Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
CA 02596588 2013-08-13
NUCLEIC ACID SILENCING OF HUNTINGTON'S DISEASE GENE
10 Claim of Priority
This patent application claims priority to U.S. Patent Application No.
11/048,627 filed on January 31, 2005 which is a continuation-in-part
application
of U.S. Application Serial No. 10/859,751 filed on June 2, 2004, which is a
continuation-in-part of International PCT Application No. PCT/US03/16887
filed on May 26, 2003, which is a continuation-in-part of application U.S.
Application Serial No. 10/430,351 filed on May 5, 2003, which is a
continuation
of U.S. Application Serial No. 10/322,086 filed on December 17, 2002, which is
a continuation-in-part application of U.S. Application Serial No. 10/212,322,
filed August 5, 2002. The instant application claims the benefit of all the
listed
applications.
Background of the Invention
Double-stranded RNA (dsRNA) can induce sequence-specific
posttranscriptional gene silencing in many organisms by a process known as
RNA interference (RNAi). However, in mammalian cells, dsRNA that is 30
base pairs or longer can induce sequence-nonspecific responses that trigger a
shut-down of protein synthesis. Recent work suggests that RNA fragments are
the sequence-specific mediators of RNAi (Zamore et al., 2000, Cell, 101, 25-
33;
Elbashir etal., 2001, Genes Dev., 15,188). Interference of gene expression by
these small interfering RNA (siRNA) is now recognized as a naturally occurring
strategy for silencing genes in C. elegans, Drosophila, plants, and in mouse
1
CA 02596588 2013-08-13
=
embryonic stem cells, oocytes and early embryos (Cogoni et al., 1994;
Baulcombe, 1996; Kennerdell and Carthew, 1998; Timmons and Fire, 1998;
Waterhouse et al., 1998; Wianny and Zernicka-Goetz, 2000; Yang et at., 2001;
Svoboda et at., 2000). In mammalian cell culture, an siRNA-mediated reduction
in gene expression has been accomplished only by transfecting cells with
synthetic RNA oligonucleotides (Caplan et al., 2001).
Summary of the Invention
This invention relates to compounds, compositions, and methods useful
for modulating Huntington's Disease (also referred to as huntingtin, htt, or
HD)
gene expression using short interfering nucleic acid (siNA) molecules. This
invention also relates to compounds, compositions, and methods useful for
modulating the expression and activity of other genes involved in pathways of
HD gene expression and/or activity by RNA interference (RNAi) using small
nucleic acid molecules. In particular, the instant invention features small
nucleic
acid molecules, such as short interfering nucleic acid (siNA), short
interfering
RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and
short hairpin RNA (shRNA) molecules and methods used to modulate the
expression HD genes. A siNA of the instant invention can be chemically
synthesized, expressed from a vector or enzymatically synthesized.
In one embodiment, the present invention provides an AAV-1 expressed
siRNA comprising an isolated first strand of RNA of 15 to 30 nucleotides in
length and an isolated second strand of RNA of 15 to 30 nucleotides in length,
wherein the first or second strand comprises a sequence that is complementary
to
a nucleotide sequence encoding a mutant Huntington's Disease protein, wherein
at least 12 nucleotides of the first and second strands are complementary to
each
other and form a small interfering RNA (siRNA) duplex under physiological
conditions, and wherein the siRNA silences the expression of the nucleotide
sequence encoding the mutant Huntington's Disease protein in the cell. In one
embodiment, the first or second strand comprises a sequence that is
complementary to both a mutant and wild-type Huntington's disease allele, and
2
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
the siRNA silences the expression of the nucleotide sequence encoding the
mutant Huntington's Disease protein and wild-type Huntington's Disease protein
in the cell.
In one embodiment, the present invention provides an AAV-1 expressed
siRNA comprising an isolated first strand of RNA of 15 to 30 nucleotides in
length and an isolated second strand of RNA of 15 to 30 nucleotides in length,
wherein the first or second strand comprises a sequence that is complementary
to
both a nucleotide sequence encoding a wild-type and mutant Huntington's
Disease protein, wherein at least 12 nucleotides of the first and second
strands
are complementary to each other and form a small interfering RNA (siRNA)
duplex under physiological conditions, and wherein the siRNA silences the
expression of the nucleotide sequence encoding the wild-type and mutant
Huntington's Disease protein in the cell. In one embodiment, an AAV-1 vector
of the invention is a psuedotyped rAAV-1 vector.
In one embodiment, the present invention provides a mammalian cell
containing an isolated first strand of RNA for example corresponding to SEQ ID
NO:60, SEQ ID NO:63, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ
ID NO:72, SEQ ID NO:74, SEQ ID NO:76, SEQ ID NO:78, SEQ ID NO:80,
SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, or SEQ ID NO:88, and an
isolated second strand of RNA of 15 to 30 nucleotides in length, wherein the
first strand contains a sequence that is complementary to a nucleotide
sequence
encoding a Huntington's Disease protein (htt), such as wherein at least 12
nucleotides of the first and second strands are complementary to each other
and
form a small interfering RNA (siRNA) duplex for example under physiological
conditions, and wherein the siRNA silences the expression of the Huntington's
Disease (HD) gene in the cell, for example by targeting the cleavage of RNA
encoded by the HD gene or via translational blocking of the BD gene
expression. SEQ ID NO:60 through SEQ ID NO:89 are all represented herein as
DNA sequences. However, as used herein when a claim indicates an RNA
"corresponding to" it is meant the RNA that has the same sequence as the DNA,
except that uracil is substituted for thymine. For example, SEQ ID NO:61 is 5'-
3
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
GAAGCTTG-3', and the RNA corresponding to this sequence is 5'-
GAAGCUUG-3' (SEQ ID NO: 58).
The present invention provides a method of suppressing the accumulation
of huntingtin in a cell by introducing a ribonucleic acid (RNA) described
above
into the cell in an amount sufficient to suppress accumulation of huntingtin
in
the cell. In certain embodiments, the accumulation of huntingtin is suppressed
by at least 10%. The accumulation of huntingtin is suppressed by at least 10%,
20%, 30%, 40%, 50%, 60%, 70% 80%, 90% 95%, or 99%.
The present invention provides a method to inhibit expression of a
huntingtin gene in a cell by introducing a ribonucleic acid (RNA) described
above into the cell in an amount sufficient to inhibit expression of the
huntingtin,
and wherein the RNA inhibits expression of the huntingtin gene. The huntingtin
is inhibited by at least 10%, 20%, 30%, 40%, 50%, 6-0%, 70% 80%, 90% 95%,
or 99%.
The present invention provides a method to inhibit expression of a
huntingtin gene in a mammal (e.g., a human) by (a) providing a mammal
containing a neuronal cell, wherein the neuronal cell contains the huntingtin
gene and the neuronal cell is susceptible to RNA interference, and the
huntingtin
gene is expressed in the neuronal cell; and (b) contacting the mammal with a
ribonucleic acid (RNA) or a vector described above, thereby inhibiting
expression of the huntingtin gene. In certain embodiments, the accumulation of
huntingtin is suppressed by at least 10%. The huntingtin is inhibited by at
least
10%, 20%, 30%, 40%, 50%, 60%, 70% 80%, 90% 95%, or 99%. In certain
embodiments, the cell located in vivo in a mammal.
The present invention also provides a method to inhibit expression of a
protein associated with the neurodegenerative disease, such as huntingtin, in
a
mammal in need thereof, by introducing the vector encoding a miRNA described
above into a cell in an amount sufficient to inhibit expression of the protein
associated with the neurodegenerative disease, wherein the RNA inhibits
expression of the protein associated with the neurodegenerative disease. The
4
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
protein is inhibited by at least 10%, 20%, 30%, 40%, 50%, 60%, 70% 80%, 90%
95%, or 99%.
The present invention provides a method to inhibit expression of
huntingtin in a mammal in need thereof by (a) providing a mammal containing a
neuronal cell, wherein the neuronal cell contains the huntingtin gene and the
neuronal cell is susceptible to RNA interference, and the huntingtin gene is
expressed in the neuronal cell; and (b) contacting the mammal the vector
encoding a miRNA described above, thereby inhibiting expression of the
huntingtin gene. The huntingtin is inhibited by at least 10%, 20%, 30%, 40%,
50%, 60%, 70% 80%, 90% 95%, or 99%.
In one embodiment, the invention features siRNA duplexes where the
first and/or second strand of the duplex further include a 3' overhang region,
a 5'
overhang region, or both 3' and 5' overhang regions, and the overhang region
(or
regions) can be from 1 to 10 nucleotides in length. As used herein, the term
"overhang region" means a portion of the RNA that does not bind with the
second strand. Further, the first strand and the second strand encoding the
siRNA duplex can be operably linked by means of an RNA loop strand to form a
hairpin structure comprising a duplex structure and a loop structure. Such
siRNAs with hairpin stem-loop structure are referred to sometimes as short
hairpin RNAs or shRNAs. This loop structure, if present may be from 4 to 10
nucleotides or longer in length. In one embodiment, the loop structure
corresponds to SEQ ID NO:58. In one embodiment, the first strand corresponds
to SEQ ID NO:56 and the second strand corresponds to SEQ ID NO:57.
The reference to siRNAs herein is meant to include shRNAs and other
small RNAs that can or are capable of modulating the expression of RD gene,
for example via RNA interference. Such small RNAs include without limitation,
shRNAs and miroRNAs (miRNAs).
The present invention also provides a mammalian cell containing an
expression cassette encoding an isolated first strand of RNA corresponding to,
for example, SEQ ID NO:56 or SEQ ID NO:57, and encoding an isolated second
strand of RNA of 15 to 30 nucleotides in length, wherein the first or second
5
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
strand comprises a sequence that is complementary to a nucleotide sequence
encoding a Huntington's Disease protein (htt), for example wherein at least 12
nucleotides of the first and second strands are complementary to each other
and
form a small interfering RNA (siRNA) duplex for example under physiological
conditions, and wherein the siRNA silences the expression of the Huntington's
Disease gene in the cell, for instance by targeting the cleavage of RNA
encoded
by the HD gene or via translational blocking of the HD gene expression. The
expression cassette may further include a promoter, such as a regulatable
promoter or a constitutive promoter. Examples of suitable promoters include
without limitation a pol II promoter such as cytomegalovirus (CMV), Rous
Sarcoma Virus (RSV), pol III promoters such as U6, and any other pol II or pol
III promoter as is known in the art. The expression cassette may further
optionally include a marker gene, such as a stuffer fragment comprising a
marker
gene. The expression cassette may be contained in a vector, such as an
adenoviral, lentiviral, adeno-associated viral (AAV), poliovirus, HSV, or
murine
Maloney-based viral vector. In one embodiment, the first strand corresponds to
SEQ ID NO:56 and the second strand corresponds to SEQ ID NO:57.
The present invention provides a small interfering RNA (siRNA)
containing a first strand of RNA corresponding to for example SEQ ID NO:56 or
SEQ ID NO:57, and a second strand of RNA of 15 to 30 nucleotides in length,
wherein the first or second strand comprises a sequence that is complementary
to
a nucleotide sequence encoding a Huntington's Disease protein (htt), for
example wherein at least 12 nucleotides of the first and second strands are
complementary to each other and form an siRNA duplex under physiological
conditions, wherein the duplex is between 15 and 30 base pairs in length, and
wherein the siRNA silences the expression of the Huntington's Disease gene in
the cell, for instance via RNA interference.
The present invention provides a method of performing Huntington's
Disease gene silencing in a mammal by administering to the mammal an
expression cassette encoding an isolated first strand of RNA corresponding to
for
example SEQ ID NO:56 or SEQ ID NO:57, and encoding an isolated second
6
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
strand of RNA of 15 to 30 nucleotides in length, wherein the first or second
strand comprises a sequence that is complementary to a nucleotide sequence
encoding a Huntington's Disease protein (h-tt), for example wherein at least
12
nucleotides of the first and second strands are complementary to each other
and
form a small interfering RNA (siRNA) duplex under physiological conditions,
and wherein the expression of the siRNA from the expression cassette silences
the expression of the Huntington's Disease gene in the mammal, for instance
via
RNA interference.
The present invention provides an isolated RNA comprising for example
SEQ ID NO:59 that functions in RNA interference to a sequence encoding a
mutant Huntington's Disease protein (htt).
The present invention provides an isolated RNA duplex comprising a
first strand of RNA corresponding to for example SEQ ID NO:56 and a second
strand of RNA corresponding to for example by SEQ ID NO:57. The first and/or
second strand optionally further include a 3' overhang region, a 5' overhang
region, or both 3' and 5' overhang regions, and the overhang region (or
regions)
can be from 1 to 10 nucleotides in length. Further, the first strand and the
second strand can be operably linked by means of an RNA loop strand to form a
hairpin structure comprising a duplex structure and a loop structure. This
loop
structure, if present may be from 4 to 10 nucleotides. In one embodiment, the
loop structure corresponds to SEQ ID NO:58 or a portion thereof.
The present invention provides a vector, such as an AAV vector,
comprising two expression cassettes, a first expression cassette comprising a
nucleic acid encoding the first strand of the RNA duplex corresponding to for
example SEQ ID NO:56 and a second expression cassette comprising a nucleic
acid encoding the second strand of the RNA duplex corresponding to for
example SEQ ID NO:57. The present invention also provides a cell containing
this vector. In one embodiment, the cell is a mammalian cell.
The present invention provides a mammalian cell containing an isolated
first strand of RNA of 15 to 30 nucleotides in length, and an isolated second
strand of RNA of 15 to 30 nucleotides in length, wherein the first strand
contains
7
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
a sequence that is complementary to for example at least 15 nucleotides of RNA
encoded by a targeted gene of interest (for example the HD gene), wherein for
example at least 12 nucleotides of the first and second strands are
complementary to each other and form a small interfering RNA (siRNA) duplex
for example under physiological conditions, and wherein the siRNA silences
(for
example via RNA interference) only one allele of the targeted gene (for
example
the mutant allele of HD gene) in the cell. The duplex of the siRNA may be
between 15 and 30 base pairs in length. The two strands of RNA in the siRNA
may be completely complementary, or one or the other of the strands may have
an "overhang region" or a "bulge region" (i.e., a portion of the RNA that does
not bind with the second strand or where a portion of the RNA sequence is not
complementary to the sequence of the other strand). These overhangs may be at
the 3' end or at the 5' region, or at both 3' and 5' ends. Such overhang
regions
may be from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) or more nucleotides
in
length. The bulge regions may be at the ends or in the internal regions of the
siRNA duplex. Such bulge regions may be from 1-5 (e.g., 1, 2, 3, 4, 5) or more
nucleotides long. Such bulge regions may be the bulge regions characteristics
of
miRNAs. In the present invention, the first and second strand of RNA may be
operably linked together by means of an RNA loop strand to form a hairpin
structure to form a "duplex structure" and a "loop structure." These loop
structures may be from 4 to 10 (e.g., 4, 5, 6, 7, 8, 9, 10) or more
nucleotides in
length. For example, the loop structure may be 4, 5 or 6 nucleotides long.
The present invention also provides a mammalian cell that contains an
expression cassette encoding an isolated first strand of RNA of 15 to 30
nucleotides in length, and an isolated second strand of RNA of 15 to 30
nucleotides in length, wherein the first strand contains a sequence that is
complementary to for example at least 15 contiguous nucleotides of RNA
encoded by a targeted gene of interest (for example the HD gene), wherein for
example at least 12 nucleotides of the first and second strands are
complementary to each other and form a small interfering RNA (siRNA) duplex,
for example under physiological conditions, and wherein the siRNA silences
(for
8
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
example via RNA interference) only one allele of the targeted gene (for
example
the mutant allele of HD gene) in the cell. These expression cassettes may
further
contain a promoter. Such promoters can be regulatable promoters or
constitutive
promoters. Examples of suitable promoters include a CMV, RSV, pol II or pol
III promoter. The expression cassette may further contain a polyaderiylation
signal, such as a synthetic minimal polyadenylation signal. The expression
cassette may further contain a marker gene. The expression cassette may be
contained in a vector. Examples of appropriate vectors include adenoviral,
lentiviral, adeno-associated viral (AAV), poliovirus, HSV, or murine Maloney-
based viral vectors. In one embodiment, the vector is an adenoviral vector or
an
adeno-associated viral vector.
In the present invention, the alleles of the targeted gene may differ by
seven or fewer nucleotides (e.g., 7, 6, 5, 4, 3, 2 or 1 nucleotides). For
example
the alleles may differ by only one nucleotide. Examples of targeted gene
transcripts include transcripts encoding a beta-glucuronidase, TorsinA, Ataxin-
3,
Tau, or huntingtin. The targeted genes and gene products (i.e., a transcript
or
protein) may be from different species of organisms, such as a mouse allele or
a
human allele of a target gene.
The present invention also provides an isolated RNA duplex containing a
first strand of RNA and a second strand of RNA, wherein the first strand
contains for example at least 15 nucleotides complementary to mutant Torsinil
represented for example by SEQ ID NO:55, and wherein the second strand is
complementary to for example at least 12 contiguous nucleotides of the first
strand. In one embodiment of the invention (mutA-si), the first strand of RNA
corresponds to for example SEQ ID NO:49 and the second strand of RNA
corresponds to for example SEQ ID NO:50. In an alternative embodiment
(mutB-si), the first strand of RNA corresponds to for example SEQ ID NO:51
and the second strand of RNA corresponds to for example SEQ ID NO:52. In
another embodiment (mutC-si), the first strand of RNA corresponds to for
example SEQ ID NO:53 and second strand of RNA corresponds to for example
SEQ ID NO:54. As used herein the term "encoded by" means that the DNA
9
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
sequence is transcribed into the RNA of interest. This term is used in a broad
sense, similar to the term "comprising" in patent terminology. For example,
the
statement "the first strand of RNA is encoded by SEQ lD NO:49" means that the
first strand of RNA sequence corresponds to the DNA sequence indicated in
SEQ ID NO:49, but may also contain additional nucleotides at either the 3' end
or at the 5' end of the RNA molecule.
The present invention further provides an RNA duplex containing a first
strand of RNA and a second strand of RNA, wherein the first strand contains
for
example at least 15 contiguous nucleotides complementary to mutant Ataxin-3
transcript encoded by SEQ ID NO:8, and wherein the second strand is
complementary to for example at least 12 contiguous nucleotides of the first
strand. In one embodiment (siC7/8), the first strand of RNA is encoded by SEQ
ID NO:19 and the second strand of RNA is encoded by SEQ ID NO: 20. In
another embodiment (siC10), the first strand of RNA is encoded by SEQ ID
NO:21 and the second strand of RNA is encoded by SEQ ID NO:22.
The present invention further provides an RNA duplex containing a first
strand of RNA and a second strand of RNA, wherein the first strand contains
for
example at least 15 contiguous nucleotides complementary to mutant Tau
transcript for example encoded by SEQ ID NO:39 (siA9/C12), and wherein the
second strand is complementary to at least 12 contiguous nucleotides of the
first
strand. The second strand may be encoded for example by SEQ ID NO:40.
The RNA duplexes of the present invention are between 15 and 30 base
pairs in length. For example they may be between 19 and 25 base pairs in
length
or 19-27 base-pairs in length. As discussed above the first and/or second
strand
further may optionally comprise an overhang region. These overhangs may be at
the 3' end or at the 5' overhang region, or at both 3' and 5' ends. Such
overhang
regions may be from 1 to 10 nucleotides in length. The RNA duplex of the
present invention may optionally include nucleotide bulge regions. The bulge
regions may be at the ends or in the internal regions of the siRNA duplex.
Such
bulge regions may be from 1-5 nucleotides long. Such bulge regions may be the
bulge regions characteristics of miRNAs. In the present invention, the first
and
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
second strand of RNA may be operably linked together by means of an RNA
loop strand to form a hairpin structure to form a "duplex structure" and a
"loop
structure." These loop structures may be from 4 to 10 nucleotides in length.
For
example, the loop structure may be 4, 5 or 6 nucleotides long.
In the present invention, an expression cassette may contain a nucleic
acid encoding at least one strand of the RNA duplex described above. Such an
expression cassette may further contain a promoter. The expression cassette
may be contained in a vector. These cassettes and vectors may be contained in
a
cell, such as a mammalian cell. A non-human mammal may contain the cassette
or vector. The vector may contain two expression cassettes, the first
expression
cassette containing a nucleic acid encoding the first strand of the RNA
duplex,
and a second expression cassette containing a nucleic acid encoding the second
strand of the RNA duplex.
In one embodiment, the present invention further provides a method of
performing gene silencing in a mammal or mammalian cell by administering to
the mammal an isolated first strand of RNA of about 15 to about 30 nucleotides
(for example 19-27 nucleotides) in length, and an isolated second strand of
RNA
of 15 to 30 nucleotides (for example 19-27 nucleotides) in length, wherein the
first strand contains for example at least 15 contiguous nucleotides
complementary to a targeted gene of interest (such as HD gene), wherein for
example at least 12 nucleotides of the first and second strands are
complementary to each other and form a small interfering RNA (siRNA) duplex
for example under physiological conditions, and wherein the siRNA silences
only one or both alleles of the targeted gene (for example the wild type and
mutant alleles of HD gene) in the mammal or mammalian cell. In one example,
the gene is a beta-glucuronidase gene. The alleles may be murine-specific and
human-specific alleles of beta-glucuronidase. Examples of gene transcripts
include an RNA transcript complementary to TorsinA, Ataxin-3 , huntingtin or
Tau. The targeted gene may be a gene associated with a condition amenable to
siRNA therapy. For example, the condition amenable to siRNA therapy could
be a disabling neurological disorder.
11
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
"Neurological disease" and "neurological disorder" refer to both
hereditary and sporadic conditions that are characterized by nervous system
dysfunction, and which may be associated with atrophy of the affected central
or
peripheral nervous system structures, or loss of function without atrophy. A
neurological disease or disorder that results in atrophy is commonly called a
"neurodegenerative disease" or "neurodegenerative disorder."
Neurodegenerative diseases and disorders include, but are not limited to,
amyotrophic lateral sclerosis (ALS), hereditary spastic hemiplegia, primary
lateral sclerosis, spinal muscular atrophy, Kennedy's disease, Alzheimer's
disease, Parkinson's disease, multiple sclerosis, and repeat expansion
neurodegenerative diseases, e.g., diseases associated with expansions of
trinucleotide repeats such as polyglutamine (polyQ) repeat diseases, e.g.,
Huntington's disease (HD), spinocerebellar ataxia (SCA1, SCA2, SCA3, SCA6,
SCA7, and SCA17), spinal and bulbar muscular atrophy (SBMA),
dentatorubropallidoluysian atrophy (DRPLA). An example of a disabling
neurological disorder that does not appear to result in atrophy is DYT1
dystonia.
The gene of interest may encode a ligand for a chemokine involved in the
migration of a cancer cell, or a chemokine receptor.
The present invention further provides a method of substantially
silencing a target gene of interest or targeted allele for the gene of
interest in
= order to provide a therapeutic effect. As used herein the term
"substantially
silencing" or "substantially silenced" refers to decreasing, reducing, or
inhibiting
the expression of the target gene or target allele by at least about 5%, 10%,
15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%
to 100%. As used herein the term "therapeutic effect" refers to a change in
the
associated abnormalities of the disease state, including pathological and
behavioral deficits; a change in the time to progression of the disease state;
a
reduction, lessening, or alteration of a symptom of the disease; or an
improvement in the quality of life of the person afflicted with the disease.
Therapeutic effect can be measured quantitatively by a physician or
qualitatively
by a patient afflicted with the disease state targeted by the siRNA. In
certain
12
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
embodiments wherein both the mutant and wild type allele are substantially
silenced, the term therapeutic effect defines a condition in which silencing
of the
wild type allele's expression does not have a deleterious or harmful effect on
normal functions such that the patient would not have a therapeutic effect.
= 5 In one embodiment, the present invention further provides a method
of
performing allele-specific gene silencing in a mammal by administering to the
mammal an isolated first strand of RNA of 15 to 30 nucleotides in length, and
an
isolated second strand of RNA of 15 to 30 nucleotides in length, wherein the
first strand contains for example at least 15 contiguous nucleotides
complementary to a targeted gene of interest, wherein for example at least 12
nucleotides of the first and second strands are complementary to each other
and
form a small interfering RNA (siRNA) duplex for example under physiological
conditions, and wherein the siRNA silences only one allele of the targeted
gene
in the mammal. The alleles of the gene may differ by seven or fewer base
pairs,
such as by only one base pair. In one example, the gene is a beta-
glucuronidase
gene. The alleles may be murine-specific and human-specific alleles of beta-
glucuronidase. Examples of gene transcripts include an RNA transcript
complementary to TorsinA, Ataxin-3, huntingtin or Tau. The targeted gene may
be a gene associated with a condition amenable to siRNA therapy. For example,
the condition amenable to siRNA therapy could be a disabling neurological
disorder.
"Neurological disease" and "neurological disorder" refer to both
hereditary and sporadic conditions that are characterized by nervous system
dysfunction, and which may be associated with atrophy of the affected central
or
peripheral nervous system structures, or loss of function without atrophy. A
neurological disease or disorder that results in atrophy is commonly called a
"neurodegenerative disease" or "neurodegenerative disorder."
Neurodegenerative diseases and disorders include, but are not limited to,
amyotrophic lateral sclerosis (ALS), hereditary spastic hemiplegia, primary
lateral sclerosis, spinal muscular atrophy, Kennedy's disease, Alzheimer's
disease, Parkinson's disease, multiple sclerosis, and repeat expansion
13
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
neurodegenerative diseases, e.g., diseases associated with expansions of
trinucleotide repeats such as polyglutamine (polyQ) repeat diseases, e.g.,
Huntington's disease (HD), spinocerebellar ataxia (SCA1, SCA2, SCA3, SCA6,
SCA7, and SCA17), spinal and bulbar muscular atrophy (SBMA),
dentatorubropallidoluysian atrophy (DRPLA). An example of a disabling
neurological disorder that does not appear to result in atrophy is DYT1
dystonia.
The gene of interest may encode a ligand for a chemokine involved in the
migration of a cancer cell, or a chemokine receptor.
In one embodiment, the present invention further provides a method of
substantially silencing both alleles (e.g., both mutant and wild type alleles)
of a
target gene. In certain embodiments, the targeting of both alleles of a gene
target
of interest can confer a therapeutic effect by allowing a certain level of
continued
expression of the wild-type allele while at the same time inhibiting
expression of
the mutant (e.g., disease associated) allele at a level that provides a
therapeutic
effect. For example, a therapeutic effect can be achieved by conferring on the
cell the ability to express siRNA as an expression cassette, wherein the
expression cassette contains a nucleic acid encoding a small interfering RNA
molecule (siRNA) targeted against both alleles, and wherein the expression of
the targeted alleles are silenced at a level that inhibits, reduces, or
prevents the
deleterious gain of function conferred by the mutant allele, but that still
allows
for adequate expression of the wild type allele at a level that maintains the
function of the wild type allele. Examples of such wild type and mutant
alleles
include without limitation those associated with polyglutamine diseases such
as
Huntington's Disease.
In one embodiment, the present invention further provides a method of
substantially silencing a target allele while allowing expression of a wild-
type
allele by conferring on the cell the ability to express siRNA as an expression
cassette, wherein the expression cassette contains a nucleic acid encoding a
small interfering RNA molecule (siRNA) targeted against a target allele,
wherein
expression from the targeted allele is substantially silenced but wherein
expression of the wild-type allele is not substantially silenced.
14
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
In one embodiment, the present invention provides a method of treating a
dominantly inherited disease in an allele-specific manner by administering to
a
patient in need thereof an expression cassette, wherein the expression
cassette
contains a nucleic acid encoding a small interfering RNA molecule (siRNA)
targeted against a target allele, wherein expression from the target allele is
substantially silenced but wherein expression of the wild-type allele is not
substantially silenced.
In one embodiment, the present invention provides a method of treating a
dominantly inherited disease by administering to a patient in need thereof an
expression cassette, wherein the expression cassette contains a nucleic acid
=
encoding a small interfering RNA molecule (siRNA) targeted against both the
mutant allele and the wild type allele of the target gene, wherein expression
from
the mutant allele is substantially silenced at a level that still allows for
expression from the wild type allele to maintain its function in the patient.
In one embodiment, the present invention also provides a method of
performing allele-specific gene silencing by administering an expression
cassette
containing a pol II promoter operably-linked to a nucleic acid encoding at
least
one strand of a small interfering RNA molecule (siRNA) targeted against a gene
of interest, wherein the siRNA silences only one allele of a gene.
In one embodiment, the present invention also provides a method of
performing gene silencing by administering an expression cassette containing a
pol II promoter operably-linked to a nucleic acid encoding at least one strand
of
a small interfering RNA molecule (siRNA) targeted against a gene of interest,
wherein the siRNA silences one or both alleles of the gene.
In one embodiment, the present invention provides a method of
performing allele-specific gene silencing in a mammal by administering to the
mammal a vector containing an expression cassette, wherein the expression
cassette contains a nucleic acid encoding at least one strand of a small
interfering
RNA molecule (siRNA) targeted against a gene of interest, wherein the siRNA
silences only one allele of a gene.
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
In one embodiment, the present invention provides a method of
performing gene silencing in a mammal by administering to the mammal a
vector containing an expression cassette, wherein the expression cassette
contains a nucleic acid encoding at least one strand of a small interfering
RNA
molecule (siRNA) targeted against a gene of interest, wherein the siRNA
silences one or both alleles of the gene.
In one embodiment, the present invention provides a method of screening
of allele-specific siRNA duplexes, involving contacting a cell containing a
predetermined mutant allele with an siRNA with a known sequence, contacting a
cell containing a wild-type allele with an siRNA with a known sequence, and
determining if the mutant allele is substantially silenced while the wild-type
allele retains substantially normal activity.
In one embodiment, the present invention provides a method of screening
of specific siRNA duplexes, involving contacting a cell containing both a
predetermined mutant allele and a predetermined wild-type allele with an siRNA
with a known sequence, and determining if the mutant allele is substantially
silenced at a level that allows the wild-type allele to retain substantially
normal
activity.
In one embodiment, the present invention also provides a method of
screening of allele-specific siRNA duplexes involving contacting a cell
containing a predetermined mutant allele and a wild-type allele with an siRNA
with a known sequence, and determining if the mutant allele is substantially
silenced while the wild-type allele retains substantially normal activity.
In one embodiment, the present invention also provides a method for
determining the function of an allele by contacting a cell containing a
predetermined allele with an siRNA with a known sequence, and determining if
the function of the allele is substantially modified.
In one embodiment, the present invention further provides a method for
determining the function of an allele by contacting a cell containing a
predetermined mutant allele and a wild-type allele with an siRNA with a known
16
CA 02596588 2013-08-13
sequence, and determining if the function of the allele is substantially
modified
while the wild-type allele retains substantially normal function.
In one embodiment, the invention features a method for treating or
preventing Huntington's Disease in a subject or organism comprising contacting
the subject or organism with a siRNA of the invention under conditions
suitable
to modulate the expression of the HD gene in the subject or organism whereby
the treatment or prevention of Huntington's Disease can be achieved. In one
embodiment, the HD gene target comprises a mutant HD allele (e.g., an allele
comprising a trinucleotide (CAG) repeat expansion). In one embodiment, the
HD gene target comprises both HD allele (e.g., an allele comprising a
trinucleotide (CAG) repeat expansion and a wild type allele). The siRNA
molecule of the invention can be expressed from vectors as described herein or
otherwise known in the art to target appropriate tissues or cells in the
subject or
organism.
In one embodiment, the invention features a method for treating or
preventing Huntington's Disease in a subject or organism comprising,
contacting
the subject or organism with a siRNA molecule of the invention via local
administration to relevant tissues or cells, such as brain cells and tissues
(e.g.,
basal ganglia, striatum, or cortex), for example, by administration of vectors
or
expression cassettes of the invention that provide siRNA molecules of the
invention to relevant cells (e.g., basal ganglia, striatum, or cortex). In one
embodiment, the siRNA, vector, or expression cassette is administered to the
subject or organism by stereotactic or convection enhanced delivery to the
brain.
For example, US Patent No. 5,720,720 provides methods and devices useful for
stereotactic and convection enhanced delivery of reagents to the brain. Such
methods and devices can be readily used for the delivery of siRNAs, vectors,
or
expression cassettes of the invention to a subject or organism. US Patent
Application Nos. 2002/0141980; 2002/0114780; and 2002/0187127 all provide
methods and devices useful for stereotactic and convection enhanced delivery
of
reagents that can be readily adapted for delivery of siRNAs, vectors, or
expression cassettes of the invention to a subject or organism. Particular
devices
17
CA 02596588 2013-08-13
that may be useful in delivering siRNAs, vectors, or expression cassettes of
the
invention to a subject or organism are for example described in US Patent
Application No. 2004/0162255. The siRNA molecule of the invention can be
expressed from vectors as described herein or otherwise known in the art to
target appropriate tissues or cells in the subject or organism.
In one embodiment, a viral vector of the invention is an AAV vector. An
"AAV" vector refers to an adeno-associated virus, and may be used to refer to
the naturally occurring wild-type virus itself or derivatives thereof. The
term
covers all subtypes, serotypes and pseudotypes, and both naturally occurring
and
recombinant forms, except where required otherwise. As used herein, the term
"serotype" refers to an AAV which is identified by and distinguished from
other
AAVs based on capsid protein reactivity with defined antisera, e.g., there are
eight known serotypes of primate AAVs, AAV-1 to AAV-8. For example,
serotype AAV-2 is used to refer to an AAV which contains capsid proteins
encoded from the cap gene of AAV-2 and a genome containing 5' and 3' ITR
sequences from the same AAV-2 serotype. Pseudotyped AAV refers to an AAV
that contains capsid proteins from one serotype and a viral genome including
5'-
3' ITRs of a second serotype. Pseudotyped rAAV would be expected to have
cell surface binding properties of the capsid serotype and genetic properties
consistent with the ITR serotype. Pseudotyped rAAV are produced using
standard techniques described in the art. As used herein, for example, rAAV1
may be used to refer an AAV having both capsid proteins and 5'-3' ITRs from
the same serotype or it may refer to an AAV having capsid proteins from
serotype 1 and 5'-3' ITRs from a different AAV serotype, e.g., AAV serotype 2.
For each example illustrated herein the description of the vector design and
production describes the serotype of the capsid and 5'-3' ITR sequences. The
abbreviation "rAAV" refers to recombinant adeno-associated virus, also
referred
to as a recombinant AAV vector (or "rAAV vector").
18
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
An "AAV virus" or "AAV viral particle" refers to a viral particle
composed of at least one AAV capsid protein (preferably by all of the capsid
proteins of a wild-type AAV) and an encapsidated polynucleotide. If the
particle
comprises heterologous polynucleotide (i.e., a polynucleotide other than a
wild-
type AAV genome such as a transgene to be delivered to a mammalian cell), it
is
typically referred to as "rAAV".
In one embodiment, the AAV expression vectors are constructed using
known techniques to at least provide as operatively linked components in the
direction of transcription, control elements including a transcriptional
initiation
region, the DNA of interest and a transcriptional termination region. The
control
elements are selected to be functional in a mammalian cell. The resulting
construct which contains the operatively linked components is flanked (5' and
3')
with functional AAV ITR sequences.
By "adeno-associated virus inverted terminal repeats" or "AAV ITRs" is
meant the art-recognized regions found at each end of the AAV genome which
function together in cis as origins of DNA replication and as packaging
signals
for the virus. AAV ITRs, together with the AAV rep coding region, provide for
the efficient excision and rescue from, and integration of a nucleotide
sequence
interposed between two flanking ITRs into a mammalian cell genome.
The nucleotide sequences of AAV ITR regions are known. See for
example Kotin, R. M. (1994) Human Gene Therapy 5:793-801; Berns, K. I.
"Parvoviridae and their Replication" in Fundamental Virology, 2nd Edition, (B.
N. Fields and D. M. Knipe, eds.). As used herein, an "AAV ITR" need not have
the wild-type nucleotide sequence depicted, but may be altered, e.g., by the
insertion, deletion or substitution of nucleotides. Additionally, the AAV ITR
may be derived from any of several AAV serotypes, including without
limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc.
Furthermore, 5' and 3' ITRs which flank a selected nucleotide sequence in an
AAV vector need not necessarily be identical or derived from the same AAV
serotype or isolate, so long as they function as intended, i.e., to allow for
excision and rescue of the sequence of interest from a host cell genome or
19
CA 02596588 2013-08-13
vector, and to allow integration of the heterologous sequence into the
recipient
cell genome when AAV Rep gene products are present in the cell.
In one embodiment, AAV ITRs can be derived from any of several AAV
serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-
5, AAVX7, etc. Furthermore, 5' and 3 ITRs which flank a selected nucleotide
sequence in an AAV expression vector need not necessarily be identical or
derived from the same AAV serotype or isolate, so long as they function as
intended, i.e., to allow for excision and rescue of the sequence of interest
from a
host cell genome or vector, and to allow integration of the DNA molecule into
the recipient cell genome when AAV Rep gene products are present in the cell.
In one embodiment, AAV capsids can be derived from any of several
AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4,
AAV-5, AAV6, orAAV8, and the AAV ITRS are derived form AAV serotype 2.
Suitable DNA molecules for use in AAV vectors will be less than about 5
kilobases (kb),less than about 4.5 kb, less than about 4kb, less than about
3.5 kb,
less than about 3 kb, less than about 2.5 kb in size and are known in the art
Dong, J.-Y. et al. (November 10, 1996). "Quantitative Analysis of the
Packaging Capacity of Recombinant Adeno-Associated Virus," Human Gene
Ther. 7(17):2101-2112 and US Patent No. 6,596,535. In some embodiments of
the invention the DNA molecules for use in the AAV vectors will contain
multiple copies of the identical siRNA sequence. As used herein the term
multiple copies of an siRNA sequences means at least 2 copies, at least 3
copies,
at least 4 copies, at least 5 copies, at least 6 copies, at least 7 copies, at
least 8
copies, at least 9 copies, and at least 10 copies. In some embodiments the DNA
molecules for use in the AAV vectors will contain multiple siRNA sequences.
As used herein the term multiple = Si RNA sequences means at least 2 siRNA
sequences, at least 3 siRNA sequences, at least 4 siRNA sequences, at least 5
siRNA sequences, at least 6 siRNA sequences, at least 7 siRNA sequences, at
least 8 siRNA sequences, at least 9 siRNA sequences, and at least 10 siRNA
sequences. In some embodiments suitable DNA vectors of the invention will
contain a sequence encoding the
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
siRNA molecule of the invention and a stuffer fragment. Suitable stuffer
fragments of the invention include sequences known in the art including
without
limitation sequences which do not encode an expressed protein molecule;
sequences which encode a normal cellular protein which would not have
deleterious effect on the cell types in which it was expressed; and sequences
which would not themselves encode a functional siRNA duplex molecule.
In one embodiment, suitable DNA molecules for use in AAV vectors will
be less than about 5 kilobases (kb) in size and will include, for example, a
stuffer
sequence and a sequence encoding a siRNA molecule of the invention. For
example, in order to prevent any packaging of AAV genomic sequences
containing the rep and cap genes, a plasmid containing the rep and cap DNA
fragment may be modified by the inclusion of a stuffer fragment as is known in
the art into the AAV genome which causes the DNA to exceed the length for
optimal packaging. Thus, the helper fragment is not packaged into AAV virions.
This is a safety feature, ensuring that only a recombinant AAV vector genome
that does not exceed optimal packaging size is packaged into virions. An AAV
helper fragment that incorporates a stuffer sequence can exceed the wild-type
genome length of 4.6 kb, and lengths above 105% of the wild-type will
generally
not be packaged. The staffer fragment can be derived from, for example, such
non-viral sources as the Lac-Z or beta-galactosidase gene.
