Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02604066 2007-10-29
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME OF '2
NOTE: For additional volumes please contact the Canadian Patent Office.
CA 02604066 2007-10-29
COMPOSITIONS AND METHODS FOR DIAGNOSING OR TREATING PSORIASIS
FIELD OF THE INVENTION
The present invention relates generally to polynucleotides, polypeptides,
antibodies and methods for the diagnosis of psoriasis, and/or the amelioration
of the
symptoms of psoriasis.
BACKGROUND OF THE INVENTION
Psoriasis is a chronic inflammatory dermatosis that affects about 2% of the
Caucasian population. It is characterized by hyperproliferation of epidermal
cells and
inflammation resulting from infiltration of activated T-helper cells and
mononuclear cells
and release of pro-inflammatory cytokines (Menter and Barker, Lancet 338:231,
1991;
Barker, Lancet 338:227, 1991). It may also be associated with arthritis and
can present as
a severely inflammatory dermatosis in patients with acquired immunodeficiency
syndrome (AIDS) (Duvic, J. Invest. Dermatol. 95:385, 1990). The symptoms of
psoriasis
include sharply defined erythematous patches covered with a distinctive scale,
hyperproliferation of the epidermis, incomplete differentiation of
keratinocytes and
dermal inflammation. Clinical variants of psoriasis include erythroderma,
seborrheic,
inverse, guttate, and photosensitive psoriasis, pustular variants and Reiter's
disease.
The role of immunomodulation in psoriasis is supported by the pharmacological
action of drugs such as cyclosporine. For example, inhibition of the synthesis
of
interleuldn-2 prevents the proliferation of T-cells and thus their release of
cytokines.
Mediators of inflammation play a role in the immunoregulation of psoriasis.
Currently
available methods for treatment ' include topical therapy, phototherapy,
photochemotherapy and systemic therapy and provide, at best, only temporary
relief.
Topical glucocorticoids are most commonly prescribed as the initial treatment
of
psoriasis for their anti-inflammatory, antimitotic and aritipruritic effects.
However, their
efficacy is often short term. Crude coal tar is a complex mixture of thousands
of
hydrocarbon compounds and affects psoriasis by enzyme inhibition and
antimitotic
action. Although effective, tar stains the skin and has an odor. Anthralin
(dithranol) is
used topically and inhibits enzyme metabolism and reduces epidermal mitotic
turnover.
Remission may last for weeks to months. Phototherapy and photochemotherapy
entailing
the administration of the photosensitizing drug methoxsalen are only
temporarily
-1-
CA 02604066 2007-10-29
effective, as psoriasis recurs months after this treatment is discontinued.
This recurrence
indicates that the therapy is palliative rather than curative. Long-term
consequences are
altered immunologic effects and an increased risk of carcinogenesis.
Methotrexate is the most commonly administered systemic cytotoxic agent for
widespread psoriasis. Contraindications are numerous and after withdrawal,
psoriatic
symptoms may be more severe than= during earlier episodes. Hydroxyurea,
etretinate,
cyclosporine, and AZT are also systemic medications used for the control of
psoriasis and
all have serious side effects. Clearly, an understanding of the pathogenesis
of psoriasis
remains an important challenge in dermatologic medical treatment.
Associations between psoriasis and certain human lymphocyte antigen (HLA)
alleles have been described. This factor has been used to support the
hypothesis that
psoriasis is a T-cell-mediated, autoimmune disorder (Bos, Bf : J. Dermatol.
118:141,
1988; Baadsgaard et al., Proc. Nat. Acad. Sci. USA 87:4256, 1990; Ortonne, Br.
J.
Dermatol. 140:1, 1999). The presence of the HLA-Cw6 allele may predispose to
psoriasis because there is a strong association between age of onset, family
history, and
the presence of HLA-Cw6, B-13 and B-w-57 (Henseler and Christophers, J. Am.
Acaa:
Dermatol. 13:450, 1985; Christophers and Henseler, Acta Dermato-Yenereol.
Suppl.,
151:88, 1989; Elder et al., Arch. Dermatol. 130:216, 1994). The relative risk
of HLA-
Cw6 carriers developing psoriasis is 20 (Talkainen et al., Br. J. Dermatol.
192:179 1980).
This association between psoriasis and HLA indicates that certain HLA alleles
are more
frequent in psoriasis patients than in controls. 'Loci are "linked" when they
do not assort
independently at meiosis.
Monozygotic twins have significantly higher concordance rates of disease
generally than dizygotic twins (Brandrup et al., Arch. Dermatol. 114:874,
1978; Watson
et al., Arch. Dermatol. 105:197, 1972). Psoriasis has also been reported to
aggregate in
some families (Pietrzyk et al., Arch. Dermatol. Res. 273:295, 1982; Karvonen
et al., Ann.
Clin. Res.,8:298, 1976; Civatte et al., Ann. Dermatol. Venereol. 104:525,
1977; Espinoza
et al., J. Rheumatol. 7:445, 1980). The aggregation of psoriasis in families
suggests that
psoriasis can be inherited as an autosomal dominant trait with penetrance
values of 10 to
50%. About 30% of psoriasis patients have a frst degree relative with the
disease
(Barker, 1991, supra).
-2-
CA 02604066 2007-10-29
A need continues to exist in the medical arts for preparations and techniques
for
both diagnosing and treating psoriasis and psoriasis-like conditions that have
less severe
side 'effects and are more effective in treating the source of the disease.
The present
invention is directed to compositions, including polynucleotides, polypeptides
and
antibodies, and methods useful for the diagnosis of psoriasis and/or the
amelior.ation of
the symptoms of psoriasis.
SI.TMMARY OF THE INVENTION
In one aspect, the present invention provides isolated cDNA molecules that
encode a CAN-1 polypeptide. An exemplary CAN-1 cDNA of the invention is set
forth
in SEQ ID NO:1, and encodes the CAN-1 polypeptide set forth in SEQ ID NO:2.
The
CAN-1 polypeptide of SEQ ID NO:3 is the mature fonn of the CAN-1 polypeptide
of
SEQ ID NO:2 and lacks an amino termi.nal signal sequence. Thus, for example,
the
present invention encompasses isolated cDNA molecules that encode a CAN-1
polypeptide that is at least 80% identical, at least 90% identical, at least
95% identical or
at least 99% identical to a CAN-1 polypeptide consisting of an amino acid
sequence set
forth in SEQ ID NO:2 or SEQ ID NO:3.
The present invention also encompasses isolated cDNA molecules, that encode a
CAN-1 polypeptide, and that are at least 70% (such as at least 80%, at least
90%, at least
95% or at least 99%) identical to the nucleic acid molecule of SEQ ID NO:1.
The present
invention also encompasses isolated cDNA molecules that hybridize under
conditions of
2 X SSC at 55 C for 30 minutes to the complement of the cDNA molecule set
forth in
SEQ ID NO:1.
In another aspect, the present invention provides isolated nucleic acid
molecules
that are at least 70% identical (such as at least 80%, at least 90%, at least
95% or at least
99% identical) to the portion of the CAN-i eDNA of SEQ ID NO:1 extending from
nucleotide 1 through nucleotide 551 of SEQ ID NO:1, or to the complement of
the
foregoing portion of the eDNA of SEQ ID NO:1.
In one aspect, the present invention provides isolated cDNA molecules and
genomic DNA molecules that encode a CAN-1 polypeptide and that include one or
more
single nucleotide polymorphisms as discussed more fully herein.
In another aspect, the present invention provides isolated genomic DNA
molecules that encode a CAN-1 polypeptide, and that are less than 38 kilobases
long.
-3-
CA 02604066 2007-10-29
Thus, for example, the present invention encompasses isolated genomic DNA
molecules
that: (a) encode a CAN-1 polypeptide that is at least 80% identical, at least
90% identical,
at least 95% identical or at least 99% identical to a CAN-1 polypeptide
consisting of an
amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:3; and (b) are less
than
38 kilobases long. Again by way of example, the present invention encompasses
isolated
genomic *DNA molecules that: (a) encode a CAN-1 polypeptide; (b) are less than
38 lcilobases long; and (c) hybridize to the -complement of the nucleic acid
molecule of
SEQ ID NO:1 under conditions of 2 X SSC at 55 C for 30 minutes. An exemplary
genomic DNA molecule of this aspect of the invention is set forth in SEQ ID
NO:4.
In another aspect, the present invention provides isolated oligonucleotides of
between,10 base pairs' and 100 base pairs that hybridize at 10 C below their
melting
temperature (Tm) to the CAN-1 cDNA of SEQ ID NO: 1, or to the CAN-I genomic
DNA
of SEQ ID NO:4, or to the complement of SEQ ID NO:1 or SEQ ID NO:4. In a
related
aspect, the present invention provides isolated oligonucleotides of between 10
base pairs
and 100 base pairs that are at least 90% identical to any 10 base pair to 100
base pair
portion of the CAN-I cDNA of SEQ ID NO:1 (such as to any 10 base pair to 100
base
pair portion of the portion of SEQ ID N0:1 extending from nucleotide 1 through
nucleotide 551), or to any 10 base pair portion of the CAN-1 genomic DNA of
SEQ ID
NO:4, or to the complement of any 10 base pair portion of SEQ ID NO:1 or SEQ
ID
NO:4.
In another aspect, the present invention provides isolated nucleic acid
molecules
(such as isolated nucleic acid molecules that encode an STG protein) that
hybridize under
conditions of 2 X SSC at 55 C for 30 minutes to the complement of the cDNA
molecule
set forth in SEQ ID NO:5, provided that the isolated nucleic acid molecule is
not a
genomic DNA molecule greater than 43 kilobases long. The cDNA molecule set
forth in
SEQ ID NO:5 encodes the STG protein having the amino acid sequence set forth
in SEQ
ID NO:6.
In one aspect, the present invention provides isolated cDNA molecules and
genomic DNA molecules that encode an STG polypeptide and that include one or
more
single nucleotide polymorphisms as discussed more fully herein.
In another aspect, the present invention provides isolated oligonucleotides of
between 10 base pairs and 100 base pairs that hybridize at 10 C below their
melting
-4-
CA 02604066 2007-10-29
temperature (Tm) to the STG cDNA of SEQ ID NO:5, or to the STG genomic clone
set
forth in SEQ ID NO:7; or to the complement of the STG eDNA of SEQ ID NO:5, or
to
the complement of the STG genomic clone of SEQ ID NO:7.
The present invention also provides vectors comprising a nucleic acid molecule
of
the invention (such as a cDNA molecule of the invention), and host cells that
include one
or more of the vectors of the invention.
The present invention also provides isolated CAN-1 polypeptides that are at
least
70% identical (such as at least 80% identical, at least 90% identical, at
least 95% identical
or at least 99% identical) to the CAN-1 polypeptide of SEQ ID NO:2 or to the
CAN-i
polypeptide of SEQ ID NO:3.
The present invention further provides isolated SEEK-1 polypeptides. For
example, the SEEK-1 cDNA set forth in SEQ ID NO:8 encodes the SEEK-1
polypeptide
set forth in SEQ ID NO:9: Thus, =in one aspect, the present invention further
provides
isolated SEEK-1 polypeptides that are at least 70% identical (such as least
80% identical,
at least 90% identical, at least 95% identical, or at least 99% identical) to
the SEEK 1
polypeptide of SEQ ID NO:9.
The present invention also provides isolated STG polypeptides. For example,
the
STG cDNA'set forth in SEQ ID NO:5 encodes the STG polypeptide set forth in SEQ
ID
NO:6. Thus, in one aspect, the present invention finther provides isolated STG
polypeptides that are at least 70% identical (such as' least '80% identical,
at least 90%
identical, at least 95% identical, or at least 99% identical) to the STG
polypeptide of SEQ
ID NO:6.
In another aspect, the present invention provides isolated antibodies (such as
monoclonal, polyclonal or CDR-grafted antibodies) that'bind specifically to a
CAN-1,
SEEK-1 or STG polypeptide consisting of an amino acid sequence that is at
least 70%
Adentical (such as at least 80% identical, at least 90% identical, at least
95% identical or at
least 99% identical) to an amino acid sequence selected from the group
consisting of SEQ
ID NO:27 SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9.
In another aspect, the present invention provides methods of diagnosing or
predicting the susceptibility to psoriasis of an individual, the methods each
comprising
the steps of: (a) obtaining a sample from an individual; (b) determining an
expression
level. of at least one polypeptide chosen from the group consisting of CAN-1,
STG and
-5-
CA 02604066 2007-10-29
SEEK-1 in the sample; and (c) diagnosing or predicting the susceptibility of
the
individual to psoriasis based on the presence or amount of the polypeptide.
In another aspect, the present invention provides methods for ameliorating the
symptoms and/or progression of psoriasis, the methods comprising administering
to an
individual suffering from psoriasis an inhibitory amount of a selective
inhibitor of at least
one polypeptide chosen from the group consisting of CAN-1, STG and SEEK-1,
wherein
the inlubitory amount causes a reduction in the amount and/or activity of the
chosen
polypeptide(s). A representative example of a selective inhibitor is an
antisense
polynucleotide that is complementary to all, or to a portion, of a nucleic
acid molecule
(such as an mRNA molecule) that encodes a CAN-1, STG or SEEK-1 polypeptide.
In another aspect, the pwsent invention provides methods for making an
isolated
CAN-1, SEEK-1 or STG polypeptide, the methods each comprising the steps of
(a) culturing a host cell, that comprises ari expression vector comprising a
nucleic acid
molecule that encodes a CAN-1, SEEK-1 or STG polypeptide, under conditions
that
enable expression of the polypeptide; and (b) recovering the expressed
polypeptide.
In yet another aspect, the present invention provides methods for identifying
a
bindiing partner of a CAN-1, STG or SEEK-1 polypeptide, the methods comprising
the
steps of (a) contacting a CAN-l, STG or SEEK-1 polypeptide with a binding
partner
(such as a monoclonal or polyclonal antibody); and (b) determ;ning whether the
binding
partner affects a biological activity of the polypeptide.
In a further aspect, the present invention provides a method of inhibiting
movement of cells into the epidermis comprising contacting a CAN-1 binding
partner to a
CAN-1 polypeptide such that the binding partiier inhibits movement of cells
(such as T-
cells, endothelial cells, lymphocytes, monocytes and/or neutrophils) into the
epidermis by
reducing a chemotaxic property of the CAN-1 polypeptide.
The present invention also provides a method of inhibiting hyperproliferation
of
keratinocytes andlor lymphocytes comprising contacting a CAN-1 binding partner
to a
CAN-1 polypeptide such that the binding partner inhibits the
hyperproliferation of
keratinocytes and/or lymphocytes by reducing a hyperproliferation property of
the CAN-
1 polypeptide. The present invention also provides. a method of inhibiting
abnormal
differentiation of keratinocytes comprising contacting a CAN-1 binding partner
to a
-6-
CA 02604066 2007-10-29
CAN-1 polypeptide such that the binding partner inhibits abnormal
differentiation of
keratinocytes by reducing an amount of unbound CAN-1.
The methods and compositions of. the invention are useful, for example, to
identify individuals predisposed to psoriasis (but who do not show symptoms of
psoriasis), or to identify individuals who are suffering from psoriasis,
and/or to
ameliorate the symptoms of psoriasis. The methods and compositions of the
invention
are also useful, for example, to identify agents useful for treating psoriasis
(such as
CAN-1, SEEK-1 or STG binding partners).
The nucleic acid molecules of the invention are useful, for example, for
TO suppressing the expression of a CAN-1 or STG gene (e.g., by antisense
inhibition).
Moreover, the nucleic acid molecules of the invention are useful for
genetically and/or
physically mapping the human genome (such as mapping the location within the
human
genome of a CAN-1 or STG gene). The polypeptides of the invention are useful,
for
example, for enhancing the level of CAN-1, STG or SEEK 1 biological activity
in a cell
or tissue (e.g., by expressing within a cell a nucleic acid molecule encoding
a.CAN-1,
SEEK 1 or -STG polypeptide). The antibodies of the invention are useful, for
example,
for decreasing the level of CAN-i, STG or SEEK-1 biological activity in a cell
(e.g., by
introducing into a cell, or onto a cell surfaoe; or into sera, an antibody
that selectively
binds to a CAN-1, SEEK-1 or STG polypeptide).
DETAILED DESCRIPTION OF THE PREFERRED EMBODIlVIENT
Unless specifically defined herein, allterms used herein have the same meaning
as they would to one skilled in the art of the present invention.
Practitioners are
particularly directed to Sambrook et al. (1989) Molecular Cloning: A
Laboratory Manual,
2nd ed., Cold Spring Harbor Press, Plainsview, New York (1989), and Ausubel et
al.,
Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New
York
(1999), for definitions and terms of the art.
-7-
CA 02604066 2007-10-29
The letter "n" within any nucleic acid sequence set forth herein means that
the
identity of the nucleic acid residue represented by "n" was not determined and
is A, C, G
or T.
As used herein, the term "isolated" used with respect to a nucleic acid
molecule or
polypeptide of the invention means a molecule that is substantially free from
cellular
components that are associated with the nucleic acid molecule or polypeptide
as it is
found in nature. As used in this context, the term "substantially free from
cellular
components" means that the nucleic acid molecule or polypeptide is purified to
a purity
level of greater than 80% (such as greater than 90%, greater than 95%, or
greater than
99%). Moreover, the terms "isolated nucleic acid molecule" and "isolated
polypeptide"
include nucleic acid molecules and polypeptides which do not naturally occur,
and have
been produced by synthetic means. An isolated nucleic acid molecule or
polypeptide
generally resolves as a single, predominant, band by gel electrophoresis, and
yields a
nucleotide or amino acid sequence profile consistent with the presence of a
predominant
nucleic acid molecule or polypeptide.
As used herein, the term "CAN-1 polypeptide" refers to a polypeptide that is
(a) at
least 70% identical to a CAN-1 polypeptide consisting of an amino acid
sequence
selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:3, (b) has the
same
biological function as a CAN-i polypeptide consisting of an amino acid
sequence
selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:3, and (c) is
expressed predominantly or exclusively in human slcin.
As used herein, the term "STG polypeptide" refers to a polypeptide that is (a)
at
least 70% identical to the STG polypeptide of SEQ ID NO:6, and (b) has the
same
biological function as the STG polypeptide of SEQ ID NO:6.
As used herein, the term "SEEK-1 polypeptide" refers to a polypeptide that is
(a) at l'east 70% identical to the SEEK-1 polypeptide of SEQ ID NO:9, and (b)
has the
same biological function as the SEEK-1 polypeptide of SEQ ID NO:9.
The term "percent identity" or "percent identical" when used in connection
with
the nucleic acid molecules and polypeptides of the present invention, is
defined as the
percentage of nucleic acid residues in a candidate nucleic acid sequence, or
the
percentage of amino acid residues in a candidate polypeptide sequence, that
are identical
with a subject.nucleic acid sequence or polypeptide molecule sequence (such as
the
-8-
CA 02604066 2007-10-29
nucleic acid sequence set forth in SEQ ID NO:1, or the polypeptide amino acid
sequence
set forth in SEQ ID NO:2), after aligning the candidate and subject sequences
to achieve
the maximum percent identity, and not considering any nucleic acid residue
substitutions
as part of the nucleic acid sequence identity. When making the comparison, the
candidate nucleic acid sequence or polypeptide sequence (which may be a
portion of a
larger nucleic acid sequence or polypeptide sequence) is the same length as
the subject
nucleic acid sequence or polypeptide sequence, and no gaps are introduced into
the
candidate polynucleotide sequence or polypeptide sequence in order to achieve
the best
alignment.
For example, if a 100 base pair, subject nucleic acid sequence is aligned with
a
100 base pair candidate portion of a larger DNA molecule (such as a genomic
clone), and
80% of the nucleic acid residues in the 100 base pair candidate portion align
with the
identical nucleic acid residues in the 100 base pair subject nucleic acid
sequence, then the
100 base pair candidate portion of the larger DNA molecule is 80% identical to
the
subject nucleic acid sequence.
