Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
GENES FROM ACTINO.BACILLUS SUCCINOGENES 130Z (ATCC 55618) FOR
PRODUCTION OF CHEMICALS FROM THE A. SUCCINOGENES C4-PATHWAY
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of Provisional
Application No. 60/705,841, filed August 05, 2005, which is
incorporated herein by reference in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR
DEVELOPMENT
[0002] This work was supported by a grant from the
National Science Foundation. It was made possible by genome
sequencing efforts of the Joint Genome Institute at the
Department of Energy. The U.S. government has certain
rights to this invention.
BACKGROUND OF THE INVENTION
a. Field of the Invention
[0003] The present invention relates generally to
metabolic engineering, and more particularly to engineering
Actinobacillus succinogenes to produce chemicals such as
succinate, fumarate, malate, 5-aminolevulinate, 2-
oxoglutarate, glutamate, and aspartate. Specifically, the
present invention relates to inhibiting the C3 pathway
enzymes and overexpressing C4 pathway enzymes. The present
invention also relates to improving the flux supplying
substrate to the C4 pathway. The present invention also
relates to increasing the excretion rates of products from
the C4 pathway.
b. Description of the Related Art
[0004] Succinate has many industrial fine chemical uses.
-1-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
Succinate can also be used as an intermediary commodity
chemical feedstock for producing bulk chemicals. Its
greatest market potential might lie in its use as feedstock
to produce stronger-than-steel plastics, biodegradable
chelators, and green solvents. Most of the 17,000 tons
(15,400 metric tons) of succinate sold per year are produced
petrochemically from maleic acid. Succinate is also
produced as a fine chemical by fermentation from glucose.
For fermentation to be competitive in producing succinate as
a commercial chemical, the overall production cost should be
lowered from one (1) dollar per pound ($2.20 per kg) to
approximately twenty (20) cents per pound (44 cents per kg).
[0005] U.S. Patent No. 5,143,833 to Datta et al. teaches
a method for producing succinic acid by growing a succinate
producing Anaerobiospirillum succiniciproducens
microorganism under specific conditions.
[0006] U.S. Reissued Patent No. RE37,393 to Donnelly et
al. teaches a method for isolating succinic acid producing
bacteria by increasing the biomass of an organism which
lacks the ability to catabolize pyruvate and then growing
the biomass in glucose-rich medium under an anaerobic
environment to enable pyruvate-catabolizing mutants to grow.
By using this method, Donnelly provides a mutant E. coli
that produces high amounts of succinic acid. The mutant
Escherichia coli was derived from a parent that lacked the
genes for pyruvate formate lyase and lactate dehydrogenase.
[0007] U.S. Pat. No. 6,455,284 and U.S. Pat. Application
Publication No. 2003/0087381, both to Gokarn et al. teach
metabolic engineering to increase the carbon flow toward
oxaloacetate to enhance production of bulk biochemicals,
such as lysine and succinate, in bacterial and industrial
-2-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
fermentations. The carbon flow is redirected by genetically
engineering bacteria to overexpress the enzyme pyruvate
carboxylase.
[0008] U.S. Pat. Application Publication No. 2003/0113885
to Lee et al. teaches a novel microorganism, Mannheimia sp.
55E, capable of producing organic acids and a process using
the microorganism for producing organic acids through
anaerobic and aerobic incubations.
[0009] U.S. Pat. No. 6,420,151 to Eikmanns, et al.
teaches an isolated nucleic acid from coryneform bacteria
that encodes a phosphoenolpyruvate carboxykinase, which is
involved in production of succinate.
[0010] U.S. Pat. Nos. 5,504,004 and 5,723,322 to
Guettler, et al. teaches a process for making succinic acid,
teaches a novel microorganism, Actinobacillus succinogenes
130Z for use in the process, and methods of obtaining the
microorganism.
[0011] U.S. Pat. No. 5,573,931 to Guettler, et al.
teaches a method for making succinic acid, A. succinogenes
variants for use in process, and methods for obtaining
variants.
[0012] While the above methods can be used to produce
succinate, Actinobacillus succinogenes is still the best
succinate producer known. A. succinogenes is a gram-
negative capnophilic, anaerobic bacillus that belongs to
Pasteurellaceae. A. succinogenes produces up to one hundred
(100) grams per liter of succinate in optimized conditions.
Much effort has been spent on engineering E. coli strains to
produce high succinate amounts, however none of the
r
engineered E. coli strains surpassed A. succinogenes for
succinate production. Carbon flow is stringently regulated
-3-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
in microorganism metabolism, including carbon flux towards
oxaloacetate. Overcoming this control of carbon flux will
possibly improve the yields of desirable products, such as
succinate, fumarate, malate, 5-aminolevulinate, 2-
oxoglutarate, and glutamate.
[0013] While the related art teaches production of
succinate, there still exists a need for improved methods of
producing chemicals such as succinate, fumarate, malate, 5-
aminolevulinate, 2-oxoglutarate, glutamate, and aspartate by
inhibiting the C3 pathway enzymes and overexpressing C4
pathway enzymes and also by improving the flux supplying
substrate to the C4 pathway and increasing the excretion
rates of the products.
OBJECTS
[0014] Therefore, it is an object of the present
invention to provide gene sequences that can be
overexpressed, knocked out, or altered to benefit chemical
production.
[0015] It is further an object of the present invention
to provide methods of engineering A. succinogenes to produce
chemicals such as succinate, fumarate, malate, 5-
aminolevulinate, 2-oxoglutarate, glutamate, and aspartate by
overexpressing and/or inhibiting these genes.
[0016] These and other objects will become increasingly
apparent by reference to the following description.