In one embodiment, the selected nucleotide sequence is operably linked
to control elements that direct the transcription or expression thereof in the
subject in vivo. Such control elements can comprise control sequences normally
associated with the selected gene. Alternatively, heterologous control
sequences
can be employed. Useful heterologous control sequences generally include those
derived from sequences encoding mammalian or viral genes. Examples include,
but are not limited to, the SV40 early promoter, mouse mammary tumor virus
LTR promoter; adenovirus major late promoter (Ad MLP); a herpes simplex
virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV
immediate early promoter region (CMVIB), a rous sarcoma virus (RSV)
promoter, pol II promoters, pol III promoters, synthetic promoters, hybrid
21
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
promoters, and the like. In addition, sequences derived from nonviral genes,
such
as the murine metallothionein gene, will also find use herein. Such promoter
sequences are commercially available from, e.g., Stratagene (San Diego,
Calif.).
In one embodiment, both heterologous promoters and other control
elements, such as CNS-specific and inducible promoters, enhancers and the
like,
will be of particular use. Examples of heterologous promoters include the CMB
promoter. Examples of CNS-specific promoters include those isolated from the
genes from myelin basic protein (MBP), glial fibrillary acid protein (GFAP),
and
neuron specific enolase (NSE). Examples of inducible promoters include DNA
responsive elements for ecdysone, tetracycline, hypoxia and aufin.
In one embodiment, the AAV expression vector which harbors the DNA
molecule of interest bounded by AAV ITRs, can be constructed by directly
inserting the selected sequence(s) into an AAV genome which has had the major
AAV open reading frames ("ORFs") excised therefrom. Other portions of the
AAV genome can also be deleted, so long as a sufficient portion of the ITRs
remain to allow for replication and packaging functions. Such constructs can
be
designed using techniques well known in the art. See, e.g., U.S. Pat. Nos.
5,173,414 and 5,139,941; International Publication Nos. WO 92/01070
(published Jan. 23, 1992) and WO 93/03769 (published Mar. 4 1993);
Lebkowski etal. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990)
Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, B. J. (1992)
Current
Opinion in Biotechnology 3:533-539; Muzyczka, N. (1992) Current Topics in
Microbiol. and Immunol. 158:97-129; Kotin, R. M. (1994) Human Gene
Therapy 5:793-801; Shelling and Smith (1994) Gene Therapy 1:165-169; and
Zhou etal. (1994) J. Exp. Med. 179:1867-1875.
Alternatively, AAV ITRs can be excised from the viral genome or from
an AAV vector containing the same and fused 5' and 3' of a selected nucleic
acid
construct that is present in another vector using standard ligation
techniques,
such as those described in Sambrook et al., supra. For example, ligations can
be
accomplished in 20 mM Tris-C1 pH 7.5, 10 mM MgC12, 10 mM DTT, 33 Wm'
BSA, 10 mM-50 mM NaC1, and either 40 uM ATP, 0.01-0.02 (Weiss) units T4
22
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
DNA ligase at 0 C. (for "sticky end" ligation) or 1 mM ATP, 0.3-0.6 (Weiss)
units T4 DNA ligase at 14 C. (for "blunt end" ligation). Intermolecular
"sticky
end" ligations are usually performed at 30-100 ig/m1 total DNA concentrations
(5-100 nM total end concentration). AAV vectors which contain ITRs have been
described in, e.g., U.S. Pat. No. 5,139,941. In particular, several AAV
vectors
are described therein which are available from the American Type Culture
Collection ("ATCC" ) under Accession Numbers 53222, 53223, 53224, 53225
and 53226.
Additionally, chimeric genes can be produced synthetically to include
AAV ITR sequences arranged 5' and 3' of one or more selected nucleic acid
sequences. Preferred codons for expression of the chimeric gene sequence in
mammalian CNS cells can be used. The complete chimeric sequence is
assembled from overlapping oligonucleotides prepared by standard methods.
See, e.g., Edge, Nature (1981) 292:756; Nambair et al. Science (1984)
223:1299;
Jay etal. J. Biol. Chem. (1984) 259:6311.
In order to produce rAAV virions, an AAV expression vector is
introduced into a suitable host cell using known techniques, such as by
transfection. A number of transfection techniques are generally known in the
art.
See, e.g., Graham etal. (1973) Virology, 52:456, Sambrook et al. (1989)
Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New
York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and
Chu et al. (1981) Gene 13:197. Particularly suitable transfection methods
include calcium phosphate co-precipitation (Graham et al. (1973) Virol. 52:456-
467), direct micro-injection into cultured cells (Capecchi, M. R. (1980) Cell
22:479-488), electroporation (Shigekawa etal. (1988) BioTechniques 6:742-
751), liposome mediated gene transfer (Mannino et al. (1988) BioTechniques
6:682-690), lipid-mediated -transduction (Feigner etal. (1987) Proc. Natl.
Acad.
Sci. USA 84:7413-7417), and nucleic acid delivery using high-velocity
microprojectiles (Klein etal. (1987) Nature 327:70-73).
In one embodiment, suitable host cells for producing rAAV virions
include microorganisms, yeast cells, insect cells, and mammalian cells, that
can
23
CA 02596588 2007-07-30
WO 2006/083800 PCT/US2006/003298
be, or have been, used as recipients of a heterologous DNA molecule. The term
=
includes the progeny of the original cell which has been transfected. Thus, a
"host cell" as used herein generally refers to a cell which has been
transfected
with an exogenous DNA sequence. Cells from the stable human cell line, 293
=
(readily available through, e.g., the American Type Culture Collection under
Accession Number ATCC CRL1573) can be used in the practice of the present
invention. Particularly, the human cell line 293 is a human embryonic kidney
cell line that has been transformed with adenovirus type-5 DNA fragments
(Graham et al. (1977) J. Gen. Virol. 36:59), and expresses the adenoviral Ela
and Elb genes (Aiello et al. (1979) Virology 94:460). The 293 cell line is
readily
transfected, and provides a particularly convenient platform in which to
produce
rAAV virions.
In one embodiment, host cells containing the above-described AAV
expression vectors are rendered capable of providing AAV helper functions in
order to replicate and encapsidate the nucleotide sequences flanked by the AAV
1TRs to produce rAAV virions. AAV helper functions are generally AAV-
derived coding sequences which can be expressed to provide AAV gene
products that, in turn, function in trans for productive AAV replication. AAV
helper functions are used herein to complement necessary AAV functions that
are missing from the AAV expression vectors. Thus, AAV helper functions
include one, or both of the major AAV ORFs, namely the rep and cap coding
regions, or functional homologues thereof.
The Rep expression products have been shown to possess many
functions, including, among others: recognition, binding and nicking of the
AAV
origin of DNA replication; DNA helicase activity; and modulation of
transcription from AAV (or other heterologous) promoters. The Cap expression
products supply necessary packaging functions. AAV helper functions are used
herein to complement AAV functions in trans that are missing from AAV
vectors.
The term "AAV helper construct" refers generally to a nucleic acid
molecule that includes nucleotide sequences providing AAV functions deleted
24
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
from an AAV vector which is to be used to produce a transducing vector for
delivery of a nucleotide sequence of interest. AAV helper constructs are
commonly used to provide transient expression of AAV rep and/or cap genes to
complement missing AAV functions that are necessary for lytic AAV
replication; however, helper constructs lack AAV ITRs and can neither
replicate
nor package themselves. AAV helper constructs can be in the form of a plasmid,
phage, transpo son, cosmid, virus, or virion. A number of AAV helper
constructs
have been described, such as the commonly used plasmids pAAV/Ad and
pIM29+45 which encode both Rep and Cap expression products. See, e.g.,
Samulski et al. (1989) J. Virol. 63:3822-3828; and McCarty et al. (1991) J.
Virol. 65:2936-2945. A number of other vectors have been described which
encode Rep and/or Cap expression products. See, e.g., U.S. Pat. No. 5,139,941.
By "AAV rep coding region" is meant the art-recognized region of the
AAV genome which encodes the replication proteins Rep 78, Rep 68, Rep 52
and Rep 40. These Rep expression products have been shown to possess many
functions, including recognition, binding and nicking of the AAV origin of DNA
replication, DNA helicase activity and modulation of transcription from AAV
(or other heterologous) promoters. The Rep expression products are
collectively
required for replicating the AAV genome. For a description of the AAV rep
coding region, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol. and
Immunol. 158:97-129; and Kotin, R. M. (1994) Human Gene Therapy 5:793-
801. Suitable homologues of the AAV rep coding region include the human
herpesvirus 6 (HHV-6) rep gene which is also known to mediate AAV-2 DNA
replication (Thomson et al. (1994) Virology 204:304-311).
By "AAV cap coding region" is meant the art-recognized region of the
AAV genome which encodes the capsid proteins VP1, VP2, and VP3, or
functional homologues thereof. These Cap expression products supply the
packaging functions which are collectively required for packaging the viral
genome. For a description of the AAV cap coding region, see, e.g., Muzyczka,
=
N. and Kotin, R. M. (supra).
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
In one embodiment, AAV helper functions are introduced into the host
cell by transfecting the host cell with an AAV helper construct either prior
to, or
concurrently with, the transfection of the AAV expression vector. AAV helper
constructs are thus used to provide at least transient expression of AAV rep
and/or cap genes to complement missing AAV functions that are necessary for
productive AAV infection. AAV helper constructs lack AAV ITRs and can
neither replicate nor package themselves. These constructs can be in the form
of
a plasmid, phage, transposon, cosmid, virus, or virion. A number of AAV helper
constructs have been described, such as the commonly used plasmids pAAV/Ad
and pIM29+45 which encode both Rep and Cap expression products. See, e.g.,
Samulski et al. (1989) J. Virol. 63:3822-3828; and McCarty et al. (1991) J.
Virol. 65:2936-2945. A number of other vectors have been described which
encode Rep and/or Cap expression products. See, e.g., U.S. Pat. No. 5,139,941.
In one embodiment, both AAV expression vectors and AAV helper
constructs can be constructed to contain one or more optional selectable
markers.
Suitable markers include genes which confer antibiotic resistance or
sensitivity
to, impart color to, or change the antigenic characteristics of those cells
which
have been transfected with a nucleic acid construct containing the selectable
marker when the cells are grown in an appropriate selective medium. Several
selectable marker genes that are useful in the practice of the invention
include
the hygromycin B resistance gene (encoding Aminoglycoside phosphotranferase
(APH)) that allows selection in mammalian cells by conferring resistance to
G418 (available from Sigma, St. Louis, Mo.). Other suitable markers are known
to those of skill in the art.
In one embodiment, the host cell (or packaging cell) is rendered capable
of providing non AAV derived functions, or "accessory functions," in order to
produce rAAV virions. Accessory functions are non AAV derived viral and/or
cellular functions upon which AAV is dependent for its replication. Thus,
accessory functions include at least those non AAV proteins and RNAs that are
required in AAV replication, including those involved in activation of AAV
gene transcription, stage specific AAV mRNA splicing, AAV DNA replication,
26
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
synthesis of Cap expression products and AAV capsid assembly. Viral-based
accessory functions can be derived from any of the known helper viruses.
In one embodiment, accessory functions can be introduced into and then
expressed in host cells using methods known to those of skill in the art.
Commonly, accessory functions are provided by infection of the host cells with
an unrelated helper virus. A number of suitable helper viruses are known,
including adenoviruses; herpesviruses such as herpes simplex virus types 1 and
2; and vaccinia viruses. Nonviral accessory functions will also find use
herein,
such as those provided by cell synchronization using any of various known
agents. See, e.g., Buller et al. (1981) J. Virol. 40:241-247; McPherson et al.
(1985) Virology 147:217-222; Schlehofer et al. (1986) Virology 152:110-117.
In one embodiment, accessory functions are provided using an accessory
function vector. Accessory function vectors include nucleotide sequences that
provide one or more accessory functions. An accessory function vector is
capable of being introduced into a suitable host cell in order to support
efficient
AAV virion production in the host cell. Accessory function vectors can be in
the
form of a plasmid, phage, transposon or cosmid. Accessory vectors can also be
in the form of one or more linearized DNA or RNA fragments which, when
associated with the appropriate control elements and enzymes, can be
transcribed
or expressed in a host cell to provide accessory functions. See, for example,
International Publication No. WO 97/17548, published May 15, 1997.
In one embodiment, nucleic acid sequences providing the accessory
functions can be obtained from natural sources, such as from the genome of an
adenovirus particle, or constructed using recombinant or synthetic methods
known in the art. In this regard, adenovirus-derived accessory functions have
been widely studied, and a number of adenovirus genes involved in accessory
functions have been identified and partially characterized. See, e.g., Carter,
B. J.
(1990) "Adeno-Associated Virus Helper Functions," in CRC Handbook of
Parvoviruses, vol. I (P. Tijssen, ed.), and Muzyczka, N. (1992) Curr. Topics.
Microbiol and Immun. 158:97-129. Specifically, early adenoviral gene regions
El a, E2a, E4, VAT RNA and, possibly, Elb are thought to participate in the
27
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
accessory process. Janik et al. (1981) Proc. Natl. Acad. Sci. USA 78:1925-
1929.
Herpesvirus-derived accessory functions have been described. See, e.g., Young
et al. (1979) Prog. Med. Virol. 25:113. Vaccinia virus-derived accessory
functions have also been described. See, e.g., Carter, B. J. (1990), supra.,
Schlehofer et al. (1986) Virology 152:110-117.
In one embodiment, as a consequence of the infection of the host cell
with a helper virus, or transfection of the host cell with an accessory
function
vector, accessory functions are expressed which transactivate the AAV helper
construct to produce AAV Rep and/or Cap proteins. The Rep expression
products excise the recombinant DNA (including the DNA of interest) from the
AAV expression vector. The Rep proteins also serve to duplicate the AAV
genome. The expressed Cap proteins assemble into capsids, and the recombinant
AAV genome is packaged into the capsids. Thus, productive AAV replication
ensues, and the DNA is packaged into rAAV virions.
In one embodiment, following recombinant AAV replication, rAAV
virions can be purified from the host cell using a variety of conventional
purification methods, such as CsC1 gradients. Further, if infection is
employed to
express the accessory functions, residual helper virus can be inactivated,
using
known methods. For example, adenovirus can be inactivated by heating to
temperatures of approximately 60.degrees C. for, e.g., 20 minutes or more.
This
treatment effectively inactivates only the helper virus since AAV is extremely
heat stable while the helper adenovirus is heat labile. The resulting rAAV
virions
are then ready for use for DNA delivery to the CNS (e.g., cranial cavity) of
the
subject.
Methods of delivery of viral vectors include, but are not limited to, intra-
arterial, intra-muscular, intravenous, intranasal and oral routes. Generally,
rAAV
virions may be introduced into cells of the CNS using either in vivo or in
vitro
transduction techniques. If transduced in vitro, the desired recipient cell
will be
removed from the subject, transduced with rAAV virions and reintroduced into
the subject. Alternatively, syngeneic or xenogeneic cells can be used where
those
cells will not generate an inappropriate immune response in the subject.
28
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Suitable methods for the delivery and introduction of transduced cells
into a subject have been described. For example, cells can be transduced in
vitro
by combining recombinant AAV virions with CNS cells e.g., in appropriate
media, and screening for those cells harboring the DNA of interest can be
screened using conventional techniques such as Southern blots and/or PCR, or
by using selectable markers. Transduced cells can then be formulated into
pharmaceutical compositions, described more fully below, and the composition
introduced into the subject by various techniques, such as by grafting,
intramuscular, intravenous, subcutaneous and intraperitoneal injection.
In one embodiment, for in vivo delivery, the rAAV virions are
formulated into pharmaceutical compositions and will generally be administered
parenterally, e.g., by intramuscular injection directly into skeletal or
cardiac
muscle or by injection into the CNS.
In one embodiment, viral vectors of the invention are delivered to the
CNS via convection-enhanced delivery (CED) systems that can efficiently
deliver viral vectors, e.g., AAV, over large regions of a subject's brain
(e.g.,
striatum and/or cortex). As described in detail and exemplified below, these
methods are suitable for a variety of viral vectors, for instance AAV vectors
carrying therapeutic genes (e.g., siRNAs).
Any convection-enhanced delivery device may be appropriate for
delivery of viral vectors. In one embodiment, the device is an osmotic pump or
an infusion pump. Both osmotic and infusion pumps are commerically available
from a variety of suppliers, for example Alzet Corporation, Hamilton
Corporation, Aiza, Inc., Palo Alto, Calif.). Typically, a viral vector is
delivered
via CED devices as follows. A catheter, cannula or other injection device is
inserted into CNS tissue in the chosen subject. In view of the teachings
herein,
one of skill in the art could readily determine which general area of the CNS
is
an appropriate target. For example, when delivering AAV vector encoding a
therapeutic gene to treat PD, the striatum is a suitable area of the brain to
target.
Stereotactic maps and positioning devices are available, for example from ASI
Instruments, Warren, Mich. Positioning may also be conducted by using
29
CA 02596588 2013-08-13
anatomical maps obtained by CT and/or MRI imaging of the subject's brain to
help guide the injection device to the chosen target. Moreover, because the
methods described herein can be practiced such that relatively large areas of
the
brain take up the viral vectors, fewer infusion cannula are needed. Since
surgical
complications are related to the number of penetrations, the methods described
herein also serve to reduce the side effects seen with conventional delivery
techniques.
In one embodiment, pharmaceutical compositions will comprise
sufficient genetic material to produce a therapeutically effective amount of
the
siRNA of interest, i.e., an amount sufficient to reduce or ameliorate symptoms
of
the disease state in question or an amount sufficient to confer the desired
benefit.
The pharmaceutical compositions will also contain a pharmaceutically
acceptable excipient. Such excipients include any pharmaceutical agent that
does
not itself induce the production of antibodies harmful to the individual
receiving
the composition, and which may be administered without undue toxicity.
Pharmaceutically acceptable excipients include, but are not limited to,
sorbitol,
Tween80 TWEEN 80, and liquids such as water, saline, glycerol and ethanol.
Pharmaceutically acceptable salts can be included therein, for example,
mineral
acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and
the
like; and the salts of organic acids such as acetates, propionates, malonates,
benzoates, and the like. Additionally, auxiliary substances, such as wetting
or
emulsifying agents, pH buffering substances, and the like, may be present in
such vehicles. A thorough discussion of pharmaceutically acceptable excipients
is available in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub.
Co., N.J. 1991).
As is apparent to those skilled in the art in view of the teachings of this
specification, an effective amount of viral vector which must be added can be
empirically determined. Administration can be effected in one dose,
continuously or intermittently throughout the course of treatment. Methods of
determining the most effective means and dosages of administration are well
known to those of skill in the art and will vary with the viral vector, the
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
composition of the therapy, the target cells, and the subject being treated.
Single
and multiple administrations can be carried out with the dose level and
pattern
being selected by the treating physician.
It should be understood that more than one transgene could be expressed
by the delivered viral vector. Alternatively, separate vectors, each
expressing one
or more different transgenes, can also be delivered to the CNS as described
herein. Furthermore, it is also intended that the viral vectors delivered by
the
methods of the present invention be combined with other suitable compositions
and therapies.
Brief Description of the Figures
Figure 1. siRNA expressed from CMV promoter constructs and in vitro
effects. (A) A cartoon of the expression plasmid used for expression of
functional siRNA in cells. The CMV promoter was modified to allow close
juxtaposition of the hairpin to the transcription initiation site, and a
minimal
polyadenylation signal containing cassette was constructed immediately 3' of
the
MCS (mCMV, modified CMV; mpA, minipA). (B, C) Fluorescence
photomicrographs of HEK293 cells 72 h after transfection of pEGFPN1 and
pCMVpgal (control), or pEGFPN1 and pmCMVsiGFPmpA, respectively. (D)
Northern blot evaluation of transcripts harvested from pmCMVsiGFPmpA
(lanes 3, 4) and pmCMVsiBgalmpA (lane 2) transfected HEK293 cells. Blots
were probed with 32P-labeled sense oligonucleotides. Antisense probes yielded
similar results (not shown). Lane 1, 32P-labeled RNA markers. AdsiGFP
infected cells also possessed appropriately sized transcripts (not shown). (E)
Northern blot for evaluation of target mRNA reduction by siRNA (upper panel).
The internal control GAPDH is shown in the lower panel. HEK293 cells were
transfected with pEGFPN1 and pmCMVsiGFPmpA, expressing siGFP, or
31
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
plasmids expressing the control siRNA as indicated. pCMVeGFPx, which
expresses siGFPx, contains a large poly(A) cassette from SV40 large T and an
unmodified CMV promoter, in contrast to pmCMVsiGFPmpA shown in (A).
(F) Western blot with anti-GFP antibodies of cell lysates harvested 72 h after
transfection with pEGFPN1 and pCMVsiGFPmpA, or pEGFPN1 and
pmCMVsiBglucmpA. (G, H) Fluorescence photomicrographs of HEK293 cells
72 h after transfection of pEGFPN1 and pCMVsiGFPx, or pEGFPN1 and
pmCMVsiBglucmpA, respectively. (I, J) siRNA reduces expression from
endogenous alleles. Recombinant adenoviruses were generated from
pmCMVsiBglucmpA and pmCMVsiGFPmpA and purified. HeLa cells were
infected with 25 infectious viruses/cell (MOI = 25) or mock-infected (control)
and cell lysates harvested 72 h later. (I) Northern blot for B-glucuronidase
mRNA levels in AdsiBgluc and AdsiGFP transduced cells. GAPDH was used as
an internal control for loading. (J) The concentration of p-glucuronidase
activity
in lysates quantified by a fluorometric assay. Stein, C.S. et al., J. Viral.
73:3424-3429 (1999).
Figure 2. Viral vectors expressing siRNA reduce expression from
transgenic and endogenous alleles in vivo. Recombinant adenovirus vectors
were prepared from the siGFP and siBgluc shuttle plasmids described in Fig. 1.
(A) Fluorescence microscopy reveals diminution of eGFP expression in vivo. In
addition to the siRNA sequences in the El region of adenovirus, RFP expression
cassettes in E3 facilitate localization of gene transfer. Representative
photomicrographs of eGFP (left), RFP (middle), and merged images (right) of
coronal sections from mice injected with adenoviruses expressing siGFP (top
panels) or siBgluc (bottom panels) demonstrate siRNA specificity in eGFP
transgenic mice striata after direct brain injection. (B) Full coronal brain
sections (1 mm) harvested from AdsiGFP or AdsiBgluc injected mice were split
into hemisections and both ipsilateral (ii) and contralateral (c1) portions
evaluated by western blot using antibodies to GFP. Actin was used as an
internal control for each sample. (C) Tail vein injection of recombinant
32
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
adenoviruses expressing siPgluc directed against mouse P-glucuronidase
(AdsiMuPgluc) reduces endogenous P¨glucuronidase RNA as determined by
Northern blot in contrast to control-treated (AdsiBgal) mice.
Figure 3. siGFP gene transfer reduces Q19-eGFP expression in cell
lines. PC12 cells expressing the polyglutamine repeat Q19 fused to eGFP
(eGFP-Q19) under tetracycline repression (A, bottom left) were washed and
dox-free media added to allow eGFP-Q19 expression (A, top left).
Adenoviruses were applied at the indicated multiplicity of infection (MOI) 3
days after dox removal. (A) eGFP fluorescence 3 days after adenovirus-
mediated gene transfer of Adsipgluc (top panels) or AdsiGFP (bottom panels).
(B, C) Western blot analysis of cell lysates harvested 3 days after infection
at the
indicated MOIs demonstrate 'a dose-dependent decrease in GFP-Q19 protein
levels. NV, no virus. Top lanes, eGFP-Q19. Bottom lanes, actin loading
controls. (D) Quantitation of eGFP fluorescence. Data represent mean total
area
fluorescence standard deviation in 4 low power fields/well (3 wells/plate).
Figure 4. siRNA mediated reduction of expanded polyglutamine protein
levels and intracellular aggregates. PC12 cells expressing tet-repressible
eGFP-
Q80 fusion proteins were washed to remove doxycycline and adenovirus vectors
expressing siRNA were applied 3 days later. (A-D) Representative punctate
eGFP fluorescence of aggregates in mock-infected cells (A), or those infected
with 100 MOI of AdsiPgluc (B), AdsiGFPx (C) or AdsiPgal (D). (E) Three days
after infection of dox-free eGFP-Q80 PC12 cells with AdsiGFP, aggregate size
and number are notably reduced. (F) Western blot analysis of eGFP-Q80
aggregates (arrowhead) and monomer (arrow) following Adsipgluc or AdsiGFP
infection at the indicated MOIs demonstrates dose dependent siGFP-mediated
reduction of GFP-Q80 protein levels. (G) Quantification of the total area of
fluorescent inclusions measured in 4 independent fields/well 3 days after
virus
was applied at the indicated MOIs. The data are mean standard deviation.
Figure 5. RNAi-mediated suppression of expanded CAG repeat containing
genes. Expanded CAG repeats are not direct targets for preferential
inactivation
(A), but a linked SNP can be exploited to generate siRNA that selectively
33
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
silences mutant ataxin-3 expression (B-F). (A) Schematic of cDNA encoding
generalized polyQ-fluorescent protein fusions. Bars indicate regions targeted
by
siRNAs. HeLa cells co-transfected with Q80-GFP, Q19-RFP and the indicated
siRNA. Nuclei are visualized by DAPI staining (blue) in merged images.
(B)Schematic of human ataxin-3 cDNA with bars indicating regions targeted by
siRNAs. The targeted SNP (G987C) is shown in color. In the displayed siRNAs,
red or blue bars denote C or G respectively. In this Figure,
AGCAGCAGCAGGGGGACCTATCAGGAC is SEQ ID NO:7, and
CAGCAGCAGCAGCGGGACCTATCAGGAC is SEQ ID NO:8. (C)
Quantitation of fluorescence in Cos-7 cells transfected with wild type or
mutant
ataxin-3-GFP expression plasmids and the indicated siRNA. Fluorescence from
cells co-transfected with siMiss was set at one. Bars depict mean total
fluorescence from three independent experiments +1- standard error of the mean
(SEM). (D) Western blot analysis of cells co-transfected with the indicated
ataxin-3 expression plasmids (top) and siRNAs (bottom). Appearance of
aggregated, mutant ataxin-3 in the stacking gel (seen with siMiss and siG10)
is
prevented by siRNA inhibition of the mutant allele. (E) Allele specificity is
retained in the simulated heterozygous state. Western blot analysis of Cos-7
cells
cotransfected with wild-type (atx-3-Q28-GFP) and mutant (atx-Q166)
expression plasmids along with the indicated siRNAs. (Mutant ataxin-3 detected
with 1C2, an antibody specific for expanded polyQ, and wild-type ataxin-3
detected with anti-ataxin-3 antibody.) (F) Western blot of Cos-7 cells
transfected
with A-tx-3-GFP expression plasmids and plasmids encoding the indicated
shRNA. The negative control plasmid, phU6-LacZi, encodes siRNA specific for
LacZ. Both normal and mutant protein were detected with anti-ataxin-3
antibody. Tubulin immunostaining shown as a loading control in panels (D)-(F).
Figure 6. Primer sequences for in vitro synthesis of siRNAs using T7
polymerase. All primers contain the following T7 promoter sequence at their 3'
ends: 5'-TATAGTGAGTCGTATTA-3' (SEQ ID NO:9). The following primer
was annealed to all oligos to synthesize siRNAs: 5'-
TAATACGACTCACTATAG-3' (SEQ ID NO:10).
34
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Figure 7. Inclusion of either two (siC7/8) or three (siC10) CAG triplets
at the 5' end of ataxin-3 siRNA does not inhibit expression of unrelated CAG
repeat containing genes. (A) Western blot analysis of Cos-7 cells transfected
with CAG repeat-GFP fusion proteins and the indicated siRNA.
Immunostaining with monoclonal anti-GFP antibody (MBL) at 1:1000 dilution.
(B) Western blot analysis of Cos-7 cells transfected with Flag-tagged ataxin-1-
Q30, which is unrelated to ataxin-3, and the indicated siRNA. Immunostaining
with anti-Flag monoclonal antibody (Sigma St. Louis, MO) at 1:1000 dilution.
In panels (A) and (B), lysates were collected 24 hours after transfection.
Tubulin
immunostaining shown as a loading control.
Figure 8. shRNA-expressing adenovirus mediates allele-specific
silencing in transiently transfected Cos-7 cells simulating the heterozygous
state.
(A) Representative images of cells cotransfected to express wild type and
mutant ataxin-3 and infected with the indicated adenovirus at 50
multiplicities of
infection (MOI). Atx-3-Q28-GFP (green) is directly visualized and Atx-3-Q166
(red) is detected by immunofluorescence with 1C2 antibody. Nuclei visualized
with DAPI stain in merged images. An average of 73.1% of cells co-expressed
both ataxin-3 proteins with siMiss. (B) Quantitation of mean fluorescence from
2
independent experiments performed as-in (A). (C) Western blot analysis of
viral-
mediated silencing in Cos-7 cells expressing wild type and mutant ataxin-3 as
in
(A). Mutant ataxin-3 detected with 1C2 antibody and wild-type human and
endogenous primate ataxin-3 detected with anti-ataxin-3 antibody. (D) shRNA-
expressing adenovirus mediates allele-specific silencing in stably transfected
neural cell lines. Differentiated PC12 neural cells expressing wild type
(left) or
mutant (right) ataxin-3 were infected with adenovirus (100 MOI) engineered to
express the indicated hairpin siRNA. Shown are Western blots immunostained
for ataxin-3 and GAPDH as loading control.
Figure 9. Allele-specific siRNA suppression of a mis sense Tau
mutation. (A) Schematic of human tau cDNA with bars indicating regions and
mutations tested for siRNA suppression. Of these, the V337M region showed
effective suppression and was further studied. Vertical bars represent
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
=
microtubule binding repeat elements in Tau. In the displayed siRNAs, blue and
red bars denote A and C respectively. In this Figure,
GTGGCCAGATGGAAGTAAAATC is SEQ ID NO:35, and
GTGGCCAGGTGGAAGTAAAATC is SEQ ID NO:41. (B) Western blot
analysis of cells co-transfected with WT or V337M Tau-EGFP fusion proteins
and the indicated siRNAs. Cells were lysed 24 hr after transfection and probed
with anti-tau antibody. Tubulin immunostaining is shown as loading control.
(C)
Quantitation of fluorescence in Cos-7 cells transfected with wild type tau-
EGFP
or mutant V337M tau-EGFP expression plasmids and the indicated siRNAs.
Bars depict mean fluorescence and SEM from three independent experiments.
Fluorescence from cells co-transfected with siMiss was set at one.
Figure 10. Allele-specific silencing of Tau in cells simulating the
heterozygous state. (A) Representative fluorescent images of fixed Hela cells
co-
transfected with flag-tagged WT-Tau (red), V337M-Tau-GFP (green), and the
indicated siRNAs. An average of 73.7% of cells co-expressed both Tau proteins
with siMiss. While siA9 suppresses both alleles, siA9/C12 selectively
decreased
expression of mutant Tau only. Nuclei visualized with DAPI stain in merged
images. (B) Quantitation of mean fluorescence from 2 independent experiments
performed as in (A). (C) Western blot analysis of cells co-transfected with
Flag-
WT-Tau and V337M-Tau-EGFP fusion proteins and the indicated siRNAs. Cells
were lysed 24 hr after transfection and probed with anti-tau antibody. V337M-
GFP Tau was differentiated based on reduced electrophoretic mobility due to
the addition of GFP. Tubulin immunostaining is shown as a loading control.
Figure 11. Schematic diagram of allele-specific silencing of mutant
TorsinA by small interfering RNA (siRNA). In the disease state, wild type and
mutant alleles of TOM are both transcribed into mRNA. siRNA with sequence
identical to the mutant allele (deleted of GAG) should bind mutant mRNA
selectively and mediate its degradation by the RNA-induced silencing complex
(RISC) (circle). Wild type mRNA, not recognized by the mutant ¨specific
siRNA, will remain and continue to be translated into normal TorsinA. The two
36
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
adjacent GAG' s in wild type TOR1A alleles are shown as two parallelograms,
one of which is deleted in mutant TOR1A alleles.
Figure 12. Design and targeted sequences of siRNAs. Shown are the
relative positions and targeted mRNA sequences for each primer used in this
study. Mis-siRNA (negative control) does not target TA; com-siRNA targets a
sequence present in wild type and mutant TA; wt-siRNA targets only wild type
TA; and three mutant-specific siRNAs (Mut A, B, C). preferentially target
mutant TA. The pair of GAG codons near the c-terminus of wild type mRNA are
shown in underlined gray and black, with one codon deleted in mutant mRNA.
Figure 13. siRNA silencing of TAwt and TAmut in Cos-7 cells. (A)
Western blot results showing the effect of different siRNAs on GFP-TAwt
expression levels. Robust suppression is achieved with wt-siRNA and corn-
siRNA, while the mutant-specific siRNAs MutA, (B) and (C) have modest or no
effect on GFP-TAwt expression. Tubulin loading controls are also shown- . (B)
Similar experiments with cells expressing HA-TAmut, showing significant
suppression by mutant-specific siRNAs and com-siRNA but no suppression by
the wild type-specific siRNA, wt-siRNA. (C) Quantification of results from at
least three separate experiments as in A and B. (D) Cos-7 cells transfected
with
GFP-TAwt or GFP-TAmut and different siRNAs visualized under fluorescence
microscopy (200X). Representative fields are shown indicating allele-specific
suppression. (E) Quantification of fluorescence signal from two different
experiments as in D.
Figure 14. Allele-specific silencing by siRNA in the simulated
heterozygous state. Cos-7 cells were cotransfected with plasmids encoding
differentially tagged TAwt and TAmut, together with the indicated siRNA. (A)
Western blot results analysis showing selective suppression of the targeted
allele
by wt-siRNA or mutC-siRNA. (B) Quantification of results from three
experiments as in (A).
Figure 15. Allele-specific silencing of mutant huntingtin by siRNA.
PC6-3 cells were co-transfected with plasmids expressing siRNA specific for
the
polymorphism encoding the transcript for mutant huntingtin.
37
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Figure 16. RNAi reduces human huntingtin expression in vitro. (A)
RNA sequence of shHD2.1. The 21 nucleotide antisense strand is cognate to
nucleotides 416-436 of human htt mRNA (Genbank #NM 00211). (B and C)
Northern and western blots demonstrate shHD2.1 mediated reduction of HD-
N171-82Q mRNA and protein expression, 48 h post-transfection of target- and
shRNA-expressing plasmids. GAPDH and actin serve as loading controls. (D)
Western blots show that shHD2.1 inhibits expression of full-length human
huntingtin protein, 48 h post-transfection. (E) ShHD2.1 induces dose-dependent
reduction of human htt mRNA. Cells were transfected with shLacZ- or
shHD2.1-expressing plasmids in the indicated amounts. Relative htt expression
was determined by quantitative PCR 24 h later. SEQ ID NO:56 is 5'-
AAGAAAGAACUUUCAGCUACC-3'. SEQ ID NO:57 is 5'-
GGUAGCUGAAAGUUCUUUCLTU-3'. SEQ ID NO:58 is 5'-GAAGCUUG-3'.
SEQ ID NO:59 is 5'-
AAGAAAGAACUUUCAGCUACCGAAGCLTUGGGUAGCUGAAAGUUCU
UUCUUULTUUUU-3' .
Figure 17. AAV.shHD2.1 delivers widespread RNAi expression to
mouse striatum. (A) AAV.shHD2.1 viral vector. ITR, inverted terminal repeat.
(B) Northern blot showing shHD2.1 transcripts are expressed in vivo. Processed
antisense (lower band) and unprocessed (upper band) shHD2.1 transcripts in
three different AAV.sh1-1D2.1-injected mice. L, ladder; +, positive control
oligo.
Blot was probed with radiolabeled sense probe. (C) Typical AAV1 transduction
pattern (Iu-GFP) in mouse brain. CC, corpus callosum; LV, lateral ventricle.
Figure 18. AAV.shHD2.1 eliminates accumulation of huntingtin-
reactive neuronal inclusions and reduces HD-N171-82Q mRNA in vivo. (A)
Representative photomicrographs show htt-reactive inclusions (arrows) in HD
striatal cells transduced with AAV.shLacZ-, but not AAV.shHD2.1. Scale bar,
20 p.m. (B) Higher magnification photomicrograph from a (bottom, right)
showing lack of htt-reactive inclusions in cells transduced by AAV.shHD2.1. *
serves as a marker for orientation. Scale bar, 20 pm. (C) Representative
western blot demonstrates decreased HD-N171-82Q expression in mouse striata
38
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
transduced with AAV.shHD2.1 compared to uninjected or AAV.shLacZ-injected
striata. Prion protein was used as a loading control to normalize for tissues
expressing the HD-N171-82Q transgene. (D) AAV.shHD2.1-treatedqD mice
showed a 55% average reduction in HD-N171-82Q mRNA compared to
AAV.shLacZ or uninjected HD mice. Data are means + S.E.M. relative to
uninjected BD samples. *, difference from AAV.shHD2.1 samples, p<0.05
(ANOVA). (E) Mice were injected directly into cerebellum with AAV.shHD2.1
or AAV.shLacZ. Cerebellar sections confirm that AAV.shHD2.1, but not
AAV.shLacZ, reduces htt immunoreactivity. GCL, granule cell layer; ML,
molecular layer. Scale bar, 100 um.
Figure 19. AAV.shHD2.1 improves behavioral deficits in 1HD-N171-
82Q mice. (A) Box plot. Bilateral striatal delivery of AAV.shED2.1 improves
stride length in HD-N171-82Q mice. HD mice had significantly shorter stride
lengths compared to WT. AAV.shHD2.1 mediated significant gait improvement
relative to control-treated HD mice. *, p<0.0001 (ANOVA, Scheffe post-hoc).
(B) Bilateral striatal delivery of AAV.shBD2.1 significantly improves rotarod
performance in BD-N171-82Q mice. Only AAV.shLacZ-injected and
uninjected HD-N171-82Q declined significantly with time. Data are means
S.E.M.
Figure 20. DNA sequences of huntingtin hairpins. The bases that are
underlined indicate changes from the native huntingtin sequence.
Figure 21. PCR method for cloning hairpins. A 79 nt primer is used
with the Ampr template. Pfu. and DMSO are used in the amplification reaction.
Products are ligated directly into pCR-Blunt Topo (Invitrogen) and Kanr
resistant colonies picked and sequenced. Positive clones can be used directly.
Figure 22. Reduction of eGFP inclusions after transduction with 25, 50
or 100 viruses/cell into cultures with pre-formed aggregates. Note dose-
dependent response with shGFP vectors only.
Figure 23. Regulated RNAi. Two Teto2 sequences were placed up- and
down-stream of the TATA box of the H1 promoter element (cartoon). Either
control shRNA or shGFP was placed into the cassette for expression of
hairpins.
39
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Plasmids expressing GFP and the hairpin constructs were transfected into a
cell
line expressing the TetR (tet-repressor). GFP fluorescence (left panels) or
western blot (right panels) was evaluated in the absence (TetR binding) or
presence (TetR off) of doxycycline.
Figure 24. Top, FIV construct. Bottom, AAV construct. Both express
the hrGFP reporter so that transduced cells can be readily evaluated for shRNA
efficacy (as in Figures 3 and 4).
Detailed Description of the Invention
Modulation of gene expression by endogenous, noncoding RNAs is
increasingly appreciated as a mechanism playing a role in eukaryotic
development, maintenance of chromatin structure and genomic integrity
(McManus, 2002). Recently, techniques have been developed to trigger RNA
interference (RNAi) against specific targets in mammalian cells by introducing
exogenously produced or intracellularly expressed siRNAs (Elbashir, 2001;
Brummelkamp, 2002). These methods have proven to be quick, inexpensive and
effective for knockdown experiments in vitro and in vivo (2 Elbashir, 2001;
Brummelkamp, 2002; McCaffrey, 2002; Xia, 2002). The ability to accomplish
selective gene silencing has led to the hypothesis that siRNAs might be
employed to suppress gene expression for therapeutic benefit (Xia, 2002;
Jacque,
2002; Gitlin, 2002).
RNA interference is now established as an important biological strategy
for gene silencing, but its application to mammalian cells has been limited by
nonspecific inhibitory effects of long double-stranded RNA on translation.
