Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
TITLE OF THE INVENTION
HUMAN HYPERPOLARIZATION-ACTIVATED CYCLIC NUCLEOTIDE-
GATED CATION CHANNEL HCN3
CROSS-REFERENCE TO RELATED APPLICATIONS
Not applicable.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D
Not applicable.
REFERENCE TO MICROFICHE APPENDIX
Not applicable.
FIELD OF THE INVENTION
The present invention is directed to novel human DNA sequences
encoding a hyperpolarization-activated cyclic nucleotide-gated cation channel
(HCN3), proteins encoded by the DNA sequences, methods of expressing the
proteins
in recombinant cells, and methods of identifying activators and inhibitors of
HCN3.
BACKGROUND OF THE INVENTION
The HCN genes encode a family of cation channels that are believed to
carry a current known as Ih or Iq in neural tissue and If in cardiac tissue.
This current
is activated by hyperpolarization beyond about -50 to -70mV, does not
inactivate, is
carried by both Na+ and K+, exhibits a small single channel conductance (about
1pS),
and has the effect of slowly depolarizing a cell toward the Ih reversal
potential of
about -30mV. The voltage dependence of Ih can be modulated by cyclic
nucleotides
such as cAMP or cGMP. The Ih current can contribute significantly to the total
current at subthreshold membrane potentials, and thus can be an important
factor in
the regulation of neuronal firing and cardiac contraction.
Three major roles for the Ih current have been postulated in neurons:
(a) Ih contributes to the cell's resting membrane potential; (b) Ih can
modulate the
summation of synaptic inputs into the neuron, e.g., by counteracting
hyperpolarizing
signals from inhibitory postsynaptic potentials; and (c) Ih contributes to the
-1-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
generation of "pacemaker" or oscillatory activity (i.e., rhythmic, spontaneous
firing of
action potentials).
In the heart, the If current arises following repolarization of an action
potential, which returns the cell to its hyperpolarized resting membrane
potential. In
pacemaker regions of the heart, such as the sinoatrial node, this
hyperpolarization
activates If, which leads to a slow depolarization of the myocyte, eventually
returning
the membrane potential to the action potential threshold, and triggering
another action
potential. The larger the If current, the more rapid the return to the action
potential
threshold and the faster the heart will beat. Agents that stimulate the heart
by
stimulating the (3-adrenergic receptor act, in part, through the If current.
Such agents
lead to an increase in intracellular cAMP which shifts the voltage dependence
of the If
current towards more positive (i.e., depolarized) levels, resulting in faster
entry of this
current into its role in moving the cell back toward the action potential
threshold.
For reviews of the Ih/If current, see Clapham, 1998, Neuron 21:5-7;
Liithi & McCormick, 1998, Neuron 21:9-12; Pape, 1996, Ann. Rev. Physiol.
58:299-
327; DiFrancesco, 1993, Ann. Rev. Physiol. 55:455-472.
Certain HCN genes and their encoded protein products have been
identified. The DNA and deduced amino acid sequences, as well as some
electrophysiological properties, of human HCN2 and human HCN4 have been
disclosed (Vaccari et al., 1999, Biochim. Biophys. Acta 1446:419-425; Seifert
et al.,
1999, Proc. Natl. Acad. Sci. USA 96:9391-9396; Ludwig et al., 1999, EMBO J.
18:2323-2329; GenBanlc accession nos. AF065164 and AJ012582 (HCN2); GenBank
accession nos. AJ132429 and AJ238850 (HCN4)). GenBank accession no.
AF064876 represents a partial HCN1 sequence. Certain fragments of human HCN3
have appeared in certain databases (GenBanlc accession nos. AI571225;
AQ625620).
Full length mouse HCN1, HCN2, and HCN3 have been cloned as has a partial mouse
cDNA encoding HCN4 (Santoro et al., 1998, Cell 93:717-729; Ludwig et al.,
1998,
Nature 393:587-591). Examination of the cDNAs encoding HCN channels revealed
that the HCN proteins represent a family of ion channels having six putative
transmembrane domains (S1-S6) and a CAMP binding domain. Functional expression
of human HCN2 in a kidney cell line produced currents with properties similar
to
those of the heart If current (Vaccari et al., 1999, Biochim. Biophys. Acta
1446:419-
425).
-2-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
It is desirable to discover as wide a variety as possible of novel cation
channels, especially those from humans and those exhibiting restricted tissue
expression. Such novel cation channels would be attractive targets for drug
discovery, useful in counterscreens for a variety of other drug targets, and
would be
valuable research tools for understanding more about ion channel biology.
SUMMARY OF THE INVENTION
The present invention is directed to a novel human DNA sequence
encoding human HCN3, a hyperpolarization-activated cyclic nucleotide-gated
cation
channel. The present invention also includes certain polymorphic variants of
human
HCN3. The present invention includes DNA comprising the nucleotide sequences
shown as SEQ.ID.NOs.:l, 3, and 5 as well as DNA comprising the coding regions
of
SEQ.ID.NOs.:l, 3, and 5. Also provided are proteins encoded by the novel DNA
sequences. The human HCN3 proteins of the present invention comprise the amino
acid sequences shown as SEQ.ID.NOs.:2, 4, and 6 as well as fragments thereof.
Methods of expressing the novel human HCN3 proteins in recombinant systems are
provided. Also provided are methods of using human HCN3 as a drug target by
identifying activators and inhibitors of canon channels comprising human HCN3
proteins. Also provided are methods of using the novel human HCN3 proteins and
DNA encoding these HCN3 proteins in counterscreens for assays designed to
identify
activators and inhibitors of other drug targets.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1A shows a cDNA sequence encoding human HCN3
(SEQ.ID.N0.:1) and Figure 1B shows the corresponding amino acid sequence
(SEQ.ID.NO.:2). The start ATG codon in Figure 1A is at position 9-11; the stop
codon is at position 2331-2333.
Figure 2A shows a cDNA sequence encoding human HCN3 with a
single nucleotide polymorphism (SEQ.117.N0.:3) as compared to (SEQ.ID.N0.:1).
Position 1051 in SEQ:ID.N0.:3 is C rather than G as in SEQ.ID.NO.:1. Figure 2B
shows the amino acid sequence (SEQ.117.N0.:4) encoded by SEQ.ll~.N0.:3.
SEQ.ID.NO.:4 differs from SEQ.1D.N0.:2 in having an A rather than a G at
position
348.
-3-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
Figure 3A shows a cDNA sequence encoding human HCN3 with a
single nucleotide polymorphism (SEQ.ID.N0.:5) as compared to (SEQ.117.N0.:1).
Position 1795 in SEQ.ID.N0.:5 is T rather than G as in SEQ.ID.NO.:1. Figure 3B
shows the amino acid sequence (SEQ.~.N0.:6) encoded by SEQ.ID.N0.:5.
SEQ.ID.N0.:6 differs from SEQ.ID.N0.:2 in having an L rather than an R at
position
596.
Figure 4A-B shows an amino acid sequence alignment of human
HCN3 (HCN3 Hum; SEQ.ID.N0.:2), mouse HCN3 (HCN3 Mus; SEQ.ID.N0.:7;
GenBanlc accession no. AJ225124), and rat HCN3 (HCN3 Rat; SEQ.ID.N0.:8;
GenBanlc accession no. AF247452). The consensus sequence is SEQ.ID.N0.:20.
Figure 5 shows the results of a multi-tissue Northern blot
demonstrating that human HCN3 is expressed in a variety of tissues, including
brain
and heart. Lanes: 1=heart; 2=brain; 3=placenta; 4=lung; 5=liver; 6=skeletal
muscle;
7=kidney; 8=pancreas; 9=spleen; 10=thymus; 11=prostate; 12=testis; 13=ovary;
14=small intestine; 15=colon; 16=peripheral blood leulcocytes.
DETAILED DESCRIPTION OF THE INVENTION
For the purposes of this invention:
"Substantially free from other proteins" means at least 90%, preferably
95%, more preferably 99%, and even more preferably 99.9%, free of other
proteins.
Thus, a human HCN3 protein preparation that is substantially free from other
proteins
will contain, as a percent of its total protein, no more than 10%, preferably
no more
than 5%, more preferably no more than 1%, and even more preferably no more
than
0.1 %, of proteins that are not human HCN3 proteins. Whether a given human
HCN3
protein preparation is substantially free from other proteins can be
determined by
conventional techniques of assessing protein purity such as, e.g., sodium
dodecyl
sulfate polyacrylamide gel electrophoresis (SDS-PAGE) combined with
appropriate
detection methods, e.g., silver staining or immunoblotting.
