a polynucleotide as set. forth .in SEQ ID NO.: 1, a
polynscLeotide as set forth ir: SEQ ID IVO_: 6, a polynucleotide having
sequence L to 1392 of SE[~ ID r!0.:6, a polynucleotide having sequence 1.
r_.a ! > ~_ of SE:Q ':D N0. : 6, a poyru.c°leot~.cle of a size 'between
21 and
2'?("~ vases ir: L ength idera:t.ca m sequence t.o a~ ccntlguous portion of
() the same size oi: the polynucle:otide set tort:h Ln ~EQ ID NO.: 1 or a
po;.ynacleotide of a size bc~twf-'en 21 and 18'!6, bases in length,
identical in sec~,tence, to a cot;t:id~~ous portion of the same size of the
polynucleoti<ie set forth in St;() .ID NO.: 6, and a ci:iluent or buffer.
It is t.o be understood he:r;~in t:hat the vector may enable the
expression of a po.l.ypept~de encoded from said poly.nucleoti.de. The
vector may oe linear or :~ircu:.ar and may contain rc:nimal sequences in
addition to t:he po:iyr~.ucl~otid~= ir.selt (~~.g.. sequ<~nce for integration
into the genome, promoteu, Cp~r se' uences;) . Admin_..;tration of a
polyr;ucleotide of the prasent .invention (without any additional
.ii.) sequence, i.e, wit:bout a vector) may sometimes be sufficient to
initiate a desired inunun~ respon::,o.
In a r~~rr_her aspect, the pres:::nt invention :elate: to an immunizing
camposztioa comprising a polyaeptrde as defined herein (e.g., SEQ __D
.BS N0. : <:, SE:Q ID NO. : s, SEQ ID Nv>. : ', SEQ ID N0. :8, ~EQ ID NU. :9;
, a
polypeL>t~ de <~zualogue, variant , r ragment or, ~zombin<~t..zon thereof and
a
diluc.nt or a buf.for. Immunizatic>n with a combinar.ion of any of th<:
immunizing composition descri;Jed herein is also encompassed by the
prest.nt: invent ion .
~0
8

CA 02426589 2003-05-O1
'i'lie lmmunlZlrig COmpOSltlOn[S) ;flay tllrther COInprlSe do ad]uVarit. Iri
an
additional Pmbodiment, the imm.mizLng compos:itiori relay also comprise
?SP94 (native andior reconbirla;:lt) , PSP94 variant, :aSP94 fragment, a
~,rector comprising er polynucleo~~ide en<eoding PSP94, a polynucleotide
encoding a PSP94 variant, a po! ynucleotide encodin~;~ a PSP94 fragment:
.-end combination thereof. F.gain, the trect;or may Enable the expression
~:~f a polypepticie encoded from ~ai~l po:lynucleotide. For reference on
ativee E~SF'94, recombinant PSP94 [e. g., rHuPSP94), PSP94 variants,
anaiodues arud fx-agments, plea:~;~ see Canadian patent application No.:
1(J 2, s59, d::aG or imte:r:.:at:lonal patent app:licvation, pubi:i.shed under
No. t~IO
0:?/33090.
In a further aspect:, the presEnt invention relates to a method of
(for) germerating an antil~ocYy tmonoclonal or polyclonal) to a
1~ polypepticle [e. g., PSP94, PSP~4-binding protein and!or PSP94/PSP94-
binbi.ng protein c:omplex), sai.c: method comprising administering to a
mammal an immunizing coml~osit:on (comprising a polypeptide,
p~~:.ypepti,~e analogue, a polyni.cleotide and combination thereof etc.)
as defined 'rierein.
?0
In accordance with the p.i-esent invention, mammals that may be
immunized using the presc:n~ mt~thucl include, fo:r example, a human, a
mouse, a rabbit, a sheep. ;~ h«rsE:, a cow, a rat, a pig, and other
mammals having a functional ir:unur:e system. A "manunal having a
~''~ functional immune system° is - o ~e: unde.c-stoc>d 'nerein as a
manunal able
to produce antibodies (irnmuno~)-'~obvalins) wYien immunized with an antigen
l . a . , having a humora:L ~m-nun~ response and; or a cvel lular immune
response to the arut igen) .
~4) Further aspects of: the presen;~ irlventi.on relate to a monoclonal
antibody produced by the hybr~doma cell IinE~ depo:~ited to the ATCC
~~.nder ~~ar-er.t L.~epo;:! t No. : PT-4242 and ant:rgen b:..nding fragments
therefor, to a monoclonal anti.:~odu~ produced .by the hybridoma cell line
depositeEto the AuCC under Patent Deposit No.: ??TA-4243 and anticten
35 bindi.nc; fragments thereof, to an, hybridoma cell l:a.ne deposited to t:he
ATCC undF~r Patent Deposit: No.: PTA-4242 and to a hybridoma cell line
deposited t.o the ATCC under P:~tent DE>posit No.: P'CA-4243.
Tn arl additional aspect, the present invention relates to a cell that
r~' nas .:.n::onporated ;nas beer. transformed,. transduced, transfected,
el.c.)
9

CA 02426589 2003-05-O1
w ~ try .-~rny "f c;m, p<>.L ~rnucle~ot idE. o<: ~:he presen t invenr: ion a .
g . , SEQ :LD
NO.: , SF,Q ID NO.:&, antisenses, fra<~ments, var.l_ant:s, mRNA, etc.
In yet an additional aspect, the present invention relates to a
,isolated; cel.i that has incorporated and/or that is expressing at
least one of the polypeptides of the preserut ii:vention, e.g., SEQ ID
VO.: . , SEQ ID NC).:3, SEA 1:D 1\0. :'', SEQ 1D N0.:8, SEQ ID N0.:9,
~~ariants, fragments, analogues or combination thereof.
1~1 Ln another aspect, the present invention comprises the use of a
polynucLeotide a.s definer: herEin (SEQ ID N(.>.:1, SEA ID N0.:6,
fragments, antisense, an~7logues, mRNA), in the diagnosis or prognosis,
(or treatment) of a cond:it_~on linked wit=h abnormal (e.g. , high,
elevated) lovels, of PSP9~, or with abnormal. (e. g., high, elevated)
'~ levels of a PSP94-bindincr protein.
In yet another aspect, tt:e preasent invention provides the use of the
polypeptide as defined h~:rein Ia.g., SEQ ID N0.:2, ShQ ID N0.:3, SEQ
ID N0.:7, SEQ ID N0.:8, ,~EQ II? N0.:9, amalogue, variant, fragments) in
2() the diagnosis or prognos.:s, (c.r treatment) c:~f a ccrodition linked with
abnormal (e. g., high, elevated) levels of PSP94 or with abnormal
(e. g., high, elevated) lfwels of a PSP94--binding protein.
In accordance wwtt the p:-esew: lr:ventiori the poiyr,ucleotide defined
herein or the polypeptidc-edef:.ned herein may be used in the diagnosis,
or prognosis of a e:ondi_tion s.ich as, for- e.xa:cmple, prostate cancer,
stomach cancer, brc.east c~rncer, endometri.ai cancer, ovarian cancer,
other cancers of epithelial s~;:~crEet~ion and benign I>rostate hyperplasia
(BPH) car a disease chara~~teri,:c:d with an elevated .Level of FSH.
~()
Ir. ar. -~;dc_.it.i::>nal aaspect, the ;;>:resent invention re:ates t.o a
method for
measurmrc~, m a sample, the a.noun,. of a pol.ypept.idfe as defined herein,
for examX~le, a po-ypepci:le selected t:rom the group consisr_ing of SL.Q
I D NCi . : '~' , SEQ ID NO . : 3 , SEQ ID "J0. : '7 , SEQ Ii: NO . : 8 and
SEQ ID N0. : 9
35 (as well variants, analogues :xnd frac~meruts thereof) or combination
thereof. In accordance with .:he present invention, the method may
comprise contacting said sample with a molecule (an antibody or a
poiyaeptldE:I able to recognize said polypeptide, vhe method
:vcn~4>mL~l~ted herein may be applied to polypepCides that are
-~l~ _rrsnebi~ i::eu to a bloc membrane, a plate, a matrix or not ( in
solut:i.cm) .

CA 02426589 2003-05-O1
rt is to be understood herein that in order to develop a quantitative
assay to assess th~~ level. of a polypeptide, a preferred molecule may
have su>=ficient affinity and specificity for the desired polypeptide.
a>=f:inity anc specificity may x_e determined, for example, by comparing
binding of the molecule to irrelevant polyp2pt;.des, by competition
assays 'o~ :he polypepticie of interest, etc.
In one embodiment of the presE-nt invention, the molecule used for t:ne
14) above desvribed rnethod may include, for example, the monoclonal
antibody produced by the hybr:idoma cell line deposited to the ATCC
snder Patent Deposit No.: I?TA 4242 and the monocionai antibody
produced by the hybridom~: c,el lime deposited ..o tree ATCC under Patent
Deposit No.: PTA--4243. Jn anc~t.ruer embodiment: of the present
1'? i-wention, the molecule may bE=, fc~r example PSP94 and analogues
thereo.
The method for measuring t:ne ,.-mount of a polyp=~ptide selected from the
group consi.st.ing of SEQ :;:D NO.: ~, SEQ ID NO.: 3, SEQ ID N0.:7, SEQ ID
~lj NO.:8 and SEQ II) NO.:9 contemtolated herein may fm then comprise, for
example, the following sr:eps:
a) br iruging a samp ~e cor;prising at 1 east one of the polypeptide
oL t:.he present :.nven ion int<5 contact with an antibody
imm<:Wi.Lize-'d to <.r sui ablca substrate-: (u.g. , ELISA plate,
matrix, SDS-PAG~~, We >tern blot rnemk~ranes,
b) add:i.ng to step r~) a =et~ection reagent comprising a label or
marker, and;
c1 detect.ind a sig,ial resulting from a label or marker.
i~ Suitable detection reagents m-~y comprise, for example, an antibody or
a po~'ypep~tide having an affinity for a polypeptidf~(s) of the present
ir,veraor:, ancthe detection :.-eagent may have preferably, a different
binding site than the antiboci,~. :'~s cfe.vcribed her~:=in, the detection
reagEmt may either be directlv,~ couplE.~d (conjugates ) to a label (or
35 marke r) c>r able to be reccgniz2d by a second mole<::ule carrying
(con,ugac.eci wathi Bald label .:>r marker.
An e:campi.e of an antibody that may be used in step a) is the
monoc, l c~n~~l anrm.body ( 1'769 > pr oduced by the hyx~ridoma cell line
U depo:>ited !~o the .~'rCC under I at.ent Deposit No. : P'L'A-4243 . In that
<:ase, t.hc: .nonoclonal antibody (3F~i) (produced by t=oEe hybridoma cell
11

CA 02426589 2003-05-O1
'..ine c:lepoait:ed to tutee ATC~:: und~rr I?atent~ Deposit no.: PTA-4242 may
be
~_rsed as a detection reagent in step c).
Arry arrti.bodies able to bind tc a PSP94-binding pro~:ein (SEQ ID NO.: 2,
'' ;3.~Q T) V0 : ~~ , E~tc , j , .such us t hose ant ibodi es 7 ista>ci in
table 20
~,::dent,i_ied as cionesi , rray be, used in t.t-ie methods described herein
!~ = to~one? 2B10, 1B11, 9Bt':, P8f~2, B3D1, 26F310) . When two
<~ntibod:ie:~ are needed to perform the present mE.tho-is it may be
preferabl<e r.o choose antpbodies bindi>rg to different epitopes.
Another example of an antibody that may be used in step a) is
tine monoclonal. antibody ~3F4) :prc>ciuced by t:he hybridoma cell l.:ine
depo:~it~d to tae A~?'CC.' unca.er Patent Deposit no. : PTA-4242. In that case
c_m rnonoc ~amai antibody ; 1'%G9 ) prc:duced by the hybridoma cell line
f~ deposltea to the A.~CC under Patent. Deposit no.: PTA-4243 may be used
as a detection reagent ire :ate) c l .
In a further aspect, the pres<nt invention relates to a method for
measuring, in a sample t re am~~unt of a 1>olyhepr-ide selected from the
U group consist: ing of SEQ ::D NO . : ~' , SEQ TD NO. : :3 , :'EQ TD NO. : 7
, SEQ ID
N0.:8 and SEQ ID N0.:9 (~.ra:riamts, analogues, fragments) or combination
the.r~of, tfrac is r_ot bound 1i e. , free iunbound> ) r_o PSPy4, said
me~:.hcc compr~.smg ;
a) removing, from sa,.d ;>ample, a complex foamed by PSP94 and
any one of tire po .ypeptide ,.elected fncm the ctroup
c_onsi~:tirg o;_ SEQ ID NO.: 2, SEQ ID Nf~.:3, SEQ ID NO.: 7,
SEQ IL) N0.:8 and :;EQ ID N0.:9 (variant.s, analogues,
fragments) g~:nera~:.ing a complex-free :tample,and;
b) c:ontacr ing s,~id c ~mp.iF:x-free sample w:. rte an antibody able
.;?~) :~o .cecogrrize any ::ne of t: he polypepticae selected from the
group consist.irrg rY ;~EQ 7:IJ NO.: 2, SEQ ID NO. :3, SEQ IIi
NO.:'7, SEQ IJ N0.:8 and SEQ ID N0.:9 e~ariants, analogues,
fragments) and co;tu~inati<in thereof.
35 In one embodiment of the present invention, the antibody used in si;,ep
b~ mrry bE~ .~>e,Lec t:eci from t:he g.coup consisting of the monoclonal
an t ~iooay proo.uced by the h,ykm: .Ldorna ce:l l l ine uepo:a l ted t.o the
ATCC
u=._,de,. _:ar.or.= Depov~.t No.: PTh-4242 and the mor:ocl~:>nal antibody
produced by the hybridoma cell line deposited to the ATCC under Pa~_ent
~ Depo:>it: tdo.: PTA-4243.
j '7

CA 02426589 2003-05-O1
;he mettnod i:or measuring the a::nount o:E the polypeptide of the present
~.nL~er;T:icm that is not bound t< PSE~94 c~ontemplated above may, for
e:xamp:~e, <:omprise the followir:g step;
a) removing, from said sample, a complex formed by PSP9~~
and any or;e of the pol.ypeptide selected from the group
consistinc of .E,Q W NO.: 2, SEQ ID N0.:3, SEQ ID
D10.:'7, SE~~ ID b~0..z3 and :~EQ TD Dl0.:r3, generating a
complex-free,
b) irnmobiliz:ing (coating, adsorbing) an antibody to a
1~) suitable ::ubst:ate (ELISA plate, matrix, SDS-PAGE,
Western b~ of me-rrtbranes ) ,
c) adding sa-: d cor plex--free sample,
d) adding a r~eteccion .reagent comprising a label or
marker, anl;
ej detecting a su;nai result-i.ncT from a 1<~bel or marker.
The removal of the complex ma~.~ be performed, for example, by using the
monoclc>na:l antibody produc~=d uy the hybridoma cell line deposited to
the ATCC under Patent Deposit No.: PTA-4'1.41.
?0
Suitable antibodies chat may >e ;aed in step b) are antibodies
selected from the group ~~onsm~r_ing of the monoclorval antibody (3F4)
producead by the hybridoma cel;lire deposited to the ATCC under Patent
Depo:=it No.: PTA--4:?42 am3. the rnoraoclortal antibody (1769) x>roduced try
~''~ the r:ybridoma cell line ~iepos;.ted to t:,l:e AT(:C under Patent
Deposit:
No.: P'.I'A--424:a.
In ar: additional aspect, the .,o.resent in~aention includes the use of an
(moncc=Lonal) antibody selecte. from the group consisting of a
ifs monooonal ant ibody 12D3 ) pro ~uced by the hybridorna cell 1 ine
deposited to the A'fCC un:~er Patent: Deposit No.: P't'A-4240 , a
monoclonal antibody (P1E~) pr:)duced by the hybrid<>ma cell line
deposited to the A'rCC under Patent Deposit No.: P'fA-4241, a monoclonal
antibody (~iF'4) produced ay the hyhri<iorera cell lin'-: deposited to the
3~ ATCC under Patent Deposit No.: F'fA-4242 and a monoclonal antibody
'~ ~ G~r ; pr o<zu;: ed b_~° the hybridoma cel l ~ ine deposi ~:e~d to
the ATCC under
E~ar_en~ DFrpos.lt No.: PT'A-4243, xor evaluating iin J~ sample) the amount
~;ua:~'v::- , , ~~orcen~_rar_ionsp (f ree, bound, andiur total amounts) of SEQ
:.D N0.:2, SEQ ID NO.: 3, SEQ ID N0.:1, SEQ ID NO.:t3, SEQ ID N0.:9,
0 variants, fragments, analogues, and%or combination thereof.
13

CA 02426589 2003-05-O1
in another aspect, the pr went invention i.ricludes the use of a
molecalf~ :~e:lected from the group cons.isti.ng of a pol.ypeptide as set
forth in SEQ II7 N0.:2, a polyTeptide as set forth in SEQ ID NO.: 3, a
paiypeptide as set faith in SEQ ID NO.: 7, a polypeptide as set forth
:: SE~:~ 1D NO.: ~s, a polyl:~eptice as set: torth in SEQ ID NO.: 9, a
monoc long an t ibody ( 2D3 ) proc:ucec; by them hybridoma cel.1 l ine
depasited tc> the ATCC unc.er P~.tent: Deposit No.: PTA--4240, a monoclo:zal
antibody (P1E;81 produced by t1-:e hybridama c:el1 line: deposited to the
A'TCC under ~atE~n~~ Deposit TJO. f''A--4241, a monoclonal antibody (3F4)
1~) produced dy the irybr:i.doma:~ c;el l.irre d~p~::~sit:ed t,o tl-e ATCC
under Patent
Deposit No.: P'TA-42,42 anc:a <r rnc;noc.lonal ant.~body (1'lG9) produced by
the
hybridama cell 7.ine depo:-sited to ~he AT(~C under Patent Deposit No.:
PTA-424x, far evaluating (in a. sample) the amount of PSP94 or for the
diagnostic at a condition liW:ed with abnormal or elevated levels of
1 ~i PSP94 ar of a PSP94-bind: ng p: at<, l n .
In another aspect, the prresen~ ioventi.on relates to an antibody
conjugate comprising a f..rat nioiet_y and a sEecond moiety, said first
moiety being seieCCed. from th,J gr-oup consl_st::ing of a monoclonal
?t1 arvrbed~~ (2D_sj produced ioy the hybridoma cell IinE~ deposited to the
ATCC :~n der Patent I)eposij~ ;Vo. : P'I~A-4246, a rnonoclunal antibody (P1E8)
produced by the hybrldama cel.- line deposited to the ATCC under Patent
Depo~;it No.: P'fA-4'24.1, a mono~~:Lc:>:ia.l antibody (3F4; produced by the
hybridoma <:e11 litre depo,~ited t:o t:he A'fCC under P~:t.ent Deposit No.:
PTA-9242 and a monoc:L.onaL ant~):~ody (liG9) produces by the hybridoma.
cell l.ne deposited to tire AT:.'C under Patent Depoa.it No.: PTA-4243 and
said second maiety being sele:,teci from the group oansisting of a
pl-rarrnace~tlrai agent, a solid support, a reporter molecule, a group
carry~_r.g a reporter nnoie~uie, a c: helating agent, yin acylating agent., a
3(~ cross;-linking agent, and a t:a~~geti.ng group, where rr said second
moiety
or cc.m;ugation of said second mo~.~ay does not, int~:rfere with the
biological activity (e. g., af;in~_t:y, stability) o~ the first moiety.
In one embodiment of the present invention, examples of solid support
~S may ~:ora~.st: in ca=bohydrates, lipasomes, lipids, ~:volloiaal gold,
=r,-rr<y r: lc:- ._s , Ir:LCr;.cal:~s~les, rm<:roemulslons, and t:he matrix of
an
ci~t-. f llrl';:.y C:'.>.i. ilrtll'r .
In an additional embodiment, reporter :molecule may be selected from
~ the c.Iroul> consisting of a fluorophore (e. g., rhodamine, fluoroscein,
and careen fluorescent proteir:l , a chrornaphore, a dye, an enzyme (e.g. ,
1~