SUMMARY OF THE INVENTION
[0017] The present invention provides a method for
producing succinate comprising: providing a genetically
-4-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
engineered A. succinogenes comprising one or more gene
knockouts or modifications which inhibit C3 enzymes selected
from the group consisting 'of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof; providing a growth medium for culturing the
genetically engineered A. succinogenes; and culturing the
genetically engineered A. succinogenes in the growth medium
to produce the succinate.
[0018] The present invention provides a method for
producing succinate comprising: providing a genetically
engineered A. succinogenes capable of overexpressing C4
enzymes selected from the group consisting of
phosphoenopyruvate carboxykinase (PEPCK), malate
dehydrogenase, fumarase, fumarate reductase, and
combinations thereof; providing a growth medium for
culturing the genetically engineered A. succinogenes; and
culturing the genetically engineered A. succinogenes in the
growth medium to produce the succinate.
[0019] The present invention provides a method for
producing succinate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof, and capable of overexpressing C4 enzymes selected
from the group consisting of PEPCK, malate dehydrogenase,
fumarase, fumarate reductase, and combinations thereof;
providing a growth medium for culturing the genetically
engineered A. succinogenes; and culturing the genetically
engineered A. succinogenes in the growth medium to produce
the succinate. In further embodiments the genetically
-5-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
engineered A. succinogenes further comprises modifications
to one or more genes that can bridge the C4 and C3 pathways
selected from a group consisting of malic enzyme and
oxaloacetate decarboxylase. In still further embodiments the
genetically engineered A. succinogenes further comprises
modifications to one or more genes that increase flux
through the Embden-Meyerhof-Parnas (EMP) pathway. In still
further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase flux through the pentose phosphate
pathway (PPP) . In further embodiments, the genetically
engineered A. succinogenes further comprises a gene knockout
or modification that inhibits malic enzyme. In still
further embodiments, the genetically engineered A.
succinogenes further comprises a gene knockout or
modification that inhibits oxaloacetate decarboxylase. In
still further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase substrate uptake. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase uptake of a substrate selected from the group
consisting of arabinose, xylose, glucose, fructose, and
sucrose. In still further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that increase chemical excretion. In
still further embodiments the one or more genes encode for
dicarboxylate transporters.
[0020] The present invention provides a method of
producing fumarate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
-6-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof; providing a growth medium for culturing the
genetically engineered A. succinogenes; and culturing the
genetically engineered A. succinogenes in the growth medium
to produce the fumarate.
[0021] The present invention provides a method of
producing fumarate comprising: providing a genetically
engineered A. succinogenes capable of overexpressing C4
enzymes selected from the group consisting of PEPCK, malate
dehydrogenase, fumarase, and combinations thereof; providing
a growth medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the fumarate.
[0022] The present invention provides a method of
producing fumarate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof, and capable of overexpressing C4 enzymes selected
from the group consisting of PEPCK, malate dehydrogenase,
fumarase, and combinations thereof; providing a growth
medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the fumarate.
In further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that can bridge the C4 and C3 pathways selected from a
group consisting of malic enzyme and oxaloacetate
-7-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
decarboxylase. In still further embodiments the genetically
engineered A. succinogenes further comprises a gene knockout
or modification that inhibits fumarate reductase. In still
further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase flux through the (EMP) pathway. In
still further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase flux through the PPP. In further
embodiments, the genetically engineered A. succinogenes
further comprises a gene knockout or modification that
inhibits malic enzyme. In still further embodiments, the
genetically engineered A. succinogenes further comprises a
gene knockout or modification that inhibits oxaloacetate
decarboxylase. In still further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that increase substrate uptake. In
still further embodiments the one or more genes increase
uptake of a substrate selected from the group consisting of
arabinose, xylose, glucose, fructose, and sucrose. In still
further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase chemical excretion. In still further
embodiments the one or more genes encode for dicarboxylate
transporters.
[0023] The present invention provides a method of
producing malate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
-8-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
thereof; providing a growth medium for culturing the
genetically engineered A. succinogenes; and culturing the
genetically engineered A. succinogenes in the growth medium
to produce the malate.
[0024] The present invention provides a method of
producing malate comprising: providing a genetically
engineered A. succinogenes capable of overexpressing C4
enzymes selected from the group consisting of PEPCK, malate
dehydrogenase, and combinations thereof; providing a growth
medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the malate.
[0025] The present invention provides a method of
producing malate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof, and capable of overexpressing C4 enzymes selected
from the group consisting of PEPCK, malate dehydrogenase and
combinations thereof; providing a growth medium for
culturing the genetically engineered A. succinogenes; and
culturing the genetically engineered A. succinogenes in the
growth medium to produce the malate.
[0026] In further embodiments the genetically engineered
A. succinogenes further comprises modifications to one or
more genes that can bridge the C4 and C3 pathways selected
from a group consisting of malic enzyme and oxaloacetate
decarboxylase. In still further embodiments the genetically
engineered A. succinogenes further comprises a gene knockout
or modification that inhibits fumarate reductase. The
-9-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
method of Claim 22, 23, or 24 wherein the genetically
engineered A. succinogenes further comprises a gene knockout
or modification that inhibits fumarase. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase flux through the EMP pathway. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase flux through the PPP. In further embodiments, the
genetically engineered A. succinogenes further comprises a
gene knockout or modification that inhibits malic enzyme.
In still further embodiments, the genetically engineered A.
succinogenes further comprises a gene knockout or
modification that inhibits oxaloacetate decarboxylase. In
still further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase substrate uptake. In still further
embodiments the one or more genes increase uptake of a
substrate selected from the group consisting of arabinose,
xylose, glucose, fructose, and sucrose. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase chemical excretion. In still further embodiments
the one or more genes encode for dicarboxylate transporters.