"Substantially free from other nucleic acids" means at least 90%,
preferably 95%, more preferably 99%, and even more preferably 99.9%, free of
other
nucleic acids. Thus, a human HCN3 DNA preparation that is substantially free
from
other nucleic acids will contain, as a percent of its total nucleic acid, no
more than
10%, preferably no more than 5%, more preferably no more than 1%, and even
more
preferably no more than 0.1%, of nucleic acids that are not human HCN3 nucleic
-4-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
acids. Whether a given human HCN3 DNA preparation is substantially free from
other nucleic acids can be determined by conventional techniques of assessing
nucleic
acid purity such as, e.g., agarose gel electrophoresis combined with
appropriate
staining methods, e.g., ethidium bromide staining.
A "conservative amino acid substitution" refers to the replacement of
one amino acid residue by another, chemically similar, amino acid residue.
Examples
of such conservative substitutions are: substitution of one hydrophobic
residue
(isoleucine, leucine, valine, or methionine) for another; substitution of one
polar
residue for another polar residue of the same charge (e.g., arginine for
lysine;
glutamic acid for aspartic acid); substitution of one aromatic amino acid
(tryptophan,
tyrosine, or phenylalanine) for another.
A polypeptide has "substantially the same biological activity as human
HCN3" if that polypeptide is able to either form a functional cation channel
by itself,
i.e., as a homomultimer, having properties similar to that of human HCN3
channels,
or combine with at least one other canon channel subunit (e.g., HCN1, HCN2, or
HCN4) so as to form a complex that constitutes a functional canon channel
where the
polypeptide confers upon the complex (as compared with the other subunit
alone)
altered electrophysiological or pharmacological properties that are similar to
the
electrophysiological or pharmacological properties that the human HCN3 protein
having SEQ.ID.N0.:2 confers on the complex and where the polypeptide has an
amino acid sequence that is at least about 50°70 identical, preferably
at least about 80%
identical, and even more preferably at least about 95% identical to
SEQ.m.N0.:2
when measured by such standard programs as BLAST or FASTA. See, e.g.,Gish &
States, 1993, Nature Genetics 3:266-272 and Altschul et al., 1990, J. Mol.
Biol.
215:403-410 for examples of sequence comparison programs. For the purposes of
this definition, examples of electrophysiological or pharmacological
properties are:
cation selectivity, voltage dependence of activation and inactivation,
activation
kinetics, reversal potential, and modulation by cyclic nucleotides such as
cAMP or
cGMP.
The present invention relates to the identification and cloning of DNA
encoding the human HCN3 protein. Although cDNAs encoding mouse and rat HCN3
have been isolated, cDNA encoding the complete, correct human HCN3 protein has
not previously been reported. A few ESTs, representing fragmentary sequences
of
human HCN3 (although not identified as HCN3 sequences) have been deposited in
-5-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
databanks. GenBanlc accession no. AI571225 represents an amino terminal
fragment;
AQ625620 represents a 3' genomic sequence.
Other human HCN family members have been deposited. AF064876
represents a partial HCN1 sequence; AF065164 and AJ012582 represent HCN2;
AJ132429 and AJ238850 represent HCN4.
Sequences from HCN family members of certain non-human species
have been deposited in GenBank: AJ225123 (mouse HCNl); AJ247450 (rat HCNl);
AF168122 (rabbit HCNl); AJ225122 (mouse HCN2); AJ225124 (mouse HCN3);
AF247452 (rat HCN3); AF247453 (rat HCN4); AB022927 (rabbit HCN4).
The present invention provides DNA encoding human HCN3 having
SEQ.ID.N0.:1. SEQ.ID.NO.:1 encodes a human HCN3 protein having
SEQ.ID.NO.:2. Other sequence variants of human HCN3 have also been identified.
Two single nucleotide polymorphisms (SNPs) were found in the cDNAs. They are
highlighted and underlined below. In both cases, more than one clone was found
containing each sequence. The resulting amino acids from these polymorphisms
are
also highlighted and underlined.
1. G (SEQ.ID.N0.:1) or C (SEQ.ID.N0.:3) at nucleotide position 1051
1051 (G/C)ACTCATCCA GTCCCTGGAC TCTTCCCGGC GTCAGTACCA GGAGAAGTAC
(SEQ.ID.N0.:9)
resulting in G (SEQ.ID.N0.:2) or A (SEQ.m.N0.:4) at amino acid position 348
301 ALFKAMSHML CIGYGQQAPV GMPDVWLTML SMIVGATCYA MFIGHAT(G/A)LI
(SEQ.ID.NO.:10)
2. G (SEQ.ID.NO.:1) or T (SEQ.ID.N0.:5) at nucleotide position 1795
1751 GGCTCGGGGT GTTCGGGGTC GGGCCCCGAG CACAGGAGCT CAGC G/T TAGTG
(SEQ.ID.NO.:11)
resulting in R (SEQ.ID.N0.:2) or L (SEQ.~.N0.:6) at amino acid position 596
551 NSILQRKRSE PSPGSSGGIM EQHLVQHDRD MARGVRGRAP STGAQ(R/L)SGKP
(SEQ.ID.N0.:12)
Northern blot analyses demonstrated expression of human HCN3 in a
variety of tissues, including brain and heart. This pattern of expression
suggests that
the human HCN3 potassium channel subunit may have therapeutic relevance for
the
-6-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
modulation of cellular excitability in the treatment of neurodegenerative
diseases,
cognitive and sensory disorders, inflammation, pain, cardiac brady- and tachy-
arrhythmias, heart failure, ataxias, fertility disorders, hepatic dysfunction,
pancreatic
disorders (including diabetes), and diabetic neuropathy.
The present invention provides nucleic acids encoding the human
HCN3 hyperpolarization-activated and cyclic nucleotide-gated ration channel
that are
substantially free from other nucleic acids. The nucleic acids may be DNA or
RNA.
The present invention also provides isolated and/or recombinant DNA molecules
encoding the human HCN3 ration channel. The present invention provides DNA
molecules substantially free from other nucleic acids as well as isolated
andlor
recombinant DNA molecules comprising the nucleotide sequence shown in
SEQ.m.NOs.:l, 3, or 5.
The present invention includes isolated DNA molecules as well as
DNA molecules that are substantially free from other nucleic acids comprising
the
coding region of SEQ.m.NOs.:l, 3, or 5. Accordingly, the present invention
includes
isolated DNA molecules and DNA molecules substantially free from other nucleic
acids having a sequence comprising positions 9 to 2330 of SEQ.m.N0.:1, 9 to
2330
of SEQ.m.N0.:3, or 9 to 2330 of SEQ.~.N0.:5.
Also included are recombinant DNA molecules having a nucleotide
sequence comprising positions 9 to 2330 of SEQ.n7.N0.:1, 9 to 2330 of
SEQ.m.N0.:3, or 9 to 2330 of SEQ.~.N0.:5. The novel DNA sequences of the
present invention encoding the human HCN3 protein, in whole or in part, can be
linked with other DNA sequences, i.e., DNA sequences to which DNA encoding the
human HCN3 protein is not naturally linked, to form "recombinant DNA
molecules"
encoding the human HCN3 protein. Such other sequences can include DNA
sequences that control transcription or translation such as, e.g., translation
initiation
sequences, internal ribosome entry sites, promoters for RNA polymerase II,
transcription or translation termination sequences, enhancer sequences,
sequences that
control replication in microorganisms, sequences that confer antibiotic
resistance, or
sequences that encode a polypeptide "tag" such as, e.g., a polyhistidine
tract, the
FLAG epitope, or the myc epitope. The novel DNA sequences of the present
invention can be inserted into vectors such as plasmids, cosmids, viral
vectors, P1
artificial chromosomes, or yeast artificial chromosomes.
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
Included in the present invention are DNA sequences that hybridize to
the reverse complement of SEQ.ID.NO:1 under conditions of high stringency.
Preferably, these sequences encode proteins that have substantially the same
biological activity as human HCN3 protein having SEQ.ID.NO.:2 and that have at
least about 50%, preferably at least about 75%, and even more preferably at
least
about 95% nucleotide sequence identity with SEQ.ID.NO.:l. By way of example,
and
not limitation, a procedure using conditions of high stringency is as follows:
Prehybridization of filters containing DNA is carried out for 2 hr. to
overnight at
65°C in buffer composed of 6X SSC, 5X Denhardt's solution, and 100
~Cglml
denatured salmon sperm DNA. Filters are hybridized for 12 to 48 hrs at
65°C in
prehybridization mixture containing 100 ~xg/ml denatured salmon sperm DNA and
5-
X 106 cpm of 32P-labeled probe. Washing of filters is done at 37°C for
1 hr in a
solution containing 2X SSC, 0.1% SDS. This is followed by a wash in 0.1X SSC,
0.1% SDS at 50°C for 45 min, before autoradiography.
15 Other procedures using conditions of high stringency would include
either a hybridization carried out in 5XSSC, 5X Denhardt's solution, 50%
formamide
at 42°C for 12 to 48 hours or a washing step carried out in 0.2X SSPE,
0.2% SDS at
65°C for 30 to 60 minutes.