CA 02426589 2003-05-O1
alkaline E~hc~sphatase, hoxsE~rac'ish peroxidase, beta-galactosidase,
ehloramphc~n.LCO1 acetyl transferase), a radioactive molecule and a
molecule of a binding/ligand ie.g., biotiniavidin (streptavidin))
~~~nnpi~:~x .
~: yet an additional embodimer:t., the pharmaceutmcal agent may be
selected from. the group ~~f a i ox:~rn (e.g. , l~actc.rial toxins) , a (e.g.
,
anti-cancer) drug and a I~ro-drug.
1~) In a further aspect, the present invention includes a kit for use in
evaluating (in a sample) the :,.mount of 1>SP99 or far the diagnosis of a
_on:1_tior_ l i~~ked w:th abno:rma (<=',g., high, elcwated) levels of PSP94
for of a PSPy4-binding protein) comprising a container having a
molecule able to rcscogni::e (b:ndt PSP94. Lt: is tc~ be understood
l:~ herein that the Kit: may he pr~svided (sold) ,n separate constituents.
In one embodiment of the presf~nt invention, the me>lecule able to
recognize PSP94 that may be iro.luc3ed in the kit, may (comprise, for
exampiee) be a moleo:ule st,lect~ed from th~~ group consisting of (one or
Vii') more of t he f o1:Lowing ) a mono v 7. onz~ 1 ant ibody ( 2D3 ) produced
by the
hybridoma c:eil lure deposited to the A'f~~'C under Patent Deposit No.:
PTA-42A0, a monocl.onai arrtiboiy i):'1E8) t~r<r3~.rced by~ the hybridoma
c:eli
line deposited to the ATc'C un ler Patent Dep~.>sit No. : PTA-4242, a
monoclonal antibody (3F4i pro:3uced by the hybridorna cell line
deposited to the AfCC: un:ier P,~tent Deposit rdo.: P~:'A-4242, a monoclonal
antibody (.1769 ) produced by t'ue hybri.doma cell l irre deposited to the
a.TCC ?mder Pate..~.t L7eposit No. . PTA-424:3, the antik5ody conjugates) of
tire prE:sent inve.mions and a .oolypept:ide selected from the group
cons~stirag o= SEQ LD N0.:2, S;,Q _~) NCi.:3, SEQ 71~ CJU.:7; SEQ iii N0.:8
~) and :>EQ I D NO . : 9 .
In another embodiment of the present invention, tile kit may further
comps-ise a container having acn antibody able to rs=,cognize (bind) a
polypeL_>tpdE:e selected from the group consisting of the polypeptide set
fort~r in SEQ 1D N0.:2, t:he pclypeptide set forth in SEQ ID N0.:3 and
_.r~e ~csypeytiae se~~ -ortrr ir: ~~:Q ID TVO. :l, the polypeptide set forth
~_n Si~:Q i.7 N0. :8, the polypeptide set forth in SEQ 'D NO.:B, variant,
fragment, analogues and combination thereof. Contemplated by the
present. invention are the mor_:~clonal antibody (1709) produced by the
4o hybr-vdc.:m<i cel s. line depesi tec: to the ATCC under Patent Deposit No.
11

CA 02426589 2003-05-O1
PTA-4:?4:~ and a monoclonal antibody (31.~41 produced by the hybridoma
cell ine deposited to the A'fC!, under Patent DE:posit No.: PTA-4242.
t is to ire understood herein that kites may be provided in separate
'~ carat::tuents. 'flie antibodies provident wi.tYn the.~ kit may be in
~3ifferent. f~:3rms such as round to plates or membranes or other type ~~f
solid matrix or in vials containing concent.ratE:d forms or suitable
'~orkiag dilutions of the antiY~odi~:s.
1() Ia another aspect, the pTesem ir;ventior_ px-ovides a method for
preparing a polypeptide a:~s de:ineci herein (a PSP94-binding protein,
_.c~., a p~lypept:ide :elected horn the group cons is t.ing of the
pol.ypeptide set forth in SEQ 'D N0.:2, the polypeptide set forth in
SEQ IL N0.:3, the polypeptide set forth in SEQ ID N0.:7, the
I"t po'~ypeptide set forth in S1~Q L) Nc>.:8 an<i t:Y::e polypeptide set forth
in
SEQ ID NO.:~) comprising
a) cultivating ~i hoss. cell under conditions which provide for
the expression of sa d polypeptide by t:he cell; and
b) ~ ecovez: ing tue pa ~ ypeptide by orue ~~r more purification
~() step.
In yet another aspect , the pr~_:sent:. inventioru provi des a method fox'
preparing these polypept:idc> as E~fir;ed herein (a PSFe94-binding protein,
e.g., a polypeptide selected °rom the group consi:,c.ing of the
polypeptide set forth in SEQ (D NC>.:2, the polypeytide set forth ir.
SEQ D Ni~.:~, the o:~ol.ypeot.ide~ :aet: forth in SEQ ~D NG.:7 the
poly_r..:epode :yet fort: In SEQ :D Nc).:8, the pol.ypel)tide set forth in
SEQ ID NC!.:9 and combination ::hereof) comprising:
aj collec=ting one or mart:: biological samlrle containing s<~id
pc7lypeptide; and
b) recove=ring the po.Lypeptide by one or more purification
step.
~. i:~ to be ~ander:~t.ood herein that the purification step either alone
i~ or irr comb~.nation may be sele;sted from the group _~<>nsisting of
ammonium sultate~ precipit;atlo:r, size exclusi.or? chromatography,
affinity chromat=ography, ion-:~xchangE~ chromatography or the like.
In another embodiment of the E~resc=_nt irmention, toe purification s~_ep
4n may <.:ornpJ:i:;e;
a; adding ammonium sulfate to said biological sample,
1 ~i

CA 02426589 2003-05-O1
ia) perfo:rrnmg ion-excwanc~e chromatography,
:.; performing affinity-chromatc.~graphy usir:g a PSP94-
conjugated af: finit y a,at.rix,
d) performing size-exclusion chromatography, and
e) recovering a fraction containing a substantially pure
PSp94-bindin<:: prot cin.
In a further aspect, the prese-nt invention also includes a process for
ant, plrif ication or a PST~91~-bi:nd_~ng profeirr from a sample comprising:
a) adding arrmonm,zm sulfate to ,aid s<rrxrple (e.g., human
male ser~.rm) i.n a manner as to pro-,ride precipitation of
a PSP94-bindi:rg protein,
b) centrifuging ~::he mixture of step <~) to recover
1.'7 precipitated aratein s,
c) resuspenciing aaid prEec:ipitated proteins,
d) pc.=_rforming ic>ir-Exchange chromatography to recover <r
fraction of proteins containing a i'SP94-binding
protein,
E:) performing affinity-c-hromatography~ using a PSP94-
conjugat:ed offinity matrix to recover a fraction o:~
protf°ina containing a PSP94-bindi,zg protein,
f) performinct size exclusion chromatography to recover a
fraction c7f I:rot.~i.ns cc>nta:ining a PSP94-binding
~':i protein <~nd;
recovernc~ a fraction cont-aini.na a substantially pwre
PSP94-bindinc; protei:l le.y. , rr peiypeptide selected
from the <~ror.p c-onsisti.ng of the polypeptide definsd
in SEQ ID N0.:2, the polypept,~de defined in SEQ ID
() NC'. :3, 1: he' pc>lypeptide del i.neci in SEQ ID N0. :7, the
polypept icie :.et forth in SEQ ID NG. :8, the polypeptide
set forth in ~~EC~ ID NU.:9 and con.bination thereof).
in one enwodirrent of the present invention, tl:e precipitation of a
T'SP9~-binding protein in step a) may be effected ray adding ammoniur:r
suaf~rte to a i-ina:i concentration of up to 47~.
I_r. a second embodiment of the present. :invention, T_he ion-exchange
chromatography of step d) may be performed by using an anion-exchange
n cnrornatoc~r<~phy mawria.

CA 02426589 2003-05-O1
~}1E: p:''2:~211t lnVentlUn In a fuYthEY aslJ2~.:t: tr7erE'_Of COmprIS2S a
p;~YvF i:::at nom process for a PS3 94--bi.ndind pr otein ( ~~ . g. , a
polypeptide
seiecaed i=roan the group c onsir ting of the poly~~eptide defined in SE~~
Il? N0. : ? , the po:Lypeptide def ~ neck in SEQ I1) NO _ : 3 , the
polypeptide
defint~d irY SEQ 11) N0. :7, the x_,~~lypeptide dE:fined in SEQ ID N0.:8, the
poiypeptirle def fined l n SL.Q ID n(0. : 9 acrd comrf>inatior: thereof )
(summarized .in F'.igure $). ThE purification of a FSP94-binding protein
from serurn may comprise, for f:xample, the following steps:
(() a) adding a;nrr.oni,.rzn sulfate to a human (mai.e) serum sample
to provide a :;olut:ion with a firrai concentration oi=
ammonium; sulf:~te of 32~,
b) centrifuging the :solution of the previous step to
17 recover a pellet fraction of proteins containing
ur~specific humar; serum proteins arid a supernatant
fraction of proteins containing a PSP94-binding
p:rot<:in,
~() r) recoverinct tr:e supernatant fraction of proteins
containi.nq a PSP94-binding protein and adjusting tZe
concv~ntrat:ior of ammonium sulfate to a final
conc~antxat:ior. of 47~ to provide a solution of
precipitated proteins oont.ain3ng .a PSP94-binding
~1 protein,
d) centrifa.g_~ng the mixture to recover precipitated
protein:: containing a PSP94-b:i-riding protein,
p) e) resuspending said precipitated proteins containing a
PSP94-b- ndinci pr c>tein i n an arxueaus media ( a . g . ,
LNater, phosptatee buffered ~>aline, LO mM MES, 10 mM
MOPS, 1t~ rnM I;ici.ne : these solution (when applicable)
rr:ay be art a I~EI i:omprised, for example, between 4.7 and
35 9.0, pre~f~~raljly between 5.7 and 8.0 arid more
p~referal>iy bta:w~~~en 5.7 anc:3 6.'7) Fiewever a preferred
aqueous medic. is 10 mM MES buffer at a pH of 6.5,
f? loading (~::om.acting, c:hargi.ng) said aqueous solution
~~) of I:rotcmn.s ~vonraining a P;)P94--binding protein in an
ion-excrange (araon-exchange) chromatography columnr
18

CA 02426589 2003-05-O1
coraaini g an ion-exchange (anion exchange)
chromatography matrix (resin, gel:,
g) adding a salt solution selected from the group
c<onsi_sti:zg of sodium cY~rlori:le, macYnesium chloride,
potassium chloride to x-ecover (elut:e, detach) proteins
containing a eSFi3~L-bin<aing protein from said .ion-
exchange chro~natogra~>hy column, pxv:ferably sodium
c):~.;~ride with a :nolarit:y ranging ~r,~om, for example,
I 1 ) 10 0 mM t a 10 0 ~:) rruM ,
h) recovering a fraction speak) of proteins containin<~ a
PSP94-binding prc;>teir~,
)~ l) contactinc(charg:ing, passing through) a PSP94-
c~~njugateci affinity mat:rix with they fraction recovered
in ordez t.o genex'ate a PSP94-conj~igated affinity
matrix bound to a PSP9~a:-b~ndirrg protein,
2f) :l) adding an elLting reagent (free PSP94, urea, sodium
acetate or CPPS; preferably free PSP94) to said PS:P94-
conjugated affinity matrix bound to a PSP94-bindin~~
protein to recover (elut:e, detach) a PSP94-binding
protein,
'v
k) recover:mg a fraction c<mt.ain:ing a r?SP94-binding
protein,
L) loading said PSP94-binding protein in a size exclusion
.3~) chromatc~gr_aph~y c_~olumn containing a size exclusion
chromate>graph y matrix to separate PSP94-binding
pror_ein f:=om con t.aminants, anti;
m) recovering a fraction containing a (substant.ially)
iS pure PSP94-b.:nding protein.
~t ~.~ to be understood that some of the purification steps describ<~d
nere:n may prove to be unnecessary depending on thc:e level of
pLri_:~c:ation reauirea or depending on the optimization of one or more
°~~i t)f :1r' i~:riical~i:riCStEj~S.
17

CA 02426589 2003-05-O1
en a ~ur-tiie:r. aspect, the present invention relates Co the product
obtained From the purification; process defined above.
In accordance with the present invention, :~ampies Se. g., biological
'~ sample) r>:ferred herein may cc~mpr:ise, for e::xample, blood, plasma,
serun;, ,.trine, semiriai. fl~.iicl, c eM.l cult:uree media, cell lyzate, etc.
The sample is preferably a hur,ian (e. g., mate) sample.
In arct.her aspe<:t, the pt~e;~enn invention relates to an antibody, and
1() antigen binding fragrnent:> the: eof , able to 2ecogni ~ze a PSP94 epitope
(i,a., exposed epitope) that ,s available even when PSP94 is bound to
another polypeptide (anot:her ~.~olecule) . Such polypeptide may be for
example, a palypeptide se:_1~°ct~:~d from the group coraisting of SEQ
TD
NO . : t , SEQ ID NO . : 3 , 51~.,Q ID NO . : '7 , :ilaQ CI:) NO . : f' , SEQ
ID NO . : 9 ,
'~ va=iant:, fragment., analogue arid combination thereof . The hybridoma
cell pint. produc~ir,<3 such anti;x>dy is al~;;o oontemp:iated by the present
inven t x on . An exampa a o ~~ such arv t ibody ~s t:he rnor:oc lonal
antibody
produced by the hybridoma cell. line depositE:d to the ATCC under Patent
Deposit: NO.: PTA-4:41 (PLEB) ~sr :a polyc:Lona.L antibody able to
?!) recognize free and bound form; of PSF94.
The identiricat:ion of an expo:,s=d epitope may be pf~rformed by testing a
pane; c.>f arit-ibody for th,~ir s;,>ecificity to free and bound forms of
Pco~r _ Ann-ibod-ie;> which react:. (recognize) with_ b<>th forms may
?5 represent candidate atntidodie:;. Ch para:Lle.l., para ral, trypsin
digestion. may be perform:~d on the PSP94/PSP94-binding protein compl-ex.
PSP94 epitopes (e. g., li~~ear c.=pitopes) avai.:Lable ;n the complexed
form:. rnay tht.ri be identified :a:y amino acid ;sequen<;e analysis.
Antibodies able to bind to this or these (availabe) epitope(s) ma5~ be
~~() gene~atee . Exposed epitopes <:are to bf: understood herein, as epitopes
of a molE:=cule te.c~. , PSP94, S;Q ID N0. :2, SEQ ID "dCi. :3. SEQ :ID N0. ~
7,
5EQ ~D NU.:fs, SEQ ID N0.:9 aroa their complex) than are accessible i:o
an antibody, preferably when the molt>cule(s) cr complex is in its
nati~~e (natural) state ~e. g., non--denatured, natural or 3D form).
=n a 'urt:her aspect-_, the pre:;ent :i.nvention provides a method for
remo~.ring PSP94 from a sample, said method comprising
as c<mtacting said s;~mpl-a with a molecule able to bind to
PSP94 ! the molecule :nay be <jix°ect ly or indirectly bound to a
matr.vx or solid support.) and ;
b) recuperating a sample free of PSP94.

CA 02426589 2003-05-O1
It may proved useful to zemov~ PSP94 from ac sample (biological sample)
for example, removing excess hSP94 from sez°um of individuals (i.e.,
serum depletion of PSP94) havr:g elevated :Levels of PSP94 and to
S rei.nfuse a depleted serum :Lntc- tl~e individual (e.g. , patient in need) .
In ot-~er instance, ir_ mas~ be r:seful to remove I?SP94 from a sample in
order t~; optimize measurement of other serum constituents. Removal of
e9P5~3 l s oaseci on t he of t init.: between IeSP~34 and any orre of the
sequence set forth in SEn CD PiO.: ?., SEQ L1.) NO.: 3, SEQ ID NO.: 7, SEQ
Il) ID NO.: 8, SEQ IJ NO.: 9, ?SP'4 antibodies, and combination thereof.
The molecule referred abc>v~~ m<:y molecu.le may be se7:l.ected from the
group consisting of SEQ .D NO . 2, SEQ ID NC.:3, SEQ ID NO.: 7, SEQ ID
NO.:e, SEQ ID NO.: 9, a ;nonoc.ona1 antitjody produced by the hybridoma
ce_l i~.ne ciepositE~c.i to tie A'f!'.C: :nder Patent: Depo.-;i.t No. : PTA-
4240 and
a monoclonal antibody produce<i by the hybri<loma cell lme deposited to
the ATC:C under Patent Deposit No.: PTA-4241.
In yet a further aspect, the resent invention provides a method fcr
''() removing a comp:Lex formed by 'SPy4 ar.d any one of the polypeptide
defir=e<9 in SEQ :ID NO: 2, SEQ 1:D N0.:3, SEQ 1D NO.:'7, SEQ ID N0.:8, SEQ
~D tlC . :9 and combir:ation they ~of (e.g. , PSP94/SEQ I:D N0:2 and/or
FSP9-~;:~EQ ID 1TC.:;~ andio~ PSPS>4;Sr;Q ID N0:7, etc.; from a sample, ..aid
method comprising;
a) r_ontac:t=ing said srmp~e with an ~:~ntibo<3y able t:o recogni.ze
an. av<r.ilable (exp oseii) epit~ope of sai<i complex (e.g. , t:he
antibo<:ly may be d i.:rect~ly or indirectis~ bound to a matrix
or so : id supaort. ) and ;
b) recupe.rat:ing a sa;np:lce free of said complex.
:n cr_e embodiment of the present rnventlor., the antibody used in step
b) miry compri:~e, for example, a monoclonal antibo~ay produced by the
hybr:dom~~ ce.L7. line depo;~ited to t:he A'fCC under P,rt:ent Deposit No.
PTA--*241, a monoc:Lonal antibody produced by the hybridoma cell line
deposited to t:he A'rCC ur:ds,r Fatent Deposit No.: PfA-4242 and a
monoclonal ant.:ibody produced by the hybridoma cell line deposited 1.0
t'_:e .<?TC.'C under Paten r_ Deposit No.: PTA--9243. Preferably used is the
raonoc:lonal anr_ibody produced by the hybridoma cell line deposited to
the ~'fCC under Patent Depc>sit No.: P'I'.A-4243.
4~
21

CA 02426589 2003-05-O1
Other aspects of the pre;-:ent nvention encompass the monoclonal
antibody produced by the hybrdoma cell. line deposited to the ATCC
under Patent Deposit (e.ci., A<~cessionl No.: PTA-4240, as well as the
monoclonal antibody prodvrced kay Blue hybr:idoma cell line deposited to
the ATCC under Patent Deposit (e.g " Accessions N«.: PTA-4241 and
antigen binding fragment:c :.he:. eof .
Also covered by the present invention are true hybradoma cell lines
producing the antibodies desc:'ibec9 herein. These include the
() hybridoma cell 'ir.Ee depo:>ited too t:he ATG:C :.:nder Patent Deposit
(e.g.,
Ac;;ession) !V<:~.: PTA-4240 and ..he loybridoma c:el.1 line deposited to the
ATCC under Patent lJeposis: (e.~J., Accession) No.: I"~'A-4241.
In ar:ot~her aspect; tre p~resen' invention provides a method for
)~ cneasur~ng, iru a sample, ~,::he t~::~tal amount of PSP94, said method may
comprise contacting said sample with an antibody able to recognize
PSP94 even when P:>t?99 is bound tn another pc>lypept.ide (such as for.
examP:le, SEQ ID NO.:;?, S.~Q ID N0.:3. SEQ ID N0.:7, SEQ ID N0,:8, SE;Q
ID NC . : 9 vari_anr_s, f ragm~>nts end anal.ogues) . Thi:: aspect of the
~() inver,t.iorn enc:ompa;tse; an,r met.uod which comp.r:'ises this step,
irrelevant.
of tire tact that one or more >>teps are to be perf<.>rmed or not.
In one embodiment, the antibody that may be used :gin measuring the
total amount of PSP94 in a sa:np.lc>, may he, for F°xs:lmple, the
monocle>nal.
?5 antibody produced by the hybridoma cell line depo:~ited to the ATCC
Lrder Pater;t DeposLt No.: PTA-429'1. or it. may be a polyclonal antibody
able t:~ recognize free and bo..rnd forms of PSP94.
'.'he merhc7d for me<~suring total ( f r~ee Oarrboundj am.3 bound) amount of=
U PSP9~= in a sample conterrylated above may comprise the following steps:
a) imrnob:ilizing (coa:~ir.q, adsorbing) a PSh94-antibody to a
suitable substrata (EhISP. plate, matrix, SDS-PAGE, West=ern
blot membranes) . 'fl~.c-~ ant: ibody may be able to recognize
PSP94 oven when bound to a PSF94-binding protein (such as
35 S;~;Q I17 N0. : 2 , SEA; ID N0. : 3 , SEQ ID t~d0 . : 7 , SEQ ID N0. : 8 ,
SEQ ~'~ N0 . : 9 ) ;
b; adcnn~x a sample c:vompr:ising F'SE'94,
c; addsny a PSP99 dFt~ecr..ion r~:~agent comprising a label or
marker, and;
40 d) dc~tect..ing a signa:L resul~~ing from a 1<~bel or marker.

CA 02426589 2003-05-O1
Exampie:> of suitable detE~ct:ion:. reagents t:heat may be used in step c) of
the present method, ? ncl~.ade~ ar, ant.ibody and a polypeptide having an
affinity for PSP94. However, the detection reagent: may preferably
:.ave a different: bi.n<ling site than the F~ SP':)4-ant.ik;~ody and a PSP94-
c~Lnalng z>rotein. ~fhs~ det edit:gin rt:eagent may either be directly coupled
to a label (or marker) (e~.ca. , anti.bod:y conjugate ce the present
invention) or able to be reco<,nized by a secorxci molecule carrying
(conjugated with) said libel :~r- nm:~rker.
1l) An example of a PSP94-ant.ibod~.~ that may be used it step a) is the
antibody (Plr:B) pr<:>duced by ti;e t~.ybridoma r:ell lir;fe deposited to the
a.'r"t' under Patent L7eposie, no. . P'tA--4241. I:n r_hat <wse, r_he
det.ecti.cn
reagen;: fi~ay be, fox example, ~::he antibody ('2D3) O~.g., antibody-
conjugate) produce=d by t=ie lry:aridoma cell Line deposited to the ATCC
IS under F~atent Depo~;it no. : PTA 4240 or achy of:her sl.Aitable PSP94
antibody.
It is t=o be understood h~:rein t=hat. a poLyclonal an t,ibody (one or more
polyclc>nal antibodies) a:>le t:_:;~ recognize free and bound forms of P~;P94
'i'i may ;e suitable for any ~af st aps a) or c~) in comb:. nation with any of
the r::onoclonal antmbody ~3escrrbed herein. nor example, total PSP99
may be captured with a polycl.~na l an t.i.body (an ant: i.body able to
recogn:izE free and bound form:. of PSP94) and detection may be
perfc:rmed (directly or i :dire .~.tly) with another antibody such as Pl.EB
~'S ( and v i co ~rersa) .
7n addition; t:otal PSP94 may jae captured witty an antibody able to
r e~:ccrrri ze PS!~W 4 in i is f ree and bound f o-rms ( a . g . bourrct to a
PSP94-
bina~.nc.) F_>rotexn as described ;uerE~ in) , such as, fo.~: example, a
a0 polyclonal ant:ibody or tie P1:~;8 antibody (produc-e!i by the hybridom~r
cell line PTA--424:L) , and dete::tion of the captured proteins (comple=x)
may )>e p~:rf o:rmed wit h a .:ombi nit on «f t=wo or mor.: antibodies i . a .
,
one abi.e t<> de-.tec~~. the f re~e I=:pP94 ( a . g , , 2D3 produc=ed by
hybridoma
cell !x.ne PTA--4240) and one or more antibodies able to detect PSP94-
35 bindi_mc~ prc~tezn (e.g., 37G9 produced by the hy'bri~~oma cell line PT7~
tk~%4:~ ~-~nci~~:°~r- ib'u produced by the nybricyoma cell line PTA-
4242) .
In yet another aspect, the present invention provides an improved
method for measuring the amount of f~-a_E::' PSP94 in a sample, said mevhod
40 c;ompri:;ing contacting said sa;nple wit=h an antibody able to recognize
1?SP94 (e g. , in its free four ) .
?3

CA 02426589 2003-05-O1
In an embodiment of the I>reser:.t: inventic:m , suitable antibodies may
include for example, the monoc~lonal antibody produced by the hybridoma
gel ~~ line depos~teci ..o the ATt:C under Pat=ent. Depow:it No.: PTA-4240 and
'~ the :nonoclonai antibody produced by the hybr°idoma cell Line
deposited
to the A'fOC' under Patent Depo:~it No.: PTA--4241. F-!owever, other
suitable antibodies are e.n~:omf~assed by t;he x:~resent invention, such as
the 12C".3 antibody tTable 10).
1~) In an additional aspect, the faresent invention prcwides an improves.
method for meeasuring the a-nourit uf: fro-.:e (unbound HSP94) PSP94 (and/or
PSP94 fragments arol analogues thereof) m a sample:, said method
c:ornprising, c:ontaot;iu,.g a samp~.<~ fr°ee of th<~ pSp94~ PSP94-
binding
protein: complex with an ,~ntib~>dy able to recognizes PSP94, PSP94
1> fragments and analogues here::~f. For example, the: improved method may
for measuring the amount of f~~ee PSP94 in a sample: may comprise;
a) removing a comple.,: tc.~rmed by PSI?94 anca any one of the
polype:pti.de select-ed ,from the group consisting of SEQ TD
NO.: ::. SEQ ID N0.:3, SEQ ID Nu.:7 SEQ ID N0.:8, SEQ IL>
~() N0. : 3 and coinbma ::ioru therEruf , ~;~enerat: l ng a complex-free
sample, and;
bi <:onta<:ting s~~id c;>mp1<:.x-free sample w.,.t.h an antibody able
to :re<:ognize PSP9=1.
?1 The improved method for measuring the amount of free (unbound PSP9~;)
PSP9s in a sample corrtemplate~.i herein rnay also comprise, for examp7.e,
the Following steps-;
,-x) removing a c:ompi-ex f,~rmed by PSP94 and any one of the
polypept:Lde selected from the group consisting of SEQ ID LJO..
BO 2, SF,Q :ID N0.:3, SEQ ID N0.:7, SEQ IL N0.:8, SEQ ID N0.:9
variants, fragments analogues and combination thereof,
gener-atinc~ a complex -free sample (e.g. , casing methods
described herein)
;a) ircunobili~air_g (coating, adsorbing) a PSP94--antibody to a
3~ smtable substrate (ELISA plate, matrix, SDS-PAGE, Western
b~~~t membranes);
c..v) adding said complex-free sample comprising free (unbound)
PSP94,
d) adding a (PSP94) detect.on reagent comprising a label or
4t) marker, and;
e) detecting a signal resul..ting from a label or marker.
'7<~

CA 02426589 2003-05-O1
Examples of suitable detectior: reagents that. m<iy be used in the
present inven.tiorw are rea.gent;: selected frc.~m the group consisting of
era: a.~~il~ody and ~i poly~pept_ide hav~rZg an affinity for_ PSP94. The
'~ detect/ ti>n reagent may have a ~:ii.ffc~rent k~i.nding site than the PSP94-
antibody, and the detection re:ager~t may either be directly coupled to
a label (or marker) or able tcbe recognized by a second molecule
carrying (conjugated with;) sa.d iabe=L or marker.
1() An example of a PSP94--antibody used in step b) is the monoclonal
antinociy (2~3) prcduc:ed i>y the-~ hybridoma cell Line deposited to the
ATCC ~r_der Patent :deposit. no.. PTA-4240. (r: that Case, the monoclonal
antibody (PLE8) (e.g. , cc>njug<<t:ed) prod~.rced by the hybridoma cell. line
deposited to the ATCC under Pa: t:eot Depo;>it no.: PTA-4242 may be used
I> as a detection reagent (clirec._:y or indrer_t::ly as described herein).
Anotper example of a PSPV34-an:ibo<iy that: may be used in step b)is the
monoclonal antibody (PlEt3) pr~aducod by t=he hybridozna cell line
depos:.ter t: the r~TC;: unuer P. te::t Deposit mo. : P~'A-4241. In that
() case the monoclonal antii~ody ~:2D~) (e.g., conjugated) produced by the
hybridcma cell .Line depo:~ited to the A'fCC under Percent Deposit no.:
PTA-4240 may be u_~ed as .~ det~ec~t l on reagent (direct. 1y or indirectly as
described her.ein).
?~ In a further aspects, the present invention relater to a method for
measuring the amount of :total PSPN4 (bound and unbound (free)) in ~i
sampu e, T:: he method may c ~mpri ,e ~isinc~ a f ir:>t ar:d a second
antibod~~
able t« bind tc PSP94 even wh.rn PSP94 is bound t.o another polypepti.de
( a . g . , SE;Q ID NO . : 2 , SEQ ID N 7. : :p , SF:Q ID NO . : 7 , ;;EQ ID
NO . : 8 , SEQ ID
r30 NO.:~). It may be preferable that the first and :second antibodies
bind to a ciifferen~~ PSP94 epi :=ope.
(:n yc:t a further aspect, the ?resent invention relates also to a
rret:od for measur:~ng total PSP94 in a sample; the method comprising
3'~ as~ncl ~, first amd a second ar~mb«dy, wherein said first antibody i:~
axrlQ t~r imr~d ? c Paf94 ever. wh=~n JSP94 as bound to a polypeptide anti
wherwei;; said second antibody :is able to bind to P5P94 and to displt~ce
any one of the polypepti_de selected :From the group consisting of S13Q
ID N0.:2, SEQ ID N0.:3, SEQ ID N0.:7, SEQ ID N0.:8, SEQ ID N0.:9 f:_om
~ a complex formed by PSP94 ant: said polypeptide.
~1

CA 02426589 2003-05-O1
In an embodiment of the presex~.t invention, the first antibody may be,
fo:r example, the rnonoclorlaL au.t:ibody pro>duc:eed by tlxe hybridoma cell
x une oeposi tea to r ht: AT;:C unc ier Patent: Deposi t No . : PTA-4241 , or
any
other suitable antibody. 'The second antLbody rnay be, for example, the
:' :nonoclorxal antibody prodmc~=d 1>y r_he hybridoma ~:el~ Line deposited to
the ATCC under Patent: Det>osit Cdo.: PTA-424t?.
In an addit:ic>nal aspect r:he p~~eesent ixuvent.i<:m provides a method for
measuring the leve'_ (amovrnt, ~~.oncentration) of PSP94 in a sample said
U method comprising contac~:ing :;aid sample with an antibody that is able
-~ ~LOogniz~ PSP94 i:~. it:3 free ancbound forms (e.g. , bound to SEQ ID
NO. :2, SEQ ID NO. :3, SEQ ID N~?. : , SE;Q iD NO. :8, :~EQ ID NO. :9 etC. )
forms.
l 1 In ac- embodiment of the ~rese:it invention, t:he monoclonal antibody
produced by r:he hybri dom;~ cel . l ine deposi ted to ! he ATCC under Patent
Deposit CvrO.: PTA--424.1. ma-~ be xsed.
~ri~'hen mer_'r.ocs (e.g. , measuring total PSP94, tree PSP94, free or total
'0 PSP94-binding protein an::3 cal wlar.ing ratios) des<:w ibed herein are
appli.ect to clinical samples (:serum, blood, plasma. etc.), they may be
u.seful_ for screenix:g subjects for a condition linked to abnormal or
elevated levels of PSP94 (e.g., prost:ate cancer (E:.g., prediction of
relapse free interval in post :ra~~liotherapy prost.a"-c cancer) ) and for
'> asse,>sing, for example, ~rogn~:>sis in a subject: diaictnosed with
prost:ate
~ancer. For example, it may oe found that the higher the level of
v.otal rSP94 (or raaio of free PSP94%t:ot:al PSP94, ~ar total PSP94-
bindinyf protein) in individual. with prostate cancer, relative to
control subjects, the poorer -.he prognosis or higher the chance o.f
0 having (developed recurrent) prost:ate cancer. In addition, when a
raised level, of tor_a1 PSP94 (or of:her parameter d~~~~cribed herein) :~s
observed ii: a subject, it may be predictive (or s.iggestive) of
prose ac a cancE-.r ii: tknat st.bje::t . Thus, diagnosti : and prognostic
methods t-or screening subject for prostate cancer (or any other
ZS condition linked with ac: abnormal or elevated levee. of PSP94 or of
r?SPy~f-i:~ind~ng protein) are also erlconnpassed by t.he: present invention.
.f dc->sirEed or nec~assary, rrletr~ods of ~~he. present invention may also
ancL~zdee a step of co:Llecting as sampLu; for- examplw, a blood sample
0 from an ~ndividuai with a condition linked wit-h elevated levels of
26

CA 02426589 2003-05-O1
PSr94 or- other c:ondit:lon and t~ert:c>rming the above-mentioned methods
and assays.
Methods of the present imvont~on rnay furthei:~ comprise detecting a
signal from a label that is p::-ovided (carried) by said molecule
(anti.body, polypeptide; e.g. , f_rutn~, the .Label attached to the molecule)
or by a second molecule :;antii:rody or binding/ligar.ci system) carrying
said label.
i~)' ~lechods of the prc,sent invention niay also include comparing
(detecting) t:he signal (:~esul..s) obtained for the sample with signal
(results) obtained for a cont. of sample cont:ai.ninc3 a known amount of
the poiypeptide of interest.
1> In a further aspect, the pres.-ant .invention related~ to the use of a
PSP99 antibody for tr:e t:_eatm<:nt. <:~f a concur.:ion associated with
elevated levels pi: PSPy4_ It as to be understood chat a method of
tr?atir._g a patient with :>uch condition, comprisinc) administering a
PSP94 antibody is also a comp issect herein.
?0
In yet a further aspect, the .present :irivention re'_ates to the use c>f a
PSP94 antibody in the marufac~:.ure of a rnedicanient for the treatment. of
a comditior! associated with elevated levels of PSt>94.
~ T'he I'SP94 armibod,~es may be fir example, a monoclonal antibody
prodL;ced by r_ne by ori.doma cel ~ lone deposited to ;:.he ATCC under Patient
Depo:,i~ :No.: PTA--4:?40 or a mo:iocl.ona7. antibody proc_'tuc:ed by the
hybridoma well line deposited to the ATCC under Patent Deposit No.:
PTA-s~ 2 41 .
~a
A sarnpie, is to be understood herein as an ali.quo: of blood, serum,
r~iasr;ua. :uc:loglca:l fluid, or _t may be, for example, proteins
~cor!1:.N-na.n<t other consCituent..~ or not) bound ro tn~:e well of an ELI:~A
plate, a membrane, a gel , a m.~tr i;c, etc .
~5
In yE~t a further aspect, the present invention relates to the use of a
molecua_e select.e:d from t:he gr:~up consisting of thc~ polypeptide as set
f orth ~.n SE:Q -~D NO . : 2 , SEQ IL" NO . : 3 , SEQ I D N<i . : l , SEQ ID
NO . : 8 , :3EQ
:D N().::9, a monoclon<~1 antibc:dy (:?D31 )_>roduced k>y r_he hybridoma ce:Ll
_=r!e deposrte<z to the AI::C ur;der Patent Deposit No.: PTA-4240, a
utono<: i.on<.ii anti,x:>ody ( P1 Ti8 ) produced by t ho hyt:>rid:~ma cell
line

CA 02426589 2003-05-O1
~epo:=lr.<.r.: t:; z.:'lf> ~.:::~Ci_; unde:r Paat:ent. Deposut. Fao.: fTA-
4241, a
~ronoclonal antmody c3F4: produced by the riybrx.doma cell Iine
deposited to the A'fCC. un<Ier P~aerit. Deposit PJo.: P'?'A-4242 and a
monoclonal antibody (17G~7) produced by the hybri.dc::ma cell line
7 deposited to the ATCC under P,vtent.; Deposit No.: P'fA-4243, for
evaluating the amount of PSP9~(free and!or bound and/or total), PSP94
variant~.~ and analogues ttiereo.' ir_ a sample.
:~ctcrding t.o the present invention, conditions that are contemplated
lij nor tr:etrtods and uses desaribe~i hemein may comprise, for example,
prostate cancer, ~;t;o:nach canc~rr, breast cancer, erndometrial cancer,
ovarian cancer, other cancers of epithelial secretary cells and beerign
prostate hyperplasia (BPH).
l > Tt ~~ t o be under>tood h~~rein that. other antibody may be used (are
sux.tabxei zn the methods desc:-.ibed herein. For example, PSP94-binding
~,ror_e~:~ specific antibodLes lasted in table 10 are' interchangeable and
are Encompassed b~J the preser.°.:. a.nvent.iorl (includitug their
hydridoma
cell i.inesj . For c~~xampl~ the monocle>nal antibody (3F4) produced by
0 the ryt>ridoma cell line .~3epos ited to the A'rCC ur~df~r Patent Deposit
NO.: P'fA-4242 may be intarcharxged with the monoclonal antibodies ;3f310,
9B6, 1131:1, er_c. and the :nonocl.onaL antibody (1769 produced by the
rybrz dome ce 11 1 ine cleposi ted to t:he ATCC under Ptxtent Deposit N0.
PTA-7243 may be inc~erchazged ..vith the monoclonal aantibody P8C2, 1B71,
r_~r z6BlG, 986, etc. A variety or: o~'ner conditions arw possible.
However, when two antibodies .ire neecLed to perform the present methods
1_t. is preferable t:o choose anT::ibodies that bind te> different epitopes.
It l:; al;o to be understood ht~r.e:in that: antibody fragments, such as an
0 antitlen-binding fragment (e.g.., anti<Ien binding site) of any of the
imonoclonal) ant.ibodles discl::~sed herein are encompassed by the
~~reserxt_ ini~encion_
Geners~ Molecular Biology and Definitions
35 Clnless or_herwise indicated, the recombinant DNA techniques utilized in
the ,resent invent ion a ~e st xndard procedures, known to those skilled
r; ! ne:~ at~t . Lxarnple~ of su<.h techniques are' explained in the
-~ite.-ar.ure in sources such as J. Perbal, A Practical Guide to
~Ic?e;~uiax- Cloning,. john Wiley and ~)ons (1984) , J. Sambrook et al ,
~~ Mclec:u.:ar' s.lormng: A La~orat. o.ry Manual., C:'old Spring Harbor
Laboratory
I?res:~ ( 1989; , ~r.A. Brc:~wm i~~dir:or) , !~ssentiai Molecular Biolog~,r: A
Zs

CA 02426589 2003-05-O1
Practical Approach, vial urges 1 and 2, IRL: Press i1~391 ;t ; D.M. Glover and
B.1). Names ieditors) , DNA C1<:ninc~: A Pr_acti.c:ai AL.~proach, Volumes ~-4,
IRL Press ( 1995 and :1996) , and F.M. Ausubei. et a.. . (editors) , Current
Protocols _n Molecular Biolmgy, Greens Pub. Associates and Wi.Ley-
'i Interscience (1.9~if3, includ:irg a:Ll updates until present) and are
incorporated hereiru by reefere;:ce.
wPoiynucieomde" a~neral.~y revers to any poi-yribor~ucleotide or
poLydeoxyribc:>nucleotide, w~ici: may be unmodi.f.ied 1';NA or DNA, or
Il) modified RNA or DNA. "Pmlynu::vleotides" include, without limitation
single-- and double:--stranded DI IA, DNA that it a mixture of single- and
double--stranded regions, sing;-e- and double--stranded RNA, and RNA that
is a mixture of si-ngLe- and d~:~ublE>-strarrcled regiora, hybri-d molecules
comprising DNA anti RNA that m<.jy be single-strandec! or, more typically,
! ~ doublF-stranded or a m,ix~;ure >t e:ingle-- and doublf::e-stranded region
.
Ir. a d;t:.on, "poi-ynucleo~=ids" .reff~rs t:o tri~;~:le-stranded regions
comprising RNA or DNA or both RNE~ and DNA. 'The te:erm polynucleotide
also includes DNAs or RN,~s containing one or. more modified bases and
hNAs or RNAS with backbones m~difi.ed for stability or for other
?0 xeasc:ns. "Modifiec.9" bas«s in--Lude, for example, t cityl.ated bases and
unusual. bases such as inosine. A variety of modifications has been
made to DNA and RNA; thin "po Lyn~ar.~.le<>tide" embrace:es chemically,
enzyn,aticaliy or metabolicall: modified forms of polynucleotides a:>
typically found irt nacur:=, as ~Ne! 1. as t:he chemica'~. forms of DNA anti
RNA characteristic of viruses and ce7.ls. "Polynu<~leotide" includes
but s not limited to linear ,z:nd e:nd--c:7.ose~d molec~zles.
"Polynucleotide" also embraces relatively short pcalynucleotides, of: ten
referre::d tct <~:> olic~onucleotid~~s.
3l) M'hertWore, in accordance mth the present invention, the
poi yr:u,::leot ids may be, for ex ample, a I>olyribonuc:Leotide, a
poly<lecaxyribonucif:otide, a mo~:3ified poiyribonucleot:ide, a modified
polydec.>x~~ribonucleotide, a c«cnple:rnent:ary polynucl~~~:~t.ide (e.g. ,
anti~~errsE.) or a cornbinatic>n t.hereof.
"Pali,~peprW de" refers to any peptide or protein comprising two or more
amino eicids joined to each other by 1~e1;~'tide bonds r~r modified peptide
:~cna:~ ,..e-; peptide iscst.eres). "Polypeptide" refers to both sho:ct
c-ina._~as, r-ozrmonly Yeterreed as peptide:>, <.~l~gopepti~les or oiigomers,
and
~ t_o longer chains generally referral to as prot.ems. As described

CA 02426589 2003-05-O1
above, po.lypepti_des may contain amino ac~cis other than the 20 gene-
encoded amino acids.
"Variant" as the term used herein, is a polynucleot:ide or polypeptide
:~ that differs from :ef.eremce pr~7_yrm.~cleot:ide or polypeptide
respectively, but retain: esst-:ntial properties. A typical variant of a
po'_ynut~leot ide ~ilf teas irt nuc : eor a. de sequen<:ve Iron: another,
reference
polyrmc:~eot:ide. Changes in thce :mcleot:.ide :equen<:e of the variant. may
or may rat alter the amino ac'.d sequence of a polypeptide encoded by
if) the referen~~e polyr:uc.Leo;:ide. N,aolectide clanges may result in amino
acid substitutions, addi::ions. deletions, fl.~sion and truncations i.n
the polypeptide encoded :~y th'e reference sequence, as discussed
herein. A typical variant of <~ pc.~lypept:idc=_ diffexs in amino acid
sequEn ce from aaot.aer , rc:fere:nce l.:olypeptide. Cer:pral7_y, differences
i7 are lm,atea so that the :;equerce of the reference polypeptide and the
variant; are closely :.,imi~ar o-:rf~ratl a.nd, in many legions, identical.
A variant and reference ;~olyp=::pti.de may dif.f_er in amino acid by one or
more substitutions, addi~:ions, deletions, or any mombination
therefore. A sub;~tit.ute~:7 or .nserted amino acid residue may or may
?() not t>e one encoded by th~~ gene:tic code. A variam polynucleotide or
polypeptide may be a rat hall ; occurring swh as an allelic variant.,
or it ma;% be a variant that i:.t not, known to occur naturally. Non--
natunai ii. c>ccurrrnc; variants >f polynucLeotides arid polypeptides may
:~e made try muragenesis t-achni.lues or by direct sy::t:hesis. "Variant:s"
as u:.ec:a herei.ri encompass (ac t. a.veJ mutants, <~nalognies, homologues,
chimeras, fragments and porti.~ans t: hereof. Howeve_-, "variants" as used
here;n may retain parts of th~:~ biologic:al activity of the original
polyF.>ept l de .
73) As u~~e;~: iuezem;, "'ptrarmaceu.ti.c:ai composition" mean:.
therapeutically
effect,vEe amounts :of the agen°.: together wrth suitable diiuents;
preservatives, solubilizers, emulsifiers, adjuvant andior carriers.. A
"therapeutically effective arv;~ur:_." as used herein twefers to that
amourut which provides a t:l-~era~oeut:i.c effect. for a liven condition and
~S administration regimen. Such ":ompositions are liquids or lyophilized
<;r u;:ht.rwv:~e urged formulations and :inc°:lude dl lue.nr..s of
various bu:~fer
~vont.s.n~ e.ex.. , '~~.r~s-fvCl. , ac~et:ate, phosphate) , pH and ionic
strengs~h,
addi': iT:~e:: such as albumin or gelatin to prevent aosorpr_ion to
surf<xces, detergents (e.g., ' wee: 2U, ~I'wee:n 80, P!uron-~c F68, bile
n acid salt: s). sol.ubillzirig agents (e. g., glycerol, polyethylene
glycerol), anti--oxidants !e.g., ascorbic acid, sodium metabisulfit~>>,
3()

CA 02426589 2003-05-O1
preservat ives ( a , g . , Thirnerosal , benzy:l alcoho 1, ~:arabens ) ,
bulking
substances or tonicit:y mc>dific.~rs (e.g., lact:.ose, n~annitol), covalent
attacrment of polymers suc:c a~~ polyethylene glycol to the protein,
complexation with metal ions, or :ncox~porataon of the material intc or
'i onto particulate preparations of poly-nte.ric oompour.ds such as
poiyiact~c acid, polyglyc:olic acrd, hydrogels, etc°, or onto
liposones,
micrcemulsions, mx.ceiles, uni:.ame.llar or mu:l.tilame~llar vesicles,
erythnocyt:.= cthosts, <:~r s)oheror~:lasts. ~uc.-h rc>mposit_ions will
influerce
the physical state, solui~ilit~~, stability, :-ate o: in vivo release,
I() and rate of in vi~~o c~lear.ance. Control.lc;d oz- sustained release
compcs~tior.s include for:nulati.on .i.n li.pophilic depots (e.ct., fatty
acids, waxes, o.ils). Also com,,iretuended by the invention are
particulate c:ompo~;vtions coat~~c3 with polyme.r.s (e.cr. , poloxamers or
;~eloxamines) . Othez- embo,,iimenv:s of the compositions of the invention
aJ incorporate particulate Eorms protective coatings, protease inhibitors
or permeation enhancers Eor v i:rious routes of adm: ni.stration,
including parenteral, pulmona;:y, nasal and oral rc,utes. In one
embodiment the pharmaceutical composition is administered
parer:t:r_~rally, parac;ancer-xli.y, trartsmucosally, trarisdermally,
0 intramuscularly, :_nt.rave;xousl.;, intrade:rmal:iy, sul_icutaneously,
intraperitonealy, xntrav~~ntrixularly, intracrania_i.y and
xntratumoral. iy.
An ' irrmmr::i~ing composition" o:° ~mmunogenic compo~~ztion~ as
used
'?S here; n rE~fer:a to a composition ab:Le t o promote an immune response __n
the boat receiving such composition. An "irrununiz rng composition"
inci~:des a compound, suc;n as for example, a polypt~t>tide (or a DNA or
F,NA able to encode a polypept ide) fox- which an an-ibody is sought.
The polypeptide is usually diluted ir: a buffer, diluent. or a
30 phar~rnaL:eutica~~ly acceptaole c;~rr~e;r. hn "immun.iz Trig composition"
may
comprise a:. adjuvant such as r>r example complete j~reund's adjuvant,
i_ncornpiet.e F'reund's adjuvant :end aluminum hydroxide.
Further, as used herein "p'rrar:~nac~eutically acceptable carrier" or
~5 "pharmaceur:ical carrier" are known iri tit-ce art and ;.nclude, but are
not
«.Lu~::e;r:c, 0.0~-".1 M and preferably 0.05 M phosptxate buffer or 0.8~
~,al a_ne hcidit:ronai iy, such pharmaceutically acceptable carriers may be
agueour~ car riorr-aqueous soluc~ons, suspc=:ansions, and emu~~sions. Examples
cxi rian-aqueous :aoivents are F-ropy.len~ c,~l.ycol, polyethylene glycol,
0 veget:able~ oils such as olive oil, and .injectable organic esters su~~h
as ev:~hyl oaeat;e. Aqueous: carriers inwlucle water, ilcoholic/aqueous
31

CA 02426589 2003-05-O1
solutions, emul~~ions or ~~uspeu~sions, including sal i.ne and buffered
media. Parenteral ~.~ehiclt>s inc°ludee sodium <:YuloridEa solution,
Ringer's
dextrose, dextrosE and sodium chloride, lactated Fi.nger's orfixed
o.r.ls. Intravenous weiricles inwludc: fluid and nutrient replenishers,
~l;~~trc.~lytr ep'ien.i.s:~ers such as those based on Rp:nger~s dextrose, and
the iir;e. rreservatives <rnd o~.her additives may also be present, such
as, for example, antimic.wo.bia:.s, antioxidants, coil.ating agents, inert
gases and the like,
1() As used herein, "PSP94-bindirg protein" relates t.o a protein (suc'.Z as
SEQ '_ D NO . : 2 , SEQ ID IVo . : .! , ;EQ 7 D NO . : 7 , :pEQ ID NO . : 8 ,
SEQ TD N0. : 9 )
:hat !.s aerie to bind (i.e., assoc:iate) Lo i'SP94, usually in a
reversible fashion.
17 As u~~ec:i herein, t:he germ '" free: PSP94" relates to t~ 'PSP94 protein
that
is n<5t associar_ed with a.noti~eer polypeptide. T'nee term "free PSP94"
means that PSP94 is in am unbound form (state).
As used I':.ereW , ttu_ germ "ant ~bocly" refers to eitiner monoclonal
_'t~ antir~o<~y, polyclonal antibody. :humanized anr_ibody. single-chain
amti_ouy, ar:tibody fragments ~nc'Luding Fc, t~(abl~, F(abi2' and Fab and
the :like.
As used herein, the term "antigen binding fragmen~~" relates to an
~5 antiYpody fragment (antigen bi:idiny domain) able t~> recognize (bind)
the cantic~er~ of: interest. Are °ant:igen binding fra~~rrtent", may be
isolated from the genes) (e.~., c7ene encoding a ~rariable region)
F°racoa~:.g tre antibody using rr;oleculai: biology metruds. The
isolated
ge:le.s) may «nginee~red t.o cre,:rte, for a>xample, a :a:~.nglo chain
3~ antibody.
As used t~exein "PSP94" relater t.o the native and recombinant PSP94.
3~ Gene (cDNA,I cloning anCl protein expression
..~ :. leixt -. ~ ~~ed a.:-rc. :.o:~ata-ci gene r ~ . f, . , poi ynucleot:ide
) may be
inserted into an appropria:e cloning or expression vector (i..e.,
~:xprta;~ion system) . A ltir<~e r:unlber of vector-host systems )mown ir,
ti2e
art: may be used. Possi,>7.e vectors i.nc~ludk~, but are not limited to,
0 plasmids or modified viruses (e.c~., bacteri.ophages, adenoviruses,
aderr~o-<~ssor.iated viruses , ret roviruses) , but the vector system must be

CA 02426589 2003-05-O1
compatible witLu the hcst c~.=_11 used. Examples of cloning vectors
include, but are not i.imi ted to, Escherichia coli (E. coli) ,
bacteriophages such as lambda derivatives, or plusmids such as pB..~322
ae~ivatives o~ pLl' plasmid derivatives (e.g. , piEX vectors, pmal-c,
'l ~,~E'~t,AC~, et:c) . Examples of expr~ass_r>n vectors are discussed bellow.
The
l user t ~or> >ntc> a cloning or expeess.ian vector :.an, for example, be
accom,pi.ished by ii.gat.ing the ;)NA t=radmer~t into a r.Loning vector, which
has camp.Lementary cohesive termini. However, f the complementary
restriction sites used to f;_agment the DNA are not present in the
1() cloning vector, the ends of they DNA molecules may be enzymatically
modified. Aicernat.~ively, any site desired may be produced by ligating
nucleotide sequences (linker:a) onto the DNA termini; these ligated
.._.:kE~-:ma-~ comprise spacifi~: chemically synt.hesi-.>.ed oligonucleotides
encoding restric:t.i on en 3onuc l.ease> recogn.i.t.ion st~quences .
Recombinant
1> molecules car: be introduce~.f into h<wt cells via transformation,
transfection, lipcofec:tian, infection, <=lecvtropora:~:ion, etc. The cloned
gene may be contained or,~ s:::utt.ie vector plasmi~9, which provides for
exparaion in a cloning cell, e.g., E. call, and facilitate
puri.f ic:~ation for =;ubseqment i.nser.tion into an apLoropriate expression
?t~ cell l~nt~, if such is desires. Fair example, a shuttle vector, which is
a vector that can repliwat~e n more than one type of organism, can be
prepared for :,replication i.n i>ott. E. call and Saccharamyces cerevisiae
by .l..nicing sequences from an E. c:ol~ I~lasmid with sequences from the
yeast. l.nru. plasmld.
?5
Lt-_ is to be ~.rnderstood herein that. wL:en the polynucleotide (e. g.,
gene, ~~DNA, RNA) of the present invention is inse~_t~ed into the
e.pp~c:~p~:i~aE: vector, v.t rnay be used, for example, as a way to express
c.he F~rote>in ire a ~oreigr. host cei~~. for its isalation (such as
() Y>acteria, yea<~~t, insect, animril or plant cells) o- in a (:isolated)
cell. from an indi.~ridual ten p~.zrpose of gene trteral>y treatment or cell-
mediated vaccination (using, 1=or example, dendritic: cells). For
e:xam~>le, cells may be isolate from a mammal and treated (e. g.,
expo:~e~ , tran:~fected, lipofe<.-ted, in~ec:ted, bambarded (using high
~5 velo<vivy micropro:jectiles) ) E.K-wivo with the polynucleotide (cDNA,
caer~ +~~E.., anr:iseraeaof r:he present :rnvent.lon bef~~z-e being re-
infu:>ed
.. the same-' ind~viduc~l an m ;r c<~mpat.ible indiv:rdual. In vivo delivery
at a p«lynucleot.ide may be performed by other metm:~ds than the one
described above. Fox example, l.iposomal formulations when injected,
n may also be suitable for medp:~ting in vivo delivery of a
polynucleot~ido.

CA 02426589 2003-05-O1
A.ny of a wide variety o" expressr-on systemsbe used to provide
may a
reconbinant poiyp~~pt_de (prot.ein) . The
prec=ise host. cell used is not
critical to the ~nventic>n. P:~iypeptides
of the present invention may
'7 be proclut~ed in a prakaryot=is bast. (e.g.<>r Bacillus subtilis
, E.. r_ol.i
( B . su:nti 1 ~-s > ) or in a eukaryot i.c . cr . , Saccharomyce:~
host ( yeas t a or
Pichia Pastoris; mammal_~an cr.~lls, e.g. ~'r~S cells, mouse
, monkey 3T3
cells (TOdaro ~~J and Green I-I., ;T. Cell 17: 299-313, 1963),
Biol.
Chinese Hamster Ovary cells (CHO) (e. g., et al. , J. Exp.
Yuck T'f Med.
!() 108: 945 -956, ! 958) , BHK, h~.irnar~ is (e.g. , ATCC:
kidne=y 253 cel CRL-
'??) , or human HeLa cells te.g. , ATCC_':t'CL-'~?)insect cells) .
; or
In a yeast cell exprs:ssion system such as Pichia Pastoris (P.
Pastoris), DNA sequence er_coding polypeptides of the present invention
)S may be c:loved into a ::~u-Ltak>.le ~::xpression vector such as the pPIC9
vector (Invitrogent. Upon introduction of a vector containing the DNA
sequence encoding a:Ll _ar pa.rt of the palypeptides of the present
inversion ~r~to the P. Past_oris host cells, recombination event may
oc=cur ro.r example in the AO:~i locus. Such rec,~ombination event may
?0 placa~ t he, DTQA sequence of po i.ypeptides of the present invention under
the dependency of the AJX1 gene promoter. Succeessful insertion of a
gene ; i ., a . C:)NA sequence) enc<>dir,g polypeptinles of: the present
;.rver_ti.on may result ir; an expression of such polypeptides thal~ is
regu7at ed aind/or inczacec: by rivet:~anol aided in t,hc~ growth media of the
S host. cell tfor reference sae~ Buckhol.z, R.c~. and Gleeson, M.A.G.,
i3iote:cr_ncrlcc~y, v: 06?-1072, 15:~91; Cregg, tr.M. , et al. ,
Blctechnology,
i1:90~-9~u, 1993; Sreekrishna, F;., et~ al.. J.Basic Microhiol., 28:265-
278, 1988; wegner. G_H., FEMS Microbwology Review:, 87:279-28~, 1990).
3~ Ir_ mammalian host cell::, a ;:mmber of viral-based expression systems
may oe ratil.ized. For ex ample, in the event wt:E.re an adenovirus is
used as an expression vect~>r for the p<:>lypept.ides of the prersent
i-r:v~eur~_,or:, nuc.Lei.c: aci~:l sequence rnay by ligated to an adenowirus
t.ranscrll,>t1-oni translation control. complex (e.g. , t=he later promoter
and
i5 triparti re leader sequer:ce) . ~:'h:vs chimeric aerie may be inserted into
the a~aenovirus genome roi:~ example, by in vitro or in viva
recambmzition. Insertior: iato a r_on--essential region of the viral
genorne (c..g. , region El. or E l ) rnay .Yesult in a recombinant virus that
is viable and capable of expressing polypeptides of the present
0 v~nventiori ~n ::-ntected hosts.
3~

CA 02426589 2003-05-O1
Proteins and polypeptides cf the present invention may also be
produced by plant cell. ~xpr-essioru vectors ;such as cauliflower
mosaic m rus and tobacco mos.-:sic ~rirus and plasmid expression vectors
;G.g. , ~"i ~~lasmid'~ rcay he us.~d for the expression of po.Lypeptides in
plant cells. Such cells are available from a wide range of sources
(e.g. , the Ame:ri<:an Type CulturF~ Col.Lect.ion, Rc:rc:kland, Md. ) . The
methods of transformatao:z or vransfec-tion and the choice of expression
vehicle are c°>f course to be c:kuosen accordingly to the host sell
selerted_
1 ()
:~ a~~ ~nsec:~ cei_ expr:,ssao:r system such as A~rtographa calafornica
nuclear pcityhectrosi:a m_~~us t~wNPV), which <:brows in Spodoptera
frugiperda cei.ls, AcNPV may be used as a vector to express foreign
genes . For exatnple~, L~NI~ sequence coding for polypeptides of_ the
(:7 present. invention may toe e~lonec~t into nor:-esserrt.ial regions of the
virus t for example, the polyhe:3rin ger:e) and placed under control of an
AcNPV promoter, (e.g., the pclyhedrin promoter). Successful insertion
of a gene 1 l . a . , DNA se:~uerLC ~ ) e~ncodirZC~ polypepr_ ides of the
present
in~rer:t _ or :rray resin t: n ir:act l vat ion of the polyhedrin gene and
'0 productavn of non-oc~~luc:eck recombinant. vi.rms (i.a., virus lacking the
proteanaceous coat e:zcocied b~ t:ce polyhedrin genes) . These recombinant
viruses may be used t.~o l nfec:t: spc>dopt:el a f rugaperda cells in which
the
inserted gene is expressed.
?J Ir_ add~tior.; a host cell may be chosen for its ability to modulate the
expres~;ion of the irsert:ec: se:xuences, or t o modify or process the gene
produc; rn a specizic, aesiree fashion. Such modifications (e. g.,
cJLyc<~sylat:i on) a.11(~ prOCE.'.SSing ( a . g . , c Leavage ) of protean
products may
be impor~_ant for the functic.n <~1- the pr<.oteirr. Different host cells
3() have characteristics acrd sF.!ecific mechanisms t:or post.translational
processing anti modif:icat:ion c:f proteins arid gene products. Of course,
cell lines or krost systems may be chosen to ensure desired
mothl:lcation and proces::ar:g c:t the foreign protein expressed. To this
end, eukaryotic hosr_ cfriis tha,.°.: possess the cellular machinery
for
35 proper i>roc:essi.nr~ of the primary t,::ranscript, glycosylat.aon, and
prtosphor5~latzon of the xene product may be used. Sack mammalian host
rell:> comprise f:or example, but are not limited to, CHO, VERO, BHK,
HeLa, ~'.'OS, MDC."K, :?93; and 3T3.
0 Alter-natrveiy; polypepti.des ->.f the present: invention may be produced
':>~ a :~tabiy-'~rans ectec: mamnalian ce:il line. A number of vectors

CA 02426589 2003-05-O1
suitable for stable cransfect~on of mammalian cells are availabl<> to
~he ~:ublvc;~ methods for ;~cnstruct~~~ng such cell !i~nes are also publicly
available. In one examp._e, c:3NA encoding the rHuPSP94 protein may be
cloned into art expression vector that wnclude-~s the dihydrofolate
:7 reduct.ase (DHFR) gene. lnt;egrati<a:n of the _plasmici and, therefore, DNA
sequence of polypeptides of the present. invention, into the host cell
chromosome may be seleceed f o:r by inc:iud~ng netY~otrexate in the cell
cultr~re rr;edia. This selectio;t may be accomplished in most cell types.
at.7 SpecWic =mtyar_ion sigaais may also be requirec-3 for the efficient
trans-latior: of DNA sequences i.nsert:ec:i :i.n <a su_itak;le expression
vehicle
as described above. These signals may include the ATG initiation colon
and adjacent ~~equences. 1~or example, i.n the event where gene or cDNA
encoding polypeptides othe prf=sent invention, would not nave their
l5 own _n:itrat:ioru colon and adjacent: sequences, addi.t~ional translational
controa mgnals may be needs-d. ~~or examp:l.e, ex;:><~enous translat.ional
font_ o! r>igna l s, including, ~;erhaps, tine A'PG init:i.ation colon, may be
:.eerie=d. ~,. is known in the art that the initiatron colon must be in
phase with the reading frarru~~ of tr.e poiypeptidc> sequence to ensure
U proper translat.on of n= de~;ir.e~d polypc::ptide. Exogenous
t:ranslational control :~ignavs and irr:it_ation colons may be of a
variE~ty of orig':I1S, i:lclud.ng both nat~.zral wand synthetic. The
efficiency of expression tray be enhanced by the inclusion of
apprc>pr':iatr-~ transcript=ion e,nharrcf~i° elements, transcription
~5 r:erm-natc~rs. 1'he transcripr.~on, translation signals may be
spec_ f ic~~l ~y engineered to p~rov:~.de a desired expression pattern and
l.eve_ ;e.g., signals that may require a specific inducer, signals that
wi.l.l aLl~aw t:exp:rea;.rion in a efi:ned cell type or in a specific time
frame). However, t.hesi> signals may be provided by the expression
..3~ vector, which oi:ten con t:ai.ns a Xmornoter enabling the expression of
the
polypeptide in a desired Y_ost cell.
Polypeptide modifications (mutants, variants, analogues, homologues
$ chimeras and portionslfragments).
As may be appreciated, a numk:~er of modificatic>ns :nay be made to them
polypept~des and tragment~; of the prs~sent. invention without
cielec:er:iou:>ly affect:ing the Y:iological activity of the polypeptide;a or
rragrrrerut:~ . Polypept:ide:.: of t, he present invent ion c°omprises
for
~C~ exarryiE_; ti~ose cor.taimng amino acid sequences modified either by
rrat~.:e-.a_. processes, such as posttranslat:.i.ona:1 processing, or by
36

CA 02426589 2003-05-O1
~'ne:Tr.mv ai nod: f ic;at l on tec;hniqt.es which are known i n the art .
LKOdif icat ions may occur anywhere un a polypept ide i.acludir_g the
po:Lypeptide backbone, th<e ,~mit~.o ac:~id si<.le--chains and the amino or
carboxy--termini. .-t wil. be sAppreciated that the same type of
J modification may be present iu the same or varying degrees at several
sites i.n a given pc:>lypept:i~3e. A15(,, a given polypeptide may contain
many types of modifications. PoLypeptides may be branched as a result
of ubiquitination, and they m.ay ~e cycl..ic, with or without branching.
i~yr? ac. hrancl7ec9 axrd braocrled r_yc:..ic po:Lypeptides may result from
IE) posttranslational. nat.urai pro~;essE=s or cnay be madE- by synthetl.c
methods. Modif:icatic~ns c:ompr:.sP for example , witl~e;ut limitation,
acetylation, acylat:i.on, ~iddit~.on «f a.cetomidomethyl (Acm) group, ADP-
ribosy,.~ation, amiciation, covalent att.actrrnent: to favin, covalent
attachment to a borne moi~:ty, :ovalent attachment c>f a nucleotide or
17 nucleotide derivative, covale:a attachment of a lipid or lipid
deri~at ive, covalent att,ichme;ut of phosphat.idylinosi.tol, c:ross-
~~i;ik~ric~, o.yc~ization, di:3ulfi 3E= toc..snd L:ormat.lon, demethylat:ion,
formation of covalent. crass-l:.nks, formation of c~.~stine, formation of
pyro_clutamate, forrnyl.ation, g<zmma-carboxyLat:ion, ~J.lycosylation, GPI:
~() anchc.r formation, hydroxyl at:i:>n, i.odination, methyl at ion,
rnyristoylation, oxidation, pr:~teolyti.c processing. phosphorylation,
prenylation, racern.i.zatio,z, se l.enoy~lation, sttlfat.i..>n, transfer-RNA
mediated addition of amino ac.ds t:o proteins such as arginylation and
ub.iai:i.t.ir.ati~~r. (for reference sea-', Protein-stxuc:t,~re and molecular
~> p-ropE.:;~.i~~s, ~"j Ed., 'f.E. C.'reightnn, W.li. Freeman and Company, New-
York, 1993),
Other type of polyl>eptide modification may comprises for example,
amino acid i:~rsert:ion (i.e., a.idition), deletion and substitution
t) f.i.e., repl.acemenr_j, eitrrer conservative or non-conservative (e.g., D-
amino acids, desamino acids) Ln r_.he polypeptide sequence where such
c;hamger> clo not suhstzantially ,~ltcm: the overall bi::>:rogical activity of
t:he L~olyf>ept.ide. Polypeptide::> of the present invention comprise for
example, biologically active mutants, variants, fragments, chimeras,
S and analogs; irragments encompass amir~.o acid sequem:es having
t=run~at~ions of on.=_ or more arr ino acids, wherein the truncation may
originate, from the amino terminus (N--terminus), carboxy terminus ((:-
t~ermnusj , or from the interior c:~f tlne prc>teim. P~~iypept:ide analog; of
t:he _nvention invoiva an insertion or a substitution of one or more.
-~(,A ~3m.;_n:: ,~tcvdr~. Variants, mutanr_s, fragments, ctmmer~rs and analogs
may
have she biologi ca 1 property of polypept ldes of tLre present invent:i on .
3'7

CA 02426589 2003-05-O1
It should be further noted thaat: if the polypepcide s are made
synthetically, subst:itut~..ons try amino acids, whicl- are not naturally
encoded by DNA may also he made. For example, alternative residues
:~ include; the omega amino acids c7f the fo.rrnula NH2(CH2)nCUOH wherein n
is 2-6. These are neutral nor~pola;~r amino ac~ids, ~.~s are sarcosine, t-
butyl aianine, t-butyl g~y~:im~, tv--met:ryl iscrleucir~e, and norleucine.
Phenyidiyclne may substi?-:ute : or '1'rp, Tyr or Pne; t~itrulline and
methior:ine sulfoxcie are neut,-al nonpolar, cysteic acid is acidic, and
i~) orwithine is ba:;ic. Pro:.ine may be subst~_tt.ited wir_h hydroxyproline
and retain ttie coniormat..on c~>nferrir,g t>ropfarties.
It is known i.n the' art that mrtant:s or variants may be generated by
subst i tut Tonal mut:agenes is an~3 retain the biological activity of tl-.e
p of yp:eptides of the l.~res~.nt irvent.ion . These var.ants have at least
one r;:~no acrc ier;:dt:~e To. r_he prt~tein molecule removed and a different
residue inserted in :i.ts ;place. F'a~r example, one site of interest for
substitutional mutagenesis ma,. include but are riorrestricted to sites
identi~.ied as the active site;:), or irrununo.Logica. site(s). Other.
2() sites of interest may be thost~, fc_>r example, in w:tich particular
resicues obtained from v.~riou:, species are identi~::al. These positions
may i>e ir;;port:ant f=or bio Logic t.1 activit:.y. Example: of_
substitution:c
deny T ~med as "conservat ive s.lbst itutions" are showm in table 1. If
=uoh substitutions reesul,~, m t criange not desired: then other type of
?~ substivutic>ns, denominated "e:,empi.ary substituti.o!m" ire table T, or as
furtt:er described herein in reference to amine ac_d classes, are
introduced and the pr-oduct:s s~:~reened.
Example of substit:utions may be those, which are conservative (i.e..,
~ wheze:~ir: ~, re.s:tdue is replaced by anot:h<:~r of the same general typef
.s a; .;~nr:erst<tod, not:urally-o:,curring amino acids may be sub-
ciass~tied ds ac:idic, basic, ::eutral and polar, o~ neutral and non--
polar. EirrthE:~rmo-Ae, three ofthe ene-o<9ed amino a~vids are aromatic.
l:t may b~~ c~f use that encoded polypeptides differing from the
35 deter-m:.ned polypepti<9e c:f the presentinventicn contain substituted
codorss fc>r amino acids, which area from the same g~oup as that of the
amino acid be replaced. Thus, in some cases, the basic amino acid:
i~ysi.:ue (T,ysj , Arginine (Arg) and I-Iist:idine (His) :nay be
nt.erc.uangeab! e; the acidic amino ac ids Aspart is re~.id (Asp) and
-() ;~lstam~c acid !,Glw) may be ir;terchangeabie; the neutral polar amino
acids ::~er~irze iSer) , 'PhrE=oninc: ('fhr) , Cysteine (Cysj , G'~utamine
lGln) ,
38

CA 02426589 2003-05-O1
and Asp<~ragine (Asn) may be i:nt.erc:har,geeible; the mon-polar aliphatic
amino acids Glycine (Gly~, Al~rnine (Al.a), Valine ~Val), Isoleucine
(Ile) , and Leuc:ine (Lieu) are ;nterchang<~able but because of size Gly
and Ala are more closely rela::ed and Val, Ire and Leu are more closely
S relat.ec:i to each other, a;rd th~~ at°omatic amino acids
Phenylalanine
tPhe) , Tryptophan Trp) and 'I'Jrosine ('fyr) may be interchangeable.
'T'able y. Pre?=erred amino aci.ci su'rastitur_ion
jOriginal residue f p ary s,ibstitur_ion Conserv<:~tive
i
substit~~k.ion
!Ala (A) Val, Leu, Iie Jal
_.-. ~-_- -_ -- ____ _..T _
iP,rg !R) Lys, (:lra, Psn Lys
~Asn !N) Gln, His, I_ys, Arg Gln
I _ _
-.-___-__._ _ -_~_ ._-._.._-_
j Asp -! D i ~ Gl a
G 1u
a __
Cys r C ' ~ Se.r j Ser
---_-__.-~ _- _ _-~ __.____._.~~-L.----_
~,in ( Qi Asn 4 Asn
Glu !E) Asp !, Asp
G1y !<,j~---'_-_ Prn _._.~ ._-___.~.-Pro --.-
His iH) ~~ Asn, Gln, Lys, Arg Arg