Moreover, delivery of interfering RNA has largely been limited to
administration
of RNA molecules. Hence, such administration must be performed repeatedly to
have any sustained effect. The present inventors have developed a delivery
mechanism that results in specific silencing of targeted genes through
expression
of small interfering RNA (siRNA). The inventors have markedly diminished
expression of exogenous and endogenous genes in vitro and in vivo in brain and
liver, and further apply this novel strategy to a model system of a major
class of
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
neurodegenerative disorders, the polyglutamine diseases, to show reduced
polyglutamine aggregation in cells. This strategy is generally useful in
reducing
expression of target genes in order to model biological processes or to
provide
therapy for dominant human diseases.
Disclosed herein is a strategy that results in substantial silencing of
targeted alleles via siRNA. Use of this strategy results in markedly
diminished
in vitro and in vivo expression of targeted alleles. This strategy is useful
in
reducing expression of targeted alleles in order to model biological processes
or
to provide therapy for human diseases. For example, this strategy can be
applied
to a major class of neurodegenerative disorders, the polyglutamine diseases,
as is
demonstrated by the reduction of polyglutamine aggregation in cells following
application of the strategy. As used herein the term "substantial silencing"
means that the mRNA of the targeted allele is inhibited and/or degraded by the
presence of the introduced siRNA, such that expression of the targeted allele
is
reduced by about 10% to 100% as compared to the level of expression seen
when the siRNA is not present. Generally, when an allele is substantially
silenced, it will have at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%,
74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at
least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, 99% or even 100% reduction expression as compared to when the
siRNA is not present. As used herein the term "substantially normal activity"
means the level of expression of an allele when an siRNA has not been
introduced to a cell.
Dominantly inherited diseases are ideal candidates for siRNA-based
therapy. To explore the utility of siRNA in inherited human disorders, the
present inventors employed cellular models to test whether mutant alleles
responsible for these dominantly-inherited human disorders could be
specifically
targeted. First, three classes of dominantly inherited, untreatable
neurodegenerative diseases were examined: polyglutamine (polyQ)
neurodegeneration in MID/SCA3, Huntington's disease and frontotemporal
dementia with parkinsonism linked to chromosome 17 (FTDP-17). Machado-
41
CA 02596588 2013-08-13
Joseph disease is also known as Spinocerebellar Ataxia Type 3 (The HUGO
official
name is MJD). The gene involved is MJD1, which encodes for the protein ataxin-
3
(also called Mjd I p). Huntington's disease is due to expansion of the CAG
repeat
motif in exon 1 of huntingtin. In 38% of patients a polymorphism exists in
exon 58
of the huntingtin gene, allowing for allele specific targeting. Frontotemporal
dementia (sometimes with parkinonism, and linked to chromosome 17, so
sometimes called FTDP-17) is due to mutations in the MAPT1 gene that encodes
the protein tau.
The polyQ neurodegenerative disorders include at least nine diseases caused
by CAG repeat expansions that encode polyQ in the disease protein. PolyQ
expansion confers a dominant toxic property on the mutant protein that is
associated
with aberrant accumulation of the disease protein in neurons (Zoghbi, 2000).
In
FTDP-17, Tau mutations lead to the formation of neurofibrillary tangles
accompanied by neuronal dysfunction and degeneration (Poorkaj, 1998; Hutton,
1998). The precise mechanisms by which these mutant proteins cause neuronal
injury are unknown, but considerable evidence suggests that the abnormal
proteins
themselves initiate the pathogenic process (Zoghbi, 2000). Accordingly,
eliminating
expression of the mutant protein by siRNA or other means slows or prevents
disease
(Yamamoto, 2000). However, because many dominant disease genes also encode
essential proteins (e.g. Nasir, 1995) siRNA-mediated approaches were developed
that selectively inactivate mutant alleles, while allowing continued
expression of the
wild type proteins ataxin-3 and huntingtin.
Second, the dominantly-inherited disorder DYT1 dystonia was studied.
DYT1 dystonia is also known as Torsion dystonia type 1, and is caused by a GAG
deletion in the TOR1A gene encoding torsinA. DYT1 dystonia is the most common
cause of primary generalized dystonia. DYT1 usually presents in childhood as
focal
dystonia that progresses to severe generalized disease (Fahn, 1998; Klein et
al.,
-Epsilon-sarcoglycan mutations found in combination with other dystonia gene
mutations," Ann. Neurol., 2002, 52, 675-679). With one possible exception
(Leung,
2001; Doheny, 2002; Klein et al., -Epsilon-sarcoglycan mutations found in
combination with other dystonia gene mutations," Ann. Neurol., 2002, 52, 675-
679),
all cases of DYT1 result from a common GAG deletion in TORIA, eliminating one
of two adjacent glutamic acids near the C-terminus of
42
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
protein TorsinA (TA) (Ozelius, 1997). Although the precise cellular function
of _
TA is unknown, it seems clear that mutant TA (TAmut) acts through a
dominant-negative or dominant-toxic mechanism (Breakefield, 2001).
Several characteristics of DYT1 make it an ideal disease in which to use
siRNA-mediated gene silencing as therapy. Of greatest importance, the dominant
nature of the disease suggests that a reduction in mutant TA, whatever the
precise pathogenic mechanism proves to be, is helpful. Moreover, the existence
of a single common mutation that deletes a full three nucleotides suggested it
might be feasible to design siRNA that specifically targets the mutant allele
and
is applicable to all affected persons. Finally, there is no effective therapy
for
DYT1, a relentless and disabling disease.
As outlined in the strategy in Figure 11, the inventors developed siRNA
that would specifically eliminate production of protein from the mutant
allele.
By exploiting the three base pair difference between wild type and mutant
alleles, the inventors successfully silenced expression of the mutant protein
(TAmut) without interfering with expression of the wild type protein (TAwt).
Because TAwt may be an essential protein it is critically important that
efforts be
made to silence only the mutant allele. This allele-specific strategy has
obvious
therapeutic potential for DYT1 and represents a novel and powerful research
tool
with which to investigate the function of TA and its dysfunction in the
disease
state.
Expansions of poly-glutamine tracts in proteins that are expressed in the
central nervous system can cause neurodegenerative diseases. Some
neurodegenerative diseases are caused by a (CAG)õ repeat that encodes poly-
glutamine in a protein include Huntington disease (HD), spinocerebellar ataxia
(SCA1, SCA2, SCA3, SCA6, SCA7), spinal and bulbar muscular atrophy
(SBMA), and dentatorubropallidoluysian atrophy (DRPLA). In these diseases,
the poly-glutamine expansion in a protein confers a novel toxic property upon
the protein. Studies indicate that the toxic property is a tendency for the
disease
protein to misfold and form aggregates within neurons.
43
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
The gene involved in Huntington's disease (IT-15) is located at the end of
the short arm of chromosome 4. This gene is designated HD and encodes the
protein huntingtin (also known as Htt). A mutation occurs in the coding region
of this gene and produces an unstable expanded trinucleotide repeat
(cytosine-adenosine-guanosine), resulting in a protein with an expanded
glutamate sequence. The normal and abnormal functions of this protein (termed
huntingtin) are unknown. The abnormal huntingtin protein appears to
accumulate in neuronal nuclei of transgenic mice, but the causal relationship
of
this accumulation to neuronal death is uncertain.
One of skill in the art can select additional target sites for generating
siRNA specific for other alleles beyond those specifically described in the
experimental examples. Such allele-specific siRNAs made be designed using
the guidelines provided by Ambion (Austin, TX). Briefly, the target cDNA
sequence is scanned for target sequences that had AA di-nucleotides. Sense and
anti-sense oligonucleotides are generated to these targets (AA + 3' adjacent
19
nucleotides) that contained a G/C content of 35 to 55%. These sequences are
then compared to others in the human genome database to minimize homology
to other known coding sequences (BLAST search).
To accomplish intracellular expression of the therapeutic siRNA, an
RNA molecule is constructed containing two complementary strands or a hairpin
sequence (such as a 21-bp hairpin) representing sequences directed against the
gene of interest. The siRNA, or a nucleic acid encoding the siRNA, is
introduced to the target cell, such as a diseased brain cell. The siRNA
reduces
target mRNA and protein expression.
The construct encoding the therapeutic siRNA can be configured such
that one or more strands of the siRNA are encoded by a nucleic acid that is
immediately contiguous to a promoter. In one example, the promoter is a pol II
promoter. If a pol II promoter is used in a particular construct, it is
selected from
readily available pol II promoters known in the art, depending on whether
regulatable, inducible, tissue or cell-specific expression of the siRNA is
desired.
44
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
The construct is introduced into the target cell, such as by injection,
allowing for
diminished target-gene expression in the cell.
It was surprising that a poi II promoter would be effective. While small
RNAs with extensive secondary structure are routinely made from Pol TEE
promoters, there is no a priori reason to assume that small interfering RNAs
could be expressed from poi II promoters. Pol III promoters terminate in a
short
stretch of Ts (5 or 6), leaving a very small 3' end and allowing stabilization
of
secondary structure. Polymerase II transcription extends well past the coding
and polyadenylation regions, after which the transcript is cleaved. Two
adenylation steps occur, leaving a transcript with a tail of up to 200 As.
This
string of As would of course completely destabilize any small, 21 base pair
hairpin. Therefore, in addition to modifying the promoter to minimize
sequences
between the transcription start site and the siRNA sequence (thereby
stabilizing
the hairpin), the inventors also extensively modified the polyadenylation
sequence to test if a very short polyadenylation could occur. The results,
which
were not predicted from prior literature, showed that it could.
The present invention provides an expression cassette containing an
isolated nucleic acid sequence encoding a small interfering RNA molecule
(siRNA) targeted against a gene of interest. The siRNA may form a hairpin
structure that contains a duplex structure and a loop structure. The loop
structure
may contain from 4 to 10 nucleotides, such as 4, 5 or 6 nucleotides. The
duplex
is less than 30 nucleotides in length, such as from 19 to 25 nucleotides. The
siRNA may further contain an overhang region. Such an overhang may be a 3'
overhang region or a 5' overhang region. The overhang region may be, for
example, from 1 to 6 nucleotides in length. The expression cassette may
further
contain a pol II promoter, as described herein. Examples of poi II promoters
include regulatable promoters and constitutive promoters. For example, the
promoter may be a CMV or RSV promoter. The expression cassette may further
contain a polyadenylation signal, such as a synthetic minimal polyadenylation
signal. The nucleic acid sequence may further contain a marker gene or stuffer
sequences. The expression cassette may be contained in a viral vector. An
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
appropriate viral vector for use in the present invention may be an
adenoviral,-
lentiviral, adeno-associated viral (AAV), poliovirus, herpes simplex virus
(HSV)
or murine Maloney-based viral vector. The gene of interest may be a gene
associated with a condition amenable to siRNA therapy. Examples of such
conditions include neurodegenerative diseases, such as a trinucleotide-repeat
disease (e.g., polyglutamine repeat disease). Examples of these diseases
include
Huntington's disease or several spinocerebellar ataxias. Alternatively, the
gene
of interest may encode a ligand for a chemokine involved in the migration of a
cancer cell, or a chemokine receptor.
The present invention also provides an expression cassette containing an
isolated nucleic acid sequence encoding a first segment, a second segment
located immediately 3' of the first segment, and a third segment located
immediately 3' of the second segment, wherein the first and third segments are
each less than 30 base pairs in length and each more than 10 base pairs in
length,
and wherein the sequence of the third segment is the complement of the
sequence of the first segment, and wherein the isolated nucleic acid sequence
functions as a small interfering RNA molecule (siRNA) targeted against a gene
of interest. The expression cassette may be contained in a vector, such as a
viral
vector.
The present invention provides a method of reducing the expression of a
gene product in a cell by contacting a cell with an expression cassette
described
above. It also provides a method of treating a patient by administering to the
patient a composition of the expression cassette described above.
The present invention further provides a method of reducing the
expression of a gene product in a cell by contacting a cell with an expression
cassette containing an isolated nucleic acid sequence encoding a first
segment, a
second segment located immediately 3' of the first segment, and a third
segment
located immediately 3' of the second segment, wherein the first and third
segments are each less than 30 base pairs in length and each more than 10 base
pairs in length, and wherein the sequence of the third segment is the
complement
of the sequence of the first segment, and wherein the isolated nucleic acid
46
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
sequence functions as a small interfering RNA molecule (siRNA) targeted
against a gene of interest.
The present method also provides a method of treating a patient, by
administering to the patient a composition containing an expression cassette,
wherein the expression cassette contains an isolated nucleic acid sequence
encoding a first segment, a second segment located immediately 3' of the first
segment, and a third segment located immediately 3' of the second segment,
wherein the first and third segments are each less than 30 bases in length and
each more than 10 bases in length, and wherein the sequence of the third
segment is the complement of the sequence of the first segment, and wherein
the
isolated nucleic acid sequence functions as a small interfering RNA molecule
(siRNA) targeted against a gene of interest.
I. Interfering RNA
A "small interfering RNA" or "short interfering RNA" or "siRNA" or
"short hairpin RNA" or "shRNA" is a RNA duplex of nucleotides that is targeted
to a nucleic acid sequence of interest, for example, a Huntington's Disease
gene
(also referred to as huntingtin, htt, or HD). As used herein, the term "siRNA"
is
a generic term that encompasses the subset of shRNAs. A "RNA duplex" refers
to the structure formed by the complementary pairing between two regions of a
RNA molecule. siRNA is "targeted" to a gene in that the nucleotide sequence of
the duplex portion of the siRNA is complementary to a nucleotide sequence of
the targeted gene. In certain embodiments, the siRNAs are targeted to the
sequence encoding huntingtin. In some embodiments, the length of the duplex
of siRNAs is less than 30 base pairs. In some embodiments, the duplex can be
29, 28, 27, 26, 25,24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or
10 base
pairs in length. In some embodiments, the length of the duplex is 19 to 25
base
pairs in length. In certain embodiment, the length of the duplex is 19 or 21
base
pairs in length. The RNA duplex portion of the siRNA can be part of a hairpin
structure. In addition to the duplex portion, the hairpin structure may
contain a
loop portion positioned between the two sequences that form the duplex. The
47
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
"loop can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10,
11, 12
or 13 nucleotides in length. In certain embodiments, the loop is 9 nucleotides
in
length. The hairpin structure can also contain 3' or 5' overhang portions. In
some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3, 4 or 5
nucleotides in length.
The siRNA can be encoded by a nucleic acid sequence, and the nucleic
acid sequence can also include a promoter. The nucleic acid sequence can also
include a polyadenylation signal. In some embodiments, the polyadenylation
signal is a synthetic minimal polyadenylation signal.
"Knock-down," "knock-down technology" refers to a technique of gene
silencing in which the expression of a target gene is reduced as compared to
the
gene expression prior to the introduction of the siRNA, which can lead to the
inhibition of production of the target gene product. The term "reduced" is
used
herein to indicate that the target gene expression is lowered by 1-100%. In
other
words, the amount of RNA available for translation into a polypeptide or
protein
is minimized. For example, the amount of protein may be reduced by 10, 20, 30,
40, 50, 60, 70, 80, 90, 95, or 99%. In some embodiments, the expression is
reduced by about 90% (i.e., only about 10% of the amount of protein is
observed
a cell as compared to a cell where siRNA molecules have not been
administered). Knock-down of gene expression can be directed by the use of
dsRNAs or siRNAs.
"RNA interference (RNAi)" is the process of sequence-specific, post-
transcriptional gene silencing initiated by siRNA. During RNAi, siRNA induces
degradation of target mRNA with consequent sequence-specific inhibition of
gene expression. RNAi involving the use of siRNA has been successfully
applied to knockdown the expression of specific genes in plants, D.
melanogaster, C. elegans, trypanosomes, planaria, hydra, and several
vertebrate
species including the mouse. For a review of the mechanisms proposed to
mediate RNAi, please refer to Bass et al., 2001 Elbashir, 2001a, 2001b, 2001c;
or Brantl, 2002.
48
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
According to a method of the present invention, the expression of
huntingtin can be modified via RNAi. For example, the accumulation of
huntingtin can be suppressed in a cell. The term "suppressing" refers to the
diminution, reduction or elimination in the number or amount of transcripts
.present in a particular cell. For example, the accumulation of mRNA encoding
huntingtin can be suppressed in a cell by RNA interference (RNAi), e.g., the
gene is silenced by sequence-specific double-stranded RNA (dsRNA), which is
also called short interfering RNA (siRNA).- These siRNAs can be two separate
= RNA molecules that have hybridized together, or they may be a single
hairpin
wherein two portions of a RNA molecule have hybridized together to form a
duplex.
A mutant protein refers to the protein encoded by a gene having a
mutation, e.g., a missense or nonsense mutation in one or both alleles of
huntingtin. A mutant huntingtin may be disease-causing, i.e., may lead to a
disease associated with the presence of huntingtin in an animal having either
one
or two mutant allele(s). The term "nucleic acid" refers to
deoxyribonucleotides
or ribonucleotides and polymers thereof in either single- or double-stranded
form, composed of monomers (nucleotides) containing a sugar, phosphate and a
base that is either a purine or pyrimidine. Unless specifically limited, the
term
encompasses nucleic acids containing known analogs of natural nucleotides that
have similar binding properties as the reference nucleic acid and are
metabolized
in a manner similar to naturally occurring nucleotides. Unless otherwise
indicated, a particular nucleic acid sequence also encompasses conservatively
modified variants thereof (e.g., degenerate codon substitutions) and
complementary sequences, as well as the sequence explicitly indicated.
Specifically, degenerate codon substitutions may be achieved by generating
sequences in which the third position of one or more selected (or all) codons
is
substituted with mixed-base and/or deoxyinosine residues (Batzer et al.,
(1991);
= Ohtsuka et al., (1985); Rossolini et al., (1994)).
A "nucleic acid fragment" is a portion of a given nucleic acid molecule.
Deoxyribonucleic acid (DNA) in the majority of organisms is the genetic
49
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
material while ribonucleic acid (RNA) is involved in the transfer of
information
contained within DNA into proteins.
The term "nucleotide sequence" refers to a polymer of DNA or RNA
which can be single- or double-stranded, optionally containing synthetic, non-
natural or altered nucleotide bases capable of incorporation into DNA or RNA
polymers.
The terms "nucleic acid", "nucleic acid molecule", "nucleic acid
fragment", "nucleic acid sequence or segment", or "polynucleotide" are used
interchangeably and may also be used interchangeably with gene, cDNA, DNA
and RNA encoded by a gene.
The invention encompasses isolated or substantially purified nucleic acid
or protein compositions. In the context of the present invention, an
"isolated" or
"purified" DNA molecule or RNA molecule or an "isolated" or "purified"
polypeptide-is a DNA molecule, RNA molecule, or polypeptide that exists apart
from its native environment and is therefore not a product of nature. An
isolated
DNA molecule, RNA molecule or polypeptide may exist in a purified form or
may exist in a non-native environment such as, for example, a transgenic host
cell. For example, an "isolated" or "purified" nucleic acid molecule or
protein,
or biologically active portion thereof, is substantially free of other
cellular
material, or culture medium when produced by recombinant techniques, or
substantially free of chemical precursors or other chemicals when chemically
synthesized. In one embodiment, an "isolated" nucleic acid is free of
sequences
that naturally flank the nucleic acid (i.e., sequences located at the 5' and
3' ends
of the nucleic acid) in the genomic DNA of the organism from which the nucleic
acid is derived. For example, in various embodiments, the isolated nucleic
acid
molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or
0.1
kb of nucleotide sequences that naturally flank the nucleic acid molecule in
genomic DNA of the cell from which the nucleic acid is derived. A protein that
is substantially free of cellular material includes preparations of protein or
polypeptide having less than about 30%, 20%, 10%, or 5% (by dry weight) of
contaminating protein. When the protein of the invention, or biologically
active
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
portion thereof, is recombinantly produced, culture medium represents less
than
about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-
protein-of-interest chemicals. Fragments and variants of the disclosed
nucleotide sequences and proteins or partial-length proteins encoded thereby
are
also encompassed by the present invention. By "fragment" or "portion" is meant
a full length or less than full length of the nucleotide sequence encoding, or
the
amino acid sequence of, a polypeptide or protein.
The term "gene" is used broadly to refer to any segment of nucleic acid
associated with a biological function. Thus, genes include coding sequences
and/or the regulatory sequences required for their expression. For example,
"gene" refers to a nucleic acid fragment that expresses mRNA, functional RNA,
or specific protein, including regulatory sequences. "Genes" also include
nonexpressed DNA segments that, for example, form recognition sequences for
other proteins. "Genes" can be obtained from a variety of sources, including
cloning from a source of interest or synthesizing from known or predicted
sequence information, and may include sequences designed to have desired
parameters. An "allele" is one of several alternative forms of a gene
occupying a
given locus on a chromosome.
"Naturally occurring," "native" or "wildtype" are used to describe an
object that can be found in nature as distinct from being artificially
produced.
For example, a protein or nucleotide sequence present in an organism
(including
a virus), which can be isolated from a source in nature and which has not been
intentionally modified by a person in the laboratory, is naturally occurring.
The term "chimeric" refers to a gene or DNA that contains 1) DNA
sequences, including regulatory and coding sequences that are not found
together
in nature or 2) sequences encoding parts of proteins not naturally adjoined,
or 3)
parts of promoters that are not naturally adjoined. Accordingly, a chimeric
gene
may include regulatory sequences and coding sequences that are derived from
different sources, or include regulatory sequences and coding sequences
derived
from the same source, but arranged in a manner different from that found in
nature.
51
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
A "transgene" refers to a gene that has been introduced into the genome
by transformation. Transgenes include, for example, DNA that is either
heterologous or homologous to the DNA of a particular cell to be transformed.
Additionally, trans genes may include native genes inserted into a non-native
-- organism, or chimeric genes.
The term "endogenous gene" refers to a native gene in its natural location
in the genome of an organism.
A "foreign" gene refers to a gene not normally found in the host
organism that has been introduced by gene transfer.
The terms "protein," "peptide" and "polypeptide" are used
interchangeably herein.
A "variant" of a molecule is a sequence that is substantially similar to the
sequence of the native molecule. For nucleotide sequences, variants include
those sequences that, because of the degeneracy of the genetic code, encode
the
-- identical amino acid sequence of the native protein. Naturally occurring
allelic
variants such as these can be identified with the use of molecular biology
techniques, as, for example, with polymerase chain reaction (PCR) and
hybridization techniques. Variant nucleotide sequences also include
synthetically derived nucleotide sequences, such as those generated, for
-- example, by using site-directed mutagenesis, which encode the native
protein, as
well as those that encode a polypeptide having amino acid substitutions.
Generally, nucleotide sequence variants of the invention will have at least
40%,
50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%,
generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%,
-- 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98%, sequence identity to the
native (endogenous) nucleotide sequence.
"Conservatively modified variations" of a particular nucleic acid
sequence refers to those nucleic acid sequences that encode identical or
essentially identical amino acid sequences. Because of the degeneracy of the
-- genetic code, a large number of functionally identical nucleic acids encode
any
given polypeptide. For instance, the codons CGT, CGC, CGA, CGG, AGA and
52
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
AUG all encode the amino acid arginine. Thus, at every position where an
arginine is specified by a codon, the codon can be altered to any of the
corresponding codons described without altering the encoded protein. Such
nucleic acid variations are "silent variations," which are one species of
"conservatively modified variations." Every nucleic acid sequence described
herein that encodes a polypeptide also describes every possible silent
variation,
except where otherwise noted. One of skill in the art will recognize that each
codon in a nucleic acid (except ATG, which is ordinarily the only codon for
methionine) can be modified to yield a functionally identical molecule by
standard techniques. Accordingly, each "silent variation" of a nucleic acid
that
encodes a polypeptide is implicit in each described sequence.
"Recombinant DNA molecule" is a combination of DNA sequences that
are joined together using recombinant DNA technology and procedures used to
join together DNA sequences as described, for example, in Sambrook and
Russell (2001).
The terms "heterologous gene", "heterologous DNA sequence",
"exogenous DNA sequence", "heterologous RNA sequence", "exogenous RNA
sequence" or "heterologous nucleic acid" each refer to a sequence that either
originates from a source foreign to the particular host cell, or is from the
same
source but is modified from its original or native form. Thus, a heterologous
gene in a host cell includes a gene that is endogenous to the particular host
cell
but has been modified through, for example, the use of DNA shuffling. The
terms also include non-naturally occurring multiple copies of a naturally
occurring DNA or RNA sequence. Thus, the terms refer to a DNA or RNA
segment that is foreign or heterologous to the cell, or homologous to the cell
but
in a position within the host cell nucleic acid in which the element is not
ordinarily found. Exogenous DNA segments are expressed to yield exogenous
polypeptides.
A "homologous" DNA or RNA sequence is a sequence that is naturally
associated with a host cell into which it is introduced.
"Wild-type" refers to the normal gene or organism found in nature.
53
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
"Genome" refers to the complete genetic material of an organism.
A "vector" is defined to include, inter alia, any viral vector, as well as
any plasmid, cosmid, phage or binary vector in double or single stranded
linear
or circular form that may or may not be self transmissible or mobilizable, and
that can transform prokaryotic or eukaryotic host either by integration into
the
cellular genome or exist extrachromosomally (e.g., autonomous replicating
plasmid with an origin of replication).
"Expression cassette" as used herein means a nucleic acid sequence
capable of directing expression of a particular nucleotide sequence in an
appropriate host cell, which may include a promoter operably linked to the
nucleotide sequence of interest that may be operably linked to termination
signals. It also may include sequences required for proper translation of the
nucleotide sequence. The coding region usually codes for a protein of interest
but may also code for a functional RNA of interest, for example an antisense
RNA, a nontranslated RNA in the sense or antisense direction, or a siRNA. The
expression cassette including the nucleotide sequence of interest may be
chimeric. The expression cassette may also be one that is naturally occurring
but
has been obtained in a recombinant form useful for heterologous expression.
The expression of the nucleotide sequence in the expression cassette may be
under the control of a constitutive promoter or of an regulatable promoter
that
initiates transcription only when the host cell is exposed to some particular
stimulus. In the case of a multicellular organism, the promoter can also be
specific to a particular tissue or organ or stage of development.
Such expression cassettes can include a transcriptional initiation region
linked to a nucleotide sequence of interest. Such an expression cassette is
provided with a plurality of restriction sites for insertion of the gene of
interest to
be under the transcriptional regulation of the regulatory regions. The
expression
cassette may additionally contain selectable marker genes.
"Coding sequence" refers to a DNA or RNA sequence that codes for a
specific amino acid sequence. It may constitute an "uninterrupted coding
sequence", i.e., lacking an intron, such as in a cDNA, or it may include one
or
54
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
more introns bounded by appropriate splice junctions. An "intron" is a
sequence
of RNA that is contained in the primary transcript but is removed through
cleavage and re-ligation of the RNA within the cell to create the mature mRNA
that can be translated into a protein.
The term "open reading frame" (ORF) refers to the sequence between
translation initiation and termination codons of a coding sequence. The terms
"initiation codon" and "termination codon" refer to a unit of three adjacent
nucleotides (a 'codon') in a coding sequence that specifies initiation and
chain
termination, respectively, of protein synthesis (mRNA translation).
"Functional RNA" refers to sense RNA, antisense RNA, ribozyme RNA,
siRNA, or other RNA that may not be translated but yet has an effect on at
least
one cellular process.
The term "RNA transcript" refers to the product resulting from RNA
polymerase catalyzed transcription of a DNA sequence. When the RNA
transcript is a perfect complementary copy of the DNA sequence, it is referred
to
as the primary transcript or it may be a RNA sequence derived from
posttranscriptional processing of the primary transcript and is referred to as
the
mature RNA. "Messenger RNA" (mRNA) refers to the RNA that is without
introns and that can be translated into protein by the cell. "cDNA" refers to
a
single- or a double-stranded DNA that is complementary to and derived from
mRNA.
"Regulatory sequences" and "suitable regulatory sequences" each refer to
nucleotide sequences located upstream (5' non-coding sequences), within, or
downstream (3' non-coding sequences) of a coding sequence, and which
influence the transcription, RNA processing or stability, or translation of
the
associated coding sequence. Regulatory sequences include enhancers,
promoters, translation leader sequences, introits, and polyadenylation signal
sequences. They include natural and synthetic sequences as well as sequences
that may be a combination of synthetic and natural sequences. As is noted
above, the term "suitable regulatory sequences" is not limited to promoters.
However, some suitable regulatory sequences useful in the present invention
will
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
include, but are not limited to constitutive promoters, tissue-specific
promoters,
development-specific promoters, regulatable promoters and viral promoters.
Examples of promoters that may be used in the present invention include CMV,
RSV, pol II and pol III promoters.
"5' non-coding sequence" refers to a nucleotide sequence located 5'
(upstream) to the coding sequence. It is present in the fully processed mRNA
upstream of the initiation codon and may affect processing of the primary
transcript to mRNA, mRNA stability or translation efficiency (Turner et al.,
1995).
"3' non-coding sequence" refers to nucleotide sequences located 3'
(downstream) to a coding sequence and may include polyadenylation signal
sequences and other sequences encoding regulatory signals capable of affecting
mRNA processing or gene expression. The polyadenylation signal is usually
characterized by affecting the addition of polyadenylic acid tracts to the 3'
end of
the mRNA precursor.
The term "translation leader sequence" refers to that DNA sequence
portion of a gene between the promoter and coding sequence that is transcribed
into RNA and is present in the fully processed mRNA upstream (5') of the
translation start codon. The translation leader sequence may affect processing
of
the primary transcript to mRNA, mRNA stability or translation efficiency.
The term "mature" protein refers to a post-translationally processed
polypeptide without its signal peptide. "Precursor" protein refers to the
primary
product of translation of an mRNA. "Signal peptide" refers to the amino
terminal extension of a polypeptide, which is translated in conjunction with
the
polypeptide forming a precursor peptide and which is required for its entrance
into the secretory pathway. The term "signal sequence" refers to a nucleotide
sequence that encodes the signal peptide.
"Promoter" refers to a nucleotide sequence, usually upstream (5') to its
coding sequence, which directs and/or controls the expression of the coding
sequence by providing the recognition for RNA polymerase and other factors
required for proper transcription. "Promoter" includes a minimal promoter that
is
56
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
a short DNA sequence comprised of a TATA-box and other sequences that serve
to specify the site of transcription initiation, to which regulatory elements
are
added for control of expression. "Promoter" also refers to a nucleotide
sequence
that includes a minimal promoter plus regulatory elements that is capable of
controlling the expression of a coding sequence or functional RNA. This type
of
promoter sequence consists of proximal and more distal upstream elements, the
latter elements often referred to as enhancers. Accordingly, an "enhancer" is
a
DNA sequence that can stimulate promoter activity and may be an innate
element of the promoter or a heterologous element inserted to enhance the
level
or tissue specificity of a promoter. It is capable of operating in both
orientations
(normal or flipped), and is capable of functioning even when moved either
upstream or downstream from the promoter. Both enhancers and other upstream
promoter elements bind sequence-specific DNA-binding proteins that mediate
their effects. Promoters may be derived in their entirety from a native gene,
or
be composed of different elements derived from different promoters found in
nature, or even be comprised of synthetic DNA segments. A promoter may also
contain DNA sequences that are involved in the binding of protein factors that
control the effectiveness of transcription initiation in response to
physiological
or developmental conditions.
The "initiation site" is the position surrounding the first nucleotide that is
part of the transcribed sequence, which is also defined as position +1. With
respect to this site all other sequences of the gene and its controlling
regions are
numbered. Downstream sequences (i.e., further protein encoding sequences in
the 3' direction) are denominated positive, while upstream sequences (mostly
of
the controlling regions in the 5' direction) are denominated negative.
Promoter elements, particularly a TATA element, that are inactive or that
have greatly reduced promoter activity in the absence of upstream activation
are
referred to as "minimal or core promoters." In the presence of a suitable
transcription factor, the minimal promoter functions to permit transcription.
A
"minimal or core promoter" thus consists only of all basal elements needed for
transcription initiation, e.g., a TATA box and/or an initiator.
57
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
"Constitutive expression" refers to expression using a constitutive or
regulated promoter. "Conditional" and "regulated expression" refer to
expression controlled by a regulated promoter.
"Operably-linked" refers to the association of nucleic acid sequences on
single nucleic acid fragment so that the function of one of the sequences is
affected by another. For example, a regulatory DNA sequence is said to be
"operably linked to" or "associated with" a DNA sequence that codes for an
RNA or a polypeptide if the two sequences are situated such that the
regulatory
DNA sequence affects expression of the coding DNA sequence (i.e., that the
coding sequence or functional RNA is under the transcriptional control of the
promoter). Coding sequences can be operably-linked to regulatory sequences in
sense or antisense orientation.
"Expression" refers to the transcription and/or translation of an
endogenous gene, heterologous gene or nucleic acid segment, or a transgene in
cells. For example, in the case of siRNA constructs, expression may refer to
the
transcription of the siRNA only. In addition, expression refers to the
transcription and stable accumulation of sense (mRNA) or functional RNA.
Expression may also refer to the production of protein.
"Altered levels" refers to the level of expression in transgenic cells or
organisms that differs from that of normal or untransformed cells or
organisms.
"Overexpression" refers to the level of expression in transgenic cells or
organisms that exceeds levels of expression in normal or untransformed cells
or
organisms.
"Antisense inhibition" refers to the production of antisense RNA
transcripts capable of suppressing the expression of protein from an
endogenous
gene or a transgene.
"Transcription stop fragment" refers to nucleotide sequences that contain
one or more regulatory signals, such as polyadenylation signal sequences,
capable of terminating transcription. Examples include the 3' non-regulatory
regions of genes encoding nopaline synthase and the small subunit of ribulose
bisphosphate carboxylase.
58
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
"Translation stop fragment" refers to nucleotide sequences that contain
one or more regulatory signals, such as one or more termination codons in all
three frames, capable of terminating translation. Insertion of a translation
stop
fragment adjacent to or near the initiation codon at the 5' end of the coding
sequence will result in no translation or improper translation. Excision of
the
translation stop fragment by site-specific recombination will leave a site-
specific
sequence in the coding sequence that does not interfere with proper
translation
using the initiation codon.
The terms "cis-acting sequence" and "cis-acting element" refer to DNA
or RNA sequences whose functions require them to be on the same molecule.
An example of a cis-acting sequence on the replicon is the viral replication
origin.
The terms "trans-acting sequence" and "trans-acting element" refer to
DNA or RNA sequences whose function does not require them to be on the same
molecule.
"Chromosomally-integrated" refers to the integration of a foreign gene or
nucleic acid construct into the host DNA by covalent bonds. Where genes are
not "chromosomally integrated" they may be "transiently expressed." Transient
expression of a gene refers to the expression of a gene that is not integrated
into
the host chromosome but functions independently, either as part of an
autonomously replicating plasmid or expression cassette, for example, or as
part
of another biological system such as a virus.
The following terms are used to describe the sequence relationships
between two or more nucleic acids or polynucleotides: (a) "reference
sequence",
(b) "comparison window", (c) "sequence identity", (d) "percentage of sequence
identity", and (e) "substantial identity".
(a) As used herein, "reference sequence" is a defined sequence used as a
basis for sequence comparison. A reference sequence may be a subset or the
entirety of a specified sequence; for example, as a segment of a full-length
cDNA or gene sequence, or the complete cDNA or gene sequence.
59
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
(b) As used herein, 'comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence, wherein the
polynucleotide sequence in the comparison window may comprise additions or
deletions (i.e., gaps) compared to the reference sequence (which does not
-- comprise additions or deletions) for optimal alignment of the two
sequences.
Generally, the comparison window is at least 20 contiguous nucleotides in
length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in
the art
understand that to avoid a high similarity to a reference sequence due to
inclusion of gaps in the polynucleotide sequence a gap penalty is typically
-- introduced and is subtracted from the number of matches.
Methods of alignment of sequences for comparison are well-known in
the art. Thus, the determination of percent identity between any two sequences
can be accomplished using a mathematical algorithm. Non-limiting examples of
such mathematical algorithms are the algorithm of Myers and Miller (1988); the
-- local homology algorithm of Smith et al. (1981); the homology alignment
algorithm of Needleman and Wunsch (1970); the search-for-similarity-method
of Pearson and Lipman (1988); the algorithm of Karlin and Altschul (1990),
modified as in Karlin and Altschul (1993).
Computer implementations of these mathematical algorithms can be
-- utilized for comparison of sequences to determine sequence identity. Such
implementations include, but are not limited to: CLUSTAL in the PC/Gene
program (available from Intelligenetics, Mountain View, California); the ALIGN
program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in
the Wisconsin Genetics Software Package, Version 8 (available from Genetics
-- Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA).
Alignments using these programs can be performed using the default parameters,
The CLUSTAL program is well described by Higgins et al. (1988); Higgins et
al. (1989); Corpet et al. (1988); Huang et al. (1992); and Pearson et al.
(1994).
The ALIGN program is based on the algorithm of Myers and Miller, supra. The
-- BLAST programs of Altschul et al. (1990), are based on the algorithm of
Karlin
and Altschul supra.
CA 02596588 2013-08-13
Software for performing BLAST analyses is publicly available through
the National Center for Biotechnology Information. This algorithm involves
first identifying high scoring sequence pairs (HSPs) by identifying short
words
of length W in the query sequence, which either match or satisfy some positive-
valued threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score threshold.
These initial neighborhood word hits act as seeds for initiating searches to
find
longer HSPs containing them. The word hits are then extended in both
directions
along each sequence for as far as the cumulative alignment score can be
increased. Cumulative scores are calculated using, for nucleotide sequences,
the
parameters M (reward score for a pair of matching residues; always > 0) and N
(penalty score for mismatching residues; always < 0). For amino acid
sequences, a scoring matrix is used to calculate the cumulative score.
Extension
of the word hits in each direction are halted when the cumulative alignment
score falls off by the quantity X from its maximum achieved value, the
cumulative score goes to zero or below due to the accumulation of one or more
negative-scoring residue alignments, or the end of either sequence is reached.
In addition to calculating percent sequence identity, the BLAST
algorithm also performs a statistical analysis of the similarity between two
sequences. One measure of similarity provided by the BLAST algorithm is the
smallest sum probability (P(N)), which provides an indication of the
probability
by which a match between two nucleotide or amino acid sequences would occur
by chance. For example, a test nucleic acid sequence is considered similar to
a
reference sequence if the smallest sum probability in a comparison of the test
nucleic acid sequence to the reference nucleic acid sequence is less than
about
0.1, less than about 0.01, or even less than about 0.001.
To obtain gapped alignments for comparison purposes, Gapped BLAST
(in BLAST 2.0) can be utilized as described in Altschul et al. (1997).
Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated
search that detects distant relationships between molecules. See Altschul et
al.,
61
CA 02596588 2013-08-13
supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default
parameters of the respective programs (e.g. BLASTN for nucleotide sequences,
BLASTX for proteins) can be used. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10,
a
cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid
sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an
expectation (E) of 10, and the BLOSUM62 scoring matrix. Alignment may also
be performed manually by inspection.
For purposes of the present invention, comparison of nucleotide
sequences for determination of percent sequence identity to the promoter
sequences disclosed herein is made using the BlastN program (version 1.4.7 or
later) with its default parameters or any equivalent program. By "equivalent
program" is intended any sequence comparison program that, for any two
sequences in question, generates an alignment having identical nucleotide or
amino acid residue matches and an identical percent sequence identity when
compared to the corresponding alignment generated by the preferred program.