Reagents mentioned in the foregoing procedures for carrying out high
20 stringency hybridization are well known in the art. Details of the
composition of
these reagents can be found in, e. g., Sambrook, Fritsch, and Maniatis, 1989,
Molecular Cloning: A Laboratory anual, second edition, Cold Spring Harbor
Laboratory Press. In addition to the foregoing, other conditions of high
stringency
which may be used are well known in the art.
The degeneracy of the genetic code is such that, for all but two amino
acids, more than a single codon encodes a particular amino acid. This allows
for the
construction of synthetic DNA that encodes the human HCN3 protein where the
nucleotide sequence of the synthetic DNA differs significantly from the
nucleotide
sequences of SEQ.ID.N0:1, SEQ.ID.N0:3, or SEQ.ID.NO:5 but still encodes the
same human HCN3 protein as SEQ.TD.NO:l, SEQ.ll~.N0:3, or SEQ.m.N0:5. Such
synthetic DNAs are intended to be within the scope of the present invention.
Mutated forms of SEQ.ID.N0:1, SEQ.ID.N0:3, or SEQ.II7.N0:5 are
intended to be within the scope of the present invention. In particular,
mutated forms
of SEQ.ID.NO:1, SEQ.ID.N0:3, or SEQ.117.NO:5 encoding a protein that forms
_g_
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
cation channels having altered voltage sensitivity, current carrying
properties, or other
properties as compared to cation channels formed by the proteins encoded by
SEQ.ID.N0:1, SEQ.m.N0:3, or SEQ.ID.N0:5, are within the scope of the present
invention. Such mutant fomns can differ from SEQ.ID.NO:1, SEQ.ID.N0:3, or
SEQ.ID.N0:5 by having nucleotide deletions, substitutions, or additions.
Also intended to be within the scope of the present invention are RNA
molecules having sequences corresponding to SEQ.ID.NO:1, SEQ.ID.N0:3, or
SEQ.ll~.N0:5 or corresponding to the coding regions of SEQ.ID.NO:l,
SEQ.ID.NO:3, or SEQ.ID.N0:5. The RNA molecules can be substantially free from
other nucleic acids or can be isolated and/or recombinant RNA molecules.
Antisense nucleotides, DNA or RNA, that are the reverse complements
of SEQ.ID.NO:1, SEQ.ID.N0:3, or SEQ.ID.NO:S, or portions thereof, are also
within
the scope of the present invention.
In addition, polynucleotides based on SEQ.ID.NO:1, SEQ.ID.N0:3, or
SEQ.ID.N0:5 in which a small number of positions are substituted with non-
natural
or modified nucleotides such as inosine, methyl-cytosine, or deaza-guanosine
are
intended to be within the scope of the present invention. Polynucleotides of
the
present invention can also include sequences based on SEQ.ID.NO:1,
SEQ.ID.N0:3,
or SEQ.ID.N0:5 but in which non-natural linkages between the nucleotides are
present. Such non-natural linkages can be, e.g., methylphosphonates,
phosphorothioates, phosphorodithionates, phosphoroamidites, and phosphate
esters.
Polynucleotides of the present invention can also include sequences based on
SEQ.ID.N0:1, SEQ.m.N0:3, or SEQ.ff~.N0:5 but having de-phospho linkages as
bridges between nucleotides, e.g., siloxane, carbonate, carboxymethyl ester,
acetamidate, carbamate, and thioether bridges. Other internucleotide linkages
that can
be present include N-vinyl, methacryloxyethyl, methacrylamide, or
ethyleneimine
linkages. Peptide nucleic acids based upon SEQ.~.NO:1, SEQ.ID.N0:3, or
SEQ.ID.NO:S are also included in the present invention. Generally, such
polynucleotides comprising non-natural or modified nucleotides and/or non-
natural
linlcages between the nucleotides, as well as peptide nucleic acids, will
encode the
same, or highly similar, proteins as are encoded by SEQ.ID.NO: l, SEQ.ID.N0:3,
or
SEQ.TD.N0:5.
Another aspect of the present invention includes host cells that have
been engineered to contain andlor express DNA sequences encoding the human
-9-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
HCN3 protein. Such recombinant host cells can be cultured under suitable
conditions
to produce human HCN3 protein. An expression vector comprising DNA encoding
human HCN3 protein can be used for the expression of human HCN3 protein in a
recombinant host cell. Recombinant host cells may be prokaryotic or
eulcaryotic,
including but not limited to, bacteria such as E. coli, fungal cells such as
yeast,
mammalian cells including, but not limited to, cell lines of human, bovine,
porcine,
monkey and rodent origin, amphibian cells such as Xefaopus oocytes, and insect
cells
including but not limited to Drosoplzila and silkworm derived cell lines
(e.g.,
Spodoptera fr-ugiperda). Cells and cell lines which are suitable for
recombinant
expression of human HCN3 protein and which are widely available, include but
are
not limited to, L cells L-M(TK-) (ATCC CCL 1.3), L cells L-M (ATCC CCL 1.2),
HEK 293 (ATCC CRL 1573), Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1
(ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-Kl (ATCC CCL 61), 3T3
(ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC
CRL 1616), BS-C-1 (ATCC CCL 26), MRC-5 (ATCC CCL 171), CPAE (ATCC
CCL 209), Saos-2 (ATCC HTB-85), ARPE-19 human retinal pigment epithelium
(ATCC CRL-2302), Xe~2opus melanophores, and Xenopus oocytes.
A variety of mammalian expression vectors can be used to express
recombinant human HCN3 protein in mammalian cells. Commercially available
mammalian expression vectors which are suitable include, but are not limited
to,
pMClneo (Stratagene), pSG5 (Stratagene), pcDNAI and pcDNAIamp, pcDNA3,
pcDNA3.1, pCR3.1 (Invitrogen), EBO-pSV2-neo (ATCC 37593), pBPV-1(8-2)
(ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199),
pRSVneo (ATCC 37198), pIZD35 (ATCC 37565), and pSV2-dhfr (ATCC 37146).
Another suitable vector is the PT7TS oocyte expression vector.
Following expression in recombinant cells, human HCN3 protein can
be purified by conventional techniques to a level that is substantially free
from other
proteins. Techniques that can be used include ammonium sulfate precipitation,
hydrophobic or hydrophilic interaction chromatography, ion exchange
chromatography, affinity chromatography, phosphocellulose chromatography, size
exclusion chromatography, preparative gel electrophoresis, and alcohol
precipitation.
In some cases, it may be advantageous to employ protein denaturing and/or
refolding
steps in addition to such techniques.
-10-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
Certain ion channel subunit proteins have been found to require the
expression of other ion channel subunits in order to be properly expressed at
high
levels and inserted in membranes. For example, co-expression of KCNQ3 appears
to
enhance the expression of KCNQ2 in Xe~zopus oocytes (Wang et al., 1998,
Science
282:1890-1893). Also, some voltage-gated potassium channel Kvcc subunits
require
other related cc subunits or Kv(3 subunits (Shi et al., 1995, Neuron 16:843-
852).
Accordingly, the recombinant expression of human HCN3 proteins may under
certain
circumstances benefit from the co-expression of other ion channel proteins and
such
co-expression is intended to be within the scope of the present invention.
Such co-
expression can be effected by transfecting an expression vector encoding human
HCN3 protein into a cell that naturally expresses another ion channel protein.
Alternatively, an expression vector encoding human HCN3 protein can be
transfected
into a cell in which an expression vector encoding another ion channel protein
has
also been transfected. Preferably, such a cell does not naturally express
human HCN3
subunit proteins or the other ion channel protein. Co-expression of human HCN3
with other HCN family proteins such as HCN1, HCN2, or HCN4 may be of benefit.
In addition, since these ration channels are also modulated by cyclic
nucleotides, co-
expresion of HCN3 with other types of receptors, such as those that control
levels of
intracellular cyclic nucleotides (e.g., the beta adrenergic receptor) may also
be of
benefit and is also within the scope of the present invention.
The present invention includes human HCN3 proteins substantially
free from other proteins. The amino acid sequences of full-length human HCN3
subunit proteins are shown in SEQ.117.NOs.:2, 4, and 6. Thus, the present
invention
includes human HCN3 protein substantially free from other proteins comprising
an
amino acid sequence selected from the group consisting of SEQ.ID.NOs.:2, 4,
and 6.
The present invention also includes isolated human HCN3 protein comprising an
amino acid sequence selected from the group consisting of SEQ.)D.NOs.:2, 4,
and 6.
Mutated forms of human HCN3 proteins are intended to be within the
scope of the present invention. In particular, mutated forms of SEQ.ID.NOs:2,
4, or 6
that form ration channels having altered electrophysiological or
pharmacological
properties as compared to potassium channels formed by SEQ.ID.NOs:2, 4, or 6
are
within the scope of the present invention.