Nucleic acid sequence identity can be determined in the following manner. The
subject nucleic acid sequence is used to search a nucleic acid sequence
database, such as
the GenBank database (accessible at web site
http://www.ncbi.nln.nih.gov/blastl), using
the program BLASTM version 2.1 (based on Altschul et al., Nucleic Acids
Research
25:3389-3402 (1997)). The program is used in the ungapped mode. Default
filtering is
used to remove sequence homologies due to regions of low complexity. The
default
parameters of BLASTM are utilized.
Amino acid sequence idetitity.. can be determined in the following manner. The
subject polypeptide sequence is used to search a polypeptide sequence
database, such as
the GenBank database (accessible at web site
http://www.ncbi.nln.nih.gov/blastl), using
the BLASTP program. The program is used in the ungapped mode. Default
filtering is
used to remove sequence homologies due to regions of low complexity. The
default
parameters of BLASTP are utilized. Filtering for sequences of low complexity
utilize the
SEG program.
The term "hybridize under stringent conditions", and grammatical equivalents
thereof, refers to the ability of a nucleic acid molecule to hybridize to a
target nucleic acid
molecule (such as a target nucleic acid molecule immobilized on a DNA or RNA
blot,
-9-
CA 02604066 2007-10-29
such as a Southern blot or Northern blot) under defined conditions of
temperature and salt
concentration. With respect to nucleic acid molecules greater than about 100
bases in
length, typical stringent hybridization conditions are no more than 25 C to 30
C (for
example, 10 C) below the melting temperature (Tm) of the native duplex (see
generally,
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring
Harbor
Press, 1987; Ausubel et al., Current Protocols in Molecular Biology, Greene
Publishing,
1987). Tm for nucleic acid molecules greater'than about 100 bases can be
calculated by
theformulaTm=81.5+0.41%(G+C-log(Na+)).
With respect to nucleic acid molecules having a length less than 100 bases,
exemplary stringent hybridization conditions are, 5 to 10 C below Tm.
As used herein, the term "oligonucleotide" refers to a nucleic acid molecule
of up
to 100 bases.
The term "complement" when used in connection with a nucleic acid molecule
refers to the complementary nucleic acid sequence as determined by Watson-
Crick base
pairing. For example, the complement of the nucleic acid sequence 5'CCATG3' is
5'CATGG3'.
The term "vector" refers to a nucleic acid molecule, usually double-stranded
DNA, which may have inserted into it another nucleic acid molecule (the insert
nucleic
acid molecule) such as, but not.limited to, a cDNA molecule. The vector is
used to
transport the insert nucleic acid molecule into a suitable host cell. A vector
that includes
the necessary elements that permit transcribing and translating the insert
nucleic acid
molecule into a polypeptide is called an expression 'vector. The insert
nucleic acid
molecule may be derived from the host cell, or may be derived from a different
cell or
organism. Once in the host cell, the vector can replicate independently of, or
coincidental
with, the host chromosomal DNA, and several copies of the vector and its
inserted
nucleic acid molecule may be generated.
The term "fnnctional fragment" when used in reference to a CAN-1 polypeptide
refers to a fragment that is a portion of the full-length CAN-1 polypeptide,
provided that
the portion has a biological activity that is characteristic of the
corresponding fall-length
polypeptide.
The term "fiuictional fragment" when used in reference to a STG polypeptide
refers to a fragment that is a portion of the fitll-length STG polypeptide,
provided that the
-10-
CA 02604066 2007-10-29
portion has a biological activity that is characteristic of the corresponding
full-length
polypeptide.
The term "functional fragment" when used in reference to a SEEK-1 polypeptide
refers to a fragment that is a portion of the full-length SEEK-1 polypeptide,
provided that
the portion has a biological activity that is characteristic of the
corresponding full-length
polypeptide..
The term "antibody" encompasses a whole antibody, or a fragment thereof, for
example a F(ab)2, Fab, Fv, VH or VK fragment, a single-chain antibody, a
multimeric
monospecific an#body or fragment thereof, or a bi- or multispecific antibody
or fragment
thereof. An antibody according to the invention may be a polyclonal
or,especially, a
monoclonal antibody. The antibody may belong to any ixnmunoglobulin class, and
may
be for example an IgG, for example IgGl, IgG2, IgG3, IgG4, IgE, IgM or IgA
antibody.
It may be of animal, for exaxnple mammalian origin, and may be for example a
murine,
rat or human antibody. Alternatively, the antibody may be a chimeric antibody.
The
term chimeric antibody is used herein to mean any antibody containing portions
derived
from different animal species. Particular non-limiting examples include those
antibodies
having a variable region derived from a murine or other antibody constant
region, and
those antibodies in which one or more CDR sequences and optionally one or more
variable region framework amino acids are derived from a murine or other
antibody and
the remaining portions of the variable and the constant regions are derived
from a human
immunoglobulin.
The term "sample" When used in connection with the methods of the invention
for
diagnosing or predicting the susceptibility to psoriasis in an individual,
means any
biological fluid, cell, tissue, organ or portion thereof, that includes, or
potentially
includes, a CAN-1, STG or SEEK-1 nucleic acid molecule or polypeptide. The
term
includes samples present in an individual as well as samples obtained or
derived from an
individual. For example, a sample can be a histologic section of a specimen
obtained by
biopsy, or cells that are placed in or adapted to tissue culture. A sample can
be a
subcellular fraction or extract, or a purified or crude nucleic acid or
polypeptide
preparation.
The term "binding partner" when used in reference to CAN-1, STG or SEEK-1
polypeptides, means a composition, such as a macromolecule, that selectively
binds a
-11-
CA 02604066 2007-10-29
CAN-1, STG or SEEK 1 polypeptide,. or fragment thereof. For example, a binding
partner can be a monoclonal or polyclonal antibody that selectively binds with
high
affinity to a CAN-1, STG or SEEK-1 polypeptide, without substantial cross-
reactivity
with other polypeptides that are unrelated to CAN-1, STG or SEEK-1
polypeptides. The
affinity of a binding partner that selectively binds to a CAN-1, STG or SEEK-1
polypeptide is generally greater than about 10-5M, and more usually greater
than about
10-6M. High affinity interactions are preferred, and are generally greater
than about 10-
8M to 10-9M. Representative examples of binding partners include polyclonal or
monoclonal antibodies, peptides, polynucleotides, nucleic acids, nucleic acid
derivatives,
steroids or steroid analogues, small organic molecules, identified, for
example, by affinity
screening of a small molecule library.
In one aspect, the present invention provides isolated cDNA molecules that
encode a CAN-1 polypeptide. An exemplary CAN-1 cDNA of the invention is set
forth
in SEQ ID NO:l, and encodes the CAN-1 polypeptide set forth in SEQ ID NO:2.
The
CAN-1 polypeptide of SEQ ID NO:3 is the mature form of the CAN-1 polypeptide
of
SEQ ID NO:2 and lacks an amino terminal signal sequence. Thus, for example,
the
present invention encompasses isolated cDNA molecules that encode a CAN-1
polypeptide that is at least 80% identical, at least 90% identical, at least
95% identical or
at least 99% identical to a CAN-1 polypeptide consisting of a nucleic acid
sequence set
forth in SEQ ID NO:2 or SEQ ID NO:3.
The present invention also encompasses isolated eDNA molecules, that encode a
CAN-1 polypeptide, and that are at least 70% (such as at least 80%, at least
90%, at least
95% or at least 99%) identical to the nucleic acid molecule of-SEQ ID NO: 1.
The present
invention also encompasses isolated cDNA molecules that hybridize under
conditions of
2 X SSC at 55 C for 30 minutes to the complement of the cDNA molecule set
forth in
SEQ ID NO: 1. Some isolated cDNA rrtolecules of this aspect of the invention
hybridize
under conditions of 1 X SSC at 55 C for 30 minutes to the complement of the
cDNA
molecule set forth in SEQ ID NO:1. Some isolated cDNA molecules of this aspect
of the
invention hybridize under conditions, of 0.2 X SSC at 55 C for 30 minutes to
the
complement of the cDNA molecule set forth in SEQ ID NO:1.
In another aspect, the present invention provides isolated nucleic acid
molecules
that are at least 70% identical (such as at least 80%, at least 90%, at least
95% or at least
-12-
CA 02604066 2007-10-29
99% identical) to the portion of the CAN-1 eDNA of SEQ ID NO:1 extending from
nucleotide 1 through nucleotide 551 of SEQ ID NO:1, or to the complement of
the
foregoing portion of the cDNA of SEQ ID NO:1.
In one aspect, the present invention provides isolated cDNA molecules that
encode a CAN-1 polypeptide that is the same length as the CAN-1 polypeptide
consisting
of the amino acid sequence of SEQ ID NO:2; wherein the encoded CAN-1
polypeptide is
at least 70% identical to the CAN-1 polypeptide consisting of the amino acid
sequence
set forth in SEQ ID NO:2, and wherein the second nucleic acid residue of the
codon that
encodes the. amino acid at position 83 of the CAN-1 polypeptide is T. Some
cDNA
molecules of this aspect of the invention are the same length as the cDNA
molecule set
forth in SEQ ID NO:1. Some cDNA molecules of this aspect of the invention
encode a
CAN-1 polypeptide that has an amino acid sequence that is identical to the
amino acid
sequence set forth in SEQ ID NO:2 except that the amino acid proline at
position 83 of
the CAN-1 polypeptide is leucine. An exemplary cDNA molecule of this aspect of
the
invention has a nucleic acid sequence that is identical to the nucleic acid
sequence set
forth in SEQ ID NO:1, except that the nucleic acid residue at position 311 of
SEQ ID
NO:1 is T.
In another aspect, the present invention provides isolated cDNA molecules that
encode a CAN-1 polypeptide and are at least '70% identical (such as at least
80%
identical, at least 90% identical, at least 95% identical or at least 99%
identical) to the
CAN-1 cDNA sequence set forth in SEQ ID NO:1, and comprise a thymine (T)
residue at
position 311. Some isolated eDNA molecules of this aspect of the invention
consist of a
nucleic acid sequence that is completely identical to the CAN-1 cDNA sequence
set forth
in SEQ ID NO:1, except that the nucleic acid sequence of the cDNA molecule
includes a
thymine (T) residue at position 311. Some isolated cDNA molecules of this
aspect of the
invention hybridize to the complement of the CAN-1 eDNA sequence set forth in
SEQ
ID NO:1 under conditions of 2 X SSC at 55 C for 30 minutes. Some isolated
eDNA.
molecules of this aspect of the invention hybridize to the complement of the
CAN-1
cDNA sequence set forth in SEQ ID NO:1 under conditions of 1 X SSC at 55 C for
30
minutes. Some isolated eDNA molecules of this aspect,of the invention
hybridize to the
complement of the CAN-1 cDNA sequence set forth in SEQ ID NO:1 under
conditions of
0.2 X SSC at 55 C for 30 minutes.
-13-
CA 02604066 2007-10-29
In another aspect, the present invention provides isolated genomic DNA
molecules that: (a) encode a CAN-1 polypeptide; (b) comprise a nucleic acid
sequence
that is at least 70% identical (such as at least 80% identical, at least 90%
identical, at least
95% identical or at least 99% identical) to the CAN-1 genomic DNA sequence set
forth
in SEQ ID NO:4; and (c) comprise at least one of the single nucleotide
polymorphisms
set forth in Table 1 herein. Some isolated genomic DNA molecules of this
aspect of the
invention comprise a nucleic acid sequence that is completely identical to the
CAN-1
genomic DNA sequence set forth in SEQ ID NO:4, except that the nucleic acid
sequence
of the genomic DNA molecule includes at least one of the single nucleotide
polymorphisms set, forth in Table 1 herein. Some isolated genomic DNA
molecules of
this aspect of the invention hybridize to the complement of the CAN-1 genomic
DNA
sequence set forth in SEQ ID NO:4 under conditions of 2 X SSC at 55 C for 30
minutes.
Some isolated genomic DNA molecules of this aspect of the invention hybridize
to the
complement of the CAN-1 genomic DNA sequence set forth in SEQ ID NO:4 under
conditions of 1 X SSC at 55 C for 30 minutes. Some isolated genomic DNA
molecules
of this aspect of the invention hybridize to the complement of the CAN-1
genomic DNA
sequence set forth in SEQ ID NO:4 under conditions of 0.2 X SSC at 55 C for 30
minutes. The exons in the CAN-1 gene consisting of the sequence set forth in
SEQ- ID
NO:4 are located at the following positions: nucleic acid 'residue 1485
through nucleic
acid residue 1539, and nucleic acid residue 2206 through nucleic acid residue
2561.
In another aspect, the present invention provides isolated genomic DNA
molecules that encode a CAN-1 polypeptide, and that are less than 38 kilobases
long.
Thus, for example, the present invention encompasses isolated genomic DNA
molecules
that: (a) encode a CAN-i polypeptide that is at least 80% identical, at least
90% identical,
at least 95% identical or at least 99% identical to a CAN-1 polypeptide
consisting of a
nucleic acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:3; and (b) are
less than
38 kilobases long. Again by way of example, the present invention encompasses
isolated
genomic DNA molecules that: (a) encode a CAN-1 polypeptide; (b) are less than
38 kilobases long; and (c) hybridize to the complement of the nucleic acid
molecule of
SEQ ID NO:1 under conditions of 2 X SSC at .55 C for 30 minutes. Some isolated
genomic DNA molecules of this aspect of the invention hybridize under
conditions of 1
X SSC at 55 C for 30 minutes to the complement of the cDNA molecule set forth
in SEQ
-14-
CA 02604066 2007-10-29
ID NO: 1. Some isolated genomic DNA molecules of this aspect of the invention
hybridize under conditions of 0.2 X SSC at 55 C for 30 minutes to the
complement of the
cDNA molecule set forth in SEQ ID NO: 1.
In another aspect, the present invention provides isolated oligonucleotides of
between 10 base pairs and 100 base pairs that hybridize at 10 C below their
melting
temperature (Tm) to the CAN-1 cDNA of SEQ ID NO: 1, or to the CAN-1 genomic
DNA
of SEQ ID NO:4, or to the complement of SEQ ID NO:1 or SEQ ID NO:4. In a
related
aspect, the present invention provides isolated oligonucleotides of between 10
base pairs
and 100 base pairs that are at least 90% identical to any 10 base pair portion
of the CAN-
1 cDNA of SEQ ID NO: 1 (such as to any 1'0 base pair portion of the portion of
SEQ ID
NO: 1 extending from nucleotide 1 through nucleotide 551), or to any 10 base
pair portion
of the CAN-1 genomic DNA of SEQ ID NO:4, or to the complement of any 10 base
pair
portion of SEQ ID NO: 1 or SEQ ID NO:4.
In another aspect, the present invention provides isolated nucleic acid
molecules
(such as genomic DNA molecules and cDNA molecules) that hybridize under
conditions
of 2 X SSC at 55 C for 30 minutes to the complement of the cDNA molecule set
forth in
SEQ ID NO:5, provided that the isolated nucleic acid molecule is not a genomic
DNA
molecule greater than 43 kilobases long. The cDNA molecule set forth in SEQ ID
NO:5
encodes the STG protein having the amino acid sequence set forth in SEQ 'ID
NO:6.
Some isolated nucleic acid molecules of this aspect of the invention hybridize
under
conditions of 1 X SSC at 55 C for 30 minutes to the complement of the cDNA
molecule
set forth in SEQ ID NO:5. Some isolated nucleic acid molecules of this aspect
of the
invention hybridize under conditions of 0.2 X SSC at 55 C for 30 minutes to
the
complement of the cDNA molecule set forth in SEQ ID NO:5.
25. In one aspect, the present invention provides isolated cDNA molecules that
each:
(a) encode an STG polypeptide that is the same length as the STG polypeptide
consisting
of the amino acid sequence of SEQ ID NO:6, wherein the encoded STG polypeptide
is at
least 70% identical (such as at least 80% identical, at least 90% identical,
at least 95%
identical or at least 99% identical) to the STG polypeptide consisting of the
amino acid
sequence set forth in SEQ ID NO:6; and (b) include at least one of the
following single
nucleotide polymorphisms: the first nucleic acid residue of the forty eighth
codon is A;
the second nucleic acid residue of the eighty first codon is C; the f rst
nucleic acid residue
-15-
CA 02604066 2007-10-29
of the eighty third codon is C; the third nucleic acid residue of the one
hundred and sixty
fourth codon is T; the frst nucleic aoid residue of the one hundred and sixty
fifth codon is
A; and the third nucleic acid residue of the three hundredth codon is C. Some
cDNA
molecules of this aspect of the invention are the same length as the cDNA
molecule set
forthinSEQID NO:5.
The present invention also provides isolated cDNA molecules that encode an STG
protein and have the same nucleic acid sequence as the cDNA molecule set forth
in SEQ
ID NO:5, except that each cDNA molecule includes at least one of the following
single
nucleotide polymorphisms: the nucleic acid residue at position 142 is A; the
nucleic acid
residue at position 242 is C; the nucleic acid residue at position 247 is C;
the nucleic acid
residue at position 492 is T; the nucleic acid residue at position 493 is A;
the nucleic acid
residue at position 900 is C.
The present invention also provides isolated cDNA molecules that encode an STG
protein that is at least 70% identical (such as at least 80% identical, at
least 90% identical,
at least 95% identical or at least 99% identical) to the STG polypeptide
consisting of the
amino acid sequence set forth in SEQ ID NO:6, except that the STG protein
sequence
includes at least one of the following amino acid polymorphisms: the amino
acid at
position 48 is arginine; the amino acid at.position 81 is alanine; the amino
acid at position
83 is proline; and the amino acid at position 165 is lysine. Some isolated
nucleic acid
molecules of this aspect of the invention hybridize under conditions of 2 X
SSC at 55 C
for 30 minutes to the complement of the cDNA molecule set forth in SEQ ID
NO:5.
Some isolated nucleic acid molecules of this aspect of the invention hybridize
under
conditions of 1 X SSC at 55 C for 30 minutes to the complement of the cDNA
molecule
set forth in SEQ ID NO:5. Some isolated nucleic acid molecules of this aspect
of the
invention hybridize under conditions of'0.2 X SSC at 55 C for 30 minutes to
the
complement of the cDNA molecule set forth in SEQ ID NO:5.
In another aspect, the present invention provides isolated genomic DNA
molecules that: (a) encode an STG polypeptide; (b) comprise a nucleic acid
sequence
that is at least 70% identical (such as at least 80% identical, at least 90%
identical, at least
95% identical or at least 99% identical) to the STG genomic DNA sequence set
forth in
SEQ ID NO:7; and (c) comprise at least one of the single nucleotide
polymorphisms'set
forth in Table 2 herein. Some isolated genomic DNA molecules of this aspect of
the
-16-
CA 02604066 2007-10-29
invention comprise a.nucleic acid sequence that is completely identical to the
STG
genomic DNA sequence set forth in SEQ ID NO:7, except that the nucleic acid
sequence
of the genomic DNA molecule includes at least one of the single nucleotide
polymorphisms set forth in Table 2 herein. Some isolated genomic DNA molecules
of
this aspect of the invention hybridize to -the complement of the STG genomic
DNA
sequence set forth in SEQ ID NO:7 under conditions of 2 X SSC at 55 C for 30
minutes.
Some isolated genomic DNA molecules of this aspect of the invention hybridize
to the
complement of the STG genomic DNA sequence set forth in SEQ ID NO:7 under
conditions of 1 X SSC at 55 C for 30 minutes. Some isolated genomic DNA
molecules
of this aspect of the invention hybridize to the complement of the STG genomic
DNA
sequence set forth in SEQ ID NO:7 under conditions of 0.2 X SSC at 55 C for 30
minutes. The exons in the STG gene consisting of the sequence sefforth in SEQ
ID
NO:7 are located at the followiuig positions: nucleic acid residue 765 through
nucleic
acid residue 831, and nucleic acid residue 1029 through nucleic acid residue
1283.