j Lle ~~ j ~-. -.-- ~eu, Val / ._ Met , AlyLeu . __.
i
Phe, rorleucine
L,eu ~L1~' ~~~lVo:rlei.c:ine, vll.e Va.L,tIie
i
! Met, P. la, I~he
_ _ __ _ i __
-j_~ _. _
TJys I K'--__-_ . ,z~rg, C'.lrr, F:sn -.__~__. Arg
Me t E. M ; .~---!. Leu , F he , l l e ----.. L~u
Phe F) LE:u, Val, i 1e, Ala Leu
Pro ! p ~ -.-__ G .y --. ._~_._-~...,_.. G.iY .r_ __._
Ser .S) '.-- 'Thr -p a Thr _
'1 h r ! T j -_-.__.- _' g ea r . _~__- ._-___-.- S a r --. __._~
rp Iw ~ - _ ,
ny _. _.-..._._v-_ _;. ~~_~; I~hE--ylr,,__ Ser--___~~Fno --_
Val ;V) Ii.e, L~~au, ME~t, PHe, L~~u
Ala, r,orleu.cir:c-.'~
~n some <:ases it may be of irterest to modify the biological activity
c~a p;>iypc~pt~de ay amino aci3 substitution, inserr:ion, or deletion.
For e.xampie; modiW ration of a polypept.ide may result rn an increa;~e
wr: tlne polypepti.de's bic;-Logical activity, rnay mod~.zl.ate its toxicity,
(5 may e;~ult in changes in bioavailability or in stability, or may

CA 02426589 2003-05-O1
rnodui.at.e its imrnunologic<al activity or .i.rnmunological identity.
Substantial modifications in unction or- irru:runolocical identity are
accornpl fished by sel.ectin;J sub.,t:it:utions th<~t. diffE~r significantly
in
their effect on ma intain ing (,~) t:he structure ~:~f t rre polypeptide
backbone in the area of ~:ha s.~bstitution, for exarr~ple, as a sheet cr
~e'_ical. conformation. (b the charge or hydrophobicity of the molecule
ar tyke target: site, or (~~) th~-' bu:l.k of the : fide ct-:ain. Naturally
occurring residues are d~vide<1 int:o groups l:>ased cm common side chain
properties:
(1) hydrophobic: r_orleuoin~~, m<>thionl.ne (Met) , Alanine (Ala) ,
Vali.ne (Val.), Leu~-ine ~:Leu), Lso:Leucine (IW:)
vi) neutral hydrophii~c: C:lste.ine (Cys), Serine (Ser), Threonine
(Thr)
:> (3) acidic: Aspart.ic acid ;Asp), Glutamic acid (Glui
(~)) basi.c: Asparagine (Asrm , u,:'l.utamine ((31n) , Histidine (His) ,
Lysine (Ly_>?, Arginine (Arg)
(".) re~si.dues that inf LuencEe chain orientation: Gl.ycine (Gly) ,
Proline (Pro) ; an~z
?() ( 6 ) aroma t: i c : ''.'ryptop =an ( i':rp? , Tyrosine ( Tyr) ,
Phenylalanine ( Phe )
Non-corise~rvacYive :;ub~stitltiona will entail exchanc)ing a member of one
of these classes for another.
~> Mutar~.t polypept:.ides wil l po ;se;s one or more mutations, which are
deletions (e.g. , t:runoatior:s) , insertions (e.g. , additions) , or
~;ubstiturions of amino acid residues. Mutants cart be either naturally
occurrincr ;that i.= to say, ptrified or isolated from a natura~i. source)
r_~r synr:he-et:L~; ;for e.~campe, b;~ performing site--directed mutagenesis
on
30 the encoding DNA or made by other synthet is methods such as cherrmcal
syntrresi=;) . Lt is; t':ms pparent: t:hat the polypept:ides of the
i.nventi.on can be either naturally occurring or recombinant (that is to
say i>reparc~d from the recombinant DNA technidu.es).
3S A protein at least 5c)~ .L;ie~nt:i.~::al, as determined by methods known to
~_~':~see skwlied in she art: lfox example, the methods described by Smith,
:..~ cud 'wate_rrtuan M.:'3. 11981) Ad. Appl.Math., 2:43<'-489, or Needleman,
s.B. and Wunsch, u.lG. (1.9'i0) .J.Mol.B:ioi . , 48: 443-453) , to those
pclyF>e):~t~~.des of the present invention are include:a in the invention,
40 as are pi:~oteins at least i0~ or 80~ and more preferabli.~ at least 90~
~dent:ical. t:o t:he protein: of t: he present: ir:vent.ion. Thi s will
41)

CA 02426589 2003-05-O1
generally be over a region of at least 5, preferably at least 20,
contiguous amino acids.
Amino acid sequence vari;~nts :-tay be prepared by introducing
appropriate nuc:Leoticle c:lange:; ir~t:o DNA, or by in vitro synthesis of
'she ~:es,~rec'. polypeptlde. Such variant: include, f~.>r example,
deletions, insertions, or sub.atit~utic>ns of :nesiduaa within the aml.no
acid sequence. A ~ombin,~tion of cielet:i.on, msert:.on and substitution
can be made to arrive at the f=inal construct, provided that the final
!0 protein product possesses the desired characteristics. The amino acid
chancres also may alter p::~stt.r;rns.i.atic>nal processes such as changinct
the ru:r!ber or position of the glycosylation sitesaltering the
inemb.ar~e anchoring characteri:;tic:a, alterin,l the :ntra-cellular
iocar ion by insert inch, d.~alet.i.,ng ;!r~ ot:herwise affe<vt ing the
1S transmemt~rane sequence of the native protein, or :modifying its
suscc:pt.ibility to proteol.ytic cleavacte,
Protein purification
?f) Some aspects of the present .invention concern the purification, anc~ in
part~~~~.!lar errir.odiments, the s.~bsr_antial purification, ef a
i>ciyg!eNtide. ~:'tie tern "purifi::ed polypeptide" as u:7ed herein, is
intended to refer to a composition, isolatable from other components,
wherei:! the: polypeptide is pu:rifie:d t:o any degree relative to its
?5 natur-ally-obr_ainable state, ii.e., in this case, relative to its
purity within a prostate, cell extract). A purif!ed polypeptide
therefore also refer:; to a po!ypeptide, free from the environment =~n
which t ma.y raarur al _! y occur.
3() Gene!-ally; '~pi!rified" will re:ter t-_o a polypeptide ~,omposition,
which
has been subjected to frantic>nati.on to remove various other
components, and which composition substantially regains its expres:;ed
bio.og:ical activity. Where tl-ne team "sabstantiall~ purified" .is used,
this wil:refer to a con-posit ion In which the pol-~rpeptide forms thc~
~5 major <vomponent of the compos:Ltion, :such as constituting about 50~ or
rac..r~ ,~;. e:hc:a polypept:rdes in the ~.-omposltic3n.
Various techm goes suitable for use in polypeptide purification wi:Ll
be weep known to those <;f skill in the art. These include, for
)0 example, precipitation with ammonium sulfate, PEG, antibodies and she
like or by heat denaturation, followed by cent.r:ifsgation;
41

CA 02426589 2003-05-O1
chromatography steps such as :on exchange, gel filtration (i.e., size
exclusion chromatouraphy , re~~ersephase, hydroxylapatite and affinity
chromatography; nsoelect;vi~~ fcucusi.ng; gel electrophoresis; and
combiratior~s of such and other techniques. These techniques may be
'~ used e~ttaer: aiotie ~:~r in c:ombiriatc,m. As i.s generally known in the
art, it is believed that the acrder of conducting the various
purification steps may bEe sharic~ed, or that c:ertair, steps may be
omitted, and still resulr: in .-c suitable method for the preparation of
a substar3tially purified polyy>ept-ide.
The ability of purifying a pr~~teir: by ammonium sul fate precipitation
is based or: ~:r~e fact thaw. a p-ot a rn's: solubility :; _, lowered at high
sal t c<~ncentrat.ion. However, :he solubi l ity of proteins is affected in
a different manner depen~xing in r.heir pr-ope.r.tie;>.
I
Size exclusion chromatography or gel filtration separates molecule;
basec: on their sia:v. The gel ( l . c . , matrix, resin'. media may consi;rt
of beads containing pores of _i specific: distribution. Separation may
~:cvur s whey: rnol~ecule~> of diff~:~rent: sire are included or excluded from
2(~ the pore's: wi.>.hin t:he matrix. Smai.l molecules may diffuse into the
pores and their f-ow through ,-he columrn is retardt.ci, while large
nuolerules rlo not enter the po!::es ~xnd are elated irr the column's void
volume. Consequently, molecui.es separate based on their size as they
x>ass tl:rc~ugh the <~<:~lumn .end a,:.-e a l.ute~d in order adecreasing
'?S molecular weight.
ProtF~~ir_s can be separated on ~~he basis of their net charge by ion--
exchange chromatography. For example, if a protein has a net pos:it:ive
charge at Ioi ~;, it w:.ll usuall.y b:nd (adsorb) to oeads ~;i.e., matr:.x)
in contaair:ing a negatively charged group. For example, a positively
char<led protein can be separated on a .negatively <:vharged
c;art>c~xymEethyl--cellulose or carboxymet.hyl-agarose .matrix. Following
elution, pxoteir~s that have a lo~.a density of net positive charge will
t:en<i t;.a emE:~rge first from tlie: column followed by c~tzose having a
higher
char~ye density. .negatively charged proteins can ae separated by
c~,r.r~ar~mr.our'~~F>-by on positlveLy :vharged dlethylaminoorhyl-cellulose
;I,sEA!:-ce_lulose) or DEAF-agarose matrix. A charged protein bound ~:o
an ion-exchange matrix may be el-uted (released, detached) by
ir.crea:~ing the: corncentration of sodium chloride oc anot=her salt
40 solution as an eluting buffer. Ions will compete with the charged
groups on t::he protein fc;r bir;ding t:o the matrix.
4'?

CA 02426589 2003-05-O1
5a~t sciutions may be adcie,~ tc> the matr~.x in a sectuential manner
si.~:., by adding a sclut:.o_-r o: a specific molari.ty (e.g., 200 mM
sodmm crilor?de;t folioweci by ~_.He addition of one or more solutions of
'.) different rr;olarity (e.g. , 200 rnM, followed J:>y :~ s<~lution of, 300
mM,
followed by a solution o,~ 400 mM, followed by a solution of 500 mM,
followed by a sol.ut,ion off: 100tU mM) ) until tJue specific polypeptide of
the invention (i.e., PSP'34-bi:id:ind protein (SEQ ITS N0.:2, SEQ ID
N0.:3, SEQ ID N0.:7, SEQ ID N~).:~, SE;Q ID N0.:9) ... eluted. In
I() addit.ic>n, sa:i_ts scriution may ~e added as a continuous gradient. For
example, a salt so~utior. of high molarity (e.g., 1000 mM) may be
graaLd ~ iy added to a sec~.>nd s:>lut. ion of lowc;.r molar i.ty (e.g. , 7 00
mM)
before entering the ion-~~xchamge chromatography c<>iumn. The salt
solution entering the column ~ai?1 have a moiarity slowly increasinct
1.5 from 1.00 miM t=o up to 100.) mM.
Affinity chromatography 'nay bc: a>~>d when thc~ spec:~.ticity (affinity) of
a po:cypeptide for a ~_ompound s :chown car suspected. For example, as a
t rsr r~r_F p s~acYi compound ( a . r~ . . s~ SP94i ~ is covalen: l y at
tacked to a
'?() column (F~.g. " a cyanogen bromide ,~3ctivated sephar«se matrix) and a
mixture Isolation; containing a desired polypepti<le (e.g., a PSP94-
binding protein) may be added to t:he matrix. After washing the
matrix, to remove unbound proteins, the desired polypeptide may be
elutaed fxom, the matrix by adding t~ high conc:entra!;ion of the compound
(e.g., PSP941 i.n a soluble fo~.-m. Antibodies are ~~u example of a
compound; which i.. often used r-c par-fy proteins !_o which it binds.
Tt is known .in the art, that equilibration and substantial washing of
c;hrorvatoc~raphy matrix (i..a., resin) (e.g., ion-exchange matrix, s.i::e-
0 exclusion matrix, affinity matrix) is preferred in order to minimise
bind_,.n_l of unwantt~d (i.es., unspecifi<vl proteins (:rc7n-specific
bindinct)
~S Antibodies sad Xybridome
Other aspects o2 cne present Invention relaters to antibodies and
hybr:.doma c:ell.. lines. 'They preparation and characterization of
antibodies are well Jcnown in the art (See, e.g., ,antibodies: A
LabO: at:ory Marmal. , Col~9 ~~pr:ing Elarbcnr Laboratory, 1988; incorporated
40 herein by reference) ants has been discussed in United States Patenv
Nc:. 5 ? '~6, 51'x, the entire cc:.tztent of which l:; incorporated herein by
43

CA 02426589 2003-05-O1
reference.
ror example, a polyclona_ ant:-body preparation may be obtained by
imrnunl.zmg an anl.mai with an mmuroogeni~~ ( inununizing) composition and
collecting antisera from that immunized animal. A wide range of animal
species may be used for r_ha pvodu<°.ticrr c>f antisera. Typically the
animal used for producti~>n of anti-antisera is a rabbit, a mouse, a
rat, a hamster, a guinea pig ..r ~z goat.
)t) It ~s often necessary to boos : the host. immune sy_>tem by coupling, for
example, ar: ~mmunc>ger_ to a ca vr.iet ( a . g . , keyhole 1 impet
hemocyanir.
yh,H) and bovins~ sF.r~..m a~bumi . (ii;;A) ) or by i.ncorx>orating an
adjuvs.nt
to the immunizing c-_omposition. as described herein.
F> The productiors of antibodies nay be monitored by sampling blood of the
immunized anv~ma.L at ~~~ari~~us t_me Looints fol-~owing immunization.
Sometimes, additional bo::~sts nay be required to pr-ovide a sufficient
~~:er c:f tkue ant.ibody(ie:~) .
?~ ~fho ci,.e~;ired antibody may be pa:rifvi.ed by known mettic~ds, such as
affir~i~y chromatography asirzg. f<or example, another antibody or a
peptide hound to a solid matt :x.
Monoclonal antibodie;> (mAbs) nay k7e readily prepared through use of:
?S known techniques, such as those exemplified in U.:3. Pat. No.
~, 196,%5~~, the ent:ire content of whi<-h is incorporated herein by
refe~wer~c~. Mice ~~.g., BALB/_: mouse) and rats ar~~ the animals that:
are usual 1y used fc3r the immuraizat:ior:. Pol Lowing immunization, B
iymptGo~~ytes (E3 ce:lLs) , are select:ed fore use in the-a mAb generating
0 pro t.occ,l. Often, a panel cf animals will have to oe immunized and t=he
animal having the ~iqhest antibody tier will be Wosen. The
antibody-producing B lymphocy.es from t:he immunized animal are then
::~sec;l ~o.g. , usine~ polyetl:y.le m~ dlycc~l) with cell; of an ,immortal
myeloma ce.l. Any one of a n.miber of myeloma cells may be used, as
~.'t are known ro t.hose of skial. i_r trze art (coding, p1>. 65--66, 1986;
~ampbell, pp. 75-33, 1984). For example, where the immunized animal is
a mo~zse, ocno may use P3-X63/Ag8, X63--Ag8.653, NSl%;l..Ag 4 1, Sp210-
Agl4: FO, NSO/JU, MPC-11, MPC11-X45-GTG 1.7 and S194/5XX0 Bul; for
:-ats, <>ne may use R210.hC~3, '~'3-Ag 1.2.:3, T_R983F and 4B210; and U-:?66,
0 GM1500--GRG2, LICR-LON-HMy2 an~:3 UC729-6 are all useful in connection
v;7r_h n~zman c~eil f,xsions.
4~~

CA 02426589 2003-05-O1
Fuses hybrids are grown _n a :,elective medium that enables the
d~Lferent:ia~-,on between Bused cel_'s and t:he parental cells (i.e.,
myeloma and B cells). Th~~ selEective medium usually contains an agent
:1 te.g., aminopterir, methc>trexa:t=e, azase.r.ine) that blocks the de nowo
synthesis of nu<:leotides_ Wh<:n aminopterin or methotrexate is used,
the n.eciia is supplemented with LuyE>oxanthine and tf;ymidine as a source
of nucleotides (HA'r' rcied.ium) . t~Jherce azas~_r.ine .i.s u~:ed, the media
is
supplemented with :~ypoxanthin~e. Only cells capabe of operating
r l) nucleoc ide salvage pa thw<~ys a a able t.o sur~.~ive lc: HAT medium. The
myeloma cells are defective lm key enzy~,nes of cne salvage pathway,
e.g. , hypoxanth:Lne~ p:~.osptiorib~ay7. transfe:ra:~e (HP1-;'I') , and they
cannot
survive. The B cells may opermte this pathway, but they have a limited
life span in culture and gene.-ally die within abotu two weeks.
i> Therefore, the on7.y ~_e11:, thaw. caci surv:i.ve in the selective media
a_re
those: hybrids formed from mye'_oma and B cel."~s.
~clect~orv of hybrciomas is pe:for~trted by culturing r_.he cells by sincrle-
clone dilution in microtiter plat.e.s, fo:l:Iowed by testing the
?0 indiwi<lual c~onal ~>upern.~t.ant:~ tox the desired re<~ctiW ty. The
selec-ted hybridomas may when .~e :serially diluted and cloned into
indiv~iclual antibody-~>rod~cing cell. lutes, which cones may then be
propagatEd indefir~i.teely '..o pr.>vide~ mF~b~~.
E'ragments of monoci_onai :~ntib,pdy(ies) are encompa:>:~ed by the present
invertior~. 'these may be obta:med by methods, whi<at include digestion
with enzymes such as pepsin o. papain and/or cleavage of disulfide
bonds by chemical .reduction. :alternatively, monoclonal antibody
fragment's encompassed by the yresent znrrention mayue be synthesized
30 using an automated peptide synthesizer or may be produced from cloned
gene segments enginee:.red to produce such fragment (e.g. , single-chain
antibody) in a suitable cell (celY li.nej.
Actibody con,mgatc~s are also encompassed by the present invention
~S Thess.. naf~ be crenerate:d by cou;:~ling tl:e antibody wLrh a fluorophore,
a
chroraophore or dy<~ ie.g., rhodamine, fi.uoroscein, and green
fluor-e~~ce:nt protean) or ar_y other agent. or label ~_hat gives rise to a
dete~~tab:Le signal, either by acting alone or following a biochemical
react=ion (e. g., enzymes such as horseradish peroxidase, alkaline
~) phosphatase and boca~-galactosi.dase). A molecule such as
d.retvi~~~_enerriaminepentaacetic acid (DTPA) may also be linked to the

CA 02426589 2003-05-O1
an'=lbody . i~'I'FA lTld!.~ ~Ct W S a i'hf'! L3tlng agent. t._''lat 1.5 dble
t0 bind t0
heavy metal ions ~nc.rudirrg racmomotopes ! e_ g. Iscitope 111 of Indium
cm
In) ) . 't''hese cor=jugatees mad: be used <zs detectic;n tools in
immunoassays or in imaging. Aternatively, conjugates having a
t. herapeutic: agent such a:~ ~ ta,xir; may bE~ prepared from the monoclonal
antibodies o: the present: invention, theae may be used to target
cancer cells an<i t.c> prom«tn t:aeir destru.ict_ion.
It "i'_' be .appreciated bbl tho:~e c,i skill in the ar:t: that monoclonal or
~() polyclonal antibodies sp~~cifi~v for- proteins that are linked to
prost.at:e cancer wi ~ l hav;: uti 'a. it l es in :>ever-al. ty~;>e~s of
applicatior:.s .
These may include ,~.he product on c>f diagnost:ic kits for use in
detecting, d:i.agnossing or eval.at:i.ng the prognosis of individual with
prostate cancer.
17
Aatig'en detection
In terms of tlnt.ige:n dete~~tion, tile biological sam~oie analyzed may be
any sample that i:a suspe::ted ~f c:ontaining <~n antigen of interest,.
~() eithc-r a tis;vue, cell. lyaat=e, uri.iue, blood, seri:m, plasma, etc.
Cont~;ct ing the bio:logica 1 sample with the antigen detection
(detecting) reagent. (protein, peptide or antibody" is generally a
matt°of simply adding she c,>rnp~,>:>ition to the sar~.y>ie anal
incubating
the mixture for a period of time long enough for pile antibodies to
form immune c_omple;xe~> wi th th~ ~ art t: i.gen . Washing o l. the sample (
l . a . ,
tissue section, ELISA plate, ;lot blot or Western blot) is generally
requ~rerd to remove any non-sp~7cio:ica~_ly bound arlti.body species. The'
antic~erl-antibody complex (inun;inocump~ex) is then cie.tected using
.30 spec 1 f l c reagents .
Where, Ior example, the antigen detect iz2g reagent i:a an antibody (a
spec~_flc aT:~~ibady::, this antibody may be (directly) Labeled with a
marker (i:luorophore, chromophore, dye, enzyme, radioisotope, etc.) for
S enab:.ing the detection of the complex. In otk:er instances, it may be
advantageous t:o use <l sesc:cmdary binding li.gand su~:in as a secondary
antibody or a biotin/avidin (streptavidin) (binding/ligand complexi
ac rarige~ment:, as i;s knowr: l n t he art . Again, secondary antibodies rnay
~e -laberled with a marker as cLscrlbed above ox wic'rl an arrangement of
-3~(~ blot m:; a~s~i: in ( .e. avicir: pe: rax_idasc>y , which all..~w the
detection of
tile ~rnrnunocomplex. Unified States Patents concerning the use of such
4C

CA 02426589 2003-05-O1
labels v.~cl.id~;,817,837: 3,8'_,0,'?52; 3,~a39,350; 3,996,345; 4,277,437;
4, a?7 , 1.49 anti 4, 36e;, ~'41, each incorporat=ed luerein t_sy reference.
Usually, the secondary amtiborfy will be~ <~n <antibociy directed to the
specific antibody tprimary an;:ibody) of a defined isotype and species
S such as, for exam~rle, an anti-mouse IgG.
On tre other hand, the antige~: detecting reagent may also be a
poiypeptrde iuavmct affinity f :~r am antibody or ant>r_her polypeptide,
why ~rv ~ orms a compie:x ( i . a . , ;~olypept i.cle-poiypept : de complex or
I() antibody-polypeptide complex) in that case, the polypeptide itself
may be labeled using the mark=~.rs described above, allowing direct
detection. Again, the c>mplec may~ be detected indirectly by adding a
secor:dary (labeled> antibody >r pcylypept=ide.
L'~ Immunodetection methods, such as enzyme--linked immunosorbent assay..
.~~i;A; , Western plots, ~Jt.c. nave ut.lrty 1:n the magnosls oz
cond~~tions s~,ach a;; prost-~te c-arlc<:>.-. Etowever, thesE, methods also
ha~~e
appl ~ cat : ons t o non:-cl in ical ,>amp ies , such as in ! he ti tering of
antigen or antibody samples, .:a ttie selection of hybridomas, and the
'?~ like.
ELISA
as r<_ar~d, ~t ~s contemplated e:hat the encoded polypeptides (SEQ ID
~S NC. :~., SEQ ~.7 Ne. :_ , SEQ ID N7. :-?, SEQ ID NO. :8, SEQ ID NO. :9i of
the
present invention wi7_1 find u~;ility in immunohistochemistry and in
F;LISA assays Y~ut also as immunogen (:..e., antigen; in connection w:_th
vaccjne devel<apment. One ev.id=-ant utility of the encoded polypeptide
and <-orresponding antibodies Ls lei immunoassays for the
diagno;si~>%proc)nos i=~ of px~osta';:e canccer.
3.rr:rnunoassays that .nay be perf.>rmed using reagents :.the polypeptide
defi:ied ~n SEQ ID NO.: a, m ~EQ ID 2Q0.: 3, i.n SE,~ ID NO.:7, in SEQ ID
NO.:f3 car in SEQ :CD NO.:9 and antibodies) of tt.e present, invention
;S i.nc:iudes, or example, Enzyme linked immunosorbent assays (ELISAs) and
radioimmunoassays(RIA), which are known in the art.
wrrunumohistochemical detect ion using 1: issue sections is also
purt::_c~Alcir':y useful . However, it wil:L i>e readi 1y appreciated that
dete<:r~~_or= ~s not ' im:Lteci to :_ucY: teclmaques, an<i western blotting,
dot
~'~) x ot°:ing, =WT"O analyses, and r_he .Like also may be ~zsed_
4'7

CA 02426589 2003-05-O1
Examples of ELISA assays incltcde tape following; antibodies binding to
a polypeptide (e.g. , ant._bodit: s to PSP94 or antibc:~ciies to PSP94-
binding protein (SF~Q ID NQ.:2 SEQ ID N~.: 3, etc.)) are immobilized
onta a selected surface (i.e. s~.a.itable sub:~tratei exhibiting prote n
affinity, such as a well in a polystyrene microtiter plate (ELISA
pl~t::~;; . ~rher.; a sample s'.:spec :end <:~f cont.aiuing t.he~ palypeptide
is
adder: °~:o the we.ils of th~-. pea :e. After k~lrrding and washing to
remove
non-~spesc ~ f 1 cal ly k~out~;d i;cununo~ ~omlo.l exe;~ , the bound ant igen
may be
detected. De~~ectior: rnay -~e achieved r>y the addition of a second
I$) antibody specific for th~-= tar;et );-olypeptidc:, which is linked to a
detectable label. :'his type oEL1SA is a simple "sandwich ELISA."
Detection al.sa male be ac:nieve~i by the a<iditAon of a second antibody,
followed by the addition of a thi.e~d antibody that has binding affinity
for t.tie~_ ~ec;orid ant: ibc~dy, with ~hF~ thi rd ant ibody i:>eing linked to
a
detectable label cnarkeri.
Anott:er example o1E1.ISA assa.r is tire follow rig; i~he samples suspected
of containing the po7_ypeptide of interest are immcabilized onto the
surface of a suitable suostra:~e and there contacte:3 with the antibodies
~0 of tt~e invc:n~=ion. ~ft:er oindi.ig and washing to remove non--
specifically
bound immunocomplexe;;, t;re bo:rnd antigen is detected. 'The
i.rrunurGoc:ompi.e:~es may be detected <li.rect=ly or indir~~c°tly as
described
herein.
S Am additional example of an ELISA assay is the following; again,
paly~>eptides are immobilized :.o a subs t. rate, howewe:r, i.n r-hat case the
assay involves a competition ~~tep. In this ELISA, a known amount of
the tooly~>epti<Le ointerast-_ i::> adsorbed to the pls~t:e. The amount oi=
polypeptide~ irr an unknown sample ~s then determin=~d by mixing the
U samp::e w~.t"t~: a sperLf:~c antiba,ay be:fowe or during incubation w.i.th
wE;lls
containing tore imrnobilized pa-aypopti<1e. A detection reagent is added
y a . c; , , antibody) ''..o quanta fy the antibody that. l s able to bind to
t:he
immobilia°_e<l polypeptide. The presen<°e of the polypeptide in
the
sample acts to reduce the amount of <~ntibady available for binding to
35 the poiypeptide contained in the well (i.mmobilized polypeptide) and
!::~:us ..~eed~.rce::s t he s ~gnal .
t>r~xE~r t.a:~ ~~Eet a <.orreiat for between the signal and the amount
;c-crr:aer_tr:at~on) of polypeptiue m an unknown sample, a control sample
0 may L.~e inc:iudE:d daring t: he assay. Fear example:, k,rown quantities of
a
polypeptidEa (usually in a suY~staritially pure Form) may be measured
4~

CA 02426589 2003-05-O1
(detected] at. the same t:.me a:~ the unknown ~;ampl.e. The signal
obtained for the unknown same : a ~.:> then; comx>ared wi th the signal
obtained for the control. Tha: intensity (level) of the signal is
usually proportional to 'he amounts of p<7lypeptide (anti.body bound to
'~ the poi.ypeptide; lm a sample. However, the amount of control
poiypex;trde and an t:ibodi">s re~yuT'E-d to generate a quantitative assay
;reeds to be evaluated fi-st.
Tn ccatlng a plate with ~~ithe:- ax; antigen (polypeptide) or antibody,
1!) one will generally incubate t.e wells o: tae plate with a solution of
the antiger_ or antibody, eith.~r c:wernight or for m specified period of
hours. The wE>lls of the ;late will then. be washed to remove
i.nconvpletely adsorbecl maYeria.. Array remaining ava...lable surfaces of
the ~:eals are then. "c:oat~::d"' w_ti a nonspecific prt>tein that is
~> antiyenically neutral wish re and to the te:~t ant:sera. These include
bovine strum albums.n (BS.3) , c,a.se.iru and solutions of milk powder. The
coating allows for blocking o- nonspecific adsorption sites on the
immok~i:l.izing surface and thus :reduces the background caused by
nonspecific binding of a-rtise:~a onto the surface.
?0
Conditions that may allo,a imm:rnoc:omplex (antigen/rlntibodyj formation
mciude: diiuti.ng t=he antigens an<9. anrzbodie:~ with solutions such as
BSA, bov.me ~~amrna globulin (B G) rind phosphate buetered saline
(PBS)'I'ween. 'these added agen;~s also tend to assist in the reduction
S of nonspecific ba<~kgnouna.
Suitable conditions i.nvol_ves shat: the incubation l.:; at a r_emperatune
and fox a period of time sufficieent t=o allow effective binding.
T:ncubat.icsn steps <~re typicail;r from about i_ to ~. vo 4 h, at
30 temperatures f:>refera'bly on the order of '2~ "C to a7''C, or may be
overnight at about. 4'"C o- so.
C>ften, the detection of the imcnun ocomplex is performed with a reagcsnt
that is l_iruked to an enzyme. Detections then req,iires t:he addition of
ZS the emyme substrate. Fnz.ymes such as, for example, alkaline
I>hosnnr~tase ~:~r lae:roxldase, wl~~n given: an appropri-:rte substrate will
g~nF~~:at_e a reaction that may be cluanriiled by measuring the intensity
,,deg.:-eN) of color produced. ~he reaction is usuali.y 1?near over a
wide range of cc:~n~~entrations and may be quantifi.e:3 using a visible
40 spectra spectrophotometer.
49

CA 02426589 2003-05-O1
KitB
The present invention al:~o rebates tc immunodetecti.on kits and
reagents for use w.th. th~~ imm:mo<leetecti.on me:ethods described above. As
the polvpeptide of tile p~esen:: invention may be employed to detect
''~ anr~irJOdie~s and true: corre:~pond:ng a~ntibo<iies may bE, employed to
detect
t-rze co=_vpe~3t-ae. Fr~tC2er ~>r borh ~>t such components may be provided in
the k i t: . 'The imrnunode.tec:: ion :i t:~ may thus compri: c1, in suitable
container means, a polyp~:ptid~~ (PSP94, cor PSP9~-binding protein), or a
first antibody that:: binds> to .~ po:i.ypept:ide ~rnd/or an immunodetection
)() reagert:. The kit may comprise <also a su:itabie matrix tc> which the
antibody or polypeptide _>f choico may a:Lready be bound. Suitable
matrix include. an t.LISA elate TIuEe plate prc:>vi.ded with the kit may
unready be coated c,;ith t-ze an~..ibody or polypeptide of choice. The
coated Ei.,ISA plate may a Lso have L:>een b:Locked usirug reagents described
15 herein tc~ prevent unspecific .~.inding. Detection reagents may also be
provided and may i.ncl.ude, for example, <~ secondar;,~ antibody or a
ligar_d, which may carry the libel or marker and/or an enzyme
substrate. Kits may further vomto:rise an antibody or polypeptide
(usually of known titer or co;zcentration) that ma-~ be used for
~'~) contz o i . ke-~gent:~ may b,= pro ,~ideec:a, f o~ examp:i.e, yophilized
or in
llau:d fc:yrrr: tof a de fined con:~enr:z-ation) anti are prwovided in
suitable
ccntcair:ezs iensur=.rig sta;~ilit: Y~ oi: reagents, safety,~ etc. ) .
It :s to b<> understood rerein, that if a "range", "group of
?5 substancErs" UI:' particulai charact.eri.stic (e.g. , temperature,
concenr_ration, time and t)ze ike) is mentioned, the present invention
relates t:o and expli.c.it-y in.~vorpcarates herein eawLn and every specific
member and combination ef suY~-ranges or sub-groups therein whatsoever.
r'hus, ;pry spe<~iried rance or gr:~up i.s t:o be understood as a shorthand
3n way o. referring to each and every member of a range or croup
indi«iclually a..<s well_ a:; eac:u and every possible sub-ranges or sub-
groups encompassed therein; and similarly with respect to any sub-
range~s of ;sub- groyps therein. Thus, fc;r example,
with respect to reaction tune, a time of ~ minute or more is
to c~~- ~sn~~eratood as spec,v:i.fic-ally incorporating herein each
arr ~~,Iery indiv~nual time, as well as sua-range, above 1
miruute, suciz as for uxam,ple 1 mirnzte, 3 ~u 15 m:.nutes, 1
minute to 20 hours, . to 3 hours, 16 hours. 3 hours to 20
hc7urs et~~ . ,
5()

CA 02426589 2003-05-O1
- arid similarly mth r~espeot to othex.- parameters such as
concenr_rat ions, temp~erat_ure, et.c. . .
._ i~ also to be umderst~~od h~~rei.rthat non--PSP94 -binding protein (or
i LNi~ encoamg such poa.ype:>t i.de aro-~ exc:l tided of thae polypeptide or
polynucleoti.de of the present :inventi-on.
Table' 2. "~,abl.e of ar~brc=_~riatior:.
Abbreviation ~ Signification
M ___--_---_ -_~ Mo 1 a r -_-.___ -_ _~. _..- .
_
nlM ~ m.i. l l _ Mo l a r
__~- ~- _ -
~. ___--
~gram
-_~_-_~___-_~_--___.
_--_--_-_ ~ m:il1 dram
_---_- -._ ._T__~,--
~ micrc;ctr-an1 -
i
__ _
n~ _--.--__-__-_~-nanoc,r-aIn-._~.__-_..--_
j
-__ ~~.._ -- _
-C. or -C -_
u~..-_~ _ ~DegrE=a Celcius
- _-__'____~.~.._.-.- ____
percent
___--.---____-.1___-_ _-___~.._-__-._.---
~~;n , cc::nt metEer
___ i _ ____
cpm (CPM) -_ ~ Count s per minute '-- -._-
~_-_ i
_ ___ _ _
i pgS _ __ ___ _
'-_ ', Pho~t~ha a buffe~recji saLine-
~
I NaCl ' Sodi,:m aIlor idt.
'MES' J ~~~2-(N Morpholin<>)ethanesulfonic
acid
(MOPS ~ ~ 1',3-(N Morf>holino?propanesulfonic
acid
,, _. ~ _ ~-. _-.~ _
t1~ ---~ -_ ult
z -<,vio7at
j'r~a -._ '..lddl tcnT1 -_-._-._~_._.~ '
-.__.-_ -_ ' kilo~ialr:on -___-__~ __
Kd ~~ Dissuciat:ion constant
~_-._.-~ _ ,
iim -_--_-_- -_ _nanorleter
r_.T
_._.~_ - Q'~ti~~a1 c_iensity -
!! CAPS ~ .~3-- (C,.clohexylamino) -1-propanesulfonic
a4id
H1~ ~ High molecular weicJht
MW ' Low r~.volecula.r weic~llt
- -
~~ Foll icla: stimulating hormone
~'SH
~SP94 'Pros:ate Secretory Pr otel r: of 94
anrlln~> acids
SD,~_---~_ _.--,,-~odi .m dodecyl_.sulfate
_ _ _ ,
--- _ -_
PAGE Poly.ICry.lamide gel electrophoresis
__._.-- _._-____..-_ ~_ .._. _-__-.' _.~--. __-
DMSO iDime lzylsulfoxide
PVDF ' ~ Poly r:i.nyl iden<~ di f luoride
51

CA 02426589 2003-05-O1
The content of eacri publ~cati.~n, patent and patent. application
~,.~:i t_one~~ ~.. the present appl:cat~.on is incorporated herein by
t C.~.CI E'riC~ .
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a graph ~~howing size exclusion c:hromat;ography results of
l() ~~rote~vr;s from human male servo bound t-_o PSP94 radiolabeled with
isct:,p:= ? 2h of iodine (1~~'I) (.>pec i.fic binding) . i3inding of
lzsl_pSE'94
_ rm.,ni~:~ :na~.e s~r~.irn prot~sin r ~ df~c:ermined by the :wadioactlvity,
expressed in counts per ;ninut: (c:pm) , in ea~~h fraction. Non-specific
binding was determined by including f-nee PSP94 in the incubation
15 mixture- toget=her with human m::rle :>erum and 'zSI-PSI'94. 'fhe location
of
fractions cont.ainirng frees- an3 complexed-PSP94 IPSP94 associated with
a cars l en ) ar_e in<i icated i.n t :ue c:~ t:~apt~..
_igure 2 is a graph depicting results of '~wI-PSP94 binding in
~~j Txact -icna ~~~f c~rote.ir.;~, from naznan ma_~.e serum, partially
purified b5~
ammonium strl. fate precipit:atioa. Who~_e human male serum was
precipi_taterd with various con_~ent.rations of ammonium sulfate (0 to
52~, 3l to 47~, 4'7 to 62'~ and 62 f.o '~7'~ of ammoni~,zm sulfate (~ are
calculated in w/v)), and the uresence of PSP94-binding activity within
?5 t:he Tact is>ns was assessed by measuring the abil.iT.-y of radiolabeleci
r'SP9~= to a::,sociatc~ w_.th ~>rote~ns c: ont;an in each fraction (high
mole<:~~:a:- weight components) ~~f serum. Results are expressed as the
arz~-tur:t o=.. :ad~cacv;:.iv:ity bound to human male serum proteins in each
fract=ion re:rlative to the total amount c~f radioac;tivity used in the
U bindvng assay (in terms of percentage).
Figure 3 i:> a graph :~howirg anion--exchange chromatography results
using a MacroPrep High ~ anion exchange column, leaded with proteins
purl: ?ced by anunonium sulfate. P.rot.e:ins are elute-:1 with sodium
~5 chior-ide The peals .located between point A arid B represents the
iYr.~T_r~~ . er.-ir_~.c.r; ,..on.~a-irirtg ESPJ4-biriW ng protein. Proteins
are
dEter~t~.d and quant.Lf led by tie absorl:~ance measure:) at 280 nm.
Figua 4 i~~ a picture of a reducing sodium dodecyl. sulfate-
~ pclyacry~arnide gel electrophoresis (;3DS-PAGE) gel loaded with samp.Les
obtained foilow~ng PSP99-affinity chromatography. The gel was run in

CA 02426589 2003-05-O1
an electric field and stained with Gelcode~ Blue Code Reagent
( Pxerc:e~ ) . Lane 1 r-epresFmts he rnole~cul ar weight marker . Lane 2
represents protexra bound to .he PSP94-conjugated affinity matrix,
Lane :5 represents protei,ls th-zt bound to thk; E~SP9~r---conjugated affinity
matrix when excess free ~SP94 was included within the incubation
tr,i x t L. r- e.~ .
Figure 5 is a picture of a no'-r_educ~ng SDS--PAGE cfel loaded with
samples obtained f:c:~ll.owi~g t.h.:~ el.ution of the PSP~~~1-binding protein
li) from t)-re PSP94-conjugated aff rnity matrix using dif ferent eluting
tdLSSOC~lataoni conceit::ion:;. A:ter incubation, ir:a rt:e different eluting
buffers, the affinity matrix .vas removed from the eluting buffer b~~
centnitugation. 'A'he matrix w..:cs washed in Pt3S, anc) boiled in non-
reducing SDS-PAVE sample buff=:r. 'ihe SDS-PACE was run in an electric
15 fielcand was sta~wzred with Gelcode~ Blue Code Reagent-_ (Pierce). Arrows
represent the. posu_t~ion of the iaic,aPv molecular weight binding protein
(HMW) and the low molecular w.=igtrt: binding protein (LMW) . Lane A
represent s ttne molecular weigh rnarkEer. Lame B represents untreated
sample. Lane C represents sa.nple incubated for 1 hour in PBS at 34
~~() =C. LanEe I> represent:s sample incubated for 1 hou:= in water at 34 S'C.
Lane E represents sample incuoated with 300 ~,g of PSP94 in 1ml of PBS
at. s~.+ ='C. Lane F repres~.nt:s t:he competition control. Lane G
represents :>ample i.nc:ubat:ed l a '? M m-ea. Lane I-i epresents sample
incubated in 8 "~ urea. Lane I represents sample Incubated in 100 r~M
:7 sodium acetatE: at pH 2.7. La:ue ,.T reF>r_esents sample incubated in 100
mN! 3 ~_yclohexylamino)-1-prop::rnesu:lfonlc acid (C:As'S) at pH 11Ø
Figure b i=~ a graph showing aLfinity chromatography (using PSP94
conj~.zgatE,d affir;ity rnatrix) x~esu:Lts of samples pu-r:ified by ammoniurn
3() sulfate preciF>itation followe,i by anOOn-exchange aP~romatography.
PSP94-binding protein was el-uted from the column by adding excess
PSP94. 'The pE:ak Located betw~~er. point I~ and Fi represents the PSP9~)-
bind--ng protein f-ract_ion. Proteins are detected and quantified by the
absoiwance at 2&0 nm.
.3 _5
Figure 7 is a picture of a SDS-FAGE performed In :ion-reducing
c:cnd t.ions. Lane A is the moi~cular weight: marker. Lane B represents
t:he ~~SP94-affinity matri-x after incubatior: with PSP94-binding prot<~in
purl=.led by arnrnonium sue fate prec ipitat.i.on and anion-exchange
~ chromatography, and prier to :elution with competing PSP94. Lane C
:-epxt~seYnt s Lhe: r:ompetit~on.: c:c:nt:rc:~.l.. Lane D repre:~E:nts the
affinit~l
53

CA 02426589 2003-05-O1
matrix after elution with excess PSP94. Lane E represents the final
ei;~te~a arty concentrated isubs~:ant:Lallyj purr' PSP94--binding protein.
Figure 8 is a schematic of a ,>rohosed purification process for the
O PSP94-binding protein.
Figure 9a is a picture of a N:>:rthern blot performf-_~d tin samples of
humar: tissue poly--:'~ FtNA. Lan.., 1 represents brain RNA, lane 2
reprwsent.s heart RNA lane 3 y-eprtasents skeletal muscle RNA, lane <<
iii wepr~aents solo=~ RNA, lane 5 represents thymus F2Ni~, Lane ti represents
spleE~n RFVA, lane -% represents kidney RNA, 1%~ne 8 represents liver F;NA,
lane 9 represents small intesvine RNA, lane 1U represents placenta
FNA, lane 11 r epresents lung ?NA and lane 1 2 reprf;~;ents peripheral
rnlooci lymphocytes (PE3L) RNA.
~>
Figure 9b is a pi.ct:ure ~ Northerru blot performed
of on sample; of
humar: tissue bane> 1 represents spleenRNA, lane
poly-~'1 2
Fu~~A.
rer~r~~sonts=aymu:> RNA; ce _i repsesents prostateRNA, lane
la 4
represents testis RNA, ' represents ovary R'~A, 6 represents
ane lane
?0 snial=i tine RNA, lane zepresents colon RNA and 8 represents
ant.es 7 lane
peripheral Blood Lymphocytes(PBL) RPJA.
figuve 1Ci i s a picture of a Western t~lot showing recogrtit:ion (bind__ng)
of PSP94-binding protein with a specific monoclonal antibody (1B1:_) .
'' i,ane ~ i:fnolecu~aw weigat markers (from top to bottom, 212, 132, 86,
44 kl~a~ , t,ane i :rs ~.2 ug of ~:substanT:ially> pur:fi.ed PSP94-binding
protceiu ana lane a is 2~~ N,1 0,- parvtia_Liy pure PSP94-binding protein.
F'igurva 17. is r~ pic,tuoe crf-__ an LISA plat:.e where t:h;. specificity of
0 monoclonal antibodies for bou,zd and free forms of PSP94 is evaluated.
C:olo:~ed wells represent a po:W tive r<esult.
F'igu~~e 12a 1_ a schematic of -~ method used to measure the amount o:=
free PSP94. Figure 12b is a r~:sulr_ o:ian E,LISA assay using the method
3S illustr°at:ed in figure 12a.
Figure 13 is a schematic of a proposed method used to measure the
~amourit (F?SI,94 sandwich ELI:SA) of total PSP94 i.n a :7 ample.
S~~

CA 02426589 2003-05-O1
Fi3ure i4a is a schernati:, of .~ method used t=o measure the amount of
total i?SF~34-oinding prot~W n ( z:>irng a PSP94-bindincr proteir: sandwicr.
ELISF_) in a sample. Figure 1-(b is a result of an ELISA assay used to
measure the L'SP94--birxdin~? pro°:=ei-n in a ;~ampie usir:g the method
1 illustrated in figure 14a.
figure .15A represents; co lcent:-at,i.c.-~n of t.::ota1 f?SP94 levels from
serum
or ir:dividuals in low (< 4ng/wl) and high (> 4ng/rnl) PSA categories.
!0 Figure 15B represents concentration of free PSP94 levels from serum of
indi~~i<iuals in low (<: 4n ~/ml ) an <) high ( > 4rxgi ml ) PSA categories .
Figure 1SC represents concentnati~::>n of= total PSP94 Binding protein
levels from serum of individu-als :i-n 1. ow (< =1ng/m1and high (> 4ng/ml)
I.1 PSA categories.
rrigure 15D represents concent::-ation of corrected :ree PSP94 levels
from serum of individuals in Low (< 4ng/ml) and h~c~h (> 4ng/ml> PS~~
catecsories. Free F?SP~)4 values were corrected since 1-5~ of PSP94
?() bindung L,~rotei.n (and complexe::l PSP94) remained af?~er absorption
protocol. The correction subt~-acts the bound PSP9~1 x proportion of
PSP9~ t>ir:ding prot<=in not abs >rbed from the uncorrected free PSP94
value:.
S figure 16 represen'~s total PS'94 binding protein voncentration
compared to total PSP94.
DETAILED DESCRIPTION OP' THE INVENTION
.3
fSP94 was :aecl as a bait in tae isolation and identification of a
r'SP~~-k~inding protein. For. t.:xat purpose, labeled-PSP94 was used to
detect the presence of the PSP94-bindir;g protein(si in serum fractions
that wE,rc~ subrnittc=d t=o various purification steps. In addition, P:iP94
$ was used for affinity chromatography purification of the PSP94-binding
proreiru. H:xarnple;~ do>scritred below illustr-ate the L>urif_ication,
iden~.ificat~om and utility of the PSP94-binding protein.
5:~

CA 02426589 2003-05-O1
EXAMPLE 1
Radiolabeling of PSP94 and PSP94-binding protein kinetic analysis.
'f F'xpern.mer,t:~ to op t:imi.ze ''ST-P: ~P94 labeling, 1'SI-P:FP94 binding
assay to
human male serum proteins and development of means to separate free
.t" .inbound; an:oompL.exed - ( i-.e. , bound: assocuated) rasl-_PSP94
were uncle°rtaKen. iiunuan male ~~~rum prot..ein(:>) than will bind to
PSp94
(in the present case; "sI-PSPV4) will generate the formation of a
l~) comp l.e:.c c~f higher molecular w~:ight: than: :Free-PSP9~) (or frE:e
12''I-
PSP94).
Iodination of PSP94 was ;5erfo_me~3 as followed. TwEmty micrograms of
nature human PSP94 prepared a:~ pre:viously describE=d (Baijal Gupta et
Pro: . F:;cp. and ESurificat i.on 8:483--488, 1996) .n 15 microl:.iters of
_~~ ~~M sodium bicarbonate (pH 8.0) was Labe:Led using one millicurie of
mono-iodinated Bolton-Hu,-rter :-~a<~ent al 0 °-._ foll~>wing the
manufacturer's instructions ('~dEIVT '.ERadiochemicals) . The reaction wasp
terminated after '.? hours by tre addition of 100 microliters of 100 mM
,0 glycine. 'fhe free iodine was separat:ed from the iodine incorporated
into tire P5P94 by a PD10 disposable gel filtration column accordin<~ to
.rar_u.fawtn_rer"s in:.,tr:rctions (t3IGIZAD) . "Typically, t_he proportion of
s.~air:E, c:,at r~ecarne lflCOrpcrat.~,d rntc the PSP94 pn~t ein was about
60$,
giving a specific activity of about .i0 microcuries per microgram al=
?5 psP9~f .
Optim.izat.ion of the binding a;:~say of human male s<~ru.m proteins to ~'sI--
F?SP9~:* wa:> F.>erformc~d in order- to ident: ity the optimal incubation
time,
temperaturE:~, and separation conditiora. Equilibrium (e. g., no further
ii7i sagn..fic_ant incra_ase In blndiag a:> incubat.ion ti.m.~ lengthens) was
3pNr~:rat'hed after a considerable incubation time at 3i =C, so a 16
irour:r ::.ncubation ~:ime~ was sel-~ctc-~c. Separati<>rr or the complexed
form
c;i.e., bound form) PSP94 (or ~omp.'Lexed-"""''1-PSP94), having a higher
molecular weight and the free-PSP94 (or free-''sI-PSP94), having a _Low
rrole<:ular_ weight , wa:a ef fe~ctc d by gel f l ltration :-hromatography,
u;~ing
Sephadex 6100 resin (Amer=:han pharmacies Biotech Ltd) packed into a 1 x
a?r c:rn co~_umn. The mo:Lecm,lar sieve ch:romatc>graphy ,N<rs performed at 4
QC
_~,noc: at h.gher temperatures 3i.ssociation of the ~_~orrrplex during the
m~ocorlure was strown ro be src~niiic:an~.
4U
5~~

CA 02426589 2003-05-O1
.=.aser. ,n the op~zm..zat~om res zits described above, radioligand binding
analys:r s of r?SP94--tJindin~l ser zm cc>mponents ( i . a . , PSP94-binding
protein) was performed. This assay was done in a total volume of E~00
microliters. The t:est samples contained PSP94-bin<:Ling protein (neat.
serurra, ox fractions from purl ,: ic<it.ion t :vials) 50 rrq of radiolabeled
PSP94, with or without excess free competitor (10 micrograms free
PSP94 (,unlabeled)) in phospha:e buffered saline-gelatin (PBS-gelatin:
'Wi rrW ;ocxium phosphate, 140 mw~I NaC:l, 0.1~ gelatin (Fisher Scientific,
'f;~pe A? ; pH 7.5, vncluding & :mM sodium azide as art antibacterial
l~ agent.). Tt:ose were incubated for 16 hours at 37 '=t.'. At this time,
the equil ibrated mixt:ure was >lac: ed on ice, and the; components
separat:.eci according to their :molecular weight by molecular sieve
chromatography at 4 °-C using ~ 1 x 2(l cm sephadex u100 column
equiibrate~i with PBS-gelatin. After t_he sample Tad run into the
co 1 ~.:rm: ., rml was <Yisc:arded, a_zd 20 fractions of 0 .'~i ml were
collect:ed.
=. sir_g?e fraction of 30 girl wa:~ also collected at ~:he end of the run.
'I'he xac:lioactivity (expressed in counts per minute (cpm)) in the
collected fractions was measured using an LKB rack gamma counter, and
?0 the t.ot:.al radioactivity i.n t:h:z high molecular wei~~ht. peak
(general=_y
contained within fractions 4-.L4) and low molecular weight peak (the.
remainder of the 0.5 ml fractions anti the single 30 ml fraction) were
caicuiated. A typical elut:i:>n prof=.le is illustrated in figure 1
$ Figut-e 1 shows size exclusion chromatography results of proteins from
human nra:l.e serum bound t.c~ PSP~)4 xadiolabeled with isotc>pe 125 of
iodine ('"51 ) ( i . a . , '°SI-PSP94 ~ ( speci fit biding) . Binding
of ~'SI--
PSP94 to human male serum protein is determined by the radioactivit=y,
a:xpressed :in counr_s per minute: (cpm)" ?n each fra~,:t:i.on. Non-spec.it=is
~30 bind~nd was determined by including 10 ~tg of free HSP94 in the
zncui>at.i<>n mixturN together with '250 ~tl. of hurman male serum and 50 mg
ref '~-yL.. p~;pga. Tree iocati.on of tractic>ns contaznin~.;~ free-- (i.e. ,
unbound) and complexed li,e., bound) PSP94 are indicated in the graph.
The majority c.~f the free F'SP94 ("5I-PSP94) eluted later than fraction
~S ?0. ''yl:riK:a:liy, about 33Rs of t'ne total radioactive J'SP94 added to
the
a.50 rnicroiiters of human serum eluted in the earlier fractions as part
of r_he PSP94-binding protein complex, and about 67~ of the radioacl~ive
PcP4,t r~~rna;ned un;~omplexecl eluting irr the later fractions. In the
;:um;pet~t__v~~ :~.ont.r;::~, with the inoLus:;on of 10 miceograms of
unlabe:Lled
0 PSP94 :in the ~ncur~at:ion mixture, only about 3~, of the radioactive
PSP9~= elutF~~d :nn t:°:e ear7..iE:r 1 ract ion:_> as part of a high
molecular
57

CA 02426589 2003-05-O1
weight complex, confirming the' specifi.c.ity of the PSP94 for the PSP94-
bindinc~ protein.
Using this methodology, and by varying the concept:ration of
7 radiolabeled and competing PS:?94 and maintaining t:he quantity of human
rreaie serum, cc>nstant (25J Etl) .it was possible to perform kinetic
analysis oT the equilibrrum b~ndi.r:~g data. A:~sumind that PSP94 is ak~out.
one fifth of the molecul:~.r wei.dht of a PSP94-bindLng protein, this
woulc; suggest that: each :nilli Liter of: serum has abaut 1 microgram c>f
l~ PSP9~'a-binding protE~irr. Phe t.:~tal protein content. c:>f serum is
about: 80
milligrams per milliliter, so the PSP94-binding protein : total
prote~ir: xatio it >c=rum i.s app:;-oxymatEely 1:8(),000.
F°?:r::ne~ xrW ormatior: from radialigand binding analysis indicated
that a
l:, FSi~9~d-c~ir~d~ng protein is present (.,n t~urnan female :3erum, virgin
fem~rle
human serum, fetal bovine serum, and pooled mouse serum.
EXAMPLE 2
Ammonium sulfate precipitation.
:'ram t'ae kinetic results abtamed in example 1, i~: was shown that t;he
F'SP94--bir:ding protein was poox.-ly abundant in human serum.
?S I:n order to isolate a PSP94-binding protein for further
characterization and identification, a first purification step was
perf<.~rmeci 'tuy ammon:iurn sul.fat:ee precip:itatian. Ta a>tablish the
approx>riate concer:tratic>n of ,~mmoniurr, sulfate nec~>ssary to precipit:ate
a PSP9G-bindirug potf=i.~~.,, smal.',. se~,~le artunoaium sulfate
precipitatiarz
0 t.ria~.s were performed. TI-:e presence of a PSP94-binding protein in the
precip~t~rte was determined titter dissolution and .iialysis against
HSP9~t by radialigand binding analysi:~ as discussed in example 1.
These t.rval.s determined that the :32-4'7~k anunonium sulfate fraction
cont:ainec~ the vas.. rnajoxity c;L a PSP94 bindinct mar_f,ria:~. as
illustrated
;5 in f ~gure :: .
?l,~unormm sulfate precipitation was routinely performed on a larger
.>t.~~;:. E,3r: ;~f:iy, _ I ~ter of n tile t:roron serum ~f3.m~reclamation
Inc, New
~~orKt wa:> thawed and added (c 1 lifter of cold 10 ,rvM Sodium Phospha~e,
0 140 mM NaC_L, pH 7.5 (phcsphatc= buffered saline; PBS), and to this :370
d of ammon::.um sulfate (E3DH ACS reager:t grade) was added slowly under
58

CA 02426589 2003-05-O1
constant stirring to bring th._ ammonium sulfate concentration up tc>
32~. iafter dissolution ~f th:e sa.Lt, t:lm. mixture l l .e. , male serum
contai.nirveg ammonitun ~sulf~te) aas stirred for 2U m:rmtees before
centri=ugation at 5,000 x g f:.pr 15 minutes. The pellet was disCar~ied,
7 and the supernatant: f:ract.i.on pf F.~roteins containing a PSP94-binding
nrorE>:~r: =h:as coliec:ted. ~urth.~r anunonium su.Lfate i88 g) was added
slowi.y under constant stirr.irt.j to the supernatant Traction, bringing
the t ora.i anunoniurn sulfare co nten.tration to 47~k. After 20 minute:>,
this mixture was also spun at 5,t>00 x g, the supernatant was
]C) discarded, and the pellet was dissolved in a Iota of 500 ml of 10 mM
MES i(2-[N-Morphol.ino]ethanesnlfonic acid) hydrate), 100 rnM NaCl, pH
F..S. 'This pellet was dialyzed using 6--8,000 moleo ular weight cut off
dialysis tubing (Spectra/Por, Fisher Scientific C<~nada) with 16 liters
o~ lu ~i.M MFj, i00 mM NaCl, pH 6.5 for 16 hours at 4 °-C followed by
I$ anot2ue~ dialysis :~t:ep using a furt:hei 16 liters o~ the same buffer for
an addi tiorua:l 7 hours. Tae px,~tein concentration within tine product.
was measured using 280 nm ultraviolet tLN) absorbance and the
preparation was stored at: -20 =C in 4 g of protein aliquots (generally
about 15t? ml). A typical ammonium sulfate precipitation assay is
fit) shown in figure 2.
EXAMPLE 3
Ion-exchange chromatography assays.
?5
Ion exchange chromatography (iEX) separates molecules based on their
net c~harcJe. Negative.Ly or. pos:~tively charged functional groups are
cova~ently bound to a solid support matrix yielding a can on or anion
exchanger-. inlhE.~n a charged moi :~cu7.e i:> appl led to an exchanger of
~U oppo:s:it.e ctn.ar<~e i,~ i:> adsorbed, wi-ri.le neutral. ions or ions of
the :>ame
charge aT_e eluted in the vole: volume of the column. The binding of the
charged molecules is reversik:Le, and acxsorbed molecules are common=Ly
eluted with a salt. or pH graaienc.
n~_~h(;v:r pr~ar kr:ow:lecxge of: arv.y characteristics of the F?SP94-binding
.?v l;rot;:~._: tree abi.l: ty of anion. and cacion exchange matrices to
absorb a
i~SF'y<6-tmrrdr.ng protein at a rGnge of 1>H values was determined in a
seri.t:s al :i.on-exchange asstay:~. Aliquots of arranonium sulfate
prec_~pitated serum were exchanged into the buffers indicated in table
3 us:~ncf a lii.orad DG 10 colurru ec;ui.7.ibratec? with toe appropriate
buffer

CA 02426589 2003-05-O1
according to the manufacturer's i.nstruc.tions. Seven hundred
microliters aliguots were .i.nc.zbat..ed with 500 microlite:rs of ion-
exchange matrix (prepa.re~~ acc ~.rdi.ng t:o t:he manufa<vt,urer's
rece:~rnendat.io.ls) . After incuoation for 90 minute:; at room temperature
wi ti: gen~~ie agitat:ior~, t-ae mi.~~uree was spun at 1000 x g for 5 minutes
to separate the marsrix from tine supernatant. If a PSP94-binding
protein l s bc:>und (ad~~orb;~d) t > th~~ mect:ri.x, it wil.. remain bound to
it
after centrifugation and will not. be present in tlm supernatant. The
supernatant was immecl:iat~ly m:,utralia:ed with 0.3 vc:~lumes of 250 mM
l~) '?'RIS pH 7.' and 250 micr~litet~s of this solution was assessed in the
1'~'I-r~SF?9~i i>inding asd>ay :lescr iberi herein (example 1 ) . Conditions
tested and results of these a:~says are presented ..n table 3.
Canon Matrix: izsl__.PSPg4 zs~~~".
Macro Prep High Buffer binding before binding aft=er
S
(F3IORAD) i.nc:ubat:ion incubation urith
with
matrix matrix
_____-~y- 4'_~ ~-~ 0 ~oM Cif _. _ -9_: 5~i__.___~ ___- ~ . 08$
_. ___.. rat-c::~ _ _ -~___
_ pH- 5 7 _- ~ _. -1 tt-- . __ 1 9 ~ _. ~ .._..___~
_._ ~~ I 1F,S . __ 7_. 7 ~ -__.__
__.- ___ _ .___ __.-
. __ -. _. ~ -
._. -
F)H 6 1() ,nM plF;;;2i).6~ 18.6$
f / --_
~
- _ _.___ .. _ _-___. -._.__ __. ___.. . _..___-_..._-________
.. __ -_. ___._ ..._. , _ _ __. . __ 11.9$
___._.. 1Ci mM M~JPS _
pH 7.9 20.5$
Anion Matrix l2sl.-PSP94 1z I- S 6
Macro Prep High Buffer binding before binding after
~
( f3Ii>RAD) inc,ubat=ion incubation with
w::. t. h
matr-:_x ~ matrix
I:~H 5.7 1i) mM ~~dES I1.9$ 4 0.73$
-~ -,__ __~.
- -
6 . '7 . 2 0 . 6 $ 0 . 6 6 $
yH 1 ~? mM r'dE
S
~
pH 8.0 l0 1<~.1$~~ 0.81$
mri B:icine
pH 9.0 10 ~mM Bicine ~~ '12.5$ i- 0.65$
.
I
S
Table
3
"re -va, or indrrrga rrom thesE: ion-exc~r_ange chromatography assays
.ndicate that temporary exposure of a PSP94-binding protein to
extremes of pFi ( 8 and ax:~ove, and i5 and bel ow) res~.z.Lted in a reducer
U abil_ty of a PSP94-b.indina protein to bind to PSP94, suggesting th~3t a
PSP94-bind:i.ng protein is pH sensitive. No adsorption of PSP94-binding
prot_tein rno t-_he ration matrix was seem at pH 4.7. Some adsorption vo
6f)

CA 02426589 2003-05-O1
the ration matrix was seen at pH '.i.7 and maximal adsorption was seen
at pt- 6,°?, These result: may suggest an ~soelectric point. of about
pH
:7 The anion-exchange chromatogrrphy as=;ays indicated good adsorption of
a PSP99-binding pr.-otein ~o th-' matrix between pH '~.7 and 9.0,
cons: stmt w-with an isoel~~ctri ~ pi>i.nt of 5. it was clear that a
preferred purificatian strate::~y would have to use the anion-matrix,
because good adsorption could be attained at neutral (non--denaturing)
I~) pH values. So the anion-exch.inge matrix, and the lOmM MES buffer at
p~H ~ ~ was selected f:or ~urth:~:r work usin<~ salt cs>ncentrat:ion elution
cashew tr~ar. pHe'_,t:tion.
Optiruization of conditions of PSP94-binding proseAn elution from the
IS anion--exchange mat=rix =,aas performed using various sodium r_hloride
concen::.rat;_on.
oc~umn ('_ a 15 cm) containing Macro Prep ILigh Q was equilibrated
with buf.-er contain ng l~ mM 'dES, 10(> mM NaCl, pH 6.5 and run at 0.5
~?U m1 pe~r m;.nute. Sevi:n mii 1-i li.t :ers of t: he 32--.~7~ artunonium
sulfate cut.
(i.e., starting material ef trble 4) ec;uilibrated into the same
buffer, was applied t:o the column, and various buffers were applied to
elutes a PSP94--binding protein. 'fhe elt.iant was monitored with a W
recordNr. '"he fractions were co:l.iecte:d, and x:>uff~er was exchanged =_nto
~5 PBS t_tsincf CentriPrep concentr:rt.ors with a molt,cul,:~r weight cut of:f
of
kTra (Am~con). Tnese sample's were tested in the 'z5I-PSP94 binding
essay: ~re;~c~~l~ed in exam~;ie 1.. 'fable ~~ summarizes r-he different
cand-tons used and the results obtained is this experiment. A star
y * ) :_n<licvate that Borne 1.o4~ses wan; ex1_>er i enced dun i ng buffer
exchan<~e .
U Protei;~ concentrations were estimate: from absorbance at ?80 nn (A280)
with 1 OD unit:, equivalent to 1 nua of protein.
61

CA 02426589 2003-05-O1
Sodium chloride~ Tot;al proteinTotal protein ~ 1"I-PSP94
in
coaCen~.rat~or:' Eluted (mg) binding assay bound
Start=ing 179 mg* 7.2 mg 12.7
material
( ammo n l um
sulfate cut)
100 mM (flow 50 mg 0.67 mg 0.89
through)
2 0 0 ~~ -_-. _ 3 77 mg _~, ~t . g 0 mg 7_ . 4 ~
_-v. ~ -
l
300 rnM ~ L~ 0.63 mg 24.4$
4 0 0 n,M -~..--- j ing -, .--_~ . 3 U mg ~ 1 . 5 ~
i~
500 mM 8 mg 0.62 mg 0.9 ~
1000 mM 7 mg - -
Table 4
From these data, it. is clear :_hat- the buffer containing 300 mM NaC7.
was effect:.ve and would oe prc=ferably used for el2zting a PSP94-binding
protE:ar iron: the armon-exchan:a~~ matrix. Using t:h<::>e results, a scale
up ion-exchange protocol was developed allowing the application of 4 g
of ammonium sulfat=e precipita~::ed serum e~xtr<~ct: t.o a 5 cm x 12 cm
aniorz-exchange matrix as desclibecl belaw.
1U
EXAMPLE 4
Large-scale anion-exchange chromatography purification of PSP94
binding protein.
15 An anion exchange column (5 c-:r diameter x 12 cm length, Macro-Prep Hi
~7, B.i.ora<i) was prepared arid a::Iui i.ibrated in accordance with the
manui:acturer's guidelines in 10 mM ME:S, 100 mM NaCl, pH 6.5 and run at
room temperature with a flow rata of about 3 ml per° minute. An
aliquot. of ammonium sulfate precipitated serum (from example 2; 4 <~
?.~ total,. prote=in in <sroout 1.5C m1 of solution) was apy>l.:ied to the
column
whit:rz, was taen washed with about 250 ml. of 10 mM MES, 100 mM NaCI, pH
6.5 ~.FsgurEU ~j!. ~'lution was performed W th about 400 ml of 10 mM MES,
::0C r_~~._ NaC'=. pH ~.5 buffer, followed by elution with 10 mM MES, 300 mM
NaC.i The 300 mM eluting fra:tion was collected (Figm:e 3). The
?5 prof=ile c~f the eluting proteins was monitored by ~V absorbance at :?80
nm on a chart recorder. A typical profile is ill;.zstrated in figure 3.
Figure 3 is a graph :showing anion-exchange chromatography results
:zs~nc;t a MacroPrep High ~: anion exchange column, loaded with proteins
6''

CA 02426589 2003-05-O1
pu~if:isd by arnmc:nium sul=ate ;about 4 g:ramsj. Proteins are eluted
mth st.:epmse lrrcreases ,_n so~?iurn chlarlde convent ration. The peak.
located between point A and B represents the protE~in fraction
containing a PSP94--binding pr~~t~e:in. Proteins are detected by the
absorbance measured at 280 nm
The column could 17e regenerat~:d with 10 mM MES, 1 M NaCl, pH 6.5 (300
ml) followed by an ec~uilbrat..on with 500 m~ of 1(r mM MES, 100 mM
lVai.'.:; ~.oH 6.5 Sad.urn azLde w.r:~ <added ca this buff-er at 0.05 (w/v)
s~ =or st;;rage ~f the column for greater than 24 hour s.
The 300 mM fraction (about 90 ml) was collected (between markers A and
B, Figure 3) and t:hi~: wa.~ shorn previausly too contain the majority of
a PSP94-binding activity. Th~a preparation identified "partially pure
17 FSP94--finding p.rot~ein" ( PPBP) wa:~ cor:centrated too about 20 ml in
centrifugal concenvrator~ acc >rd~.ng to the rnanufacvturer's instruction
t~entrrprep 10, Amrcont xilut'd with PBS to 60 ml: concentrated to 20
ml, rurttaer diluted with PBS :::a 60 ml., concentrated to 20 ml, and
finally diluted with PBS to g!ve a solution with an A280 of 2.0
?0 (gene: rally a f.ina~_ volumes of cbout: 1~>0 ml) . This solution was
stoned
at -20 °-C'. After a total application of 20 g of protein (5 cycles)
the column was sanitized using 1 M NaOH and re-eqmilibrated in 10 nrM
MES, 100 mb9 NaCl, pH 6.5 usi.n:1 the protocol descr:~bed by BIORAD.
S P.mmar:ium s~.~1'at~ ,_rac:tionatio~a (i.e., precipitation) and anion
exchange chromatography nave resuLteci in approximately 4 fold and ._0
fold purification of a PSP94--binding protein respectively. In neat:
serum, estimations indicated .hat the ratio of PSa'94-binding protein
t.ota-:: prc>tein was 1:80, 000. t?he efficiency of thk~ two protein
.3() puri f i<:vat icm step: described n eexamp ie 2 and example 4 were
monitored
using the I'SP94 radioligan.d binding assay described in example 1.. In
both st..eps, :.he vast majority of the PSF94 rJindirry material was
c:entvnF:d mtn~n a sl.ngle frac:tian. From this information, it appe<~rs
that in corrir~ination, thE:se t:wo steps result ir. an ~ffic::i.ent.
_35 puriu cat:ion process with little loss iqualitatme~y; of the PSF94
bind-;.ng material. However, assuming losses ax-e small, t:he partial:Ly
puri.!-ie:ad binding proi~ein (PPBI?) ;rielcled by the combination of the awo
protein purification steps described in examples 2 and 4, should
c:ont~rin about 1 part. of bi.ndiag protc;in: 2000 pares of other prote:Lns,
~(.~ by 1<r s s .
6:

CA 02426589 2003-05-O1
EXAMPhE 5
Affinity chromatography assays.
J Preparation of affinity matri,K for PSP94-binding protein purification
was performed a:~ followed. A.~>proximate:Ly 0.5 g of: cyanogen bromide
activated sepharose CL 4!3 (Si_xma cYhemica.L Company; was swelled in 1 mM
HCi and prepared as per vhe m~:ani.~Eacture.r's l:~er_omm<.~ndations. To 1 ml
.._ tris matrix, 5 rn1 of ,~ solltiorr containing 5 m<) of PSP94 purified
l!.) as described in Baijal O~zpta ~:~t al.. IProt. Exp. acrd Purification
8 : 48 ~-488 , 1996 ) i_rr 1.00 :nM Na~iCOs 0 . 5 M NaCl , pH 8 . 0 was added
and the
reactants inr_ubated at 4 =C with periodic agitatic>r:. At time
intervals, the reactants were spun at: 200 x g for '<? minutes, and the
absorbance at 280 nm (A280) expressed in optical density (OD) unit.:,
)1 of ar. a:L:iquot: of superna~.ant ,vas meat>ux~ed in order to determine the
prop<;r tior_ of binding of PSP9 1 to the matrix. Re:~ults showing the
~~~ne course of corn7ugation ~.i . e. , binding) of PSP')4 to the activated
sepharose ( l . a. , matrix) are :;ummariz ed in table ~i .
Duration A280 (OD) unitsA280 (OD) units $ of PSP94
of
reaction not: bo~..~nci bound t:o matrix incorporation
~ tc~
rmin) l matrix
0 ( start ~
) 0
~ 5 1
~
_.. ._ _
_I 4 _' 0 4 ~.. l 9 Y 6
_~ _.___ __ _.
_... .._.._. _ ________._-_-.__
_
-_. ___ 2 :.1 . __ _ - ~. _- ~ 1
_ _. _
__ _~3
' p d ____
.._.. _
,'() _ .__ _ ,...___.____. __ _._ _ T-.....--_-____,_-_
_ __._._ 3.1 ~ 51
l ____
_.__....
_._. .
.
-- _.._.-_ 3 _5_. _ ___.-__._._ _. _ 69
~_1-~ -__. -.~- --
._- ._._._ i
.
?0 Table 5
The conjugation reaction was ~zortinued until 70-80~ of the PSP94 had
bound to tire matrix (aft:er about. 60 minutes in the preparation
._llu:>trateci in table 5). At this time, 1 ml of 200 mM glycine was
adde<? Uo bllock any further rE,:acti.ve groups anal they slurry was
incubated overnight at 4 =C with gen-~1E: agitation. The matrix was
wash<7d according t.o the manufacturer's r-ecommendac:.ions and diluted in
PEiS ..o give a slurry with a concentration with respect to PSP94 of 1
rmcrograra per microliter . Soc.ium azicle (NaN3) was added to 0.05 ass an
0 anti--m~crobia.L agent.
Based vn tue results of optimization assay described above, a PSP9.~
aff~rmry matrix was prepared by conjugating PSP94 to cyanogen bromide
64