As with many proteins, it may be possible to modify many of the
amino acids of the human HCN3 protein and still retain substantially the same
-11-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
biological activity as for the original protein. Thus, the present invention
includes
modified human HCN3 proteins which have amino acid deletions, additions, or
substitutions but that still retain substantially the same biological activity
as naturally
occurring human HCN3 proteins. It is generally accepted that single amino acid
substitutions do not usually alter the biological activity of a protein (see,
e.g.,
Molecular Biol~w of the Gene, Watson et al., 1987, Fourth Ed., The
Benjamin/Cummings Publishing Co., Inc., page 226; and Cunningham & Wells,
1989, Science 244:1081-1085). Accordingly, the present invention includes
polypeptides where one amino acid substitution has been made in SEQ.ID.NOs:2,
4,
or 6 wherein the polypeptides still retain substantially the same biological
activity as
naturally occurnng human HCN3 proteins. The present invention also includes
polypeptides where two or more amino acid substitutions have been made in
SEQ.ID.NOs:2, 4, or 6 wherein the polypeptides still retain substantially the
same
biological activity as naturally occurring human HCN3 proteins. In particular,
the
present invention includes embodiments where the above-described substitutions
are
conservative substitutions. In particular, the present invention includes
embodiments
where the above-described substitutions do not occur in conserved positions.
Conserved positions are those positions in which the human HCN3 protein having
SEQ.~.N0:2, the mouse HCN3 protein (SEQ.ID.N0:7), and the rat HCN3 protein
(SEQ.ID.N0:8) share the same amino acid (see Figure 4).
The human HCN3 proteins of the present invention may contain post-
translational modifications, e.g., covalently linked carbohydrate,
phosphorylation,
myristoylation, palmytoylation.
The present invention also includes chimeric human HCN3 proteins.
Chimeric human HCN3 proteins consist of a contiguous polypeptide sequence of
at
least a portion of a human HCN3 protein fused to a polypeptide sequence that
is not
from a human HCN3 protein. The portion of the human HCN3 protein must include
at least 10, preferably at least 25, and most preferably at least 50
contiguous amino
acids from SEQ.ID.N0:2, 4, or 6.
The present invention also includes isolated human HCN3 protein and
isolated DNA encoding human HCN3 protein. Use of the term "isolated" indicates
that the human HCN3 protein or DNA has been removed from its normal cellular
environment. Thus, an isolated human HCN3 protein may be in a cell-free
solution or
placed in a different cellular environment from that in which it occurs
naturally. The
-12-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
term isolated does not necessarily imply that an isolated human HCN3 protein
is the
only, or predominant, protein present (although that is one of the meanings of
isolated), but instead means that the isolated human HCN3 protein is at least
95% free
of non-amino acid material (e.g., nucleic acids, lipids, carbohydrates)
naturally
associated with the human HCN3 protein.
It is known that certain ion channel subunits can interact to form
heteromeric complexes resulting in functional ion channels. For example, KCNQ2
and KCNQ3 can assemble to form a heteromeric functional potassium channel
(Wang
et al., 1998, Science 282:1890-1893). Accordingly, it is believed that the
human
HCN3 proteins of the present invention may also be able to form heteromeric
structures with other proteins where such heteromeric structures form
functional ion
channels. Thus, the present invention includes such heteromers comprising
human
HCN3 protein. Preferred heteromers are those in which the human HCN3 protein
forms heteromers with at least one other HCN family member, e.g., HCN1, HCN2,
or
HCN4. Preferably, the other HCN family member is a human HCN family member.
DNA encoding human HCN3 proteins can be obtained by methods
well known in the art. For example, a cDNA fragment encoding full-length human
HCN3 protein can be isolated from human brain or heart cDNA by using the
polymerase chain reaction (PCR) employing suitable primer pairs. Such primer
pairs
can be selected based upon the DNA sequences encoding the human HCN3 proteins
shown in Figures 1-3 as SEQ.ID.NOs.: l, 3, and 5. Suitable primer pairs would
be,
e.g.:
5' TGGGCGCCAT GGAGGCAGAGC 3' (SEQ.ID.NO.:13)
5' AAAGGTTTTACATGTTGGC 3' (SEQ.ll~.N0.:14)
The above primers are meant to be illustrative only; one skilled in the
art would readily be able to design other suitable primers based upon
SEQ.ID.NOs.:l,
3, and 5. Such primers could be produced by methods of oligonucleotide
synthesis
that are well known in the art.
PCR reactions can be carried out with a variety of thermostable
enzymes including but not limited to AmpliTaq, AmpliTaq Gold, or Vent
polymerase.
For AmpliTaq, reactions can be carried out in 10 mM Tris-Cl, pH 8.3, 2.0 mM
MgCl2, 200 ~.M of each dNTP, 50 mM KCI, 0.2 ~.M of each primer, 10 ng of DNA
-13-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
template, 0.05 units/~.1 of AmpliTaq. The reactions are heated at 95°C
for 3 minutes
and then cycled 35 times using the cycling parameters of 95°C, 20
seconds, 62°C, 20
seconds, 72°C, 3 minutes. In addition to these conditions, a variety of
suitable PCR
protocols can be found in PCR Primer, A Laboratory Manual, edited by C.W.
Dieffenbach and G.S. Dveksler, 1995, Cold Spring Harbor Laboratory Press; or
PCR
Protocols: A Guide to Methods and Applications, Michael et al., eds., 1990,
Academic Press.
Since the human HCN3 proteins of the present invention are
homologous to other cation channel subunit proteins, it is desirable to
sequence the
clones obtained by the herein-described methods, in order to verify that the
desired
human HCN3 protein has in fact been obtained. Sequencing is also advisable in
order
to ensure that one has obtained the desired cDNA from among SEQ.ID.NO:1, 3,
and
5.
By these methods, cDNA clones encoding human HCN3 proteins can
be obtained. These cDNA clones can be cloned into suitable cloning vectors or
expression vectors, e.g., the mammalian expression vector pcDNA3.1
(Invitrogen,
San Diego, CA). Human HCN3 protein can then be produced by transferring
expression vectors encoding human HCN3 or portions thereof into suitable host
cells
and growing the host cells under appropriate conditions. Human HCN3 protein
can
then be isolated by methods well known in the art.
As an alternative to the above-described PCR methods, cDNA clones
encoding human HCN3 proteins can be isolated from cDNA libraries using as a
probe
oligonucleotides specific for human HCN3 and methods well known in the art for
screening cDNA libraries with oligonucleotide probes. Such methods are
described
in, e.g., Sambrook et al., 1989, Molecular Clofaing: A Laboratory Ma~zual;
Cold
Spring Harbor Laboratory, Cold Spring Harbor, New York; Glover, D.M. (ed.),
1985,
DNA Cloniszg: A Practical Approach, MRL Press, Ltd., Oxford, U.K., Vol. I, II.
Oligonucleotides that are specific for human HCN3 and that can be used to
screen
cDNA libraries can be readily designed based upon the DNA sequences shown in
30. Figures 1-3 (viz., SEQ.ID.NOs:l, 3, and 5) and can be synthesized by
methods well-
known in the art.
Genomic clones containing the human HCN3 gene can be obtained
from commercially available human PAC or BAC libraries from suppliers such as,
e.g., Research Genetics, Huntsville, AL. Alternatively, one may prepare
genomic
-14-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
libraries, e.g., in P1 artificial chromosome vectors, from which genomic
clones
containing the human HCN3 gene can be isolated, using probes based upon the
human HCN3 DNA sequences disclosed herein. Methods of preparing such libraries
are known in the art (see, e.g., Ioannou et a1.,1994, Nature Genet. 6:84-89).
The novel DNA sequences of the present invention can be used in
various diagnostic methods. The present invention provides diagnostic methods
for
determining whether a patient carries a mutation in the human HCN3 gene. In
broad
terms, such methods comprise determining the DNA sequence of a region in or
near
the human HCN3 gene from the patient and comparing that sequence to the
sequence
from the corresponding region of the human HCN3 gene from a non-affected
person,
i.e., a person who does not have the condition which is being diagnosed, where
a
difference in sequence between the DNA sequence of the gene from the patient
and
the DNA sequence of the gene from the non-affected person indicates that the
patient
has a mutation in the human HCN3 gene.
The present invention also provides oligonucleotide probes, based
upon SEQ.ID.NOs: l, 3, or 5 that can be used in diagnostic methods to identify
patients having mutated forms of the human HCN3 gene, to determine the level
of
expression of RNA encoding human HCN3, or to isolate genes homologous to human
HCN3 from other species. In particular, the present invention includes DNA
oligonucleotides comprising at least about 10, 15, or 18 (but not more than
100)
contiguous nucleotides of SEQ.)D.NOs:l, 3, or 5 where the oligonucleotide
probe
comprises no stretch of contiguous nucleotides longer than 5 from:
SEQ.ID.NOs:l, 3,
or 5 other than the said at least about 10, 15, or 18 contiguous nucleotides.
The
oligonucleotides can be substantially free from other nucleic acids. Also
provided by
the present invention are corresponding RNA oligonucleotides. The DNA or RNA
oligonucleotides can be packaged in lcits.