In another aspect, the present invention provides isolated oligonucleotides of
between 10 base pairs and 100 base pairs that hybridize at 10 C below their
melting.
temperature (Tm) to the STG cDNA of SEQ ID NO:5, or to the STG genomic clone
set
forth in SEQ ID NO:7, or to the complement of the STG cDNA of SEQ ID NO:5, or
to
the complement of the STG genomic clone of SEQ ID NO:7.
Hybridization can be conducted, for example, by utilizing the technique of
hybridizing labeled nucleic acid probes to nucleic acid molecules immobilized
on
nitrocellulose filters or nylon membranes. An exemplary hybridization protocol
is set
forth in Example 19 herein. For example, utilizing the exemplary hybridization
protocol
set forth in Example 19, nucleic acid molecules of the invention, that
hybridize under
conditions of 2 X SSC at 55 C for 30 minutes to the complement of the nucleic
acid
molecule consisting of the nucleic acid sequence set forth in SEQ ID NO:1, can
be
identified by irnmobilizing the nucleic molecule to a nylon membrane (or
nitrocellulose
filter). The membrane is incubated in aqueous solution in the presence of the
probe
nucleic acid molecule (such as the complement of the nucleic acid molecule
consisting of
the nucleic acid sequence set forth in SEQ ID NO:1) under low stringency
conditions
(such as 6 X SSC at 50 C for 12 hours). The membrane is then washed under
conditions
of 2 X SSC at 55 C for 30 minutes. In this example, an isolated nucleic acid
molecule of
-17-
CA 02604066 2007-10-29
the invention will remain hybridized to the immobilized target molecule under
these wash
conditions of 2 X SSC at 55 C for 30 minutes.
The nucleic acid molecules of the invention can be isolated by using a variety
of
cloning techniques known to those of ordinary skill in the art. Thus, for
example, all, or
portions of, the CAN-1 cDNA of SEQ ID NO:l can be used as a hybridization
probe to
sereen a genomic or cDNA library, such as a human skin cDNA h'brary. The
technique
of hybridizing radiolabelled nucleic acid probes to nucleic acids immobilized
on
nitrocellulose filters or nylon membranes can be used to screen the genomic or
cDNA
library. Exemplary hybridization and wash conditions are: hybridization*at 65
C in 5.0
X SSC, 0.5% sodium dodecyl sulfate, for 12 hours; washing (three washes of
twenty
minutes each at 55 C) in 2.0 X SSC, 1% (w/v) sodium dodecyl sulfate.
Again, by, way of example, nucleic acid molecules of this aspect of the
invention
can be isolated by the polymerase chain reaction (PCR) descn'bed in The
Polymerase
Chain Reaction (K.B. Mullis et al., eds. 1994).
Gobinda et al (PCR Methods Applic. 2:318-22 [1993]),
disclose "restriction-site PCR" as a direct method which uses universal
primers to retrieve
unknown sequence adjacent to a known locus. First, genomic DNA is amplified in
the
presence of a linker-primer, that is homologous to a linker sequence ligated
to the ends of
the genomic DNA fragments, and in the presence of a primer specific to the
known
region. The amplified sequences are subjected to a second rournd of PCR with
the same
linker primer and another specific primer internal to the first one. Products
of each round
of PCR are transcribed with an appropriate RNA polymerase and - sequenced
using
reverse transcriptase.
Further, by way of example, inverse PCR permits acquisition of unknown
sequences starting with primers based on a known region ('Triglia T. et al.,
Nucleic Acids
Res 16:8186 (1988]). The method uses several
restriction enzymes to generate a suitable fragment in the known region of a
gene. The
fragment is then circularized by intranaolecular ligation and used as a PCR
template.
Divergent primers are designed from the known region.
By way of example, the nucleic acid molecules of the invention are useful as '
hybridization probes in diagnostic procedures (such as diagnosing the presence
of
psoriasis, or the propensity to develop psoriasis). The particular application
and degree
-18-
CA 02604066 2007-10-29
of desired specificity will be one consideration well known to those skilled
in the art in
selecting a probe. Untranslated region sequences are useful regions to
construct probes
since there is little evolutionary pressure to conserve non-coding domains.
Hybridization probes can be produced recombinantly or chemically synthesized
using methods well known in the art. Additionally, hybri dization probes can
be labeled
with a variety of detectable labels including, for example, radioisotopes,
fluorescent tags,
reporter enzymes, biotin and other ligands. Such detectable labels can
additionally be
coupled with, for example, colorimetric or photometric indicator substrate for
spectrophotometric detection. Methods for labeling and detecting such probes
are well
known in the art and can be found described in, for example, Sambrook et al.,
supra, and
Ausubel et al., supra.
In another aspect, the present invention is directed to regulatory nucleic
acid
sequences that are operably linked to a CAN-1 gene, an STG gene, or to a SEEK-
1 gene.
The term "regulatory nucleic acid sequence" refers to nucleic acid sequences
located
upstream, within, or downstream of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the associated
coding
sequence. Regulatory sequences include, but are not limited to, enhancers,
promoters,
translation leader sequences, introns, and polyadenylation signal sequences.
"Promoter" refers to a DNA sequence involved in controlling the expression of
a
coding sequence or functional RNA. In general, a coding sequence is located 3'
to a
promoter sequence. The term "promoter". includes a minimal promoter that is a
short
DNA sequence comprised of a TATA- box and other sequences that serve to
specify the
site of transcription initiation, to which other regulatory elements may be
added for
control of expression. "Promoter" also refers to a nucleic acid sequence that
includes a
minimal promoter plus other regulatory elements that are capable of
controlling the
expression of a coding sequence or functional RNA. This type of promoter
sequence
typically consists of proximal and more distal upstream elements, the latter
elements
often referred to as enhancers. Accordingly, an "enhancer" is a DNA sequence
which can
stimulate promoter activity and may be an innate element of the promoter or a
heterologous element inserted to enhance the level or tissue-specificity of a
promoter.
Promoters may be derived in their entirety from a native gene, or be composed
of
different elements derived from different promoters found in nature, or even
comprise
-19-
CA 02604066 2007-10-29
synthetic DNA segments. It is understood by those skilled in the art that
different
promoters may direct the expression of a gene in different tissues or cell
types, or at
different stages of development, or in response to different environmental
conditions.
Promoters which cause a gene to be expressed in most cell types at most times
are
commonly referred to as "constitutive promoters". It is further recognized
that since in
most cases the exact boundaries of regulatory sequences have not been
completely
defined, DNA fragments of different lengths may have identical promoter
activity.
In another aspect, the invention provides vectors that comprise a nucleic acid
molecule of the invention. Some vectors of the invention include a nucleic
acid molecule
that encodes a CAN-1 polypeptide that is at least 80% identical, at least
900/iy identical, at
least 95% identical or at least 99% identical, to a CAN-1 polypeptide
consisting of a
nucleic acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:3.
Some vectors of the invention include a nucleic acid molecule that encodes a
CAN-1 polypeptide, and that is at least 70% (such as at least 80%, at least
90%, at least
95% or' at least 99%) identical to the nucleic acid molecule of SEQ ID NO:1.
Some
vectors of the invention include a nucleic acid molecule that encodes a CAN-1
polypeptide, and that hybridizes under conditions of 2 X SSC at 55 C for 30
minutes to
the complement of the cDNA molecule set forth in SEQ ID NO: 1. Some vectors of
the
invention include a nucleic acid molecule that encodes a CAN-1 polypeptide,
and that
hybridizes under conditions of 1 X SSC at 55 C for 30 minutes to the
complement of the
cDNA molecule set forth in SEQ ID NO:1. Some vectors of the invention include
a
nucleic acid molecule that encodes a CAN-1 polypeptide, and that hybridizes
under
conditions of 0.2 X SSC at 55 C for 30 minutes to the complement of the cDNA
molecule set forth in SEQ ID NO:1.
Some vectors of the invention include a nucleic acid molecule that encodes an
STG polypeptide, and that is at least 70% (such as at least 80%, at least 90%,
at least 95%
or at least 99%) identical to the nucleic acid molecule of SEQ ID NO:5. Some
vectors of
the invention include a nucleic acid molecule that encodes an STG polypeptide,
and that
hybridizes under conditions of 2 X SSC at 55 C for 30 minutes to the
complement of the
cDNA molecule set forth in SEQ ID NO:5. Some vectors of the invention include
a
nucleic acid molecule that encodes an STG polypeptide, and that hybridizes
under
conditions of 1 X SSC at 55 C for 30 minutes to the complement of the cDNA
molecule
-20-
CA 02604066 2007-10-29
set forth in SEQ ID NO:5. Some vectors of the invention include a nucleic acid
molecule
that encodes an STG polypeptide, and that hybridizes under conditions of 0.2 X
SSC at
55 C for 30 minutes to the complement of the cDNA molecule set forth in SEQ ID
NO:5.
The vectors are constructed using conventional techniques well known to those
skilled in the art. The choice of vector is dependent, for example, upon the
method that
would be used to transform the host cells and the desired selection markers.
The skilled
artisan is well aware of the genetic elements that can be included on the
vector in order to
successfully transform, select and propagate host cells containing the vector.
For
example, a vector may also include any other necessary regulatory sequences
such as
terminators (Guerineau et al., Mol. Gen. Genet. 226:141-144 [1991]; Proudfoot,
Cell
64:671-674 [1991]; Sanfacon et al., Genes & Dev. 5:141-149 [1991]; Mogen et
al., Plant
Cell 2:1261-1272,[1990]; Munroe et al., Gene 91:151-158 [1990]; Ballas et al.,
Nucleic
Acids Res. 17:7891-7903 [1989]; Joshi et al., Nucleic Acid Res. 15:9627-9639
[1987]);
nuclear localization signals (Kalderon et al., Cell 39:499-509 [1984]; Lassner
et al., Plant
Mol. Biol. 17:229-234 [1991]); introns (Luehrsen & Walbot, Mol. Gen. Genet.,
225:81-93
[1991]) and the like, operably linked to the nucleotide sequence encoding the
transactivator and/or the toxic product. It may also be beneficial to include
5' leader
sequences. Such leader sequences can act to enhance translation. Translational
leaders
are known in the art and include Picomavirus leaders, for example,
Encephalomyocarditis
leader (Elroy-Stein et al., Proc. Natl. Acad. Sci. USA 86:6126-6130 [1989]).
In another aspect, the present invention is directed to isolated CAN-1, SEEK-1
and STG polypeptides. The polypeptides of the present invention can be
isolated, for
example, by incorporating a nucleic acid molecule encoding the polypeptide
into.an
expression vector, introducing the expression vector into a host cell and
expressing the
nucleic acid molecule to yield polypeptide. The polypeptide can then be
purified by art-
recognized means. , When a crude polypeptide extract is initially prepared, it
may be
desirable to include one or more protease inhibitors in the extract.
Representative
examples of protease inhibitors include: serine protease inhibitors (such as
phenylmethylsulfonyl fluoride (PMSF), benzaniide, benzamidine HCI,
s-Amino-n-caproic acid and aprotinin (Trasylol); cysteine protease inhibitors,
such as.
sodium p-hydroxymercuribenzoate; competitive protease inhibitors, such as
antipain and
leupeptin; covalent protease inhibitors, such as iodoacetate and N-
ethylmaleimide;
-21-
CA 02604066 2007-10-29
aspartate (acidic) protease inhibitors, such as pepstatin and
diazoacetylnorleucine methyl
ester (DAN); metalloprotease inhibitors, such as EGTA [ethylene glycol
bis(P-am:inoethyl ether) N,N,N;N'-tetraacetic acid], and the chelator 1, 10-
phenanthroline.
Fusion polypeptides may also be engineered to improve characteristics of the
inventive polypeptides. For instance, a region of additional amino acids,
particularly
charged amino acids, may be added to the N-terminus of the polypeptide to
improve
stability and persistence during purification from a host cell, or during
subsequent storage
and handli.ng. Such regions may be removed prior to final preparation of the
polypeptide.
The addition of peptide moieties to facilitate handling of polypeptides are
familiar and
routine techniques in the art. For example, a hexa-histidine peptide, such as
the tag
provided in a pOE vector (Qiagen, Inc., Chatsworth, CA), among others, many of
which
are commercially available,' can be used to facilitate purification of
inventive fnsiori
polypeptides. Gentz et al. (Proc. Natl. Acad. Sci. USA 86:82 1, 1989) also
discloses the
use of another peptide tag, "HA", which corresponds to an epitope derived from
the
influenza hemagglutinin polypeptide (Wilson, Cell 37:767, 1984).
Thus, any of the above mentioned fusion polypeptides can be engineered using
the polynucleotides or the polypeptides of the present invention.
Moreover, polypeptides of the invention, including fragments, and specifically
epitopes, can be combined with parts of the constant domain of immunoglobulins
(IgG),
resulting in fusion polypeptides. This class of fusion polypeptide usually
facilitate
purification and show an increased half-life in vivo. One reported example,
describes
chimeric polypeptides consisting of the first two domains of the human CD4-
polypeptide
and various domains of the constant regions of the heavy or light chains of
mammalian
immunoglobulins (EP A 394,827; Traunecker et al., Nature 331:84, 1988). Fusion
polypeptides having disulfide-linked dimeric structures (due to the IgG) can
also be more
efficient in binding and neutralizing other molecules, than the monomeric
secreted
polypeptide or polypeptide fragment alone (Fountoulakis et al., J. Biochem.
270:3958,
1995).
Similarly, EP A 0464533 (Canadian counterpart 2045869) discloses fusion
polypeptides comprising various portions of a constant region of
immunoglobulin
molecules together with another human polypeptide or part thereof. In many
cases, the
Fc part in a fusion polypeptide is beneficial in therapy and diagnosis, and
thus can result
-22-
CA 02604066 2007-10-29
in, for example, improved pharmocokinetic properties (EP A 0232262).
Alternatively,
deleting the Fc part after the fusion polypeptide has been expressed,
detected, and
purified, would be desired. For example, the Fc portion may hinder therapy.
and
diagnosis if the fusion polypeptide is used as an antigen for immunizations.
In drug
discovery, for example, human polypeptides, such as hIL-5, have been fused
with Fc
portions for the purpose of high-throughput screening assays to identify
antagonists of
hIL-5 (see, Bennett et al., J. Molecular Recognition 8:52, 1995; Johanson et
al., J. Biol.
Chem. 270:9459, 1995).
In another aspect, the present invention provides nucleic acid and - amino
acid
polymorphisms of the CAN-1, SEEK-1 and STG nucleic acid molecules and
polypeptides of the invention. By way of example, nucleic acid polymorphisms
of the
invention can be identified by using a CAN-1, SEEK-1 or STG cDNA as a probe to
screen a mammalian genomic library to identify polymorphic CAN-1, SEEK-1
and/or
STG genes. Exemplary nucleic = acid polymorphisms of the invention are set
forth in
Tables 1, 2 and 3 herein.
In another aspect, the present invention is directed to antibodies that bind
specifically to polypeptides of the invention, and/or to fragments thereof. By
way of
representative example, antigen useful for raising antibodies can be prepared
in the
following manner. A nucleic acid molecule (such as a cDNA molecule) encoding a
CAN-1, SEEK-1 or STG polypeptide is cloned into a plasmid vector, such as a
Bluescript
plasmid (available from Stratagene, Inc., La Jolla, California). The
recombinant vector is
then introduced into an E. coli strain (such as E. coli XL1-Blue, also
available from
Stratagene, Inc.) and the polypeptide encoded by the nucleic acid molecule is
expressed
in E. coli and then purified: For example, E. coli XLl-Blue harboring a
Bluescript vector
including a cDNA molecule of interest is grown overnight 'at 37 C in LB medium
'containing 100 g ampicillin/ml. A 50 gl aliquot of the overnight culture is
used to
inoculate 5 ml of fresh LB medium containing ampicillin, and the culture grown
at 37 C
with vigorous agitation to A600 = 0.5 before induction with 1 mM IPTG. After
an
additional two hours of growth, the suspension is centrifuged (1000 x g, 15
min, 4 C), the
media removed, and the pelleted cells resuspended in 1 ml of cold buffer that
preferably
contains 1 mM EDTA and one or more polypeptidease inhibitors, such as those
descnbed
herein in connection with the purification of the isolated polypeptides of the
present
-23-
CA 02604066 2007-10-29
invention. The cells can be disrapted by sonication with a microprobe. The
chilled
sonicate is cleared by centrifugation and the expressed, recombinant
polypeptide purified
from the supematant by art-recognized polypeptide purification techniques,
such as those
described herein.
Inventive polypeptides can also be prepared using peptide synthesis methods
that
are well known in the art. The synthetic polypeptides can then be used to
prepare
antibodies. Direct peptide synthesis using solid-phase techniques (Stewart et
al., Solid-
Phase Peptide Synthesis, W H Freeman Co, San Francisco Calif. (1969);
Merrifield, J.
Am. Chem. Soc. 85:2149-2154 (1963) is an alternative to recombinant or
chimeric peptide
production. Automated synthesis may be achieved, for example, using Applied
Biosystems 431A Peptide Synthesizer (Foster City, Calif.) in accordance with
the
instructions provided by the manufacturer. Additionally the polypeptide
sequences of the
present invention or any fragment thereof may be mutated during direct
synthesis and, if
desired, combined using chemical methods with other amino acid sequences. The
polypeptides used to induce specific antibodies may have an amino acid
sequence
consisting of at least five amino acids and preferably at least 10 amino
acids. Short
stretches of amino acid sequence may be attached with those of another
polypeptide, and
the chimeric polypeptide used for antibody production. Alternatively, the
polypeptide
may be of sufficient length to contain an entire domain for antibody
recognition.
Representative examples of art-recognized techniques for purifying, or
partially
purifying, polypeptides from biological material are exclusion chromatography,
ion-exchange chromatography, hydrophobic interaction chromatography, reversed-
phase
chromatography and immobilized metal affinity chromatogra.phy.
Hydrophobic interaction chromatography and reversed-phase chromatography are
two' separation methods based on the interactions between the hydrophobic
moieties of a
sample and an insoluble, immobilized hydrophobic group present on the
chromatography
matrix. In hydrophobic interaction chromatography the matrix is hydrophilic
and is
substituted with short-chain phenyl or octyl nonpolar groups. The mobile phase
is
usually an aqueous salt solution. In reversed phase chromatography the matrix
is silica
that has been substituted with longer n-alkyl chains,, usually C8 (octylsilyl)
or C18
(octadecylsilyl). The matrix is less polar than the mobile phase. The mobile
phase is
usually a mixture of water and a less polar organic modifier.
-24-
CA 02604066 2007-10-29
Separations on hydrophobic interaction chromatography matrices are usually
done
in aqueous salt solutions, which generally are nondenaturing conditions.
Samples are
loaded onto the matrix in a high-salt buffer and elution is by a descending
salt gradient.
Separations on reversed-phase media are usually done in mixtures of aqueous
and organic
solvents, which are often denaturing conditions. In the case of polypeptide
and/or peptide
purification, hydrophobic interaction chromatography depends on surface
hydrophobic
groups and is carried out under conditions which maintain the integrity of the
polypeptide
molecule. Reversed-phase chromatography depends on the native hydrophobicity
of the
polypeptide and is carried out under conditions which expose nearly all
hydrophobic
groups to the matrix, i.e., denaturing conditions.
Ion-exchange chromatography is designed specifically for the separation of
ionic
or ionizable compounds. The stationary phase (column matrix material) carries
ionizable
functional groups, fixed by chemical bonding to the stationary phase. These
fixed
charges- carry a counterion of opposite sign. This counterion is not fixed and
can be
displaced. Ion-exchange chromatography is named on the basis of the sign of
the
displaceable charges. Thus, in anion ion-exchange chromatography the fixed
charges are
positive and in cation ion-exchange chromatography the fixed charges are
negative.