(c) As used herein, "sequence identity" or "identity" in the context of two
nucleic acid or polypeptide sequences makes reference to a specified
percentage
of residues in the two sequences that are the same when aligned for maximum
correspondence over a specified comparison window, as measured by sequence
comparison algorithms or by visual inspection. When percentage of sequence
identity is used in reference to proteins it is recognized that residue
positions
which are not identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid residues with
similar chemical properties (e.g., charge or hydrophobicity) and therefore do
not
change the functional properties of the molecule. When sequences differ in
conservative substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution. Sequences
that differ by such conservative substitutions are said to have "sequence
similarity" or "similarity." Means for making this adjustment are well known
to
62
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
those of skill in the art. Typically this involves scoring a conservative
. substitution as a partial rather than a full mismatch, thereby increasing
the
percentage sequence identity. Thus, for example, where an identical amino acid
is given a score of 1 and a non-conservative substitution is given a score of
zero,
. a conservative substitution is given a score between zero and 1. The scoring
of
conservative substitutions is calculated, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, California).
(d) As used herein, "percentage of sequence identity" means the value
determined by comparing two optimally aligned sequences over a comparison
window, wherein the portion of the polynucleotide sequence in the comparison
window may comprise additions or deletions (i.e., gaps) as compared to the
reference sequence (which does not comprise additions or deletions) for
optimal
alignment of the two sequences. The percentage is calculated by determining
the
number of positions at which the identical nucleic acid base or amino acid
residue occurs in both sequences to yield the number of matched positions,
dividing the number of matched positions by the total.number of positions in
the
window of comparison, and multiplying the result by 100 to yield the
percentage
of sequence identity.
(e)(i) The term "substantial identity" of polynucleotide sequences means
that a polynucleotide comprises a sequence that has at least 70%, 71%, 72%,
73%, 74%, 75%, 76%, 77%, 78%, or 79%, or at least 80%, 81%, 82%, 83%,
84%, 85%, 86%, 87%, 88%, or 89%, or at least 90%, 91%, 92%, 93%, or 94%,
or even at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a
reference sequence using one of the alignment programs described using
standard parameters. One of skill in the art will recognize that these values
can
be appropriately adjusted to determine corresponding identity of proteins
encoded by two nucleotide sequences by taking into account codon degeneracy,
amino acid similarity, reading frame positioning, and the like. Substantial
identity of amino acid sequences for these purposes normally means sequence
identity of at least 70%, at least 80%, 90%, or even at least 95%.
63
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Another indication that nucleotide sequences are substantially identical is
if two molecules hybridize to each other under stringent conditions.
Generally,
stringent conditions are selected to be about 5 C lower than the thermal
melting
point (T.) for the specific sequence at a defined ionic strength and pH.
However, stringent conditions encompass temperatures in the range of about 1 C
to about 20 C, depending upon the desired degree of stringency as otherwise
qualified herein. Nucleic acids that do not hybridize to each other under
stringent
conditions are still substantially identical if the polypeptides they encode
are
substantially identical. This may occur, e.g., when a copy of a nucleic acid
is
created using the maximum codon degeneracy permitted by the genetic code.
One indication that two nucleic acid sequences are substantially identical is
when the polypeptide encoded by the first nucleic acid is immunologically
cross
reactive with the polypeptide encoded by the second nucleic acid.
(e)(ii) The term "substantial identity" in the context of a peptide indicates
that a peptide comprises a sequence with at least 70%, 71%, 72%, 73%, 74%,
75%, 76%, 77%, 78%, or 79%, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%,
88%, or 89%, or at least 90%, 91%, 92%, 93%, or 94%, or even, 95%, 96%,
97%, 98% or 99%, sequence identity to the reference sequence over a specified
comparison window. Optimal alignment may be conducted using the homology
alignment algorithm of Needleman and Wunsch (1970). An indication that two
peptide sequences are substantially identical is that one peptide is
immunologically reactive with antibodies raised against the second peptide.
Thus, a peptide is substantially identical to a second peptide, for example,
where
the two peptides differ only by a conservative substitution.
For sequence comparison, typically one sequence acts as a reference
sequence to which test sequences are compared. When using a sequence
comparison algorithm, test and reference sequences are input into a computer,
subsequence coordinates are designated if necessary, and sequence algorithm
program parameters are designated. The sequence comparison algorithm then
calculates the percent sequence identity for the test sequence(s) relative to
the
reference sequence, based on the designated program parameters.
64
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
As noted above, another indication that two nucleic acid sequences are
substantially identical is that the two molecules hybridize to each other
under
stringent conditions. The phrase "hybridizing specifically to" refers to the
binding, duplexing, or hybridizing of a molecule only to a particular
nucleotide
sequence under stringent conditions when that sequence is present in a complex
mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially" refers to
complementary hybridization between a probe nucleic acid and a target nucleic
acid and embraces minor mismatches that can be accommodated by reducing the
stringency of the hybridization media to achieve the desired detection of the
target nucleic acid sequence.
"Stringent hybridization conditions" and "stringent hybridization wash
conditions" in the context of nucleic acid hybridization experiments such as
Southern and Northern hybridizations are sequence dependent, and are different
under different environmental parameters. Longer sequences hybridize
specifically at higher temperatures. The T. is the temperature (under defined
ionic strength and pH) at which 50% of the target sequence hybridizes to a
perfectly matched probe. Specificity is typically the function of post-
hybridization washes, the critical factors being the ionic strength and
temperature of the fmal wash solution. For DNA-DNA hybrids, the T. can be
approximated from the equation of Meinkoth and Wahl (1984); T. 81.5 C +
16.6 (log M) +0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of
monovalent cations, %GC is the percentage of guanosine and cytosine
nucleotides in the DNA, % form is the percentage of formamide in the
hybridization solution, and L is the length of the hybrid in base pairs. T. is
reduced by about 1 C for each 1% of mismatching; thus, T., hybridization,
and/or wash conditions can be adjusted to hybridize to sequences of the
desired
identity. For example, if sequences with >90% identity are sought, the T. can
be decreased 10 C. Generally, stringent conditions are selected to be about 5
C
lower than the thermal melting point (T.) for the specific sequence and its
complement at a defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4 C lower
than
- 65
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
the thermal melting point (T.); moderately stringent conditions can utilize a
hybridization and/or wash at 6, 7, 8, 9, or 10 C lower than the thermal
melting
point (T.); low stringency conditions can utilize a hybridization and/or wash
at
11, 12, 13, 14, 15, or 20 C lower than the thermal melting point (T.). Using
the
equation, hybridization and wash compositions, and desired T, those of
ordinary
skill will understand that variations in the stringency of hybridization
and/or
wash solutions are inherently described. If the desired degree of mismatching
results in a T of less than 45 C (aqueous solution) or 32 C (forniamide
solution), the SSC concentration may be increased so that a higher temperature
can be used. An extensive guide to the hybridization of nucleic acids is found
in
Tijssen (1993). Generally, highly stringent hybridization and wash conditions
are selected to be about 5 C lower than the thermal melting point (T.) for the
specific sequence at a defined ionic strength and pH.
An example of highly stringent wash conditions is 0.15 M NaCl at 72 C
for about 15 minutes. An example of stringent wash conditions is a 0.2X SSC
wash at 65 C for 15 minutes (see, Sambrook and Russell, infra, for a
description
of SSC buffer). Often, a high stringency wash is preceded by a low stringency
wash to remove background probe signal. An example medium stringency wash
for a duplex of, e.g., more than 100 nucleotides, is 1X SSC at 45 C for 15
minutes. An example low stringency wash for a duplex of, e.g., more than 100
nucleotides, is 4-6X SSC at 40 C for 15 minutes. For short probes (e.g., about
10 to 50 nucleotides), stringent conditions typically involve salt
concentrations
of less than about 1.5 M, about 0.01 to 1.0 M, Na ion concentration (or other
salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30 C
and at
least about 60 C for long probes (e.g., >50 nucleotides). Stringent conditions
may also be achieved with the addition of destabilizing agents such as
formamide. In general, a signal to noise ratio of 2X (or higher) than that
observed for an unrelated probe in the particular hybridization assay
indicates
detection of a specific hybridization. Nucleic acids that do not hybridize to
each
other under stringent conditions are still substantially identical if the
proteins that
they encode are substantially identical. This occurs, e.g., when a copy of a
66
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
nucleic acid is created using the maximum codon degeneracy permitted by the
genetic code.
Very stringent conditions are selected to be equal to the Tin for a
particular probe. An example of stringent conditions for hybridization of
complementary nucleic acids which have more than 100 complementary residues
on a filter in a Southern or Northern blot is 50% formamide, e.g.,
hybridization
in 50% formamide, 1 M NaCl, 1% SDS at 37 C, and a wash in 0.1X SSC at 60
to 65 C. Exemplary low stringency conditions include hybridization with a
buffer solution of 30 to 35% formamide, 1M NaC1, 1% SDS (sodium dodecyl
sulfate) at 37 C, and a wash in 1X to 2X SSC (20X SSC = 3.0 M NaC1/0.3 M
trisodium citrate) at 50 to 55 C. Exemplary moderate stringency conditions
include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37 C,
and a wash in 0.5X to 1X SSC at 55 to 60 C.
By "variant" polypeptide is intended a polypeptide derived from the
native protein by deletion (also called "truncation") or addition of one or
more
amino acids to the N-terminal and/or C-terminal end of the native protein;
deletion or addition of one or more amino acids at one or more sites in the
native
protein; or substitution of one or more amino acids at one or more sites in
the
native protein. Such variants may result from, for example, genetic
polymorphism or from human manipulation. Methods for such manipulations
are generally known in the art.
Thus, the polypeptides of the invention may be altered in various ways
including amino acid substitutions, deletions, truncations, and insertions.
Methods for such manipulations are generally known in the art. For example,
amino acid sequence variants of the polypeptides can be prepared by mutations
in the DNA. Methods for mutagenesis and nucleotide sequence alterations are
well known in the art. See, for example, Kunkel (1985); Kunkel et al. (1987);
U.
S. Patent No. 4,873,192; Walker and Gaastra (1983), and the references cited
therein. Guidance as to appropriate amino acid substitutions that do not
affect
biological activity of the protein of interest may be found in the model of
67
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Dayhoff et al. (1978). Conservative substitutions, such as exchanging one
amino acid with another having similar properties, may be used.
Thus, the genes and nucleotide sequences of the invention include both
the naturally occurring sequences as well as variant forms. Likewise, the
polypeptides of the invention encompass both naturally occurring proteins as
well as variations and modified forms thereof. Such variants will continue to
possess the desired activity. The deletions, insertions, and substitutions of
the
polypeptide sequence encompassed herein are not expected to produce radical
changes in the characteristics of the polypeptide. However, when it is
difficult to
predict the exact effect of the substitution, deletion, or insertion in
advance of
doing so, one skilled in the art will appreciate that the effect will be
evaluated by
routine screening assays.
Individual substitutions deletions or additions that alter, add or delete a
single amino acid or a small percentage of amino acids (typically less than
5%,
more typically less than 1%) in an encoded sequence are "conservatively
modified variations," where the alterations result in the substitution of an
amino
acid with a chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the art. The
following five groups each contain amino acids that are conservative
substitutions for one another: Aliphatic: Glycine (G), Alanine (A), Valine
(V),
Leucine (L), Isoleucine (I); Aromatic: Phenylalanine (F), Tyrosine (Y),
Tryptophan (W); Sulfur-containing: Methionine (M), Cysteine (C); Basic:
Arginine (R), Lysine (K), Hikidine (H); Acidic: Aspartic acid (D), Glutamic
acid (E), Asparagine (N), Glutamine (Q). In addition, individual
substitutions,
deletions or additions which alter, add or delete a single amino acid or a
small
percentage of amino acids in an encoded sequence are also "conservatively
modified variations."
The term "transformation" refers to the transfer of a nucleic acid
fragment into the genome of a host cell, resulting in genetically stable
inheritance. A "host cell" is a cell that has been transformed, or is capable
of
transformation, by an exogenous nucleic acid molecule. Host cells containing
the
68
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
transformed nucleic acid fragments are referred to as "transgenic" cells, and
organisms comprising transgenic cells are referred to as "transgenic
organisms".
"Transformed", "transduced", "transgenic", and "recombinant" refer to a
, host cell or organism into which a heterologous nucleic acid molecule has
been
introduced. The nucleic acid molecule can be stably integrated into the genome
generally known in the art and are disclosed in Sambrook and Russell, infra.
See also Innis' et al. (1995); and Gelfand (1995); and Innis and Gelfand
(1999).
Known methods of PCR include, but are not limited to, methods using paired
primers, nested primers, single specific primers, degenerate primers, gene-
specific primers, vector-specific primers, partially mismatched primers, and
the
like. For example, "transformed," "transformant," and "transgenic" cells have
been through the transformation process and contain a foreign gene integrated
into their chromosome. The term "untransformed" refers to normal cells that
have not been through the transformation process.
A "transgenic" organism is an organism having one or more cells that
contain an expression vector.
"Genetically altered cells" denotes cells which have been modified by the
introduction of recombinant or heterologous nucleic acids (e.g., one or more
DNA constructs or their RNA counterparts) and further includes the progeny of
such cells which retain part or all of such genetic modification.
The term "fusion protein" is intended to describe at least two
polypeptides, typically from different sources, which are operably linked.
With
regard to polypeptides, the term operably linked is intended to mean that the
two
polypeptides are connected in a manner such that each polypeptide can serve
its
intended function. Typically, the two polypeptides are covalently attached
through peptide bonds. The fusion protein is produced by standard recombinant
DNA techniques. For example, a DNA molecule encoding the first polypeptide
is ligated to another DNA molecule encoding the second polypeptide, and the
resultant hybrid DNA molecule is expressed in a host cell to produce the
fusion
protein. The DNA molecules are ligated to each other in a 5' to 3' orientation
69
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
such that, after ligation, the translational frame of the encoded polyp
eptides is
not altered (L e., the DNA molecules are ligated to each other in-frame).
As used herein, the term "derived" or "directed to" with respect to a
nucleotide molecule means that the molecule has complementary sequence
identity to a particular molecule of interest.
"Gene silencing" refers to the suppression of gene expression, e.g.,
transgene, heterologous gene and/or endogenous gene expression. Gene
silencing may be mediated through processes that affect transcription and/or
through processes that affect post-transcriptional mechanisms. In some
embodiments, gene silencing occurs when siRNA initiates the degradation of the
mRNA of a gene of interest in a sequence-specific manner via RNA interference
(for a review, see Brant 2002). In some embodiments, gene silencing may be
allele-specific. "Allele-specific" gene silencing refers to the specific
silencing of
one allele of a gene.
"Knock-down," "knock-down technology" refers to a technique of gene
silencing in which the expression of a target gene is reduced as compared to
the
gene expression prior to the introduction of the siRNA, which can lead to the
inhibition of production of the target gene product. The term "reduced" is
used
herein to indicate that the target gene expression is lowered by 1-100%. For
example, the expression may be reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90,
95,
or even 99%. Knock-down of gene expression can be directed by the use of
dsRNAs or siRNAs. For example, "RNA interference (RNAi)," which can
involve the use of siRNA, has been successfully applied to knockdown the
expression of specific genes in plants, D. melanogaster, C. elegans,
trypanosomes, planaria, hydra, and several vertebrate species including the
mouse. For a review of the mechanisms proposed to mediate RNAi, please refer
to Bass et al., 2001, Elbashir et al., 2001 or Brantl 2002.
"RNA interference (RNAi)" is the process of sequence-specific, post-
transcriptional gene silencing initiated by siRNA. RNAi is seen in a number of
organisms such as Drosophila, nematodes, fungi and plants, and is believed to
be involved in anti-viral defense, modulation of transposon activity, and
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
regulation of gene expression. During RNAi, siRNA induces degradation of
target mRNA with consequent sequence-specific inhibition of gene expression.
A "small interfering" or "short interfering RNA" or siRNA is a RNA
duplex of nucleotides that is targeted to a gene interest. A "RNA duplex"
refers
to the structure formed by the complementary pairing between two regions of a
RNA molecule. siRNA is "targeted" to a gene in that the nucleotide sequence of
the duplex portion of the siRNA is complementary to a nucleotide sequence of
the targeted gene. In some embodiments, the length of the duplex of siRNAs is
less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27,
26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12,11 or 10
nucleotides in
length. In some embodiments, the length of the duplex is 19 - 25 nucleotides
in
length. The RNA duplex portion of the siRNA can be part of a hairpin
structure.
In addition to the duplex portion, the hairpin structure may contain a loop
portion positioned between the two sequences that form the duplex. The loop
can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12
or
13 nucleotides in length. The hairpin structure can also contain 3' or 5'
overhang
portions. In some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2,
3,
4 or 5 nucleotides in length. Examples of shRNA specific for huntingin are
encoded by the DNA sequences provided in Figure 20. The "sense" and
"antisense" sequences can be used with or without the loop region indicated to
form siRNA molecules. Other loop regions can be substituted for the examples
provided in this chart. As used herein, the term siRNA is meant to be
equivalent
to other terms used to describe nucleic acid molecules that are capable of
mediating sequence specific RNAi, for example, double-stranded RNA
(dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering
oligonucleotide, short interfering nucleic acid, post-transcriptional gene
silencing
RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is
meant to be equivalent to other terms used to describe sequence specific RNA
interference, such as post transcriptional gene silencing, translational
inhibition,
or epigenetic silencing. For example, siRNA molecules of the invention can be
used to epigenetically silence genes at both the post-transcriptional level or
the
71
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
pre-transcriptional level. In a non-limiting example, epigenetic modulation of
gene expression by siRNA molecules of the invention can result from siRNA
mediated modification of chromatin structure or methylation pattern to alter
gene
expression (see, for example, Verdel et al., 2004, Science, 303, 672-676; Pal-
Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-
1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science,
297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237). In another
non-limiting example, modulation of gene expression by siRNA molecules of
the invention can result from siRNA mediated cleavage of RNA (either coding
or non-coding RNA) via RISC, or alternately, translational inhibition as is
known in the art.
The siRNA can be encoded by a nucleic acid sequence, and the nucleic
acid sequence can also include a promoter. The nucleic acid sequence can also
include a polyadenylation signal. In some embodiments, the polyadenylation
signal is a synthetic minimal polyadenylation signal.
"Treating" as used herein refers to ameliorating at least one symptom of,
curing and/or preventing the development of a disease or a condition.
"Neurological disease" and "neurological disorder" refer to both
hereditary and sporadic conditions that are characterized by nervous system
dysfunction, and which may be associated with atrophy of the affected central
or
peripheral nervous system structures, or loss of function without atrophy. A
neurological disease or disorder that results in atrophy is commonly called a
"neurodegenerative disease" or "neurodegenerative disorder."
Neurodegenerative diseases and disorders include, but are not limited to,
amyotrophic lateral sclerosis (ALS), hereditary spastic hemiplegia, primary
lateral sclerosis, spinal muscular atrophy, Kennedy's disease, Alzheimer's
disease, Parkinson's disease, multiple sclerosis, and repeat expansion
neurodegenerative diseases, e.g., diseases associated with expansions of
trinucleotide repeats such as polyglutamine (polyQ) repeat diseases, e.g.,
Huntington's disease (HD), spinocerebellar ataxia (SCA1, SCA2, SCA3, SCA6,
SCA7, and SCA17), spinal and bulbar muscular atrophy (SBMA),
72
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
dentatorubropallidoluysian atrophy (DRPLA). An example of a neurological
disorder that does not appear to result in atrophy is DYT1 dystonia.
The siRNAs of the present invention can be generated by any method
known to the art, for example, by in vitro transcription, recombinantly, or by
synthetic means. In one example, the siRNAs can be generated in vitro by using
a recombinant enzyme, such as T7 RNA polymerase, and DNA oligonucleotide
templates.
Nucleic Acid Molecules of the Invention
Sources of nucleotide sequences from which the present nucleic acid
molecules can be obtained include any vertebrate, such as mammalian, cellular
source.
As discussed above, the terms "isolated and/or purified" refer to in vitro
isolation of a nucleic acid, e.g., a DNA or RNA molecule from its natural
cellular environment, and from association with other components of the cell,
such as nucleic acid or polypeptide, so that it can be sequenced, replicated,
and/or expressed. For example, "isolated nucleic acid" may be a DNA molecule
containing less than 31 sequential nucleotides that is transcribed into an
siRNA.
Such an isolated siRNA may, for example, form a hairpin structure with a
duplex 21 base pairs in length that is complementary or hybridizes to a
sequence
in a gene of interest, and remains stably bound under stringent conditions (as
defined by methods well known in the art, e.g., in Sambrook and Russell,
2001).
Thus, the RNA or DNA is "isolated" in that it is free from at least one
contaminating nucleic acid with which it is normally associated in the natural
source of the RNA or DNA and is substantially free of any other mammalian
RNA or DNA. The phrase "free from at least one contaminating source nucleic
acid with which it is normally associated" includes the case where the nucleic
acid is reintroduced into the source or natural cell but is in a different
chromosomal location or is otherwise flanked by nucleic acid sequences not
normally found in the source cell, e.g., in a vector or plasmid.
73
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
In addition to a DNA sequence encoding a siRNA, the nucleic acid
molecules of the invention include double-stranded interfering RNA molecules,
which are also useful to inhibit expression of a target gene. In certain
embodiment of the invention, siRNAs are employed to inhibit expression of a
target gene. By "inhibit expression" is meant to reduce, diminish or suppress
expression of a target gene. Expression of a target gene may be inhibited via
"gene silencing." Gene silencing refers to the suppression of gene expression,
e.g., transgene, heterologous gene and/or endogenous gene expression, which
may be mediated through processes that affect transcription and/or through
processes that affect post-transcriptional mechanisms. In some embodiments,
gene silencing occurs when siRNA initiates the degradation of the mRNA
transcribed from a gene of interest in a sequence-specific manner via RNA
interference, thereby preventing translation of the gene's product (for a
review,
see Brantl, 2002).
As used herein, the term "recombinant nucleic acid", e.g., "recombinant
DNA sequence or segment" refers to a nucleic acid, e.g., to DNA, that has been
derived or isolated from any appropriate cellular source, that may be
subsequently chemically altered in vitro, so that its sequence is not
naturally
occurring, or corresponds to naturally occurring sequences that are not
positioned as they would be positioned in a genome which has not been
transformed with exogenous DNA. An example of preselected DNA "derived"
from a source, would be a DNA sequence that is identified as a useful fragment
within a given organism, and which is then chemically synthesized in
essentially
pure form. An example of such DNA "isolated" from a source would be a useful
DNA sequence that is excised or removed from said source by chemical means,
e.g., by the use of restriction endonucleases, so that it can be further
manipulated, e.g., amplified, for use in the invention, by the methodology of
genetic engineering.
Thus, recovery or isolation of a given fragment of DNA from a
restriction digest can employ separation of the digest on polyacrylamide or
agarose gel by electrophoresis, identification of the fragment of interest by
74
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
comparison of its mobility versus that of marker DNA fragments of known
molecular weight, removal of the gel section containing the desired fragment,
and separation of the gel from DNA. See Lawn et al. (1981), and Goeddel et al.
(1980). Therefore, "recombinant DNA" includes completely synthetic DNA
sequences, semi-synthetic DNA sequences, DNA sequences isolated from
biological sources, and DNA sequences derived from RNA, as well as mixtures
thereof.
Nucleic acid molecules having base substitutions (i.e., variants) are
prepared by a variety of methods known in the art. These methods include, but
are not limited to, isolation from a natural source (in the case of naturally
occurring sequence variants) or preparation by oligonucleotide-mediated (or
site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an
earlier prepared variant or a non-variant version of the nucleic acid
molecule.
Oligonucleotide-mediated mutagenesis is a method for preparing
substitution variants. This technique is known in the art as described by
Adelman et al. (1983). Briefly, nucleic acid encoding a siRNA can be altered
by
hybridizing an oligonucleotide encoding the desired mutation to a DNA
template, where the template is the single-stranded form of a plasmid or
bacteriophage containing the unaltered or native gene sequence. After
hybridization, a DNA polymerase is used to synthesize an entire second
complementary strand of the template that will thus incorporate the
oligonucleotide primer, and will code for the selected alteration in the
nucleic
acid encoding siRNA. Generally, oligonucleotides of at least 25 nucleotides in
length are used. An optimal oligonucleotide will have 12 to 15 nucleotides
that
are completely complementary to the template on either side of the
nucleotide(s)
coding for the mutation. This ensures that the oligonucleotide will hybridize
properly to the single-stranded DNA template molecule. The oligonucleotides
are readily synthesized using techniques known in the art such as that
described
by Crea et aL (1978).
The DNA template can be generated by those vectors that are either
derived from bacteriophage M13 vectors (the commercially available M13mp18
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
and M13mp19 vectors are suitable), or those vectors that contain a
single-stranded phage origin of replication as described by Viera et al.
(1987).
Thus, the DNA that is to be mutated may be inserted into one of these vectors
to
generate single-stranded template. Production of the single-stranded template
is
described in Chapter 3 of Sambrook and Russell, 2001. Alternatively,
single-stranded DNA template may be generated by denaturing double-stranded
plasmid (or other) DNA using standard techniques.
For alteration of the native DNA sequence (to generate amino acid
sequence variants, for example), the oligonucleotide is hybridized to the
single-stranded template under suitable hybridization conditions. A DNA
polymerizing enzyme, usually the Klenow fragment of DNA polymerase I, is
then added to synthesize the complementary strand of the template using the
oligonucleotide as a primer for synthesis. A heteroduplex molecule is thus
formed such that one strand of DNA encodes the mutated form of the DNA, and
the other strand (the original template) encodes the native, unaltered
sequence of
the DNA. This heteroduplex molecule is then transformed into a suitable host
cell, usually a prokaryote such as E. call JM101. After the cells are grown,
they
are plated onto agarose plates and screened using the oligonucleotide primer
radiolabeled with 32-phosphate to identify the bacterial colonies that contain
the
mutated DNA. The mutated region is then removed and placed in an appropriate
vector, generally an expression vector of the type typically employed for
transformation of an appropriate host.
The method described immediately above may be modified such that a
homoduplex molecule is created wherein both strands of the plasmid contain the
mutations(s). The modifications are as follows: The single-stranded
oligonucleotide is annealed to the single-stranded template as described
above.
A mixture of three deoxyribonucleotides, deoxyriboadenosine (dATP),
deoxyriboguanosine (dGTP), and deoxyribothymidine (dTTP), is combined with
a modified thiodeoxyribocytosine called dCTP-(*S) (which can be obtained from
the Amersham Corporation). This mixture is added to the
template-oligonucleotide complex. Upon addition of DNA polymerase to this
76
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
mixture, a strand of DNA identical to the template except for the mutated
bases
is generated. In addition, this new strand of DNA will contain dCTP-(*S)
instead of dCTP, which serves to protect it from restriction endonuclease
digestion.
After the template strand of the double-stranded heteroduplex is nicked
with an appropriate restriction enzyme, the template strand can be digested
with
ExoIII nuclease or another appropriate nuclease past the region that contains
the
site(s) to be mutagenized. The reaction is then stopped to leave a molecule
that
is only partially single-stranded. A complete double-stranded DNA homoduplex
is then formed using DNA polymerase in the presence of all four
deoxyribonucleotide triphosphates, ATP, and DNA ligase. This homoduplex
molecule can then be transformed into a suitable host cell such as E. coli
JM101.
III. Expression Cassettes of the Invention
To prepare expression cassettes, the recombinant DNA sequence or
segment may be circular or linear, double-stranded or single-stranded.
Generally, the DNA sequence or segment is in the form of chimeric DNA, such
as plasmid DNA or a vector that can also contain coding regions flanked by
control sequences that promote the expression of the recombinant DNA present
in the resultant transformed cell.
A "chimeric" vector or expression cassette, as used herein, means a
vector or cassette including nucleic acid sequences from at least two
different
species, or has a nucleic acid sequence from the same species that is linked
or
associated in a manner that does not occur in the "native" or wild type of the
species.
Aside from recombinant DNA sequences that serve as transcription units
for an RNA transcript, or portions thereof, a portion of the recombinant DNA
may be untranscribed, serving a regulatory or a structural function. For
example,
the recombinant DNA may have a promoter that is active in mammalian cells.
Other elements functional in the host cells, such as introns, enhancers,
polyadenylation sequences and the like, may also be a part of the recombinant
77
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
DNA. Such elements may or may not be necessary for the function of the DNA,
=
but may provide improved expression of the DNA by affecting transcription,
stability of the siRNA, or the like. Such elements may be included in the DNA
as desired to obtain the optimal performance of the siRNA in the cell.
Control sequences are DNA sequences necessary for the expression of an
operably linked coding sequence in a particular host organism. The control
sequences that are suitable for prokaryotic cells, for example, include a
promoter, and optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation signals, and
enhancers.
= Operably linked nucleic acids are nucleic acids placed in a functional
relationship with another nucleic acid sequence. For example, a promoter or
enhancer is operably linked to a coding sequence if it affects the
transcription of
the sequence; or a ribosome binding site is operably linked to a coding
sequence
if it is positioned so as to facilitate translation. Generally, operably
linked DNA
sequences are DNA sequences that are linked are contiguous. However,
enhancers do not have to be contiguous. Linking is accomplished by ligation at
convenient restriction sites. If such sites do not exist, the synthetic
oligonucleotide adaptors or linkers are used in accord with conventional
practice.
The recombinant DNA to be introduced into the cells may contain either
a selectable marker gene or a reporter gene or both to facilitate
identification and
selection of expressing cells from the population of cells sought to be
transfected
or infected through viral vectors. In other embodiments, the selectable marker
may be carried on a separate piece of DNA and used in a co-transfection
procedure. Both selectable markers and reporter genes may be flanked with
appropriate regulatory sequences to enable expression in the host cells.
Useful
selectable markers are known in the art and include, for example, antibiotic-
resistance genes, such as neo and the like.
Reporter genes are used for identifying potentially transfected cells and
for evaluating the functionality of regulatory sequences. Reporter genes that
encode for easily assayable proteins are well known in the art. In general, a
78
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
reporter gene is a gene that is not present in or expressed by the recipient
organism or tissue and that encodes a protein whose expression is manifested
by
some easily detectable property, e.g., enzymatic activity. For example,
reporter
genes include the chloramphenicol acetyl transferase gene (cat) from Tn9 of E.
coli and the luciferase gene from firefly Photinus pyralis. Expression of the
reporter gene is assayed at a suitable time after the DNA has been introduced
into the recipient cells.
In order to prevent any packaging of AAV genomic sequences containing
the rep and cap genes, a plasmid containing the rep and cap DNA fragment can
be modified by the inclusion of a stuffer fragment into the AAV genome which
causes the DNA to exceed the length for optimal packaging. Thus, in certain
embodiments, the helper fragment is not packaged into AAV virions. This is a
safety feature, ensuring that only a recombinant AAV vector genome that does
not exceed optimal packaging size is packaged into virions. An AAV helper
fragment that incorporates a stuffer sequence can exceed the wild-type genome
length of 4.6 kb, and lengths above 105% of the wild-type will generally not
be
packaged. The stuffer fragment can be derived from, for example, such non-
viral
sources as the Lac-Z or beta-galactosidase gene.
The general methods for constructing recombinant DNA that can
transfect target cells are well known to those skilled in the art, and the
same
compositions and methods of construction may be utilized to produce the DNA
useful herein. For example, Sambrook and Russell, infra, provides suitable
methods of construction.
The recombinant DNA can be readily introduced into the host cells, e.g.,
mammalian, bacterial, yeast or insect cells by transfection with an expression
-
vector composed of DNA encoding the siRNA by any procedure useful for the
introduction into a particular cell, e.g., physical or biological methods, to
yield a
cell having the recombinant DNA stably integrated into its genome or existing
as
a episomal element, so that the DNA molecules, or sequences of the present
invention are expressed by the host cell. The DNA is introduced into host
cells
via a vector. The host cell is may be of eukaryotic origin, e.g., plant,
79
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
mammalian, insect, yeast or fungal sources, but host cells of non-eukaryotic
origin may also be employed.
Physical methods to introduce a preselected DNA into a host cell include
calcium phosphate precipitation, lipofection, particle bombardment,
microinjection, electroporation, and the like. Biological methods to introduce
the DNA of interest into a host cell include the use of DNA and RNA viral
vectors. For mammalian gene therapy, as described hereinbelow, it is desirable
to use an efficient means of inserting a copy gene into the host genome. Viral
vectors, and especially retroviral vectors, have become the most widely used
method for inserting genes into mammalian, e.g., human cells. Other viral .
vectors can be derived from poxviruses, herpes simplex virus I, adenoviruses
and
adeno-associated viruses, and the like. See, for example, U.S. Patent Nos.
5,350,674 and 5,585,362.
As discussed above, a "transfected", "or "transduced" host cell or cell
line is one in which the genome has been altered or augmented by the presence
of at least one heterologous or recombinant nucleic acid sequence. The host
cells of the present invention are typically produced by transfection with a
DNA
sequence in a plasmid expression vector, a viral expression vector, or as an
isolated linear DNA sequence. The transfected DNA can become a
chromosomally integrated recombinant DNA sequence, which is composed of
sequence encoding the siRNA.
To confirm the presence of the recombinant DNA sequence in the host
cell, a variety of assays may be performed. Such assays include, for example,
"molecular biological" assays well known to those of skill in the art, such as
Southern and Northern blotting, RT-PCR and PCR; "biochemical" assays, such
as detecting the presence or absence of a particular peptide, e.g., by
immunological means (ELISAs and Western blots) or by assays described herein
to identify agents falling within the scope of the invention.
To detect and quantitate RNA produced from introduced recombinant
DNA segments, RT-PCR may be employed. In this application of PCR, it is
first necessary to reverse transcribe RNA into DNA, using enzymes such as
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
reverse transcriptase, and then through the use of conventional PCR techniques
amplify the DNA. In most instances PCR techniques, while useful, Will not
demonstrate integrity of the RNA product. Further information about the nature
of the RNA product may be obtained by Northern blotting. This technique
demonstrates the presence of an RNA species and gives information about the
integrity of that RNA. The presence or absence of an RNA species can also be
determined using dot or slot blot Northern hybridizations. These techniques
are
modifications of Northern blotting and only demonstrate the presence or absen-
ce
of an RNA species.
While Southern blotting and PCR may be used to detect the recombinant
DNA segment in question, they do not provide information as to whether the
preselected DNA segment is being expressed. Expression may be evaluated by
specifically identifying the peptide products of the introduced recombinant
DNA
sequences or evaluating the phenotypic changes brought about by the expression
of the introduced recombinant DNA segment in the host cell.
The instant invention provides a cell expression system for expressing
exogenous nucleic acid material in a mammalian recipient. The expression
system, also referred to as a "genetically modified cell", comprises a cell
and an
expression vector for expressing the exogenous nucleic acid material. The
genetically modified cells are suitable for administration to a mammalian
recipient, where they replace the endogenous cells of the recipient. Thus, the
genetically modified cells are non-immortalized and are non-tumorigenic.
According to one embodiment, the cells are transfected or otherwise
genetically modified ex vivo. The cells are isolated from a mammal (such as a
human), nucleic acid introduced (i.e., transduced or transfected in vitro)
with a
vector for expressing a heterologous (e.g., recombinant) gene encoding the
therapeutic agent, and then administered to a mammalian recipient for delivery
of the therapeutic agent in situ. The mammalian recipient may be a human and
the cells to be modified are autologous cells, i.e., the cells are isolated
from the
mammalian recipient.
81
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
According to another embodiment, the cells are transfected or transduced
or otherwise genetically modified in vivo. The cells from the mammalian
recipient are transduced or transfected in vivo with a vector containing
exogenous nucleic acid material for expressing a heterologous (e.g.,
recombinant) gene encoding a therapeutic agent and the therapeutic agent is
delivered in situ. As used herein, "exogenous nucleic acid material" refers
to a nucleic acid or an oligonucleotide, either natural or synthetic, which is
not
naturally found in the cells; or if it is naturally found in the cells, is
modified
from its original or native form. Thus, "exogenous nucleic acid material"
includes, for example, a non-naturally occurring nucleic acid that can be
transcribed into an anti-sense RNA, a siRNA, as well as a "heterologous gene"
(i.e., a gene encoding a protein that is not expressed or is expressed at
biologically insignificant levels in a naturally-occurring cell of the same
type).
To illustrate, a synthetic or natural gene encoding human erythropoietin (EPO)
would be considered "exogenous nucleic acid material" with respect to human
peritoneal mesothelial cells since the latter cells do not naturally express
EPO.
Still another example of "exogenous nucleic acid material" is the introduction
of
only part of a gene to create a recombinant gene, such as combining an
regulatable promoter with an endogenous coding sequence via homologous
recombination.
IV. Promoters of the Invention
As described herein, an expression cassette of the invention contains, inter
alia,
a promoter. Such promoters include the CMV promoter, as well as the RSV
promoter, SV40 late promoter and retroviral LTRs (long terminal repeat
elements), or brain cell specific promoters, although many other promoter
elements well known to the art, such as tissue specific promoters or
regulatable
promoters may be employed in the practice of the invention.
82
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
In one embodiment of the present invention, an expression cassette may
contain a pol II promoter that is operably linked to a nucleic acid sequence
encoding a siRNA. Thus, the pol II promoter, i.e., a RNA polymerase II
dependent promoter, initiates the transcription of the siRNA. In another
-- embodiment, the pol II promoter is regulatable.
Three RNA polymerases transcribe nuclear genes in eukaryotes. RNA
polymerase II (pol II) synthesizes mRNA, i.e., pol II transcribes the genes
that
encode proteins. In contrast, RNA polymerase I (pol I) and RNA polymerase
III (pol III) transcribe only a limited set of transcripts, synthesizing RNAs
that
-- have structural or catalytic roles. RNA polymerase I makes the large
ribosomal
RNAs (rRNA), which are under the control of pol I promoters. RNA
polymerase III makes a variety of small, stable RNAs, including the small 5S
rRNA and transfer RNAs (tRNA), the transcription of which is under the control
of pd. III promoters.
As described herein, the inventors unexpectedly discovered that pol II
promoters are useful to direct transcription of the siRNA. This was surprising
because, as discussed above, pol If promoters are thought to be responsible
for
transcription of messenger RNA, i.e., relatively long RNAs as compared to
RNAs of 30 bases or less.
A pol 11 promoter may be used in its entirety, or a portion or fragment of the
promoter sequence may be used in which the portion maintains the promoter
activity. As discussed herein, pol II promoters are known to a skilled person
in
the art and include the promoter of any protein-encoding gene, e.g., an
endogenously regulated gene or a constitutively expressed gene. For example,
-- the promoters of genes regulated by cellular physiological events, e.g.,
heat
shock, oxygen levels and/or carbon monoxide levels, e.g., in hypoxia, may be
used in the expression cassettes of the invention. In addition, the promoter
of
any gene regulated by the presence of a pharmacological agent, e.g.,
tetracycline
and derivatives thereof, as well as heavy metal ions and hormones may be
-- employed in the expression cassettes of the invention. In an embodiment of
the
83
CA 02596588 2013-08-13
invention, the pol II promoter can be the CMV promoter or the RSV promoter.
In another embodiment, the pol II promoter is the CMV promoter.
As discussed above, a pol II promoter of the invention may be one
naturally associated with an endogenously regulated gene or sequence, as may
be obtained by isolating the 5' non-coding sequences located upstream of the
coding segment and/or exon. The pol II promoter of the expression cassette can
be, for example, the same pol II promoter driving expression of the targeted
gene
of interest. Alternatively, the nucleic acid sequence encoding the siRNA may
be
placed under the control of a recombinant or heterologous pol II promoter,
which
refers to a promoter that is not normally associated with the targeted gene's
natural environment. Such promoters include promoters isolated from any
eukaryotic cell, and promoters not -naturally occurring," i.e., containing
different elements of different transcriptional regulatory regions, and/or
mutations that alter expression. In addition to producing nucleic acid
sequences
of promoters synthetically, sequences may be produced using recombinant
cloning and/or nucleic acid amplification technology, including PCRTM, in
connection with the compositions disclosed herein (see U.S. Patent 4,683,202,
U.S. Patent 5,928,906).