[0027] The present invention provides a method of
producing 5-aminolevulinate: comprising: providing a
genetically engineered A. succinogenes comprising one or
more gene knockouts or modifications that inhibit C3 enzymes
selected from the group consisting of pyruvate kinase,
pyruvate-formate lyase, pyruvate dehydrogenase, and
combinations thereof; providing a growth medium for
-10-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
culturing the genetically engineered A. succinogenes; and
culturing the genetically engineered A. succinogenes in the
growth medium to produce the 5-aminolevulinate.
[0028] The present invention provides a method of
producing 5-aminolevulinate comprising: providing a
genetically engineered A. succinogenes capable of
overexpressing C4 enzymes selected from the group consisting
of succinyl-CoA synthetase, PEPCK, malate dehydrogenase,
fumarase, fumarate reductase, and combinations thereof;
providing a growth medium for culturing the genetically
engineered A. succinogenes; and culturing the genetically
engineered A. succinogenes in the growth medium to produce
the 5-aminolevulinate.
[0029] The present invention provides a method of
producing 5-aminolevulinate: comprising: providing a
genetically engineered A. succinogenes comprising one or
more gene knockouts or modifications that inhibit C3 enzymes
selected from the group consisting of pyruvate kinase,
pyruvate-formate lyase, pyruvate dehydrogenase, and
combinations thereof, and capable of overexpressing C4
enzymes selected from the group consisting of succinyl-CoA
synthetase, PEPCK, malate dehydrogenase, fumarase, fumarate
reductase, and combinations thereof; providing a growth
medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the 5-
aminolevulinate. In further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that can bridge the C4 and C3 pathways
selected from a group consisting of malic enzyme and
oxaloacetate decarboxylase. In still further embodiments
-11-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
the genetically engineered A. succinogenes is capable of
overexpressing enzymes leading to glycine synthesis. In
still further embodiments the genetically engineered A.
succinogenes is capable of overexpressing 5-aminolevulinate
synthase. In still further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that increase flux through the EMP
pathway. In still further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that increase flux through the PPP. In
further embodiments, the genetically engineered A.
succinogenes further comprises a gene knockout or
modification that inhibits malic enzyme. In still further
embodiments, the genetically engineered A. succinogenes
further comprises a gene knockout or modification that
inhibits oxaloacetate decarboxylase. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase substrate uptake. In still further embodiments the
one or more genes increase uptake of a substrate selected
from the group consisting of arabinose, xylose, glucose,
fructose, and sucrose. In still further embodiments the
genetically engineered A. succinogenes further comprises
modifications to one or more genes that increase chemical
excretion. In still further embodiments the one or more
genes encode dicarboxylate transporters. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more glycine
synthesis genes.
[0030] The present invention provides a method of
producing 2-oxoglutarate comprising: providing a genetically
-12-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof; providing a growth medium for culturing the
genetically engineered A. succinogenes; and culturing the
genetically engineered A. succinogenes in the growth medium
to produce the 2-oxoglutarate.
[0031] The present invention provides a method of
producing 2-oxoglutarate comprising: providing a genetically
engineered A. succinogenes capable of overexpressing C4
enzymes selected from the group consisting of succinyl-CoA
synthetase, PEPCK, malate dehydrogenase, fumarase, fumarate
reductase, and combinations thereof; providing a growth
medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the 2-
oxoglutarate.
[0032] The present invention provides a method of
producing 2-oxoglutarate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof, and capable of overexpressing C4 enzymes selected
from the group consisting of succinyl-CoA synthetase, PEPCK,
malate dehydrogenase, fumarase, fumarate reductase, and
combinations thereof; providing a growth medium for
culturing the genetically engineered A. succinogenes; and
culturing the genetically engineered A. succinogenes in the
growth medium to produce the 2-oxoglutarate.
-13-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[0033] In further embodiments the genetically engineered
A. succinogenes further comprises a gene knockout or
modification that inhibits 2-oxoglutarate dehydrogenase and
further is capable of overexpressing 2-oxoglutarate:acceptor
oxidoreductase. In still further embodiments the
genetically engineered A. succinogenes further comprises
modifications to one or more genes that can bridge the C4
and C3 pathways selected from a group consisting of malic
enzyme and oxaloacetate decarboxylase. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase flux through the EMP pathway. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase flux through the PPP. In further embodiments, the
genetically engineered A. succinogenes further comprises a
gene knockout or modification that inhibits malic enzyme.
In still further embodiments, the genetically engineered A.
succinogenes further comprises a gene knockout or
modification that inhibits oxaloacetate decarboxylase. In
still further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase substrate uptake. In still further
embodiments the one or more genes increase uptake of a
substrate selected from the group consisting of arabinose,
xylose, glucose, fructose, and sucrose. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase chemical excretion. In still further embodiments
the one or more genes encode for dicarboxylate transporters.
-14-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[0034] The present invention provides a method of
producing glutamate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof; providing a growth medium for culturing the
genetically engineered A. succinogenes; and culturing the
genetically engineered A. succinogenes in the growth medium
to produce the glutamate.
[0035] The present invention provides a method of
producing glutamate comprising: providing a genetically
engineered A. succinogenes capable of overexpressing C4
enzymes selected from the group consisting of succinyl-CoA
synthetase, PEPCK, malate dehydrogenase, fumarase, fumarate
reductase, and combinations thereof; providing a growth
medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the glutamate.
[0036] The present invention provides a method of
producing glutamate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof, and capable of overexpressing C4 enzymes selected
from the group consisting of succinyl-CoA synthetase, PEPCK,
malate dehydrogenase, fumarase, fumarate reductase, and
combinations thereof; providing a growth medium for
culturing the genetically engineered A. succinogenes; and
-15-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
culturing the genetically engineered A. succinogenes in the
growth medium to produce the glutamate.