Retention of a molecule on an ion-exchange chromatography column involves an
electrostatic interaction between the fixed charges and those of the molecule,
binding
involves replacement of the nonfixed ions by the molecule. Elution, in turn,
involves
displacement of the molecule from the fixed charges by a new counterion with a
greater
affmity for the fixed charges than the molecule, and which then becomes the
new,
nonfixed ion.
The ability of counterions (salts) to displace molecules bound to fixed
charges is a
function of the difference in afflnities between the fixed charges and the
nonfixed charges
of both the molecule and the. salt. Affinities in turn are affected by several
variables,
including the magnitude of the net charge of the molecule and the
concentration and type
of salt used for displacement.
Solid phase, packings used in ion-exchange chromatography include cellulose,
dextrans, agarose, and polystyrene. The exchange groups used include DEAE
(diethylaminoethyl), a weak base, that will have a net positive charge when
ionized and
wi11 therefore bind and exchange anions; and CM (carboxymethyl), a weak acid,
with a
-25-
CA 02604066 2007-10-29
negative charge when ionized that will bind and exchange cations. Another form
of weak
anion exchanger contains the PEI (polyethyleneimine) fanctional group. This
material,
most usually found oii thin layer sheets, is useful for binding polypeptides
at pH values
above their pI. The polystyrene -matrix can be obtained with quaternary
ammonium
functional groups for strong base anion exchange or with sulfonic acid
functional groups
for strong acid cation exchange. Intermediate and weak ion-exchange materials
are also
available. Ion-exchange chromatography need not be performed using a column,
and can
be performed as batch ion-exchange chromatography with the slurry of the
stationary
phase in a vessel such as a beaker.
Gel f ltration is performed using porous beads as the chromatographic support.
A
column constructed from such beads will have two measurable liquid volumes,
the
external volume, consisting of the liquid between the beads, and the internal
volume,
consisting of the liquid, within the pores of the beads. Large molecules will
equilibrate
only with the external volume while small molecules will equilibrate with both
the
external and internal volumes. A mixture of molecules (such as polypeptides)
is applied
in a discrete volume or zone at the top of a gel'filtration column and allowed
to percolate
through the column. The large molecules are excluded from the internal volume
and
therefore emerge first from the column while the smaller molecules, which can
access the
internal volume, emerge later. The volume of a conventional matrix used for
polypeptide
purification is typically 30 to 100 times the volume of the sample to be
fractionated. The
absorbance of the column effluent can be continuously monitored at a desired
wavelength
using a flow monitor.
A technique that is often applied to the purification of polypeptides is High
Performance Liquid Chromatography (HPLC). HPLC is an advancement in both the
operational theory and fabrication of traditional chromatographic systems.
HPLC
systems for the separation of biological macromolecules vary from the
traditional column
chromatographic systems in three ways; (1) the column packing materials are of
much
greater mechanical strength, (2) the particle size of the, column packing
materials has
been decreased 5- to 10-fold to enhance adsorption-desorption kinetics and
diminish
bandspreading, and (3) the columns are operated at 10-60 times higher mobile-
phase
velocity. Thus, by way of non-limiting example, HPLC can utilize exclusion
chromatography, ion-exchange chromatography, hydrophobic interaction
-26-
CA 02604066 2007-10-29
chromatography, reversed-phase chromatography and immobilized metal affinity
chromatography. Art-recognized techniques for the purification of polypeptides
and
peptides are set forth in Methods in Enzymology, Vol. 182, Guide to
Polypeptide
Purification, Murray P. Deutscher, ed (1990).
Methods for preparing monoclonal and polyclonal antibodies are well known to
those of ordinary skill in the art and are set forth, for example, in chapters
five and six of
Antibodies A Laboratory Manual,' E. Harlow and D. Lane, Cold Spring Harbor
Laboratory (1988). For example, antibodies according to the invention may be
prepared
by conventional immunization and recombinant DNA techniques. Thus, for example
polyclonal antibodies may be obtained from the sera of animals immunised with
a CAN-
1, SEEK 1 or STG protein or fragment thereof. Any suitable host, for example
BALB/c
mice where it is desired to obtain a mouse polyclonal antibody, may be
injected with the
irnmunogen, the serum collected and the antibody recovered therefrom.
Monoclonal
antibodies may be obtained from hybridomas derived form the spleen cells of an
animal
irnmunised as just discussed and fused to an appropriate "immortal" B-tnmour
cell. In
each instance, the antibody may be recovered from either the serum or the
hybridoma by
making use of standard purification and or concentration techniques, for
example by
chromatography, using for example Protein A or by other affinity
chromatography
employing a protein of the invention or fragment thereof.
Once a cell line, for example a hybridoma, expressing an antibody according to
the invention has been obtained it is possible to clone therefrom the cDNA and
to identify
the variable region genes encoding the desired antibody, including the
sequences
encoding the CDRs. From here, other chimeric antibodies according to the
invention
may be obtained by preparing one or more replicable expression vectors
containing at
least the DNA sequence encoding the variable domain of the antibody heavy or
light
chain and optionally other DNA sequences encoding remaining portions of the
heavy
and/or light chains as desired, and transforming an appropriate cell line,
e.g., a non-
producing myeloma cell li.ne, such as a mouse NSO line, in which production of
the
antibody will occur. In order to obtain efficient transcription and
translation, the DNA
sequence in each vector should include appropriate regulatory sequences,
particularly a
promoter and leader sequence operably linked to the variable domain sequence.
Particular methods for producing antibodies in this way are generally well
known and
-27-
CA 02604066 2007-10-29
routinely used. For example, basic molecular biology procedures are descnbed
by
Maniatis et al (Molecular Cloning, Cold Spring Harbor Laboratory, New York,
1989);
DNA sequencing can be performed as described in Sanger et al (PNAS 74: 5463,
(1977))
and the Am.ersham International plc sequencing handbook; and site directed
mutagenesis
can be carried out according to the method of Kramer et al (Nucl. Acids Res.
12: 9441,
(1984)) and the Anglian Biotechnology Ltd. handbook. Additionally, there are
numerous
publications, including patent specifications, detailing techniques suitable
for the
preparation of antibodies by manipulation of DNA, creation of expression
vectors and
transformation of appropriate cells, for example as reviewed by Mountain A and
Adair, J
R in Biotechnology and Genetic Engineering Reviews [ed. Tombs, M P, 10,
Chapter 1,
1992, Intercept, Andover, UK] and in International Patent Specification
No. WO 91/09967.
Antibody production includes not only the stimulation of an immune response by
injection into animals, but also analogous processes such as the production of
synthetic
antibodies, the screening of recombinant immunoglobulin libraries for specific-
binding
molecules (Orlandi_ et al., Proc. Natl. Acad. Sci.. USA 86:3833, 1989, or Huse
et al.
Science 256:1275, 1989), or the in vitro stimulation of lymphocyte
populations.
Current technology (Winter and Milstein, Nature 349:293, 1991) provides for a
number of highly specific binding reagents based on the principles of antibody
formation.
These techniques may be adapted to produce molecules which specifically bind
to the
inventive polypeptides or fragments thereof. Antibodies or other appropriate
molecules
generated against a specific immunogenic peptide fragment or polypeptide can
be used in
Western analysis, enzyme-linked immunosorbent assays (ELISA) or similar tests
to
establish the presence of, or to quantitate amounts of, any one the inventive
polypeptides
in normal, diseased, or therapeutically treated cells or tissues. Variations
on any
procedure known in the art for the measurement of polypeptides can be used in
the
practice of the instant invention. Such procedures include but are not limited
to
competitive and - non-competitive assay systems using techniques such as
radioimmunoassays, ELISA (enzyme linked immunoabsorbent assay), sandwich
immunoassays, agglutination assays, complement fixation assays,
immunoradiometric
assays, fluorescent inimunoassays, polypeptide A immunoassays,
immunoelectrophoresis
assays and the like.
-28-
CA 02604066 2007-10-29
In another aspect, the present invention provides methods of diagnosing or
predicting the suscepthbility to psoriasis of an individual, the methods each
comprising
the steps of: (a) obtaining a sample from an individual; (b) determining an
expression
level of at least one polypeptide chosen from the group consisting of CAN-1,
STG and
SEEK-l in the sample; and (c) diagnosing or predicting the susceptibility of
the
individual to psoriasis based on the presence or amount of the polypeptide. In
some
embodiments of the method of this aspect of the invention, step (b) comprises
determining an expression level of a CAN-1 polypeptide in said sample, wherein
the
CAN-1 polypeptide is at least least 70% (such as at least 80%, at least 90%,
at least 95%
or at least 99%) identical to the CAN-1 polypeptide of either SEQ ID NO:2 or
SEQ II)
NO:3. In some embodiments of the method of this aspect of the invention, step
(b)
comprises determining an expression level of an STG polypeptide in said
sample,
wherein the STG polypeptide is at least least 70% (such as at least 80%, at
least 90%, at
least 95% or at least 99%) identical to the STG polypeptide of SEQ ID NO:6. In
some
embodiments of the method of this aspect of the invention, step (b) comprises
determining an expression level of a SEEK 1 polypeptide in said sample,
wherein the
SEEK-1 polypeptide is at least least 70% (such as at least 80%, at least 90%,
at least 95%
or at least 99%) identical to the SEEK 1' polypeptide of SEQ ID NO:9.
Thus, in one embodiment, an individual is diagnosed as being susceptible to,
or
suffering from, psoriasis by virtue of a level of CAN-1, SEEK-1 and/or STG
that is at
least two-fold higher than a control level measured in a population of
individuals who are
not susceptible to psoriasis, and/or who do not suffer from psoriasis.
The methods of this aspect of the invention are applicable for use with a-
variety of
different types of samples isolated or obtained from an individual. For
example, tissue
samples and/or cell samples can be used. A tissue -or cell sample can be
obtained, for
example, by biopsy or surgery. As described below, and depending on the format
of the
method, the tissue can be used whole or subjected to various methods known in
the art to
disassociate the sample into smaller pieces, cell aggregates or individual
cells.
Additionally, when combined with amplification methods such as polymerase
chain
reaction (PCR), a single skin cell sample is sufficient for use in diagnostic
assays of the
invention which employ nucleic acid hybridization detection methods.
Similarly, when
measuring polypeptide levels or activity levels, amplification of the signal
with
-29-
CA 02604066 2007-10-29
enzymatic coupling or photometric enhancement can be employed using only a few
or a
small number of cells.
Whole tissue obtained from a skin biopsy or surgery is one example of a skin
cell
sample. Whole tissue sldn samples can be assayed employing any of the formats
described below. For example, the skin tissue sample can be mounted and
hybridized in
situ with a nucleic acid probe of the present invention. Similar histological
formats
employing polypeptide detection methods and in situ activity assays also can
be used to
detect polypeptides of the invention in whole slcin tissue cell samples.
Polypeptide
detection methods include, for example, staining with antibodies specific for
a target
polypeptide (e.g., CAN-1) and activity assays which result in the deposition
of a
polypeptide end product at the site of enzyme activity in the sample. Such
histological
methods as well as others are well known to those skilled in the art and are
applicable for
use in the diagnostic methods of the invention using whole tissue as the
source of the
sample. Methods for preparing and mounting the samples are similarly well
known in the
art.
Individual keratinocyte cells and cell aggregates from an individual having,
or
suspected of having, psoriasis is another example of a slcin cell sample which
can be
analyzed for increased or decreased expression of CAN-1, SEEK 1 or STG
polypeptide
or activity. The cells can be grown in culture and analyzed in situ using
procedures such
as those described above. The expression level can be determined by, for
example,
binding agents specific for CAN-1, SEEK 1 or STG polypeptides, or by
hybridization to
a probe specific to at least 15 contiguous nucleotides of a nucleic acid
molecule encoding
a CAN-1, SEEK-i or STG polypeptide. Other methods for measuring the expression
level of the inventive polypeptides or polynucleotides in whole cell samples
are known in
the art and are similarly applicable in any of the diagnostic formats
described below.
The sample obtained from an individual also can be analyzed for increased or
decreased expression of CAN-1, SEEK 1 and/or STG by lysing the cell and
measuring
the expression levels of CAN-1, SEEK 1 or STG polypeptide or nucleic acid
molecule in
the lysate, a fractionated portion thereof, or a purified component thereof
using any of
diagnostic formats described below. For example, if a hybridization format is
used, RNA
from one or more of the inventive polynucleotides can be amplified directly
from the
lysate using PCR, or other amplification procedures well known in the art such
as RT-
-30-
CA 02604066 2007-10-29
PCR, 5' or 3' RACE to directly measure the expression levels of CAbT-1, SEEK-1
or
STG. RNA also can be isolated and probed directly such as by solution
hybridization or
indirectly by hybridization to immobilized RNA. Similarly, when determining
the
expression level of the polypeptides of the invention using polypeptide
detection or
enzyme activity formats, lysates can be assayed directly, or they can be
further
fractionated to enrich for the inventive polypeptides and their corresponding
activities.
Numerous other methods applicable for use with various cell fractions are well
known to
those skilled in the art and can accordingly be used in the methods of the
invention.
The sample (such as a skin sample) can be obtained directly from the
individual
or, alternatively, it can be obtained from other sources for testing.
Similarly, the sample
can be tested when it is freshly isolated or it can be tested following short
or prolonged
periods of cryopreservation without substantial loss in accuracy or
sensitivity. If the
sample is to be tested following an indeterminate period of time, it can be
obtained and
then cryopreserved, or stored at 4 C for short periods of time, for example.
An advantage
of the diagnostic methods of the invention is that they do not require
histological analysis
of the sample. As such, the sample can be initially disaggregated, lysed,
fractionated or
purified and the active component stored for later diagnosis.
The diagnostic methods of the invention are applicable for use with a variety
of
different types of samples other than skin cell samples. For example,
intracellular nucleic
acid molecules and polypeptides of the invention may leak into the
extracellular space
when a psoriatic condition causes a disruption of the normal skin
architecture. Therefore,
the diagnostic methods of the invention are applicable with fluid samples
collected from
an individual having, or suspected of having psoriasis.
Fluid samples which can be measured for CAN-l, SEEK-1 or STG expression
levels include, for example, blood, serum, lymph, urine and semen. Other
bodily fluids
are known to those skilled in the art and are similarly applicable for use as
a sample in the
diagnostic methods of the invention. One advantage of analyzing fluid samples
is that
they are readily obtainable, in sufficient quantity, without invasive
procedures as required
by biopsy and surgery. Analysis of fluid samples such as blood, serum and
urine will
generally be in the diagnostic formats described above and below which measure
CAN-1,
SEEK-1 and/or STG polypeptide levels or activity. As the inventive
polypeptides are
-31-
CA 02604066 2007-10-29
circulating in bodily fluids, the methods will be similar to those which
measure
expression levels from cell lysates, fractionated portions thereof or purified
components.
Psoriasis can be diagnosed, predicted or prognosed by measuring the expression
levels of the nucleic acid molecules and polypeptides of the present invention
in a tissue
or cell sample, circulating fluid, or other bodily fluid obtained from the
individual. As
described above, expression levels can be measured by a variety methods known
in the
art. For example, the expression level of a nucleic acid of the invention can
be
determined by measuring the amount of an RNA or polypeptide of the invention
in a
sample from the individual. Alternatively, the expression level of the
inventive
.10 polypeptides can be determined by measuring the amount of enzyme activity
in the
sample, the amount of activity being indicative of the expression level of the
inventive
polynucleotide.
Given the teachings and guidance provided herein, the choice of measuring
nucleic acid (such as RNA), polypeptide or activity will be that of the user.
Considerations such as the sample type, availability and amount will also
influence
selection of a particular diagnostic format. For example, if the sample is a
kaeratinocyte
cell sample and there is only a small amount available, then diagnostic
formats which
measure the amount of RNA by, for example, PCR amplification, can be an
appropriate
choice for determining the expression level of a nucleic acid molecule of the
invention.
Alternatively, if the sample is a blood sample and the user is analyzing
numerous
different samples simultaneou.sly, such as in a clinical setting, then a multi
sample format,
such as an Enzyme Linked Immunoabsorbent Assay (ELISA), which measures the
amount of polypeptide can be an appropriate choice- for determiining the
expression level
of a polypeptide of the invention. Additionally, nucleic acid molecules of the
invention
released into bodily fluids from psoriatic skin cells can also be analyzed by,
for example,
PCR or RT-PCR. Those skilled in the art will know, or can determi.ne which
format is
asnenable for a particular application and which methods or modifications
known within
the art are compatible with a particular type of format.
Hybridization methods are applicable for measuring the amount of RNA as an
indicator of expression levels. There are numerous methods well known in the
art for
detecting nucleic acid molecules by specific or selective hybridization with a
complementary probe. Such methods include both solution hybridization
procedures and
-32-
CA 02604066 2007-10-29
solid-phase hybridization procedures where the probe or sample is immobilized
to a solid
support. Descriptions for such methods can be found in, for example, Sambrook
et al.,
supra, and in Ausubel et al., supra. Specific examples of such methods include
PCR and
other amplification methods such as RT-PCR, 5' dr 3' RACE, RNase protection,
RNA
blot, dot blot or other membrane-based technologies, dip stick, pin, ELISA or
two-
dimensional arrays immobilized onto chips as a solid support. These methods
can be,
performed using either qualitative or quantitative measurements, all of which
are well
known to those skilled in the art.
PCR or RT-PCR can be used with isolated RNA or crude cell lysate preparations.
"
As described previously, PCR is advantageous when there is little starting
material. A
further description of PCR methods can be found in, for example, Dieffenbach,
C.W., and
Dveksler, G.S., PCR Primer: . A Laboratory Manual, Cold Spring Harbor Press,
Plainsview, New York (1995). Multi sample formats such as an ELISA or two-
dimensional array offer the advantage of analyzing numerous, different samples
in a
single assay. A particular example of a two-dimensional array used in a
hybridization
format is described further below in the Examples. In contrast, solid-phase
dip stick-
based methods offer the advantage of being able to rapidly analyze a patient's
fluid
sample and obtain an immediate result.
Polynucleotide probes useful for measuring the expression level of the nucleic
acid molecules of the invention by hybridization include, for example, all of
the inventive
nucleic acid molecules described herein.
Briefly, for detection by hybridization, one or more polynucleotide probes
having
detectable labels are added to a cell, tissue or fluid sample obtained from an
individual
under conditions which allow annealing of the probe to RNA. Such conditions
are well
known in the art for both solution and solid phase hybridization procedures.
Moreover,
optimization of hybridization conditions can be performed, if desired, by
hybridization of
an aliquot of the sample at different temperatures, durations and in different
buffer
conditions. Such procedures are routine and well known to those skilled.
Following
annealing, the sample is washed and the signal is measured and compared with a
suitable
control or standard value. The magnitude of the hybridization signal is
directly
proportional to the expression levels of the polynucleotide of the invention
for which the
probe was specific.
-33-
CA 02604066 2007-10-29
A suitable control for comparison can be, for example, the expression level of
a
nucleic acid molecule of the invention from a skin cell or a fluid sample
obtained from a
norrnal individual. The control sample for comparison can be measured
simultaneously
with one or more test samples or, altematively, expression levels can be
established for a
particular type of sample and standardized to internal or external parameters
such as
polypeptide or polynucleotide content, cell number or mass of tissue. Such
standardized
control samples can then be directly compared with results obtained from the
test sample.
An increase (such as, by way of non-limiting example, an increase of two-fold
or more)
of expression levels of a nucleic acid molecule of the invention indicates the
presence
psoriasis in the tested individual.
-The diagnostic procedures described above and below using the inventive
nucleic
acid molecule and polypeptide probes can additionally be used in conjunction
with other
psoriasis markers, for simultaneous or independent corroboration of a sample.