In one embodiment, a pol II promoter that effectively directs the
expression of the siRNA in the cell type, organelle, and organism chosen for
expression will be employed. Those of ordinary skill in the art of molecular
biology generally know the use of promoters for protein expression, for
example,
see Sambrook and Russell (2001). The promoters employed may be
constitutive, tissue-specific, inducible, and/or useful under the appropriate
conditions to direct high level expression of the introduced DNA segment, such
as is advantageous in the large-scale production of recombinant proteins
and/or
peptides. The identity of tissue-specific promoters, as well as assays to
characterize their activity, is well known to those of ordinary skill in the
art.
In another aspect of the invention, RNA molecules of the present invention
can be expressed from transcription units (see for example Couture et al.,
1996,
TIG., 12, 510) inserted into DNA or RNA vectors. The recombinant vectors can
be DNA plasmids or viral vectors. siRNA expressing viral vectors can be
84
CA 02596588 2013-08-13
constructed based on, but not limited to, adeno-associated virus, retrovirus,
adenovirus, or alphavirus. In another embodiment, poi III based constructs are
used to express nucleic acid molecules of the invention (see for example
Thompson, U.S. Pats. Nos. 5,902,880 and 6,146,886). The recombinant vectors
capable of expressing the siRNA molecules can be delivered as described above,
and persist in target cells. Alternatively, viral vectors can be used that
provide
for transient expression of nucleic acid molecules. Such vectors can be
repeatedly administered as necessary. Once expressed, the siRNA molecule
interacts with the target mRNA and generates an RNAi response. Delivery of
siRNA molecule expressing vectors can be systemic, such as by intravenous or
intra-muscular administration, by administration to target cells ex-planted
from a
subject followed by reintroduction into the subject, or by any other means
that
would allow for introduction into the desired target cell (for a review see
Couture et al., 1996, TIG., 12, 510). In one aspect the invention features an
expression vector comprising a nucleic acid sequence encoding at least one
siRNA molecule of the instant invention. The expression vector can encode one
or both strands of a siRNA duplex, or a single self-complementary strand that
self hybridizes into a siRNA duplex. The nucleic acid sequences encoding the
siRNA molecules of the instant invention can be operably linked in a manner
that allows expression of the siRNA molecule (see for example Paul et al.,
2002,
Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature
Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19, 500; and
Novina et al., "siRNA-directed inhibition of HIV-1 infection," Nat Med., 2002
Jul;8(7):681-6. Epub 2002 Jun 3). In another aspect, the invention features an
expression vector comprising: a) a transcription initiation region (e.g.,
eukaryotic
poll, II or III initiation region); b) a transcription termination region
(e.g.,
eukaryotic poll, II or III termination region); and c) a nucleic acid sequence
encoding at least one of the siRNA molecules of the instant invention, wherein
said sequence is operably linked to said initiation region and said
termination
region in a manner that allows expression and/or delivery of the siRNA
molecule. The vector can optionally include an open reading frame (ORF) for a
CA 02596588 2013-08-13
protein operably linked on the 5' side or the 3'-side of the sequence encoding
the
siRNA of the invention; and/or an intron (intervening sequences).
Transcription of the siRNA molecule sequences can be driven from a
promoter for eukaryotic RNA polymerase I (poll), RNA polymerase II (pol II),
or RNA polymerase III (pol III). Transcripts from pol II or pol III promoters
are
expressed at high levels in all cells; the levels of a given pol II promoter
in a
given cell type depends on the nature of the gene regulatory sequences
(enhancers, silencers, etc.) present nearby. Prokaryotic RNA polymerase
promoters are also used, providing that the prokaryotic RNA polymerase enzyme
is expressed in the appropriate cells (Elroy-Stein and Moss, 1990, Proc. Natl.
Acad. Sci. USA, 87, 6743-7; Gao and Huang 1993, Nucleic Acids Res., 21,
2867-72; Lieber etal., 1993, Methods Enzymol., 217, 47-66; Zhou etal., 1990,
Mol. Cell. Biol.,10, 4529-37). Several investigators have demonstrated that
nucleic acid molecules expressed from such promoters can function in
mammalian cells (e.g. Kashani-Sabet etal., 1992, Antisense Res. Dev., 2, 3-15;
Ojwang etal., 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6; Chen etal.,
1992, Nucleic Acids Res., 20, 4581-9; Yu etal., 1993, Proc. Natl. Acad. Sci. U
SA, 90, 6340-4; L'Huillier et al., 1992, EMBO J.,11, 4411-8; Lisziewicz et
al.,
1993, Proc. Natl. Acad. Sci. U S. A, 90, 8000-4; Thompson etal., 1995, Nucleic
Acids Res., 23, 2259; Sullenger & Cech, 1993, Science, 262, 1566). More
specifically, transcription units such as the ones derived from genes encoding
U6
small nuclear (snRNA), transfer RNA (tRNA) and adenovirus VA RNA are
useful in generating high concentrations of desired RNA molecules such as
siRNA in cells (Thompson et al., supra; Couture etal., 1996; Noonberg et al.,
1994, Nucleic Acid Res., 22, 2830; Noonberg etal., U.S. Pat. No. 5,624,803;
Good etal., 1997, Gene Ther., 4, 45; Beigelman etal., International PCT
Publication No. WO 96/18736. The above siRNA transcription units can be
incorporated into a variety of vectors for introduction into mammalian cells,
including but not restricted to, plasmid DNA vectors, viral
86
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
DNA vectors (such as adenovirus or adeno-associated virus vectors), or viral
RNA vectors (such as retroviral or alphavirus vectors) (for a review see
Couture
and Stinchcomb, 1996, supra).
In another aspect the invention features an expression vector comprising a
nucleic acid sequence encoding at least one of the siRNA molecules of the
invention in a manner that allows expression of that siRNA molecule. The
expression vector comprises in one embodiment; a) a transcription initiation
region; b) a transcription termination region; and c) a nucleic acid sequence
encoding at least one strand of the siRNA molecule, wherein the sequence is
operably linked to the initiation region and the termination region in a
manner
that allows expression and/or delivery of the siRNA molecule.
In another embodiment the expression vector comprises: a) a transcription
initiation region; b) a transcription termination region; c) an open reading
frame;
and d) a nucleic acid sequence encoding at least one strand of a siRNA
molecule,
wherein the sequence is operably linked to the 3'-end of the open reading
frame
and wherein the sequence is operably linked to the initiation region, the open
reading frame and the termination region in a manner that allows expression
and/or delivery of the siRNA molecule. In yet another embodiment, the
expression vector comprises: a) a transcription initiation region; b) a
transcription termination region; c) an intron; and d) a nucleic acid sequence
encoding at least one siRNA molecule, wherein the sequence is operably linked
to the initiation region, the intron and the termination region in a manner
which
allows expression and/or delivery of the nucleic acid molecule.
In another embodiment, the expression vector comprises: a) a transcription
initiation region; b) a transcription termination region; c) an intron; d) an
open
reading frame; and e) a nucleic acid sequence encoding at least one strand of
a
siRNA molecule, wherein the sequence is operably linked to the 3'-end of the
open reading frame and wherein the sequence is operably linked to the
initiation
region, the intron, the open reading frame and the termination region in a
manner
which allows expression and/or delivery of the siRNA molecule.
87
CA 02596588 2007-07-30
WO 2006/083800 PCT/US2006/003298
V. Methods for Introducing the Expression Cassettes of the
Invention into Cells
The condition amenable to gene inhibition therapy may be a prophylactic
process, i.e., a process for preventing disease or an undesired medical
condition.
Thus, the instant invention embraces a system for delivering siRNA that has a
prophylactic function (i.e., a prophylactic agent) to the mammalian recipient.
The inhibitory nucleic acid material (e.g., an expression cassette
encoding siRNA directed to a gene of interest) can be introduced into the cell
ex
vivo or in vivo by genetic transfer methods, such as transfection or
transduction,
to provide a genetically modified cell. Various expression vectors (i.e.,
vehicles
for facilitating delivery of exogenous nucleic acid into a target cell) are
known to =
one of ordinary skill in the art.
As used herein, "transfection of cells" refers to the acquisition by a cell
of new nucleic acid material by incorporation of added DNA. Thus, transfection
refers to the insertion of nucleic acid into a cell using physical or chemical
methods. Several transfection techniques are known to those of ordinary skill
in
the art including: calcium phosphate DNA co-precipitation (Methods in
Molecular Biology (1991)); DEAE-dextran (supra); electroporation (supra);
cationic liposome-mediated transfection (supra); and tungsten particle-
facilitated
microparticle bombardment (Johnston (1990)). Strontium phosphate DNA co-
precipitation (Brash et al. (1987)) is also a transfection method.
In contrast, "-transduction of cells" refers to the process of transferring
nucleic acid into a cell using a DNA or RNA virus. A RNA virus (i.e., a
retrovirus) for transferring a nucleic acid into a cell is referred to herein
as a
transducing chimeric retrovirus. Exogenous nucleic acid material contained
within the retrovirus is incorporated into the genome of the transduced cell.
A
cell that has been transduced with a chimeric DNA virus (e.g., an adenovirus
carrying a cDNA encoding a therapeutic agent), will not have the exogenous
nucleic acid material incorporated into its genome but will be capable of
88
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
expressing the exogenous nucleic acid material that is retained
extrachromosomally within the cell.
The exogenous nucleic acid material can include the nucleic acid
encoding the siRNA together with a promoter to control transcription. The
promoter characteristically has a specific nucleotide sequence necessary to
initiate transcription. The exogenous nucleic acid material may further
include
additional sequences (i.e., enhancers) required to obtain the desired gene
transcription activity. For the purpose of this discussion an "enhancer" is
simply
any non-translated DNA sequence that works with the coding sequence (in cis)
to change the basal transcription level dictated by the promoter. The
exogenous
nucleic acid material may be introduced into the cell genome immediately
downstream from the promoter so that the promoter and coding sequence are -
operatively linked so as to permit transcription of the coding sequence. An
expression vector can include an exogenous promoter element to control
transcription of the inserted exogenous gene. Such exogenous promoters include
both constitutive and regulatable promoters.
Naturally-occurring constitutive promoters control the expression of
essential cell functions. As a result, a nucleic acid sequence under the
control of
a constitutive promoter is expressed under all conditions of cell growth.
Constitutive promoters include the promoters for the following genes which
encode certain constitutive or "housekeeping" functions: hypoxanthine
phosphoribosyl transferase (HPRT), dihydrofolate reductase (DHFR)
(Scharfmann et al. (1991)), adenosine deaminase, phosphoglycerol kinase
(PGK), pyruvate kinase, phosphoglycerol mutase, the bet-actin promoter (Lai et
al. (1989)), and other constitutive promoters known to those of skill in the
art.
In addition, many viral promoters function constitutively in eukaryotic cells.
These include: the early and late promoters of SV40; the long terminal repeats
(LTRs) of Moloney Leukemia Virus and other retroviruses; and the thymidine
kinase promoter of Herpes Simplex Virus, among many others.
Nucleic acid sequences that are under the control of regulatable
promoters are expressed only or to a greater or lesser degree in the presence
of
89
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
=
an inducing or repressing agent, (e.g., transcription under control of the
metallothionein promoter is greatly increased in presence of certain metal
ions).
Regulatable promoters include responsive elements (REs) that stimulate
transcription when their inducing factors are bound. For example there are REs
for serum factors, steroid hormones, retinoic acid, cyclic AMP, and
tetracycline
and doxycycline. Promoters containing a particular RE can be chosen in order
to
obtain an regulatable response and in some cases, the RE itself may be
attached
to a different promoter, thereby conferring regulatability to the encoded
nucleic
acid sequence. Thus, by selecting the appropriate promoter (constitutive
versus
regulatable; strong versus weak), it is possible to control both the existence
and
level of expression of a nucleic acid sequence in the genetically modified
cell. If
the nucleic acid sequence is under the control of an regulatable promoter,
delivery of the therapeutic agent in situ is triggered by exposing the
genetically
modified cell in situ to conditions for permitting transcription of the
nucleic acid
sequence, e.g., by intraperitoneal injection of specific inducers of the
regulatable
promoters which control transcription of the agent. For example, in situ
expression of a nucleic acid sequence under the control of the metallothionein
promoter in genetically modified cells is enhanced by contacting the
genetically
modified cells with a solution containing the appropriate (i.e., inducing)
metal
ions in situ.
Accordingly, the amount of siRNA generated in situ is regulated by
controlling such factors as the nature of the promoter used to direct
transcription
of the nucleic acid sequence, (L e., whether the promoter is constitutive or
regulatable, strong or weak) and the number of copies of the exogenous nucleic
acid sequence encoding a siRNA sequence that are in the cell.
In addition to at least one promoter and at least one heterologous nucleic
acid sequence encoding the siRNA, the expression vector may include a
selection gene, for example, a neomycin resistance gene, for facilitating
selection
of cells that have been transfected or transduced with the expression vector.
Cells can also be transfected with two or more expression vectors, at least
one vector containing the nucleic acid sequence(s) encoding the siRNA(s), the
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
other vector containing a selection gene. The selection of a suitable
promoter,
enhancer, selection gene and/or signal sequence is deemed to be within the
scope
of one of ordinary skill in the art without undue experimentation.
The following discussion is directed to various utilities of the instant
invention. For example, the instant invention has utility as an expression
system
suitable for silencing the expression of gene(s) of interest.
The instant invention also provides various methods for making and
using the above-described genetically-modified cells.
The instant invention also provides methods for genetically modifying
cells of a mammalian recipient in vivo. According to one embodiment, the
method comprises introducing an expression vector for expressing a siRNA
sequence in cells of the mammalian recipient in situ by, for example,
injecting
the vector into the recipient.
VI. Delivery Vehicles for the Expression Cassettes of the
Invention
Delivery of compounds into tissues and across the blood-brain barrier
can be limited by the size and biochemical properties of the compounds.
Currently, efficient delivery of compounds into cells in vivo can be achieved
only when the molecules are small (usually less than 600 Daltons). Gene
transfer for the correction of inborn errors of metabolism and
neurodegenerative
diseases of the central nervous system (CNS), and for the treatment of cancer
has
been accomplished with recombinant adenoviral vectors.
The selection and optimization of a particular expression vector for
expressing a specific siRNA in a cell can be accomplished by obtaining the
nucleic acid sequence of the siRNA, possibly with one or more appropriate
control regions (e.g., promoter, insertion sequence); preparing a vector
construct
comprising the vector into which is inserted the nucleic acid sequence
encoding
the siRNA; transfecting or transducing cultured cells in vitro with the vector
construct; and determining whether the siRNA is present in the cultured cells.
91
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Vectors for cell gene therapy include viruses, such as replication-
deficient viruses (described in detail below). Exemplary viral vectors are
derived from Harvey Sarcoma virus, ROUS Sarcoma virus, (MPSV), Moloney
murine leukemia virus and DNA viruses (e.g., adenovirus) (Ternin (1986)).
Replication-deficient retroviruses are capable of directing synthesis of all
virion proteins, but are incapable of making infectious particles.
Accordingly,
these genetically altered retroviral expression vectors have general utility
for
high-efficiency transduction of nucleic acid sequences in cultured cells, and
specific utility for use in the method of the present invention. Such
retroviruses
further have utility for the efficient transduction of nucleic acid sequences
into
cells in vivo. Retroviruses have been used extensively for transferring
nucleic
acid material into cells. Standard protocols for producing replication-
deficient
retroviruses (including the steps of incorporation of exogenous nucleic acid
material into a plasmid, transfection of a packaging cell line with plasmid,
production of recombinant retroviruses by the packaging cell line, collection
of
viral particles from tissue culture media, and infection of the target cells
with the
viral particles) are provided in Kriegler (1990) and Murray (1991).
An advantage of using retroviruses for gene therapy is that the viruses
insert the nucleic acid sequence encoding the siRNA into the host cell genome,
thereby permitting the nucleic acid sequence encoding the siRNA to be passed
on to the progeny of the cell when it divides. Promoter sequences in the LTR
region have been reported to enhance expression of an inserted coding sequence
in a variety of cell types (see e.g., Hilberg et al. (1987); Holland et al.
(1987);
Valerio et al. (1989). Some disadvantages of using a retrovirus expression
vector are (1) insertional mutagenesis, i.e., the insertion of the nucleic
acid
sequence encoding the siRNA into an undesirable position in the target cell
genome which, for example, leads to unregulated cell growth and (2) the need
for target cell proliferation in order for the nucleic acid sequence encoding
the
siRNA carried by the vector to be integrated into the target genome (Miller et
al.
(1990)).
92
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Another viral candidate useful as an expression vector for transformation
of cells is the adenovirus, a double-stranded DNA virus. The adenovirus is
infective in a wide range of cell types, including, for example, muscle and
endothelial cells (Larrick and Burck (1991)). The adenovirus also has been
used
as an expression vector in muscle cells in vivo (Quantin et al. (1992)).
Adenoviruses (Ad) are double-stranded linear DNA viruses with a 36 kb
genome. Several features of adenovirus have made them useful as transgene
delivery vehicles for therapeutic applications, such as facilitating in vivo
gene
delivery. Recombinant adenovirus vectors have been shown to be capable of
efficient in situ gene transfer to parenchymal cells of various organs,
including
the lung, brain, pancreas, gallbladder, and liver. This has allowed the use of
these vectors in methods for treating inherited genetic diseases, such as
cystic
fibrosis, where vectors may be delivered to a target organ. In addition, the
ability of the adenovirus vector to accomplish in situ tumor transduction has
allowed the development of a variety of anticancer gene therapy methods for
non-disseminated disease. In these methods, vector containment favors tumor
cell-specific transduction.
Like the retrovirus, the adenovirus genome is adaptable for use as an
expression vector for gene therapy, i.e., by removing the genetic information
that
controls production of the virus itself (Rosenfeld et al. (1991)). Because the
adenovirus functions in an extrachromosomal fashion, the recombinant
adenovirus does not have the theoretical problem of insertional mutagenesis.
Several approaches traditionally have been used to generate the
recombinant adenoviruses. One approach involves direct ligation of restriction
endonuclease fragments containing a nucleic acid sequence of interest to
portions of the adenoviral genome. Alternatively, the nucleic acid sequence of
interest may be inserted into a defective adenovirus by homologous
recombination results. The desired recombinants are identified by screening
individual plaques generated in a lawn of complementation cells.
Most adenovirus vectors are based on the adenovirus type 5 (Ad5)
backbone in which an expression cassette containing the nucleic acid sequence
93
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
of interest has been introduced in place of the early region I (El) or early
region
3 (E3). Viruses in which El has been deleted are defective for replication and
are propagated in human complementation cells (e.g., 293 or 911 cells), which
supply the missing gene El and pIX in trans.
In one embodiment of the present invention, one will desire to generate
siRNA in a brain cell or brain tissue. A suitable vector for this application
is an
FIV vector (Brooks et al. (2002); Alisky et al. (2000a)) or an AAV vector. For
example, one may use AAV5 (Davidson et al. (2000); Alisky et al. (2000a)).
Also, one may apply poliovirus (Bledsoe et al. (2000)) or HSV vectors (Alisky
et al. (2000b)).
Adeno associated virus (AAV) is a small nonpathogenic virus of the
parvoviridae family (for review see Muzyczka, N. 1992. Curr Top Microbiol
Immunol 158: 97-129; see also U.S. Patent No. 6,468,524). AAV is distinct
from the other members of this family by its dependence upon a helper virus
for
replication. In the absence of a helper virus, AAV may integrate in a locus
specific manner into the q arm of chromosome 19 (Kotin et al., (1990) Proc.
Natl. Acad. Sci. (USA) 87: 2211-2215). The approximately 5 kb genome of
AAV consists of one segment of single stranded DNA of either plus or minus
polarity. The ends of the genome are short inverted terminal repeats which can
fold into hairpin structures and serve as the origin of viral DNA replication.
Physically, the parvovirus virion is non-enveloped and its icosohedral capsid
is
approximately 20 nm in diameter.
To-date seven serologically distinct AAVs have been identified and five
have been isolated from humans or primates and are referred to as AAV types 1-
5 (Arella et al Handbook of Parvoviruses. Vol. 1. ed. P. Tijssen. Boca Raton,
Fla., CRC Press, 1990). The most extensively studied of these isolates is AAV
type 2 (AAV2). The genome of AAV2 is 4680 nucleotides in length and
contains two open reading frames (ORFs). The left ORF encodes the non-
structural Rep proteins, Rep40, Rep 52, Rep68 and Rep 78, which are involved
in regulation of replication and transcription in addition to the production
of
single-stranded progeny genomes. Furthermore, two of the Rep proteins have
94
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
been associated with the possible integration of AAV genomes into a region of
the q arm of human chromosome 19. Rep68/78 have also been shown to possess
NTP binding activity as well as DNA and RNA helicase activities. The Rep
proteins possess a nuclear localization signal as well as several potential
phosphorylation sites. Mutation of one of these kinase sites resulted in a
loss of
replication activity.
The ends of the genome are short inverted terminal repeats which have
the potential to fold into T-shaped hairpin structures that serve as the
origin of
viral DNA replication. Within the ITR region two elements have been described
which are central to the function of the ITR, a GAGC repeat motif and the
terminal resolution site (trs). The repeat motif has been shown to bind Rep
when
the ITR is in either a linear or hairpin conformation. This binding serves to
position Rep68/78 for cleavage at the trs which occurs in a site- and strand-
specific marmer. In addition to their role in replication, these two elements
appear to be central to viral integration. Contained within the chromosome 19
integration locus is a Rep binding site with an adjacent trs. These elements
have
been shown to be functional and necessary for locus specific integration.
The AAV2 virion is a non-enveloped, icosohedral particle approximately
nm in diameter, consisting of three related proteins referred to as VPI,2 and
3.
20 The right ORF encodes the capsid proteins, VP1, VP2, and VP3. These
proteins
are found in a ratio of 1:1:10 respectively and are all derived from the right-
hand
ORF. The capsid proteins differ from each other by the use of alternative
splicing and an unusual start codon. Deletion analysis has shown that removal
or alteration of VP1 which is translated from an alternatively spliced message
25 results in a reduced yield of infections particles. Mutations within the
VP3
coding region result in the failure to produce any single-stranded progeny DNA
or infectious particles.
The following features of AAV have made it an attractive vector for gene
transfer. AAV vectors have been shown in vitro to stably integrate into the
cellular genome; possess a broad host range; transduce both dividing and non
dividing cells in vitro and in vivo and maintain high levels of expression of
the
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
transduced genes. Viral particles are heat stable, resistant to solvents,
detergents,
changes in pH, temperature, and can be concentrated on CsC1 gradients.
Integration of AAV provirus is not associated with any long term negative
effects on cell growth or differentiation. The ITRs have been shown to be the
only cis elements required for replication, packaging and integration and may
contain some promoter activities.
Further provided by this invention are chimeric viruses where AAV can
be combined with herpes virus, herpes virus amplicons, baculovirus or other
viruses to achieve a desired tropism associated with another virus. For
example,
the AAV4 ITRs could be inserted in the herpes virus and cells could be
infected.
Post-infection, the ITRs of AAV4 could be acted on by AAV4 rep provided in
the system or in a separate vehicle to rescue AAV4 from the genome. Therefore,
the cellular tropism of the herpes simplex virus can be combined with AAV4 rep
mediated targeted integration. Other viruses that could be utilized to
construct
chimeric viruses include lentivirus, retrovirus, pseudotyped retroviral
vectors,
and adenoviral vectors.
Also provided by this invention are variant AAV vectors. For example,
the sequence of a native AAV, such as AAV5, can be modified at individual
nucleotides. The present invention includes native and mutant AAV vectors.
The present invention further includes all AAV seroty-pes.
Thus, as will be apparent to one of ordinary skill in the art, a variety of
suitable viral expression vectors are available for transferring exogenous
nucleic
acid material into cells. The selection of an appropriate expression vector to
express a therapeutic agent for a particular condition amenable to gene
silencing
therapy and the optimization of the conditions for insertion of the selected
expression vector into the cell, are within the scope of one of ordinary skill
in the
art without the need for undue experimentation.
In another embodiment, the expression vector is in the form of a plasmid,
which is transferred into the target cells by one of a variety of methods:
physical
(e.g., microinjection (Capecchi (1980)), electroporation (Andreason and Evans
(1988), scrape loading, microparticle bombardment (Johnston (1990)) or by
96
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
cellular uptake as a chemical complex (e.g., calcium or strontium co-
precipitation, complexation with lipid, complexation with ligand) (Methods in
Molecular Biology (1991)). Several commercial products are available for
cationic liposome complexation including LipofectinTM (Gibco-BRL,
Gaithersburg, Md.) (Feigner et al. (1987)) and TransfectamTm (Promega,
Madison, Wis.) (Behr et al. (1989); Loeffler et al. (1990)). However, the
efficiency of transfection by these methods is highly dependent on the nature
of
the target cell and accordingly, the conditions for optimal transfection of
nucleic
acids into cells using the above-mentioned procedures must be optimized. Such
optimization is within the scope of one of ordinary skill in the art without
the
need for undue experimentation.
VII. Diseases and Conditions Amendable to the Methods of the
Invention
In the certain embodiments of the present invention, a mammalian
recipient to an expression cassette of the invention has a condition that is
amenable to gene silencing therapy. As used herein, "gene silencing therapy"
refers to administration to the recipient exogenous nucleic acid material
encoding a therapeutic siRNA and subsequent expression of the administered
nucleic acid material in situ. TimS", the phrase "condition amenable to siRNA
therapy" embraces conditions such as genetic diseases (i.e., a disease
condition
that is attributable to one or more gene defects), acquired pathologies (i.e.,
a
pathological condition that is not attributable to an inborn defect), cancers,
neurodegenerative diseases, e.g., trinucleotide repeat disorders, and
prophylactic
processes (i.e., prevention of a disease or of an undesired medical
condition). A
gene "associated with a condition" is a gene that is either the cause, or is
part of
the cause, of the condition to be treated. Examples of such genes include
genes
associated with a neurodegenerative disease (e.g., a trinucleotide-repeat
disease
such as a disease associated with polyglutamine repeats, Huntington's disease,
and several spinocerebellar ataxias), and genes encoding ligands for
chemokines
involved in the migration of a cancer cells, or chemokine receptor. Also siRNA
97
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
expressed from viral vectors may be used for in vivo antiviral therapy using
the
vector systems described.
Accordingly, as used herein, the term "therapeutic siRNA" refers to any
siRNA that has a beneficial effect on the recipient. Thus, "therapeutic siRNA"
embraces both therapeutic and prophylactic siRNA.
Differences between alleles that are amenable to targeting by siRNA
include disease-causing mutations as well as polymorphisms that are not
themselves mutations, but may be linked to a mutation or associated with a
predisposition to a disease state. Examples of targetable disease mutations
include tau mutations that cause frontotemporal dementia and the GAG deletion
in the TOR1A gene that causes DYT1 dystonia. An example of a targetable
polymorphism that is not itself a mutation is the C/G single nucleotide
polymorphism (G987C) in the MJD1 gene immediately downstream of the
mutation that causes spinocerebellar ataxia type 3 and the polymorphism in
exon
58 associated with Huntington's disease.
Single nucleotide polymorphisms comprise most of the genetic diversity
between humans, and that many disease genes, including the HD gene in
Huntington's disease, contain numerous single nucleotide or multiple
nucleotide
polymorphisms that could be separately targeted in one allele vs. the other,
as
shown in Figure 15. The major risk factor for developing Alzheimer's disease
is
the presence of a particular polymorphism in the apolipoprotein E gene.
A. Gene defects
A number of diseases caused by gene defects have been identified. For
example, this strategy can be applied to a major class of disabling
neurological
disorders. For example this strategy can be applied to the polyglutamine
diseases, as is demonstrated by the reduction of polyglutamine aggregation in
cells following application of the strategy. The neurodegenerative disease may
be a trinucleotide-repeat disease, such as a disease associated with
polyglutamine
repeats, including Huntington's disease, and several spinocerebellar ataxias.
98
CA 02596588 2013-08-13
Additionally, this strategy can be applied to a non-degenerative
neurological disorder, such as DYT1 dystonia.
B. Acquired pathologies
As used herein, "acquired pathology" refers to a disease or syndrome
manifested by an abnormal physiological, biochemical, cellular, structural, or
molecular biological state. For example, the disease could be a viral disease,
such as hepatitis or AIDS.
C. Cancers
The condition amenable to gene silencing therapy alternatively can be a
genetic disorder or an acquired pathology that is manifested by abnormal cell
proliferation, e.g., cancer. According to this embodiment, the instant
invention
is useful for silencing a gene involved in neoplastic activity. The present
invention can also be used to inhibit overexpression of one or several genes.
The
present invention can be used to treat neuroblastoma, medulloblastoma, or
glioblastoma.
VIII. Dosages, Formulations and Routes of Administration of the
Agents of the Invention
The agents of the invention are administered so as to result in a reduction
in at least one symptom associated with a disease. The amount administered
will
vary depending on various factors including, but not limited to, the
composition
chosen, the particular disease, the weight, the physical condition, and the
age of
the mammal, and whether prevention or treatment is to be achieved. Such
factors can be readily determined by the clinician employing animal models or
other test systems which are well known to the art.
Administration of siRNA may be accomplished through the
administration of the nucleic acid molecule encoding the siRNA (see, for
example Feigner et al., U.S. Patent No. 5,580,859; Pardoll et al., "Exposing
the
Immunology of Naked DNA Vaccines," Immunity, 1995, 3(2): 165-169;
Stevenson et al., -Human Adenovirus Serotypes 3 and 5 Bind to Two Different
Cellular Receptors via the Fiber Head Domain," J. Virology 69:2850-2857,
1995; Moiling, "Naked DNA for vaccine or therapy," J. Mol. Med., 1997,
75(4):242-246; Yang et al. , "Specific Double-stranded RNA Interference in
99
CA 02596588 2013-08-13
Undifferentiated mouse Embryonic Stem Cells," Molecular and Cellular Biology,
2001, 21:7807-7816; Abdallah et al. -Non-viral gene transfer: applications in
developmental biology and gene therapy-, Biology of the Cell, 1995, 85(1):1-7.
Pharmaceutical formulations, dosages and routes of administration for nucleic
acids
are generally disclosed, for example, in Feigner et al., supra.
The present invention envisions treating a disease, for example, a
neurodegenerative disease, in a mammal by the administration of an agent,
e.g., a
nucleic acid composition, an expression vector, or a viral particle of the
invention.
Administration of the therapeutic agents in accordance with the present
invention
may be continuous or intermittent, depending, for example, upon the
recipient's
physiological condition, whether the purpose of the administration is
therapeutic or
prophylactic, and other factors known to skilled practitioners. The
administration of
the agents of the invention may be essentially continuous over a preselected
period
of time or may be in a series of spaced doses. Both local and systemic
administration is contemplated.
One or more suitable unit dosage forms having the therapeutic agent(s) of
the invention, which, as discussed below, may optionally be formulated for
sustained release (for example using microencapsulation, see WO 94/07529, and
U.S. Patent No. 4,962,091), can be administered by a variety of routes
including
parenteral, including by intravenous and intramuscular routes, as well as by
direct
injection into the diseased tissue. For example, the therapeutic agent may be
directly injected into the brain. Alternatively the therapeutic agent may be
introduced intrathecally for brain and spinal cord conditions. In another
example,
the therapeutic agent may be introduced intramuscularly for viruses that
traffic back
to affected neurons from muscle, such as AAV, lentivirus and adenovirus. The
formulations may, where appropriate, be conveniently presented in discrete
unit
dosage forms and may be prepared by any of the methods well known to pharmacy.
Such methods may include the step of bringing into association the therapeutic
agent with liquid carriers, solid matrices, semi-solid carriers, finely
divided solid
carriers or combinations thereof, and then, if necessary, introducing or
shaping the
product into the desired delivery system.
When the therapeutic agents of the invention are prepared for
administration, they may be combined with a pharmaceutically acceptable
100
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
carrier, diluent or excipient to form a pharmaceutical formulation, or unit
dosage
form. The total active ingredients in such formulations include from 0.1 to
99.9% by weight of the formulation. A "pharmaceutically acceptable" is a
carrier, diluent, excipient, and/or salt that is compatible with the other
ingredients of the formulation, and not deleterious to the recipient thereof.
The
active ingredient for administration may be present as a powder or as
granules;
as a solution, a suspension or an emulsion.
Pharmaceutical formulations containing the therapeutic agents of the
invention can be prepared by procedures known in the art using well known and
readily available ingredients. The therapeutic agents of the invention can
also be
formulated as solutions appropriate for parenteral administration, for
instance by
intramuscular, subcutaneous or intravenous routes.
The pharmaceutical formulations of the therapeutic agents of the
invention can also take the form of an aqueous or anhydrous solution or
dispersion, or alternatively the form of an emulsion or suspension.
Thus, the therapeutic agent may be formulated for parenteral
administration (e.g., by injection, for example, bolus injection or continuous
infusion) and may be presented in unit dose form in ampules, pre-filled
syringes,
small volume infusion containers or in multi-dose containers with an added
preservative. The active ingredients may take such forms as suspensions,
solutions, or emulsions in oily or aqueous vehicles, and may contain
formulatory
agents. such as suspending, stabilizing and/or dispersing agents.
Alternatively,
the active ingredients may be in powder form, obtained by aseptic isolation of
sterile solid or by lyophilization from solution, for constitution with a
suitable
vehicle, e.g., sterile, pyrogen-free water, before use.
It will be appreciated that the unit content of active ingredient or
ingredients contained in an individual aerosol dose of each dosage form need
not
in itself constitute an effective amount for treating the particular
indication or
disease since the necessary effective amount can be reached by administration
of
a plurality of dosage units. Moreover, the effective amount may be achieved
101
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
using less than the dose in the dosage form, either individually, or in a
series of
administrations.
The pharmaceutical formulations of the present invention may include, as
optional ingredients, pharmaceutically acceptable carriers, diluents,
solubilizing
or emulsifying agents, and salts of the type that are well-known in the art.
Specific non-limiting examples of the carriers and/or diluents that are useful
in
the pharmaceutical formulations of the present invention include water and
physiologically acceptable buffered saline solutions such as phosphate
buffered
saline solutions pH 7.0-8Ø saline solutions and water.
The invention willnow be illustrated by the following non-limiting
Example.
Example 1
siRNA-Mediated Silencing of Genes Using Viral Vectors
In this Example, it is shown that genes can be silenced in an allele-
specific manner. It is also demonstrated that viral-mediated delivery of siRNA
can specifically reduce expression of targeted genes in various cell types,
both in
vitro and in vivo. This strategy was then applied to reduce expression of a
neurotoxic polyglutamine disease protein. The ability of viral vectors to
transduce cells efficiently in vivo, coupled with the efficacy of virally
expressed
siRNA shown here, extends the application of siRNA to viral-based therapies
and in vivo targeting experiments that aim to define the function of specific
genes.
Experimental Protocols
Generation of the expression cassettes and viral vectors. The
modified CMV (mCMV) promoter was made by PCR amplification of CMV by
primers
5'-AAGGTACCAGATCTTAGTTATTAATAGTAATCAATTACGG-3 (SEQ
ID NO:1) and =
102
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
5'-GAATCGATGCATGCCTCGAGACGGTTCACTAAACCAGCTCTGC-3'
(SEQ ID NO:2) with peGFPN1 plasmid (purchased from Clontech, Inc) as
template. The mCMV product was cloned into the Kpn/ and Cla/ sites of the
adenoviral shuttle vector pAd5KnpA, and was named pmCMVknpA. To
construct the minimal polyA cassette, the oligonucleotides, 5'-
CTAGAACTAGTAATAAAGGATCCTTTATTTTCATTGGATCCGTGTGTT
GGTTTTTTGTGTGCGGCCGCG-3' (SEQ ID NO:3) and 5'-
TCGACGCGGCCGCACACAAAAAACCAACACACGGATCC
AATGAAAATAAAGGATCCTTTATTACTAGTT-3' (SEQ ID NO:4), were
used. The oligonucleotides contain Spe/ and Sal/ sites at the 5' and 3' ends,
respectively. The synthesized polyA cassette was ligated into Spe/, Sal/
digested
pmCMVKnpA. The resultant shuttle plasmid, pmCMVmpA was used for
construction of head-to-head 21bp hairpins of eGFP (bp 418 to 438), human p-
glucuronidase (bp 649 to 669), mouse P-glucuronidase (bp 646 to 666) or E.
coil
f3-galactosidase (bp 1152-1172). The eGFP hairpins were also cloned into the
Ad shuttle plasmid containing the commercially available CMV promoter and
polyA cassette from SV40 large T antigen (pCMVsiGFPx). Shuttle plasmids
were co-transfected into REK293 cells along with the adenovirus backbones for
generation of full-length Ad genomes. Viruses were harvested 6-10 days after
transfection and amplified and purified as described (Anderson, R.D., et al.,
Gene Ther. 7:1034-1038 (2000)).
Northern blotting. Total RNA was isolated from HEK293 cells
transfected by plasmids or infected by adenoviruses using TRIZOL8Reagent
(InvitrogenTM Life Technologies, Carlsbad, CA) according to the manufacturer's
instruction. RNAs (30n) were separated by electrophoresis on 15% (wt/vol)
polyacrylamide-urea gels to detect transcripts, or on 1% agaro se-formaldehyde
gel for target mRNAs analysis. RNAs were transferred by electroblotting onto
hybond N+ membrane (Amersham Pharmacia Biotech). Blots were probed with
32P-labeled sense (5'-CACAAGCTGGAGTACAACTAC-3' (SEQ ID NO:5)) or
antisense (5'-GTACTTGTACTCCAGCTTTGTG-3' (SEQ ID NO:6))
oligonucleotides at 37 C for 3h for evaluation of siRNA transcripts, or probed
103
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
for target mRNAs at 42 C overnight. Blots were washed using standard
methods and exposed to film overnight. In vitro studies were performed in
triplicate with a minimum of two repeats.
In vivo studies and tissue analyses. All animal procedures were
approved by the University of Iowa Committee on the Care and Use of Animals.
Mice were injected into the tail vein (n = 10 per group) or into the brain (n
= 6
per group) as described previously (Stein, C.S., et al., Virol. 73:3424-3429
(1999)) with the virus doses indicated. Animals were sacrificed at the noted
times and tissues harvested and sections or tissue lysates evaluated for 3-
glucuronidase expression, eGFP fluorescence, or p-galactosidase activity using
established methods (Xia, H. et al., Nat. Biotechnol. 19:640-644 (2001)).
Total
RNA was harvested from transduced liver using the methods described above.
Cell Lines. PC12 tet off cell lines (Clontech Inc., Palo Alto, CA) were
stably transfected with a tetracycline regulatable plasmid into which was
cloned
GFPQ19 or GFPQ80 (Chai, Y. et al., J. Neurosci. 19:10338-10347 (1999)). For
GFP-Q80, clones were selected and clone 29 chosen for regulatable properties
and inclusion formation. For GFP-Q19 clone 15 was selected for uniformity of
GFP expression following gene expression induction. In all studies 1.5 pgiml
dox was used to repress transcription. All experiments were done in triplicate
and were repeated 4 times.
Results and Discussion
To accomplish intracellular expression of siRNA, a 21-bp hairpin
representing sequences directed against eGFP was constructed, and its ability
to
reduce target gene expression in mammalian cells using two distinct constructs
was tested. Initially, the siRNA hairpin targeted against eGFP was placed
under
the control of the CMV promoter and contained a full-length SV-40
polyadenylation (polyA) cassette (pCMVsiGFPx). In the second construct, the
hairpin was juxtaposed almost immediate to the CMV transcription start site
(within 6 bp) and was followed by a synthetic, minimal polyA cassette (Fig.
1A,
pmCMVsiGFPmpA) (Experimental Protocols), because we reasoned that
104
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
functional siRNA would require minimal to no overhangs (Caplan, N.J., et al.,
Proc. NatL Acad. Sci. U S. A. 98:9742-9747 (2001); Nykanen, A., et al., Cell
107:309-321 (2001)). Co-transfection of pmCMVsiGFPmpA with pEGFPN1
(Clontech Inc) into 11E1(293 cells markedly reduced eGFP fluorescence (Fig.