CA 02426589 2003-05-O1
ac:ti.e,ated sepharose. 'rtt~> mat::ux r_,ypically had 4 micrograms of PSP94
per rrricroliter of packed matr..x, and a working slurry with 1 microcrram
of PSP94 per nnicro:Lit:er was prepared by dilr.ttior: uai.th PBS containing
0. 05~, NaN3. fihe PSP94 aff.init y matrix (at a concentration of 5
micrc>grams per milliliter with respect to PSP94) was added to the
partially pure PSf?94--binding o:rotein. 'fween 20 at. a concentration of
ii.l~ tv/v) anti NaPd~ at 0 0'W w%v) were also incltded in the mixture,
whit!: was then incubated ac 3v ~C for 18 hours on a rocking table. In
a ~a.~ als~l cor,troi experiment , free- PSP94 was al:~o added at a
1.n concentration of '_i0 microgram;> per milliliter. The: addition of free
PSP94 in this control experirne>nt wouJ d compete wiT~h the PSP94
conjugated to the matrix for !::.he k>inciing of a PSPO4-binding protein.
This will reverse t:hE: bi.uding of a P:>P94-binding protein to the
affir;ity column this enabling Che identification of proteins
spec=.i~_wal!y binding to PSP94. ~ftoee aff:i.air_y matri.:~ was separated
from
c.ne supernatant by rap,G flit:~at:ion, and the matrix was extensively
washed in PBS at. 4 ~C: . ~fhe ma ~r~x was collected arid boiled in sodium
dodec:yi sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) reducing
samp:ia buffer (ffinal concentr.~t:ion in sample: StnM ~fris pH 6.8, 2~
~~ (w/v) SDS, 10~ glycerol (v/v), 8rnM dithiothreitol, 0.001 Bromophenol
blue) t.o dissociate the bound proteins and these were resolved by '~.5~
SDS-PACE. Result of this experiment :is illustratfa<:3 in figure 4
z'ig~~r~ 4 s'-,ews r-e:~:alts of a s~:~dium dodecyl sulfate-~polyacrylarmde
cxel
~$ eelecr.ropitoresls 1SDS--PAGE) lo;~de<J with samples c>br.~:ained following
PSP94-affinity chromatography. The clef was run i~i an electric. fie:Ld
and :stained with Coomassie Brilliant Blue. Lane L represents the
molecular weight. marker iR.aleidoscope prestained standards, Bio-Ra<i).
Dane 2 represents proteins bc;"tnd r_o the PSP94-conjugated affinity
3~ matr:.c. Lane 3 represents proteins bound to PSP94-conjugated affinity
runt r ;.x and =n<.:ubatec with excess of i'Sf94. Note that at least two
prorsmns, A and cu, remain pre:senc m true t.wo canes, (lane 2 arud 3; .
'~'wo bands, B and D, are present in tl-to lane s but not m the control
experiment ilam: 2) . Tt;ese r: ands (B and L>) are likely to be specific
~5 PSP94-binding proteins.