Those
skilled in the art will know which markers are applicable for use in
conjunction with* a
nucleic acid molecule or polypeptide of the invention to delineate more
specific
diagnostic information such as that described above. '
Therefore, in one aspect, the invention provides a method of diagnosing or
predicting the susceptibility of a psoriatic condition in an individual
suspected of having
psoriasis where the expression level of a nucleic acid molecule of the
invention is
determined by measuring the amount of its respective RNA. The amount of CAN-1,
STG or SEEK-1 RNA can be determined by hybridization with a polynucleotide
probe of
at least 10 nucleotides in length.
The invention additionally provides a method of diagnosing or predicting the
susceptibility of a psoriatic condition in an individual suspected of having
psoriasis where
the expression level of an inventive polypeptide is determined by measuring
the amount
of polypeptide. The method comprises contacting a cell or tissue sample, or
lysate
thereof, or fractionated sample thereof, from an individual suspected of
having psoriasis
with a binding agent selective for one of the inventive polypeptides, and
determining the
amount of selective binding of the agent. The fractionated sample can be, for
example, a
cell lysate or lipid membranes and the binding agent can be an antibody or a
non-
hydrolyzable substrate analog depending upon which inventive polypeptide is
being
assayed. For example, when the assay is directed to CAN-1 the fraction can be
lipid
-34-
CA 02604066 2007-10-29
membranes and the selective binding agent can be an antibody. Alternatively,
when the
assayed polypeptide is CAN-1, the fractionated sample can be a cell lysate and
the
binding agent can be an antibody or non-hydrolyzable substrate analog.
Essentially all modes of affinity binding assays are applicable for use in
determiniiig the amount of a polypeptide of the invention in a sample. Such
methods are
rapid, efficient and sensitive. Moreover, affinity binding methods are simple
and can be
adjusted to be performed in a variety of clinical settings and under
conditions to suit a
variety of particular needs. Affinity binding assays which are known and can
be used in
the methods of the invention include both soluble and solid phase formats. A
specific,
representative, example of a soluble phase affinity binding assay is
immunoprecipitation
using an antibody selective for CAN-1. Solid phase formats are advantageous
for the
methods of the invention since they are rapid and can be performed more easily
on
multiple different samples simultaneously without losing sensitivity or
accuracy.
Moreover, solid phase affinity binding assays are ftuther amenable to high
throughput
screening and automation.
Specific examples of solid phase aff nity binding assays include
immunoaffinity
binding assays such as an ELISA and radioimmune assay (RIA). Other solid phase
affinity binding assays are known to those skilled in the art and are
applicable to the
methods of the invention. Although affnity binding assays are generally
formatted for
use with an antibody that is selective for the analyte or ligand of interest,
essentially any
binding agent can be alternatively substituted for selectively binding the
antibody. Such
binding agents include, for example, 'steroids, steroid derivatives,
macromolecules such
as polypeptides, peptides, nucleic acids, lipids and sugars as well as small
molecule
compounds. Methods are lcnown in the art for identifying such molecules which
bind
selectively to a particular analyte or ligand and include, for example,
combinatorial
libraries. Thus, for a molecule other than an antibody to be used in an
affinity binding
assay, all that is necessary is for the binding agent to exhibit selective
binding activity for
the inventive polypeptide.
Various modes of affinity binding formats are similarly known which can be
used .
' in the diagnostic methods of the invention. For the purpose of illustration,
particular
embodiments of such affinity=binding assays will be described further in
reference to
immunoaf6nity binding assays. The various modes of affnity binding assays,
such as
-35-
CA 02604066 2007-10-29
immunoaffinity binding assays, include for example, solid phase ELISA and RIA
as well
as modifications thereof. Such modifications thereof include, for example,
capture assays
and sandwich assays as well as the use of either mode in combination with a
competition
assay format. The choice of which mode or format of immunoaffinity binding
assay to
use will depend on the intent of the user. Such methods can be found described
in
common laboratory manuals such as Harlow and Lane, Using Antibodies: A
Laboratory
Manual, Cold Spring Harbor Laboratory Press, New York (1999).
As with the hybridization methods described previously, the diagnostic formats
employing affinity binding can be used in conjunction with a variety of
detection labels
and systems known in the art to quantitate amounts of a polypeptide of the
invention.in
the analyzed sample. Detection systems include the detection of bound
polypeptide of
the invention by both direct and indirect means. Direct detection methods
include
labeling of an antibody or binding agent that binds specifically to a
polypeptide of the
invention. Indirect detection systems include, for example, the use of labeled
secondary
antibodies and binding agents.
Secondary antibodies, labels and detection systems are well known in the art
and
can be obtained commercially or by techniques well known in the art. The
detectable
labels and systems employed with a binding agent that is specific to a
polypeptide of the
invention should not impair binding of the agent to its cognate inventive
polypeptide.
Moreover, multiple antibody and label systems can be employed for detecting
bound
antigen/antibody complexes of the invention to enhance the sensitivity of the
binding
assay if desired.
As with the hybridization formats described previously, detectable labels can
be
essentially any label that can be quantitated or measured by analytical
methods. Such
labels include, for example, enzymes, radioisotopes, fluorochromes as well as
chemi- and
bioluminescent compounds. Specific examples of enzyme labels include
horseradish
peroxidase (HRP), alkaline phosphatase (AP), 0-galactosidase, urease'and
luciferase.
A horseradish-peroxidase detection system can be used, for example, with the
chromogenic substrate tetramethylbenzidine (TMB), which yields a soluble
product in the
presence of hydrogen peroxide that is detectable by measuring absorbance at
450 nm. An
alkaline phosphatase detection system can be used with the chromogenic
substrate
p-nitrophenyl phosphate, for example, which yields a soluble product readily
detectable
-36-
CA 02604066 2007-10-29
by measuring absorbance at 405 nm. Similarly, aP-galactosidase detection
system can be
used with the chromogenic substrate o-nitrophenyl-o-D-galactopyranoside
(ONPG),
which yields a soluble product detectable by measuring absorbance at 410 nm,
or a urease
detection system can be used with a substrate such as urea-bromocresol purple
(Sigma
Imrnunochemicals, St. Louis, MO). Luciferin is the substrate compound for
luciferase
which emits light following ATP-dependent oxidation.
Fluorochrome detection labels are rendered detectable through the emission of
light of ultra.violet or visible wavelength after excitation by light or
another energy
source. DAPI, fluorescein, Hoechst 33258, R-phycocyanin, B-phycoerythrin,
R-phycoerythrin, rhodamine, Texas red and lissamine are specific examples of
fluorochrome detection labels that can be utilized in the affinity binding
formats of the
invention. Particularly useful fluorochromes include fluorescein and
rhodamine.
Chemiluminescent as well as bioluminescent detection labels are convenient for
sensitive, non-radioactive detection of the inventive polynucleotides and
polypeptides
and can be obtained commercially from various sources such as Amersham
Lifesciences,
Inc. (Arlington Heights, IL).
Radioisotopes can alternatively be used as detectable labels for use in the
binding
assays of the inventioii. Iodine-125 is a specific -example of a radioisotope
useful for a
detectable label.
Signals from detectable labels can be analyzed, for example, using a
spectrophotometer to detect color from a chromogenic substrate; a fluorometer
to detect
fluorescence in the presence of light of a certain wavelength; or a radiation
counter to
detect radiation, such as a gamma counter for detection of iodine-125. For
detection of
an enzyme-linked secondary antibody, for example, a quantitative analysis of
the amount
of bound agent can be made using a spectrophotometer such as an EMAX
Microplate
Reader (Molecular Devices, Menlo Park, CA) in accordance with the
manufacturer's
'instructions. If desired, the assays of the invention can be automated or
performed
robotically, and the signal from multiple samples can be detected
simultaneously.
The diagnostic formats of the present invention can be forward, reverse or
simultaneous as described in U.S. Patent No. 4,376,110 and No. 4,778,751.
Separation
steps for the various assay formats described herein, including the removal of
unbound
secondary antibody, can be performed by methods known in the art (Harlow and
Lane,
-37-
CA 02604066 2007-10-29
supra). For example, washing with a suitable buffer can be followed by
filtration,
aspiration, vacuum or magnetic separation as well as by centrifugation.
In yet another aspect, the present invention provides methods for identifying
a
binding partner of a CAN-1, STG or SEEK-1 polypeptide, the methods comprising
the
steps of (a) contacting a CAN-1, STG or SEEK-1 polypeptide with a binding
partner
(such as a monoclonal or polyclonal antibody); and (b) determining whether the
binding
partner affects a biological activity of the polypeptide.
The methods of this aspect of the invention may include contacting a sample
containing the CAN-1, STG or SEEK-1 polypeptide, and an appropriate substrate,
with a
test compound under conditions that allow product formation from the
substrate, and
measuring the amount of the product formation from the substrate. A decrease
in the
amount of product formation from the polypeptide substrate in the presence of
the test
compound compared to the absence of the .test compound indicates that the
compound
has inhibitory activity towards the inventive polypeptide activity. Similarly,
compounds
that increase the activity of a CAN-1, STG or SEEK 1 polypeptide also can be
identified.
A test compound added to a sample containing a CAN-1, STG or SEEK-1
polypeptide
and an appropriate substrate which increases the amount of product or rate of
product
formation or chemical modification of the substrate, compared to the absence
of the test
compound, indicates that the compound increases the activity of the
polypeptide.
Therefore, in one aspect, the invention provides a method of identifying
compounds that
modulate the activity of the polypeptides of the present invention. The
polypeptide-
containing sample used for such a method can be serum, skin tissue, a
keratinocyte cell
population or a recombinant cell population expressing the inventive
polypeptide.
The methods for determining the activity of -a CAN-1, SEEK-1 or STG
polypeptide in a sample described above can also be adapted for screening test
compounds to determine their ability to inhibit or increase the enzymatic
and/or
biological activity of an inventive polypeptide. In such cases, a test
compound is added
to a reaction system and the effect of the test compound on production of
product is
observed. Those compounds which inhibit the product formation or rate of
product
formation are considered as potential antagonists of the inventive
polypeptides and
furkher as potential therapeutic agents for treatment of psoriasis. Similarly,
those
compounds which increase the product or rate of product formation are
considered as
-38-
CA 02604066 2007-10-29
potential agonists of the inventive polypeptides and further as potential
therapeutic agents
for the treatment of psoriasis.
A reaction system for identifying a compound that inhibits or enhances the
activity of the inventive polypeptides can be performed using essentially any
source of
inventive polypeptide activity. Such sources include, for example, a skin cell
sample,
lysate or fcactionated portion thereof; a bodily fluid such as blood, serum or
urine from an
individual with prosiasis; a recombinant cell or soluble recombinant source,
and an in
vitro translated source. The source of inventive polypeptide is combined with
an
appropriate substrate as described above and incubated in the presence or
absence of a
test inhibitory compound. The reaction rate or extent of the usage of the
substrate in the
presence of the test compound is compared with that in the absence of the test
compound.
Those test compounds which provide inhibition of the reaction activity of at
least
about 50% are considered to be inhibitors of the inventive polypeptides.
Similarly, those
compounds which increase the reaction activity of two-fold or more are
considered to be
enhancers of the activity of the inventive polypeptides. Such inhibitors of
the inventive
polypeptides can then be subjected to further in. vitro or in vivo testing to
confirm that
they inhibit the production of substrates of the inventive polypeptides in
cellular and
animal models.
Suitable test compounds for the inhibition or enhancement assays can be any
substance, molecule, compound, mixture of molecules or compounds, or any other
composition which is suspected of being capable of inhibiting inventive
polypeptide
activity in vivo or in vitro. The test compounds can be heterocyclic organic
compounds
such as steroids or steroid derivatives, macromolecules, such as biological
polymers,
including polypeptides, polysaccharides and nucleic acids. Sources of test
compounds
which can be screened for inhibitory activity against the inventive
polypeptides include,
for example, libraries of peptides, polypeptides, DNA, RNA and small organic
compounds. Additionally, test compounds can be preselected based on a varieiy
of
criteria. For example, suitable test compounds for CAN-1 can be selected, for
example,
randomly and tested by the screening methods of the present invention. Test
compounds
are administered to the reaction system at a concentration in the range from
about 1 nM
to I mM. Useful test compounds such as steroids and steroid derivatives are
lipophilic,
-39-
CA 02604066 2007-10-29
thus allowing them to cross the cell membrane. In addition, routine ligand
specific
targeting methods are useful for testing compounds for inhibitory activity.
Therefore, in one aspect, the invention - provides methods of identifying a
compound that inhibits or enhances the activity of a CAN-1, SEEK-1 or STG
polypeptide
where the sample further consists of a skin cell lysate, a recombinant cell
lysate
expressing a CAN-1, SEEK-1 and/or STG polypeptide, an in vitro translation
lysate
containing mRNA encoding CAN-1, SEEK-1 or STG polypeptide, a fractionated
sample
of a sltin cell lysate, a fractionated sample of a recombinant cell lysate
expressing CAN-
1, SEEK-1 or STG polypeptide, a fractionated sample of an in vitro translation
lysate
containing niRNA encoding a CAN-1, SEEK-1 or STG polypeptide or an isolated
CAN-
1, SEEK-1 or STG polypeptide. The method can be in single or multiple sample
format.
In another aspect, the present invention provides methods for ameliorating the
symptoms and/or progression of psoriasis, the methods comprising administering
to an
individual suffering from psoriasis an inhibitory amount of a selective
inhibitor of at least
one polypeptide chosen from the group consisting of CAN-1, STG and S$EK-1,
wherein
the inhibitory amount causes a reduction (such as, by way of non-limiting
example, a
reduction of about 2-fold) in the amount and/or activity of the chosen
polypeptide(s). A
representative example of a selective inhibitor is an antisense polynucleotide
that is
- complementary to all, or to a portion, of a nucleic acid molecule (such as
an mRNA
molecule) that encodes a CAN-1, STG or SEEK-1 polypeptide.
Such inhibitors may be produced using methods which are generally known in the
art, and include the use of purified CAN-i, SEEK-1 or STG polypeptide to
produce
antibodies or to screen libraries of compounds, as descn"bed previously, for
those which
specifically bind to CAN-l, SEEK 1 or STG polypeptide. Lipophilic compounds
able to
cross the lipid bilayer that makes up cell membranes are especially useful
inhibitors for
practicing the methods of the invention.
Antibodies specific to CAN-i can be used, for example, directly as an
antagonist.
The antibodies can be generated using methods that are well known in the art
and
include, for example, polyclonal, monoclonal, chimeric, humanized single
chain, Fab
fragments, and fragments produced by a Fab expression library.
It is preferred that antibodies of the present invention are CDR-grafted
antibodies.
The term "CDR-grafted antibody" as used herein refers to an antibody molecule
wherein
-40-
CA 02604066 2007-10-29
the heavy and/or light chain contains one or more CDRs from a donor antibody
(e.gõ a
murine monoclonal antibody) grafted into a heavy and./or light chain variable
region
framework of an acceptor antibody (e.g., human antibody).- Constraction of CDR-
grafted
antibodies is fully described in European Patent Application EP-A-0239400.
The earliest work, on humanising monoclonal antibodies by CDR-grafting was
carried out on monoclonal antibodies recognizing synthetic antigens, such as
NP or NIP
antigens. However, examples in which a mouse monoclonal antibody recognizing
lysozyme and a rat monoclonal antibody recognizing an antigen on human T-cells
were
humanised by CDR-grafting have been described by Verhoeyen et al (Science,
239:
1534-1536 (1988)), and Riechmann et al (Nature, 332: 323-324 (1988)),
respectively.
In Riechmann et al, it was found that the transfer of the CDR regions alone
(as
defined by Kabat et al, 1987, in Sequences of Proteins of Immunological
Interest, US
Department of Health and Human Services, NIH, USA; and Wu et al, J. F.V. Med,
132:
211-250 (1970)) was not sufficient to provide satisfactory antigen binding
activity in the
CDR-grafted product. It was -found that a number of framework residues have to
be
altered so that they correspond to those of the donor framework region.
Proposed criteria
for selecting which framework residues need to be altered are descnbed in
International
Patent Application WO 90/07861.
In another embodiment of the invention, the nucleic acid molecules encoding a
CAN-1, SEEK 1 or STG polypeptide, or any fragment thereof, or antisense
molecules
complementary to all or part of a nucleic acid molecule encoding a CAN-1, SEEK-
1 or
STG polypeptide, are used for therapeutic purposes. In one aspect, antisense
molecules
complementary to nucleic acid moleoules encoding a CAN 1, SEEK 1 or STG
polypeptide are used to block the transcription or translation of an mRNA
homologous to
the antisense molecule. Specifically, cells are transformed with sequences
complementary to mRNA transcripts encoding a CAN-1, SEEK 1 or STG polypeptide.
Such methods are well known in the art, and sense or antisense
oligonucleotides or larger
polynucleotide fragments, can be designed from various locations along the
coding or
control regions of sequences encoding the inventive polypeptides. - Thus,
antisense
molecules may be used to modulate the activity of the inventive polypeptides,
or to
achieve regulation of gene fanction.
-41-
CA 02604066 2007-10-29
Expression vectors derived from retroviruses, adenovirus, adeno-associated
virus
(AAV), herpes or vaccinia viruses, or from various bacterial plasmids can be
used for
delivery of antisense nucleotide sequences to a skin cell population. The
viral vector
selected should be able to infect the skin cells and be safe to the host and
cause minimal
cell transformation. Retroviral vectors and adenoviruses offer an efficient,
useful, and
well characterized means of introducing and expressing foreign genes
efficiently in
mammalian cells. These vectors are well known in the art and have very broad
host and
cell type ranges, express genes stably and efficiently. Methods which are well
known to
those skilled in.*the art can be used to construct such recombinant vectors
and are
described in Sambrook et al. (supra). Even in the absence of integration into
the DNA,
such vectors can continue to transcribe RNA molecules for a substantial period
of time.
Transient expression can last for a month or more with a non-replicating
vector and even
longer if appropriate replication elements are part of the vector system.
Ribozymes, enzymatic RNA molecules, can also be used to catalyze the specific
cleavage of mRNAs encoding CAN-1, SEEK-1 or STG. The mechanism of ribozyme
action involves sequence-specific hybridization of the ribozyme molecule to a
complementary target RNA, followed by endonucleolytic cleavage. Specific
ribozyme
cleavage sites within any potential RNA target are identified by scanning a
target RNA
-for ribozyme cleavage sites which include, for example, the following
sequences: GUA,
GUU, and GUC. Once identified, short RNA sequences of between 10 and 20
ribonucleotides corresponding to the region of the target polynucleotide
containing the
cleavage site can be evaluated for secondary structural features which can
render the
oligonucleotide inoperable. The suitability of candidate targets can also be
evaluated by
testing accessibility to hybridization with complementary oligonucleotides
using
ribonuclease protection assays. Antisense molecules and ribozymes of the
invention can
be prepared by any method known in the art for the synthesis of nucleic acid
molecules.
In another embodiunent, the CAN-1, SEEK 1 or STG promoter and regulatory
regions can be used for constructing vectors for psoriasis therapy. The
promoter and
regulatory region can be operatively fused to a therapeutic polynucleotide for
keratinocyte-specific expression. This method can include the addition of one
or more
enhancer elements which amplify expression of the heterologous therapeutic
polynucleotide without compromising tissue specificity.
-42-
CA 02604066 2007-10-29
It is understood that modifications which do not substantially affect the
activity of
the various embodiments of this invention are also included within the
definition of the
invention provided herein. Accordingly, the following examples are intended to
illustrate
but not limit the present invention.