[0037] In further embodiments the genetically engineered
A. succinogenes further comprises a gene knockout or
modification that inhibits 2-oxoglutarate dehydrogenase and
further is capable of overexpressing 2-oxoglutarate:acceptor
oxidoreductase. In still further embodiments the
genetically engineered A. succinogenes is capable of
overexpressing glutamate dehydrogenase. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase flux through the EMP pathway. In further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
can bridge the C4 and C3 pathways selected from a group
consisting of malic enzyme and oxaloacetate decarboxylase.
In still further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase flux through the PPP. In still further
embodiments, the genetically engineered A. succinogenes
further comprises a gene knockout or modification that
inhibits malic enzyme. In still further embodiments, the
genetically engineered A. succinogenes further comprises a
gene knockout or modification that inhibits oxaloacetate
decarboxylase. In still further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that increase substrate uptake. In
still further embodiments the one or more genes increase
uptake of a substrate selected from the group consisting of
arabinose, xylose, glucose, fructose, and sucrose. In still
further embodiments the genetically engineered A.
-16-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
succinogenes further comprises modifications to one or more
genes that increase chemical excretion. In still further
embodiments the one or more genes encode dicarboxylate
transporters.
[0038] The present invention provides a method of
producing aspartate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof; providing a growth medium for culturing the
genetically engineered A. succinogenes; and culturing the
genetically engineered A. succinogenes in the growth medium
to produce the aspartate.
[0039] The present invention provides a method of
producing aspartate comprising: providing a genetically
engineered A. succinogenes capable of overexpressing C4
enzymes selected from the group consisting of succinyl-CoA
synthetase, PEPCK, malate dehydrogenase, fumarase, fumarate
reductase, and combinations thereof; providing a growth
medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the aspartate.
[0040] The present invention provides a method of
producing aspartate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate
formate lyase, pyruvate dehydrogenase, and combinations
thereof, and capable of overexpressing C4 enzymes selected
from the group consisting of succinyl-CoA synthetase, PEPCK,
-17-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
malate dehydrogenase, fumarase, fumarate reductase, and
combinations thereof; providing a growth medium for
culturing the genetically engineered A. succinogenes; and
culturing the genetically engineered A. succinogenes in the
growth medium to produce the aspartate.
[0041] In further embodiments the genetically engineered
A. succinogenes further comprises a gene knockout or
modification that inhibits 2-oxoglutarate dehydrogenase and
further is capable of overexpressing 2-oxoglutarate:acceptor
oxidoreductase. In still further embodiments the
genetically engineered A. succinogenes is capable of
overexpressing glutamate dehydrogenase. In still further
embodiments the genetically engineered A. succinogenes is
capable of overexpressing aspartate transaminase. In still
further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase flux through the EMP pathway. In
further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that can bridge the C4 and C3 pathways selected from a
group consisting of malic enzyme and oxaloacetate
decarboxylase. In still further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that increase flux through the PPP. In
further embodiments, the genetically engineered A.
succinogenes further comprises a gene knockout or
modification that inhibits malic enzyme. In further
embodiments, the genetically engineered A. succinogenes
further comprises a gene knockout or modification that
inhibits oxaloacetate decarboxylase. In still further
embodiments the genetically engineered A. succinogenes
-18-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
further comprises modifications to one or more genes that
increase substrate uptake. In still further embodiments the
one or more genes increase uptake of a substrate selected
from the group consisting of arabinose, xylose, glucose,
fructose, and sucrose. In still further embodiments the
genetically engineered A. succinogenes further comprises
modifications to one or more genes that increase chemical
excretion. In still further embodiments the one or more
genes encode dicarboxylate transporters.
[0042] The present invention provides a method of
producing aspartate comprising: providing a genetically
engineered A. succinogenes capable of overexpressing C4
enzymes selected from the group consisting of PEPCK, malate
dehydrogenase, fumarase, and combinations thereof; providing
a growth medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the aspartate.
[0043] The present invention provides a method of
producing aspartate comprising: providing a genetically
engineered A. succinogenes comprising one or more gene
knockouts or modifications that inhibit C3 enzymes selected
from the group consisting of pyruvate kinase, pyruvate-
formate lyase, pyruvate dehydrogenase, and combinations
thereof, and capable of overexpressing C4 enzymes selected
from the group consisting of PEPCK, malate dehydrogenase,
fumarase, and combinations thereof; providing a growth
medium for culturing the genetically engineered A.
succinogenes; and culturing the genetically engineered A.
succinogenes in the growth medium to produce the aspartate.
[0044] In further embodiments the genetically engineered
A. succinogenes further comprises a gene knockout or
-19-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
modification that inhibits fumarate reductase. In still
further embodiments the genetically engineered A.
succinogenes is capable of overexpressing aspartate ammonia-
lyase. In still further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that increase flux through the EMP
pathway. In further embodiments the genetically engineered
A. succinogenes further comprises modifications to one or
more genes that can bridge the C4 and C3 pathways selected
from a group consisting of malic enzyme and oxaloacetate
decarboxylase. In still further embodiments the genetically
engineered A. succinogenes further comprises modifications
to one or more genes that increase flux through the PPP. In
still further embodiments the genetically engineered A.
succinogenes further comprises modifications to one or more
genes that increase substrate uptake. In still further
embodiments the one or more genes increase uptake of a
substrate selected from the group consisting of arabinose,
xylose, glucose, fructose, and sucrose. In still further
embodiments the genetically engineered A. succinogenes
further comprises modifications to one or more genes that
increase chemical excretion. In still further embodiments
the one or more genes encode dicarboxylate transporters.
-20-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] Figure 1 illustrates a pathway of reactions
mentioned in disclosure for using A. succinogenes genes for
chemical production.
[0046] Figure 2 illustrates a pathway of arabinose uptake
and entry into central metabolism.
[0047] Figure 3 illustrates a pathway of xylose uptake
and entry into central metabolism.