The present invention makes possible the recombinant expression of
human HCN3 protein in various cell types. Such recombinant expression
facilitates
the study of this protein so that its biochemical activity and its possible
role in various
diseases such as neurodegenerative diseases, cognitive and sensory disorders,
pain,
cardiac brady- and tachy-arrhythmias, ataxias, fertility disorders, hepatic
dysfunction,
pancreatic disorders (including diabetes), inflamnnation, heart failure, and
diabetic
neuropathy can be elucidated.
-15-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
The present invention also makes possible the development of assays
which measure the biological activity of cation channels containing human HCN3
protein. Assays using recombinantly expressed human HCN3 protein are
especially
of interest. Such assays can be used to screen libraries of compounds or other
sources
of compounds to identify compounds that are activators or inhibitors of the
activity of
canon channels containing human HCN3 protein. Such identified compounds can
serve as "leads" for the development of pharmaceuticals that can be used to
treat
patients having diseases in which it is beneficial to enhance or suppress
cation
channel activity.
In versions of the above-described assays, cation channels containing
mutant human HCN3 proteins are used and inhibitors or activators of the
activity of
the mutant cation channels are identified.
Preferred cell lines for recombinant expression of human HCN3
proteins are those which do not express endogenous cation channels. Cell lines
expressing recombinant human HCN3 can be exposed to and loaded with g6Rb, an
ion which can substitute for potassium in many ion channels. The efflux of
~6Rb out
of such cells can be assayed in the presence and absence of collections of
substances
(e.g., combinatorial libraries, natural products, analogues of lead compounds
produced by medicinal chemistry), or members of such collections, and those
substances that are able to alter $6Rb efflux thereby identified. Such
substances are
likely to be activators or inhibitors of cation channels containing human HCN3
protein.
Activators and inhibitors of canon channels containing human HCN3
proteins are likely to be substances that are capable of binding to cation
channels
containing human HCN3 proteins. Thus, one type of assay determines whether one
or
more of a collection of substances is capable of such binding.
Accordingly, the present invention provides a method of identifying
substances that bind to cation channels containing human HCN3 protein
comprising:
(a) providing cells expressing a cation channel containing human
HCN3 protein;
(b) exposing the cells to a substance that is not known to bind
cation channels containing human HCN3 protein;
(c) determining the amount of binding of the substance to the cells;
-16-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
(d) comparing the amount of binding in step (c) to the amount of
binding of the substance to control cells where the control cells are
substantially
identical to the cells of step (a) except that the control cells do not
express human
HCN3 protein;
where if the amount of binding in step (c) is greater than the amount of
binding of the substance to control cells, then the substance binds to cation
channels
containing human HCN3 protein.
An example of control cells that are substantially identical to the cells
of step (a) would be a parent cell line where the parent cell line is
transfected with an
expression vector encoding human HCN3 protein in order to produce the cells
expressing a canon channel containing human HCN3 protein of step (a).
Another version of this assay malces use of compounds that are known
to bind to cation channels containing human HCN3 protein. Substances that are
new
binders are identified by virtue of their ability to augment or block the
binding of
these known compounds. This can be done if the known compound is used at a
concentration that is far below saturation, in which case a substance that is
a new
binder is likely to be able to either augment or block the binding of the
known
compound. Substances that have this ability are likely themselves to be
inhibitors or
activators of cation channels containing human HCN3 protein.
Accordingly, the present invention includes a method of identifying
substances that bind cation channels containing human HCN3 protein and thus
are
likely to be inhibitors or activators of canon channels containing human HCN3
protein comprising:
(a) providing cells expressing cation channels containing human
HCN3 protein;
(b) exposing the cells to a compound that is known to bind to the
cation channels containing human HCN3 protein in the presence and in the
absence of
a substance not known to bind to canon channels containing human HCN3 protein;
(c) determining the amount of binding of the compound to the
cells in the presence and in the absence of the substance;
where if the amount of binding of the compound in the presence of the
substance differs from that in the absence of the substance, then the
substance binds
catian channels containing human HCN3 protein and is likely to be an inhibitor
or
activator of canon channels containing human HCN3 protein.
-17-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
Generally, the known compound is labeled (e.g., radioactively,
enzymatically, fluorescently) in order to facilitate measuring its binding to
the canon
channels.
Once a substance has been identified by the above-described methods,
it can be assayed in functional tests, such as those described herein, in
order to
determine whether it is an inhibitor or an activator.
In particular embodiments, the compound known to bind potassium
channels containing human HCN3 protein is selected from the group consisting
of:
ZD7288 and L-cis-diltiazem.
The present invention includes a method of identifying activators or
inhibitors of cation channels containing human HCN3 protein comprising:
(a) recombinantly expressing human HCN3 protein in a host cell
so that the recombinantly expressed human HCN3 protein forms canon channels
either by itself or by forming heteromers with other canon channel subunit
proteins;
(b) measuring the biological activity of the cation channels formed
in step (a) in the presence and in the absence of a substance not known to be
an
activator or an inhibitor of cation channels containing human HCN3 protein;
where a change in the biological activity of the cation channels formed
in step (a) in the presence as compared to the absence of the substance
indicates that
the substance is an activator or an inhibitor of cation channels containing
human
HCN3 protein.
In particular embodiments of the methods described herein, the
biological activity is the conduction of a mixed Na+/K+ current or the efflux
of 86Rb.
In particular embodiments, it may be advantageous to recombinantly
'~5 express the other subunits of cation channels. Alternatively, it may be
advantageous
to use host cells that endogenously express such other subunits. Other
subunits may
be other HCN family members such as HCN1, HCN2, or HCN4, particularly other
human HCN family members.
In particular embodiments, a vector encoding human HCN3 protein is
transferred into Xeoopus oocytes in order to cause the expression of human
HCN3
protein in the oocytes. Alternatively, RNA encoding human HCN3 protein can be
prepared irz vitr~ and injected into the oocytes, also resulting in the
expression of
human HCN3 protein in the oocytes. Following expression of the human HCN3
protein in the oocytes, and following the formation of canon channels
containing
-18-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
human HCN3, membrane currents are measured after the transmembrane voltage is
changed in steps. A change in membrane current is observed when the ration
channels containing human HCN3 open or close, modulating sodium and potassium
ion flow. Similar studies were reported for KCNQ2 and, KCNQ3 potassium
channels
in Wang et al., 1998, Science 282:1890-1893 and for Minx channels by Goldstein
&
Miller, -1991, Neuron 7:403-408. These references and references cited therein
can be
consulted for guidance as to how to carry out such studies. In such studies it
may be
advantageous to co-express other ration channel subunit proteins (e.g., HCNl,
HCN2,
or HCN4) in addition to human HCN3 in the oocytes.
Inhibitors or activators of ration channels containing human HCN3
protein can be identified by exposing the oocytes to individual substances or
collections of substances and determining whether the substances can
blockldiminish
or enhance the membrane currents observed in the absence of the substance.
Accordingly, the present invention provides a method of identifying
inhibitors or activators of canon channels containing human HCN3 protein
comprising:
(a) expressing human HCN3 protein in cells such that ration
channels containing human HCN3 protein are formed;
(b) changing the transmembrane potential of the cells in step (a)
from a potential where the ration channels containing human HCN3 protein are
closed to a potential where ration channels containing human HCN3 protein are
open
in the presence and the absence of a substance not known to be an inhibitor or
an
activator of ration channels containing human HCN3 protein;
(c) measuring mixed sodium/potassium currents following step
(b);
where if the mixed sodium/potassium currents measured in step (c) are
less in the presence rather than in the absence of the substance, then the
substance is
an inhibitor of ration channels containing human HCN3 protein;
where if the mixed sodium/potassium currents measured in step (c) are
greater in the presence rather than in the absence of the substance, then the
substance
is an activator of ration channels containing human HCN3 protein.
In general, for step (b), the potential where the ration channels
containing human HCN3 protein are closed will be a depolarized potential and
the
19-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
potential where cation channels containing human HCN3 protein are open will be
a
hyperpolarized potential.
The method described above can be practiced by the use of techniques
that are well known in the art such as voltage clamp studies or patch clamp
studies.
Alternatively, where the cells contain a ~i-adrenergic receptor as well as the
HCN3
channel, instead of changing the membrane potential by voltage clamp to turn
on the
HCN3 current, the potential can be held steady and a (3-adrenergic receptor
agonist
can be added to the cells. This should increase cAMP concentration and turn on
the
HCN3 channel. One could then assay for activators and inhibitors in the same
way as
above by looking at the currents pluslminus the compounds.