CA 02426589 2003-05-O1
EXAbIPLE 6
Optimization of PSP94-binding protein elution from the PSP94-affinity
matrix
A raruge of condition's were asv~essed in order to dissociate a PSP94
hmd-inch prot~~rn from the affinity matrix using Ie:~s denaturing
~crrd~ = _cra t han bc: ~~ 1 i.ng in SD ~-PAGE sample buf fer ( either in non-
reducing conditions or not). _'on<iitions tesr_ed are summarized in gable
k~ 6. Undenatured active PSP94-Minding protein is required for antib<7dy
generation and furr_her experimentation and development. Aliquots of
PSP9~'~-afiinir_y matrix that ha-:l been pre-incubated with partially pure
PSP94--biruding protein an:_1 washed (i.e., with birtd~ng protein attached)
were incubated for 1 hour in the eelut:ion (dissociation) conditions
1~ listed in table 6. After incu:~atmn, the affinity matrices were
remo~~eci from the eluting bufff~rs 'by centrifugation. The matrices were
washcad ir; PB:3, an<l boiled in non--reducing SDS-PAGE sample buffer
(final concentration in sample: 5mM '."ris pH 5.8, .'>_~ (w/v) SDS, 10~
glycerol (v/v), 0.00~~~ Bromoptienu~ blue) and prot~>~ns were resolved on
~() , .5~ 575--PAGE. I~ proteins ;-ema~~ns associate-d with the matrix a:Et=er
elut:o.~1, the ceonditions are n.ot suitable for an appropriate
dissociation. Thus if a PSP91-binding protein is absent from the SDS-
PAGE: i~l~~straged :in i=figure 5, elut=ion (dissociation) conditions are
suitaW e. Non-reduc!~ng condi.ions were found to arovide superior
2S separation conditions, because the major contaminating band was lei=t
at the top of the gel, rather than between the t~w~~ PSP94-binding
protein bands. Conditions tested and x-esults of ~~tais experiment are
illustrated in figure 5 and s.immarized in table 6.
6~