1C). pmCMVsiGFPmpA transfection led to the production of an approximately
63 bp RNA specific for eGFP (Fig. 1D), consistent with the predicted size of
the
siGFP hairpin-containing transcript. Reduction of target mRNA and eGFP
protein expression was noted in pmCMVsiGFPmpA-transfected cells only (Fig.
1E, F). In contrast, eGFP RNA, protein and fluorescence levels remained
unchanged in cells transfected with pEGFPN1 and pCMVsiGFPx (Fig. 1E, G),
pEGFPN1 and pCMVsiBglucmpA (Fig. 1E, F, H), or pEGFPN1 and
pCMVsiBgalmpA, the latter expressing siRNA against E. coli13-galactosidase
(Fig. 1E). These data demonstrate the specificity of the expressed siRNAs.
Constructs identical to pmCMVsiGFPmpA except that a spacer of 9, 12
and 21 nucleotides was present between the transcription start site and the 21
bp
hairpin were also tested. In each case, there was no silencing of eGFP
expression (data not shown). Together the results indicate that the spacing of
the
hairpin immediate to the promoter can be important for functional target
reduction, a fact supported by recent studies in MCF-7 cells (Brummelkamp,
T.R., et al., Science 296:550-553 (2002)).
Recombinant adenoviruses were generated from the siGFP
(pmCMVsiGFPmpA) and sipgluc (pmCMVsipglucmpA) plasmids (Xia, H., et
al., Nat. BiotechnoL 19:640-644 (2001); Anderson, R.D., et al., Gene Ther.
7:1034-1038 (2000)) to test the hypothesis that virally expressed siRNA allows
for diminished gene expression of endogenous targets in vitro and in vivo.
HeLa
cells are of human origin and contain moderate levels of the soluble lysosomal
enzyme P-glucuronidase. Infection of HeLa cells with viruses expressing
sif3gluc caused a specific reduction in human13-glucuronidase mRNA (Fig. II)
leading to a 60% decrease in p-glucuronidase activity relative to siGFP or
control cells (Fig 1J). Optimization of siRNA sequences using methods to
refine
target mRNA accessible sequences (Lee, N.S., et al., Nat. BiotechnoL 19:500-
105
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
505 (2002)) could improve further the diminution of B-glucuronidase transcript
and protein levels.
The results in Fig. 1 are consistent with earlier work demonstrating the
ability of synthetic 21-bp double stranded RNAs to reduce expression of target
genes in mammalian cells following transfection, with the important difference
that in the present studies the siRNA was synthesized intracellularly from
readily
available promoter constructs. The data support the utility of regulatable,
tissue
or cell-specific promoters for expression of siRNA when suitably modified for
close juxtaposition of the hairpin to the transcriptional start site and
inclusion.of
the minimal polyA sequence containing cassette (see, Methods above).
To evaluate the ability of virally expressed siRNA to diminish target-
gene expression in adult mouse tissues in vivo, transgenic mice expressing
eGFP
(Okabe, M. et al., FEBS Lett. 407:313-319 (1997)) were injected into the
striatal
region of the brain with 1 x 107 infectious units of recombinant adenovirus
vectors expressing siGFP or control sipgluc. Viruses also contained a dsRed
expression cassette in a distant region of the virus for unequivocal
localization of
the injection site. Brain sections evaluated 5 days after injection by
fluorescence
(Fig. 2A) or western blot assay (Fig. 2B) demonstrated reduced eGFP
expression. Decreased eGFP expression was confined to the injected
hemisphere (Fig. 2B). The in vivo reduction is promising, particularly since
transgenically expressed eGFP is a stable protein, making complete reduction
in
this short time frame unlikely. Moreover, evaluation of eGFP levels was done 5
days after injection, when inflammatory changes induced by the adenovirus
vector likely enhance transgenic eGFP expression from the CMV enhancer
(Ooboshi, H., et al., Arterioscler. Thromb. Vasc. Biol. 17:1786-1792 (1997)).
It was next tested whether virus mediated siRNA could decrease
expression from endogenous alleles in vivo. Its ability to decrease p-
glucuronidase activity in the murine liver, where endogenous levels of this
relatively stable protein are high, was evaluated. Mice were injected via the
tail
vein with a construct expressing murine-specific sipgluc (AdsiMuPgluc), or the
control viruses AdsiPgluc (specific for human P-glucuronidase) or Adsipgal.
106
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Adenoviruses injected into the tail vein transduced hepatocytes as shown
previously (Stein, C.S., et aL, J ViroL 73:3424-3429 (1999)). Liver tissue
harvested 3 days later showed specific reduction of target B-glucuronidase RNA
in AdsiMagluc treated mice only (Fig. 2C). Fluorometric enzyme assay of
liver lysates confirmed these results, with a 12% decrease in activity from
liver
harvested from AdsiMuPgluc injected mice relative to AdsiPgal and Adsipgluc
treated ones (p<0.01; n=10). Interestingly, sequence differences between the
murine and human siRNA constructs are limited, with 14 of 21 bp being
identical. These results confirm the specificity of virus mediated siRNA, and
indicate that allele-specific applications are possible. Together, the data
are the
first to demonstrate the utility of siRNA to diminish target gene expression
in
brain and liver tissue in vivo, and establish that allele-specific silencing
in vivo is
possible with siRNA.
One powerful therapeutic application of siRNA is to reduce expression of
toxic gene products in dominantly inherited diseases such as the polyglutamine
(polyQ) neurodegenerative disorders (Margolis, R.L. & Ross, C.A. Trends MoL
Med. 7:479-482 (2001)). The molecular basis of polyQ diseases is a novel toxic
property conferred upon the mutant protein by polyQ expansion. This toxic
property is associated with disease protein aggregation. The ability of
virally
expressed siRNA to diminish expanded polyQ protein expression in neural PC-
12 clonal cell lines was evaluated. Lines were developed that express
tetracycline-repressible eGFP-polyglutamine fusion proteins with normal or
expanded glutamine of 19 (eGFP-Q19) and 80 (eGFP-Q80) repeats, respectively.
Differentiated, eGFP-Q19-expressing PC12 neural cells infected with
recombinant adenovirus expressing siGFP demonstrated a specific and dose-
dependent decrease in eGFP-Q19 fluorescence (Fig. 3A, C) and protein levels
(Fig. 3B). Application of Adsikluc as a control had no effect (Fig. 3A-C).
Quantitative image analysis of eGFP fluorescence demonstrated that siGFP
reduced GFPQ19 expression by greater than 96% and 93% for 100 and 50 MOI
respectively, relative to control siRNA (Fig. 3C). The multiplicity of
infection
(MOI) of 100 required to achieve maximal inhibition of eGFP-Q19 expression
107
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
results largely from the inability of PC12 cells to be infected by adenovirus-
based vectors. This barrier can be overcome using AAV- or lentivirus-based
expression systems (Davidson, B.L., et al., Proc. Natl. Acad. Sc!. U. S. A.
97:3428-3432 (2000); Brooks, A.I., et al, Proc. Natl. Acad. Sc!. U S. A.
99:6216-6221 (2002)).
To test the impact of siRNA on the size and number of aggregates
formed in eGFP-Q80 expressing cells, differentiated PC-12/eGFP-Q80 neural
cells were infected with AdsiGFP or Adsipgluc 3 days after doxycycline
removal to induce GFP-Q80 expression. Cells were evaluated 3 days later. In
mock-infected control cells (Fig. 4A), aggregates were very large 6 days after
induction as reported by others (Chai, Y., et al., J. Neurosci. 19:10338-10347
(1999; Moulder, K.L., et al., J. Neurosci. 19:705-715 (1999)). Large
aggregates
were also seen in cells infected with Adsipgluc (Fig. 4B), AdsiGFPx, (Fig. 4C,
siRNA expressed from the normal CMV promoter and containing the SV40
large T antigen polyadenylation cassette), or Adsif3gal (Fig. 4D). In
contrast,
polyQ aggregate formation was significantly reduced in AdsiGFP infected cells
(Fig. 4E), with fewer and smaller inclusions and more diffuse eGFP
fluorescence. AdsiGFP-mediated reduction in aggregated and monomeric GFP-
Q80 was verified by Western blot analysis (Fig. 4F), and quantitation of
cellular
fluorescence (Fig. 4G). AdsiGFP caused a dramatic and specific, dose-
dependent reduction in eGFP-Q80 expression (Fig. 4F, G).
It was found that transcripts expressed from the modified CMV promoter
and containing the minimal polyA cassette were capable of reducing gene
expression in both plasmid and viral vector systems (Figs. 1-4). The placement
of the hairpin immediate to the transcription start site and use of the
minimal
polyadenylation cassette was of critical importance. In plants and Drosophila,
RNA interference is initiated by the ATP-dependent, processive cleavage of
long
dsRNA into 21-25 bp double-stranded siRNA, followed by incorporation of
siRNA into a RNA-induced silencing complex that recognizes and cleaves the
target (Nykanen, A., et al., Cell 107:309-321 (2001); Zamore, PD., et al.,
Cell
101:25-33 (2000); Bernstein, E., et al., Nature 409:363-366 (2001); Hamilton,
108
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
A.J. & Baulcombe, D.C. Science 286:950-952 (1999); Hammond, S.M. et al.,
Nature 404:293-296 (2000)). Viral vectors expressing siRNA are useful in
determining if similar mechanisms are involved in target RNA cleavage in
mammalian cells in vivo.
In summary, these data demonstrate that siRNA expressed from viral
vectors in vitro and in vivo specifically reduce expression of stably
expressed
plasmias in cells, and endogenous transgenic targets in mice. Importantly, the
application of virally expressed siRNA to various target alleles in different
cells
and tissues in vitro and in vivo was demonstrated. Finally, the results show
that
it is possible to reduce polyglutamine protein levels in neurons, which is the
cause of at least nine inherited neurodegenerative diseases, with a
corresponding
decrease in disease protein aggregation. The ability of viral vectors based on
adeno-associated virus (Davidson, B.L., et al., Proc. Natl. Acad. Sci. U. S.
A.
97:3428-3432 (2000)) and lentiviruses (Brooks, A.I., etal., Proc. Natl. Acad.
Sci. U. S. A. 99:6216-6221 (2002)) to efficiently transduce cells in the CNS,
coupled with the effectiveness of virally-expressed siRNA demonstrated here,
extends the application of siRNA to viral-based therapies and to basic
research,
including inhibiting novel ESTs to define gene function.
Example 2
siRNA Suppression of Genes Involved in MJD/SCA3 and FTDP-17
Modulation of gene expression by endogenous, noncoding RNAs is
increasingly appreciated to play a role in eukaryotic development, maintenance
of chromatin structure and genomic integrity. Recently, techniques have been
developed to trigger RNA interference (RNAi) against specific targets in
mammalian cells by introducing exogenously produced or intracellularly
expressed siRNAs. These methods have proven to be quick, inexpensive and
effective for knockdown experiments in vitro and in vivo. The ability to
accomplish selective gene silencing has led to the hypothesis that siRNAs
might
be employed to suppress gene expression for therapeutic benefit.
109
CA 02596588 2013-08-13
Dominantly inherited diseases are ideal candidates for siRNA-based
therapy. To explore the utility of siRNA in inherited human disorders, the
inventors employed cellular models to test whether we could target mutant
alleles causing two classes of dominantly inherited, untreatable
neurodegenerative diseases: polyglutamine (polyQ) neurodegeneration in
MJD/SCA3 and frontotemporal dementia with parkinsonism linked to
chromosome 17 (FTDP-17). The polyQ neurodegenerative disorders consist of
at least nine diseases caused by CAG repeat expansions that encode polyQ in
the
disease protein. PolyQ expansion confers a dominant toxic property on the
mutant protein that is associated with aberrant accumulation of the disease
protein in neurons. In FTDP-17, Tau mutations lead to the formation of
neurofibrillary tangles accompanied by neuronal dysfunction and degeneration.
The precise mechanisms by which these mutant proteins cause neuronal injury
are unknown, but considerable evidence suggests that the abnormal proteins
themselves initiate the pathogenic process. Accordingly, eliminating
expression
of the mutant protein by siRNA or other means should, in principle, slow or
even
prevent disease. However, because many dominant disease genes may also
encode essential proteins, the inventors sought to develop siRNA-mediated
approaches that selectively inactivate mutant alleles while allowing continued
expression of the wild type protein.
Methods
siRNA Synthesis. In vitro siRNA synthesis was previously described
(Donze and Picard, 2002). Reactions were performed with desalted DNA
oligonucleotides (IDT Coralville, IA) and the AmpliScribeTM T7 High Yield
Transcription Kit (Epicentre Madison, WI). Yield was determined by absorbance
at 260nm. Annealed siRNAs were assessed for double stranded character by
agarose gel (1% w/v) electrophoresis and ethidium bromide staining. Note that
for all siRNAs generated in this study the most 5 nucleotide in the targeted
cDNA sequence is referred to as position 1 and each subsequent nucleotide is
numbered in ascending order from 5' to 3'.
110
CA 02596588 2013-08-13
Plasmid Construction. The human ataxin-3 cDNA was expanded to 166
CAG's by PCR (Laccone 1999). PCR products were digested at BamHI and
KpnI sites introduced during PCR and ligated into BglII and KpnI sites of
pEGFP-N1 (Clontech) resulting in full-length expanded ataxin-3 fused to the N-
teiminus of EGFP. Untagged Ataxin-3-Q166 was constructed by ligating a
PpuMI-NotI ataxin-3 fragment (3' of the CAG repeat) into Ataxin-3-Q166-GFP
cut with PpuMI and NotI to remove EGFP and replace the normal ataxin-3 stop
codon. Ataxin-3-Q28-GFP was generated as above from pcDNA3.1-ataxin-3-
Q28. Constructs were sequence verified to ensure that no PCR mutations were
present. Expression was verified by Western blot with anti-ataxin-3 (Paulson
1997) and GFP antibodies (MBL). The construct encoding a flag tagged, 352
residue tau isoform was previously described (Leger 1994). The pEGFP-tau
plasmid was constructed by ligating the human tau cDNA into pEGFP-C2
(Clontech) and encodes tau with EGFP fused to the amino terminus. The
pEGFP-tauV337M plasmid was derived using site-directed mutagenesis
(QuikChange Kit, Stratagene) of the pEFGP-tau plasmid.
Cell Culture and Transfections. Culture of Cos-7 and HeLa cells has
been described (Chai 1999b). Transfections with plasmids and siRNA were
performed using Lipofectamine Plus (LifeTechnologies) according to the
manufacturer's instructions. For ataxin-3 expression 1.5 ?..ig plasmid was
transfected with 5[1g in vitro synthesized siRNAs. For Tau experiments lptg
plasmid was transfected with 2.514 siRNA. For expression of hairpin siRNA
from the phU6 constructs, 14g ataxin-3 expression plasmid was transfected with
Llug phU6-siClOi or phU6-siG101. Cos-7 cells infected with siRNA-expressing
adenovirus were transfected with 0.5ug of each expression plasmid.
Stably transfected, doxycycline-inducible cell lines were generated in a
subclone of PC12 cells, PC6-3, because of its strong neural differentiation
properties (Pittman, 1993). A PC6-3 clone stably expressing Tet repressor
plasmid (provided by S. Strack, Univ. of Iowa), was transfected with
pcDNA5/TO-ataxin-3(Q28) or pcDNA5/TO-ataxin-3(Q166) (Invitrogen). After
selection in hygromycin, clones were characterized by Western blot and
111
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
immunofluorescence. Two clones, PC6-3-ataxin3(Q28)#33 and PC6-3-
ataxin3(Q166)#41, were chosen because of their tightly inducible, robust
expression of ataxin-3.
siRNA Plasmid and Viral Production. Plasmids expressing ataxin-3
shRNAs were generated by insertion of head-to-head 21 bp hairpins in phU6 that
corresponded to siC10 and siG10 (Xia 2002).
Recombinant adenovirus expressing ataxin-3 specific shRNA were
generated from phU6-ClOi (encoding C10 hairpin siRNA) and phU6si-GlOi
(encoding G10 hairpin siRNA) as previously described (Xia 2002, Anderson
2000).
Western Blotting and Immunofluorescence. Cos-7 cells expressing
ataxin-3 were harvested 24-48 hours after transfection (Chai 1999b). Stably
transfected, inducible cell lines were harvested 72 hours after infection with
adenovirus. Lysates were assessed for ataxin-3 expression by Western blot
analysis as previously described (Chai 1999b), using polyclonal rabbit anti-
ataxin-3 antisera at a 1:15,000 dilution or 1C2 antibody specific for expanded
polyQ tracts (Trottier 1995) at a 1:2,500 dilution. Cells expressing Tau were
harvested 24 hours after transfection. Protein was detected with an affinity
purified polyclonal antibody to a human tau peptide (residues 12-24) at a
1:500
dilution. Anti-alpha-tubulin mouse monoclonal antibody (Sigma St. Louis, MO)
was used at a 1:10,000 dilution and GAPDH mouse monoclonal antibody
(Sigma St. Louis, MO) was used at a 1:1,000 dilution.
Immunofluorescence for ataxin-3 (Chai 1999b) was carried out using
1C2 antibody (Chemicon International Temecula, CA) at 1:1,000 dilution 48
hours after transfection. Flag-tagged, wild type tau was detected using mouse
monoclonal antibody (Sigma St. Louis, MO) at 1:1,000 dilution 24 hours after
transfection. Both proteins were detected with rhodamine conjugated secondary
antibody at a 1:1,000 dilution.
Fluorescent Imaging and Quantification. Fixed samples were observed
with a Zeiss Axioplan fluorescence microscope. Digital images were collected
on separate red, green and blue fluorescence channels using a SPOT digital
112
CA 02596588 2013-08-13
camera. Images were assembled and overlaid using Adobe Photoshop 6Ø
Live cell images were collected with a Kodak MDS 290 digital camera mounted
to an Olympus (Tokyo, Japan) CK40 inverted microscope. Fluorescence was
quantitated by collecting 3 non-overlapping images per well at low power
(10x).
Pixel count and intensity for each image was determined using Bioquant Nova
Prime software (BIOQUANT Image Analysis Corporation). Background was
subtracted by quantitation of images from cells of equivalent density under
identical fluorescent illumination. Mock transfected cells were used to assess
background fluorescence for all experiments and were stained with appropriate
primary and secondary antibodies for simulated heterozygous experiments.
Average fluorescence is reported from 2 to 3 independent experiments. The
mean of 2 to 3 independent experiments for cells transfected with the
indicated
expression plasmid and siMiss was set at one. Errors bars depict variation
between experiments as standard error of the mean. In simulated heterozygous
experiments, a blinded observer scored cells with a positive fluorescence
signal
for expression of wild type, mutant or both proteins in random fields at high
power for two independent experiments. More than 100 cells were scored in
each experiment and reported as number of cells with co-expression divided by
total number of transfected cells.
Results
Direct Silencing of Expanded Alleles. The inventors first attempted
suppression of mutant polyQ expression using siRNA complementary to the CAG
repeat and immediately adjacent sequences to determine if the expanded repeat
differentially altered the susceptibility of the mutant allele to siRNA
inhibition
(Figure 6). HeLa cells were transfected with various in vitro synthesized
siRNAs
(Danze and Picard, 2002) and plasmids encoding normal or expanded polyQ fused
to red or green fluorescent protein, respectively (Q19-RFP and Q80-GFP) (Fig.
5a).
In negative control cells transfected with Q80-GFP, Q19-RFP and a mistargeted
siRNA (siMiss), Q80-GFP formed aggregates (Onodera et al., -Oligomerization of
Expanded-Polyglutamine Domain Fluorescent Fusion Prteins in Cultured
Mammalian Cells, Biochem and Biophys Res Comm., (1997) 238:599-605) which
recruited the normally diffuse Q19-RFP (Fig 5a). When the
113
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
experiment was performed with siRNA targeted to GFP as a positive control for
allele specific silencing, Q80-GFP expression was nearly abolished while Q19-
RFP continued to be expressed as a diffusely distributed protein (Fig. 5a).
When
Q19-RFP and Q80-GFP were co-transfected with siRNA directly targeting the
CAG repeat (siCAG) (Fig. 5a) or an immediately adjacent 5' region (data not
shown), expression of both proteins was efficiently suppressed.
To test whether siRNA could selectively silence expression of a full-
length polyQ disease protein, siRNAs were designed that target the transcript
encoding atmdn-3, the disease protein in Machado-Joseph Disease, also known
as Spinocerebellar Ataxia Type 3 (MJD/SCA3) (Zoghbi 2000) (Fig. 5b). In
transfected cells, siRNA directed against three separate regions -- the CAG
repeat, a distant 5' site, or a site just 5' to the CAG repeat (siN'CAG) --
resulted
in efficient, but not allele-specific, suppression of ataxin-3 containing
normal or
expanded repeats (data not shown). Consistent with an earlier study using
longer
dsRNA (Caplen 2002) the present results show that expanded CAG repeats and
adjacent sequences, while accessible to RNAi, may not be preferential targets
for
silencing.
Allele-specific Silencing of the Mutant PolyQ Gene in MMD/SCA3. In
further efforts to selectively inactivate the mutant allele the inventors took
advantage of a SNP in the MID 1 gene, a G to C transition immediately 3' to
the
CAG repeat (G987C) (Fig. 5b). This SNP is in linkage disequilibrium with the
disease-causing expansion, in most families segregating perfectly with the
disease allele. Worldwide, 70% of disease chromosomes carry the C variant
(Gaspar 2001). The present ataxin-3 expression cassettes, which were generated
from patients (Paulson 1997), contain the C variant in all expanded ataxin-3
constructs and the G variant in all normal ataxin-3 constructs. To test
whether
this G-C mismatch could be distinguished by siRNA, siRNAs were designed that
included the last 2 CAG triplets of the repeat followed by the C variant at
position 7 (siC7) (Figure 6 and Fig. 5b), resulting in a perfect match only
for
expanded alleles. Despite the presence of a single mismatch to the wild type
allele, siC7 strongly inhibited expression of both alleles (Fig. 5c,d). A
second G-
114
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
C mismatch was then introduced at position 8 such that the siRNA contained
two mismatches as compared to wild type and only one mismatch as compared
to mutant alleles (siC7/8). The siC7/8 siRNA effectively suppressed mutant
ataxin-3 expression, reducing total fluorescence to an average 8.6% of control
levels, with only modest effects on wild type ataxin-3 (average 75.2% of
control). siC7/8 also nearly eliminated the accumulation of aggregated mutant
ataxin-3, a pathological hallmark of disease (Chan 2000) (Fig. 5d).
To optimize differential suppression-, siRNAs were designed containing a
more centrally placed mismatch. Because the center of the antisense strand
directs cleavage of target mRNA in the RNA Induced Silencing Complex
(RISC) complex (Elbashir 2001c), it was reasoned that central mismatches might
more efficiently discriminate between wild type and mutant alleles. siRNAs
were designed that place the C of the SNP at position 10 (siC10), preceded by
the final three triplets in the CAG repeat (Figure 6 and Fig. 5b). In
transfected
cells, siC10 caused allele-specific suppression of the mutant protein (Fig.
5c,d).
Fluorescence from expanded Atx-3-Q166-GFP was dramatically reduced (7.4%
of control levels), while fluorescence of Atx-3-Q28-GFP showed minimal
change (93.6% of control; Fig. 5c,d). Conversely, siRNA engineered to suppress
only the wild type allele (siG10) inhibited wild type expression with little
effect
on expression of the mutant allele (Fig. 5c,d). Inclusion of three CAG repeats
at
the 5' end of the siRNA did not inhibit expression of Q19-GFP, Q80-GFP, or
full-length ataxin-1-Q30 proteins that are each encoded by CAG repeat
containing transcripts (Fig. 7).
In the disease state, normal and mutant alleles are simultaneously
expressed. In plants and worms, activation of RNAi against one transcript
results
in the spread of silencing signals to other targets due to RNA-dependent RNA
polymerase (RDRP) activity primed by the introduced RNA (Fire 1998, Tang
2003). Although spreading has not been detected in mammalian cells and RDRP
activity is not required for effective siRNA inhibition (Chiu 2002, Schwarz
2002, Martinez 2002), most studies have used cell-free systems in which a
mammalian RDRP could have been inactivated. If triggering the mammalian
115
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
RNAi pathway against one allele activates cellular mechanisms that also
silence
the other allele, then siRNA applications might be limited to non-essential
genes.
To test this possibility, the heterozygous state was simulated by co-
transfecting
Atx-3-Q28-GFP and Atx-3-Q166 and analyzing suppression by Western blot. As
shown in Fig. 5e each siRNA retained the specificity observed in separate
transfections: siC7 inhibited both alleles, siG10 inhibited only the wild type
allele, and siC7/8 and siC10 inhibited only mutant allele expression.
Effective siRNA therapy for late onset disease will likely require
sustained intracellular expression of the siRNA. Accordingly, the present
experiments were extended to two intracellular methods of siRNA production
and delivery: expression plasmids and recombinant virus (Brummelkamp 2002,
Xia 2002). Plasmids were constructed expressing siG10 or siC10 siRNA from
the human U6 promoter as a hairpin transcript that is processed
intracellularly to
produce siRNA (Brummelkamp 2002, Xia 2002). When co-transfected with
ataxin-3-GFP expression plasmids, phU6-GlOi and phU6-C10i-siRNA plasmids
specifically suppressed wild type or mutant ataxin-3 expression, respectively
(Fig. 5f).
This result encouraged the inventors to engineer recombinant adenoviral
vectors expressing allele-specific siRNA (Xia 2002). Viral-mediated
suppression was tested in Cos-7 cells transiently transfected with both A-tx-3-
Q28-GFP and Atx-3-Q166 to simulate the heterozygous state. Cos-7 cells
infected with adenovirus encoding siG10, siC10 or negative control siRNA (Ad-
010i, Ad-C1 0i, and Ad-LacZi respectively) exhibited allele-specific silencing
of
wild type ataxin-3 expression with Ad-GlOi and of mutant ataxin-3 with Ad-
ClOi (Fig 8a,b,c). Quantitation of fluorescence (Fig. 8b) showed that Ad-GlOi
reduced wild type ataxin-3 to 5.4% of control levels while mutant ataxin-3
expression remained unchanged. Conversely, Ad-ClOi reduced mutant ataxin-3
fluorescence levels to 8.8% of control and retained 97.4% of wild type signal.
These results were confirmed by Western blot where it was further observed
that
Ad-GlOi virus decreased endogenous (primate) ataxin-3 while Ad-ClOi did not
(Fig 8c).
116
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Viral mediated suppression was also assessed in differentiated PC12
neural cell lines that inducibly express normal (Q28) or expanded (Q166)
mutant
ataxin-3. Following infection with Ad-G10i, Ad-C10i, or Ad-LacZi,
differentiated neural cells were placed in doxycycline for three days to
induce
maximal expression of ataxin-3. Western blot analysis of cell lysates
confirmed
that the Ad-GlOi virus suppressed only wild type ataxin-3, Ad-ClOi virus
suppressed only mutant ataxin-3, and Ad-LacZi had no effect on either normal
or
mutant ataxin-3 expression (Fig. 8d). Thus, siRNA retains its efficacy and
selectivity across different modes of production and delivery to achieve
allele-
specific silencing of ataxin-3.
Allele-Specific Silencing of a Missense Tau Mutation. The preceding
results indicate that, for DNA repeat mutations in which the repeat itself
does not
present an effective target, an associated SNP can be exploited to achieve
allele-
specific silencing. To test whether siRNA works equally well to silence
disease-
causing mutations directly, the inventors targeted missense Tau mutations that
cause FTDP-17 (Poorkaj 1998, Hutton 1998). A series of 21-24 nt siRNAs were
generated in vitro against four missense FTDP-17 mutations: G272V, P301L,
V337M, and R406W (Figure 6 and Fig 9a). In each case the point mutation was
placed centrally, near the likely cleavage site in the RISC complex (position
9,
10 or 11) (Laccone 1999). A fifth siRNA designed to target a 5' sequence in
all
Tau transcripts was also tested. To screen for siRNA-mediated suppression, the
inventors co-transfected GFP fusions of mutant and wild type Tau isoforms
together with siRNA into Cos-7 cells. Of the five targeted sites, the
inventors
obtained robust suppression with siRNA corresponding to V337M (Figure 6 and
Fig. 9A) (Poorkaj 1998, Hutton 1998), and thus focused further analysis on
this
mutation. The V337M mutation is a G to A base change in the first position of
the codon (g-TG to ATG), and the corresponding V337M siRNA contains the A
missense change at position 9 (siA9). This intended V337M-specific siRNA
preferentially silenced the mutant allele but also caused significant
suppression
of wild type Tau (Fig. 9b,c).
117
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Based on the success of this approach with ataxin-3, the inventors
designed two additional siRNAs that contained the V337M (G to A) mutation at
position 9 as well as a second introduced G-C mismatch immediately 5' to the
mutation (siA9/C8) or three nucleotides 3' to the mutation (siA9/C12), such
that
the siRNA now contained two mismatches to the wild type but only one to the
mutant allele. This strategy resulted in further preferential inactivation of
the
mutant allele. One siRNA, siA9/C12, showed strong selectivity for the mutant
tau allele, reducing fluorescence to 12.7% of control levels without
detectable
loss of wild type Tau (Fig. 9b,c). Next, we simulated the heterozygous state
by
co-transfecting V337M-GFP and flag-tagged WT-Tau expression plasmids (Fig.
10). In co-transfected HeLa cells, siA9/C12 silenced the mutant allele (16.7%
of
control levels) with minimal alteration of wild type expression assessed by
fluorescence (Fig. 10a) and Western blot (Fig. 10b). In addition, siA9 and
siA9/C8 displayed better allele discrimination than we had observed in
separate
transfections, but continued to suppress both wild type and mutant tau
expression (Fig. 10a,b,c).
Discussion
Despite the rapidly growing siRNA literature, questions remain
concerning the design and application of siRNA both as a research tool and a
therapeutic strategy. The present study, demonstrating allele-specific
silencing of
dominant disease genes, sheds light on important aspects of both applications.
Because many disease genes encode essential proteins, development of
strategies to exclusively inactivate mutant alleles is important for the
general
application of siRNA to dominant diseases. The present results, for two
unrelated
disease genes demonstrate that in mammalian cells it is possible to silence a
single disease allele without activating pathways analogous to those found in
plants and worms that result in the spread of silencing signals (Fire 1998,
Tang
2003).
In summary, siRNA can be engineered to silence expression of disease
alleles differing from wild type alleles by as little as a single nucleotide.
This
118
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
approach can directly target mis sense mutations, as in frontotemporal
dementia,
or associated SNPs, as in MJD/SCA3. The present stepwise strategy for
optimizing allele-specific targeting extends the utility of siRNA to a wide
range
of dominant diseases in which the disease gene normally plays an important or
essential role. One such example is the polyglutamine disease, Huntington
disease (HD), in which normal HD protein levels are developmentally essential
(Nasir 1995). The availability of mouse models for many dominant disorders,
including MJD/SCA3 (Cemal 2002), HD (Lin 2001), and FTDP-17 (Tanemura
2002), allows for the in vivo testing of siRNA-based therapy for these and
other
human diseases.
Example 3
Therapy for DYT1 dystonia: Allele-specific silencing of mutant
TorsinA
DYT1 dystonia is the most common cause of primary generalized
dystonia. A dominantly inherited disorder, DYT1 usually presents in childhood
as focal dystonia that progresses to severe generalized disease. With one
possible
exception, all cases of DYT1 result from a common GAG deletion in TOR1A,
eliminating one of two adjacent glutamic acids near the C-terminus of the
protein TorsinA (TA). Although the precise cellular fimction of TA is unknown,
it seems clear that mutant TA (TAmut) acts through a dominant-negative or
dominant-toxic mechanism. The dominant nature of the genetic defect in DYT1
dystonia suggests that efforts to silence expression of TAmut should have
potential therapeutic benefit.
Several characteristics of DYT1 make it an ideal disease in which to
explore siRNA-mediated gene silencing as potential therapy. Of greatest
importance, the dominant nature of the disease suggests that a reduction in
mutant TA, whatever the precise pathogenic mechanism proves to be, will be
helpful. Moreover, the existence of a single common mutation that deletes a
full
three nucleotides suggests it may be feasible to design siRNA that will
specifically target the mutant allele and will be applicable to all affected
persons.
119
CA 02596588 2013-08-13
Finally, there is no effective therapy for DYT1, a relentless and disabling
disease. Thus, any therapeutic approach with promise needs to be explored.
Because TAwt may be an essential protein, however, it is critically important
that efforts be made to silence only the mutant allele.
In the studies reported here, the inventors explored the utility of siRNA
for DYT1. As outlined in the strategy in Figure 11, the inventors sought to
develop siRNA that would specifically eliminate production of protein from the
mutant allele. By exploiting the three base pair difference between wild type
and mutant alleles, the inventors successfully silenced expression of TAmut
-- without interfering with expression of the wild type protein (TAwt).
Methods
siRNA design and synthesis Small-interfering RNA duplexes were
synthesized in vitro according to a previously described protocol (Donze
2002),
-- using AmpliScribeT7 High Yield Transcription Kit (Epicentre Technologies)
and desalted DNA oligonucleotides (IDT). siRNAs were designed to target
different regions of human TA transcript: 1) an upstream sequence common to
both TAwt and TAmut (com-siRNA); 2) the area corresponding to the mutation
with either the wild type sequence (wt-siRNA) or the mutant sequence
-- positioned at three different places (mutA-siRNA, mutB-siRNA, mutC-siRNA);
and 3) a negative control siRNA containing an irrelevant sequence that does
not
target any region of TA (mis-siRNA). The design of the primers and targeted
sequences are shown schematically in Figure 12. After in vitro synthesis, the
double stranded structure of the resultant RNA was confirmed in 1.5 % agarose
-- gels and RNA concentration determined with a SmartSpectTM 3000 UV
Spectrophotometer (BioRad).
Plasmids pcDNA3 containing TAwt or TAmut cDNA were kindly
provided by Xandra Breakefield (Mass General Hospital, Boston, MA). This
construct was produced by cloning the entire coding sequences of human
-- TorsinA (1-332), both wild-type and mutant (GAG deleted), into the
mammalian
expression vector, pcDNA3 (Clontech, Palo Alto, CA). Using PCR based
120
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
strategies, an N-terminal hemagglutinin (HA) epitope tag was inserted into
both
constructs. pEGFP-C3-TAwt was kindly provided by Pullanipally Shashidharan
(Mt Sinai Medical School, NY). This construct was made by inserting the full-
length coding sequence of wild-type TorsinA into the EcoRI and BamHI
restriction sites of the vector pEGFP-C3 (Clontech). This resulted in a fusion
protein including eGFP, three "stuffer" amino acids and the 331 amino acids of
TorsinA. HA-tagged TAmut was inserted into the ApaI and Sall restriction sites
of pEGFP-C1 vector (Clontech), resulting in a GFP-HA-TAmut construct.
Cell culture and transfections Methods for cell culture of Cos-7 have
been described previously (Chai 1999b). Transfections with DNA plasmids and
siRNA were performed using Lipofectamine Plus (LifeTechnologies) according
to the manufacturer's instructions in six or 12 well plates with cells at 70-
90%
confluence. For single plasmid transfection, 1 pt,g of plasmid was transfected
with 51.1g of siRNA. For double plasmid transfection, 0.75 lug of each plasmid
was transfected with 3.75 lig of siRNA.
Western Blotting and Fluorescence Microscopy. Cells were harvested
36 to 48 hours after transfection and lysates were assessed for TA expression
by
Western Blot analysis (WB) as previously described (Chai 1999b). The antibody
used to detect TA was polyclonal rabbit antiserum generated against a TA-
maltose binding protein fusion protein (kindly provided by Xandra Breakefield)
at a 1:500 dilution. Additional antibodies used in the experiments described
here
are the anti-HA mouse monoclonal antibody 12CA5 (Roche) at 1:1,000 dilution,
monoclonal mouse anti-GFP antibody (MBL) at 1:1,000 dilution, and for
loading controls, anti a-tubulin mouse monoclonal antibody (Sigma) at 1:20,000
dilution.
Fluorescence visualization of fixed cells expressing GFP-tagged TA was
performed with a Zeiss Axioplan fluorescence microscope. Nuclei were
visualized by staining with 5ptg/m1DAPI at room temperature for 10 minutes.
Digital images were collected on separate red, green and blue fluorescence
channels using a Diagnostics SPOT digital camera. Live cell images were
collected with a Kodak MDS 290 digital camera mounted on an Olympus CK40
121
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
inverted microscope equipped for GFP fluorescence and phase contrast
microscopy. Digitized images were assembled using Adobe Photoshop 6Ø
Western Blot and Fluorescence Quantification. For quantification of
WB signal, blots were scanned with a Hewlett Packard ScanJet 5100C scanner.
-- The pixel count and intensity of bands corresponding to TA and a-tubulin
were
measured and the background signal subtracted using Scion Image software
(Scion Corporation). Using the a-tubulin signal from control lanes as an
internal
reference, the TA signals were normalized based on the amount of protein
loaded per lane and the result was expressed as percentage of TA signal in the
-- control lane. Fluorescence quantification was determined by collecting
three
non-overlapping images per well at low power (10x), and assessing the pixel
count and intensity for each image with Bioquant Nova Prime software
(BIOQUANT Image Analysis Corporation). Background fluorescence, which
was subtracted from experimental images, was determined by quantification of
-- fluorescence images of untransfected cells at equivalent confluence, taken
under
identical illumination and exposure settings.
RESULTS
Expression of tagged TorsinA constructs. To test whether allele-specific
-- silencing could be applied to DYT1, a way to differentiate TAwt and TAmut
proteins needed to be developed. Because TAwt and TAmut display identical
mobility on gels and no isoform-specific antibodies are available, amino-
terminal epitope-tagged TA constructs and GFP-TA fusion proteins were
generated that would allow distinguishingTAwt and TAmut. The use of GFP-TA
-- fusion proteins also facilitated the ability to screen siRNA suppression
because it
allowed visualization of TA levels in living cells over time.
In transfected Cos-7 cells, epitope-tagged TA and GFP-TA fusion protein
expression was confirmed by using the appropriate anti-epitope and anti-TA
antibodies. Fluorescence microscopy in living cells showed that GFP-TAwt and
-- GFP-TAmut fusion proteins were expressed diffusely in the cell, primarily
in the
cytoplasm, although perinuclear inclusions were also seen. It is important to
note
122
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
that these construct were designed to express reporter proteins in order to
assess
allele-specific RNA interference rather than to study TA function. The N-
terminal epitope and (}FP domains likely disrupt the normal signal peptide-
mediated translocation of TA into the lumen of the endoplasmic reticulum,
where TA is thought to function. Thus, while these constructs facilitated
expression analysis in the studies described here, they are of limited utility
for
studying TA function.
Silencing TorsinA with siRNA. Various siRNAs were designed to test
the hypothesis that siRNA-mediated suppression of TA expression could be
achieved in an allele-specific manner (figure 12). Because siRNA can display
exquisite sequence specificity, the three base pair difference between mutant
and
wild type TOR1A alleles might be sufficient to permit the design of siRNA that
preferentially recognizes mRNA derived from the mutant allele. Two siRNAs
were initially designed to target TAmut (mutA-siRNA and mutB-siRNA) and
one to target TAwt (wt-siRNA). In addition, a positive control siRNA was
designed to silence both alleles (com-siRNA) and a negative control siRNA of
irrelevant sequence (mis-siRNA) was designed. Cos-7 cells were first
cotransfected with siRNA and plasmids encoding either GFP-TAwt or untagged
TAwt at a siRNA to plasmid ratio of 5:1. With wt-siRNA, potent silencing of
TAwt expression was observed to less than 1 % of control levels, based on
western blot analysis of cell lysates (Figures 13A and 13C). With com-siRNA,
TAwt expression was suppressed to ¨30 % of control levels. In contrast, mutA-
siRNA did not suppress TAwt and mutB-siRNA suppressed TAwt expression
only modestly. These results demonstrate robust suppression of TAwt expression
by wild type-specific siRNA but not mutant-specific siRNA.