The present invention also includes assays for the identification of
activators and inhibitors of cation channels containing human HCN3 protein
that are
based upon fluorescence resonance energy transfer (FRET) between a first and a
second fluorescent dye where the first dye is bound to one side of the plasma
membrane of a cell expressing cation channels containing human HCN3 protein
and
the second dye is free to shuttle from one face of the membrane to the other
face in
response to changes in membrane potential. In certain embodiments, the first
dye is
impenetrable to the plasma membrane of the cells and is bound predominately to
the
extracellular surface of the plasma membrane. The second dye is trapped within
the
plasma membrane but is free to diffuse within the membrane. At polarized
(i.e.,
negative) resting potentials of the membrane, the second dye is bound
predominately
to the inner surface of the extracellular face of the plasma membrane, thus
placing the
second dye in close proximity to the first dye. This close proximity allows
for the
generation of a large amount of FRET between the two dyes. At depolarized
potentials, the second dye moves from the extracellular face of the membrane
to the
intracellular face, thus increasing the distance between the dyes. This
increased
distance results in a decrease in FRET, with a corresponding increase in
fluorescent
emission derived from the first dye and a corresponding decrease in the
fluorescent
emission from the second dye. In this way, the amount of FRET between the two
dyes can be used to measure the polarization state of the membrane. For a
description
of this technique, see Gonzalez & Tsien, 1997, Chemistry & Biology 4:269-277.
See
also Gonzalez & Tsien, 1995, Biophys. J. 69:1272-1280 and U.S. Patent No.
5,661,035.
-20-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
In certain embodiments, the first dye is a fluorescent lectin or a
fluorescent phospholipid that acts as the fluorescent donor. Examples of such
a first
dye are: a coumarin-labeled phosphatidylethanolamine (e.g., N-(6-chloro-7-
hydroxy-
2-oxo-2H--1-benzopyran-3-carboxamidoacetyl)-dimyristoylphosphatidyl-
ethanolamine) or N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-
dipalmitoylphosphatidylethanolamine); a fluorescently-labeled lectin (e.g.,
fluorescein-labeled wheat germ agglutinin). In certain embodiments, the second
dye
is an oxonol that acts as the fluorescent acceptor. Examples of such a second
dye are:
bis(1,3-diallcyl-2-thiobarbiturate)trimethineoxonols (e.g., bis(1,3-dihexyl-2-
thiobarbiturate)trimethineoxonol) or pentamethineoxonol analogues (e.g.,
bis(1,3-
dihexyl-2-thiobarbiturate)pentamethineoxonol; or bis(1,3-dibutyl-2-
thiobarbiturate)pentamethineoxonol). See Gonzalez & Tsien, 1997, Chemistry &
Biology 4:269-277 for methods of synthesizing various dyes suitable for use in
the
present invention. In certain embodiments, the assay may comprise a natural
carotenoid, e.g., astaxanthin, in order to reduce photodynamic damage due to
singlet
oxygen.
The above described assays can be utilized to discover activators and
inhibitors of cation channels containing human HCN3 protein. Such assays will
generally utilize cells that express cation channels containing human HCN3
protein,
e.g., by transfection with expression vectors encoding human HCN3 protein and,
optionally, other cation channel subunits.
The cellular membrane potential is determined by the balance between
inward (depolarizing) and outward (repolarizing) ionic fluxes through various
ion
pumps and channels. FRET based assays could be developed by co-expressing HCN3
containing cation channels with an inward rectifier potassium channel. The
inward
rectifier will allow potassium efflux from the cell, which tends to stabilize
the
membrane potential near the potassium equilibrium potential, Eg, (typically
about
-80 mV). When human HCN3 is expressed in cells having a resting membrane
potential lower than about -30mV, especially cells having resting membrane
potentials lower than about -50 to -70mV, the channels formed by human HCN3
will
be open and will tend to pass a cation current into the cell, thus tending to
depolarize
the membrane potential. The presence of an inhibitor of a cation channel
containing
human HCN3 will prevent, or diminish, the ability of HCN3 to depolarize the
membrane potential. Thus, membrane potential will remain negative (i.e.,
-21-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
hyperpolarized) in the presence of human HCN3 inhibitors. Such changes in
membrane potential that are caused by inhibitors of potassium channels
containing
human HCN3 protein can be monitored by the assays using FRET described above.
Accordingly, the present invention provides a method of identifying
inhibitors of cation channels containing human HCN3 protein comprising:
(a) providing cells comprising:
(1) an expression vector that directs the expression of
human HCN3 protein in the cells so that cation channels containing human HCN3
protein are formed in the cells and where the cells have a resting membrane
potential
lower than about -30mV;
(2) a first fluorescent dye, where the first dye is bound to
one side of the plasma membrane of the cells; and
(3) a second fluorescent dye, where the second fluorescent
dye is free to distribute from one face of the plasma membrane of the cells to
the other
face in response to changes in membrane potential;
(b) exposing the cells to a substance;
(c) measuring the amount of fluorescence resonance energy
transfer (FRET) in the cells in the presence and in the absence of the
substance;
(d) comparing the amount of FRET exhibited by the cells in the
presence and in the absence of the substance;
where if the amount of FRET exhibited by the cells in the presence of
the substance is greater than the amount of FRET exhibited by the cells in the
absence
of the substance then the substance is an inhibitor of potassium channels
containing
human HCN3 protein.
If the cells are exposed to a substance that is an activator (rather than
an inhibitor) of cation channels containing human HCN3 protein, then the HCN3
channels will pass more current into the cell, tending to move the membrane
potential
to a more positive (i.e., depolarized) level. This depolarization can also be
monitored
by the FRET assays described above.
Accordingly, the present invention provides a method of identifying
activators of cation channels containing human HCN3 protein comprising:
(a) providing cells comprising:
(1) an expression vector that directs the expression of
human HCN3 protein in the cells so that cation channels containing human HCN3
-22-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
protein are formed in the cells and where the cells have a resting membrane
potential
lower than about -30mV;
(2) a first fluorescent dye, where the first dye is bound to
one side of the plasma membrane of the cells; and
(3) a second fluorescent dye, where the second fluorescent
dye is free to distribute from one face of the plasma membrane of the cells to
the other
face in response to changes in membrane potential;
(b) exposing the cells to a substance;
(c) measuring the amount of fluorescence resonance energy
transfer (FRET) in the cells in the presence and in the absence of the
substance;
(d) comparing the amount of FRET exhibited by the cells in the
presence and in the absence of the substance;
where if the amount of FRET exhibited by the cells in the presence of
the substance is less than the amount of FRET exhibited by the cells in the
absence of
the substance then the substance is an inhibitor of potassium channels
containing
human HCN3 protein.
As an alternative way of ensuring that the ion channels containing
human HCN3 protein are turned on, one can utilize cells containing a (3-
adrenergic
receptor and expose those cells to an agonist of the (3-adrenergic receptor.
This will
cause an increase in cAMP concentration in the cells and thus opening the ion
channels containing human HCN3 protein. Further exposing such cells to
substances
that are inhibitors of ion channels containing human HCN3 protein will close
those
channels, leading to a hyperpolarization of the cells' membrane potentials.
This
hyperpolarization can be measured by FRET-based assays.
Accordingly, the present invention includes a method of identifying
inhibitors of ion channels containing human HCN3 protein comprising:
(a) providing cells comprising:
(1) an expression vector that directs the expression of
human HCN3 protein in the cells so that ion channels containing human HCN3
protein are formed in the cells;
(2) a (3-adrenergic receptor;
(3) a first fluorescent dye, where the first dye is bound to
one side of the plasma membrane of the cells; and
- 23 -
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
(4) a second fluorescent dye, where the second fluorescent
dye is free to distribute from one face of the plasma membrane of the cells to
the other
face in response to changes in membrane potential;
(b) exposing the cells to an agonist of the (3-adrenergic receptor so
that the cAMP concentration in the cells increases to a level such that the
cation
channels containing human HCN3 protein are open;
(c) exposing the cells to a substance;
(d) measuring the amount of fluorescence resonance energy
transfer (FRET) in the cells in the presence and in the absence of the
substance;
(e) comparing the amount of FRET exhibited by the cells in the
presence and in the absence of the substance;
where if the amount of FRET exhibited by the cells in the presence of
the substance is greater than the amount of FRET exhibited by the cells in the
absence
of the substance then the substance is an inhibitor of ion channels containing
human
HCN3 protein.
In particular embodiments of the above-described methods, the cells
also express an inward rectifier potassium channel, either endogenously (e.g.,
RBL
cells) or recombinantly (e.g., as a result of having been transfected with an
expression
vector encoding the inward rectifier potassium channel). In such embodiments,
it is
desirable to perform control experiments to rule out the possibility that the
substances
identified are actually agonists of the inward rectifier potassium channel
rather than
inhibitors of potassium channels containing human HCN3 protein. This can be
done
by expressing the HCN3 protein or the inward rectifier potassium channel
individually in cells and testing the effect of the substances on the HCN3
protein and
the inward rectifier potassium channel by patch clamp techniques.
As another type of control experiment, in order to be sure that the
effect of the substance in the above-described assays is arising through its
action at
canon channels containing human HCN3 protein, experiments can be run in which
the cells are as above, except that they do not contain an expression vector
that directs
the expression of human HCN3 protein.