CA 02426589 2003-05-O1
Lane iDissociation conditions Effect an PSP94-binding
protein
F Molecular weight marker-
_. , _ ._.. _ .. _ _ _. _..___.. _ _.._ __. __ _ - ._..._.....-__~______._
. __ . _ _. _ Ncne
... :~o t:reatmenc ~
I;
'___ ' hour_ irl PBS _at_ 14 _...._._ Mone _ob=So~abl2 ___.___-
~C _.__. i -
~ , ~__ hour. iti water a,-_.34_..-,V~>ne~observable ..-_____
_ ,-(y_ . .._._. -._
_...
E.___...._) 300-.~~_.PSP94___lm.._~ _g.~._.Near total_elution from-__._
~l_.P'3S (~t'._..34
i ma.ctrix
_ _ _ _ _ _ _
F i ~Competitnon control ..~ _ ~rlear full competition)
__..._____ ...._
_
.. t 2 M . u~ ea-_ . _ _ _ _ Nc>ne . ob:>ervable -_._
-~ _ _-_
.. i 8 M.. urea _..._. __- Sumo loss ..of - binding..
._. - _ _ __.__..
__......_I -.~ 0.. ~ ~od;.um acevate..._~. Sc>me ~Io,;~ ...~
- ~H 2_., 7__ f binding . _____
_ i 1~.~ . ~ SAPS pH~ 11 , .. - dome lo;s _-of binding._-_______
__._ p -_.... . __ _. .
__ -1
Table 6
i'igurwe 5 shows a SDS--PAGE loa_ed with samples obtained following the
eluti.ar: {~f a PSP94--binding pr >tein from the PSP94-conjugated affin~_ty
.~,iaty~x usir~a :iifferent eluting tc'iissc>ciation) canditions. After
i.ncuhaic,n; ir: ths~ different. elut:.~ng buffers, the affinity matrix was
i~~ remov~eci rrom r:he eiut:ing buffer ly centrifugatian. The matrix was
washed in PBS, and boiled in uon -reducing SDS_PAGI? sample buffer. ~'he
SDS-PAGE was run :in an el_ectr -~c f field and was stained w:i.th Gelcode<D
Blue Code Reagent (Pierce). arrows represent the position of the high
male<:wl.ar we.ic3ht )finding protein (HMLV) and the low molecu.Lar weight
bind..ng protein (LMW). Lane .~ represents the molecular weight marker.
i,Kal.mdoscop~a prestained standards, Bic>--Ra<i) . Lane B represents
~.~r.trea~,:ed sample. Lane C represents sample incubated far i hour in
PBS <-at 34 =C. have I3 represents sample incubated i=ar i. hour in wa5~er
at 34 ='C. Lane E represer_ts sample incubated whir 300 ~g of PSP94 in
0 1m1 of PBS at 34 =C. Lane F represents tf:e compe~;~:i.tion control, where
the matrix was incubated with the PPBP in the same way as the samp:Le
from lane' B, but: inc:Luded in r_his incubation was a saturating exce:~s
of free PSP94. Lane V represents sample incubated in 2 M urea. L<~ne
YNp.eesent::s sample ncubatea ~r: 8 M urea. bane i represents samp:Le
_. _~C'.!.~a~~~'<~ :gin .:_~I~~ mM SOd7.llITl acetate a'._ H c'.
~~ p .7. Lane J represents
samp'~e incubated in 100 mivl 3.- (Cyc Lohexylamino) -1-~aropanesulfonic acid
(CAPS) at pH 11Ø
67

CA 02426589 2003-05-O1
From the experiment described above, it is clear that a PSP94-binding
protein anti PSP94-affini!;y ma':rix interriction was highly stable unc,er
a variety of conditions. Some dissociation was seer. with 8 M urea, and
extremes of pH, however These denaturing conditions were less favored
than non--denaturi_nc~ comp~~titiwE= dissc~ciation usinct excess free liga.nd
!i..e., PSP94). This approach was therefore selected in order to
purify the active PSP94-oindiug protei.n..
Data indicates that: the HNIW an::l LMW bands of figure 5 are the same ~a
lU bands I3 and D of figure ~, respectively.
EXAMPLE 7
PSP94-binding protein purification by PSP94-affinity chromatography
1:5
Gne t:undred milli~~iters ~f partially pure PSP94-binding protein
(preparat:ion geneuated as described in example 4), containing 0.1~
(v/w) Tween-:?0 and 0.05 (w/v~ NaN3, was incubated with 250 micrograms
(witY. respect to I?SP94) ~:~f affir~it:y matrix :Eor 16 hours at 34 ~C. The
?~) matrix was separated from the soluble fraction by rapid filtration
usinc= a disposat~le Poly-Prep !~olunan ;Blo Rad) . 'Tine liquid was forced
'hrcug_~: ~he ,_olurru: by ap~lyi.n~:~ air pressure from ;~ 10 ml syringe
att«ched to the column end. caj~. 'fhe matrix was washed three times
with ~0 ml o.f ice co'wd PBS similarly, and the mat,~ix was collected
?$ from the column's polymer bed support. with a micr~opipette. The mat=six
was re~uspendE:ed in 1 mil.liiit~.:r of 10 mM sodium plnosphat.e, 500 mM PdaCl
pH r.5 containing 2 mg of free PSP94 and incubated with gentle
agitati.or: fo:r 5 hours at. 34 =._. Phe matrix was t~ofm separated from
the :~oiut.ior. by c<~ntrifugatior.i (1000 x g for 30 seconds) and the
t) supernatant: !cvontalnung the eiuteii P5P94-binding ~:~roteir~ and free
t'SP9~i) was resolved by molecular sieve chromatography at: .room
tempe-.rature using a 1 x 20 crr. sephadex 6100 column equilibrated with
i.0 mM sodium phosp~hat_e, 500 rr~C~I NaCI, pH 7.5 and r~.am at a flow rate of
approximately 0.'7 tnl per minute. The absorbance at 2$0 run of the
Z$ eluant was recorded on a char r_ rarorcier (Figure 61 . Qualitative
assessrnemts or uSP94-binding ~rotem capture, elution, and purified
r~a;:~d.lcv: ,~e_-o made oy nor:--reducimJ 7.'~'~ SDS-PAGE (Figure 7) .
Figure 6 shows affinity chromatography (using PSP94-conjugated
40 affinity matrix (Sephadex G-:100)) results of samples purified by
ammonium sulfate prer_ipitati<~n and anion-exchange chromatography.
68

CA 02426589 2003-05-O1
PSP94-binding protein wa:~ elu .ed f:rom the column lay adding excess
PSP94 (free-PSP94). The high molecular weight proteins were collected
(between points A and B) in a total volume of 4 ml. This solution was
r,u f fE.r exchanged a nto PBS ( 15;.) mM NaCI ) us ing centrifugal
:~ t-oacEntracors (C: ent:ricon-10 f,-om Amicon) and concentrated to
approxlrnateiy 1u0 ng per micrmliter. Typica'; yielc( = 40 micrograms
from 1()0 ml of PPBF? w;tar:ing :aatE~rial. The peak :.ocated between
points A and B repre~:enta a P;~94-bindimg protein fraction. Proteins
are detected and quantified b~ the absorbance measured at 280 nm.
1() Results obtained i_ndi.cat.:~ a proper separation between free PSP94 and a
PSP99-1>>inding p:rot:ein.
F'ig,.axe ~ is a picture of a SD;p-PAC:~E i7.5$) performed in non-reducing
conditions. Mane A i~> the mol:~cular v~eight marker ]Kaleidoscope
15 prest.ained standards, Bio-Rad:. Lane B represents a PSP94-affinity
matrix after incubation pith .r PSP94-binding protein purified by
an:rnoraium sulfate prec:ipitatio;n and anion-exchange chromatography, and
prior .°-.o elution with competing (i..e., excess) PSP94 (i.e., free-
PSP94). bane C' represents the competition conr_rol. Lane D represents
?U t.h.~ :,.ffinir..~..~ mat.r-~:~ =zfter elu;~ion with excess PSP94. Lane E
xepresenr.s tire final eluted aid <:oncentrated (sub:~tantially) pure
PSP94-binding protein. Results obtained indicate that affinity
chrornat;ography increase the pur.it:.y of a PSP94-bincii.ng proteins) in a
significant manner.
The puz-ification. process of a PSP94-binding protein has been
surraru;rri zed in figure 8 .
.3O EXAMPLE 8
PSP94-binding protein amino-terminal amino acid sequencing
A SDS-PACE gel was prepared as described in example 5. However thf:
proteins were transferred to sequencing grade PVDF membranes (ProB.Lott
Z5 :-!emb:-a:rer>, Appl;.e~~ B:LOSystem) us:rng a Mini. Trans-3:i.ot transfer
cel:L
J~~>--W:i~. ~x,.~s-~rdi::g to t:he~ manuf actu:rer ~ s recommendations for
sequencmrg preparation. 'I'hW membrane was stained wit h C.'oomassie
Brii~iant blue, and analyzed by amino-terminal (i.e., N-terminal]
amino acid sequencing. The amino-terminal amino acid sequencing Haas
=~~ carr::.ed out_ for bands B, C.' and D ill,.rstrated in figure 4.
69

CA 02426589 2003-05-O1
Band Amino acid Sequence
B I (L)TDE(E)KRLMVELHN
l _ _ _ _
l tJbiqaitous imrnuno<~lobu'..in sequenc-a -_._...._ _.._._-...____-_.__-
.~__._____
_i Jm~EEKRLMVELHIv.TLYRAQVSP'.'ASDMLHI'~ ....._.___..___-_--._ _
....._.___~___.._----
Table.
As sE:en in table ? bands B and D have the same N-germinal amino acid
sequences, so there are Likely to be different for-ms of the same
.5 protE ire, with B possibly reprc~sent.inq some form ofv aggregate (multi.
mere), o: a7t:ernatively, B anj D being alternativfM y spliced, or
processea.
1O EXAMPLE 9
Cloning of a PSP94-Binding Protein Gene Sequences.
Total RNA was isolated zrom ~ x 106 Jurkat clone E6-1 cells (TIB 152,
Amerpcan Type Culture C<~l.Lect iom, Manassa,s, VA) r~IV from healthy blood
d ~ donor per ipheral blood rnonon~.iciear cel is using Tri-reagent (Molecular
~ese~:rc°h v~nter Irac. , Cincinrnati, Ofi) . RNA was ethanol-
precipitated
and r esuspended i.n wate:o. RNA'. was reverse transcribed into cDNA using
the ~'hermo:~cript RT-PCR System (Life Technologies, Rockville, MD) . The
cDNA was ~~ubsequent.Ly iimpliivied by polymerase chain reaction (PCR)
?0 usin<t Platinum T~~cI DNA Polynerase t~ic~la Fidelity (Life Technologies)
us in~r a 5 ' --primer ( 5 ' - A~GCF,CGC~CTCCTGC:AGTTTCCTGATGCTT-3 ' ) and a 3
' -
prime,r ;'~'-GCCCACGCGTC.'GACTAGTAC(T)_,-~i') (Life "hechnologies 3'Race
adapo.e: prxrner, ~.,ifw T'=chno'~.ogiE~s) . ':fhe 'p'-p.-imer DNA sequence
was
based on PSP94-binding protEm n amino acid sequence and partial. cDNA
$ sequk~nce published in Gene Bank databa:;e (Na:~t:ional Institute of
Health, (J.S.A. ) G.B. Acc.:ession No. AA311654 (EST18251~ Jurkat T-cells
V1: Homo Sapiens cDNA 5' mRNA ~;equence). Ampl.ifiE~c3 DNA was resolved by
agarose gel electrophoxesis, excised from the <1e1 and concentrated
usin<L Qiagen LI: DNA extracti:m kit (Qi.agen, Miss:issauga, ON, Canada).
3~ Purl~~ed DNA was Iigatr~d into pCR2.1 plasmid (Invitrogen, Carl:;bad,
..:r,c ~.se~ :.::f 4x'r~n:>foa:r F;.cel.i., strain "P0P10 (Invitrocfen) .
~'snpi<:ill~n--resistant co.ionie:; were screened for cDNA-positme m~;erts
by r<=_str._ction enzyme analysis and DNA sequence anal.ys,i.s.
Blasting oi= DNA sequence of PSP94-binc~i:i.ng protein into Gene Bank has
.dentified some DNA sequence of ~.znknown utility such as, for example,
?0

CA 02426589 2003-05-O1
Gene Bank accession numbers XM 094933 (PRI February 6, 2002), BC022399
(PRI February 4, 2002) , NM 1p3370 (PRI April 7, 2003) , BC035634 (PRI
Septembe-r 23, 2002!, etc.
EXAMPLE 10
Tissue expression of PSP94-binding protein messenger RNA.
A PSP94-binding protein messenger RNA (mRNA) was isolated and the size
~f.) and reiatme expressior: le~ai in human tissues was determined by
Norti:er~ b:l.ct. C:'omm~:rci~nl Nont.herw bl.cat:s contain::r:g 1 or 2
micrograms
of numarn t.LSSUe poly-A RNA pr,~r lane (Multiple Tf ssue Northern (M'CId'w)
Blot, Clontech, Palo Altcv, CA) were hybridized as per the
manufacture': recommenctatior,s with a ['~~P]--labeled PSP94-binding
IS Protein cDNA pro.>be which sparred PSI?94-binding Protein cDNA sequences
346 '.0 745. The inten~>it:y ~>f the ~>and was quantified with an alpha
i.mager 2000, model 22595. '!'he relative intensity of the band was
determrned and given an arbitrary score ranging from + to +++. This
scor ; n;Sr~a4- based on ther lowest: dete<-ta:ble 2 . G kb signal band seen
~uant:ificat~ion of the results illustrated in figures 9a and 9b are
surrunari.zE~d in tables 8 and ~j respecti.vely. Briefly, RNA from brain,
heart, skeletal muscle, col<,n, t:hymus, =spleen, kidney, liver, small
intestine, placenta, lnnc~, ~;~rost;ate->, t_est:is, ovary, and peripY:.erai
?S blood y~.nphocytes (PBL) was analyzed for the: expression of a P~;P94-
bir~d~ng protein RNA expression.
~l

CA 02426589 2003-05-O1
Tissue ~ RNA sigm;r~"w (+) sine kb l Relative intensity
Brain
_. _ . . .._ _ . .. .__ ._ _,._._.._
__ ....._ ____._...._._.___ _. _ _._. ..
Heart + __. _.___ _. _
2 _0 ;+++
Skeletal muscle-_._+..__....2 ~~ _. ._r_ _.__.
__._._._.__
Colon..__-._r-______.~__+--_2 _o -.. __.__.__
._ ...-
._-
T hyr a ~ __ _ . (~ _ . . - _
__ __ _ _ _ + . _ -_ _ .. _..___
__. _. .
. .__-
2
spi_~en__-___ _~.__-_ __ _-_. _ ~-___
_ _ ____ _____..__. _.-
___
;.___-
Ll~er I
_ _ +.._._. ' o . _._...___
_.Smal _i _..intest:ine _ _ _.~__ _._._
..___ ___
~ Placenta __ ~ . __ __.._.- _~.~._--____-
__ __-._..._
._ ._. _ _... . . _ _.... ". __
_ _ __ ;_ __._ _ '~._.._
_ ____ - _ __
Lun~;
LivE~r-_____ _~-~_.~_.._-_ .___-__~~.._-_
__.~-_____. ___
Table 8
Tissue ' RNA sign<~1 t~) and Relative intensity
size kb
Spleen I
__ __ ...__ ._-r______._ _ ___ -_ _ -__-
- _______.._ __ _ _ __. ..
Thymus ._
_ _ _ _ _ .....___.__.. _. __ _ __ _ _.
_ ___ ......_ _
Prostate !+ 2.J +++
'I est i ,~ f+ -_ 2 ~- ~rr~i -
-_ 2 . 5 .__
Ova:wy __._ . i+ 2 :~. _.._.__. ..
-. _ __ . ___. __
__ -. . _. _ ___. ,.._.._
_ _ __. _____ _.. ._ _
__ . _ ... __. .
ISma.: inte~m.ne_ ~ Z.0
+ +++
~
___~_ __._. ~; _ _.._-_ I
__-__...__. _._ _.. ___ -_~_...-
__
Colon + 2 +
.U I
PBL,_ .. _ _ _ , .... _ _.____ l_..
_ . ._.. __ _ _ _ ,. __.
__. __ ._
..___.._ . .
'fabl a 9
EXAMPLE 11
Generation of monoclonal antibodies for free PSP94, bound PSP94 and
70 PSP94-binding protein.
Antibody generation
Vhe ~:runurlization scheme desc:c.ibed he rein was developed to promote the
production of antibodie:.= to e~pitopes of PSP94 that are exposed whe:~r
OS i~oun~3 ~:o a PSP94-bindinc protein.
7?

CA 02426589 2003-05-O1
Four Balbic mice (identified .~, b, c and d) were immunized
subcutaneousiy wit.i: i5 microgr-ams each of a (substantially) pure
PSP94-binding protein (i.e., his preparation also contains PSP94)
preparation in Tit:erMaxT"~ adjt.vant.. Twenty-one days later., all mice
7 were given a second boost and after a further 8 days, the mouse serum
was tested for reacti.vit;r for bot:,li P~>P94 and PSP94--binding protein in
the ELISA screening assay des:gibed above. Since the purification of a
PSP99.-Lvindmg protcrln in.rolve:, saturating all the binding sites with
PSP°>, tl:e sera cf the a.,imals irrununized with the
substantially pure
If) PSP94--W ndi.ng prot:.emn pr=parar-ion, te_>t.ed positiva:~ f. or both
antigens.
Mice a and b were boosted intrva-perit:oneally with a further 15 ~tg of a
PSP94-binding protein with no adjuvant. The remaining two mice (c and
d) wE:re boosted subcutan~~ousl.; wi.t;h a :Further 15 Elg of a PSP94-binding
17 protein together wi th 15 ~tg of native PSP94 in Titer MaxT~" adjuvant in
order °~o increase r_he iikeii.h:aod of obtaining ant.;.k>odies to
exposed
epitopes of PSP94.
After- a further 4 days, the spleens of mice a and b were harvested,
?~ the fi lymphocytes collected, end f_used with NSO myeloma cells in order
to generate hybridomas (~alfr~ G. and Milstein C, Meth. Enzymol. 7:!:3-
46, 'i.9~1). A hundred thousan-3 spienocytes, inn Iscove's MIJM select=_on
medium (supplemented with 2U~ FBS, HAT, 10 ng per ml interleukine-Ei,
and ~neixic:~tLCSj , sere plated ir_t:o each well of 9>i well_ plates. Sunce
?5 antibodies are secreted from the cells, cell cultm a media (i.e.,
supernatant:) rnay be harvested for characterization of the anti.bodises
produced. After 10 days of incubation at 37 °C, the supernatants of
wel.~ contaim!ng clones were assessed by an ELISA screening assay (see
bellow). Clones p-roducing antibodies showing a positive recognition
.30 (binding) c~f the PSP94 c:r PSP94-b.ind:ing protein plates and free of
unspeclfrc binding to PBS coated plate, were selected for further
inve:~ta.gat:i-on and characterization.
Desired (pos:itive) clones were. plated into 6 well plates. The
_~5 supernatants were re-tested for the presence of the specific antibody,
and those of th a clones wemainin g positive were passed through
succi~ssive cycles of cloning by limiting dilution, Cloning in such a
rnann~:r insure t:hat the Oryboi.cLoma cell. Li-ne pr~~< uced is stable and
Yu-_e . ~y~irally , two cy:~les ~f cloning were necessary to achieve this
ail goaa , Muit: Lpie orals c>f fr;~zen stocks we're pr<~pared, with one vial
7~3

CA 02426589 2003-05-O1
from eacr batch tested for m abi:L:~.ty and antibody production. Results
of clone characterization are illustrated in table 10.
7 EXAMPLE 12
Antibody Characterization
EL3S.r1-based bybridoma screening assay
~n o~der rt_~ e~ramate r_rn-.~ tlt~~r and the specific:~.ty of the antibodies
produced from mice or from tt.e hybridoma generated from mouse B cells,
an EhISA screening assay was .iev<:l.oped.
Briefly, microtitre plates (Nuns, Max.i.Sorp) were coated with 10~ ~tl
~liquo'~s oi: either native PSP94 (isolated from human seminal plasma; 5
~g,~rr,3 in ,~.1 M sodium cart~onate pH 9.6; or w-ith a PSP94-binding
c~rotei~-~. t0.1 ).Lg!ml lm 0.1 M P-;aHCC),3j or phosphate buffered saline
(PBS;
14U mM NaCL 10 mM sodium pho>phate pH i.5) overnight at 4 °C. Plates
were blocked for 1 hout~ wi.t.-1 a solution of 1~ bovine serum albumin
(BSA) in phosphate buffEv.red :saline at-_ 34 'C (BSA allows the saturation
~() of the binding sites an<~ lim:_t unspecific bindin~l to the plates) . The
plates (wells) were then washed in PBS containing 0.1$
polyoxyet:hyylene-sorbitan nonal.aurat;e (PBS-'_ween) , prior to
apps- c ~tion of t::e mouse serum samples, or h,.rbridoma supernatants
di'iur_eci Ln ~:~.5~ BSA. '__~he pl_ates werf': ~ncubatec for :l. hour at _34
'C
~5 prior to application ~f a 1:1000 dilution .n PBS 0.5'G BSA of
peroi:ida:~e <:on;juqated poLyc..ona.l r;~bbit immunog:Lobulins recognizing
mouse inununoglobu~ins. (rabl.it anti-mouse IgG peroxidase). After a
further L hour ir_rubatitm at 34 ''C the plates were extensively w~.shed
in PBS Tween, prior t_o development of the ;~eroxidase signa7_ in
3(7 ~~t, 3 ' . s -'~'etrwametny:ibenzidine ~;'hMB) . Aft=er 30 minutes the
opt.lCa1
:~E:nS _ ~~% at °J 5l! rim wa3 rE'~iCl lIi a In:iCYO pi.at.e reade C .
Antibody purification.
.~5 L~Iousf_ TgGi. monocion.al arlt.it:odiEes were puri.fieci using a high
salt
protein t~ procedure as ciet-_aiued in Antibodies: A Laboratory Manual eds
I-Iarlo~n~ and Lane, Cold Seri lg Harbor Laborator-~ (for reference see
above l .
7~

CA 02426589 2003-05-O1
Aatibody Isotypiag
Isotypi.ng was performed using a Mouse Monoclonal Antibody Isotyping
Kit (Roche Diagnostics Corporation Indianapo)is USA). This kit
provides information re7.at..ing to the class (IgG, IgA or IgM) the type
J of l~.ght chain (kappa or' lambda) and IgG subtype: (IgGI, IgG2a, IgG2b
or IgG3). 'Phe antibodies tested were mainly of the IgG1 kappa
subtype. :~towever; one antibody was shown to be of the IgM kappa
?,
subt~°pe. (B26~ 0) .
l0
Relative Epitope Analysis
ELISA plates were coated aitlcer with a PSP94-binding protein or PSP94
and blocked as described above. Appropriate concentrations of the
w,~~tnylat:-'d antibodies X>rex.ared as <iescuibed above were incubated
i3 wit. cite c~:~ated plates _n ths: presence or absence of a 50-fold excess
of a panel of unlabelled antbodles. Competition with the unlabelled
antiL~o<.iies imdi.cate:~ e:pitoxes that are shar~~ci between the two
antibodies. Lac:K of comp:tit.ion indicates independent epitcpes.
Resu;.ts c>f epitope analysis are illustrated in table 10.
1)
C Specificity Class and Epitope
one shared
ATCC Patent
sub;~lass with Depository No.
2B10 Binding IgG,k 9B6, 3F4 __
protein
_ _
1B1~ _. finding--__._-. IgG;k__ - _._ __-
. .__ nique --
u
prot_e~.in
_.._ __-___._... . . ..._.__ __.-__
_.. - . .._.___. . -____.
-
_.
9B5 f3indi.ng IgG h ~~~
~'
~F4
protein
_ __ _
_ TBindi.ng . Ig~ h-- p _
1759 --~ . ___ ~Inique TA-4243
- --
prote i.n ~
_
3F~._ _. _....____._.~~1.()
._ .. .~ ._-9B6 --_.___
p rld .ng __ . . .._._- i-PTA-4242
__ __._-
~, r O ~ E' I
L II
YSCL__,..-)-_~-rid.i.ng__-__.... .;.. gG rUnique.__.____~____-
_.-_
h . . _._ -_---_..
_ , pr_otEain l
- _ +__-_ __._ _._.____..... ._~ --._
~ .. __._ .
-___ -
~
B3D1__3i nd IgG,t. _.
ing
protein
~
26B1p.. ~I_ridlng_-.____-. _. . __ _ _._._ . ___
. ._.___ ...__. _.___,-...---._...
__ _. r _
pr . __
ot_ein _ _ _ ...-. _~-- ..._.v
. _. --_
_- .
-
_ _ . Unique pTA-4240 -
2D3 ~;ree ~
-_ PSP94 Ig~
__-_._.__.
_ _.__ ...
1E~.__. _~~.ee.-(~nd_____-__ l Uni.c~ue..-..__._ PTA-4241
_. __ l - _
l TgG
bound (t.otal)E !
l psP94 l ~
_ __
_ _+_hr.ee PSP94~~Ig~ K * ~Jnique __~t _ -
i~'C5.- __...
Table 10