EXAMPLE 1
IDENTIFICATION AND CHARACTERIZATION OF CAN-1
As part of a detailed sequence analysis of the publicly deposited DNA sequence
surrounding the HLA C locus on human chromosome 6, a novel candidate coding
sequence (a.k.a. CAN-1) was identified based upon its chromosomal position
relative to
the psoriasis associated HLA Cw6 allele, and its relatively strong RNA
expression level
in skin. The CAN-1 transcript unit is located on chromosome 6 approximately
132
kilobases (kb) telomeric away from the HLA Cw6 allele.
A genomic DNA sequence was obtained from the publicly available databases
(e.g. GenBank) for a cosmid clone (AC004195), which is located 130 kb
telomeric from
HLA-C. Based on a literature report of a gene (pg8) in this region being
expressed in
skin (Guillaudeux et al. PNAS 95:9494-9499, 1998) the entire cosmid sequence
was
screened for potential exons using Genscan (Burge, C. and Karlin, S.,
Prediction of
complete gene structures in human genomic DNA. J. Mol. Biol. 268, 78-94,
1997). The
Genscan program predicted the existence of three exons in the AC004195 cosmid
clone
insert DNA that were not previously described. One of the exons showed DNA
sequence
homology to six mouse IMAGE EST cDNA clones that were all derived from skin.
The
sequence information from the mouse EST clones was assembled into one
reference
sequence and then compared to the human genomic sequence from AC004195. This
led
to the identification of two exons in the human sequence, exon one, identified
by
Genscan, and exon two only partially identified by Genscan. Using both the
mouse EST
sequence and human genomic exons as a guide, additional searching of Genbank
dbest
database revealed one partially overlapping human fetal heart cDNA and two
additional
mouse skin ESTs that appeared to be similar.
To find out if these two exons identified above were expressed in human
tissues,
PCR primers were designed for these exons and tested for the ability to detect
these exons
in a number of human tissue sources. The predicted exons were detected only in
eDNA
prepared from human skin.
-43-
CA 02604066 2007-10-29
The two exon transcr.iption unit was designated as CAN-1. Using 5' RACE to
extend the 5' untranslated region sequence, a cDNA sequence was determined and
found
to have 891 nucleotides (SEQ ID NO:1). A polyadenylation signal site (AATAAA)
is
located 18 base pairs (bp) from a poly-A tail. The largest open reading frame
identified
in the CAN-1 eDNA sequence (SEQ ID NO:1) is 408 bp (or 136 amino acids (SEQ ID
NO:2)). Analysis of the predicted polypeptide (SEQ ID NO:2) revealed the
presence of a
predicted signal peptide (amino acids 1 to 22 of SEQ ID NO:2) and cleavage
site (amino
acid 22 of SEQ ID NO:2). This suggests that the entire coding sequence for CAN-
1 has
been identified. The amino acid sequence of the mature CAN-1 polypeptide
(without the
signal peptide) is set forth in SEQ ID NO:3. Comparison of the human and mouse
amino
acid sequences shows that they are 73% conserved. However, a BLAST computer
search
of the public databases did not reveal any significant polypeptide homologies
betweeri the
CA1V 1 polypeptide (SEQ ID NO:2) and any known or predicted polypeptides in
Genbank.
EXAMPLE 2
EXPRESSION PROFILE OF CAN-1 IN HUMAN TISSUES
To test what tissues expressed human CAN-1, PCR was used to examine cDNA
prepared from mRNA transcripts isolated from thirry-two different human
tissues. All
tissues were purchased from commercial sources (Invitrogen, Carlsbad, CA,
Clontech,
Palo Alto, CA. Biochain Hayward, CA), except for PBL (peripheral blood
lymphocytes)
and bone which were prepared in-house. The tissue sources assayed were: heart,
small
intestine, marnmary gland, spleen, prostate, stomach, skeletal muscle, thymus,
skin,
uterus, kidney bone marrow, liver, colon, lung, trachea, pancreas, brain,
salivary gland,
cerebellum, thyroid, fetal brain, parotid, fetal liver, umbilical cord, spinal
cord, ovary,
placenta, PBL, adrenal gland, and bone.
eDNA was prepared from 5 g of total RNA using an oligo dT primer and
standard reverse transcription methods according to manufar,hn-ers'
proto~cols. (Gibco
BRL Cat No. 18089-011, Frohman, 1985).
15 ng/ l aliquots of each cDNA sample were subjected to PCR amplification
using primers [DMO 9299: GACTCAGCCCACCCCAGCTTT (SEQ ID NO:11)] and
[DMO 8932: CCGGGGTGGGTCTAGGTCT (SEQ ID N0:12)]. PCR cycling
conditions were 94 C 30s, 62 C 30s, 72 C 30 sec for 35 cycles. The resulting
amplified
-44-
CA 02604066 2007-10-29
DNA products were separated using gel electrophoresis and according to this
analysis,
CAN-1 is readily detected in only the normal skin cDNA sample, and the only
other
tissue showing slight expression was thymus.
EXAMPLE 3
CAN-1 SEQUENCE POLYMORPHISMS
CAN-1 polynucleotide sequences from 12 different humans subjects were
analyzed for DNA polymorphisms that might affect the function of the encoded
polypeptide. Twelve psoriatic human subjects were analyzed, and three non-
psoriatic
controls. Numerous single nucleotide polymorphisms (SNPs) were found in and
around
the coding sequence for the CAN-1 polypeptide. The location and identity of
the
polymorphisms are set forth in Table 1. The locations of the polymorphisms are
with
reference to the numbering of the CAN-1 genomic nucleotide sequence set forth
in SEQ
IDNO:4.
TABLE 1
CAN-1 single nucleotide Location
polymorphism
T 118
A 365
A 554
G 970
T 1100
A 1200
T 1394
A 1681
T 1879
A 1986
C 2020
G 2111
T 2397
G 2655
G 2822
C 2875
One SNP is a T at position 311 of the CAN-1 cDNA sequence set forth in SEQ ID
NO:1.
Additionally, a CAN-1 gene polymorphism was observed in which the nucleic
acid sequence CAAG was deleted at positions twelve through fifteen of the CAN-
1
genomic nucleotide sequence set forth in SEQ ID NO:4. The nucleic acid
sequence of
-45-
CA 02604066 2007-10-29
this deletion polymorphism is set forth in SEQ ID NO:10. Thus, in one aspect,
the
present invention provides isolated genomic DNA molecules that encode a CAN-1
polypeptide, and that are*at least 70% identical (such as at least 80%
identical, at least
90% identical, at least 95% identical or at least 99% identical) to the
genomic DNA
molecule set forth in SEQ ID NO:10. The exons in the CAN-1 gene consisting of
the
sequence set forth in SEQ ID NO:10 are located at the following positions:
nucleic acid
residue 1481 through nucleic acid residue 1535, and nucleic acid residue 2202
through
nucleic acid residue 2557.
One or more of the SNPs described in and around the CAN-1 gene are likely
useful for predicting either the onset of psoriasis, or the likely outcome
following a
particular therapeutic treatment.
EXAMPLE 4
IDENTIFICATION AND CHARACTERIZATION OF STG
Using a large continuous sequence of DNA deposited and available in the public
databases, the Genscan computer program predicted the existence of a gene
called U8,
and later called STG by Oka et al. Human Mol. Genet. 8(12):2165-2170 (1999).
The specificity of the expression of the human STG coding sequence was
examined by PCR=analysis of eDNA samples prepared from mRNA transcripts
isolated
from thirty-six (36) different human tissues. The tissue sources assayed were:
heart,
small intestine, mammary gland, spleen, prostate, stomach, skeletal muscle,
thymus, skin,
uteras, lcidney, bone marrow, liver, colon, lung, trachea, pancreas, brain,
salivary gland,
cerebellum, thyroid, fetal brain, parotid, fetal liver, umbilical cord, spinal
cord, ovary,
placenta, PBL, adrenal gland, testis, adipose tissue, cartilage, fetal skin,
stimulated PBL
and bone.
Aliquots of each cDNA tissue sample were subjected to 35 cycles of PCR
amplification using primers TCCTC'rGGGCCTGCTCCT [DMO141041(SEQ ID N0:13)
and GTCCGAGCTGAGGCAAGTTG [DM014030] (SEQ ID N0:14) and the resulting
amplified DNA products separated using gel electrophoresis. According to tbis
analysis,
STG transcription products were detected in 5 out of the 36 tissues tested,
including skin
and fetal skin, The level of expression observed in the skin samples was
as high as for any of the other tissues. Further, in a panel of skin samples
from eleven
individuals, it appears tha# multiple individuals expressed STG in their skin.
Also, and
-46-
CA 02604066 2007-10-29
possibly most importantly, the STG encoding transcript was found to be
expressed highly
in a keratinocyte sample.
Based on the physical location of the STG coding sequence (near the HLA-C
locus on human chromosome 6), the STG polypeptide is a candidate to be
involved in the
genetic susceptibility towards psoriasis. Furthermore, the fact that the STG
coding
sequence is expressed in skin samples, and particularly in keratinocytes,
suggests that the
STG polypeptide may have a function important at the site of the psoriatic
lesion. For
these reasons in particular, STG appears to be a target for intervention in
the psoriasis
disease process.
EXAlYIl'LE 5
STG SEQUENCE POLYMORPHISMS STG polynucleotide sequences from nine psoriatic
humans subjects were
analyzed for DNA polymorphisms that might affect the function of the STG
polypeptide.
Numerous SNPs were found in and around the STG coding sequence (see Table 2).
Some of these polymorphisms affect amino acids in the polypeptide product, and
thus
may be of functional relevance. Other of the polymorphisms are located in 5'
or 3'
untranslated regions of the STG gene, and may have some functional importance
in the
regulation of the expression of the STG polypeptide.
Table 2. SNPs discovered by sequencing in and around the STG gene. The
location of the SNPs is with reference to the STG genomic DNA sequence set
forth in
SEQ ID NO:7.
STG single nucleotide Location
polymorphism
G 17
G 32
C 45
G 116
A 171
G 178
C 198
C 238
C 356
C 364
G 379
C 393
C 511
G 626
C 665
-47-
CA 02604066 2007-10-29
STG single nucleotide Location
polymorphism
C 730
C 3365
A 3451
G 3483
A 3497
C 4969
The. SNPs that occur within the open reading frame encoding the STG protein
product are shown in Table 3 wherein the location of the SNPs is with
reference to the
STG cDNA sequence set forth in SEQ ID NO:5.
TABLE 3
STG single nucleotide
polymorphism (amino Location
acid substitutionshown)
A (Axg) 142
C (Ala) 242
C (Pro) 247
T (silent) 492
A (Lys) 493
C (silent) 900
EXAMPLE 6
IDENTIFICATION AND CHARACTERIZATION OF SEEK-1
A cDNA was submitted to Genbank (Accession No. AB031479) which was
reported to be near the HLA C gene. There were no significant polypeptide
homologies
detected by using the SEEK,1 deduced polypeptide sequence to search the public
database using the BLAST program.
The specificity of the expression of the human SEEK-1 coding sequence was
examined by PCR analysis of cDNA samples prepared from mRNA transcripts
isolated
from thirty-six (36) different human tissues. The tissue sources assayed were:
heart,
small intestine, mammary gland, spleen, prostate, stomach, skeletal muscle,
thymus, skin,
uterus, kidney bone marrow, liver, colon, lung, trachea, pancreas, brain,
salivary gland,
cerebellum, thyroid, fetal brain, parotid, fetal liver, umbilical cord, spinal
cord, ovary,
placenta, PBL, adrenal gland, testis, adipose tissue, cartilage, fetal skin,
stimulated PBL
and bone. Expression of the SEEK-1 transcript was also examined using a
psoriatic
-48-
CA 02604066 2007-10-29
tissue panel composed of 11 patient samples from psoriatic skin lesions and
uninvolved
skin.
Aliquots of each cDNA tissue sample were subjected to 35 cycles of PCR
amplification using primers GGAACCAGGATATCCTCCTGTGT [DM014027] (SEQ
ID NO:15) and ACCCCAGCTCCTTAACACAGATC [DM014102] (SEQ ID N0:16)
and the resulting amplified DNA products separated using gel electrophoresis.
According to this analysis, SEEK 1 cDNA was readily detected in 8 out of the
36 tissues
tested, including skin and fetal skin. More specifically, SEEK 1
expression products were only detected in a subset of the tissues tested,
including skin,
fetal skin, testis, uterus, prostate, mammary gland, ovary and colon. In
a panel of skin samples, it appears that multiple individuals express SEEK 1
in their skin.
Also, the SEEK-1 coding sequence was found to be expressed highly in a
keratinocyte
sample.
EXAMPLE 7
BACTERIAL EXPRESSION OF CAN-1, STG AND SEEK 1
This example sets forth a representative protocol for expressing CAN-1, STG or
SEEK-1 protein. A nucleic acid molecule encoding a polypeptide of the present
invention is atnplified using PCR oligonucleotide primers corresponding to the
5' and 3'
ends of DNA sequences encoding CAN-1, STG or SEEK 1 to synthesize
polynucleotide
fragments that encode CAN-1, STG or SEEK-i polypeptide. The primers used to
amplify the eDNA insert should preferably contain restriction sites, such as
BamHI and
XbaI, at the 5' end of the primers in order to clone the amplified product
into the
expression vector. For example, Ndel and Xhol correspond to the restriction
enzyme
sites on the bacterial expression vector pET-23a. (Novagen, Inc, Madison, WI).
This
plasmid vector encodes antibiotic resistance (Ampr), a bacterial origin of
replication (ori),
an IPTG-regulatable promoter/operator (P/O), a ribosome binding site (RBS), a
6-histidine tag (6-His), and restriction enzyme cloning sites.
The pET-23a vector is digested with NdeI and XhoI and the ampli.fied fragment
is
ligated into the pET-23a vector maintaining the reading frame initiated at the
bacterial
RBS. The ligation mixture is then used to transform the E. coli strain
BL21(DE3)pLysS
(Novagen, Inc). Transformants are identified by their ability to grow on LB
plates and
-49-
CA 02604066 2007-10-29
ampicillin-resistant colonies are selected. Plasmid DNA is isolated and
confumed by
restriction analysis.
Clones containing the desired constructs are grown overnight (O/N) in liquid
culture in LB media supplemented with Ampicilli.n (100 g/ml). The O/N culture
is used
to inoculate a large culture at a ratio of 1:20 to 1:50. The cells are grown
to an optical
density 600 nm (O.D.600) of between 0.6 and 1.5. IPTG (Isopropyl-B-D-
thiogalacto
pyranoside) is then added to a final concentration of 0.5 mM.
Cells are grown for an extra 2 to 4 hours at 30 to 37 C. Cells are then
harvested
by centrifugation (10 mins at 6000Xg). The cells are then lysed by sonication
using three
30 second pulses on a Sonifer 450 (Branson Ultrasonics Corp., Danbury, CT).
The cell
debris is removed by centrifugation, and the supernatant containing the
polypeptide is
loaded onto a nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin column
(available
from Qiagen, Inc., Chatsworth, CA). Polypeptides with a 6 x His tag bind to
the Ni-NTA
resin with high afflnity and can be purified in a simple one-step procedure
(for details
see: The QIAexpressionist, Fourth Edition. (2000) QIAGEN, Inc., supra).
Brieffy, the supernatant is loaded onto the column in 10 mM imidazole, the
column is washed with 20 volumes of 20 mM imidazole, and the soluble
polypeptide is
eluted with 250 mM imidazole. Imidazole is removed by a final dialyzing step
against
PBS or 50 mM sodium acetate pH 6 buffer plus 200 mM NaCI. The purified
polypeptide
is stored at 4 C or frozen at -80 C.
EXAMPLE 8
PURIFICATION OF CAN-1, STG AND SEEK-1 FROM AN INCLUSION BODY
The following method can also be used' to purify a CAN-1, STG or SEEK-1
polypeptide expressed in E coli when the polypeptide is present in the form of
inclusion
bodies. Unless otherwise specified, all of the following steps are conducted
at 4-10 C.
Upon completion of the production phase of the E. coli fermentation, the cell
culture is cooled to 4-10 C and the cells harvested by continuous
centrifugation at 15,000
rpm (Heraeus Sepatech). On the basis of the expected yield of polypeptide per
unit
weight of cell paste and the amount of purified polypeptide required, an
appropriate
amount of cell paste, by weight, is suspended in a buffer solution containing
100 mM
Tris, 50 mM EDTA, pH 7.4. The cells are dispersed to a homogeneous suspension
using
a high shear mixer.
-50-
CA 02604066 2007-10-29
The cells are then lysed by passing the solution through a microfluidizer
Microfluidics, Corp. or APV Gaulin, Inc.) twice at 4000-6000 psi. The
homogenate is
then mixed with NaC1 solution to a f nal concentration of 0.5 M NaCI, followed
by
centrifugation at 7000 xg for 15 min. The resultant pellet is washed again
using 0.5M
NaC1, 100 mM Tris, 50 mM EDTA, pH 7.4.
The resulting washed inclusion bodies are solubilized with 1.5 M guanidine
hydrochloride (GuHCI) for 2-4 hours. After 7000 xg centrifugation for 15 min.,
the
pellet is discarded and the polypeptide containing supematant is incubated at
4 C
overnight to allow further GuHC1 extraction.
Following high speed centrifugation (30,000 xg) to remove insoluble particles,
the
GuHC1 solubilized polypeptide is refolded by quickly mixing the GuHCI extract
with 20
volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM NaC1, 2 mM EDTA by
vigorous stirring. The refolded diluted polypeptide solution is kept at 4 C
without
mixing for 12 hours prior to further purification steps.
To clarify the refolded polypeptide solution, a previously prepared tangential
filtration unit equipped with 0.16 m membrane filter with appropriate surface
area (e.g.,
Filtron), equilibrated with 40 mM sodium acetate, pH 6.0 is employed. The
filtered
sample is loaded onto a cation exchange resin (e.g., Poros HS-50, Perseptive
Biosystems). The column is washed with 40 mM sodium acetate, pH 6.0 and eluted
with
250 mM, 500 mM, '1000 mM, and 1500 mM NaC1 in the same buffer, in a stepwise
manner. The absorbance at 280 nm of the effluent is continuously monitored.
Fractions
are collected and farther analyzed by SDS-PAGE.
Fractions containing the polypeptide are then pooled and rriixed with 4
voluines of
water. The diluted sample is then loaded onto a previously prepared set of
tandem
columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak anion
(Poros
CM-20, Perseptive Biosystems) exchange resins. The columns are equilibrated
with
40 mM sodium acetate, pH 6Ø Both columns are washed with 40 mM sodium
acetate,
pH 6.0, 200 mM NaCl. The CM-20 column is then eluted using a 10 column volume
linear gradient ranging from 0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1.0 M
NaCI,
50 mM sodium acetate, pH 6.5. Fractions are collected under constant A280
monitoring
of the effluent. Fractions containing the polypeptide (determined, for
instance, by 16%
SDS-PAGE) are then pooled.
-51-
CA 02604066 2007-10-29
The resultant polypeptide should exhibit greater than 95% purity after the
above
refolding and purification steps. No major contaminant bands should be
observed from
Coomassie blue stained 16% SDS-PAGE gel when 5 g of purified polypeptide is
loaded.
EXAMPLE 9
CLONING AND EXPRESSION OF CAN-1, STG AND SEEK-1
IN A BACULOVIRUS EXPRESSION SYSTEM
In this example the plasmid shuttle vector pFastBacl (Life Technologies Inc.,
Rockville, MD) is used to insert a polynucleotide into a baculovirus to
express an
inventive polypeptide. This expression vector contains the strong polyhedrin
promoter of
the Autographa californica nuclear polyhedrosis virus (AeMNPV) followed by
convenient restriction sites such as'BamHI, XbaI and EcoRI. The
polyadenylation site of
the simian virus 40 ("SV40") is used for efficient polyadenylation. The gene
of interest is
cloned into the pFastBacl donor plasmid, and the recombinant plasmid is
transformed
into DH10Bac (Life Technologies, Inc.) competent cells which contain the
bacmid with a
mini-attTn7 target site and the helper plasmid. The mini-Tn7 element on the
FastBac
donor plasmid can transpose to the mini-atffn7 target site on the bacmid in
the presence
of transposition polypeptides provided by the helper plasmid. Colonies
containing
recombinant bacmids are identified by the disruption of the lacZalpha gene on
the
bacmid. High molecular weight mini-prep DNA is prepared from selected E. coli
clones
containing the recombinant bacmid, and this DNA is used to transfect insect
cells.