In particular embodiments of the above-described methods, the
expression vectors are transfected into the test cells.
In particular embodiments of the above-described methods, the human
HCN3 protein has an amino acid sequence selected from the group consisting of
-24-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
SEQ.ID.NOs.:2, 4, and 6. In particular embodiments of the above-described
methods,
the expression vector comprises positions 9 to 2330 of SEQ.ID.NO.:1, 9 to 2330
of
SEQ.ID.N0.:3, or 9 to 2330 of SEQ.ID.N0.:5.
In particular embodiments of the above-described methods, the first
fluorescent dye is selected from the group consisting of: a fluorescent
lectin; a
fluorescent phospholipid; a coumarin-labeled phosphatidylethanolamine; N-(6-
chloro-
7-hydroxy-2-oxo-2H--1-benzopyran-3-carboxamidoacetyl)-dimyristoylphosphatidyl-
ethanolamine); N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-
dipalmitoylphosphatidylethanolamine); and fluorescein-labeled wheat germ
agglutinin.
In particular embodiments of the above-described methods, the second
fluorescent dye is selected from the group consisting of: an oxonol that acts
as the
fluorescent acceptor; bis(1,3-dialkyl-2-thiobarbiturate)trimethineoxonols;
bis(1,3-
dihexyl-2-thiobarbiturate)trimethineoxonol; bis(1,3-dialkyl-2-thiobarbiturate)
quatramethineoxonols; bis(1,3-dialkyl-2-thiobarbiturate)pentamethineoxonols;
bis(1,3-dihexyl-2-thiobarbiturate)pentamethineoxonol; bis(1,3-dibutyl-2
thiobarbiturate)pentamethineoxonol); and bis(1,3-diallcyl-2-
thiobarbiturate)hexamethineoxonols.
In a particular embodiment of the above-described methods, the cells
are eulcaryotic cells. In another embodiment, the cells are mammalian cells,
preferably human cells. In other embodiments, the cells are L cells L-M(TK-)
(ATCC
CCL 1.3), L cells L-M (ATCC CCL 1.2), HEK 293 (ATCC CRL 1573), Raji (ATCC
CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL
1651), CHO-Kl (ATCC CCL 61), 3T3 (ATCC CCL 92), NIHi3T3 (ATCC CRL
1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26), or
MRC-5 (ATCC CCL 171).
In assays to identify activators or inhibitors of canon channels
containing human HCN3 protein, it may be advantageous to co-express another
cation
channel subunit besides human HCN3. In particular, it may be advantageous to
co-
express another HCN family member subunit (e.g., HCN1, HCN2, or HCN4).
Preferably, this is done by co-transfecting into the cells an expression
vector encoding
the other HCN family member subunit.
The present invention also includes assays for the identification of
inhibitors of canon channels containing human HCN3 protein that are based upon
-25-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
modulation of the growth phenotype of trkl dtrk2d mutant yeast that also
express
cation channels containing human HCN3. The products of the yeast tr°7~1
and trk2
genes are high affinity potassium transporters and their expression in wild
type yeast
allows growth under conditions in which the concentration of K+ in the medium
is
very low (e.g., <50 ~M). Deletion, or inactivation, of these two genes
abolishes high
affinity K+ uptake and results in impaired growth in potassium limited (e.g,
<7 mM)
media. In addition, growth of trkl dtrk2d yeast is also impaired by low (<3.0)
pH
even in the presence of otherwise permissive K+ concentrations (Nakamura &
Gaber,
1999, Methods. Enz. 293:89-104). Heterologous expression of a human HCN3 canon
channel in trkl dtrk2d yeast could rescue the mutant growth phenotype. That
is,
expression of such a channel could restore wild type growth to these cells in
limiting
K+ or low pH. Thus, inhibitors of human HCN3 cation channels will negate its
effect
in these mutant yeast and result in their reversion to the mutant growth
phenotype
(i.e., impaired growth in low K+ or low pH). Thus, the present invention
includes a
method of identifying inhibitors of cation channels containing human HCN3
protein
comprising:
(a) providing a yeast strain that has been engineered to
(1) have inactivated trkl and trk2 genes and
(2) heterologously express a cation channel containing
human HCN3 protein;
(b) exposing the yeast to a substance;
(c) measuring the growth rate of the yeast in the presence of the
substance under either limiting K+ concentration or low pH and in the absence
of the
substance under either limiting K+ concentration or low pH;
(d) comparing the growth rates measured in step (c) in the presence
and in the absence of the substance;
wherein if the growth rate in the presence of the substance is less than
the growth rate in the absence of the substance then the substance is an
inhibitor of
cation channels containing human HCN3 protein.
In certain embodiments, the yeast trkl and trk2 genes have been
inactivated by deletion or mutagenesis.
Growth of the yeast is measured in media containing either 1) limiting
K+ (e.g., <7 mM K+) or 2) permissive K+ and low pH (e.g., 100 mM K+ and pH
<3.0). Growth rate may simply be measured as turbidity of the culture (e.g.,
as
-26-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
absorbance at 700 nm) as a function of time, or may be measured by other
methods
known in the ant. Growth rate may also be measured in an all or none fashion
by
measuring the yeast's ability to form colonies in the presence of the absence
of the
substance.
While the above-described methods are explicitly directed to testing
whether "a" substance is an activator or inhibitor of cation channels
containing human
HCN3 protein, it will be clear to one skilled in the art that such methods can
be used
to test collections of substances, e.g., combinatorial libraries, natural
products
extracts, to determine whether any members of such collections are activators
or
inhibitors of cation channels containing human HCN3 protein. Accordingly, the
use
of collections of substances, or individual members or subsets of such members
of
such collections, as the substance in the above-described methods is within
the scope
of the present invention.
The present invention includes pharmaceutical compositions
comprising activators or inhibitors of cation channels comprising human HCN3
protein that have been identified by the herein-described methods. The
activators or
inhibitors are generally combined with pharmaceutically acceptable carriers to
form
pharmaceutical compositions. Examples of such carriers and methods of
formulation
of pharmaceutical compositions containing activators or inhibitors and
carriers can be
found in Gennaro, ed., Remington's Pharmaceutical Sciences, lath Edition,
1990,
Mack Publishing Co., Easton, PA. To form a pharmaceutically acceptable
composition suitable for effective administration, such compositions will
contain a
therapeutically effective amount of the activators or inhibitors.
Therapeutic or prophylactic compositions are administered to an
individual in amounts sufficient to treat or prevent conditions where the
activity of
cation channels containing human HCN3 protein is abnormal. The effective
amount
can vary according to a variety of factors such as the individual's condition,
weight,
gender, and age. Other factors include the mode of administration. The
appropriate
amount can be determined by a skilled physician. Generally, an effective
amount will
be from about 0.01 to about 1,000, preferably from about 0.1 to about 250, and
even
more preferably from about 1 to about 50 mg per adult human per day.
Compositions can be used alone at appropriate dosages. Alternatively,
co-administration or sequential administration of other agents can be
desirable.
-27-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
The compositions can be administered in a wide variety of therapeutic
dosage forms in conventional vehicles for administration. For example, the
compositions can be administered in such oral dosage forms as tablets,
capsules (each
including timed release and sustained release formulations), pills, powders,
granules,
elixirs, tinctures, solutions, suspensions, syrups and emulsions, or by
injection.
Likewise, they can also be administered in intravenous (both bolus and
infusion),
intraperitoneal, subcutaneous, topical with or without occlusion, or
intramuscular
form, all using forms well known to those of ordinary skill in the
pharmaceutical arts.
Compositions can be administered in a single daily dose, or the total
daily dosage can be administered in divided doses of two, three, four or more
times
daily. Furthermore, compositions can be administered in intranasal form via
topical
use of suitable intranasal vehicles, or via transdermal routes, using those
forms of
transdermal skin patches well lcnown to those of ordinary slull in that art.
To be
administered in the form of a transdermal delivery system, the dosage
administration
will, of course, be continuous rather than intermittent throughout the dosage
regimen.
The dosage regimen utilizing the compositions is selected in
accordance with a variety of factors including type, species, age, weight, sex
and
medical condition of the patient; the severity of the condition to be treated;
the route
of administration; the renal, hepatic and cardiovascular function of the
patient; and
the particular composition thereof employed. A physician of ordinary skill can
readily determine and prescribe the effective amount of the composition
required to
prevent, counter or arrest the progress of the condition. Optimal precision in
achieving concentrations of composition within the range that yields efficacy
without
toxicity requires a regimen based on the kinetics of the composition's
availability to
target sites. This involves a consideration of the distribution, equilibrium,
and
elimination of a composition.
The inhibitors and activators of cation channels containing human
HCN3 protein will be useful for treating a variety of diseases involving
excessive or
insufficient cation channel activity.