To assess suppression of TAmut, the same siRNAs were cotransfected
with plasmids encoding untagged or HA-tagged TAmut. With mutA-siRNA or
mutB-siRNA, marked, though somewhat variable, suppression of TAmut
expression was observed as assessed by western blot analysis of protein levels
(Figure 13B and 13C). With com-siRNA, suppression of TAmut expression was
observed similar to what was observed with TAwt expression. In contrast, wt-
123
CA 02596588 2007-07-30
WO 2006/083800 PCT/US2006/003298
siRNA did not suppress expression of TAmut. Thus differential suppression of
TAmut expression was observed by allele-specific siRNA in precisely the
manner anticipated by the inventors.
To achieve even more robust silencing of TAmut, a third siRNA was
engineered to target TAmut (mutC-siRNA, Figure 12). MutC-siRNA places the
GAG deletion more centrally in the siRNA duplex. Because the central portion
of the antisense strand of siRNA guides mRNA cleavage, it was reasoned that
=
placing the GAG deletion more centrally might enhance specific suppression of
. TAmut. As shown in Figure 13, mutC-siRNA suppressed TAmut expression
more specifically and robustly than the other mut-siRNAs tested. In
transfected
cells, mutC-siRNA suppressed TAmut to less than 0.5% of control levels, and
had no effect on the expression of TAwt.
To confirm allele-specific suppression by wt-siRNA and mutC-siRNA,
respectively, the inventors cotransfected cells with GFP-TAwt or GFP-TAmut
together with mis-siRNA, wt-siRNA or mutC-siRNA. Levels of TA expression
were assessed 24 and 48 hours later by GFP fluorescence, and quantified the
fluorescence signal from multiple images was quantified. The results (Figure
13D and 13E) confirmed the earlier western blots results in showing potent,
specific silencing of TAwt and TAmut by wt-siRNA and mutC-siRNA,
respectively, in cultured mammalian cells.
Allek-specific silencing in simulated heterozygous state. In DYT1, both
the mutant and wild type alleles are expressed. Once the efficacy of siRNA
silencing was established, the inventors sought to confirm siRNA specificity
for
the targeted allele in cells that mimic the heterozygous state of DYT1. In
plants
and Caenorhabditis elegans, RNA-dependent RNA polymerase activity primed
by introduction of exogenous RNA can result in the spread of silencing signals
along the entire length of the targeted mRNA (Fire 1998, Tang 2003). No
evidence for such a mechanism has been discovered in mammalian cells
(Schwarz 2002, Chiu 2002). Nonetheless it remained possible that silencing of
the mutant allele might activate cellular processes that would also inhibit
expression from the wild type allele. To address this possibility, Cos-7 cells
were
124
CA 02596588 2013-08-13
cotransfected with both GFP-TAwt and HA-TAmut, and suppression by mis-
siRNA, wt-siRNA or mutC-siRNA was assessed. As shown in Figure 14, potent
and specific silencing of the targeted allele (either TAmut or TAwt) to levels
less
than 1% of controls was observed, with only slight suppression in the levels
of
the non-targeted protein. Thus, in cells expressing mutant and wild type forms
of
the protein, siRNA can suppress TAmut while sparing expression of TAwt.
DISCUSSION
In this study the inventors succeeded in generating siRNA that
specifically and robustly suppresses mutant TA, the defective protein
responsible
for the most common form of primary generalized dystonia. The results have
several implications for the treatment of DYT1 dystonia. First and foremost,
the
suppression achieved was remarkably allele-specific, even in cells simulating
the
heterozygous state. In other words, efficient suppression of mutant TA
occurred
without significant reduction in wild type TA. Homozygous TA knockout mice
die shortly after birth, while the heterozygous mice are normal (Goodchild
2002), suggesting an essential function for TA. Thus, therapy for DYT1 needs
to
eliminate the dominant negative or dominant toxic properties of the mutant
protein while sustaining expression of the noimal allele in order to prevent
the
deleterious consequences of loss of TA function. Selective siRNA-mediated
suppression of the mutant allele fulfills these criteria without requiring
detailed
knowledge of the pathogenic mechanism.
An appealing feature of the present siRNA therapy is applicable to all
individuals afflicted with DYT1. Except for one unusual case (Leung 2001,
Doheny 2002, Klein et al., "Epsilon-sarcoglycan mutations found in combination
with other dystonia gene mutations," Ann. Neurol., 2002, 52, 675-679), all
persons with DYT1 have the same (GAG) deletion mutation (Ozelius 1997,
Ozelius 1999). This obviates the need to design individually tailored siRNAs.
In
addition, the fact that the DYT1 mutation results in a full three base pair
difference from the wild type allele suggests that siRNA easily distinguishes
mRNA derived from normal and mutant TORIA alleles.
125
CA 02596588 2013-08-13
It is important to recognize that DYT1 is not a fully penetrant disease
(Fahn 1998, Klein et al., "Epsilon-sarcoglycan mutations found in combination
with other dystonia gene mutations," Ann. Neurol. 2002, 52, 675-679). Even
when expressed maximally, mutant TA causes significant neurological
dysfunction less than 50% of the time. Thus, even partial reduction of mutant
TA
levels might be sufficient to lower its pathological brain activity below a
clinically detectable threshold. In addition, the DYT1 mutation almost always
manifests before age 25, suggesting that TAmut expression during a critical
developmental window is required for symptom onset. This raises the
possibility
that suppressing TAmut expression during development might be sufficient to
prevent symptoms throughout life. Finally, unlike many other inherited
movement disorders DYT1 is not characterized by progressive
neurodegeneration. The clinical phenotype must result primarily from neuronal
dysfunction rather than neuronal cell death (Hornykiewicz 1986, Walker 2002,
Augood 2002, Augood 1999). This suggests the potential reversibility of DYT1
by suppressing TAmut expression in overtly symptomatic persons.
Example 4
siRNA Specific for Huntington's Disease
The present inventors have developed huntingtin siRNA focused on two
targets. One is non-allele specific (siHDexon2), the other is targeted to the
exon
58 codon deletion, the only known common intragenic polymorphism in linkage
disequilibrium with the disease mutation (Ambrose et al, 1994). Specifically,
92% of wild type huntingtin alleles have four GAGs in exon 58, while 38% of
HD patients have 3 GAGs in exon 58. To assess a siRNA targeted to the
intragenic polymorphism, PC6-3 cells were transfected with a full-length
huntingtin containing the exon 58 deletion. Specifically, PC6-3 rat
pheochromocytoma cells were co-transfected with CMV-human Htt (37Qs) and
U6 siRNA hairpin plasmids. Cell extracts were harvested 24 hours later and
western blots were performed using 15 lig total protein extract. Primary
antibody was an anti-huntingtin monoclonal antibody (MAB2166, Chemicon)
that reacts with human, monkey, rat and mouse Htt proteins.
126
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
As seen in Figure 15, the siRNA lead to silencing of the disease allele.
As a positive control, a non-allele specific siRNA targeted to exon 2 of the
huntingtin gene was used. siRNA directed against GFP was used as a negative
control. Note that only siEx58# 2 is functional. The sequence for siEX58#2 is
the following: 5'-AAGAGGAGGAGGCCGACGCCC-31(SEQ ID NO:90).
siEX58#1 was only minimally functional.
Example 5
RNA Interference Improves Motor and Neuropathological
Abnormalities in a Huntington's Disease Mouse Model
Huntington'S disease (HD) is one of nine dominant neurodegenerative
diseases resulting from polyglutamine repeat expansions (CAG codon, Q) in
exon 1 of HD, leading to a toxic gain of function on the protein huntingtin
(htt)
(The Huntington's Disease Collaborative Research Group (1993) Cell 72, 971-
83; Gusella et al., (2000) Nat Rev Neurosci 1, 109-15). Hallmark BD
characteristics include cognitive and behavioral disturbance, involuntary
movements (chorea), neuronal inclusions, and striatal and cortical
neurodegeneration (Gusella et al., (2000) Nat Rev Neurosci 1, 109-15). Htt
alleles containing greater than 35 CAG repeats generally cause HD, with age-at-
onset correlating inversely with expansion length, a common characteristic of
the
polyglutamine repeat disorders. The disease usually develops in mid-life, but
juvenile-onset cases can occur with CAG repeat lengths greater than 60. Death
typically occurs 10-15 years after symptom onset. Currently, no preventative
treatment exists for BD.
Therapies aimed at delaying disease progression have been tested in HID
animal models. For example, beneficial effects have been reported in animals
treated with substances that increase transcription of neuroprotective genes
(histone deacetylase) (Ferrante et al., (2003) J Neurosci 23, 9418-27);
prevent
apoptosis (caspase inhibitors)(Ona et al., (1999) Nature 399, 263-7); enhance
energy metabolism (coenzyme Q/remacemide, creatine) (Ferrante et al., (2002) J
Neurosci 22, 1592-9; Andreassen et al., (2001) Neurobiol Dis 8, 479-91); and
127
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
inhibit the formation of polyglutamine aggregates (trehalose, Congo red,
cystamine) (Tanaka et al., (2004) Nat Med 10, 148-54; Karpuj et al., (2002)
Nat
Med 8, 143-9; Sanchez et al., (2003) Nature 421, 373-9). These approaches
target downstream and possibly indirect effects of disease allele expression.
In
contrast, no therapies have been described that directly reduce mutant
huntingtin
gene expression, thereby targeting the fundamental, underlying pathological
insult.
The therapeutic promise of silencing mutant htt expression was
demonstrated in a tetracycline-regulated mouse model of HD (Yamamoto et al.,
(2000) Cell 101, 57-66). When mutant htt was inducibly expressed, pathological
and behavioral features of the disease developed, including the characteristic
neuronal inclusions and abnormal motor behavior. Upon repression of transgene
expression in affected mice, pathological and behavioral features resolved.
Thus, reduction of htt expression using RNAi may allow protein clearance
mechanisms within neurons to normalize mutant htt-induced changes. We
hypothesize that directly inhibiting the expression of mutant htt will slow or
prevent HD-associated symptom onset in a relevant animal model.
Screening of putative therapies for HD has benefited from the existence
of several HD mouse models (Beal et al., (2004) Nat Rev Neurosci 5, 373-84;
Levine et al., (2004) Trends Neurosci 27, 691-7). BD-like phenotypes are
displayed in knock-in mice (Lin et al., (2001) Hum Mol Genet 10, 137-44;
Menalled et al., (2003) J Comp Neurol 465, 11-26), drug-induced models
(McBride et al., (2004) J Comp Neurol 475, 211-9) and transgenic mice
expressing full-length mutant huntingtin (e.g. YAC-transgenic mice) (Hodgson
et al., (1999) Neuron 23, 181-92; Slow et al., (2003) Hum Mol Genet 12, 1555-
67; Reddy et al., (1998) Nat Genet 20, 198-202) or an N-terminal fragment of
htt (Yamamoto et al., (2000) Cell 101, 57-66; Mangiarini et al., (1996) Cell
87(3), 493-506; Schilling et al., (1999) Hum Mol Genet 8(3), 397-407). Mice
expressing truncated N-terminal fragments of huntingtin have been valuable for
proof-of-principle evaluation of therapies because they show rapidly
progressive
motor abnormalities and striatal neuropathology, phenotypes which do not
128
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
develop or develop very late in knock-in or YAC transgenic mice. Mice
expressing truncated forms of huntingtin thus replicate more severe forms of
the
disease. The present inventors tested if RNA interference (RNAi) induced by
short hairpin RNAs (shRNAs) (Dylahoorn et al., (2003) Nat Rev Mol Cell Biol
4, 457-67) could reduce expression of mutant htt and improve HD-associated
abnormalities in a transgenic mouse model of HD. It was found that RNAi
directed against mutant human huntingtin (htt) reduced htt tnRNA and protein
expression in cell culture and in HD mouse brain. It is important to note that
htt
gene silencing improved behavioral and neuropathological abnormalities
associated with HD.
Materials and Methods
Plasmids and Adeno-Associated Virus (AAV) construction. Myc-
tagged HD-N171-82Q was expressed from a pCMV-HD-N171-82Q plasmid
(Schilling et al., (1999) Hum Mol Genet 8(3), 397-407). PCR (Pfu polymerase,
Stratagene) was used to amplify the U6 promoter along with shRNAs targeting
human huntingtin (shHD2.1; Fig. 16A), eGFP (shGFP) (Xia et at., (2002) Nat
Biotechnol 20, 1006-1010); or E. coli P-galactosidase (bp 1152-1172; shLacZ).
PCR products were cloned, verified by sequencing and inserted into
pAAV.CMV.hrGFP, which contains AAV-2 ITRs, a CMV-hrGFP-SV40 polyA
reporter cassette, and sequences used for homologous recombination into
baculovirus (Urabe et at., (2002) Hum Gene Ther 13, 1935-190. Recombinant
AAV serotype 1 capsid vectors were generated as described (Urabe et at.,
(2002)
Hum Gene Ther 13, 1935-1943). AAV titers were determined by quantitative
PCR and/or DNA slot blot and were 5 x 1012 vector genomes/ml.
Animals. All animal studies were approved by the University of Iowa
Animal Care and Use Committee. HD-N171-82Q mice were purchased from
Jackson Laboratories, Inc. (Schilling et at., (1999) Hum Mol Genet 8(3), 397-
407; Schilling et at., (2001) Neurobiol Dis 8, 405-18) and maintained on a
129
CA 02596588 2013-08-13
B6C3F1/J background. Heterozygous and age-matched wildtype littermates
were used for the experiments, as indicated.
Northern blots. HEK293 cells were transfected (Lipofectamineg-2000;
InvitrogenTM) with pCMV-HD-N171-82Q and plasmids expressing shHD2.1,
shGFP, or shLacZ at shRNA:target ratios of 8:1. Forty-eight hours post-
transfection, RNA was harvested (Trizolt Reagent; InvitrogenTM) and 10 g
were assessed northern blot (NorthernMax Ambion0) using probes to human
htt or human GAPDH. Band intensities were quantified using a phosphorimager
(Storm 860 instrument and ImageQuantTM v1.2 software, Molecular Dynamics).
For in vivo studies, total RNA was isolated from hrGFP-positive striata.
Thirty lug RNA was run on 15% polyacrylamide-urea gels, transferred to
HybondTM N+ membranes (Amersham Pharmacia), then probed with 32P-labeled
sense oligonucleotides at 36 C for 3 h, washed in 2X SSC (36 C), and exposed
to film.
Western blots. HEK293 cells were transfected as described with
shHD2.1 or shGFP singly or in combination with pCMV-HD-N171-82Q. Forty-
eight hours later, cells were lysed to recover total protein. Western blots
were
incubated with anti-myc (1:5,000; Invitrogen), anti full-length human htt
(1:5,000; MAB2166; Chemicon), or anti-human 3-actin (1:5,000; Clone AC-15;
Sigma) followed by HRP-coupled goat anti-mouse or goat anti-rabbit secondary
antibodies (1:20,000 and 1:100,000, respectively; Jackson Immunochemicals).
Blots were developed using ECL-Plus reagents (Amersham Biosciences). For
evaluation of transduced brain, 3 week old mice were injected as described and
protein was harvested from striata 2 weeks later. Twenty-five vig were run on
SDS-PAGE gels as described, transferred to nitrocellulose, then probed with
antibodies to detect human htt (1:500, mEM48; Gift from X.J. Li) and mouse
prion protein (1:40,000; Chemicon International). Secondary antibody
incubations were performed as described above.
Quantitative RT-PCR
130
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
In vitro shRNA dose response. HEK293 cells were transfected with 0
(mock), 10, 100, or 1000 ng of shLacZ or shBD2.1 and RNA was harvested 24 h
later. Following DNase treatment (DNA-Free, Ambion), random-primed, first
strand cDNA was generated from 500 ng total RNA (TaqmanTm Reverse
Transcription Reagents, Applied Biosystems) according to manufacturer's
protocol. TaqmanTm Assays were performed on an ABI Prism 7000 Sequence
Detection System using TaqmanTm 2X Universal PCR Master Mix (Applied
Biosystems) and TaqmanTm primers/probe sets specific for human htt and
mammalian rRNA (Applied Biosystems). Relative gene expression was
determined using the relative standard curve method.
In vivo huntingtin mRNA expression. Striata were dissected from 5.5
month old mice, snap frozen in liquid nitrogen, and pulverized. cDNA was
generated as described above. Relative gene expression was assayed using
TaqmanTm primers/probe sets specific for human htt and mammalian rRNA or
Assays-By-Design TaqmanTm primers/probes specific for mouse huntingtin
(mHdh; Applied Biosystems). All values were calibrated to contralateral,
uninjected striata. For human huntingtin detection; shHD2.1 samples, n=8
striata; shLacZ, n=7; uninjected, n=4. For mouse Hdh detection; injected HD
samples, n=4; uninjected samples n=2.
AAV Injections
All animal procedures were pre-approved by the University of Iowa
Animal Care and Use Committee. AAV Injections were performed in 4 week
old mice using the following parameters (coordinates are reported with respect
to
the bregma): Striatal: 0.5 mm anterior, 2.5 mm lateral, 2.5 mm depth,
51a1/site,
250 nl/min infusion rate. Cerebellar: 0.1 mm depth, 1 ill/site, 250 nl/min
infusion rate.
Behavioral analysis
131
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Stride length measurements. Mice injected bilaterally at 4 weeks of age
were analyzed at 4 months of age. Analyses were performed as described
previously (Carter et al., (1999) J Neurosci 19, 3248) with some
modifications.
Specifically, mice were allowed to walk across a paper-lined chamber measuring
100 cm long, 10 cm wide, with 10 cm high walls into an enclosed box. Mice
were given one practice run and were then tested three times to produce three
separate footprint tracings, totaling 42 measurements each for front and rear
footprints per mouse. Measurements were averaged and data presented as box
plots. ANOVA with Scheffe's post-hoc test was performed to determine
statistical significance. Uninjected mice, n=4; injected WT, n=3; injected
N171-
82Q, n=6 mice.
Rotarod peifonnance test. Two separate experimental cohorts of mice
were injected at 4 weeks of age and tested on the rotarod (Model 7650, Ugo
Basile Biological Research Apparatus) at 10 and 18 weeks of age as previously
described (Xia et al., (2004) Nat Med 10, 816-820). Data from trials 2-4 for
each day are presented as means S.E.M. Uninjected WT, n=6; shLacZ WT,
n=5, shBD2.1 WT, n=6; uninjected N171-82Q, n=5; shLacZ N171-82Q, n=10;
shHD2.1 N171-82Q, n=11). Reported values are means S.E.M.
Immunofluorescence
Forty gm free-floating coronal sections were stained with mEM48
antibody (1:500; 24 h, 4 C), followed by Alexa-568 labeled goat anti-mouse
secondary antibody (1:200; 4 h, room temp; Molecular Probes). Sections were
mounted onto slides, covered in Gel/Mount (Biomeda Corp) and images were
captured using fluorescent microscopy (Leica DM RBE or Zeiss confocal)
equipped with a CCD-camera (SPOT RT, Diagnostics Instruments). Results
shfiD2.1 Reduces Human Huntingtin Expression In Vitro
In vitro screening was used to identify effective shRNAs directed against
a CMV-promoter transcribed HD-N171-82Q mRNA, which is identical to the
pathogenic truncated huntingtin fragment transgene present in BD-N171-82Q
mice (Schilling et al., (1999) Hum Mol Genet 8(3), 397-407). Hairpin
132
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
constructs targeting sequences in human exons 1-3 were evaluated by co-
transfection. One htt-targeted shRNA, shHD2.1 (Fig. 16A), reduced HD-N171-
82Q mRNA and protein levels by ¨85 and ¨55% respectively, relative to control
shRNA treated samples (Fig. 16B, C). Interestingly, none of the shRNAs tested
that targeted exon 1 were functional under these conditions and in this
system.
Additional siRNAs can be screened as described herein to identify functional
siRNAs targeting exon 1 of the HD gene in this other other systems.
To test if shHD2.1 could silence endogenous full-length human htt
expression, BEK 293 cells were transfected with plasmids expressing shHD2.1
or shGFP. ShHD2.1, but not control shRNAs, directed gene silencing of
endogenous htt mRNA and protein (Figs. 16D, E). This system can be readily
used to screen additional siRNAs targeting the HD gene.
Expression of shRNA in Mouse Brain
Next, the inventors tested U6 promoter-transcribed shHD2.1 expression
in vivo and determined its effects on HD-associated symptoms in mice. This pol
HI dependent promoter has not previously been evaluated in striata for
sustained
expression in vivo, although shRNAs have been expressed in brain using either
the pol I1-dependent CMV promoter in striatum (Xia et al., (2002) Nat
Biotechnol 20, 1006-1010) or the H1 promoter in cerebellar degeneration models
(Xia et al., (2004) Nat Med 10, 816-820). U6 promoter-driven shBD2.1, and the
control hairpin shLacZ, were cloned into adeno-associated virus (AAV) shuttle
plasmids that contained a separate CMV-humanized Renilla green fluorescent
protein (hrGFP) reporter cassette (Fig. 17A). High-titer AAV1 particles
(AAV.shHD2.1 and AAV.shLacZ), which have broad neuronal tropism, were
generated (Urabe et al., (2002) Hum Gene Ther 13, 1935-1943), and hairpin
expression was assessed after injection into mouse striatum. The N171-82Q
mouse model was used because shIlD2.1 targets sequences in exon 2, precluding
use of the R6/2 transgenic model, which expresses only exon 1 of the HD gene.
As shown in Fig. 17B, precursor and processed shRNAs (-50 fit and 21 fit,
respectively) were expressed three weeks after transduction, indicating
sustained
133
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
expression and appropriate processing of shRNAs in the striatum. Analysis of
coronal brain sections from injected mice showed widespread transduction (Fig.
17C; hrGFP fluorescence) up to 5 months post-injection.
AAV.shHD2.1 Reduces HD-N171-82Q Expression In Vivo
The inventors next investigated the effects of RNAi on the characteristic
HD-associated neuronal inclusions and HD-N171-82Q mRNA levels in vivo.
Tissues were harvested from end-stage HD-N171-82Q mice (-5.5 months of
age) because striatal inclusions are less robust at earlier ages in this
model. In
striata from 1H1D-N171-82Q mice injected with AAV.shHD2.1, htt-reactive
inclusions were absent in transduced cells compared to untransduced regions
(Fig. 18A, lower panels; Fig. 18B). Conversely, abundant inclusions were
detected in transduced regions from AAV.shLacZ-injected HD mice (Fig. 18A,
upper panels). No inclusions were observed in WT mice (data not shown). In
addition, western analysis revealed that soluble HD-N171-82Q monomer was
decreased in mouse striata transduced with AAV.shHD2.1 compared to
uninjected or AAV.shLacZ-injected controls (Fig. 18C). The reduction in
protein levels detected by immunohistochemistry and western blot was due to
decreased transgene expression. BD-N171-82Q mRNA was reduced 51% to
55% in AAV.shHD2.1-injected HD mice relative to AAV.shLacZ-injected or
uninjected HD mice (Fig. 18D). AAV.shHD2.1 and AAV.shLacZ had no effect
on endogenous mouse htt expression (Avg. mil:DR expression: Uninjected HD,
1.00 0.09; Uninjected WT, 1.13 0.04; AAV.shLacZ injected BD, 1.10 0.08;
AAV.shHD2.1 injected HD, 1.08 0.05).
Neuronal inclusions in HD-N171-82Q striata are variable. Inclusions
may be present in as few as 10% and up to 50% of all striatal neurons in
different end-stage BD-N171-82Q mice (Schilling et al., (1999) Hum Mol Genet
8(3), 397-407). In contrast, robust and widespread EM48-positive inclusions
are
present in cerebellar granule cells by ¨3 months of age [(Schilling et at.,
(1999)
Hum Mol Genet 8(3), 397-407) and Fig. 18], and cerebellar BD-N171-82Q
mRNA levels are ¨8 fold higher relative to striatum (QPCR, data not shown).
134
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
This high-level cerebellar expression is partially attributable to the
transcriptional profile of the prion promoter driving HD-N171-82Q transgene
expression (Schilling et al., (1999) Hum Mol Genet 8(3), 397-407). Cerebellar
inclusions are not typically found in brains of adult-onset HD patients.
-- However, cerebellar pathology has been reported in juvenile onset HD cases,
which are the most severe forms of the disease, and interestingly, in Hdhl 40
knock-in mice as early as 4 months of age (Menalled et al., (2003) J Comp
Neurol 465, 11-26; Nance et al., (2001) Ment Retard Dev Disabil Res Rev 7,
153-7; Fennema- et al., (2004) Neurology 63, 989-95; Seneca et aL, (2004) Eur
-- J Pediatr.; Byers et al., (1973) Neurology 23, 561-9; Wheeler et al.,
(2002)
Hum Mol Genet 11, 633-40). The abundant inclusions in HD-N171-82Q
cerebellar neurons provide a second target for assessing the effects of
AAV.shHD2.1 on target protein levels. Direct cerebellar injections were done
into a separate cohort of mice, and HD-N171-82Q expression examined by
-- immunofluorescence. Together the data show that AAV.shHD2.1, but not
control AAV.shLacZ, reduces mutant htt expression and prevents formation of
the disease-associated neuronal inclusions.
Striatal Delivery of AAV.shHD2.1 improves established behavioral
phenotypes
The effects of shRNA treatment on established behavioral deficits and
animal weight were tested. RNAi directed to striatum did not normalize the
notable weight differences between HD-N171-82Q and WT mice (shliD2.1-
injected, 22.7 3.8 g; shLacZ, 22.6 2.8 g; compared to age-matched wild-type
-- mice (shHD2.1, 26.3 0.4; shLacZ, 27.3 5.8), confirming that intracerebral
injection confines RNAi therapy to the site of application (Schilling et al.,
(1999) Hum Mol Genet 8(3), 397-407; Xia et al., (2004) Nat Med 10, 816-820).
However, significant improvements in stride length measurements and rotarod
deficits were noted.
Stride length and rotarod tests were performed on uninjected mice, and
mice injected bilaterally into striatum with AAVshilD2.1 or AAVshLacZ. As
135
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
shown in Fig. 19A, HD-N171-82Q mice display significantly shorter stride
lengths than those of wild-type (WT) mice, consistent with prior work
(Menalled
et al., (2003) J Comp Neurol 465, 11-26; Carter et at., (1999) J Neurosci 19,
3248; Wheeler et al., (2002) Hum Mol Genet 11, 633-40). Gait deficits in
AAV.shHD2.1-treated BD-N171-82Q mice were significantly improved
compared to AAV.shLacZ-treated (improvements for front and rear strides, 13
and 15%, respectively; p<0.0001) and uninjected HD-N171-82Q mice (front and
rear strides, 14 and 18%, respectively; p<0.0001). Gait improvements did not
fully resolve, as all HD-N171-82Q groups remained significantly different than
their age-matched WT littermates. There was no effect of AAV.shLacZ or
AAV.shIlD2.1 expression on stride lengths of WT mice.
The accelerating rotarod test was used to confirm the beneficial
behavioral effects of RNAi targeted to the mutant human BD allele (Schilling
et
al., (1999) Hum Mol Genet 8(3), 397-407). Mice were left uninjected, or were
injected bilaterally into the striatum with AAV.shLacZ or AAV.shHD2.1 at 4
weeks of age, followed by rotarod analyses at 10- and 18-weeks of age (Fig.
19B). By 10 weeks, uninjected and AAV.shLacZ-injected HD mice show
impaired performance relative to all other groups, and continued to
demonstrate
significantly reduced performance over the course of the study (p<0.05
relative
to all other groups). It is important to note that BD mice treated with
AAVshBD2.1 showed dramatic behavioral improvements relative to control-
treated HD mice (p<0.0008) (Fig. 19B). AAV.shLacZ-treated HD mice showed
a 22% decline (p<0.005; ANOVA), while AAV.shliD2.1-treated HD mice
displayed a modest, non-significant 3% drop in rotarod performance between 10
and 18 weeks of age. There was a partial normalization of rotarod deficits in
HD
mice injected with AAV.shHD2.1 compared to WT mice that was consistent
with the gait analyses.
The inventors found no decline in stride length or rotarod performance
between WT mice left untreated, or those injected with shRNA-expressing
AAVs (Fig. 19A,B). However, at 10 weeks, there was a dramatic difference in
rotarod performance between uninjected WT and all groups of injected WT
136
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
mice, which resolved by 18 weeks of age. These data suggest that there was
some detrimental effect of direct brain injection on rotarod performance from
which the mice recovered over time. These data suggest that RNAi expression
in mammalian brain had no overt negative impact on motor behavior (Fig.
19A,B).
Discussion
The inventors have shown that motor and neuropathological
abnormalities in a relevant BD mouse model are significantly improved by
reducing striatal expression of a pathogenic huntingtin allele using AAV1-
delivered shRNA. The inventors have previously shown that RNAi can improve
neuropathology and behavioral deficits in a mouse model of spino-cerebellar
ataxia type 1 (SCA1) (Xia et at., (2004) Nat Med 10, 816-820), a dominant
neurodegenerative disorder that affects a population of neurons distinct from
those degenerating in HD.
The shED2.1 hairpin sequence reduced huntingtin expression in vitro
and in vivo, and it is important to note, the present northern blot data
suggest that
the processed active guide strand was protected by RISC in vivo. The activity
of
the shRNAs could be improved using recently described rules for optimal
shRNA design (Reynolds et al., (2004) Nat Biotechnol 22, 326-30; Schwarz et
at., (2003) Cell 115, 199-208; Khvorova et at., (2003) Cell 115, 505; Ui-Tei
et
at., (2004) Nucleic Acids Res 32, 936-48).
Prior work demonstrated an essential role for huntingtin in
embryogenesis and postnatal neurogenesis (Nasir et al., (1995) Cell 81, 811-
23;
Duyao et at., (1995) Science 269, 407-10; White et at., (1997) Nat Genet 17,
404-10; Dragatsis et al., (2000) Nat Genet 26, 300-6). However the effect of
partial reduction of normal huntingtin expression in adult, post-mitotic
neurons
in vivo is unknown. In the current study, shHD2.1 reduced expression of a
mutant, disease-causing human htt transgene, but had no effect on normal mouse
huntingtin expression due to sequence differences between mouse and human
genes. In HD patients, shHD2.1 would be expected to reduce expression of both
137
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
the mutant and normal huntingtin alleles. The present data show that HD-like
symptoms can be improved by even a partial reduction of mutant htt expression,
suggesting that complete elimination of mutant allele expression may not be
required.
In summary, the inventors have shown that RNAi can dramatically
improve HD-associated abnormalities, including pathological and behavioral
deficits, in a HD mouse model.
Example 6
Huntington's Disease (HD)
Huntington's disease (HD) is one of several dominant neurodegenerative
diseases that result from a similar toxic gain of function mutation in the
disease
protein: expansion of a polyglutamine (polyQ)-encoding tract. It is well
established that for HD and other polyglutamine diseases, the length of the
expansion correlates inversely with age of disease onset. Animal models for
FID
have provided important clues as to how mutant huntingtin (htt) induces
pathogenesis. Currently, no neuroprotective treatment exists for HD. RNA
interference has emerged as a leading candidate approach to reduce expression
of disease genes by targeting the encoding mRNA for degradation.
Short hairpin RNAs (shRNAs) were generated that significantly
inhibited human htt expression in cell lines. Importantly, the shRNAs were
designed to target sequences present in HD transgenic mouse models. The
present studies test the efficacy of the shRNAs in HD mouse models by
determining if inclusions and other pathological and behavioral
characteristics
that are representative of HD can be inhibited or reversed. In a transgenic
model
of inducible HID, pathology and behavior improved when mutant gene
expression was turned off. These experiments show that RNAi can prevent or
reverse disease.
Although the effect of partial reduction of wildtype htt in adult neurons is
unknown, it is advantageous to target only mutant htt for degradation, if
possible. One polymorphism in linkage disequilibrium with HD has been
138
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
identified in the coding sequence for htt, and others are currently being
investigated. Disease allele-specific RNAi are designed using approaches that
led to allele specific silencing for other neurogenetic disease models. This
would allow directed silencing of the mutant, disease-causing expanded allele,
leaving the normal allele intact.
Constitutive expression of shRNA can prevent the neuropathological and
behavioral phenotypes in a mouse model of Spinocerebellar Ataxia type I, a
related polyQ disease. However, the constitutive expression of shRNA may not
be necessary, particularly for pathologies that take many years to develop but
may be cleared in a few weeks or months. For this reason, and to reduce long-
term effects that may arise if nonspecific silencing or activation of
interferon
responses is noted, controlled expression may be very important. In order to
regulate RNAi for disease application, doxycycline-responsive vectors have
been
developed for controlled silencing in vitro.
BD researchers benefit from a wealth of animal models including six
transgenic and four knock-in mouse models (Bates 2003). Expression is from
the endogenous human promoter, and the CAG expansion in the R6 lines ranges
from 110 to approximately 150 CAGs. The R6/2 line is the most extensively
studied line from this work. R6/2 mice show aggressive degenerative disease,
with age of symptom onset at 8-12 weeks, and death occurring at 10 to 13
weeks. NeurOnal intranuclear inclusions, a hallmark of HD patient brain,
appear
in the striatum and cortex of the R6/2 mouse (Meade 2002).
Adding two additional exons to the transgene and restricting expression
via the prion promoter led to an HD mouse model displaying important HD
characteristics but with less aggressive disease progression (Shilling 1999,
Shilling 2001). The Borchelt model, N171-82Q, has greater than wildtype levels
of RNA, but reduced amounts of mutant protein relative to endogenous htt.
N171-82Q mice show normal development for the first 1-2 months, followed by
failure to gain weight, progressive incoordination, hypokinesis and tremors.
There are statistically significant differences in the rotarod test,
alterations in
139
CA 02596588 2013-08-13
gait, and hindlimb clasping. Mice show neuritic pathology characteristic of
human HD. Unlike the Bates model, there is limited neuronal loss.
Detloff and colleagues created a mouse knock-in model with an
extension of the endogenous mouse CAG repeat to approximately 150 CAGs.
This model, the CHL2 line, shows more aggressive phenotypes than prior mouse
knock-in models containing few repeats (Lin 2001). Measurable neurological
deficits include clasping, gait abnormalities, nuclear inclusions and
astrogliosis.
The present studies utilize the well-characterized Borchelt mouse model
(N171-82Q, line 81), and the Detloff knock-in model, the CHL2 line. The
initial
targets for htt silencing were focused on sequences present in the N171-82Q
transgene (exons 1-3). The use of this model was advantageous in the
preliminary shRNA development because the RNAi search could focus on only
the amino-terminal encoding sequences rather than the full length 14 kb mRNA.
Figure 21 depicts the one-step cloning approach used to screen hairpins
(Harper
SQ, Davidson BL, "Plasmid-based RNA interference: construction of small-
hairpin RNA expression vectors," Methods Mol Biol. 2005;309:219-35). No
effective shRNAs were found in exon 1, but several designed against exon 2,
denoted shHDEx2.1 (5'-AAGAAAGAACTTTCAGCTACC-3', SEQ ID
NO:91), shHDEx2.2 19 nt (5'- AGAACTTTCAGCTACCAAG -3' (SEQ ID
NO:92)), or shHDEx2.2 21 nt 5' -AAAGAACTTTCAGCTACCAAG -3' (SEQ
ID NO:93)) and exon 3 (shHDEx3.1 19 nt 5'-TGCCTCAACAAAGTTATCA-3'
(SEQ ID NO:94) or shHDEx3.1 21 nt 5'-AATGCCTCAACAAAGTTATCA-3'
(SEQ ID NO:95)) sequences were effective. In co-transfection experiments with
shRNA expressing plasmids and the N171-82Q transcript target, shHDEx2.1
reduced N171-Q82 transcript levels by 80%, and protein expression by 60%.
In transient transfection assays shHDex2.1 did not silence a construct
spanning exons 1-3 of mouse htt containing a 79 CAG repeat expansion, the
mouse equivalent of N171-82Q. Next shHDEx2 into NIH 3T3 cells were
transfected to confirm that endogenous mouse htt, which is expressed in NIH
3T3 cells, would not be reduced. Surprisingly, shHDEx2.1 and shHDEx3.1
silenced full-length mouse htt. In contrast, shHDEx2.2 silenced only the human
N171-82Q transgene.
140
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Yamamoto and colleagues and others have demonstrated that preformed
inclusions can resolve (Yamamoto 2000). To test if RNAi could also reduce
preformed aggregates, the inventors used a neuronal cell line, which, upon
induction of Q80-eGFP expression, showed robust inclusion formation (Xia
2002). Cells laden with aggregates were mock-transduced, or transduced with
recombinant virus expressing control shRNA, or shRNAs directed against GFP.
The inventors found dramatic reduction in aggregates as assessed by
fluorescence. Quantification showed dose dependent effects (Figure 22) that
were corroborated by western blot (Xia 2002).
As indicated in Example 1 above, viral vectors expressing siRNAs can
mediate gene silencing in the CNS (Xia 2002). Also, these studies were
extended to the mouse model of spinocerebellar ataxia type 1 (SCA1). The data
are important as they demonstrate that shRNA is efficacious in the CNS of a
mouse model of human neurodegenerative disease. The data also support that
shRNA expression in brain is not detrimental to neuronal survival.
shRNAs can target the Exon 58 polymorphism. As described in Example
4 above, a polymorphism in htt exon 58 is in linkage disequilibrium with HD
(Ambrose 1994). Thirty eight percent of the HD population possesses a 3-GAG
repeat in exon 58, in contrast to the 4-GAG repeat found in 92% of non-HD
patients. The polymorphism likely has no affect on htt, but it provides a
target
for directing gene silencing to the disease allele. As indicated in Example 4
above, in experiments to test if allele-specific silencing for HD was
possible,
plasmids were generated that expressed shRNAs that were specific for the exon
58 polymorphism. The exon 58 3-GAG-targeting shRNAs were functional.
Developing vectors for control of RNAi in vivo. As demonstrated above,
shRNA expressed from viral vectors is effective at directing gene silencing in
brain. Also, viral vectors expressing shSCA1 inhibited neurodegeneration in
the
SCA1 mouse model. ShRNA expression was constitutive in both instances.
However, constitutive expression may not be necessary, and could exacerbate
any noted nonspecific effects. The present inventors have developed and tested
several doxycycline-regulated constructs. The construct depicted in Figure 23
141
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
showed strong suppression of target gene (GFP) expression after addition of
doxycycline and RNAi induction.
RNAi can protect, and/or reverse, the neuropathology in mouse models
of human Huntington 's disease
Two distinct but complimentary mouse models are used, the N171-82Q
transgenic and CHL2 knock-in mice. The former express a truncated NH2-
terminal fragment of human htt comprising exons 1-3 with an 82Q-repeat
expansion. The knock-in expresses a mutant mouse allele with a repeat size of
¨150. Neither shows significant striatal or cortical cell loss. Both therefore
are
suitable models for the early stages of HD. They also possess similarities in
mid- and end-stage neuropathological phenotypes including inclusions, gliosis,
and motor and behavioral deficits that will permit comparison and validation.
On the other hand, the differences inherent in the two models provide unique
opportunities for addressing distinct questions regarding RNAi therapy. For
example, N171-82Q transgenic mice have relatively early disease onset. Thus
efficacy can be assessed within a few months, in contrast to 9 months or more
in
the CHL2 line. Because the data showed that shHDEx2.2 targets the human
transgene and not mouse HD, evaluate disease-allele specific silencing in N171-
82Q mice is evaluated. In contrast, the CHL2 knock-in is important for testing
how reducing expression of both the mutant and wildtype alleles impacts on the
HD phenotype. Finally, both models should be investigated because any therapy
for HD should be validated in two relevant disease models.
siRNA against human htt protects against inclusion formation in N171-
82Q mice
The data show that it is possible to silence the human N171-82Q
transgene in vitro, and work in reporter mice and SCA1 mouse models
demonstrated efficacy of RNAi in vivo in brain. shHDEx2.2 constructs,
expressed from two vector systems with well-established efficacy profiles in
CNS, are now tested for their capacity to reduce mutant transgenic allele
expression in vivo. Further, the impact of shHDEx2.2 on inclusion formation is
assessed. Inclusions may not be pathogenic themselves, but they are an
142
CA 02596588 2007-07-30
WO 2006/083800 PCT/US2006/003298
important hallmark of HD and their presence and abundance correlates with
severity of disease in many studies.