[0048] Figure 4 illustrates a pathway of fructose uptake
and entry into central metabolism.
DETAILED DESCRIPTION OF THE INVENTION
[0049] All patents, patent applications, government
publications, government regulations, and literature
references cited in this specification are hereby
incorporated herein by reference in their entirety. In case
of conflict, the present description, including definitions,
will control.
[0050] Biobased chemical production is a growing
industry, with some biobased chemicals poised to replace
markets based on fossil fuels. A. succinogenes is a
promising bio-catalyst for industrial succinate production,
as well as for other chemical productions including malate,
fumarate, 5-aminolevulinate, 2-oxoglutarate, glutamate, and
aspartate. In addition to producing succinate, wild-type A.
succinogenes 130Z also produces significant amounts of
unwanted formate, acetate, and ethanol. A. succinogenes
fermentative metabolism splits at phosphoenolpyruvate (PEP)
and/or pyruvate into the succinate-producing C4 branch and
the formate, acetate, and ethanol-producing C3 branch.
Improving A. succinogenes succinate production, and allowing
-21-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
for production of other chemicals from the C4 pathway, will
likely involve inhibiting the C3 pathway enzymes, and
overexpressing C4 pathway enzymes. Additionally, enzyme
activities such as malic enzyme and oxaloacetate
decarboxylase that can bridge the C4 and C3 pathways can
also be inhibited. With C4 pathway flux increased, the flux
supplying substrate to the C4 pathway can also then be
increased. Genes encoding specific enzymes involved in
sugar uptake, glycolysis, the PPP, and the Entner-Doudoroff
pathway can be inhibited or overexpressed to increase flux.
Additionally, chemical excretion can be increased by
overexpressing dicarboxylate transporters.
[0051] A. succinogenes is a bacterium that is a potential
bio-catalyst for industrial succinate production. Wild-type
A. succinogenes 130Z also produces significant amounts of
unwanted formate, acetate, and ethanol. A. succinogenes
fermentative metabolism splits at (PEP and/or pyruvate into
the succinate producing C4 branch and the formate, acetate,
and ethanol-producing C3 branch. Increasing A. succinogenes
succinate production will likely involve inhibiting C3
enzymes and overexpressing C4 enzymes. Not only is the C4
pathway important for producing succinate, but also other
commercially important chemicals are intermediates of, or
can be derived from, the C4 pathway. These chemicals
include: malate, fumarate, 5-aminolevulinate, 2-
oxoglutarate, glutamate, and aspartate. In agreement with
DOE/JGI, the A. succinogenes 130Z (ATCC 55618) genome is
being sequenced and a draft sequence is currently available
to the Zeikus lab. To help devise strategies for producing
C4-related compounds we have predicted what genes will be
important and have identified the corresponding open reading
-22-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
frames (ORFs) that are present in the draft sequence so that
they can be protected for use in making chemicals.
[0052] Engineering A. succinogenes to produce chemicals
such as succinate, fumarate, malate, 5-aminolevulinate, 2-
oxoglutarate, glutamate, and aspartate by overexpressing
and/or inhibiting the appropriate genes is advantageous
because: (a) By knowing the gene sequences, they can be
overexpressed, knocked out, or altered to benefit chemical
production. This is a more direct and efficient approach
than chemical mutagenesis and selective pressure; (b) It
increases succinate production beyond that of the wild-type
strain; (c) Unlike the wild-type strain, the new, engineered
strains would not produce undesired endproducts; (d) It
allows for the production of new chemicals from A.
succinogenes; and (e) The A. succinogenes chemical
production is based on renewable resources and can compete
and potentially replace chemical markets based on fossil
fuels.
[0053] Production of chemicals using the C4 pathway of A.
succinogenes requires the overexpression of C4 enzymes,
inhibition of C3 enzymes, and in some cases, inhibition of
some C4 enzymes. Figure 1 illustrates a pathway of these
reactions. A. succinogenes genes for catalytic enzymes can
be engineered to maximize production of various chemicals of
the pathways. The Bold arrows represent C4 reactions. The
thin arrows represent C3 reactions, except for 1 and 20. A
reaction decarboxylating malate to pyruvate is also believed
to exist, but the gene has not been identified at this time.
The following abbreviations and numbering designations are
used in the Figure: Glc, glucose; PEP, phophoenolpyruvate;
OAA, oxaloacetate; Mal, malate; Fum, fumarate; Suc,
-23-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
succinate; SucCoA, succinyl-CoA; Gly, glycine; ALA, 5-
aminolevulinate; 2oxo, 2-oxoglutarate; Glu, glutamate; Pyr,
pyruvate; For, formate; AcCoA, acetyl-CoA; Alde,
acetaldehyde; EtOH, ethanol; AcPi, acetyl-phosphate; Ace,
acetate. 1, glycolysis enzymes; 2, PEP carboxykinase; 3,
malate dehydrogenase; 4, fumarase; 5, fumarate reductase; 6,
succinyl-CoA synthetase; 7, glutamyl-tRNA reductase; 8, 2-
oxoglutarate:acceptor oxidoreductase; 9, 2-oxoglutarate
dehydrogenase; 10, glutamate dehydrogenase; 11, pyruvate
kinase; 12, pyruvate formate lyase; 13, pyruvate
dehydrogenase; 14, acetaldehyde dehydrogenase; 15, alcohol
dehydrogenase; 16, aldehyde dehydrogenase; 17, phosphate
acetyl-transferase; 18, acetate kinase; 19,
acetylphosphatase; 20, oxaloacetate decarboxylase.
[0054] Overexpression of enzymes can involve
overexpressing the native enzymes or overexpressing enzymes
from other bacteria. Enzymes can be overexpressed in A.
succinogenes as described by members of our lab in Kim et
al. 2004 Plasmid 51: 108-115. As chemical production is
improved, flux to the PEP branchpoint may become the
limiting factor, in which case, enzymes involved in sugar
uptake and glycolysis would have to be overexpressed as
well.