CA 02426589 2003-05-O1
Antibody Biotinylation
The ciiluent. (buffer) of the Faurif:ied antibody was exchanged for 0.1 M
NaHCC<3 buffer pH 8.0 and the X:rotein concentration. adjusted to 1 mg/ml.
A 2 mg/m1 solution of l~i~timamiciocaproate N-hydroxysucc.inimide ester
was prepared in DMSu and an appropriate volume of this solution was
sdde~a. t:e the ar_tabody ° o gi ~e either <~ 5, !.0 ~>.r 20 fold
excess of
biotinyiatirrg agent. 'this was incubated on ice for 2 hours witYr
occasional agitation before Un equal vo.lume:~ of 0 '~~ M glycine in 0.1 M
NaHCC~,.was added to give a firal concentration of 0.1 M glycine.
1 ()
After one further hour incub.~tian on i.ce, the antibody was separated
From tt:e free bi.otir~ylai ing zgent: by c3e1 filt-_rat ion using a PD10 gel
filtration column (Biorzrd). 3iotinylated antibodies were stored ,~t 4
_ =-r~ -a=th 0.i)5$ s<_~dmn azr~~e added as preservative. The optimal
IS extent of biot.i.nylation and aptima.i usage concentration of the
iaioti.nylated antibodies was d.-~termined on antigen--coated plates.
Western Blots
?() rntibodies were assessec:by l.~lestern blot. Briefly, 0.2 micrograms of
;substantially) purified PSP~4-binding protein, or 25 microliters of
part:a.ai i;.~ kpure PSP94-bir:ding pr~at~eir. were run on 7.5 $ SDS PAGE gels
under° r:or_-reducing cond.i t-won:. fhe prwteins were transferred to
PVDF
membranes, the membranes were blocked wi_t.h 1$ BSA, probed with the
?> hybrvdoma supernatants at a c:!ilution of 1:5 (in PBS/0.5$ BSA), and the
bounc.i antibody way; det:ect.ed witk~. an anti-mouse i.mmunoglof~ulin
peroxida~~e--conjugate raised in rabbit. 'the signal was developed in
0.05n ~Iiaminobenz.idine 0. C1$ aydrogerr peroxide.
3~
Specificity of PSP94 antibodies for ~ree or total PSP94
Tn o:°deer to further characterize the specificity :~Y the
antibodies
c~ene:~at.eci herein, an assay was developed to determine if the
monoclonal antibodies recognize PSP9~~ in its free form and/or when it
~S is bound to a PSP94-hin<.wing protein.
ir: u:~der tc:~ :pronuoc:e she fc>rmation of a fSP94/PSP94--binding protein
comp:_ex, the cwo isubstant:ialiy or partially) purified proteins were
pre--~nruUat.ed together. Br:ieEl_y, a partially pure PSP94-binding
4~ protein preparation (see example 4), at a concentration of 1 mg/ml
7~~

CA 02426589 2003-05-O1
(total. protein eoncentramon) in PBS containing 0.5$ BSA was pre-
incubat=ed foxy 1 hour at 34 °C witYx or without 5~tg/m1 of native
PSP9~E.
An ELISA plat=e (96 we~l1 plate was coated w=ith 17(;9 monoclonal
antibody at a concentration o:: 2Eig/ml (in 0.1 M NaHC03 pH 8.0) by an
cover: i.ght incwbati.on at 4 "C. As described herein, this antibody
recognizes a PSP94-bindi.-rg protein. Wells of the plate were
subseduentl.y blocked wita 1~ BSA for l hour at 34 ''C. The
PSP94/PSP94-binding protein complex generated above was incubated with
the 1709 coated plates f~>r 1 your at 34 "C before washing off any
unbound material. The plates were then incubated with biotinylatetl
PSP94-specific ,~nt:ibodiea (?. ;,tg/rn:1 in PBS 0.5'~ I3Sh) . Any positive
binding «f t:nese antibodies w:~ulci indicate r_hat the PSP94 epitope t=hat
l s rE~cogr~ized is exposed Lava i_ lab.le) even when bomrrd to a PSP94-
!5 bindinc; iarotein. These resents <rx-e l l:iustrated in table 10. Binding
of tree blot:irzylate~d fSP94-spe-~ific antibodies to ~~he bound PSP94 was
visu.nlized with a streptavidi.n peroxidase system and developed with
TMB diving a blue color.
?() P:esu.lts illustrated in figure 11 indicate that none of the antibod:_es
tested react with captured PS?94-binding protein when the binding
site:r are riot saturat=ed with eSP94. When the birnling sites are
saturated with PSP94, P1E8 shows strong reactivity towards the
c:omp:Lex.. However, 2D3 and 1'1,::3 do not. 'thus, PI_:8 recognize bound
?5 and Free PSP94 and the other Two antibodies (2D3 and 12C3) only
recodrm.zc, the fret= form of the prote:i.n. Antibodies 2D3 and 12C3
probably recognize a PSP94 epitope that:. is masked when it is bound to
a PSl?94-binding protein. Each of these antibodies detects native <ind
recombinant PSPS4 when coated onto ELISA plates. All three antibodies
30 f_uncr:.ion a:~ ~~apt.u:re or detect:~r antibodies in san~3wich ELISA
formats
to produce a linear standard ::urw~e o~~er a useful range of
conce:.nrr~iti.ons of PSP94. How4~ver, 13C3 appears t.~ be of lower
affinity than 2D3 or P1E8 toward PSP94,
~5 The nt~lity of these antibodies to detect PSP94 was illustrated in the
~c'~ 1:>w~n., assay; ,gin ELISA plate was coated with 5 )tg/ml of PSP94 in pH
<ic carbonate buffen ants incubated overnight at 4 "C. The plate was
blocKecl wit.:h :L~ BSA Eon 1h at 34 "C. Sample=s werfe then incubated in
the p.latc: overnight at 4 °C. ,T3i.otinylated P1E8 was applied at 1
4~ microgram/ml pox' 2 hrs at 34 "C and peroxidase stmeptavidin was