Recombinant feline immunodeficiency virus (FIV) and adeno-associated
virus (AAV) expressing shHDs are injected into N171-82Q. The levels of
shHDs expressed from FIV and AAV are evaluated, as is the ability to reduce
htt
mRNA and protein levels in brain, and subsequently affect inclusion formation.
Mice. N171-82Q mice developed by Borchelt and colleagues are used
for these experiments (Shilling 1999, Shilling 2001). The colony was set up
from breeders purchased from Jackson Laboratories (N171-82Q, line 81) and are
maintained as described (Shilling 1999, Shilling 2001). Fl pups are genotyped
by PCR off tail DNA, obtained when tagging weaned litters.
=
IC2 and EM48 have been used previously to evaluate N171-82Q
transgene expression levels in brain by immuno-histochemistry (IHC) and
western blot (Zhou 2003, Trottier 1995). EM48 is an antibody raised against a
GST-NH2 terminal fragment of htt that detects both ubiquitinated and non-
ubiquitinated htt-aggregates (Li 2000), and the IC2 antibody recognizes long
polyglutamine tracts (Trottier 1995). By 4 weeks N171-82Q mice show diffuse
EM48-positive staining in striata, hippocampus, cerebellar granule cells, and
cortical layers IV and V (Shilling 1999, Shilling 2001). The present
experiments
focus on the striatum and cortex because they are the major sites of pathology
in
human HD. TUNEL positivity and GFAP immunoreactivity are also significant
in striatal sections harvested from 3 month old N171-82Q mice (Yu 2003). At 4
months, punctate nuclear and cytoplasmic immunoreactivity is also seen (Yu
2003).
Viruses. It is difficult to directly compare the two viruses under study at
equivalent doses; FIV is enveloped and can be concentrated and purified, at
best,
to titers of 5 x 108 infectious units/ml (iu/ml). FIV pseudotyped with the
vesicular stomatitus glycoprotein (VSVg) are used because of its tropism for
neurons in the striatum (Brooks 2002). In contrast, AAV is encapsidated and
can be concentrated and purified to titers ranging from 1 x 109 to 1 x 1011
iu/ml,
with 1 x 1010 titers on average. AAV serotype 5 is used because it is tropic
for
143
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
neurons in striatum and cortex, our target brain regions. Other serotypes of
AAV, such as AAV-1 may also be used to neurons in striatum and cortex. Also,
it diffuses widely from the injection site (Alisky 2000, Davidson 2000). Ten-
fold dilutions of FIV and AAV generally results in a greater than 10-fold drop
in
transduction efficiency, making comparisons at equal titers, and dose
escalation
studies, unreasonable. Thus, both viruses are tested at the highest titers
routinely
available to get a fair assessment of their capacities for efficacy in N171-
82Q
mice: All viruses express the humanized Renilla reniformis green fluorescent
protein (hrGFP) reporter transgene in addition to the shRNA sequence (Figure
24). This provides the unique opportunity to look at individual, transduced
cells,
and to compare pathological improvements in transduced vs. untransduced cells.
Injections. Mice are placed into a David Kopf frame for injections. Mice
are injected into the striatum (5 microliters; 100 nl/min) and the cortex (3
microliters; 75 nl/min) using a Hamilton syringe and programmable Harvard
pump. The somatosensory cortex is targeted from a burr hole at ¨1.5 mm from
Bregma, and 1.5 mm lateral. Depth is 0.5 mm. The striatum is targeted through
a separate burr hole at +1.1 mm from Bregma, 1.5 mm lateral and 2 mm deep.
Only the right side of the brain is injected, allowing the left hemisphere to
be
used as a control for transgene expression levels and presence or absence of
inclusions.
Briefly, groups of 4 week-old mice heterozygous for the N171-82Q
transgene and their age-matched wildtype littermates are injected with FIV
(FIV
groups are VSVg.FIV.shHDEx2.2, VSVg.FIVshlacZ, VSVg.hrGFP, saline) or
AAV (AAV groups are AAV5.shHDEx2.2, AAV5shlacZ, AAVRIGFP, saline)
(n=18/group; staggered injections because of the size of the experiment).
Names
of shBDEx2.2 and shlacZ expressing viruses have been shortened from
shlacZ.hrGFP, for example, to make it easier to read, but all vectors express
hrGFP as reporter. Nine mice/group are sacrificed at 12 weeks of age to assess
the extent of transduction (eGFP fluorescence; viral copy number/brain
region),
shRNA expression (northern for shRNAs, and inhibition of expression of the
transgenic allele (QPCR and western blot). The remaining groups are sacrificed
144
CA 02596588 2013-08-13
at 5 months of age. This experimental set up is repeated (to n=6/group) to
confirm results and test inter-experiment variability.
All mice in all groups are weighed hi-weekly (every other week) after
initial weekly measurements. N171-82Q mice show normal weight gain up to
approximately 6 weeks, after which there are significant differences with
their
wildtype littermates.
PCR Analyses. Brains are harvested from mice sacrificed at 12 weeks of
age, and grossly evaluated for GFP expression to confirm transduction. The
cortex and striatum from each hemisphere is dissected separately, snap frozen
in
liquid N2, pulverized with a mortar and pestle, and resuspended in Trizol
(Gibco
BRL). Separate aliquots are used for Q-RTPCR for N171-82Q transgenes and
DNA PCR for viral genomes. A coefficient of correlation is determined for
transgene silencing relative to viral genomes for both vector systems, for the
regions analyzed and compared to contralateral striata and mice injected with
control vectors or saline.
The RNA harvested is used to evaluate activation of interferon-
responsive genes. Bridge et al. (Bridge, 2003) and Sledz and colleagues (Sledz
2003) found activation of 2'5' oligo(A) polymerase (OAS) in cell culture with
siRNAs and shRNAs, the latter expressed from lentivirus vectors. Gene
expression changes are assessed using QPCR for OAS, Statl, interferon-
inducible transmembrane proteins 1 and 2 and protein kinase R (PKR). PKR
activation is an initial trigger of the signaling cascade of the interferon
response.
Protein analyses. A second set of 3 brains/group are harvested for
protein analysis. Regions of brains are micro dissected as described above,
and
after pulverization are resuspended in extraction buffer (50 mM Tris, pH 8.0,
150 mM NaC1, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, 1 mM BetaME, 1X
complete protease inhibitor cocktail) for analysis by western blot. HrGFP
expression are evaluated and correlated to diminished levels of soluble N171-
82Q using anti-GFP and antibodies to the NH2-terminal region of htt (EM48) or
the polyglutamine tract (1C2).
145
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Histology. Histology is done on the remaining animals. Mice are
perfused with 2% paraformaldehyde in PBS, brains blocked to remove the
cerebellum, post-fixed ON, and then cryoprotected in 30% sucrose. Full coronal
sections (40 m) of the entire cerebrum are obtained using a Microtome
(American Products Co #860 equipped with a Super Histo Freeze freezing
stage). Briefly, every section is collected, and sections 1-6 are placed into
6
successive wells of a 24-well plate. Every 400 microns, two sections each of
10
microns are collected for Nissl and H&E staining. The process is repeated.
EM-48 immuno-staining reveals diffuse nuclear accumulations in N171-
82Q mice as early as 4 weeks of age. In 6 mo. old mice inclusions are
extensive
(Shilling 2001). The increase in cytoplasmic and nuclear EM48 immuno-
reactivity, and in EM48 immuno-reactive inclusions over time allow
quantitative
comparisons between transduced and untransduced cells. Again, control values
are obtained from mice injected with shlacZ-expressing vectors, saline
injected
mice, and wt mice. The contralateral region is used as another control, with
care
taken to keep in mind the possibility of retrograde and anterograde transport
of
virus from the injection site.
Quantitation of nuclear inclusions is done using BioQuantTM software in
conjunction with a Leitz DM RBE upright microscope equipped with a
motorized stage (Applied Scientific Instruments). Briefly, floating sections
are
stained with anti-NeuN (AMCA secondary) and EM48 antibodies (rhodamine
secondary) followed by mounting onto slides. The regions to be analyzed are
outlined, and threshold levels for EM48 immunoreactivity set using sections
from control injected mice. A minimum of 50 hrGFP-positive and hrGFP
negative neurons cells are evaluated per slide (5 slides/mouse), and inclusion
intensity measured (arbitrary units). This is done for both striata and
cortices.
To quantitate cytoplasmic inclusions, the striatum is outlined and total EM48
aggregate density measured. Threshold values are again done using control
hemispheres and control injected mice.
Additional wells of sections are stained with anti-GFAP, anti-
neurofilament, and the lectin GSA to assay for viral or viral + hairpin
induced
146
CA 02596588 2013-08-13
gliosis, neuritic changes, and microglial activation, respectively. GFAP-
stained
brain sections from N171-82Q mice show gliosis by 4 months, although earlier
time points have not been reported.
Stereology. In a separate experiment on N171-82Q mice and wt mice,
unbiased stereology using BioQuantTM software is done to assess transduction
efficiency. Stereology allows for an unbiased assessment of efficiency of
transduction (number of cells transduced/input). AAV5 (AAV5hrGFP,
AAV5shHD.hrGFP) and FIV (VSVg.FIVhrGFP, VSVg.FIVshHD.hrGFP)
transduction efficiency is compared in the striatum and somatosensory cortex
in
HD and wildtype mice, with n=5 each. Mice are harvested at 12 and 20 weeks.
The cerebrum is sectioned in its entirety and stored at ¨20 C until analysis.
Briefly, six weeks after gene transfer with VSVg.FIVhrGFP (n=3) or
AAV5hrGFP (n=3), every section of an HD mouse cerebrum is mounted and an
initial assessment of the required numbers of sections and grid and dissector
size
done using the coefficient of error (as determined by Martheron's quadratic
approximation fonnula) as a guide.
The 171-82Q HD mouse model has important neuropathological and
behavioral characteristics relevant to HD. Onset of disease occurs earlier
than
HD knock-in or YAC transgenic models, allowing an initial, important
assessment of the protective effects of RNAi on the development of
neuropathology and dysfunctional behavior, without incurring extensive long
tenn housing costs. Admittedly, disease onset is slower and less aggressive
than
the R6/2 mice created by Bates and colleagues (Mangiarini 1996), but the R6/2
line is difficult to maintain and disease is so severe that it may be less
applicable
and less predicative of efficacy in clinical trials.
N171-82Q mice (n=6/group) and age-matched littennates (n=6/group)
are be weighed twice a month from 4 wks on, and baseline rotarod tests
performed at 5 and 7 weeks of age. Numbers of mice per group are as described
in Schilling et al (Shilling 1999) in which statistically significant
differences
between N171-82Q and wildtype littermates were described. At 7 weeks of age
(after testing is complete), AAV (AAVshHDEx2.2, AAVshlacZ, AAVhrGFP,
147
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
saline) or FIV (FTVshEx2.2, FIVshlacZ, FIVhrGFP, saline) is injected
bilaterally
into the striatum and cortex. Rotarod tests are repeated at 3-week intervals
starting at age 9 weeks, until sacrifice at 6 months. The clasping behavior is
assessed monthly starting at 3 months.
Behavioral testing. N171-82Q mice are given four behavioral tests, all of
which are standard assays for progressive disease in BD mouse models. The
tests allow comparisons of behavioral changes resulting from RNAi to those
incurred in HD mouse models given other experimental therapies. For example,
HD mice given cystamine or creatine therapy showed delayed impairments in
rotarod performance, and in some cases delayed weight loss (Ferrante 2000,
Dedeoglu 2002, Dedeogu 2003) In addition to the rotarod, which is used to
assay for motor performance and general neurological dysfunction, the activity
monitor allows assessment of the documented progressive hypoactivity in N171-
82Q mice. The beam analysis is a second test of motor performance that has
also been used in BD mice models (Carter 1999). Clasping, a phenotype of
generalized neurological dysfunction, is straightforward and takes little
time.
Clasping phenotypes were corrected in R. Hen's transgenic mice possessing an
inducible mutant htt.
Accelerated rotarod. N171-82Q and age-matched littermates are
habituated to the rotarod at week 4, and 4 trials per day for 4 days done on
week
5 and 7, and every 3 weeks hence using previously described assays (Shilling
1999, Clark 1997) in use in the lab. Briefly, 10 min trials are run on an
Economex rotarod (Columbus Instruments) set to accelerate from 4 to 40 rpm
over the course of the assay. Latency to fall is recorded and averages/group
determined and plotted. Based on prior work (Shilling 1999) 6 mice will give
sufficient power to assess significance.
Clasping behavior. Normal mice splay their limbs when suspended, but
mice with neurological deficits can exhibit the opposite, with fore and hind
limbs
crunched into the abdomen (clasping). All mice are suspended and scored for
clasping monthly. The clasp must be maintained for at least 30 sec. to be
scored
positive.
148
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Activity monitor. Most HD models demonstrate hypokinetic behavior,
particularly later in the disease process. This can be measured in several
ways.
One of the simplest methods is to monitor home cage activity with an infrared
sensor (AB-system 4.0, Neurosci Co., LTD). Measurements are taken over 3
days with one day prior habituation to the testing cage (standard 12-hour
light/dark cycle). Activity monitoring is done at 12, 17, and 20 and 23 weeks
of
age.
Beam walking. N171Q-82Q and age matched littermates are assayed for
motor performance and coordination using a series of successively more
difficult
beams en route to an enclosed safety platform. The assay is as described by
Carter et al (Carter 1999). Briefly, 1 meter-length beams of 28, 17 or 11 mm
diameter are placed 50 cm above the bench surface. A support stand and the
enclosed goal box flank the ends. Mice are trained on the 11 mm beam at 6
weeks of age over 4 days, with 3 trials per day. If mice can traverse the beam
in
<20 sec. trials are initiated. A trial is then run on each beam, largest to
smallest,
with a 60 sec cutoff/beam and one minute rest between beams. A second trial is
run and the mean scores of the two trials evaluated.
RNAi cannot replace neurons; it only has the potential to protect non-
diseased neurons, or inhibit further progression of disease at a point prior
to cell
death. N171-82Q mice do not show noticeable cellular loss, and is therefore an
excellent model of early HD in humans. The general methodology is the similar
to that described above, except that the viruses are injected at 4 months,
when
N171-82Q mice have measurable behavioral dysfunction and inclusions.
Animals are sacrificed at end stage disease or at 8 months, whichever comes
first. Histology, RNA and protein in harvested brains are analyzed as
described
above.
It is important to confirm the biological effects of virally expressed
shaDs in a second mouse model, as it is with any therapy. The Detloff knock-in
mouse (the CHL2 line, also notated as HdhCAGQ150) is used as a second model
of early HD disease phenotypes. These mice have a CAG expansion of
approximately 150 units, causing brain pathologies similar to HD including
149
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
gliosis and neural inclusions in the cortex and striatum. They also show
progressive motor dysfunction and other behavioral manifestations including
rotarod deficits, clasping, gait abnormalities and hypoactivity.
Heterozygous CHL2 mice express the mutant and wildtype allele at
roughly equivalent levels, and shRNAs directed against mouse HD silence both
transcripts. shmHDEx2.1 causes reductions in gene expression, but not
complete silencing. Disease severity in mouse models is dependent on mutant
htt levels and CAG repeat length.
The inventors created shmHDEx2 (shRNA for murine HD) directed
against a region in mouse exon 2 that reduces expression of the full-length
mouse Hdh transcript in vitro. Transduction of neurons with shmHDEx2-
expressing viruses, and its impacts on neuropathological progression,
behavioral
dysfunction and the appearance of EM48 immuno-reactive inclusions in CHL2
mice is tested. shmHD-or shlacZ-expressing vectors in CHL2 and wildtype
brain is tested. In this experiment, virus is injected into the striatum of wt
or
CHL2 mice (10/group) using the coordinates described above, at 3 months of
age. Two months later mice are sacrificed and brains removed and processed for
RNA (n=5/group) and protein (n=5).
A second study tests the vectors in the Detloff model. Briefly, 15 mice
per group are injected into the striatum and cortex at 3 months of age with
AAV
(AAVshmHD, AAVshlacZ, AAVhrGFP, saline) or FIV (VSVg.FIV.shmHD,
VSVg.FIVshlacZ, VSVg.FIVhrGFP, saline) expressing the transgenes indicated.
To assess the impact of RNAi, activity performed. The mice are sacrificed at
16-18 months of age and five brains/group are processed for histology and
sections banked in 24-well tissue culture plates. The remaining brains are
processed for RNA (n=6) and protein analysis (n=5). Northern blots or western
blots are required to analyze wildtype and mutant htt expression because the
only distinguishing characteristic is size.
150
CA 02596588 2013-08-13
Development of effective allele-specific siRNAs
Mutant htt leads to a toxic gain of function, and inhibiting expression of the
mutant allele has a profound impact on disease (Yamamoto 2000). Also,
selectively
targeting the disease allele would be desirable if non-disease allele
silencing is
deleterious. At the present time, there is one documented disease linked
polymorphism in exon 58 (Lin 2001). Most non-HD individuals have 4 GAGs in
Hdh exon 58 while 38% of HD patients have 3 GAGs. As described above, RNAi
can be accomplished against the 3-GAG repeat.
Prior work by the inventors showed the importance of using full-length
targets for testing putative shRNAs. In some cases, shRNAs would work against
truncated, but not full-length targets, or vice-versa. Thus, it is imperative
that
testable, full-length constructs are made to confirm allele-specific
silencing. The V5
and FLAG tags provide epitopes to evaluate silencing at the mRNA and protein
levels. This is important as putative shRNAs may behave as miRNAs, leading to
inhibition of expression but not message degradation.
Designing the siRNAs. Methods are known for designing siRNAs (Miller 2003,
Gonzalez-Alegre 2003, Xia 2002, Kao et al., -BACE1 suppression by RNA
interference
in primary cortical neurons," J Biol Chem. 2004 Jan 16;279(3):1942-9).
Information is
also know about the importance of maintaining flexibility at the 5' end of the
antisense
strand for loading of the appropriate antisense sequence into the RISC complex
(Khvorova 2003; Schwarz et al. "Evidence that siRNAs function as guides, not
primers,
in the Drosophila and human RNAi pathways,- Mol. Cell. 10(3): 537-48 (2002)).
DNA
sequences are generated by PCR. This method allows the rapid generation of
many
candidate shRNAs, and it is significantly cheaper than buying shRNAs. Also,
the
inserts can be cloned readily into our vector shuttle plasmids for generation
of virus.
The reverse primer is a long oligonucleotide encoding the antisense sequence,
the loop,
the sense sequence, and a portion of the human U6 promoter. The forward primer
is
specific to the template in the PCR reaction. PCR products are cloned directly
into
pTOPO blunt from InVitrogen, plasmids transformed into DH5a, and bacteria
plated
onto Kanr plates (the PCR template is Ampr). Kanr clones are picked and
sequenced.
Sequencing is done with an extended 'hot start' to allow effective read-
through of the
hairpin. Correct clones are transfected into cells along with plasmids
expressing the
target or control sequence
151
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
(HttEx58.GAG3V5 and HttEx58.GAG4FLAG, respectively) and silencing
evaluated by western blot. Reductions in target mRNA levels are assayed by Q-
RTPCR. The control for western loading is neomycin phosphotransferase or
lu-GFP, which are expressed in the target-containing plasmids and provide
excellent internal controls for transfection efficiency. The control for Q-
RTPCR
is FIPRT.
Cell lines expressing targets with the identified polymorphism or control
wildtype sequences are created. Target gene expression are under control of an
inducible promoter. PC6-3, Tet repressor (TetR+) cells, a PC-12 derivative
with
a uniform neuronal phenotype (Xia 2002) are used. PC6-3 cells are transfected
with plasmids expressing HDEx58.GAG3V5 (contains neo marker) and
HDEx58GAG4FLG (contains puro marker), and G418+/puromycin+ positive
clones selected and characterized for transcript levels and htt-V5 or htt-Flag
protein levels.
FIV vectors expressing the allele specific shRNAs are generated and
used to test silencing in the inducible cell lines. FIV vectors infect most
epithelial and neuronal cell lines with high efficiency and are therefore
useful for
this purpose. They also efficiently infect PC6-3 cells. AAV vectors are
currently less effective in in vitro screening because of poor transduction
efficiency in many cultured cell lines.
Cells are transduced with 1 to 50 infectious units/cell in 24-well dishes, 3
days after induction of mutant gene expression. Cells are harvested 72 h after
infection and the effects on HDEx58.GAG3V5 or BDEx58GAG4FLG
expression monitored.
Example 7
Micro RNAi-Therapy for Polyglutamine Disease
Post-transcriptional gene silencing occurs when double stranded RNA
(dsRNA) is introduced or naturally expressed in cells. RNA interference (RNAi)
has been described in plants (quelling), nematodes, and Drosophila. This
152
CA 02596588 2013-08-13
process serves at least two roles, one as an innate defense mechanism, and
another
developmental (Waterhouse 2001 Fire 1999, Lau 2001, Lagos-Quintana 2001, Lee
2001). RNAi may regulate developmental expression of genes via the processing
of
small, temporally expressed RNAs, also called microRNAs (Knight 2001, Grishok
2001). Harnessing a cell's ability to respond specifically to small dsRNAs for
target
mRNA degradation has been a major advance, allowing rapid evaluation of gene
function (Gonczy 2000, Fire 1998, Kennerdell 1998, Hannon, -RNA interference,"
Nature, 2002; 418:244-251; Shi et al., "Genetic interference in Trypanosoma
brucei by
heritable and inducible double-stranded RNA," RNA, 2000, 6:1069-1076; Sui et
al., "A
DNA vector-based RNAi technology to suppress gene expression in mammalian
cells,"
Proc Natl Acad Sci U S A., 2002, 99(8):5515-5520).
Most eukaryotes encode a substantial number of small noncoding RNAs termed
micro RNAs (miRNAs) (Zeng 2003, Tijsterman et al., "Dicers at RISC; the
mechanism
of RNAi," Cell, 2004, 117(1):1-3; Lee 2004, Pham 2004). mir-30 is a 22-
nucleotide
human miRNA that can be naturally processed from a longer transcript bearing
the
proposed miR-30 stem-loop precursor. mir-30 can translationally inhibit an
mRNA-
bearing artificial target sites. The mir-30 precursor stem can be substituted
with a
heterologous stem, which can be processed to yield novel miRNAs and can block
the
expression of endogenous mRNAs.
Huntington's disease (HD) and Spinocerebellar ataxia type I (SCA1) are two of
a class of dominant, neurodegenerative diseases caused by a polyglutamine
(polyQ)
expansion. The mutation confers a toxic gain of function to the protein, with
polyQ
length predictive of age of onset and disease severity. There is no curative
or
preventative therapy for HD or SCA1, supporting the investigation of novel
strategies.
As described above, the inventors showed that gene silencing by RNA
interference
(RNAi) can be achieved in vitro and in vivo by expressing short hairpin RNAs
(shRNAs) specific for mRNAs encoding ataxin-1 or huntingtin. Currently,
strong,
constitutive po 1 III promoters (U6 and HO are used to express shRNAs, which
are
subsequently processed into functional small interfering RNAs (siRNAs).
However,
strong, constitutive expression of shRNAs may be inappropriate for diseases
that take
several decades to manifest. Moreover, high-level expression may be
unnecessary for
sustained benefit, and in some systems may induce a non-specific interferon
response
leading to global shut-down of gene expression. The inventors
153
CA 02596588 2013-08-13
therefore generated polII-expressed microRNAs (miRNAs) as siRNA shuttles as
an alternative strategy. Due to their endogenous nature, miRNA backbones may
prevent the induction of the interferon response.
Using human mir-30 as a template, miRNA shuttles were designed that
upon processing by dicer released siRNAs specific for ataxin-1. Briefly, the
constructs were made by cloning a promoter (such as an inducible promoter) and
an miRNA shuttle containing an embedded siRNA specific for a target sequence
(such as ataxin-1) into a viral vector. By cloning the construct into a viral
vector, the construct can be effectively introduced in vivo using the methods
described in the Examples above. Constructs containing polII-expressed
miRNA shuttles with embedded ataxin-1 -specific siRNAs were co-transfected
into cells with GFP-tagged ataxin-1, and gene silencing was assessed by
fluorescence microscopy and western analysis. Dramatic arid dose-dependent
gene silencing relative to non-specific miRNAs carrying control siRNAs was
observed. This polII-based expression system exploits the structure of known
miRNAs and supports tissue-specific as well as inducible siRNA expression, and
thus, serves as a unique and powerful alternative to dominant
neurodegenerative
disease therapy by RNAi.
Briefly, the constructs were made by cloning a promoter (such as an
inducible promoter) and an miRNA shuttle containing an embedded siRNA
specific for a target sequence (such as ataxin-1) into a viral vector. By
cloning
the construct into a viral vector, the construct can be effectively introduced
in
vivo using the methods described in the Examples above.
While in the foregoing specification this invention has been described in
relation to certain embodiments thereof, and many details have been set forth
for
purposes of illustration, it will be apparent to those skilled in the art that
the
invention is susceptible to additional embodiments and that certain of the
details
described herein may be varied considerably without departing from the basic
principles of the invention.
154
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Citations
Adelman et cd., DNA, 2, 183 (1983).
= Alisky et al., Hum Gen Ther, 11,2315 (2000b).
Alisky et al., NeuroReport, 11,2669 (2000a).
Altschul et al., JMB, 215, 403 (1990).
Altschul et al., Nucleic Acids Res. 25, 3389 (1997).
Ambrose et al., Somat Cell Mol Genet.20, 27-38 (1994)
Anderson et al., Gene Ther., 7(12), 1034-8 0000).
Andreason and Evans, Biotechniques, 6, 650 (1988).
Augood et al,. Neurology, 59, 445-8 (2002).
Augood etal., Ann. Neurol., 46, 761-769 (1999).
Bass, Nature, 411, 428 (2001).
Batzer etal., Nucl. Acids Res.,19, 508 (1991).
Baulcombe, Plant Mol. Biol., 32, 79 (1996).
Bates etal., Cuff Opin Neurol 16:465-470, 2003.
Behr etal., Proc. Natl. Acad. Sci. USA, 86, 6982 (1989).
Bernstein et al., Nature, 409, 363 (2001).
Bledsoe et al., NatBiot, 18, 964 (2000).
Brantl, Biochemica and Biophysica Acta, 1575, 15 (2002).
Brash etal., Molec. Cell. Biol., 7, 2031 (1987).
Breakefield etal., Neuron, 31, 9-12 (2001).
Bridge etal., Nat Genet 34:263-264, 2003.
Brooks etal., Proc. Natl. Acad. Sci. U. S. A., 99,6216 (2002).
Brummelkamp, T.R. et al., Science 296:550-553 (2002).
Burright, E.N. etal., Cell, 82, 937-948 (1995)
Capecchi, Cell, 22, 479 (1980).
Caplan etal., Proc. Natl. Acad. Sci. U. S. A., 98, 9742 (2001).
Caplen etal., Hum. Mol. Genet., 11(2), 175-84 (2002).
Carter etal., J Neurosci 19:3248, 1999.
Cemal etal., Hum. Mol. Genet., 11(9), 1075-94 (2002).
155
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Chai et al., Hum. Mol. Genet., 8, 673-682 (1999b).
Chai et al., J. Neurosci., 19, 10338 (1999).
Chan et al., Hum Mol Genet., 9(19), 2811-20 (2000).
Chen, H.K. et al., Cell, 113, 457-68 (2003)
Chiu and Rana, Mol. Cell., 10(3), 549-61 (2002).
Clark, H.B. et aL, J. Neurosci., 17(19), 7385-7395 (1997)Cogoni et al.,
Antonie Van Leeuwenhoek, 65, 205 (1994).
Corpet et al., Nucl. Acids Res., 16, 10881 (1988).
Crea et al., Proc. Natl. Acad. Sci. U.S.A., 75, 5765 (1978).
Cullen, Nat. Immunol., 3, 597-9 (2002).
Cummings, C.J. et aL, Nat. Genet., 19(2), 148-154 (1998)
Davidson et al., Proc. Natl. Acad. Sci. U. S. A., 97, 3428 (2000).
Davidson, B.L. et aL, The Lancet Neurol., 3, 145-149 (2004)
Davidson et al., Nat Rev Neurosci 4:353-364, 2003.
Dayhoff et al., Atlas of Protein Sequence and Structure (Natl. Biomed.
Res. Found. 1978)
Dedeoglu et al., JNeurochem 85:1359-1367, 2003.
Dedeoglu et aL, J Neurosci 22:8942-8950, 2002.
Doheny et aL, Neurology, 59, 1244-1246 (2002).
Donze and Picard, Nucleic Acids Res., 30(10) (2002).
During et al., Gene Ther 5:820-827, 1998.
Elbashir et al., EMBO J., 20(23), 6877-88 (2001c).
Elbashir et al., Genes and Development, 15, 188 (2001).
Elbashir et al., Nature, 411, 494 (2001).
Emamian, E.S. et aL, Neuron, 38, 375-87 (2003)
Fain et al., Adv. Neurol., 78, 1-10 (1998).
Feigner et aL, Proc. Natl. Acad. Sci., 84, 7413 (1987).
Fernandez-Funez, P. et al., Nature, 408, 101-106 (2000)
Ferrante et al., J Neurosci 20:4389-4397, 2000.
Fire et aL, Nature, 391(6669), 806-11 (1998).
Fire A. Trends Genet 15(9):358-363, 1999
156
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Frisella etal., Mol Ther 3(3):351-358, 2001.
Gaspar etal., Am. J. Hum. Genet., 68(2), 523-8 (2001).
Gelfand, PCR Strategies, Academic Press (1995).
Gitlin etal., Nature, 418(6896), 430-4 (2002).
0 Goeddel etal., Nucleic Acids Res., 8, 4057 (1980).
Gonczy etal., Nature 408:331-336, 2000.
Gonzalez-Alegre etal., Nat Genet 3:219-223, 1993. Goodchild etal., Mov.
Disord., 17(5), 958, Abstract (2002).
Grishok etal., Cell 106:23-34, 2001.
Hamilton and Baulcombe, Science, 286, 950 (1999).
Hammond etal., Nature, 404, 293 (2000).
Harper et al., Meth Mol Biol. In Press 2004
Hewett et al., Hum. Mol. Gen., 9, 1403-1413 (2000).
Higgins etal., CABIOS, 5, 151 (1989).
Higgins etal., Gene, 73, 237 (1988).
Hilberg etal., Proc. Natl. Acad. Sci. USA, 84, 5232 (1987).
Holland etal., Proc. Natl. Acad. Sci. USA, 84, 8662 (1987).
Hornykiewicz et al., N. Engl. J. Med,. 315, 347-353 (1986).
Huang etal., CABIOS, 8, 155 (1992).
Hutton et al., Nature, 393, 702-705 (1998).
Innis and Gelfand, PCR Methods Manual, Academic Press (1999).
Innis et al., PCR Protocols, Academic Press (1995).
Jacque etal., Nature, 418(6896), 435-8 (2002).
Johnston, Nature, 346, 776 (1990).
Kang etal., J Virol 76:9378-9388, 2002.
Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 87, 2264 (1990).
Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90, 5873 (1993)
Kennerdell and Carthew, Cell, 95, 1017 (1998).
Kao etal., J Biol Chem 2003.
Kawasaki, H., etal., Nucleic Acids Res, 31, 981-7 (2003)
Khvorova, A., etal., Cell, 115, 505 (2003)
157
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Kitabwalla and Ruprecht, N. Engl. J. Med., 347, 1364-1367 (2002).
Klein et al., Ann. Neurol., 52, 675-679 (2002).
Klein et al., Cuff. Opin. Neurol., 4, 491-7 (2002).
Klement, I.A. etal., Cell, 95, 41-53 (1998)
Knight etal., Science 293:2269-2271, 2001.
Konakova et al., Arch. Neurol., 58, 921-927 (2001).
Krichevsky and Kosik, Proc. Natl. Acad. Sci. U.S.A., 99(18),11926-9
(2002).
Kriegler, M. Gene Transfer and Expression, A Laboratory Manual, W.H.
Freeman Co, New York, (1990).
Kunath etal., Nat Biotechnol 21:559-561, 2003.
Kunkel etal., Meth. Enzymol., 154, 367 (1987).
Kunkel, Proc. Natl. Acad. Sci. USA, 82, 488 (1985).
Kustedjo et al., J. Biol. Chem., 275, 27933-27939 (2000).
Laccone etal., Hum. Mutat., 13(6), 497-502 (1999).
Lagos-Quintana etal., Science 294:853-858, 2001.
Lai etal., Proc. Natl. Acad. Sci. USA, 86, 10006 (1989).
Larrick, J. W. and Burck, K. L., Gene Therapy. Application of Molecular
Biology, Elsevier Science Publishing Co., Inc., New York, p. 71-104 (1991).
Lau etal., Science 294:858-862, 2001.
Lawn etal., Nucleic Acids Res., 9, 6103 (1981).
Lee, N.S., et al., Nat. Biotechnol. 19:500-505 (2002).
Lee etal., Science 294:862-864, 2001.
Lee etal., Cell, 117, 69-81 (2004)
Leger etal., J. Cell. Sci., 107, 3403-12 (1994).
Leung etal., Ne-urogenetics, 3, 133-43 (2001).
Li et al., Nat Genet 25:385-389, 2000.
Lin etal., Hum. Mol. Genet., 10(2), 137-44 (2001).
Loeffler etal., J. Neurochem., 54, 1812 (1990).
Lotery etal., Hum Gene Ther 13:689-696, 2002.
Mangiarini et al., Cell 87(3):493-506, 1996.
158
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Manche et al., Mol. Cell Biol., 12, 5238 (1992).
Margolis and Ross, Trends Mol. Med., 7, 479 (2001).
Martinez et al., Cell, 110(5), 563-74 (2002).
McCaffrey et al., Nature, 418(6893), 38-9 (2002).
McManus and Sharp, Nat. Rev. Genet. 3(10), 737-47 (2002).
Meade et al.,J Comp Neurol 449:241-269, 2002.
Meinkoth and Wahl, Anal. Biochem., 138, 267 (1984).
Methods in Molecular Biology, 7, Gene Transfer and Expression
Protocols, Ed. E. J. Murray, Humana Press (1991).
Miller, etal., Mol. Cell. Biol., 10, 4239 (1990).
Miller, V.M. etal., PNAS USA, 100, 7195-200 (2003)
Minks et al.,J. Biol. Chem., 254, 10180 (1979).
Miyagishi, M. & Taira, K. Nat. BiotechnoL 19:497-500 (2002).
Moulder et al., J. Neurosci., 19, 705 (1999).
Murray, E. J., ed. Methods in Molecular Biology, Vol. 7, Humana Press
Inc., Clifton, N.J., (1991).
Myers and Miller, CABIOS, 4, 11 (1988).
Nasir etal., Cell, 81, 811-823 (1995).
Needleman and Wunsch, JMB, 48, 443 (1970).
Nykanen etal., Cell, 107, 309 (2001).
Ogura and Wilkinson, Genes Cells, 6, 575-97 (2001).
Ohtsuka etal., JBC, 260, 2605 (1985).
Okabe etal., FEBS Lett., 407, 313 (1997).
Ooboshi etal., Arterioscler. Thromb. Vasc. Biol., 17, 1786 (1997).
On etal., Nat. Genet. 4, 221-226 (1993)
Orr etal., Cell 101:1-4, 2000.
Ozelius etal., Genomics, 62, 377-84 (1999).
Ozelius etal., Nature Genetics, 17, 40-48 (1997).
Passini etal., J Virol 77:7034-7040, 2003.
Paul, C.P., et al.,Nat. BiotechnoL 19:505-508 (2002).
Paulson et al., Ann. Neurol., 41(4), 453-62 (1997).
159
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85, 2444 (1988).
Pearson et al., Meth. Mol. Biol., 24, 307 (1994).
Pham et al., Cell, 117:83-94 (2004)
Pittman et al., J. Neurosci.;13(9), 3669-80 (1993).
Plasterk et al., Cell, 117, 1-4 (2004)
Poorkaj et al., Ann. Neurol., 43, 815-825 (1998).
Quantin, B., et al., Proc. Natl. Acad. Sci. USA, 89, 2581 (1992).
Reynolds, A. et al., Nat. Biotechnol,. 22, 326-30 (2004)
Rosenfeld, M. A., et al., Science, 252, 431 (1991).
Rossolini et al., Mol. Cell. Probes, 8, 91 (1994).
Rubinson et al., Nat Genet 33:401-406, 2003.
Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory Press Cold Spring Harbor, NY (2001).
Scharfmann et al., Proc. Natl. Acad. Sci. USA, 88, 4626 (1991).
Schilling et al., Hum Mol Genet 8(3):397-407, 1999.
Schilling et al., Neurobiol Dis 8:405-418, 2001.
Schwarz et al., Mol. Cell., 10(3), 537-48 (2002).
Shipley et al., J. Biol. Chem., 268, 12193 (1993).
Skinner, P.J. et al., Nature, 389, 971-234 (1997)
Skorupa et al., Exp Neurol 160:17-27, 1999.
Sledz et al., Nat Cell Biol 5:834-839, 2003.
Smith et al., Adv. Appl. Math., 2, 482 (1981).
Stein et al., J. Virol., 73, 3424 (1999).
Stein et al., Mol Ther 3(6):850-856, 2001.
Stein et al., RNA, 9(2), 187-192 (2003).
Svoboda et al., Development, 127, 4147 (2000).
Tanemura et al., J. Neurosci., 22(1), 133-41 (2002).
Tang et al., Genes Dev., 17(1), 49-63 (2003).
Ternin, H., "Retrovirus vectors for gene transfer", in Gene Transfer,
Kucherlapati R, Ed., pp 149-187, Plenum, (1986).
160
CA 02596588 2007-07-30
WO 2006/083800
PCT/US2006/003298
Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology
Hybridization with Nucleic Acid Probes, part I chapter 2 "Overview of
principles of hybridization and the strategy of nucleic acid probe assays"
Elsevier, New York (1993).
Timmons and Fire, Nature, 395, 854 (1998).
Trottier et aL, Nature, 378(6555), 403-6 (1995).
Turner et al., Mol. Biotech., 3, 225 (1995).
Tuschl, Nat. Biotechnol., 20, 446-8 (2002).
Urabe, M., et al., Hum. Gene Ther., 13, 1935-1943 (2002)
Valerio et al., Gene, 84, 419 (1989).
Viera et al., Meth. Enzymol., 153, 3 (1987).
Walker and Gaastra, Techniques in Mol. Biol. (MacMillan Publishing
Co. (1983).
Walker et al., Neurology, 58, 120-4 (2002).
Waterhouse et al., Proc. Natl. Acad. Sci. U. S. A., 95, 13959 (1998).
Waterhouse et al., Nature 411:834-842, 2001.
Wianny and Zernicka-Goetz, Nat. Cell Biol., 2, 70 (2000).
Xia et al., Nat. Biotechnol., 19, 640 (2001).
Xia et al., Nat. Biotechnol., 20(10), 1006-10 (2002).
Xiao et al.,. Exp Neurol 144:113-124, 1997.
Yamamoto et al., Cell, 101(1), 57-66 (2000).
Yang et al., Mol. Cell Biol., 21, 7807 (2001).
Yu et al., Proc. Natl. Acad. Sci., 99, 6047-6052 (2002).
Yu et al., J Neurosci 23:2193-2202, 2003.
Zamore et al., Cell, 101, 25 (2000).
Zeng et al., RNA, 9:112-123 (2003)
Zhou et al., J Cell Biol 163:109-118, 2003.
Zoghbi and Orr, Annu. Rev. Neurosci., 23, 217-47 (2000).
Zoghbi et al., Semin Cell Biol., 6, 29-35 (1995)
Zu, T. et al., In Preparation (2004)
161
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