[0055] When inhibiting or knocking out enzymes, care
should be taken to ensure that the cells get enough
essential intermediates for growth and maintenance (e.g.,
acetyl-CoA, pyruvate, succinyl-CoA). It may also be
important to eliminate or leave open alternative pathways
that form shunts between the C3 and C4 pathways such as the
oxaloacetate decarboxylase, encoded by 3 ORFs on contig 169
from 74868 - 75137, 75157 - 76965, and 76976 - 78283.
-24-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[0056] The identified C4 enzymes include, but are not
limited to: phosphoenolpyruvate carboxykinase (PEPCK)
encoded by pckA (PEPCK accession #: AY308832.1
GI:34582584); malate dehydrogenase encoded by mdh (malate
dehydrogenase accession #: AY773261.1 GI:54873671) on
contig 160 from 41924 - 42862; fumarase encoded on contig
92 from 3526 - 4920; fumarate reductase encoded by 4 ORFs
on contig 120 from 8954 - 10744, 10896 - 11541, 11538 -
11927, 11947 - 12291; succinyl-CoA synthetase beta subunit
encoded on contig 154 from 44853 - 46013. The alpha subunit
is truncated because the sequence extends beyond the edge of
the contig. Eighty-eight amino acids of the alpha subunit
are found from 266 - 1 of contig 154; 2-oxoglutarate
dehydrogenase encoded by 3 ORFs on contig 154 from 43546 -
44664, 40638 - 43463, and on contig 100 from 4439 - 5863.
[0057] The identified C3 enzymes include, but are not
limited to: pyruvate kinase encoded on contig 122 from 7757
- 9193; pyruvate formate lyase encoded on contig 126 from 1
- 2023. Of note: this gene is truncated since it extends
beyond the end of the contig.; pyruvate dehydrogenase
encoded by 3 ORFS on contig 100 from 2 - 2437, 2498 - 4381,
and 4439 - 5863. Of note: the last ORF is the same as that
for 2-oxoglutarate dehydrogenase. It is common for the two
enzymes to use this same subunit (E3 component);
acetaldehyde dehydrogenase encoded on contig 135 from 211 -
2835; alcohol dehydrogenase encoded on contig 164 from 4399
- 5517; acetylphosphatase encoded on contig 64 from 3935 -
4207; acetate kinase on contig 93 from 1070 - 3. Of note:
about 70 amino acids are missing because the ORF extends
beyond the edge of the contig.; aldehyde dehydrogenase
converting acetaldehyde and NAD to acetate and NADH encoded
-25-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
on contig 83 from 1656 - 1886 and 1883 - 3139.
[0058] An ORF encoding phosphate acetyl-transferase
cannot currently be located but is believed to be present
based on examination of closely related genomes and
significant acetate production by A. succinogenes.
[0059] Other important enzymes include, but are not
limited to: glutamate dehydrogenase encoded on contig 159
from 12909 - 14258; aspartate transaminase encoded on contig
154 from 13745 - 14935; and aspartate ammonia-lyase encoded
on contig 148 from 5361 - 3934.
Strategies for chemical production based on identified A.
succinogenes genes:
I. Production of succinate:
[0060] Knockout or inhibit C3 enzymes that may or may not
include: pyruvate kinase, pyruvate-formate lyase, and
pyruvate dehydrogenase. Overexpress C4 enzymes, which may
include some or all of PEPCK, malate dehydrogenase,
fumarase, and fumarate reductase. Recent experiments in the
lab indicate that A. succinogenes has a maximum C4 flux that
must be overcome to achieve industrial succinate production
(McKinlay et al. 2005. Actinobacillus succinogenes shows a-
ketoglutarate auxotrophy in a chemically defined growth
medium. 2005., Appl: Environ. Microbiol. 2005. 71:6651-
6656).
II. Production of fumarate:
[0061] The same approaches are taken as for succinate
production but additionally fumarate reductase should be
knocked out or inhibited.
III. Production of malate:
[0062] The same approaches are taken as for fumarate
-26-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
production but additionally fumarase should be knocked out
or inhibited.
IV. Production of 5-aminolevulinate:
[0063] The same approaches are taken as for succinate but
succinyl-CoA synthetase should also be overexpressed. So far
only the complete beta subunit of A. succinogenes succinyl-
CoA synthetase has been found, but it is expected that the
rest of the alpha subunit will be found in the completed
genome sequence. If the complete alpha-subunit is not in the
completed genome sequence then foreign genes would be
required. A hemA gene (e.g., from Rhodobacter sphaeroides
as was described by van der Werf and Zeikus. 1996. Appl.
Environ. Microbiol. 62(10): 3560-3566) can also be
overexpressed to convert glycine and succinyl-CoA to 5-
aminolevulinate. Additionally, it can be beneficial to
overexpress enzymes leading to glycine synthesis.
V. Production of 2-oxoglutarate:
[0064] The same approaches are taken as for 5
aminolevulinate but there is no need to overexpress glycine
producing path or hemA. 2-oxoglutarate dehydrogenase is
unidirectional from 2-oxoglutarate to succinyl-CoA so we
would inhibit or knock it out and overexpress 2-
oxoglutarate:acceptor oxidoreductase (e.g. from Helicobacter
pylori), which functions in reverse tricarboxylic acid
cycle.
Vi. Production of glutamate:
[0065] The same approaches are taken as for 2-
oxoglutarate but also include overexpressing glutamate
dehydrogenase, encoded on contig 159 from 12909 - 14258.