Many other baculovirus vectors can be used in place of the vector above, such
as
pAc373, pVL941, and pAcIMI, as one skilled in the art would readily
appreciate, as long
as the construct provides appropriately located signals for. transcription,
translation,
secretion and the like, including a signal peptide and an in-frame AUG as
required. Such
vectors are described, for instance, in Luckow et al., Virology 170:31, 1989.
Specifically, the eDNA sequence of a clone encoding a CAN-1, STG or SEEK-1
polypeptide, including the AUG initiation codon and the naturally associated
leader
sequence, is amplified using the PCR. If the naturally occurring signal
sequence is used
to produce a secreted polypeptide (as could be done with the CAN-1
polypeptide), the
pFastBacl vector does not need a second signal peptide. Alternatively, the
vector can be
, modified to include a baculovirus leader sequence, using the standard
methods described
-52-
CA 02604066 2007-10-29
in Summers et al., "A Manual of Methods for Baculoviras Vectors and Insect
Cell
Culture Procedures," Texas Agricultural Experimental Station Bulletin No. 1555
(1987).
The amplified PCR fragment is cloned into a TA cloning vector (such as "The
Original TA Cloning Kit" Invitrogen Inc., Carlsbad, CA). The resulting plasmid
is then
digested with the appropriate restriction enzymes and the correct fragment is
excised and
purified from a 1% agarose gel using a commercially available kit ("Qiaquick
Gel
Extraction Kit" Qiagen Inc., Valencia, CA).
The plasmid is digested with the corresponding restriction enzymes and
optionally, can be dephosphorylated using calf -intestinal phosphatase, using
routine
procedures known in the art. The DNA is then isolated from a 1% agarose gel
using a
commercially available kit ("Qiaquick Gel Extraction Kit" Qiagen Inc.,
Valencia, CA).
The fragment and the dephosphorylated plasmid are ligated together with T4
DNA ligase. E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue
(Stratagene
Cloning Systems, La Jolla, CA) cells are transformed with the ligation mixture
and
spread on culture plates. Bacteria containing the plasmid are identified by
digesting
DNA from individual colonies and analyzing the digestiori product by gel
electrophoresis. The sequence of the cloned fragment is confirmed by DNA
sequencing.
After the recombinant pFastBac donor plasmid has been determined to, be
correct,
the DNA is transformed into DH10Bac for transposition into the bacmid. White
colonies
contain the. recombinant bacmid *are selected for isolation of recombinant
bacmid DNA.
Sf9 insect cells (ATCC CRL 1711) are then transfected with the recombinant
bacmid
DNA. Recombinant baculovirus are harvested from the cell culture media at 72
hours
post-transfection. The baculovirus particles are then used for infection into
Sf9 cells at a
starting multiplicity of infection (MOI) of 5 to 10. The cells are incubated
for 24 to 96
hours and harvested by centrifugation. The polypeptides in the supematant as
well as the
intracellular polypeptides are analyzed by SDS-PAGE. Microsequencing of the
amino
acid sequence of the amino terminus of purified polypeptide may be used to
determine
the amino terminal sequence of the produced polypeptide.
EXA-MPLE 10
EXPRESSION OF CAN-1, STG AND SEEK-1 IN MAMMALIAN CELLS -
The polypeptides of the present invention can be expressed and secreted from a
mammalian cell. A typical mammalian expression vector contains a promoter
element,
-53-
CA 02604066 2007-10-29
which mediates the. initiation of transcription of mRNA, a polypeptide coding
sequence,
and signals required for the termination of transcription and polyadenylation
of the
transcript. Additional elements can include enhancers, Kozak polypeptide
synthesis
initiation sequences and intervening sequences flanked by donor and acceptor
sites for
RNA splicing. Highly efficient transcription can be achieved with the early
and late
promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g.,
RSV,
HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV). However,
cellular,
.
elements can also be used (e.g., the human actin promoter). Expression vectors
may also
contain epitope, tags or polypeptide fusions such as FLAG (Sigma-Aldrich Inc.,
St. Louis,
MO) or 6X His to aid in purification and detection of the recombinant
polypeptide.
Suitable expression vectors for use in practicing the present invention
include, for
example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pcDNA3.l
(Invitrogen Inc.), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146), pBCI2MI (ATCC
67109), pCMVSport 2.0, and pCMVSport 3Ø Mammalian host cells that could be
used.
include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells,
Cos 1,
Cos 7 and CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary
(CHO)
cells.
Alternatively, the polypeptide can be expressed in stable cell lines
containing the
polynucleotide integrated into a chromosome. The polynucleotide is cloned into
an
expression vector with a selectable marker such as dhfr, gpt, neomycin,
hygromycin
allowing the selection, identification and isolation of the transfected cells.
The transfected polynucleotide can also be amplified to express large amounts
of
the encoded polypeptide. The DHFR (dihydrofolate reductase) marker is useful
in
developing cell lines that carry several hundred or even several thousand
copies of the
polynucleotide of interest. (See, e.g., Alt, et al., J. Biol. Chem. 253:1357,
1978; Hamlin
et al., Biochem. et Biophys. Acta, 1097:107, 1990; Page et al., Biotechnology
9:64, 1991).
Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy
et al.,
Biochem J. 227:277, 1991; Bebbington et al., BiolTechnology 10:169, 1992).
Using these
markers, the mammalian cells are grown in selective medium and the cells with
the
highest resistance are selected. These cell lines contain the amplified
polynucleotides
integrated into a chromosome. Chinese hamster ovary (CHO) and NSO cells are
often
used for the production of polypeptides.
-54-
CA 02604066 2007-10-29
Derivatives of the plasmid pSV2-dhfr (ATCC Accession No. 37146), the
expression vectors pC4 (ATCC Accession No. 209646) and pC6 (ATCC Accession
No. 209647) contain the strong promoter (LTR) of the Rous Sarcoma Virus
(Cullen et al.,
Molecular and Cellular Biology, 438-447, March, 1985) plus a fragment of the
CMV-enhancer (Boshart et al., Cell 41:521-530, 1985). Multiple cloning sites,
e.g., with
the restriction enzyme cleavage sites BamHI, XbaI and Asp718, facilitate the
cloning of
the polynucleotide of interest. The vectors also contain the 3' intron, the
polyadenylation
and termination signal of the rat preproinsulin gene, and the mouse DHFR gene
under
control of the SV40 early promoter.
Specifically, the plasmid pC6, for example, is digested with appropriate
restriction
enzymes and then dephosphorylated using calf intestinal phosphatase by
procedures
known in the art. The vector is then isolated from a 1% agarose gel.
If the naturally occurring signal sequence is used to produce the secreted
polypeptide, the vector does not need to supply a signal peptide. (such as pC6
or
pcDNA3.1) Alternatively, if the naturally occurring signal sequence is not
used, a vector
can be used which contains a heterologous signal peptide, such as the mouse
Igkappa-
chain leader sequence used in the vector pSecTag2 A (Invitrogen Inc.)
The amplified PCR fragment is cloned into a TA cloning vector (such as "The
Original TA Cloning Kit" Invitrogen Inc., Carlsbad, CA). The resulting plasmid
is then
digested with the appropriate restriction enzymes and the correct fragment is
excised and
purified from a 1% agarose gel using a commercially available kit ("Qiaquick
Gel
Extraction Kit" Qiagen Inc., Valencia, CA).
The plasmid is digested with the correspondiiig restriction enzymes and
optionally, can be dephosphorylated using calf intestinal phosphatase, using
routine
procedures known in the art. The DNA is then isolated from a 1% agarose gel
using a
commercially available kit ("Qiaquick Gel Extraction Kit" Qiagen Inc:,
Valencia, CA).
The fragment and the dephosphorylated plasmid are ligated together with T4
DNA ligase. E. coli HB101 or other suitable E. coll hosts such as XL-1 Blue
(Stratagene
Cloning Systems, La Jolla, CA) cells are transformed with the ligation mixture
and
spread on culture plates. Bacteria. containing the plasmid are identified by
digesting
DNA from individual colonies and analyzing the digestion product by gel
electrophoresis. The sequence of the cloned fragment is confirmed by DNA
sequencing.
-55-
CA 02604066 2007-10-29
The resulting expression vector can then be transiently transfected into a
suitable
mammalian host, such as Cos-l, HEK 293 or CHO-Kl using electroportation,
lipofectin
or DEAE-Dextran (Sigma-Aldrich Inc., St. Louis MO) transfection methodologies.
Expressed polypeptides are then harvested from the supernatent media after
incubating 3-
5 days. Alternatively, stable transfected cells can be isolated following 10-
14 days of
incubation with the appropriate antibiotic, such as 1 mg/ml G418.
When pursuing polynucleotide amplification following transfection, Chinese
hamster ovary cells lacking an active DHFR gene can be used for transfection.
Five g
of the expression plasmid pC6 is cotransfected with 0.5 g of the plasmid
pSVneo using
lipofectin. The plasmid pSV2-neo contains a dominant selectable marker, the'
neo gene
from Tn5 encoding an enzyme that confers resistance to a group of antibiotics
including
G418. The cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates
(Greiner,
Germany) in alpha minus MEM supplemented with 10, 25, or 50, ng/ml of
methotrexate
plus 1 mg/ml G418. After about 10-14 days single clones are trypsinized and
then seeded
in 6-well petri dishes or 10 ml flasks using different concentrations of
methotrexate
(50 nM, 100 nM, = 200 nM, 400 nM, 800 nM). Clones growing at the highest
concentrations of methotrexate are then transferred to new 6-well plates
containing even
higher concentrations of methotrexate. The same procedure is repeated until
clones are
obtained which grow at a concentration of 100-200 jiM. Expression of the
desired
product is analyzed, for instance, by SDS-PAGE and Western blot or by reversed
phase
HPLC analysis.
The polypeptide can be purified from the supernatent by loading onto an
appropriate affinity resin column. Polypeptides with a 6 x His tag bind to the
Ni-NTA
resin (available from Qiagen, Inc., Chatsworth, CA) with hYgh affinity and can
be purified
in a simple one-step procedure. Alternatively, polypeptides with a FLAG
epitope can be
one-step purified using an anti-FLAG M2 monoclonal antibody agarose affinity
gel
(Sigma-Aldrich Inc.).
EXAMPLE 11
POLYPEPTIDE FUSIONS OF CAN-1, STG AND SEEK 1
The polypeptides of the present invention can be fused to other polypeptides.
These fusion polypeptides can be used for a variety of applications. For
example, fusion
-56- "
CA 02604066 2007-10-29
of the present polypeptides to His-tag, HA-tag, protein A, IgG domains, and
maltose
binding protein facilitates purification. (See EP A 394,827; Traunecker, et
al., Nature
331:84, 1988). Similarly, fusion to IgG-1, IgG-3, and albumin increases the
half life time
in vivo. Nuclear localization signals fnsed to the polypeptides of the present
invention
can target the polypeptide to a specific subcellular localization, while
covalent
heterodimer or homodimers can increase or decrease the activity of a fusion
polypeptide.
Fusion polypeptides can also create chimeric molecules having more than one
function.
Finally, fusion polypeptides can increase solubility and/or stability of the
fused
polypeptide compared to the non-fused polypeptide. All. of the types of fusion
polypeptides described above can be made by modifying the following protocol,
which
outlines 'the fusion of a polypeptide to an IgG molecule.
Briefly, the human Fc portion of the IgG molecule can be PCR amplified, using
primers that span the 5' and 3' ends of the sequence described below. These
primers also
should have convenient restriction enzyme sites that will facilitate cloning
into an
expression vector, preferably a mammalian expression vector.
For example, if pC4 (Accession No. 209646) is used, the human Fc portion can
be
ligated into the BamHI cloning site. Note that the 3' BamHI site should be
destroyed.
Next, the vector containing the human Fc portion is re-restricted with BanmHl,
linearizing
the vector, and a polynucleotide of the present invention, isolated by the PCR
protocol
described in Example 1, is ligated into this BamHI site. Note that the
polynucleotide is
cloned without a stop codon, otherwise a fusion polypeptide will not be
produced.
If the naturally occurring signal sequence is used to produce the secreted
polypeptide, pC4 does not need a second signal peptide. Alternatively, if the
naturally
occurring signal sequence is not used, the vector can be modified to include a
heterologous signal sequence. (See, e.g., WO 96/34891.)
EXA1ViPLE 12
PRODUCTION OF ANTIBODIES SPECIFIC TO CAN-1, STG AND SEEK-1
The antibodies of the present invention can be prepared by a variety of
methods.
For example, cells expressing a polypeptide of the present invention is
administered to an
animal to induce the production of sera containing polyclonal antibodies. In a
preferred
method, a preparation of the secreted polypeptide is prepared and purified to
render it
-57-
CA 02604066 2007-10-29
substantially free of natural contaminants. Such a preparation is then
introduced into an
animal in order to produce polyclonal antisera of greater specific activity.
In the most preferred method, the antibodies of the present invention are
monoclonal antibodies (or polypeptide binding fragments thereo fl. Such
monoclonal
antibodies can be prepared using hybridoma technology. (Kohler et al., Nature
256:495,
1975; Kohler et al., Eur. J. Immunol. 6:511, 1976; Kohler et al., Eur. J.
Immunol. 6:292,
1976; Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas,
Elsevier,
N.Y., pp. 563-681 (1981)). In general, such procedures involve immunizing an
animal
(preferably a mouse) with polypeptide or, more preferably, with a secreted
polypeptide-expressing cell. Such cells may be cultured in any suitable tissue
culture
medium; however, it is preferable to culture cells in Earle's modified Eagle's
medium
supplemented with 10% fetal bovine serum (inactivated at about 56 C), and
supplemented with about 10 g/l of nonessential amino acids, about, 1,000 U/ml
of
penicillin, and about 100 g/ml of streptomycin.
The splenocytes of such mice _are extracted and fused with a suitable myeloma
cell line. Any suitable myeloma cell line may be employed in accordance with
the
present invention; however, it is preferable to employ the parent myeloma cell
line
(SP20), available from the ATCC. After fusion, the resulting hybridoma cells
are
selectively maintained in HAT medium, and then cloned by limiting dilution as
described
by Wands et al. (Gastroenterology 80:225, 1981). The hybridoma cells. obtained
through
such a selection are then assayed to identify clones which secrete antibodies
capable of
biriding the polypeptide.
Alternatively, additional antibodies capable of binding to the polypeptide can
be
produced in a two-step procedure using anti-idiotypic antibodies. Such a
method makes
use of the fact that antibodies are themselves antigens, and therefore, it is
possible to
obtain an antibody which binds to a second antibody. In accordance with this
method,
polypeptide specific antibodies are used to immunize an animal, preferably a
mouse. The
splenocytes of such an animal are then used to produce hybridoma cells, and
fhe
hybridoma cells are screened to identify clones which produce an antibody
whose ability
to bind to the polypeptide-specific antibody can be blocked by the
polypeptide. Such
antibodies comprise anti-idiotypic antibodies to the polypeptide-specific
antibody and can
-58-
CA 02604066 2007-10-29
be used to immunize an animal to induce formation of further polypeptide-
specific
antibodies.
It will be appreciated that Fab and F(ab')2 and other fragments of the
antibodies of
the present invention may be used according to the methods disclosed herein.
Such
fragments are typically produced by proteolytic cleavage, using enzymes such
as papain
(to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
Alternatively,
secreted polypeptide-binding fragments can be produced through the application
of
recombinant DNA technology or through synthetic chemistry.
For in vivo use of antibodies in humans, it may be preferable to use
"humanized"
chimeric monoclonal antibodies. Such antibodies can be produced using genetic.
constructs derived from hybridoma cells producing the monoclonal antibodies
described
above. Methods for producing chixneric antibodies are known in the art. (See,
for review,
Morrison, Science 229:1202, 1985; Oi et al., BioTechniques 4:214, 1986;
Cabilly et al.,
U.S. Patent No. 4,816,567; Taniguchi et a1., EP 171496; Morrison et al., EP
173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671; Boulianne et a1.,
Nature
312:643, 1984; Neuberger et al., Nature 314:268, 1985).
In some embodiments, for in vivo use of antibodies in humans, the antibody can
be modified by attachment of polyethylene glycol (PEG) to extend the lifetime
of the
antibody.
EXAMPLE 13
METHOD OF DETECTING ABNORMAL LEVELS OF A POLYPEPTIDE IN A
BIOLOGICAL SAMPLE
A CAN-1, STG or SEEK 1 polypeptide can be detected in a biological sample,
and if an increased or decreased level of the polypeptide is detected, this
polypeptide is a
marker for a particular phenotype. Methods of detection are numerous, and
thus, it is
understood that one skilled in the art can modify the following assay to fit
their particular
needs.
For example, antibody-sandwich ELISAs are used to detect polypeptides in a
sample, preferably a biological sample. Wells of a microtiter plate are coated
with
specific antibodies, at final concentration of 0.2 to 10 g/ml. The antibodies
can be
monoclonal or polyclonal and are produced, for example, by the methods
described
-59-
CA 02604066 2007-10-29
supra. The wells are blocked so that non-specific binding of the polypeptide
to the well
is reduced.
The coated wells are then incubated for > 2 hours at RT with a sample
containing
the polypeptide. Preferably, serial dilutions of the sample should be used to
validate
results. The plates are then washed three times with deionized or distilled
water to
remove unbounded polypeptide.
Next, 50 l of specific antibody-alkaline phosphatase conjugate, at a
concentration of 25-400 ng, is added and incubated for 2 hours at room
temperature. The
plates are again washed. three times with deionized or distilled water to
remove
unbounded conjugate.
Add 75 l of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate
(NPP) substrate solution to each well, and incubate 1 hour at room
temperature. Measure
the reaction by a microtiter plate reader. Prepare a -standard curve, using
serial dilutions
of a control sample, and plot polypeptide concentration on the X-axis (log
scale) and
fluorescence or absorbance on the Y-axis (linear scale). Interpolate the
concentration of
the polypeptide in the sample using the standard curve.
EXAMPLE 14
FORMULATING A POLYPEPTIDE
Polypeptide compositions of the invention are formulated and dosed in a
fashion
consistent with good medical practice, taking into account the clinical
condition of the
'individual patient (especially the side effects of treatment with the
secreted polypeptide
alone), the site of delivery, the method of administration, the scheduling of
administration, and other factors known to practitioners. The "effective
amount" for
purposes herein is thus determined by such considerations. '
As a general proposition, the total pharmaceutically effective amount of
polypeptide administered parenterally per dose will be in the range of about 1
g/kgJday
to 10 mg/kg/day of patient body weight, although, as noted above, this will be
subject to
therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day,
and most
preferably for humans between about 0.01 and 1 mg/kg/day for the hormone. If
given
continuously, the polypeptide is typically administered at a dose rate of
about
1 g/kg/hour to about 50 g/kg/hour, either by 1-4 injections per day or by
continuous
subcutaneous infusions, for example, using a mini-pump. An intravenous bag
solution
-60-
CA 02604066 2007-10-29
may also be employed. The length of treatment needed to observe changes and
the
interval following treatment for responses to occur appears to vary depending
on the
desired effect.