CA 02426589 2003-05-O1
appliec9 fox L h at 34 "C: befo-e development in fMB. The lower limit
of quantification (LLQ) was shown to be in the range of 1 ng/ml. It
is of particular interest tha; the a:>say (e.g., standard curve) may be
performed wick natal a PSP94 (i.e., PS P94 isolated from human serum) or
:~etcrabi.n~nt PSP94.
EXAMPLE 13
Free PSP94 Immunodetecti.on assays.
The ~.hx-ee PSP94 monoclonal antibodies described above (2D3 (PTA-4240),
P°1E8 (PTA-424~~, W.C3), may be used n competitive ELISA assays
(i.e.,
coat ;.no z>iat:.e:; wlt=u PSP94 (or sample , and ,.sing rLue PSP94 within
t:he
samp:e to inhibit the bincing of the monoclonal ar~t,lbody to the PSP94
l5 coated platesi. The use of 2..73 in a competiti-ve :LISA format was
investigated.
An e:~ample of an ELISA assay to measure free PSP94, involves coating
the I~L1SA plates with the 2D3 antibody. ~1'he coatc;d plates may then be
?~ incuoatec: s~~lth =samples, and P.SP°4 mar be detected with
biotinylated
IEb, airce 2D3 and P1E8 recognize different F~SP94 epitopes. Figure
1.2b :rep resent results of an E::~ISA assay using the method illustrated
in figure 12a.
~5 In order to limit the passibl'= dissociation (e.g., promoted by 2D3) of
t:he PSP94/PSP94-binding protein comp:Lex during the ELISA assay,
impr«vements were introduced. Brief:Ly, the improved assay involves
pze-:~bsot~p! iori ;xemc:~rali of t:ne PSP94/PSP94-binding pr«t:ein complex
~~~ith 3 P;~P~4-blndlnc protein ~ntW od_a~ s~>efere ~~erf:~rming the assay.
.3~ 'rhe PSP9~i-binding protein ant ibodies se:Lective~iy remove PSP94-binding
protein and the PSP94/PSP94-i':inding protein complex (i.e., bound
PSP94). This is done w.itLuout upsetting tl'e ki.neti,cs of. the
equilibrium reaction between a PSP94-binding protein and PSP94. Pre-
absorpt~ion care be done with, for- examp:l.e t:he 1769 :L. inked to a
~S sepharose matrix, giving t:her: a sample that is free of the complex
.;,u~;,~:>u,-rd PSE?94 rema;ns) . The sample ~s t:hen processed as described
ax.~ove ~i.e., incubating the complex-free sample with the plate coated
wi. t1i 2D3 and detecting with ;; iotinylated F~lE8 .

CA 02426589 2003-05-O1
EXAMPLE 14
Total PSP94 immunodetection assays
Since :ne i~1~.S antibody is able 2:o recognize PSP94 both in its free
and k>ound form, an assay to rr:~asure t=otal PSP94 has been developed.
For t.xample, P1 E8 i.s immobili:~ed 2:o the plate and ,=r sample containing
free PSP94 an<i PSP94 complexe:3 with a PSP94--binding protein is added..
The PSP94 and the complex retrains bound to the antibody and an
antik~ody hav:irtg a different affinity (a different binding site on
PSP9~~~ than: PEES may be added. An eaarriple of sucz an antibody is 2D3
or a!.~y other auntaple PSP94-aztit.~ody. Detection is performed by using
a iabea. t: hat rnay be con_~ugate.~ to 2D3 or by a sec3ndary molecules
tant,rbody or protein] recognizing directly or indirectly (e. g.,
15 biot:i.n;avid:in or streptavidin systeml the 2D3 antibody.
Howe~rer-, based on the observation that 2D3 might disturb the binding
equi.~:ibriurn between PSP94 and PSP94-1:>inding proteiru, the assay to
measure total PSP94 (bound ar,~3 unbound? was impro=red.
Part.~.cul=rrl.y, the assay wa.s p~arformed as illustrated in figure 13. In
figur:°e 13, toi=al PSP94 is captured w:it}~ the Pi E8 antibody, and a
high
concenr.ration (excess)of biotinyl.ate<i .?D3 is used to encourage the
dissociation tdisplacement> cf a PSP94-binding protein. In the
25 previ_o~ay described assay, t~le actual concentrate<>n of 2D3 for
coatLng t-hae p:'~.at.e is low as the p:Las~:,ic has a cap.:~city of no more
than
5C nr,.
Note, chat this assay may also measure free (unbound] PSP94, if the
3~ complex iPSP94iPSP94--bin ding prot:einl is adsorbed out from the serum
pr l o ~~ ?;o measurement. .
Example 15
PSP94-binding protein Immunodetection assays
Specificity for all the PSP94-binding protein antibodies has been
confi.rrned .in the ELISA assay discussed previously, and by Western
blot. Each of them recognizes both the high and low molecular weight
~ form of the binding protein xy western blot.
7'

CA 02426589 2003-05-O1
As shown ir~: table i.0, thw antibody 1;'G9 recognize a different epitope
'~'::ar. 3;~'4. 't'hus a sandwirl~i ELISA assay, as illustzated in figure 14a,
nas been developed using thes.~ two antibodies. F:pure 14b illustrates
a standard curve from thw~ assays used to measure a PSP94-binding
protE~in within serum sam~l.es. Norse that these two antibodies may be
interchanged. For example, t.ze capture antibody ~~an be switched to be
used as detection reagent (wh4.n -labeled).
Forty serum samples from male donors have been assessed with a PSP94-
(tJ' b.ir~d~ng yrc~tein ELISA assay d.:>scribeci above (ill.ustrated in Figure
14.. T:~:e =?SP94--binding prot:~in ~;erum concentrat_:on was successfully
measured. 'laiues of PSP94-binding protein in these male donors ranged
from about ~ pg/ml to about 1:) Nc;iml, with two c:a::>es having in excess
of 2Ci ~giml. Two cases from remain donors have been assessed; one has
15 about 3 )tg; ml, the other abound 7 . 8 Etd/ml..
Example 16
Immunodetection assays application
Male human .serum sample=s wi:~h known total PSA values were obtained
from a reference standard laboratory. Forty cases had low total PSA
serum levels (<4 ng per m1) and b9 had hi<~h total PSA serum levels (>4
ng per ml) . Analysis was pe:.~formed orG tt:ese low and high categories.
~S ~;,her~~ ~s no traceable i ink t ack to these patienr_s, thus, there is no
c~ ~:!c~l tnformati_or. associUted wit-h the specimens, except for the
total PSA value. The purpose of this analysis _~ to look >=or trends
and patterns rather than determine the clinical relevance of PSP94
measurememt.s. The distvibutions of the serum concentrations of total
30 PSP9~1, PSP94-binding prot:eir, tree PSP99 and corrected free PSP94
are rllustz-ated in additional figure:-; described herein.
Wi~~~r: respe;:-t ~o addi tior:a.i figures,-
~5 T' l g~:,'"~' 1'> A. Lc 3 gT-apll 11 1u;; trat l.ng reSUl tS tnbta 121ed
follOWirig
measurement of total- PSP9~. i.r serum of individuals for which PSA
values are known to be lower or h:igh~~r than the cut-off value of
4ngirnl and using an assay as illustr,~ted in figure 13 and described in
example ~4. Results are expres:;ed a;s t:he l.og of total PSP94
concf~nr~rat;_on ( ~ n ng%ml ) mea4°.urod for each indivi:~ual . Each
point
~r~pr:~se~ns: .-esulr.s obta~r.eci fc.r a specif is ind:imdual. With respect
to
$I)

CA 02426589 2003-05-O1
this figure, total PSP94 conc-.~ntration of 1. to 22'>0 ng/ml were
measured it serum of _ndavmdu ~l s.
Wlth respect to figure 1p B, :=his figure is a graph illustrating
resin is obtained following me isuremer~t ~.of free PSP94 in serum of
individuals for which PSA val..es are known to be ower or higher than
the cut-off =.ralue of 4ng!ml. Result=~ were obtaineed using an assay
whicr-: i.s based on the removal (deplet.ion) of PSP9~1-binding protein and
PSP94 / PSP94-bi.ndincg protein c::~mplex j rom serum! us ing an anti-PSP94--
i0 bindng protein antibody as d~acribecz herein prioa:~ to measurement of
f~Po pSPu4 mth the 2D3 ~.~nd PtE8 monoclonal antibeciies in a sandwich
ELISA assay. F:esults are expr:~ss<m9 as the log of tree PSP94
concentration (in ng/ml) rreasfired for each individual. Each point
represent, results obtained fog a specific individual.
IS
tr~ith respect to figure 25 C, vhis figure is a graph illustrating
resin is c:~bt_ained following measurt~ment oaf total P;.71!94-binding protein
i : ser~,~m oindividuals for w;nich PS1~ values are known to be lower or
m gher than the cut-off value of 4ng;'ml. Results were obtained using
?0 an assay w:;ich is illustrated fir figure 14a and described in example
15. results are expressed as vhe log of total PSP94-binding protein
concentration (in ng/ml) rheas~red for each indivi<fual. Each point
represent: results obtainec:. for a specific individ.~al. With respect t:o
this figure, PSP94--binding protein concentration ranging from 0.7 to
?5 1~5 rnic~rograms/m:~ ;were measum,d i.n serum of ir._divi<iuals.
With respect to figure 15 D, this figure is a graph illustrating
results obtained following correction of the free PSP94 concentration
obta_ned in serum of i.ndiwidu,~.l.s for which PSA values are known to be
30 iowe.~ c:>r hi.gher than the cut-:off val.~:e of 4ng/ml.. Results were
correctaed by taking into accc.unt. Thai= 7 to 5 ~ of residual
PSP94!PSI?94-b_Lnding prot:e:in c~mpl.ex ,remairi.s in the serum even after
deplt~tion whilst; may affect. tie resulvs obtain, i.e., PSP94 may be
dissociated from the cornpl.ex after the 2D3 antibody is added, falsely
~J incrf~a:~ir~a the "free PSF?94" walue~. ~er;ult.s are aya~.n expressed as
the
log of correc~~ed free PSP94 concentr,3tion (in ng/mi) measured for ear_h
indi~.~idu<~1. Each point represent reaults obtained for a specific
indi~.ridual. With respect to this fi'Iure., corrected free PSP94 levels
were s:igniiicantly elevated in the high P.f~A category (> 4ng/ml) .
81

CA 02426589 2003-05-O1
Fig;:re t , rs a graph illustr,.iting the total PSP94-binding protein
conc:entratlon (ng/rrrlj versus he C.otal PSP94 concs:.ntration (ng!ml)
measured in serum of individuals, where each point: represent results
obtaW cd for a specific indiv:.dual.. Wi.t.h respect t.o this figure, a
significant: positive .rel~ti.on:~hip between these t~ac3 parameters may be
observed.
All publlcatrons and patent applications cited in this specification
are r:erein incorpor_ar.ed by re:erence as if each irrdividu.al publication
i~) or patent application were specifically and indiv._c~lually indicated to
be incorporated by reference. The cit:ati.on of any ~>ublication is for
its disclosure prior to the filing date and should not be construed as
an acmission that= the present invention is not entitled to antedate
such publication by virtue of prier _nvention.
~lthoug. to fcregcing invention has been described in some detail by
way cat lilustlrat:rori and example for purposes of clarity of
undei~sr.anding, it rs readily apparenr t:o those of ordinary skill in
the <art: ~n ,Light of the teachings of this inventi~:m that certain
?0 chance;; and rnodi fications may be made thereto wit';lout departing from
the .spirit or scope of the appended claims.

CA 02426589 2003-05-O1
SH'Q~..ENCE, ~I.:)'IING
(1) GENERAL INFORMATION:
S (i) APPLICANT:
(A) NAME: PROCYON BIOPHAFMA INC.
(B) STREET: 1650 hRANS-CP,NADA HIGHWAY, SUITE:
200
(C) C.'I~s'Y: DO:~.VAL
( D ) STATE : ~7UEBE~ ,"
I() ~;F:) COUNTRY: CANA;)A
(F') POSTAL CODE: :I9P 1H7
T-'I'LE i:)I ITJVENTI:ON P~P99 ciiag:~ostir-
reagents and assays
i:i ) NUMBER OF SEQUEIVC ;S : ~~
i
:iv C'.OMPUTEIZ READABLE '~ ORM
)
~S (A) MEDIUM T~~PE: floppy disk
(B) COMPUTER: IBM PC compatible
(C') OPERATINi:> SYS :'EM: PC-DOS/MS--DOS
(L)) SOL'T;nIARE: Pat en t:Iri
O (v) CURRENT APPLTCATION DA'PA
(A.) API~LICATION N'.TMBF:R:
(B) FI';,INt; DATE:
(C) CLASSIFI~ATIO:J:
~S (m ) PRI=OR APPLICAI'I_ON :)ATA
-
ICATI:ON N:JMBE~R: C:A 1, 391, 438
(A) APPL
(B) FILING DATE: ?002-06-25
(C.') CLASSIFI:~ATIC':~d:
3U (vi) PRIOR APPLICATION )ATA
(A) APPLICATION N'.JMBER: C.'A 2, 380, 662
(B) FILING DATE: ?002-05-01
(C.') CLASSIFICATIO,Q:
.i
S
~.Tni~ ~,?ATTORNEY/PATENT A~;EN'L' INFORMATION:
(A ) NAME : Bi~OULLET~'E KOSIE
(B) REGISTRATION NO.: 3939
(C) REFEREN~E/DOCKET NO.; 06508--048-CA--03
(D) TEL. NC..: (514; :397-8500
(E) FAK NO. : (5~4) 397-8515
~S
(2) INFOF;MA'iION FOR SEQ ID NC.: 1:
(y SEQUENCE CHARACTERISTIC'S
(A) LENGTH: 2(:05
(13) TYPE:: nuclelr acLd
(C.') STRANDEDNF;SS: single
SO (D) TOPOLOGY: lir.~ar
(i:i) MOLECULE TYPE:: cDl',:A
( i ii ) HYPOTHETICAL:
;i~.,r) ANTI--SENSE:
>S ;v.~ r'RAGMENT TYPE:
;v'..) GRLGINAL SOUFCI;:
~v::a? IMMEDIA'T'E SCLJF~CE:
v~ i ': ; POSITaON IN C)EN<.~ME
( A 1 CHROMOSOME: / SE.GMEN'I'
~0 (B) MAP POSITION:
(C) UNITS:

CA 02426589 2003-05-O1
ix ) b'EATURE
(A) NAME/KEY:
(B) LOCATION:
(C) IDENTIFICATIO~~d ME'PHOD:
(D) OTHER IN~ORMA':.'ION:
(x) PUBLICATION IN~'ORMA LION
(A) AUTHORS:
(E3) TI'CLE:
( C" ) ,JOURNAL
~() (.D) VOI:~UME:
('E:) ISSUE:
(F) PAGES:
(C=) DACE:
( H ) DOCUMENT NUMB:,R
IS (I) FIi~ING DATE:
t1 ) I?Ui3L ICAT I0N Di~TE :
(f;) RELEVANT RESI7UE 1:N SEQ ID NO.:
1:
!xi) SEQUENCE DESCRIPTION: SEQ ID NO.: 1:
atgcacggct cct:gcagttt cctgatgc-tt c:tgctgccgc tactgctact gctggtggcc 60
accac~aggcc ccgttggagc cctcacagat gaggagaaac gtttgatggt ggagctgcac 120
aacct:ctacc gggcccaggt atcc:ccgacg gcct:cagaca tgctgc::ac:at gagatgggac 18U
3U
gaggagctgg ccgccttc;gc caaggcctac c3cac;ggcagt gcgtgr_<~ggg ccacaacaag 240
gagcgcgggc gccgcggcga gaatctg~tc gccatcacag acgagggcat ggacgtgccg 300
ctggccatdg aggagtggca ccacgag~~gt gagcac:taca acctcagcgc cgccacctgc 360
agccc~aggctc agatgtgcgg ccactac;~co cag<~tggtat gggccr~agac agagaggatc 42.0
~5 ggr~t<Jrggt:t ccc~acttctg tgagaag~~tc c:agggt:gttg aggagr~ccaa r_atcgaatta
480
n
ctggt~gtgca actatgagcc tccggggaac gtgaagggga aacggr-ccta ccaggagggg 540
actccvgt.gcvt vccaatgtcc ctct ggctac cacngcaaga actcc:,tctg tggtgagtcc 600
acgggtggat gg<:cccccac gcgcagccac tttggcgccc tgtcgttcca agtggccgga 660
tttcaaccct tcaaagggag gatgttagaa agtctggcgg cttcgggggg gcccgcgcga 720
45 gaacccatcg gaagcccgga agat.gctcag gatv::tgcct:t acctggtaac tgaggcccca 780
5~
tcctccggg cgactgaagc atcagactct aggaaaatgg gt:actccttc ttccctagca 840
acggggat.tc eggctttctt ggtaacUgag gtc'caggct ccctggcaac caaggctctg 900
cctgctgtgg aaacccaggc cccaacttcc ttagcaacga aagacccgcc ctccatggca 960
acag ~ac~c~.=c caccttgcge aacaactgag gtc~~ct.:tcc:va tr_ttggcagc tcacagcctg
1020
cc:ct~ct_tgg atgaggagcc ac~ttacc~ttr ccc.~aatccJa cccatgttcc tatcccaaaa 1080
6~
tcag;-aga~ca aagtgacaga caaaacaaaa gtgccctcta ggagcccaga gaactctctg 1140
gaccccaaga tgtccctgac aggggc«agg gaa~tcctac cccatgccca ggaggaggct 1200
gagg:~tcJagg ctgagttgcc tccttcc agt gag~,Itcttctg cctcagtttt tccagcccag 1260

CA 02426589 2003-05-O1
gacaagccag gtgagctgca gg:cacavtg gaccacacgg ggcaca~cctc ctccaagtcc 1320
ctgcccaatt tccccaatac ct~tgcc'.acc gctaatgcca cgggtc.~ggcg t:gccctggct 1380
ctgcagt.cgt c<:ttgccagg tg::agag;lgc c::ctcfacaagc ctagc<,~tcgt gtcagggctg
1440
aact:gggcc c.=ggtcavgt gt~gggc:~ct ctcctcxggac tactgc:-t cct gcctcctctg 1500
r~i gv.~tt.g~acrg gaatcttc~tg aaggggatvac cact.caaagg gtgaac;~aggt cagctgtcct
1.560
1S
cctgccat<_t r~c~cccaccct gttcc:ca.Icc cctaaacaag at. act.!::cttg gttaaggccc
1620
tccgc;aaggg aaaggctacg gg:3catgrgc c:tcatcacac catccatcct ggaggcacaa 1.680
ggcctggctg clctgcgagct caggagg::c:g r~ct<~aggact gcacac:cggg cccacacctc 1740
tcctgcccct ccctcctc~ag tc~tc~gg:~gt gggaggattt gagggaagctc actgcctacc 1800
~U r_ggcc~tggctg ctgtctgccc acacagc~tg tgcgctctcc ctgag?~gcct gtgtagctgg 1860
ggat~;g~,Jgat rcctaggggc: agatgaa;Iga caac~ccccac tggagtgggg ttctttgagt 192.0
gggggaggca gggacgaggg aaggaaa~ta actcctgact ctccaataaa aacctgtcca 1980
acctgtggca aaaaaaaaaa aaaaa 2.005
.3n
! ~ 1 Ir_NRORMA'T.'ION FOR SEQ ID NC . : -? :
SEQUED1CF CI-TARACTERISTICS
(A) LENGTH: 5C6
Z$ (B) TYPE: amir_o aphids
(C') STRANDEDNE;SS:
single
(D) TOPOLOGY: lir:~ar
(ii) MOLECULE TYPE: PRC'I'EIN
O ( i ) HY1'OTHE'rLCAL
i.
i
t iv') AN'T'I--SENSE:
1 v F RAGMENT TY PE
>
cvi) ORIGINAL SOURCE:
!v~i. ) IMMED~_A'I'E SC'UF;CE:
-~.S ivW ~ f.'OSI'I'ION In GENC~ME
(A) CHROMOSC~ME;/SLGMENT:
(3) MAP POSITION:
(C) UNITS:
(ix) FEATURE
SO ( A ) NAMH~ / KEY
(~) LocATZOn.:
(i~) IDENTIF1CATI<iN
METHOD:
(. D; O'~ HER IA:FORMF.'rION
i x ~?(JBI~TC:A'I'ION INFI),R~,'I':ION
i
=i; At;':':~ORS
i 3i I'7Tl,r.,:
( = ) JJURI'~AL :
()) VOLLrME:
(E) I:pSLIE:
E1U ( F ) PAGES
(a) DAT1::

CA 02426589 2003-05-O1
( H ) DOCUMENT NZ1MBER
(I) FILLNG DATE:
(J) PUBhICATIOtJ DATA;:
(K) RELEVANT R-:~SIDU:' IN SEQ ID NO.: 2:
S
(xi.j SEQUENCE DESCRIPTLON: ;EQ ID NO.: 2:
l~ Met riz:~ i:~ly Ser Cys Ser Phe Leu Met Leu Leu Leu Pro lieu heu Leu
1 5 10 25
Leu Leu Va'.~ Ala 'lhr Th:r Gly Prc Val Gly A1a Leu Thr Asp Glu Glu
IS LO 25 30
'_.ys Arg Leu Met Val Glu Leu Hi:.; Asn Leu '1'yr Arg Ala Gln Val Ser
40 45
Pro Thr Ala Ser Asp Met Lr~u Hir. Met Arg Trp Asp Glu Glu Leu Ala
50 5.'i fi0
Aia Phe Ala Lys Ala Tyr ALa Ar~,1 Gln Cys Val Trp Gly His Asn Lys
65 70 75 80
~() C>lu Arg Gly Arg Arch Giy Glu Asn Leu Phe Ala Tle Thr Asp Glu Gly
85 90 95
Met A:~p Val Pro Leu Ala Met Glu Glu Trp His His Glu Arg Glu His
35 loo 105 llo
4~?
41
'C~~r Asn Le~u Ser Ala Ala 'I'hr Cy°s Ser Pro Gly Gln Met Cys Gly His
1 L5 1;:?0 125
Tyr Thr Gln Va1 Val Trp Ala Lys Trr Glu Arg Ile Gly Cys Gly Ser
130 ~ 35 1.40
His Phe Cys Glu Lys heu i~ln G.:y Val Glu Glu Th.r Asn Ile Glu Leu
145 150 155 160
Leu Val Cys Asn Tyr Glu aro Pr-o Gly Asn Val Lys Gl.y Lys Arg Pro
165 1.70 175
~.;~~r C>lr ;~;17.; ~.:,iy ~Ch.r 'Pro ,~ys Sk:er G1n C:ys Pro Ser G:y Tyr His
Cys
1 8C ~E35 ? 90
Lys :'~s:: Ser LE:u Cys Gly Giu Ser Thr Gly Gly Trp Pro Pro Thr Arg
?.9'_i 200 205
86

CA 02426589 2003-05-O1
Ser His Phe Gly Ala Leu Ser Phe Gln Val Ala G1y Phe Gln Pro Phe
210 21 5 2'20
Lurs Giy,r r~rr~ Met Leu Glu Ser Leu A1a Ala Ser Gly Gly Pro Ala Arg
2'?p 230 235 240
Giu Pro -~l~e Gly Ser Pro G)u AsF:a Ala Gln Asp L~eu Prc 'I'~~rr Leu Val
1~ 245 250 255
?U
Th.r Glz Ala Pro Ser Phe Arg Al~.a Thr Glu Ala Ser Asp Ser Arg Lys
'260 2&5 270
Met Gly Thr Pro Ser Ser LE~u Ala;~ Thr Gly :l:le Pro Ala Phe Leu Val
275 28(~ 285
Thr Glu Val Ser Gly Ser Lt~u Ala:c Tt?r Lys Ala Leu Prc, Ala Val Glu
'290 295 :500
Thr Gln Ala Pro Thr Ser L~:u Al,~ Thr Lys Asp Pro Prey Ser Met Ala
305 310 315 320
~T'rl- Gia Aia Pro .Pro Cys V~l Thr:- 'rhr GZ.u Val Pro Ser IIe Leu Ala
32'330 335
31
~C)
a~i.a H~ s Ser Leu Pro Ser L~eu As,;~ G.Lu G? a Pro Val Th-_- Phe Pro Lys
340 345 350
Ser '1'~nr Hs Val Pro I.Le Pro hys Ser A.l.a Asp Lys Va l Thr Asp Lys
3'~5 360 365
'.'hr Lyrs Val Pro Ser Arg Ser Px o Gl a Asn Ser Leu Ash hro Lys Met
3 ?0 3'75 380
Ser Leu Tl~r Gly Ala Arg Glu LE:u Leu Pro His Ala Gln Glu Glu Ala
385 390 395 400
Glu Ala Glu Ala Glu Leu Pro P:o Ser Ser Glu Val Leu Ala Ser Val
5() 405 410 415
ss
6!)
:~ri.t, P-~.~ A:L ~ Ea.r. ,ys g~ ~:ys er~:: G : y t:ilu Leu Gln AIa Thr Leu
Asp His
'' ~ :_ 'l .' S 4 3 0
Th:r Gl y His ':'hr Ser Ser lays S~~r Leu Pro Asn Phe Pro Asn Thr Ser
435 4-i0 4~ 5
g ~r

CA 02426589 2003-05-O1
Ala Trr Ala Asn Ala Thr Gl.y G1. Arg Ala Leu Ala Le~.i Gln Ser Ser
4'.i0 455 460
O ,eu rno W y Ala uiu Gly Prc AsE~ Lys Pro Ser Va7. Va I Ser Gly Leu
-~u5 470 475 480
~sn See: Gly P:ro Gly H_is VaI Try Gly Pro Leu Leu Gly Leu Leu Leu
1() 481 490 495
:e:u P.ro Pro Leu Vai Leu Ala G1y I1a Phe
500 505
1
(r) INFORMATION FOR SEQ ID NO.: 3:
I ) SEQUENCE CHARAC'TERIS:TICS
0 (A) LENGTH: 'v95
(B) 'TYPE: amino acids
(C) STRANDEDD1ESS: single
(D) TOPOLOGY: Lim=ar
S (ii) MOLECULE TYPE: PRO"'EIN
(iii )HYPOTHETICAL:
(iV) ANTI--SENSE:
( ~,) FRAGMENT' 'TYPE:
tvi) eRIGINAL SOURC_'E:
l) t vi 1 ) IMMEDIATE SOURCE
tmi I) POSITION IN GGNOI~IE
( A ) CHROMOSOME / SE( ~MEIV'I'
(B) MP,P POSI~.~ION:
tC) UNITS:
( ix ) FE:ATLJRE~
(A) NAME/KEY: Xaa
(B) LC>CA'I'ION: 507
(C) IDENTIFIc~ATIOId METHOD:
~; L~) OTHER IN7 ORMA'(':LON : x;aa may be any
amino acid ( a . g . ,
L~ Aia, Cys, Asp, c;lu, Phe, Gyy, 1-tis, Ile, Lys, Leu, Met,
Asn_, Pro, Gl.n,
Arg, Ser, ~.I'hr, 'Ja:, Trp, Tyr) ,
(x) PUBLICATION INFORMA?'IOLd
( A ) AI1THORS
~S (I3) T-~TLE:
( C." ) JOURNAL
( I) ) VOLUME
(F;) ISSUE:
( F' ) PAGES
JO (G) DATE:
(H) DOCUMENT NUMBER:
". .':r ~TNG LATE ~,
(:u) P;.~BL:LCA'IION LA'i'~':
(1<) R'vLEVAN'I: F:ESIDUE LN SEQ ID NO.: 3:
'~
(xi) SEQUENCE DESCRTPTIOn: SF~Q ID NO.: 3:
Met His Gly Ser Cys Ser Phe I,eu Met Leu Leu Leu Pro Leu Leu Leu
60 1 5 10 15
88

CA 02426589 2003-05-O1
Leu Leu ',f'al Al.a Thr 'f'hr Gly Pro Val Gly Ala Leu Thr Asp Glu Glu
20 25 30
S
Lys Arc, I~eu Met Val Glu Leu His Asn Leu 'i'yr Arg Ala GLn Val Ser
35 40 45
Pro Thr Ala Ser Asp Met Leu Hi" Met Arg 'I'rp Asp Glu Glu Leu Ala
50 5' 60
1~ Aia Pne Aia ~ys Aia 'I'yr Ais Ar<a Gln Cys Val 'lrp Gly His Asn Lys
?0 'J5 80
Glu Arg Gly Arg A:rg Gly Ga.u Asm I,e~ Phe Ala Tle Thr Asp Glu Gly
?U 85 90 95
Met Asp Val Pro Leu Al.a Met G1: Gl.t: Trp His His Glu Arg Glu His
100 105 110
'~~~r Asn Leu Ser Aa A.7_a Tar Cy:a Ser Pro Gly Gln Men Cys Gly His
1l5 1.2~) 12'>
3U
Tyr 'I'hr Gln Val Va.i Trp Ala Ly.s 'I'hr Glu Arg Ile Gly Cys Gly Ser
1'30 135 140
35 i3is Phe Cys Glu Lys Leu C:ln G1y Val Glu Glu Thr Asn Tle Glu Leu
L45 150 155 160
:~eu Vai Cys asn 'T_'yr: G~~u F'ro Pz o G:Ly Asr. Vai. Lys Gly Lys Arg Prc
D 165 1'J0 1'75
Tyr Gln G1u Gly 'rhr Pro l.'ys Scar Gl.n Cys Pro Ser Gly Tyr His Cys
180 185 190
47
Lys Asn Ser Leu Cy s Gly ulu S~er 'I'hr Gi.y Gly Trp Pr o Pro Thr Arg
195 2=)0 2t~5
>(~
:7er I.~~ =he ~-~y A'_a Leu ser Pue Gln ijal A1a Gly Phe Gln Pro Phe
' ?15 220
J~ Lys Gly Arg Met Le a Glu Ser Li,u Ala Ala Ser Gly GLy Pro Ala Arg
225 230 235 240
Glu Pro :elf-> Gly Ser Pro Gl.u Asp Ala Gln Asp Leu Pro Tyr Leu Val
245 250 255
89

CA 02426589 2003-05-O1
'tr :~1..: A1:~. Pro Ser Phe Arg Ala Th.r Glu Ala Ser Asp Ser Arg Lys
260 265 270
ME=t Gly Thr Pro Ser Ser Leu Ala Thr Gly Tle Pro Ala Phe Leu Val
274> 28C 285
I6 Thr Gl 'Jai Ser Gly Ser Leu A1~; Thr Lys Ala Leu Pro Ala Val Glu
290 255 300
Ttrr G.Ln Ala Pro 'rhr Ser LE~u Al~; Thr Lys Asp Pro Pro Ser Met Ala
l~ 305 3'0 ~>5 320
?U
?i
3()
Ttrr Gl a Ala Pro Pro Cys Val Th:- Thr Glu Val Pro Ser Ile Leu A1a
:325. 330 335
Ala His Ser Leu Pro Ser Lau As> GLu Glu Pro Val 'I'hz:- Phe Pro Lys
340 345 350
Ser Thr His Val Pro Ile Pro Ly:~ Ser Ala Asp Lys Va1 Thr Asp Lys
355 360 365
'rhr Lys Val Pro Se:r Arg Ser Pro Glu Asn Ser Leu Asp Pro Lys Me>:
3':'0 375 380
S Ser Leu Tlzr Gly Ala Arg C.lu LE a Leu Pro His Ala Gln Glu Glu Ala
385 390 395 400
Glu Aia GLu Ala Glu Leu taro Pro Ser Ser Gloz Val Leu Ala Ser Val
4() 405 410 415
4.°'i
SO
Phe Pro Ala Gln Asp Lys f~ro G.:y Flu Leu Gln Ala TY-~r Leu Asp His
420 425 430
Thr Gly His "'hr Ser Ser ':~ys S~~r_ L,eu Fro Asn Phe Pro Asn Thr Ser
935 4 i0 495
Ala ~'hr P_la Asn A7_a Thr ~~ly G .y Arg Ala Leu Ala Le~u Gln Ser Ser
450 455 460
JS L,eu Pro C~ly Al.a Glu Gly Pro A:>p Lys Pro Ser Val Va1 Ser Gly Leu
465 470 475 480
Asn Ser (>ly Pro G.ly His Val Trp Gly Pro Leu Leu Gly Leu Leu Leu
u~' 435 430 495
9()

CA 02426589 2003-05-O1
10
~eu rro IJrc~ i~eui Vai Leu Ala Gly Ile Phe kaa Arg Gly Tyr His Ser
500 505 510
Lys Gly Glii Gl.u Val Ser Cys Pre Pro Val. Ile Phe Pro Thr Leu Ser
515 52G 5?.5
Pro Ala .Pro ~ys Gln Asp Th:r SeT Trg Leu Az:g Pro Ser C;l.y Arg Glu
530 5?5 54G
x' firg Lea nr~~ ~iy Met Cys LE~u I1f° Thr Pro Ser 7:1e Leu Glu Ala Gln
545 500 555 560
C~ly Leu Ala Gl.y Cys Glu Leu Ar~~ Arg Pro Pro Glu Asp Cys Thr Pro
O) 565 570 575
~5
Giy Pxo His Leu Ser Cys Pro Ser Leu Leu Ser hro Gly Gly Gly Arg
58G 585 590
ale
v) INFORMATION E'OR SEQ TD NO.: 4:
(i) SEQUENCE CHARACTERISTICS
( A ) L E:(VGTH : 3 0
(B) TYPE: nucleotides
( C ) STRANDED11JESS
: s ing 1e
!D! 'I'OPOI~OGY; :inear
(ii? MOLECULE TYPE: DNA
(iii.)HYPOTHETICAL:
~U i.iv) ANTI-SENSE:
(v) FRAGMENT' TYPE:
!. vi ORIGINfiL, SOUR(~E
)
( vi
i )
IMMEDIATE
S011RCE
:
(vii i ) POSITION IN GENO"CIE
~l (A) CHROMOSOME/SE~:JMEN'P:
(B) MAI? POSI'~ION:
(C') UN:T_TS:
1X) ~"C,Ai';iRt?
'A) NJ~~IEi KEY:
Jl) (F3) IOCATION:
(C) IDENT'IFICATIC)N
METHOD:
(D) 0'I'HER INFORMATION:
(x) PUBLICATION INFORMP.rION
(A) A;ITHORS:
SS (13) TITLE:
( c~ ) ,zaur~~rAL
(:D) VOLUME:
(E) ISSL,JE:
t R i PE?.GES
E74~ '. G I D AT I? :
! H ) DOCLJMEN'=' NUMIsER
91

CA 02426589 2003-05-O1
tIi FILING DATE:
(.Jj PUBI~iCATIOrV DATE:
(K) RELE'~IANT RESIDUE IN SEQ ID NO.: 4:
S (x~.) SEQUENCE DESCRIPTION: 5EQ ID NO.: 4:
ATGCACGGCT CCTGCAGT'rT CCT<=ATGC'2 -P 3 0
!~7) INFORMATION FOR SEQ ID NO.: 5:
i=! SE~UEPdCFa <:HARAC'I'ERIS'T'ICS
)
( P. ) L:ENGTII : 3':
(B) 'TYPE: nucjeoti<ies
( C ) STRANDEDNI :S S : :, i.ng
l a
I ( D ) TOFOLOGY : l ine<xr
S
( s. MOLECULE TYPE ; DNA
i j
(ii.i )HYPOTHETICAL:
( ~v) AN"'I-SENSE
(v) FRAGMENT TYPE:
(vi) C:~RIGINAL SOURC's:
(~~'ii ) IMMEDIATE SOURCE:
('r~ i ) POS ITION IN t;ENOMi3
(A) CHROMOSOME,/SEGMENT:
~S (13) MAP POSITION:
(C) UNI'1S:
(ix) FEATURE
(A) NAME/f:EY:
(.B) L.~OCATION:
3O (C) IDENTIFICATION METHOD:
( D ) OTHER INF'ORMAT I ON
(x) PUBLICATION INF'OF~MA'1TON
( .A ) AUTHORS
B rt~ ",r. .
) I~~E.
S ( C 1 :rOL7RNAL
(D) VOLUME:
(E) :ISSUE:
( F j RAGES
(G) DATE:
( H ) DOCUMENT NLTMBI;R
( I 1 FILING DisTE
(J) PUBL1CAT'ON D~_TE:
(K) RELEVANT RESIInUE 1:N SEQ
ID NO.: 5:
4> (xi) SEQUENCE DESCRII~TLON SEQ ID NO.: 5:
GCCCACGCGT CC;ACTAC:TAC TT'~TTTT'~'TT 'f'TTTTT~' 37
92

CA 02426589 2003-05-O1
( ' ! IIVFORMAT101V F'OR SEQ ID NO . : b
.i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 1876
(B) TYPE: nucleotices
( C ) STRANDEDNE:SS : : irig.l
a
( D ) TOPOLOGY : L ~_nea:: r
( i MOLECULE TYPE : DPdA
i )
IO (iii )HYPOTHETICAL:
(iw) ANTI-SENSE:
(wo FRAGMENT TYPE:
(vi) ORIGINAL SOURCF~,:
(vii. ) IMMEDIATE SOURCE:
l5 (hii i) POSI'PION IN (~ENOM7~:
(A) C:HROMOSOMI~/SEG1QENT:
(B) MAF' POSITC'ON:
(C:) UNITS:
(ix) FEATURE
U (A) NAME/KEY:
1. I3) LOCATION:
(C) IDE;NTI:FIC:~TION ME'T'HOD:
:: ) 0'I'~iER INF~)RMAT CON
t x PLJB~~ICATIC?N INF~JRMAT CON
)
~S (A) AUTHORS:
(B) TITLE:
(~) JOURNAL:
( D ) VOI~tJME
(E) ISSUE:
3() ( F ) PAGES
('3) DATE:
( H ) DOCUMENT NLIMBE:R
( I ) FILING DATE::
(J) PUBLICATION DATE:
3; (K) RELEVANT RESIDUE IN SEQ ID
NO.: 6:
(xi) ;SEQUENCE DESCRII'T~ON: SEQ ID NO.: 6:
4()
atgcacggct cctgcagttt cctgatgctt c:tgctgc:cgc tactgctact gctggtggcc 60
accacaggcc ccgttggagc ccr.cacagat gaggagaaac gtttgatggt ggagctgcac 120
aacctct:acc gggc<:caggt: attvcccg<~cg gcctc:agaca tgctgcacat gagatgggac 180
gaggagctgg c:cgccttcgc caaggcc.ac gcacggc:agt gcgtgtgggg ccacaacaag 240
gagcgcgggc gccgcggcga gar~tctg:tc gccatcacag acgagctgcat ggacgtgccg 3(70
~0
ctggccatgg aggagtgcJca cc<~cgagagt c;agcactaca acctcagcgc cgccacctgc 360
agcccacJgcc agatgtgcgg ccactac.~cg caggtggtat gggccaagac agagaggatc 420
ggctcrtggtt ccc.acttctg tg~gaag.:t;c ~~agc~gtgttg aggagaccaa cat~cgaatta 480
5S ctggtgt.gca actatgagcc: tc-~ggggaac gtgaagggga aacggc-ccta ccaggagggg 540
n
actccgr.gct cccaatgtcc ctctggcc:ac cact_gc:aaga actccctctg tgaacccatc 60U
dgaa.gc:ccdg aagat.gc~tca ggatttgwct tacctggtaa ctgaggcccc atccttccgg 660
gcgac~tgaag catcagactc taggaaaatg ggtgctcctt cttcccCagc aacggggatt 720

CA 02426589 2003-05-O1
ccggctr;tcc tggtcacagg ggtgtcaggc tcgctgccaa ccctgggact gcctgctgtg 780
gaaacccagg ccccaacttc cttagcaacg aaagacccgc cctccatggc aacagaggct 84U
ccacct!gcg taacaa.ctga ggtcccttc°c attttggcag ctcacagcct gccctccttg 900
gatgaggagc cagttacctt ccccaaatc:g acccatgttc ctatcccaaa atcagcagac 960
~j> ;aagtgacag acaaaacaaa agtcfccctc~t. aggagccc.:ag agaaCtct-ct ggaccccaag
1020
atgtccctga caggggcaag ggarictccra ccccatgccc aggaggaggc tgaggctgag 1080
gctgagttgc ctccttccag tgacJgtctt g gcctcagttt t.tccagc°cca ggacaagcca
1.140
ggtgagctgc aggccacact ggac_c.acaag gggcacacct cctccaagtc cctgcccaat 1200
ttccccaata cctctgccac cgc:aatg~-c acgggtgggc gtgccct.ggc tctgcagtcg 1260
U tcctr_gccag gtgcagaggg ccc!:.gaca,ig c;~-tagcgtcg tgtcagggct gaactcgggc 1?20
rvctggrcatg regtggggc:cc tct~ctgg~a ctactgctcc tgcctcct:ct ggtgttggct 1'80
rrgaatcttct gaaggggata ccacLCaa~g ggtgaagagg tcagctgtcc tcctgtcatc _L440
?j
t:tccccaccc tgtccccagc ccctaaac~~a gatacttctt ggttaaggcc ctccggaagg :L'i00
gaaaggct.ac ggggcatgtg cct.catcaca ccatccatcc tggaggcaca aggcctggct 1'360
n ggctgcgagc t:caggaggcc gcc;tgaggac tgcacaccgg gcccacacct ctcctgcccc 1620
~ccctt.-ctga <Iccctggggg tgggaggatt tgagggagct: cactgcctac ctggcctggg 1680
~~cug~t:.~cgcc; :~:acacagcat gtgcgct: tc cctgagtgcc tgtgtagctg gggatgggga
1'740
ttcctagggg cagatgaagg acaagcccca ctggagr:ggcJ gttctttgag tgggggaggc 1800
agggacgagg gaaggaaagt aact<rctuac tctCCaataa aaacctgtcc aacctgtggc 1860
4() aaaaaaaaaa aaaaaa 1876
4.i
(2) INFORMA'rIUN FOR SEQ '~D NU :. ';:
i=) SEQUENCE CHARA(.TERI~TIC:;;
(A) LENGTH: ii25
(B) T~'PE: amino a~;:ids
(C) STTtANDEDNESS: single
iD) TOPOLOGY: l.in-gar
( ii ) MOLECULE 'TYPE: Prov-eir~
(iii)HYPOTHE'rICAL:
i iv) AN'T'I-SENSE:
iS !«) FRAGMENT TI'PE:
ivr) ORIGINAL SOURCE:
'.~i , IMMEDIATE SO:JRCE :
(v~i~:j POSITION IN GENOME
(A) Cl-IROMOSOME/SFc:zMENT:
C7O (I3) MAP L'OS1TLON:
('~ ) U1V I T S :

CA 02426589 2003-05-O1
x! E'EATURE
(A) NAMEIKEY: Xaa
(B) LOCATION: 464 a:Zd 551
iC) IDENTIFICAT1:ON METHOD:
S (D) OTHER INFORMATION: Xaa rnay be any amino acid
(a. g.,
Al.a, Asp, Glu, Phe, Gl~, f:is, Tle, L,ys, Leu, Met"
Cys, Asn, Pro, Gln,
Arg, Ser,Thr, ',Tal, 'rrp, 'Iyi.) .
(x.? ~'UBLICATION INFC?RMATION
IO f.A) AUTHORS:
;B) ~.'~TT,E:
1
C ) ,70URNAL
(C) VOLUME:
(E) ISSUE:
)S (F') E'AGE:S:
( G ) DAT F:
( H ) DOCUMENT NUM$Et.
(~:) FILING DA"~E:
(~T) PiJRLICATION DA''E:
(K) RELEVANT RESID!TE IN SEQ ID NO.: 7:
(xi; SEQUENCE TJESCRIP'~ION: SEQ ID NO.: 7:
Met H~.s Gly Ser Cys Ser Pyre Le°i Mer. Leu lieu Leu Prc~ Leu Leu
Leu
. S 1C1 15
3()
3 ~~
Leu Leu Val Ala Thr Thr G1y Pro Val Gly Ala Leu 'T'h:r Asp Glu Glu
20 25 30
uys Arg Leu MeL: Va:i Glu L,eu. Hi.s Asn Leu Tyr Arg Ala Gln C~'al Ser
3'i 4C 45
Pro P~:o A_1.a Seri Asp Met I_eu His Mei. A:rg 'I'rp Asp Glu Glu Leu Aia
50 55 60
A.La Pze A:La Lys Al a Tyr R.la Ar g Gln Cys Val. Trp Gl y His Asn Lys
65 70 75 80
Glu :=erg GLy Arg Arg Gly Cllu A.>:1 Leu Phe Alan Ile Thr Asp Glu Gly
4'~ 85 90 95
Mer Asp Vai Pro Leu Ala Tle~ G a Gl.u Trp His His Glu Arg Glu His
1_00 105 110
SU
~J
Tyr Asn Leu Ser Ala Ala 'Chr Cy~s Sc-.r Pro Gly Gln Met Cys Gly His
115 1:'0 lard
'i'yr ".'hr G1~lal Va-! rrp ;~la L;~s 'I'hr Glu Arg Ile Giy Cys Gl.y Ser
~a 1 35 140
6U His Phi C'ys G7 a Lys Leu Gln G1y Val Glu Glu Thr A:~n Ile Glu Leu
14S 7_50 155 160

CA 02426589 2003-05-O1
10
L~~u Va,i Cys Asn Tyr Glu Pro Pro Gly Asn Val Lys G1y Lys Arg Pro
165 170 175
Tyr Gln Glu Gly Thr Pro Cys See Gln Cys Pro Ser Gl.y 'L'yr His Cys
180 185 190
L.:ys As;i SeY s'~eu Cys Glu Pzo IlE- filly Ser Pro Glu Asp Ala Gln Asp
195 20(. 205
IS Leu Pro 'I'yr Leu Val Thr GJu Alai Pro Ser Phe Arg Ala Thr Glu Ala
210 2?5 220
5er Asp Ser Arg Lys Met G:~.y Ala-~ Pro Ser :per L~eu Ala Thr Gly Ile
225 230 235 240
~5
3U
Fro A1a Phe Leu VaI Thr GLy Va- Ser Gly Ser I~eu Pr« Thr Leu Gly
245 250 255
Leu Pro Ala Val Glu Thr GLn A1.3 Pro Thr Ser Leu Ala Thr Lys Asp
2fi0 265 270
?ro Pr-o Ser Met Ala Thr G1u Al.~ Pro Pro Cys Val Thr Thr Glu Val
2 ~'S 280 28'i
Pro Se:r Ile Leu Ala A1a Hm; Ser L,eu Pxo Ser Leu AsI~ Glu Glu Pro
290 295 300
~Jal Thr Phe Pro Lys Ser 'Ihr His Val Pro Ile Pro Lys Ser Ala Asp
40 305 310 315 320
4~
5()
Lys Val Thr Asp Lys Thr I,y_~ V<, 1 Pro Ser Ard Ser Pro Glu Asn Ser
325 330 ~ 335
Leu Asp Pro Lys Mer Ser I,eu Tl:r G:ly Ala Arq Glu Leu Leu Pro His
340 345 350
A1a Glr_ Glu Glu Ala Glu tjla G__u Ala Glu Leu Pro Pro Ser Ser Glu
355 3E;0 365
Vas Leu Ala Ser Vai Phe ~~ro A:a U1n Asp Lys Pro G:~y Glu Leu Gln
5i0 375 380
Aia Thr Leu Asp His "I'hr :~ly H.:a Thr Ser Ser Lys SE~r Leu Pro Asn
~7U 385 3.90 395 400
9fi

CA 02426589 2003-05-O1
Phe Pro Asm Thr Ser Ala Thr Ala Asn Alea Thr Gly G1y Arg Ala Leu
405 410 415
Ala Leu (~ln Ser Ser Leu Pxo Gly Ala Glu Gly Fro Asp Lys Pro Ser
420 42.5 430
l~ ~Jal '7a1 Ser -:~ly Leu Asn Scr G15.~ Pro Gly IW s Val Trp Gly Pro Leu
435 44(i 445
Leu Gly Leu Leu Leu Leu Pz~o Pr<~ Leu Va1 L,eu Ala Gly Ile Phe Xaa
1~ 450 4ti5 9.60
'?~)
?5
Arg Gly Tyr His Ser Lys G'~.y Glu Glu Val Ser Cys Px-o Pro Val Ile
465 4'70 4'75 480
Pne Pxo I'rr Leu Ser Pro Aia Pr.? Lys Gln Asp Thr Ser Trp Leu Arg
48°t 490 495
Pro Ser Gly Arg Glu Arg Leu Ar~:~ Gly Met Cys Leu Ile Thr Pro Ser
500 505 510
J:le Leu Glu A1a Gln Gly Leu Al:~ GLy Cys Glu Leu Arg Arg Pro Pro
5J 5 520 525
;;~u Asp Lys '~hr Pr<Gly Pro Hxs L,eu Ser Cys Pro Ser Leu Leu Ser
530 535 540
4Ct
,~ 6~
Pro G.iy Gly Gly Arg Ile Xaa Giy Ser Ser Leu Pro Th.r Trp Pro Gly
'i45 550 555 560
Ala Val Cys Pro His Ser Met. Cys Aia Leu Pro Glu Cys Leu Cys Ser
565 5?0 575
_rrp ;~~?y Trp Gly Phe L,eu C~l~r A.a Asp G:lu Gly Gln Ala Pro Leu Glu
580 585 590
5C) Trp Gly Ser Leu Ser Gly Gly G::y Arg Asp Glvz GIy Axg Lys Val Thr
595 6i:0 605
Fro r.sp Ser I?ro Il.e Lys '!:'hr C.~s Pro 'I'hr Cys Gly Lys Lys Lys Lys
~1.'J ~>15 620
Lys
625
97

CA 02426589 2003-05-O1
INFORMATION FOR SEQ ID NO.: $:
S ,'i) SEQUENCE CHARACTERISTTCS
(A) LENGTH: 550
1B) TYPE: amino aci;is
!C) STR_ANDEDNESS: single
(D) TOPOLOGY: l~.nPGr
)~
(ii) MOLECULE TYPE: ProtEin
(iii )HYPO'rHETICAL:
(iv) ANT I-SENSE:
(v) FRAGMENT TYPE:
IS(vi) ORIGINAL SOURCE:
(~.ii ) IMMEDIATE SOURCE:
( vi ~. i ) POS:I'rION IN C=ENOMF;
(Fi) C:I~RC)MOSOMI./SEGT:EN'r:
(B) MAP Pc)STT::O?V:
~C7 ( C ) UNITS
ice) FEATURE
(l;) NAME/K.EY: Xaa
(I3) LOC'rITtON: 454
(C) IDE:1VTIFICATION MEl'HOD:
~S (D) OTfiE~,R TNFORMATI:ON: Xaa may be any amino
acid (e.g. ,
P.la, C'ys,Asp, Glu, Phe, ~,Iy, i:is, Ile, Lys, Leu, Tvtet,
Asn, Pro, Glr.,
P.rg, Ser,Thr, Val, Trp, 'Pyr).
(:~) PUBLICATION INFORMAT:CON
3U (A) AUTHORS:
(B) TITLE:
( \_ I J OL)RNAL :
( !:) ) VOI~UMF~
(~) ISSUE:
.i> (F) PAGES:
(G) DATE:
(H) DOCUMENT NUMBER:
( I a FIhINCs DF~TE::
J ) I'UBLICATI ON DP.TE
4C) (K) RELEVANT RESIDUE IN SEQ ID NO.: 8:
(ai) :SEQUENCE DESCRIPTION: SEQ ID NO.: 8:
4S
Met His GLy Ser Cys Ser I~hf> Leu Met Leu Leu L,eu Pro Leu Leu Leu
1 5 1U 15
S() Leu Leu Val Ala 'rh.x- 'Phr C~ly P: o Val Gl.y Ala Leu Tr:r Asp Glu Glu
20 :?5 30
Lys ~:r:~ Leu Met Vas Glu .eu H:.s Asn Leu Tyr Arg A_a G:Ln Val Ser
Vx5 4 ; 4~
(i0
Pro Prr~ Ala Ser Asp Met ~eu H_s Met Arg Trp Asp G a Glu Leu Ala
0 55 60
98

CA 02426589 2003-05-O1
Aia Phe Ala hys Ala Tyr ALa Arg Gln Cys Val Trp Gly His Asn Lys
65 70 75 80
G'~u Ar<3 ;il~% Arg Arg Gly Glu Asr: Lea Phe Ala Ile Thr Asp Glu Gly
- 85 90 95
l~ Met Asp 'Jal Pro Leu Ala Met G h: Glu Trp His His Glu Arg Glu His
i00 105 11U
Tyr Asn Geu Ser Ala Ala Tr?r Cy;; Ser Pro C:.ly Gln Met Cys Gly His
15 115 1 2U 125
'I'yr Th:r ~~ln Val Val Trp A.a Ly:s 'rhr Glu Arg I:le C>ly Cys Gly Ser
i3"u 135 1.40
His Phe Cys Gi.u I~y~; Leu Gln Gly V~1 Glu Glu Thr Asr: I1e Glu Leu
145 150 155 160
Leu Val Cys Asn 'ryr GI_u Pro Pr :~ G1y Asn Va.L Lys Gly Lys Arg Pro
I6'_i 7.70 175
3~i ':~yr G-n 'G~ a Gly Thr Pro Cys Sev Gin Cys Pro Ser Gly Tyr His Cys
180 185 190
Lys Asn Ser Leu Cys Glu Pro Ile Gly Ser Pro Glu Asp Ala Gln Asp
195 200 205
~fi
4>
heu P:'~o Tyr Leu Va1 Thr C~lu ALa Pro Ser Phe Arg Ala Thr Glu Ala
2 LO 215 220
Sew A~~o Ser Arg Lys Met <: 1y A.i a. Pr :~ Ser Ser Let.i AI a 'l hr C3ly Ile
225 230 235 240
Pro Ala Phe Leu Val Thr C;ly Va.l Ser Gly Ser Leu Pro Thr Leu Gly
245 250 255
Leu Pro Aia Val Giu Thr ~Iln A.a E~ro Thr Ser Leu Ala Thr Lys Asp
260 265 270
-r,. ~-rw Ser (net tiay 't'hr ~~lu A:.a Pro Fro Cys Va1 Tr~r Thr Glu Val
$S 275 2'B0 285
6()
Pro Ser Ile Leu AI-a Ala :Ci.s S~:~:r l.~c~u Pro Ser Leu Ae:~p Glu Giu Pro
290 ~95 300
99

CA 02426589 2003-05-O1
Vai Th,- Phe Pro Lys Ser Thr His Val Pro lle Pro Lys Ser Ala Asp
305 310 315 320
1 Lys ~Ja ~ °1'hr Hsp Lys 'rhr Lys Val Pro Ser Arg Ser Pro Glu Asn Ser
3~5 330 335
Leu Asp Pro Lys Met Ser Leu Thr Gly Ala Arg C;lu Leu Leu Pro His
340 395 350
?()
P.la Gln Glu GIu Ala G.lu A__a Gl~; Alai Glu I,eu Pra Prc~ Ser Ser Glu
355 360 36'
'V'al Leu A=~a Ser Va 1 Phe P~-o Al<u Glci Asp I~ys k'ro Gly Glu Leu Gln
3%'() 3''5 380
Ala 'rY:r Leu Asp f-Iis Thr Giy Hi:: Tlnx Ser Ser Lys Sei Leu Pro Asn
385 390 395 400
S hhe Pro Asn Thr Ser Ala T"~r Al:~ Asn Ala 'I'hr Gly Glyr Arg Ala Leu
405 410 415
al.a L~eu GL.n Ser Ser Leu Pre Gly A.la Glu Gly Pro Asp Lys Pro Ser
3() 420 4 35 430
s
~( )
'Jal Val Ser G1y Leu Asn Ser Gl y Pro G.ly His Val Tr;~ Gly Pro Leu
435 440 445
~eu G'~y Leu Leu L~eu Leu Pro Pro Leu Val Leu Ala Gly Ile Phe Xaa
450 4 55 460
.=erg Gay 'T_~yr His Ser Lys G1y G 1 a Glu Val Ser Cys Pro Pro Val Ile
15~: 47U 4'7'a 480
5 Phe Pro Thr Leu Ser Pro Ala Poo Lys Gln Asp Thr Ser Trp Leu Arg
485 490 495
Pro Ser GLy Arg Glu Arg I~eu A~g Gl.y Met Cys Leu Ile Thr Pro Ser
Sl) 500 505 510
i
OO
~..r'l: ta~~...~1~ Glru ~i1 Y '.~e;a A.a i:ily Cys ~51~1 Leu Azy Arg Pr0 PYO
O1" 5 fJ
Glu Asp Cys 'J'hr Pro Gly Pro H i.;s L~eu Ser Gys Pro Se:r Leu Leu Ser
53() p35 540
10U

CA 02426589 2003-05-O1
Pro Gly Gly Gly Arg Ile
545 550
INFORMAT ION FUR SEQ ILNO . : 9
( i ;;EQUENCE CHARACTERISTICS
)
(A) LENGTH: 463
(B) "TYPE: amir;o acids
1O (C) STRANDEDNL~SS: _,ingle
(D) ~I'OPCJLOGY: l:~ne<:r
( i MOI,ECLILE TYPE : Pr ot<~ i-n
i )
( i ) HYPOTI-IETLCAL:
i.
i
i~ (1v) ANTI-SENSE:
( ~~~ FRAGMENT 'TYPE
~
(~ri? ORIGINAL SOURC(:
(vii ) IMMEDIATE SOURCE:
(vii i ) POSITION IN (VENOM
O (A) CHROMOSOMI:/SEGIIENT:
(B) TIAP POSIT'_~ON:
(C) UNI'PS:
ix) FEATURE
(A) NAbIE/KEY:
ZS ( i3 ) LOC'eITION
(C;) IDENTIFICATION METHOD:
(D) OTHER T_NFORMAT(:ON.
(x) PUF3LI'CATIUN INFORMATION
(A) AUmttORS:
3() (r~) TITL,E:
( C ) JOURNAL
( D ) VOLUME
(E) ISSUE;
(F) PAGES:
(G) I>A'I'E:
(H ) L>OCUMENT NLTM$ER
(II FIL.iNG DFTE:
(J! P:JBLICATION Dr.TE:
(K) RELEVANT RESILUE IN SEQ 1D
NO.: 9:
4C)
(:~ci) SEQUENCE DESCRIPTION: SF)Q ID NO.: 9:
~ii,~
Met His G1y Ser Cys Ser hhe Leu Met Leu L~eu Leu Pr<a Leu Leu Leu
1 5 10 I5
Leu Leu Val Ala Thr Thr Gly Po Val Gly Ala Leu Tr:r Asp Glu Glu
20 25 30
Lys Arg Leu Met Vc:-. Glu '~eu H:.s Asn Leu Tyr Arg Aia Gln Val Ser
p 5 4 ~ 4'~
5> Pro Fro Ala Ser Asp Nlet ~eu H:..s Met Arg Trp Asp G~:.~ Glu Leu Ala
p5 60
Aia Phe t~la I:.ys Ana 'lyr Ala A~ g Gln C:ys Val Trp G~y His Asn Lys
.~ 65 70 75 80
101

CA 02426589 2003-05-O1
c
.J
Gnu Ar:~ f.;lyr Arg Arg Gly G:lu Asr; Leu Phe Al.a Ile Thr Asp Glu Gly
85 90 95
Met Asp Va1 Pro Leu Ala Mf.t Gla Glu Trp His Ilis Glu Arg Glu His
100 105 110
Tyr Asn Leu Ser A1a Ala Thr Cy:; Ser Pro Gly Gln Met Cys Gly His
1i5 12:) 124
3~ '',r: ':'tar ~.=an a7a1 '7a1 Trp Ala Ly=~ Thr Glu A,rg il.e Gly Cys Gly Ser
iJ0 135 140
His Phe Cys Glu Lys Leu Gin GlT Va1 Glu Glu 'rhr Asn Ile Glu Leu
0 :145 150 155 160
~>
~.~eu V~~.1 Cys Asn Tyr G1u Pro Pr":~ G.ly Asn Val Lys Gly Lys Arg Pro
165 1'i 0 1.75
vyr C~ ~r G-: a Gly Th:r Pro C.'ys SF r G! n Cys Pro Ser C~ly 'I'yr His Cys
18() 185 190
Lys Asn Ser Leu Cys Glu Pro Ile G1y Ser Pro Glu Asp Ala Gln Asp
may 2c o 205
5 lieu Pro Tyr Leu Val Thr C~lu Aaa. Pro Ser Phe Arg Ala Thr Glu Ala
210 a:l_'i 220
Ser Asp Ser Arg Ly" Met (:1y A.a Pro Ser Ser Leu Ala Thr Gly Ile
4() 225 2.3(l 235 240
5()
Pro Ala Phe Leu Va1 Thr L~ly V<~1 Ser Gly Ser Leu Pro 'rhr Leu Gly
295 250 255
Leu Pro Ala Val Gl.i.r Thr GIn A.<~ Pro Thr Ser Leu A.l,a Thr Lys Asp
:?60 265 27C
Pro I-'ro Ser Met A_a "Thr <31u Ala Pro Pro Cys Val Thr Thr G1u Val
275 230 2135
>J Pro Ser Ile Leu Ala Ala His S~~r Leu I?ro Ser Leu Asp Glu Glu Pro
'<?90 295 300
'.7a'_ ~hr 1h<. Pro Lys Ser Thr 1-~.is Val Pro Ile Pro Lys Ser Ala Asp
OO 305 :310 37.5 320
10?

CA 02426589 2003-05-O1
L~_rs ~lal Thr Asp Lys Thr Lys Vai Pro Ser Arg Ser Pro Glu Asn Ser
325 330 335
Leu Asp Pro ~ys Met Ser Le~u Thz Gly Ala Arg C~lu Leu Leu Pro His
340 345 350
IO Ala Gln G1u Gl.u Ala Glu A:~a Glai Ala Glu ~~eu Pro Prc Ser Ser Glu
355 36~i 36':
Vai Leu Aia Ser Va). Phe Pro Al~ 6.1.15 Asp Lys Pro Gly Glu Leu Gln
LS 3' 0 3'75 '380
~-()
~S
A1a Trr Leu Asp His Thr G1y His Thr Ser Ser :Lys Ser Leu Pro Asn
:385 390 395 400
E~he P:_ o A~;n Thr Ser A1a Thr Al:::r Asn A1a Thr Gly Gl_~r Arg Ala Leu
405 4i0 415
~.la L~~u Gin SPr Ser Leu Fro G1y A!a G:lu Gly Pro Asp Lys Pro Ser
420 425 430
3tY 'Jal Val SE~r Gly Leu Asn Ser Gly Pro Gly His Val 'rrp Gly Pro Leu
435 440 445
Leu Gly L:~u Leu Leu L~eu F'ro Pro Leu Val lieu Ala GIy Ile Phe
35 450 ~'a5',> 460
103

'?003-C4-2~;-seq list (06508-048-Ca-03)
:~EQC1ENCE LLSTING
GENERAL INFORMATION:
(i) APPLICANT
(P) NAME: PROCYON L3T0I''HARMA INC.
(B) STREET : 1~.50 TI?-ANS-CANADA HIGHWAY, SUITE 200
( C' ) C'. LT 4' : DOR~'AL
( ~~ ) S'CATE : QLfEI3EC
( E ) C',OUNTRY : C'ANAD~~
', F'! I~'~OSTAL COL7E . Hip P 1H7
(ii) TLTLE,OF' INVENTICrN: 1'S,P94 diagnostic reagents and assays
(iiii NUMBER OF SEQUENCES: a
( i,r) COMPUTER READABLE= FORIz=:
A) MEDIUM TYL'E: F'c~ppY disk
~B) COMPUTER: IBM IC compatible
( C ) OI?ERA''ING S"STI.~!t : P~~ -DOS ,' MS - DOS
1: ) S(JFTWARE; : Pester r_ Ln
(vi CURRENT APPL:IC,"A'I'IC>N DA'i A
(A) APPLICATION NUMBER:
(L?) FILING DAZE:
~) C'.I~ASSIFICP'PI:ON:
(vi) PRIOR AhPLICATIOAI I7A'PF.
(A) APPLICATIC'N NUMBER: CA 2, 391 , 438
(B) FILIN C DATE: 2002--06-2.5
(' ) CLASSIF'ICF.'rION:
tv . ) PRIOR APPLICATION L)A~PP
(A) APPLICATIGN NUMBER: CA 2,380,662
~.I3) F'I:LINCDALE: 2602-OS_p:l
s0) CLA.SSIFICATION:
(v~ii)hT'I'ORNEY/PATENT AGENT INFORMATION:
(A) NAME: BROL)LL~ET'IE K0:7IE
sB) REGISTRATION NC..: 3939
(C) REFERENCE%DOCKEI' NO.: 06508-048-CA-~J:S
(D) TEL. NO.: (51.4) 39'7-8500
tE) FAX NO.: 1514) 397 851.5
(?_) INFORMATION F'OR SEQ ID NO.: l:
( i SEQUENCE; CHARACTERISTICS
(A) LENGTH: 2005
;B) TYPF_",: nucleic arid
c0) STRANDEDNESS: single
(D) 'TOPOLOGY: linE~a~
i -) MOLECULE T'I PE .- cDNA
( i :: 1 ) HYPOTHF'"I'ICAI~
(i~.~) ANTI-SENSE:
( c) FRAGMENT TYI:'E
(v~ ; ORIG=INAL SOURCE:
(v-,,...> IMMEDIATE 'SOURCE:
( v . i. : ) P(:rS L'1''ION 'IN GEN~ME
(Ai CHROMOSOME!SEGM3NT:
Page 1
CA 02426589 2003-05-O1

2003--04-29-seq list (06508-048-Cu--03)
(B) MAF POSIT:f:ON:
(C.) UNITS:
(ix) FEATURE
(I?.) NAME;/KEY:
(E~) LOCATION:
(C) IDENTIFICATION
METHOD:
(L)) t)'I'HI,R
INFORMAT ON:
( x ) PLTBL~C'.A'r:I:ON O"~
INFORDtATI
( A ) AUTHORS
(B) '?'ITI.'E:
.: C:' ) :~ OL)F'.NAL
(D) VOLLS~hiE:
(C:) ISSL.!E:
(L~') FAGE:S:
( G ) DATE:
', H ) DOCUMENT
NLTMBEF:
( r ) F' ~L1':NC~
DA~I"E
( J ) I?UBLICATION
DA''E
:K) R_ELEVPNT F'ESIDI_E IN ID NO.:
SEQ 1:
( xi ) Q ID NO.
S FQIJEhICI~ : 1
DESCRIPTION
: >E
at:gcar~<Jgct:.~ctcJcagtr.:t crgct:gccgcTact.gctact:~ct:ggtggcc6U
cc.tgatgc::tt:
accac<iggcccc:gntggagc cctcacagat_gaggagaaac:gt tt ggagctgcaci20
gatggt
aacctc:taccgggcccaggt atccccgacggcctcagacat_gct:gcacat.gagatgggac180
gaggag<:tggccgccttcgc caaggcct.acgcacggcagt.gcgtgtgggg::r~acaacaag240
gagcgcgggcgccc)cggcga gaatctgttcgcc:ati::acagacgagggcatggacgtgccg300
ctggcc:atggaggagtggca c'tacgagcgtgagcactacaacctcagcgc:cJccacctgc360
agcccacJgccagat_gtgcgg c:~actacacacaggtggtatgggccaagacagagaggatc420
g:Jc=g'=gc.Jtt-c.ccactuct:g tgagaagct:ccagggtgttgaggagaccaa~:vatcgaatt;a480
ct:ggtgt:gcaactatgagc:c tccggggaacgtc~aaggggaaacggcccta-c-aggagggg540
a<::tccgtgctcccaatgtcc cv~ctggctacca;~tgcaagaactccctctg:ggtgagtcc600
acgggr.ggatggccccccac gcgcagccacttr.ggc<Jccc:tgtcgttcc:aagtggccgga660
trtcaacccttcaaagggag gatgttagaaag-ctggcgcJcttcggggggcJcccgcgcga720
g<:zacccatcggaacTCCCgc.)a a<~atgctcagga::ttgcctt:acr_Cggtaac::~gaggcccca780
_..~tt~.:c:gggc~c)aetgaagc atca<Jact"tag:_)aa<~atgggtac-.tccttc::t.ccctaaca840
acggggattccggctttctt ggtaacagaggt::tcaggctccctggcaac<:aaggctctg900
rctgctgtggaaacccaggc cccaacttcct:t.zgcaacgaaagacc~cgccwt:ccatggca96U
ac:agaggctccaccttgcgt aacaactgaggt._ccttccattttggcagctcacagcctg1020
ccv::tcrttggatgaggagcc a<)ttacctt.ccc:aaatcgacccatgttcc~atcccaaaa1080
r:cw3gcagac:aaagtgacaga caaaacaa,3agt :fccccctaggagcccaga<Taactctct:g114()
Page 2
CA 02426589 2003-05-O1

2003-04-a9-se~4 list (06508-048-Ca-03j
~acc:ccaagatgtccctgacaggggcaagg~,3aacrcct.accccatgccc~-~ggaggaggct 12C0
~agc)ctgaggctgagt:tgcctccttc;:agt~taggt:cttggcctc::agtttttccagcccag 1260
gacaagccaggtgagctgcaggccacactg~.Jaccacacggggcacacctcctccaagtcc 1320
~:,tgcccaattccccaatacctc-tgc<:accctctaatgccacgggtgggcctgccctggct 1380
t
;~g<:agtcgtccttgccaggt:gcagadggc~:ctgacaagcctagcgtcgtgtcagggctg 1440
~act:cgcgccctggtcatc~tcltggggc:c~~tr;tcct:ggga.ctact:.gctccrgcctcct.ctg1500
~Itgttggctggaatcttctgaagggg<~tacc::acr_caaagg~~)tc~aagaggtcagctgtcct.1560
~,ctgtcatcttccccaccctgtcccceigccc:ctaaacaagatacttc~ttggttaaggccc 1620
-ccggaagggaaaggctac:gcJgc~catcltgcc t: ca cat=ocatcctggaggcacaa 1680
t,cacac
ggcc:tggctggctgcgagctcaggag<)ccgc ctgaggactgcacaccrggctcccacacctc 1740
r:cct.gcccctccctcctgagt.cctggygcxtitggaggatttgagggagctcactgcctacc 1800
ggcctqggg~Lr~tc: acacagcatgt ctcgctctccc:ttFagtgcctgtgtagctgg 1860
gcc:c
ggatggggattcctaggggcagatgaaggaoaagccccactggagtggggttctttgagt 1920
clggggaggcaggga<:gagggaadgaa~Lgt_aa.ictcctgactc~tccaataaaaacctgtcca 1980
<cctgtggcaaaaaaaaaaaaaaaa 2005
2! INF'ORMA'TION FOR SEQ~ ID N(:>. : 2
1 ) SEQfJENCF' CHARACTf:RIS'P;~ CS
;A) ~~ENGTH: '-0fi
(B) TYPE: aminc7 ac ids
(C) STRANDEDD:ESS: single
(D) TOPOLOGY: :..incur
( T T ) MOLECiJL~E TYPE : PROTE7 N
(xi; i~EQUENCE DESCRIF~TION: SEQ ID '('10.: 2:
~'et :his G 1y Ser Cys Ser Phe L.eu MF~t Leu Leu Leu Pro Leu Leu Leu
1-0 15
~.eu Leu Val A.La Thr Thr Gly Fro Val Gly Ala Leu Thr Asp Glu Glu
20 25 30
~ys Arg LE~u Met Val Glu Leu fi:~ A;n I,eu Tyr Arg Ala Gln Val Ser
3'7 90 45
?rc '~hl~ A:_a Sc,r Asp Met Leu His Met Arg T:rp Asp Glt.~ Gl,s Leu. Ala
Page 3
CA 02426589 2003-05-O1

~OC)3-04-~:9 -sec:l 1 isir ( 06508-048-C.'aa-03
50 55 60
:~la Phe Ala Lys Ala Tyr Ala tlrg G:.n ~~"ys Val Trp Gly H:is Asn Lys
';5 70 75 80
»u Arg Gly Arg F,rg Gly Glu ~lsn Lf~u Phe A.la Ile Thr A::~p Glu Gly
85 9(7 95
Met Asr~ ~'ai l~ro L~eu Ilir, Met (Ilv~ G.u 'T'.rp 1-11s Hi:'~ Gl~.r Ang C>lta
dis
100 1n'.; 110
i'yr Asn ':~eu Ser A.la Ala ~I'hr <:y:_~ S<:~r Ia:eo Gly Gln Met Cys Gly His
11~s _'.20 125
'I'yr Thr Gl.r~ Val VaL 'L'rp Ala L~ys Tlir Glu Arg Ilc:~ G1_y Cys Gly Ser
130 135 140
..1s Phe ;rs Glu :~ys Leu Gln C;l~r Va.l Glu Glu Thr Asn Ile Glu Leu
X45 150 ~ 155 160
!~eu 'Jal. Cys Asn 'Tyr Glu Pro I'ro Gi y Asn Val Ly:; Gly Lys Arg Pro
1.65 .70 175
I'yr Gln G 1u G Ly 'I'hr Pro Cys :per Gl n Cys Pro Ser Gly Tyr His Cys
180 1~ 5 1.90
~ys Asn Scar Leu C:ys Cil~ Giu ;',er Tl.,r Gly Gly Trp Pro Prc~ Thr Arg
cy x'00 2()5
Ser H-i~ Phe GLy A1a heu Ser F:'he Gln Val A1a Gly Phe Gln Pro Phe
210 215 220
'ys G' y Arg MEet Leu Crl a Se r L eLA.l a A l a S~~ r Gly Gly Pro Ala Arg
.~_:25 230 235 240
~l~a hr~: 1 :.e G_:.y Ser I3ro G.Lu As~> A:l.a Gln Asp lieu Pro Tyr L,eu Val
245 250 255
'I'hr G~_u A_l.a Pr-o Ser Phe Arg Ala. Thr Glu Ala Ser Asp Se: Arg Lys
260 265 270
~~iec G1y Thr Pro Ser Ser Leu A1a Thr G1y Il.e Pro Ala Phe Leu Val
2''S 280 285
Page 4
CA 02426589 2003-05-O1

2603-04-29-sec. list X06508--048-C~:~-03)
I'hr ~,=a Val SE~r Gly Ser Leu A1G Thr L.ys A.La Leu Pro Ala Val Glu
'u>9G 295 300
I'hr ia~~n Aia Puo 'I'hr Se=r heu A l a 'L'h r Lys Asp Pro Pra Se r NTet Ala
305 31r 37.5 320
rhr Giu A.La Pro Prcw~ Cys Val Thr Thr Glu Val Pro Ser I1e Leu Aia
32~i 330 335
ajia aiis Seer LEeu Pro Ser Le~u Asp Gl.i Gi~,z Pro Val Thr Phe Pro Lys
340 34':i 35 )
Ser 'I'hr His Val Pro Ile Pro L~ys Ser Ala Asp Lys 'Val Thr Asp Lys
3.'~5 360 365
'~'hr L~ys V«.1 Pro Ser Arcl Seer Pro Gl..z Asra Ser Leu Asp Pro Lys Mec
:3 70 375 380
.'~«r L.~eu TY;r G1y Ala Arg Glu L~u Lee,. Prep Hi.s Ala Gl.n Gl,a Glu Ala
B:'~5 39(l 395 400
c~ iu e~ia Gi a Ala G_iu Leu Pro P ro Se r SE:r Gl a Va 1 I~eu Ala Ser Va i.
405 410 415
nine Pro As a Gln Asp Lys Pro G iy Gl a i~~e a Gl.n Ala ':'hr Lev.. Asp His
420 4?. ! 43(~
p _r- r.ly ays T=;r Se:r SeY Lys S~~r Le a Pro Asn Phe a'ro Asn 'T'hr Ser
435 4-10 145
Ala Thr Ala Asn Ala Thr G1y Gty Ar~~ Ala Leu Ala 7:~eu Glr, Ser Ser
450 4S5 460
L,:~u Pro Gly Aia Gl a Gly Pro A:~p Ly:. Pro Ser Val Va1 Sei Gly Leu
4zo5 470
475
480
a.vr. per ply Pro ,1.y Hip: Val T:~p G1~:~ Pro Leu I,eu C~ly Leu Leu Leu
485 490 495
heu Pro Pro Leu Val Leu Ala Gay Ilc-~ Phe
500 50'~
ITdFORM.ATIOtV FOR SEA ID NO : 3
1?age 5
CA 02426589 2003-05-O1

~OG3-04-29-see; li.st (06508--048-Ca-03)
( i ) SEQUENCE CHARACT:~:RIST -CS'
(A) LENGTH: i93
( B ) TYPE : am ino a~, id:
(C) STRANDEDNESS: single
(L~) TOF?OLOGY: .Lin~:ar
~: i ~ ) MOLECULE TY P'E : 'ROTE ~Iv
ix ) FT~~A'~t~RE
A ) NW IE 1 KEY : Xaa
(B) LOCATION: 501
( C' ) II)ENTIFI~JATIO'd METHOL)
(D) O~',~IER INI~ORMAI'ION: Xaa may be an=,~ amino acid (e.d. , Ala, Cys
Asp, G:~ u, F'he,
(~ly, His, I1~~, Ly:~, .,eu, Met, Asn, Prc>, Gln, Arg, Ser, Thr, Val,
'I'rp , Tyr ) .
(xi) SL.'QLIENCE DES('_RIPTIOV: SEA ID N0. : 3:
Mer riis i=iy :>er t~'ys Ser Phe ~eu M=.t Leu heu Leu Pro Lt~u Leu Leu
_ 5 10 15
Leu Leu Va1 Ala Thr Thr Gly Pro Vai Giy Ala Leu Thr A:~p Glu G1u
2 0 2, '> 3 '7
vys Arg L,eu AMet tlal G.LU heu His Asn Leu Tyr Arg Ala GLn Val Ser
S 40 45
Pro Thr .:la .per A~;p Me t_ Leu His M~=~r Arg ~I'rp Asp Glu Glu Leu Ala
ii) 55 60
Ala Phe r~la L,y:-; .A:~a Tyr i~la Arg (; In Cys ~Ja1 Trp G7y H i s Asn Lys
65 70 '-'S 80
Glu Arg e~ly Arg Arg G.l y c:3lu Asn l eu E'ize Ala Il.e 'I'hr Asp Glu G1y
85 90 95
Met Asp 'Ja~ I'ro Leu Ala Met Giu <::1u 'I'rp J-li; His Gl.u Arg Glu His
":00 ' 05 117
Tyr Asn ~eu Ser A.La Ala 'I'hr Cys ~er Pro Gly~ Gln Met Cys Gly His
:~1'i 12.0 1.2.5
Tyr Thr Gl~: Vai Val Trp Ala Lys 7 hr Glu Arg Ile Gi_y Cys Gly Ser
l~0 1s5 1~0
Hls Phe :'ys tzlu Lys Leu Gln G.y Val Glu ~~lu Thr Asn Ile Glu Leu
145 150 'S5 160
Page 6
CA 02426589 2003-05-O1

2003-04-29--se~.x list (06508-048-Ca-03)
~eu Val C'ys Asr, '~yr G7..u Pro i?ro G;y r'1sn Val Lys Gly Lys Arg Pro
.65 :. 7 0 175
Tyr Gln Giu Gly Thr Pro Cys Ser G Ln (:ys Pro Ser Giy T;~r His Cys
180 1 ;3h 1'.a0
~ys Asn Ser I'.,ei. Cys Gly Glu Ser T,nr C;ly Gly Trp Pro Pro Thr Arg
9'~~ 200 205
Ser His Phe <~:ly Al.a Leu Ser Phe GLn Val Ala Gly Pre G:n Pro Phe
220 2.15 220
Lys Gly rar~_r filet Leu G:lu Ser L~eu ALa A~'~a Sei° Gly Gly P,ro
Ala Arg
225 230 235 240
~_lu erc :1=.~ (~ly Seer :r~ro Glu Asp A~a :::iLn lisp Leu Pro 'T'yt Leu Val
24; 250 255
Thr Glu Ala Pro Ser Phe Arg Aia 'Znr Glu Ala Ser Asp Ser Arg Lys
26~ 2~5 2'7r
Met Gly '!'hr hrc> Seer Ser Leu Ala 'I hr Gly :i:Le Pro Ala Pine Leu Val
275 280 285
~~r:r ~31u 'Ia. Ser r~_y S~~r_ Leu Ala 'I hr :~ys Ala Leu Pro Al.a Val Glu
290 295 300
Thr Gln Ala I?ro Thr Ser Leu Ala ihr L,ys :asp Pro Pro Ser Met Ala
305 31.0 315 320
Thr Glu Ala hro P:ro Cys 'Jal Thr 'I fin G.lu 'Ja:l. Pro Ser 'I 1.e Leu Ala
3.'?5 330 335
Aia iW s Ser Leu Prc Ser Leu Asp i:lu -Flu Pro Val I'hr Phe Pro Lys
'i4!.'! ~4'i 35i:
Ser 'Chr 3i:~ Val Prc I7.e Pro Lys Ser Ala Asp Lys Val Thr Asp Lys
35'a 3E>0 3E~5
"Phr Lys 'Ja 1 Pro Ser Arg Ser Pro (:.1 a Asn :per L.eu A:~p Pr o Lys Met
30 375 380
Ser ~eu Thr t~I,,r Ala Arg GIu Leu i,eu Pro His Aia Gln Glu Glu Ala
Page 7
CA 02426589 2003-05-O1

200.--04-2~~-:~eq Ii-st (06508-048-Ca--03)
a85 390 395 400
t~lu r~la Glu Ala Glu Leu Pro Pro Se_~ Sec G1u Val Leu Ala Ser Val
405 410 415
--'he ere A -a Gln Asp I~y;~ Pr_o Gly G1.1 L,eu G7.n Ala 'I'hx L,e!a Asp His
420 42~ 43')
I'hr :;~..y H-~s Thr Ser Se:r Lys Ser Lea Pro Asn Phe Pro Asp Thr Se.r
435 940 44',
~~la '~~hr AIa Asn Alai Thr Gly (:.1~~ Axg Ala L~eu Ala Leu Gln Ser Ser
~:~50 455 46c)
heu Pro ULy ALa Glu G1I~ Pro F.sp Lys Iyro Ser Val Vat! Ser Gly Leu
46~~ 470 475 480
Ear Se~~ly Pro Gly His Val ''rp G,y Zero Lc~u L,et-z Gly Leu I~eu Leu
485 ~t90 495
L,eu Pro Pro heu Val LPU Ala <Ily I. a Phe Xaa Ar<~ Gly Tyr His Ser
500 5~=5 5i0
_~ys Gly Glu G1u Val Se.r Cys 73ro P:r-o Val Ile Phe Pro 'rhr Leu Ser
5' S 'p20 525
~~ro Aia ,Fro L,ys fsin Asp 'I'hr :)er T:-p I~eu Arg Pro Ser G ~,~ Arg Glu
5:30 535 540
,erg Leu Arg Gly D4et Cys Leu Lle T;~r Ie~o L>er Ile Leu G_~u Ala Gln
p45 550 _'~5~~ 560
~~ly L~eu F~.la Gly Cys Glu Leu Arg A.~g Faro Pro Glu Asp Cvys Thr Pro
565 'i70 575
Jly Pro liis lieu Ser Cys hro Ser Leu !~eu Ser Pro Gly G 1y Gly Arg
'.80 '_i35 5'i0
Ile
( 2 ) INFOI2Mr'1T COrI FOR S EQ :ID IVO. : 9
( i 1 :iEQUENCE ~~HARAC'I'I:RIS'1 -ICS
(A) LENGTH: 30
(B) TYPE: m.c~.eotides
Page 8
CA 02426589 2003-05-O1

2003-04-2L3-seq list 106508-048-Ca-03;
iC) STItANDEDNESS: single
iD) TO'~OLOGY: linear
( 1.i; MOLECULE 'TYPE: I3NP.
(:ii ) SEQUENCE JESCRIF''1'LON: SEQ ID N0. : 4
atgcacggct: c:crgcagrtt =~ctgatclctt 30
( 2 ) INFORMATION FOR SEQ ID N(!. : 5
l Z ) SI;Q11ENCE CHARACTF;R~~ST:T C'S
iA) LENGTH: :=7
(B) TYPE: nucleotides
(C) STRANDEDDIESS: a;.ingle
iD) TOPOT.OGY- :inF~ar
f l ~ ~ MOLECULE 'I'YYE : i:)Ni~
', x.:~. ! SE(,~UENCE L)EpCR,I !'T.LON SEQ ID N17 . : .',i
c:3cccacgcgt cgactagtac ttttttr:ttt :.ttvttt 3 7
( 2 ! INFORMATION FOR S?~:Q ID N!) . : 6
r l ) SEQUENCE C'HAIYACTi'RIST'.:CS
iA) G ENG'PH:
L876
!.B) TYPE: i.des
nu~~leot:
c;C) S' I'RANDEDNESS:single
TC)C?OLOGY -a r
: 1_:n
MOLECULE TYPE :
7NA
~xi ) SEQUENCEDESCRIPTION: SE<~>
ID NO.:
6:
atgc::acgg<:tcr_vtc7cacytttcct:gatgctt~tgct:gcc:gc:tactgctac?:gctggtggccfi0
accacaggcvcccvgtt.ggagccct:cacagat-~aggagaaacgtttgatggrggagctgcacL20
aacctctaccgggcccaggtatccccgccggcctcagacatgctgcacac~gagatgggac1E30
caag<~agccc~gccgcr_ttc:gc,,~aaggcct.-_Jcacggcagtgcgtgtgggyccacaacaag210
ac
gagcr~c:gg~Icgc..c<~<-g<.Icgagaatctgt :lccar:c:acagacgagggca-.9gacgtgccg3110
1c
ctgg<:cat~.Jgac~gagtggc:accacgagcgtcJagcact<~caacctcagcgc:cgc<:acctgc360
agcccaggccagatgtgcggccactacacgcaggtggt:a~~gggccaagac:agagaggatc4;~C
ggctgr.ggttcc:cacttctgtgagaagctccagggtgttgaggagaccaacatcgaatta480
=tggtatg.aac~tatgagcctccggccgaacgt.gaaggggaaacgg<:cctaccaggagggg540
at:t_~=gtg~tc~~c<~attxt.ccct.ctgcct:ac'~ac:rgcaagaac:t.ccctctrJtgaacccatc600
Page 9
CA 02426589 2003-05-O1

?003-04-29--sec:( list (06508-048-Ca-03)
ggaagcccggaagatgctcaggatttc3cwtac<-t:ggtaactgaggcccc~atccttccgg660
gcgactgaagcatcagactct:aggaaaatg~;gtgc:tccttcttccctagoaacggggatt720
~cggctttc:ctggtcacaggggtgtcaggc:cgr~r:gccaaccrtgggact.gcctgctgtg780
xaaacccaggccccaacttccttagc:~acg.~aagacccgc:ccta:catggcvaacagaggctE;90
;~c:ac:c:ctgc:gtaacaactgailgt.ecc:tccittvt:ggcac.ctcacagcctgccctccttgc)CO
~atgaggac;ccagt.taccttc:cc:caa:~t.cgicccitgttcctat:cccaaraatcagcagac~3E0
aaagtgacagacaaaacaaaaigt:gcc~-tct-~ggagcccagagaactctctggaccccaag1020
atgtccctgacaggggcaagggaact..cta_cccatgcccaggaggaggctgaggctgag108:0
gctgagttgcctcctitccagtgaggt~ttgacct:c:agt:ttttci:agcccaggacaagcca119:0
ggtgagctctcaggccacactggaccaJacg~ggcacacctcctccaagtc:cctgcccaat1'200
'=tcccaatacctctgccaci:g<:taatgcc:icgggtgggcgtgccctggcat;ctgcagtcg1260
tcc~ tgcc~gg~gc:agagggccctga~aag:,~~tagcgt:cc;tgt<eagggcr:gaactcgggc1:320
~~CtygtcattcjtggggccCtCt:cctggga::~tac-tgct_cctgC.ctcct:cr,ggtgttggct13E30
g
c.~gaat.ctt.c~tgaaggggata<:cactcaaag~gt~_Iaagagcrtcac~ct::gtcct:cctgtcatc14410
ttccccaccctcrtccccagcccctaaacaa,;~atacttct:tggttaaggcc:ctccggaagg1500
gaaaggct<~cgctggcat:,gtgcct:catc.aca.:CatcCatcctggaggcacaaggcctggctl.5Ei0
_~cgct.gcgac;ctc:a<tgaggccgcctgaggactgcacaccgggcccacacc!:ctcctgcccc16'.'_0
tccctcctgagtcctgggggtgggagga.ttt:gagggagctcactgccta:-ctggcctggg680
1
gctgtctgcccacacagcatgtgcgctctcc:ctgagtgcctgtgtagctvagggatgggga1'7110
ttcct:aggggcagatgaaggacaagccccar_tgyagtggggttctttga~~tgggggaggc1$00
agggacgaJggaac~ga<;~a~taactcct~gactctccaataaaaacctgtc~:aacctgtggc1860
aaar~aaaaaaaaaaaa 18'76
t G j INFORMi'1T:~ON Fc:)k SEQ ID TAO.
( i ) SEQt'ENCE C,HARAC"ERIS'2 ICS
(A) LENGTH: 625
(~3) TYPE: arr..ino 4ccids
((":) ST'RANDEDNESS: s~ogle
(t7) TOPOLOG': linear
( I i ) MOLECULE TYPE: P1'oteirl
(lxj FEATUkE
(A) NAME/KE~ : Xa~t
iB) LOCATIODi: 46~and 55i
(o:? II7ENZ'IFIC1~TICt~f METHOD:
Page 10
C;A 02426589 2003-05-O1

2003-04-a;9-se:x list 106508-048-C.'a-03 )
(I~) 0'PHER INFORMA~ION: Xaa may be an;~,r amino acid (e.g., Ala, Cy:
A:~p, G__u, Phe,
Gly, His, Ile, Lys, Leu, Met, Asn, Pro, Gln, Arg, Ser, Thr, Val,
;,r 17 . TYr .
~si ) SI~;QUIIVCE DESCRIPTION: SE;Q ID NO. : 7
~fet His Giv~ ~,e_ ~~v_ s Ser Phe Le~u Mer Leu l.eu Leu Pro Lau Leu Leu
15
Leu Leu Tv'a:'L. Alfa Thr 'Phr Gly Px o Val ~;:Ly Ala Leu Thr Asxo Glu Glu
4: 0 2 5 3 ."I
Lys Arg i~eu Met 'Jal. Glu Leu Eiis Psn Leu 'Pyr Arg A7a GLn Vai Ser
35 4G 45
Pro P_ c .'~.l.a >;er Asp Met :~eu Hi s N'et Arg 'I'rh Asp Gl a G l a Leu Ala
;i0 55 6G
Ala Phe Alza Lys Ala T;yr Ala Arg C..Ln Cys ~Jal Trp Gly His Asn Lys
65 70 ';'S 80
Glu Arg ~11y~ Arg Arg Gly Glu Asn L:eu Phe Ala Ile Thr Asp Glu Gly
85 90 95
Met Asp Jai !?r<:~ Leu Aia Met Glu (:'1u 'rrp His His Giu Arg Glu His
L0~) ! 05 11 0
Tyr Asn :~e~a :per Ala Ala 'Ihr Cys :,er Pro Uly Gln Met Cys Gly His
L 1'~ 1<'.0 1a5
Tyr Thr ~~ln Vaa. Val Trp Ala Lys 7p.r G1u .Arg Il.e Gly Cys Gly Ser
L30 135 1~0
His Phe '_ys Glu Lys Leu Gln Gly ~al Glu Glu Thr Asn Ile Glu Leu
i45 150 ''..5'i 160
Leu 'Jal ~~ys Asn Tyr G1u Pro Pro i:ly Asn Vai Lys Gly Lys Arg Pro
1h5 170 175
Tyr Gin 31u Gly Thr Pro Cys Ser c;ln Cys Pro Ser Gly !'yr His Cys
180 85 190
Lys Asn Ser ~eu Cy~, G1u Pro I.Le C~l.y Ser Pro G.lu Asp A:la Gln Asp
19~s 200 205
Page 11
CA 02426589 2003-05-O1

2003-04-2:0-sec: list (06508--048--Ca-03)
L:eu :~?rc> Tyr L,eu Vai Thr Glu F..la Pxo Se.r P:ne Arc; Ala 'L'hr Glu Ala
210 215 220
;er Asp Ss:r A:rg Lys Met Gly 1=,la Pxc~ Ser Ser L,et.~ Ala Thr Cily Ile
225 :?30 235 240
:'ro A1a Pne L.~u Va1 'Phr Gly ~'a L Si r Vl.y Ser I~eu Pro 'rhr Leu Gly
245 250 '?55
L,eu Pro Ala Val Glu 'i'hr Gln r~la Pnc> ~I'hr Ser Leu Ala Trx Lys Asp
260 2t-5 270
Pro Pro Sex Met Ala 'lhr Glu tsla P, o i3ro Cys Va1 Thr Tt:r Glu Val
275 ,80 285
ero Ser ~i.e i.,eu Ala Ala Hi_s aer L,~~u Pro Ser Leu Asp G~u Glu Pro
29U '?95 300
'./a1 Thr Phe Pre L,ys Ser Thr ;his V~~1 Pro I.l.e Pro Lys Scar Ala Asp
305 31t) 31.5 32 0
"~ys Val Thr Asp hys Thr L,ys '7a1 Peo Ser Arg Ser Pro G:. a Asn Ser
325 330 335
~eu Asp I-ro z~ys Met ,Ser Leu I?hr G _y AJ.a Arg Glu Leu Leu Pro His
340 315 3';0
:~la Gln C~1~: Glu Al a Glu Ala :31u A i a Glu Leu Pro Pro Ser Ser Glu
~:~5!~ 360 365
Jal Leu J~la Ser Val Phe Pro Ala Gln A>p Lys Pro Gly Gnu Leu Gln
?.70 375 380
Ala Thr =.e_. Asp His Thr Gly His Thr Ser Ser Lys Ser Lei. Pro Asn
i87 3~~i.~ _}95 400
Phe Pro Asn 'I'hr Ser Ala Thr Ala Asn A:La Thr Gly Gly Arg Ala Leu
405 4:10 415
Ala Leu C;ln Ser Ser Leu Pro Gly Ala Ulu u1y Pro Asp Lys Pro Ser
42!) ~a25 430
~~a_~ Va.~ :;er ~;ly Leu Asn Ser Giy Fro Gly lis Val Trp Gly Pro Leu
433 440 445
Page 12
CA 02426589 2003-05-O1

?GG3-04-'<:9-seq list (06508-048-i:a-03?
~eu Gly I'eu T,eu Leu Leu Pro Pro L~eu Va1 L,eu Ala G1y Il.e: Phe Xaa
450 455 460
Arg C=ly ::'yt iii.; Se,r Lys Gly Giu Giu VaI Ser Cys Pxo P;-o Val Ile
4F5 410 4'7_'~ 480
Phe Pro '"hr I~eu Ser P:ro Ala Pro Lys GIn Asp Tltr Ser TrL~ Leu Arg
485 490 495
Pro Ser ~;ly :erg ~~lu Arg Leu Arg C;ly Met Cys Leu Ile Thr Pro Ser
'> 0 C) ~:~ 0 5 5 '1. ()
Ile Leu cilu Ala Gin GIy Leu Ala (::ly ~:.ys clu Leu A.rg Arg Pro Pro
'> ~'~ 520 525
Glu Asp C:ys ':~ht~ Pro Gl.y Pro His L:c=a Ser c:.ys Pz o Ser Leu Leu Ser
530 535 540
Pro Gly t;ly Gly Arg Ile Xaa Gly ::er Ser Leu Pro I'hr Trp Pro Gly
545 550 555 560
Ala 'lal ~:y:~ Pro His Ser Met C,,~s F.ia Leu Pro Glu Cys Leu Cys Ser
555 5"70 575
Trp G.y ~r~~ c;ly Plze Leu ~.zly Ai.a f~sp Glu ~:~ly G:I n Ai.a Pc o Leu Glu
'i8U '-:.85 590
Trp c:lly Ser Leu Ser Gly Gly G~y F..rg A sp Gln..t Gly Ar:g hys Val Thr
595 600 605
Pro Asp Ser Pro lle Lys 'I'hr Cys I~ro 'I'hr Cys Gi_y Lys Lys Lys Lys
!510 61.5 6'1.0
Lys
625
( 2 ) INFORMATION FOR SEQ ID TdO . : fr
( i ) SEQUENCE CHARAC'l'ERLS7'I:CS
(A1 LL;NGTH: 550
iB) TYPE: amino acids
S'C'RANDELJIVESS slrtgle
,~.~=~POLOG:' : 1. iuear
( 1 1 ) MOLECULE 'T YPE : PrOtw i. n
Pc~ge 13
CA 02426589 2003-05-O1

200 -04-2~3-s2q li~,t ( 06508-048-Ca-03 )
ix ) I'EATUKE
(A) NAME/KEY: Xaa
(B) LOCATION: 464
!,C1 1DENT:CFICA'T'IOD7 METHOD:
SD? C?THER INFORMATION: Xaa may be any <amino acid (e.g.. Ala, Cys
Asp, Gin. Pkne,
«1y, !-Is, Ilc: , Ly; , I.eiz, Met: , Asn, Pro, Gln, Arg, Ser, 'Phr, Val,
L'rp, Tyri .
(:~ci) SEQUENCE DESCRIFwr7:ON: SEQ ID NU.: 8:
:Let :his G1y Ser Cys Ser Phe Ietz Mft Leu Leu L,eu Pro Leu Leu Leu
3 5 ~ 0 15
Leu ~ea Val ALa Thr '.rhr C;ly F'ro V~_1. Gly A,La l~enz Thr Asp Gl.u c~lu
't~, 2~ 30
J..,ys Arg Leu Met Val Glu Leu Ifis A::n I~eu Tyr Arg Ala t~ln Val Ser
35 ~t0 45
x~ro Pro Vila Ser ~'ssp Met Leu its Mc~t: .~'jrg Trp Asp GI~.z GIu Leu Ala
50 55 6U'
ala Phe AIa Lys Ala Ty- Ala Arg G _n Cys 'v'al 'rrp Gly Hj s Asn Lys
X35 7C~ 75 80
,.ilu Arg ~;iy Arg Arg G1 ~;r Glu .3sn L--'u Phe ALa .I-a 'rhr A:>I.: Glu Gly
85 90 95
~Iet Asp Vai I'ra Leu A::a Met ~lu Giu 'lrp Isis His Glu Arg Glu H.is
7001 1')5 1:0
Tyr Asn L.eu Ser Ala A:La Thr :ys Ser Pro Gly Gln Met Cys Gly His
._ 1.12 0 ~. 2 5
I'yr ~'hr i:,m: 'via.a Ua1 'I~rp Ala Lys ':I: hr t; Lu A.rc~ Ile GIy Cys Gly
Ser
v0 135 140
His Phe (:ys tilu Lys Leu Gln Gly Ga1 GIu Glu TLar Asn Il.e Glu Leu
1.45 150 1.55 160
Leu 'Jal ':~y~~ ilsn Tyr Glu Pro Pro C 1y F~sn Val Lys Gl.y Lys Arg Pro
165 17U 175
T,~r :;'n 31~. ~l~r Thr Pro Cys Ser Cln C'ys Prc.: S<er GLy 'I"yr His Cys
i8ii 85 190
page 14
CA 02426589 2003-05-O1

2C'03-04-:9-se~1 list (06508-018-C:a-03;~
;~ys Asn Ser L.eu Cys Giu Pro Ile Gly Ser Pro G1u Asp A:~.a Gln Asp
195 ~00 205
~eu 1'ro ='"y~ L'eu Vai Thr_ Glu Ala Pe-o Ser Phe Arg Ala 'rlir Glu Al.a
~iv 215 220
Ser Asp Ser Arg Lys Met Gly Ala Pro Ser Ser Leu Ala TL~m Gly Ile
2'~5 230 a?3'.:i 240
Pro Ala -'he L,eu 'Jal Thr (~ly 'Jal Seer Gly :er Leu Pro Thr Leu Gly
295 2'i0 255
'~eu Pro t~:ia Vai Glu Thr G1n Ala Pro '~hr Ser Leu Ala T'nr Lys Asp
'6(' 265 2.70
Pro Pro .~er Met Ala Thr Glu Ala Pro Pro ('ys Val Thr Ttir Glu Val
280 285
Pro Ser =le Z~eu Al.a A1a His Ser L:eu aro Ser Leu Asp GLu Glu Pro
290 295 300
Val Thr !?ho Tyro Lys S2r Thr Hi.s Val Pro Ile P1o Lys Ser Ala Asp
3C5 3:0 31!:, 320
Lys Val nhr i~sp Lys Thr Lys Val E'ro Ser ,?lrcx Ser Pro Gl~.i Asn Ser
3:?5 3:3U 335
Leu Asp ~?ro I~ys Met Ser Leu Thr Cly Ala Arg Giu Lc~u Lea Pro His
340 =45 350
Ala Gln ~~lu c3ln Al a Glu Ala G--wu z,la Glu Leu Pro Pro Ser Ser Glu
355 360 3E>5
Val ~eu Ala Ser Val. Ph.e Pro Ana (~ln Asp L~y,~ Pro G.:y Gl.u Leu Gln
370 375 380
Ala 'rhr Leu Asp His Thr Gly His r"hr Ser Ser Lys Ser I.eu Pro Asn
385 390 395 400
Phe Pro As,r Phr Ser Al.a Thr Ala i~sn Ala Thr Gly Gly A.rg Ala Leu
40'~ 410 415
Aia Leu ~i Ser Ser Leu Pro Giy I'~.la i:~lu Gl.y Pro Asp Lays Pro Ser
420 ~~25 430
Page 1 '=s
CA 02426589 2003-05-O1

2u03-04-2~3-sec list (06503-048-Ca-03)
'veal 'Jal Ser G:iy Leu Asn Ser G1y Pro Giy His Val Trp CGly Pro Leu
35 440 44~i
!.~e~.a ~:;ly Leu L~.u i~en.z I_~en E~ro Pro Lcm. Val Leu Alga Gly I1a Phe Xaa
450 455 460
Arg Gly Tyr His Ser Lys Gly G1u Guu Val Ser Cys Pro Pro Val Ile
465
4 7 t
4'7 5
480
x~he Pro Phr Leu Ser Pro Ala Yro L~_rs Gl.n Asp 'Phr Ser Trp Leu Arg
485 490 495
~~r~ aer ill Arg ~_.ylu :~.ry Leu a'~rg G:y filet Cys Leu Ile rt r Pro Ser
;iuCi 5 ~5 5I c;
1.e L.eu Gli: Ala (.~ln G1y L~eu Ala G y C'ys G.lu L,eu Arg Arg Pro Pro
515 52U ~ 525
;1.u Asp C'ys 'Ihr r?ro Gly Pro its L~ =a Seer C.'ys Pro Ser Leeu Leu Ser
530 535 540
.pro Cliy my i:jll~ Arg '_'_e
~~45 55U
( 2 ) INFOr:.MATLON r'oR sr~y ID N:~ . : 9
i ) SEQUENCE CriARACT'ERIST C~.~S
(A) LENGTH: 463
(B) 'PYPE: airino a,~id:~
(C') S'I'FtAIQDEDNESS: sinclle
(I)) 'POPOLOGY: linear
.' ? Mt)LEC:CIL~E r'~'PE: !?roC~t-W
;x1) SEQUENCE DESCRIPTI01\:: SEQ ID NC).: 9:
Met His ;:;1y :per Cys Ser Phe r~eu NeC i.,eu :;~eu Leu Pro Leu Leu Leu
1 5 10 15
Leu ?~eu '7a'_ Ala Thr Thr Gly Pro V'al Gly .Ala LE~u Thr A:~p Glu Glu
'..?0 av5 30
Lys Arg ~eu Met Vai Glu Leu II~s t.sn L,eu Tyr Arg Aia Gln Val Ser
3 5 4 0 4'.i
Pro Pro ?~la ,Ser Asp Met Leu H:LS Met. Arg 'I'rr~ A:>p GLu Giu Leu Ala
5() 55 60
Page 16
CA 02426589 2003-05-O1

?003-04-~9-se.~ list (06508-048-C:a-03~
A1a Phe J~la ~,y_~ Al.a Tyr Ala ~lrg GLn Cys Va1 Trp G1y Hi:> Asn Lys
i5 71'.) ?5 80
Glu yrg siiy ArG Arg G.1~y Giu Asr~ L~Ju Phe A1a I1e Thr Asp Glu Gly
85 90 95
Met hasp V<~Pro Leu A1a Met Glu Glu 'I'rp 3~.is His Glu Arg Glu His
a. 0 (~ 1_ () 5 1 1 0
Tyr Asn ~~eu Ser ALa Al.a 'rhr Cys ~:er Pro C;ly GI TI Met Cy:> Gly His
'~1_'> 120 125
~T'~_,~r '~hr !;la ~laVa'_ Trp A1a Lys 'I hr Glu Arg iie Gly Cys Gly Ser
L.sO 1.35 1~*0
His Fhe Cys Glu Lys Leu Gln Gly '.ial G1u Glu Thr Asn Ile Glu Leu
145 150 155 160
Leu 'Ja1 ~Iy>; :'~s.i Tyr Glu Pro Pro <;1.y Asn Va", Ly~~ G:Ly L:ys Arg Pro
16'. 7.70 175
Tf~r ,n ;'1.~.~;ly Thr Pro Cys Seer ()1.n C'ys Prcv Sa-~r G:iy 'Iyr His Cys
180 E.5 1 90
Lys Asn Ser Leu Cys G1u Pro I.Le (rly Ser Pro G2u Asp A1a Gln Asp
1.u5 200 205
Leu Pro Tyr Lea Vai Thr Glu A1a i'ro Ser Phe A.rg A1a 't'rur Glu Ala
210 215 2.20
Sex Asp JE:~r Arg Lya MEet Gl.y Ala !'ro Ser Se.r Leu Ala '?'hr Gl.y Ile
2'?~: 2:;30 23'~ 240
PrcAla Phe Leu Val Thr Gly Val ::per G 1y Ser Leu Pro '~'hr Leu Gly
2.45 ~'S0 255
Leu Fro A:a Val Glu Thr Gln Ala ?ro 'I'hr Ser Leu A1a '_'r~r Lys Asp
260 :65 ~'7C
Pr<: Pro Ser Met Ala '::'hr Glu Ala ~:':ro Pro C:ys val 'I~hr "'Lrr Glu Val
Z .' J 280 285
Prc> Ser I2 a Leu Ala Ala His Ser Leu E~ro Ser Leu Asp ~~l.u Glu Pro
Page 1'7
CA 02426589 2003-05-O1

<:003--04-29--~~eq 7_ist (06508-~t)48-Ca--(:~3>
<;90 295 300
-:,1 ::'hr P~:e Pro 'bias :3er Tr,r Hrs Va , Pro> Ile Pro l:~ys Se_ Ala Asp
t;~~ 3 i(. 37 5 320
yys Val TYr Asp Lys Thr Lys V.~.1. Pro Ser Arg Ser Pro Glu Asn Ser
325 330 335
~eu Asp Pro Lys Met. See- Leu Thr Gl ~ A1a Arg Glu Leu Leu Pro His
340 34'p 35:)
~,la :inn G:.u Glu Ala Glu AIa Glu A1a Glu Leu Pro Prc> Ser Ser Glu
3'5 360 365
~%al Leu ALa Ser -Jai Phe Pra A._la Glrz Asp Lys Pro Gly G1u Leu Gln
370 375 380
Ala 'rhr LeL Asp His 'rhr Gly Iris Tl:r Ser Ser L~y:~ Sez: Leu Pro Asn
v85 39C~ 395 400
?he Pro Asrz '?'hr Ser Ala Thr asla A:;n ~Ia Thr Oly Gl.y Alg Ala Leu
405 4:1.0 415
'~la Leu ~'lr ~er Ser C~eu Fro i;ly A ~~.<~ ;~; a Gl.y Pro Asp Lys Pro Ser
~~ 2 (:~ 4 ? 5 4 .'. 0
Jal Val Ser Gly Leu Asrz Ser ~,ly Pno C~ly His Val. Trp G:.y Pro Leu
4,3 5 440 445
Leu Ctly 1-~eu L,e~.z ~eu L<~u I?ro Pro I-~z=u Val L,eu Ala Gly ILe Phe
450 455 460
Page 18
CA 02426589 2003-05-O1