VII. Production of aspartate:
[0066] Two methods can be used to produce aspartate. In
-27-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
the first method, the same approaches are taken as for
glutamate but also include overexpressing aspartate
transaminase, encoded on contig 154 from 13745 - 14935. In
the second methods, the same approaches are taken as for
fumarate production but also include overexpressing
aspartate ammonia-lyase, encoded on contig 148 from 5361 -
3934.
[0067] A. succinogenes gene sequences have been
identified from the A. succinogenes genome sequence that are
important for chemical production. Upon completion of the
genome sequence we will revise the sequences to correct for
low sequence quality, find regions of the genes that were
missing in the draft genome sequence, and find entire gene
sequences that were missing in the draft genome sequence
that may be important to chemical production. We have
manually annotated all open reading frames (ORFs) in the
draft genome sequence. Each ORF will be annotated by a
different person when the complete genome sequence is
achieved.
[0068] The genes are amplified using polymerase chain
reaction and the genes are cloned into plasmids by methods
known in the art. Once the genes are in plasmids, they can
be overexpressed, inhibited, and can be used to knockout
genes as described above. The selection of the exact genes
to be overexpressed or inhibited is guided in part by
metabolic studies, including 13C-labeling experiments as
described in McKinlay et al. (Determining Actinobacillus
succinogenes metabolic pathways and fluxes by NMR and GC-MS
analysis of 13C-labeled metabolic product isotopomers.
Submitted for publication). These labeling experiments are
made possible by the chemically defined medium developed and
-28-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
described in McKinlay et al. 2005 (Actinobacillus
succinogenes shows a-ketoglutarate auxotrophy in a
chemically defined growth medium, Appl. Environ. Microbiol.
71(11):6651-6656) and U.S. Patent Application No.
to Zeikus et al. (U.S. Patent Application No.
claiming priority to U.S. Provisional Application No.
60/717,425, MSU 4.1-758) hereby incorporated herein by
reference in its entirety. The genetic tools exist for
overexpressing genes in A. succinogenes as described in Kim
et al. 2004 Plasmid 51: 108-115 and U.S. Patent Application
No. 10/911,961. We may improve on this method for gene
overexpression and we are actively pursuing an efficient
system for gene knockout in A. succinogenes. The genes to be
knocked out can be interrupted by a drug resistance cassette
and used to replace the uninterrupted wild-type gene in the
chromosome. Each mutant is grown to assess the effect of
the mutations on growth characteristics and chemical
production. Mutants are analyzed using 13C-labelling studies
to determine how the mutations affect the intermediary
metabolism of the organism.
[0069] - The following is a list of gene targets that are
included in the identification and annotation work herein.
The genes encode: malic enzyme; pyruvate carboxylase; PEP
carboxylase; PEP synthase; pyruvate-ferredoxin
oxidoreductase; glucokinase; glucose permease; sucrose
specific phosphotransferase system; Beta-fructofuranosidase;
6-phosphogluconate dehydratase (Entner-Doudoroff pathway);
ribulose-phosphate 3-epimerase (PPP); malate synthase;
isocitrate lyase; isocitrate dehydrogenase; aconitase;
citrate synthase; citrate lyase; lactate dehydrogenase;
carbonic anhydrase; beta-galactosidase; ATP-dependent
-29-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
maltose transport system; LacI repressor protein; Arabinose
transcriptional activator protein AraC; Xylose operon
activator protein, Xy1R; cAMP receptor protein, CRP, also
known as catabolite activator protein, CAP; and carbon
storage regulator protein, CsrA.
[0070] The genes of the A. succinogenes C3 and C4
pathways can be used for production of a variety of
chemicals. Since these strategies lead to increased
chemical production at high rates, the pathways delivering
substrate to the C4 pathway can then limit the chemical
production rates. In some embodiments of the present
invention the flux through these pathways are increased by
inhibiting, knocking out, overexpressing and
modifying/evolving specific enzymes involved in glycolysis,
the PPP, and substrate uptake. In further embodiments of
the present invention chemical excretion is increased by
targeting genes encoding for dicarboxylate transporters.
ORFs in the A. succinogenes draft genome sequence are
provided that encode for these genes so that they can used
for making chemicals.
[0071] Improving C4-pathway flux can bring about a
situation where the flux delivering substrate to the C4
pathway is limiting. When this occurs, it is necessary to
affect genes involved in (i) glycolysis, or the EMP, (ii)
the PPP, and (iii) substrate uptake (e.g., glucose, xylose,
arabinose, sucrose). Figures 2, 3 and 4 illustrate pathways
of uptake and entry into central metabolism for arabinose,
xylose, and fructose, respectively. Additionally, chemical
excretion can become limiting and so genes involved in
dicarboxylate export may also need to be affected. The
specific genes to be affected and the way in which they will
-30-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
be affected will be guided in part by metabolic studies,
including 13C-labeling studies as described in McKinlay et
al. (Determining Actinobacillus succinogenes metabolic
pathways and fluxes by NMR and GC-MS analysis of 13C-labeled
metabolic product isotopomers. Submitted.). These labeling
experiments are made possible by our chemically defined A.
succinogenes growth medium described in McKinlay et al. 2005
(Actinobacillus succinogenes shows a-ketoglutarate
auxotrophy in a chemically defined growth medium, Appl.
Environ. Microbiol., 71(11):6651-6656) and U.S. Patent
Application No. to Zeikus et al. (U.S. Patent
Application No. , claiming priority to U.S.
Provisional Application No. 60/717,425, MSU 4.1-758). For
example, the distribution of fluxes between the EMP and PPP
and the extent to which gluconeogenesis occurs should be
revealed by the 13C-labeling experiments. If there is
significant gluconeogenic flux we will knock out those
enzymes believed to be involved in gluconeogenesis and
examine the effects. Also, for production of 5-
aminolevulinate, glycine is required as a substrate. It
would likely be worthwhile to enhance flux to glycine for 5-
aminolevulinate production.