Pharmaceutical compositions containing the polypeptides of the invention are
administered orally, rectally, parenterally, intracistenally, intravaginally,
intraperitoneally, topically (as by powders, ointments, gels, drops or
transdermal patch),
bucally, or as an oral or nasal spray. "Pharmaceutically acceptable carrier"
refers to a
.non-toxic solid, semisolid or liquid filler, diluent, encapsulating material
or formulation
auxiliary of any type. The term "parenteral" as used herein refers to modes of
administration which include intravenous, intramuscular, intraperitoneal,
intrastemal,
subcutaneous and intraarticular injection and infusion.
The polypeptides - of the invention are also suitably administered by
sustained-release systems. Suitable examples of sustained-release compositions
include
semi-permeable polymer matrices in the form of shaped articles, e.g., films,
or
microcapsules. Sustained-release matrices include polylactides (U.S. Pat. No.
3,773,919,
EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman,
et al., Biopolymers 22:547, 1983), poly (2- hydroxyethyl methacrylate) (Langer
et al., J.
Biomed. Mater. Res. 15:167, 1981; Langer, Chem. Tech. 12:98, 1982), ethylene
vinyl
acetate (Langer et al.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988).
Sustained-release compositions also include liposomally entrapped
polypeptides.
Liposomes containing the polypeptides are prepared by methods known per se:
e.g., DE
3,218,121; Epstein et a1., Proc. Natl. Acacd Sci. USA 82:3688, 1985; Hwang et
al., Proc.
Natl. Acad Sci. USA 77:4030, 1980); EP 52,322; EP 36,676; EP 88,046; EP
143,949; EP
142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and
4,544,545; and EP
102,324. Ordinarily, the liposomes are of the small (about 200-800 Angstroms)
unilamellar type in which the lipid content is greater tb.an about 30 mol.
percent
cholesterol, the selected proportion being adjusted for the optimal
polypeptide therapy.
For parenteral administration, in one embodiment, the polypeptides of the
invention are formulated generally by mixing at the desired degree of purity,
in a unit
dosage injectable form (solution, suspension, or emulsion), with a
pharmaceutically
acceptable carrier, i.e., one that is non-toxic to recipients at the dosages
and
concentrations employed and is compatible with other ingredients of the
formulation. For
-61-
CA 02604066 2007-10-29
example, the formulation preferably does not include oxidizing agents and
other
compounds that are lmown to be deleterious to polypeptides.
Generally, the formulations are prepared by contacting the polypeptide
uniformly
and intimately with liquid carriers or finely divided solid carriers or both.
Then, if
necessary, the product is shaped into the desired formulation. Preferably the
carrier is a
parenteral carrier, more preferably a solution that is isotonic with the blood
of the
recipient. Examples of such carrier vehicles include water, saline, Ringer's
solution, and
dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate
are also
useful herein, as well as liposomes.
The carrier suitably contains minor amounts of additives such as substances
that
enhance isotonicity and chemical stability. Such materials are non-toxic to
recipients at
the dosages and concentrations employed, and include buffers such as
phosphate, citrate,
succinate, acetic acid, and other organic acids or their salts; antioxidants
such as ascorbic
acid; low molecular weight (less than about ten residues) polypeptides, e.g.,
polyarginine
or tripeptides; polypeptides, such as serum albumin, gelatin, or
immunoglobulins;
hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as
glycine,
glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and
other
carbohydrates including cellulose or its derivatives, -glucose, manose, or
dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol;
counterions
such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers,
or PEG.
The therapeutic polypeptide is typically formulated in such vehicles at a
concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH
of about
3 to 8. It will be understood that the use of certain of the foregoing
excipients, carriers, or
stabilizers will result in the formation of polypeptide salts.
Any polypeptide to be used for therapeutic administration can be sterile.
Sterility
is readily accomplished by filtration through sterile filtration membranes
(e.g., 0.2 micron
membranes). Therapeutic polypeptide compositions generally are placed into a
container
having a sterile access port, for example, an intravenous solution bag or vial
having a
stopper pierceable by a hypodermic injection needle.
Polypeptides ordinarily will be stored in unit or multi-dose containers, for
example, sealed ampoules or vials, as an aqueous solution or as a lyophilized
formulation
for reconstitution. As an example of a lyophilized formulation, 10-m1 vials
are filled with
-62-
CA 02604066 2007-10-29
ml of sterile-filtered 1% (w/v) aqueous polypeptide solution, and the
resulting mixture
is lyophilized. The infusion solution is prepared by reconstituting the
lyophilized
polypeptide using bacteriostatic Water-for-Injection.
The invention also provides a pharmaceutical pack or kit comprising one or
more
5 containers filled with one or more of the ingredients of the pharmaceutical
compositions
of the invention. Associated with such container(s) can be a notice in the
form prescribed
by a governmental agency regulating the manufacture, use or sale of
pharmaceuticals or
biological products, which notice reflects approval by the agency of
manufacture, use or
sale for human administration. In addition, the polypeptides of the present
invention may
be employed in conjunction with other therapeutic compounds.
EXAMPLE 15
METHOD OF TREATING DECREASED LEVELS OF CAN-1, STG AND/OR SEEK-1
POLYPEPTIDE
It will be appreciated that conditions caused by a decrease in the standard or
normal expression level of a CAN-1, STG and/or SEEK-1 polypeptide in an
individual
can be treated by administering a CAN-1, STG and/or SEEK-1 polypeptide of the
present
invention, as appropriate. Thus, the invention also provides a method of
treatment of an
individual in need of an increased level of a CAN-l, STG and/or SEEK-1
polypeptide
comprising administering to such an individual a pharmaceutical composition
comprising
20. an amount.of a CAN-1, STG and/or SEEK 1 polypeptide to increase the
activity level of
the polypeptide in such an individual.
For example, a patient with decreased levels of a CAN-1, STG and/or SEEK-1
polypeptide receives a daily dose 0.1-100 g/kg of CAN-1, STG and/or SEEK-1
polypeptide for six consecutive days. The exact details of the dosing scheme,
based on
administration and formulation, are provided in Example 14.
EXAMPLE 16
METHOD OF TREATING INCREASED LEVELS OF CAN-1, STG AND/OR SEEK-1
Antisense technology is used to inhibit production of a polypeptide of the
present
invention. This technology is one example of a method of decreasing levels of
a
polypeptide, preferably a secreted form, due to a variety of etiologies, such
as cancer.
For example, a patient diagnosed with abnormally increased levels of a
polypeptide is administered intravenously antisense polynucleotides at 0.5,
1.0, 1.5, 2.0
-63-
CA 02604066 2007-10-29
and 3.0 mg/kg day for 21 days. This treatment is repeated after a 7-day rest
period if the
treatment was well tolerated. The formulation of the antisense polynucleotide
is provided
in Example 14.
Additionally, increased levels of CAN-1 can be treated by using an antibody
that
specifically binds to CAN-1, thereby reducing the amount of CAN-1 within a
cell.
EXAMPLE 17
METHOD OF TREATMENT USING GENE THERAPY
One method of gene _therapy transplants fibroblasts, which are capable of
expressing a polypeptide, onto a patient. Generally, fibroblasts are obtained
from a
subject by skin biopsy. The resulting tissue is placed in tissue-culture
medium and
separated into small pieces. Small chunks of the tissue are placed on a wet
surface of a
tissue culture flask, approximately ten pieces are placed in each flask. The
flask is tumed
upside down, closed tight and left at room temperature over night. After 24
hours at
room temperature, the flask is inverted and the chunks of tissue remain fixed
to the
bottom of tbe flask and fresh media (e.g., Ham's F12 media, with 10% FBS,
penicillin
and streptomycin) is added. The flasks are then incubated at 37 C for
approxirnately one
week.
At this time, fresh media is added and subsequently changed every several
days.
After an additional two weeks in culture, a monolayer of fibroblasts emerge.
The
monolayer is trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, et al., DNA 7:219, 1988), flanked by the long terminal
repeats of the Moloney murine sarcoma viirus, is digested with EcoRI and
HindIIi and
subsequently treated with calf inte.stiun.al phosphatase. The linear vector is
fractionated on
agarose gel and purified, using glass beads.
A cDNA encoding a polypeptide of the present invention can be amplified using
PCR primers which correspond to the 5' and 3' end sequences respectively as
set forth -in
Example 1. Preferably, the 5' primer contains an EcoRI site and the 3' primer
includes a
HindIII site. Equal quantities of the Moloney murine sarcoma virus linear
backbone and
the amplified EcoRI and HindIII fragment are added together, in the presence
of T4 DNA
ligase. The resulting mixt-ure is maintained under conditions appropriate for
ligation of
the two fragments. The ligation mixture is then used to transform bacteria
HB101, which
-64-
CA 02604066 2007-10-29
are then plated onto agar containing kanamycin for the purpose of confirming
that the
vector has the polynucleotide of interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture
to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf
seram (CS), penicillin and streptomycin. The MSV vector containing the
polynucleotide
is then added to the media and the packaging cells transduced with the vector.
The
packaging cells now produce infectious viral particles containing the
polynucleotide (the
packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the
media is harvested from a 10 cm plate of confluent producer cells. The spent
media,
containing the infectious viral particles, is filtered through a millipore
filter to remove
detached producer cells and this media is then used to infect fibroblast
cells. Media is
removed from a sub-confluent plate of fibroblasts and quickly replaced with
the media
from the producer cells. This media is removed and replaced with fresh media.
If the
titer of virus is high, then virtually all fibroblasts will be infected and no
selection is
required. If the titer is very low, then it is necessary to use a retroviral
vector that has a
selectable marker, such as neo or his. Once the fibroblasts have been
efficiently infected,
the fibroblasts are analyzed to determine whether polypeptide is produced.
The engineered fibroblasts are then transplanted onto the host, either alone
or after
having been grown to confluence on cytodex 3 microcarrier beads.
EXAMPLE 18
IN SITU HYBRIDIZATION USING CAN-1 AS A PROBE
This example shows that the expression patterns of CAN-1 mRNA in control and
psoriatic skin is consistent with the proposed involvement of the CAN-1 gene
product in
the development of psoriasis.
Basic architecture of human skin: Human skin is composed of two
distinguishable tissue layers. The outermost layer is the epidermis, and is
largely (>80%)
made of keratinocytes at various stages of differentiation (see below). A
basement
membrane separates the epidermis from the inner layer of skin, termed the
dermis. The
dermis is a cellular and fibroelastic connective tissue that is interwoven
into a three-
dimensional network. The dermis is composed of a complex fabric of
interrelated
collagen and elastic fibers. See generally Fuchs, Elaine, Epidermal Di,
fferentiation: The
-65-
CA 02604066 2007-10-29
Bare Essentials, The Journal of Cell Biology, Vohmne 111 (No. 6, Pt. 2), 2807-
2814
(Dec. 1990).
The biology of keratinocyte growth and differentiation in the epidermis: The
innermost layer of keratinocytes in the epidermis are called basal cells, and
these are
predominantly the keratinocytes with the ability to proliferate. There are
then four to
eight layers of suprabasal spinous cells that are postmitotic, but
metabolically active.
Above the spinous layer is then the granular layer where all metabolic
activity terminates,
and the resulting flattened squames are merely cellular skeletons, filled with
macrofibrils
of keratin filaments. The outermost layer of the epidermis is the stratum
comewn,
composed of terminally differentiated keratinocytes sealed together by lipids,
which
results in the impermeable, insoluble layer necessary to separate the extemal
environment
from the body.
In situ hybridization using CAN-1 as a probe: In order to identify the precise
component of the human skin that expresses the CAN-1 gene, in situ
hybridization was
performed using a nucleic acid probe from the CAN-1 gene. These experiments
were
performed using human skin from a normal healthy control donor, and also from
a
lesional and an unaffected portion of a psoriatic individual.
The results indicated strong CAN-1 gene expression in the epidermis of a
lesion
biopsy from a psoriatic patient. In particular; it was noted that
hybridization took place
predominantly in the upper granular layer, and just beneath the cornified
layer.
Hybridization was weak to absent in the same relative location in uninvolved
biopsy
material from a patient, and also from, the biopsy of normal healthy skin.
Increased CAN-1 ' expression ' in the lesion could have significance in the
chemoattractfon of inflammatory cell types (neutrophils and monocytes), and
also the
attraction of T-cells to the sites of psoriatic lesions. In addition, the
pattern of CAN-1
expression in a psoriatic lesion could indicate that the aberrant
differentiation (e.g.,
parakanthosis) in the upper epidermis could be related to the increased
expression of the
CAN- i protein. It is also possible that the increased CAN-1 expression could
play a role
in the increased keratinocyte proliferation that is characteristic of
psoriatic lesions.
Altered keratinocyte growth and differentiation in psoriasis, and relevance of
CAN 1: The underlying pathogenesis of psoriasis involves three predominant and
interdependent biologic processes: inflammation (accompanied by T-cell inf
ltration),
-66-
CA 02604066 2007-10-29
epidermal hyperproliferation, and altered differentiation of kera.tinocytes.
The
homeostasis of the normal epidermis depends on a balance of growth regulatory
signals,
which are altered in psoriatic epidermis. Based on the specific loca.fion of
CAN-1
expression in the epidermis, its small protein size, and its secreted nature,
CAN-1 could
be useful as an inhibitor of the psoriatic phenotype in any one of these three
hallmark
biologic processes of psoriatic sld n. See generally McKay, MD, Ian A. et al,
Altered
Keratinocyte Growth and Differentiation in Psoriasis, 1995 by Elsevier Science
Inc.
1. Inflammation, and the chemotaxis process: CAN-1 is produced predominantly
in the outer granular layer, and the protein could diffuse into the dermis and
play a key
role in the recruitment of other cell types into the lesional area. These
other cell types
include a subset of lymphocytes, monocytes, neutrophils, or also endothelial
cells.
Therefore inhibition of the chemotaxic properties of CAN-1 through the use of
a binding
partner would be beneficial in the disease state.
2. Keratinocyte proliferation: Over expression of CAN-1 could also act on the
basal layer of keratinocytes by providing a signal for proliferation, which is
increased in
psoriatic lesions. Therefore the inhibition of the proliferation properties of
CAN-1
through the use of a binding partner to CAN-1 would be beneficial in the
disease state.
3. Keratinocyte differentiation: CAN-1 could act within the granular layer
itself
to account for the altered pathway of keratinocyte differentiation. In
psoriatic skin, there
is a pronounced thickening of the cornified layer, as well as an accumulation
of nucleated
keratinocytes. CAN-i could control the normal balance between the shedding of
the
cornified layer, and the keratinocyte proliferation in the basal layer. The
use of a binding
partner to CAN-1 could reduce the effects of excess CAN-1 in the sk.in.
EXAMPLE 19
HYBRIDIZATION PROTOCOL
This example describes a representative hybridization protocol -that can be
used to
identify nucleic acid molecules of the invention (such as cDNA and genomic DNA
molecules) that hybridize to a nucleic acid probe under defined conditions.
Hybridization solution should preferably be prepared and filtered through a
0.45-
micron disposable cellulose acetate filter. The composition of the
hybridization solution
-67-
CA 02604066 2007-10-29
is 6 X SSC, 5 x Denhardt's reagent, 0.5% sodium dodecyl sulfate (SDS), 100
glml
denatured, fragmented salmon sperm DNA.
Denhardt's reagent is utilized in nucleic acid hybridization solutions. 500 ml
of
50 X Denhardt's reagent (the 50-fold concentrate) includes 5 g Fico11'T' (Type
400,
Pharmacia), 5 g polyvinylpyrrolidone, 5 g bovine serum albumin (Fraction V,
Sigma) and
water to a final volume of 500 ml.
The nitrocellulose filter or nylon membrane containing the target DNA (e.g., a
putative CAN-1 cDNA) is floated on the surface of a tray of 6 X SSC until it
becomes
thoroughly wetted from beneath. The filter is submerged for 2 minutes and then
slipped
into a heat-sealable bag. 0.2 ml of hybridization solution is added for each
square
centimeter of nitrocellulose filter or nylon membrane.
As much air as possible is squeezed from the bag, and the open eiid of the bag
is
sealed with a heat sealer. The bag is incubated for 1-2 hours submerged at the
desired
temperature (typically no higher than the hybridization temperature). It is
desirable to
' agitate the bag.
If the radiolabeled probe is double-stranded, it is denatured by heating for
5 minutes at 100 C. Single-stranded probe need not be denatured. The denatured
probe
is chilled rapidly in ice water. Ideally, probe having a specific.activity of
109 cpml g, or
greater, is used. Hybridization is carried out for the desired time period at
50 C, typically
using 1-2 g/ml radiolabeled probe. The probe can be, for example, a nucleic
acid
molecule consisting of the complement of the nucleic acid sequence set forth
in SEQ ID
NO:l.
The bag containing the filter is quickly removed from the water bath and
opened
by cutting off one corner with scissors. The denatured probe is added to the
hybridization
solution, and then as much air as possible is squeezed from the bag which is
then resealed
with the heat sealer so that as few bubbles as possible are trapped in the
bag. To avoid
radioactive contamination of the water bath, the resealed bag should be sealed
inside a
second, noncontarninated bag.
The bag is submerged in a water bath for the required period of hybridization
(for
example, 16 hours) at 50 C. The bag is removed from the water bath and 6ne
corner is
cut off. The hybridization solution is poured into a container suitable for
disposal, and
then the bag is cut along the length of three sides. The filter is removed and
immediately
. -68-
CA 02604066 2007-10-29
submerged in a tray containing several hundred milliliters of 2 X SSC and 0.5%
SDS at
room temperature (no higher than 25 C). The filter should not be allowed to
dry out at
any stage during the washing procedure.
After 5 minutes, the filter is transferred to a fresh tray containing several
hundred
milliliters of 2 X SSC. and 0.1% SDS, and incubated for 15 minutes at room
temperature
(no higher than 25 C) with occasional gentle agitation. The filter should then
be washed
at the desired stringency, i.e., in the desired concentration of SSC and at
the desired
temperature. If, for example, nucleic acid molecules that hybridize to the
probe at a
temperature of 55 C in 2 X SSC are sought, then the filter is washed in 2 X
SSC at 55 C,
i.e., nucleic acid molecules that do not hybridize to the probe under
conditions of 2 X
SSC at 55 C are washed off. Washing can be done for any desired time period,
such as
one hour, with several changes of washing solution.
Most of the liquid is then removed from the filter by placing the filter on a
pad of
paper towels. The damp filter is then placed on a sheet of Saran Wrap.
Adhesive dot
labels marked with radioactive ink are applied to several asymmetric locations
on the
Saran Wrap. These markers serve to align the autoradiograph with the filter.
The labels
are covered with Scotch Tape which prevents contamination of the film holder
or
intensifying screen with the radioactive ink. Radioactive ink is made by
mixing a small
amount of 32P with waterproof black dra.wing ink. A fiber-tip pen can be used
to apply
ink to the adhesive labels.
The filter is covered with a second sheet of Saran Wrap, and exposed to X-ray
film (Kodak XAR-2 or equivalent) to obtain an autoradiographic image. The
exposure
time should be detennined empirically.
From the foregoing, it may be seen that this invention is one well-adapted to
achieve all the ends and objects hereinabove set forth together with other
advantages
which are obvious and which are inherent to the invention. It will be
understood that
certain features and subcombinations are of utility and may be employed
without
reference to other features and subcombinations. The above examples discuss
the
techniques and procedures utilized and are considered to be the preferred
embodiment of
the current invention, and it is understood that there are many other
techniques and
procedures that could be employed which would allow an individual of ordinary
skill in
the art to perform the claimed invention. Such other tecbniques and procedures
are
-69-
CA 02604066 2007-10-29
contemplated by and are within the scope of the claims. Since many. possible
embodiments may be made of the invention without departing from the scope
thereof, it
is to be understood that all matter herein set forth and shown in the examples
are to be
interpreted as illustrative and not in a limiting sense.
-70-
CA 02604066 2007-10-29
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME DE
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME OF _2
NOTE: For additional volumes please contact the Canadian Patent Office.