Expression of human HCN3 in the human brain, heart, pancreas and
several other tissues was seen by Northern blot analysis. This suggests that
inhibitors
and activators of canon channels containing human HCN3 protein are likely to
be
useful fox the treatment of neurodegenerative diseases, cognitive and sensory
disorders, pain, cardiac brady- and tachy-arrhythmias, ataxias, fertility
disorders,
_28_
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
hepatic dysfunction, pancreatic disorders (including diabetes), heart failure,
inflammatory disease, and diabetic neuropathy.
The human HCN3 nucleic acids and proteins of the present invention
are useful in conjunction with screens designed to identify activators and
inhibitors of
other ion channels. When screening compounds in order to identify potential
pharmaceuticals that specifically interact with a target ion channel, it is
necessary to
ensure that the compounds identified are as specific as possible for the
target ion
channel. To do this, it is necessary to screen the compounds against as wide
an array
as possible of ion channels that are similar to the target ion channel. Thus,
in order to
find compounds that are potential pharmaceuticals that interact with ion
channel A, it
is not enough to ensure that the compounds interact with ion channel A (the
"plus
target") and produce the desired pharmacological effect through ion channel A.
It is
also necessary to determine that the compounds do not interact with ion
channels B,
C, D, etc .(the "minus targets"). The methods used to determine that a
compound that
is a drug candidate does not interact with minus targets are often referred to
as
"counterscreens." In general, as part of a screening program, it is important
to use as
many minus targets in counterscreens as possible (see Hodgson, 1992,
Bio/Technology 10:973-980, at 980). Human HCN3 protein, DNA encoding human
HCN3 protein, and recombinant cells that have been engineered to express human
HCN3 protein have utility in that they can be used as "minus targets" in
screening
programs designed to identify compounds that specifically interact with other
ion
channels. For example, Wang et al., 1998, Science 282:1890-1893 have shown
that
KCNQ2 and KCNQ3 form a heteromeric potassium ion channel know as the "M-
channel." The M-channel is an important target for drug discovery since
mutations in
KCNQ2 and KCNQ3 are responsible fox causing epilepsy (Biervert et al., 1998,
Science 279:403-406; Singh et al., 1998, Nature Genet. 18:25-29; Schroeder et
al.,
Nature 1998, 396:687-690). A screening program designed to identify activators
or
inhibitors of the M-channel would benefit greatly by the use of canon channels
comprising human HCN3 protein as minus targets.
Accordingly, the present invention includes methods for identifying
drug candidates that modulate ion channels where the methods encompass using
human HCN3 in a counterscreen. Such methods comprise:
(a) determining that a compound is an activator or an inhibitor of
an ion channel where the ion channel does not comprise human HCN3; and
-29-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
(b) determining that the compound is not an activator or an
inhibitor of ion channels comprising human HCN3.
Of course, human HCN3 may also be valuable in counterscreens where
the primary drug target is not an ion channel. Thus, the present invention
includes a
method for determining that a drug candidate is not an activator or inhibitor
of human
HCN3 comprising:
(a) selecting a drug target that is not human HCN3;
(b) screening a collection of compounds to identify a compound
that is an activator or an inhibitor of the drug target; and
(c) determining that the compound identified in step (b) is not an
activator or an inhibitor of human HCN3.
The present invention also includes antibodies to the human HCN3
protein. Such antibodies may be polyclonal antibodies or monoclonal
antibodies.
The antibodies of the present invention can be raised against the entire human
HCN3
protein or against suitable antigenic fragments that are coupled to suitable
carriers,
e.g., serum albumin or keyhole limpet hemocyanin, by methods well known in the
art.
Methods of identifying suitable antigenic fragments of a protein are known in
the art.
See, e.g., Hopp & Woods, 1981, Proc. Natl. Acad. Sci. USA 78:3824-3828; and
Jameson & Wolf, 1988, CABIOS (Computer Applications in the Biosciences) 4:181-
186.
For the production of polyclonal antibodies, human HCN3 protein or
antigenic fragments, coupled to a suitable carrier, are injected on a periodic
basis into
an appropriate non-human host animal such as, e.g., rabbits, sheep, goats,
rats, mice.
The animals are bled periodically and sera obtained are tested for the
presence of
antibodies to the injected human HCN3 protein or antigenic fragment. The
injections
can be intramuscular, intraperitoneal, subcutaneous, and the lilce, and can be
accompanied with adjuvant.
For the production of monoclonal antibodies, human HCN3 protein or
antigenic fragments, coupled to a suitable carrier, are injected into an
appropriate non-
human host animal as above for the production of polyclonal antibodies. In the
case
of monoclonal antibodies, the animal is generally a mouse. The animal's spleen
cells
are then immortalized, often by fusion with a myeloma cell, as described in
Kohler &
Milstein, 1975, Nature 256:495-497. For a fuller description of the production
of
-30-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
monoclonal antibodies, see Antibodies: A Laboratory Manual, Harlow & Lane,
eds.,
Cold Spring Harbor Laboratory Press, 1988.
Gene therapy may be used to introduce human HCN3 protein into the
cells of target organs. Nucleotides encoding human HCN3 protein can be ligated
into
viral vectors, which mediate transfer of the nucleotides by infection of
recipient cells.
Suitable viral vectors include retrovirus, adenovirus, adeno-associated virus,
herpes
virus, vaccinia virus, lentivirus, and polio virus based vectors.
Alternatively,
nucleotides encoding human HCN3 protein can be transferred into cells for gene
therapy by non-viral techniques including receptor-mediated targeted transfer
using
ligand-nucleotide conjugates, lipofection, membrane fusion, or direct
microinjection.
These procedures and variations thereof are suitable for ex viv~ as well as
i~a vivo gene
therapy. Gene therapy with wild type human HCN3 proteins will be particularly
useful for the treatment of diseases where it is beneficial to elevate cation
channel
activity. Gene therapy with a dominant negative mutant of human HCN3 protein
will
be particularly useful for the treatment of diseases where it is beneficial to
decrease
cation channel activity.
The following non-limiting examples are presented to better illustrate
the invention.
EXAMPLE 1
Identification and cloning_of human HCN3 cDNA
Full length HCN3 was cloned as two separate overlapping fragments
by PCR: 1) the amino terminus from EST AI571225 to a region downstream (3') to
the cyclic nucleotide binding domain and 2) a region 5' to S4 to the stop
codon were
designed from the sequence obtained from the genomic DNA database searches.
Two
identical cDNAs, encoding the amino terminal sequence, were obtained by
standard
PCR techniques using the following primer pair:
5' TGGGCGCCATGGAGGCAGAGCAGCGGCCG 3' (SEQ.ID.N0.:15)
5' TTTCCACTAAGCTGAGCTCCT 3' (SEQ.ID.N0.:16)
-31-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
The preS4 to stop cDNAs was cloned by PCR with the following primer pair:
5' GAGCCACGGTTGGACGCTGAG 3' (SEQ.ID.N0.:17)
5' AAAGGTTTTACATGTTGGCAGAAAGCTG 3' (SEQ.ID.N0.:18)
Three clones were sequenced. When all five PCR sequences were aligned and
compared to the corresponding genomic sequence, two polymorphisms were found.
One nucleotide polymorphism was at position 1051 and one was at position 1795.
The cDNA encoding the full length ORF was then constructed from the two pa~.-
tial
cDNAs by standard molecular biologic techniques.
EXAMPLE 2
Analysis of the expression of human HCN3
Northern blots of poly(A+) RNA isolated from human heart, brain,
placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus,
prostate,
testis, uterus, small intestine, colon, and peripheral blood leukocytes were
purchased
from Clontech (Palto Alto, CA) and probed with a 32P-labeled oligonucleotide
probe
derived from EST AI571225. The sequence of the sense stand of the probe is:
5'CGAAGGGGCGACCCCTGGACTGGAGGCGGTGCCTCCCGTTGCTCCCCCG
CCTGCGACCG 3' (SEQ.~.N0.:19)
The probe was constructed from two overlapping synthetic oligonucleotides that
were
annealed and filled in in the prescence of all four [32P]dNTPs and the Klenow
fragment of DNA polymerase. The hybridization was carried out in 5X SSPE, 2X
Denhardt's solution, 0.5% SDS, 100 ~,g/ml salmon sperm DNA at 42°C
overnight.
Blots were washed stepwise in 2X SSC, 0.05% SDS at 42°C 3 times
for 15-20
minutes, followed by 1X SSC, 0.05% SDS at 50°C 3 times for 15-20
minutes.
Hybridization was detected by exposure of the blots to Kodak CAR X-ray film.
The present invention is not to be limited in scope by the specific
embodiments described herein. Indeed, various modifications of the invention
in
-32-
CA 02432274 2003-06-20
WO 02/50300 PCT/USO1/47903
addition to those described herein will become apparent to those skilled in
the art
from the foregoing description. Such modifications are intended to fall within
the
scope of the appended claims.
Various publications are cited herein, the disclosures of which are
incorporated by reference in their entireties.
-33-