[0072] We have identified the gene sequences believed to
encode specific enzymes in the A. succinogenes 130Z draft
genome sequence that we predict will be important for
modifying (i) the EMP flux, (ii) the PPP flux, (iii)
substrate uptake, (iv) dicarboxylate transport, (v) and
glycine synthesis. These gene sequences are attached as an
appendix and are summarized below. These sequences are
subject to modification upon the release of the complete A.
succinogenes genome sequence, since the draft genome
-31-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
sequence contains gaps and regions of poor sequence quality.
( i ) EMP gene s :
[0073] phosphoglucoisomerase (EC 5.3.1.9) on contig 135
from 14164 - 15858
[0074] 6-phosphofructokinase (EC 2.7.1.11) on contig 163
from 33518 - 34483
[0075] triosephosphate isomerase (EC 5.3.1.1) on contig
154 from 16095 - 15022
[0076] triosephosphate isomerase (EC 5.3.1.1) on contig
154 from 40514 - 41299
[0077] triosephosphate isomerase (EC 5.3.1.1) on contig
163 from 42329 - 43099
[0078] fructose-1, 6-bisphosphatase (EC 3.1.3.11)
(gluconeogenic) on contig 74 from 2747 - 3760
[0079] Two ORFs encoding the N-terminus of fructose 1,6-
bisphosphate aldolase on contig 138 from 376 - 1. Note: the
complete sequence is not known as the ORF extends beyond the
edge of the contig. The sequence was divided into 2 ORFs due
to low sequence quality causing a frame shift. (Fructose
uptake path).
[0080] glyceraldehyde-3-phosphate dehydrogenase (EC
1.2.1.12) on contig 127 from 13295 - 12330. Note: an
estimated 60 bases coding for about 20 amino acids are
missing as the 5'-end of this ORF extends beyond the edge of
the contig.
[0081] 3-phosphoglycerate kinase (EC 2.7.2.3) on contig
138 from 1655 - 480
[0082] phosphoglycerate mutase (EC 5.4.2.1) on contig 133
from 4053 - 3370
-32-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[0083] phosphoglycerate mutase (EC 5.4.2.1) on contig 162
from 48008 - 48652
[0084] enolase (EC 4.2.1.11) on contig 157 from 33951 -
33061 Note: this is only the C-terminus of the enolase. The
region coding the N-terminus extends beyond the edge of the
contig.
Potential EMP strategies:
[0085] To increase flux delivering substrate (i.e., PEP
and pyruvate) to the C4-pathway, some or all of the EMP
enzymes may need to be overexpressed. The extent to which
each EMP enzyme affects C4-pathway flux can be estimated
from measurements of EMP flux (determined using 13C-labeling
experiments) and of enzyme activity and from using metabolic
control analysis calculations. As an alternative, the EMP
flux could be complemented by an Entner-Doudoroff (ED)
pathway flux, providing two pathways to deliver substrate to
the C4 pathway. A gene encoding the A. succinogenes ED
enzyme 6-phosphogluconate dehydratase (EC 4.2.1.12) was not
found in the draft genome sequence so it may be necessary to
overexpress a foreign gene encoding this enzyme if it is not
present in the complete genome sequence. Genes encoding the
A. succinogenes ED enzyme 2-keto-3-deoxy-6-phosphogluconate
aldolase (EC 4.2.1.14) were found on contig 148 from 19472 -
18834 and on contig 159 from 15090 - 14452.
(ii) PPP genes :
[0086] glucose-6-phosphate dehydrogenase (EC 1.1.1.49) on
contig 146 from 10225 - 8738
[0087] 6-phosphogluconolactonase (EC 3.1.1.31) on contig
115 from 8607 - 7906
-33-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[0088] 6-phosphogluconate dehydrogenase (EC 1.1.1.44) on
contig 115 from 5548- 4094
[0089] 6-phosphogluconate dehydrogenase (EC 1.1.1.44) on
contig 141 from 5548 - 4094
[0090] ribulose-phosphate 3-epimerase (EC 5.1.3.1) was
not found on any contigs but will likely be found in the
complete genome sequence, since closely related
Pasteurellaceae have this gene.
[0091] ribose-5-phosphate isomerase (EC 5.3.1.6) on
contig 154 from 20162 - 19710.
[0092] ribose 5-phosphate isomerase (EC 5.3.1.6) on
contig 154 from 37092 - 36643
[0093] ribose 5-phosphate isomerase (EC 5.3.1.6) on
contig 56 from 2978 - 2337.
[0094] ribose 5-phosphate isomerase (EC 5.3.1.6) on
contig 168 from 64945 - 64286
[0095] transketolase N-terminal subunit (EC 2.2.1.1) on
contig 159 from 37734 - 36904
[0096] transketolase C-terminal subunit (EC 2.2.1.1) on
contig 159 from 36911 - 35976
[0097] transketolase (EC 2.2.1.1) on contig 86 from 2744
- 738.
[0098] transaldolase (EC 2.2.1.2) on contig 105 from 6033
- 5368
[0099] transaldolase (EC 2.2.1.2) on contig 135 from
12149 - 13102.
[00100] Potential PPP strategies: Flux through the PPP
results in 1/6th of the carbon to be lost as C02r not all of
which can be recovered in the C4 pathway. In the event that
there is significant PPP flux (to be determined by 13C-
labeling studies), maximizing carbon recovery in chemical
-34-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
product will require knocking out glucose-6-phosphate
dehydrogenase, or if ED pathway flux is desired, knocking
out 6-phosphogluconate dehydrogenase instead. These two
enzymes are part of the oxidative PPP. The cell should still
be able to survive by diverting minimal flux through the
non-oxidative PPP to produce essential metabolic
intermediates without loss of carbon as C02r as has been
shown to be the case with E. coli (Zhao et al. FEMS
Microbiol. Lett. 2003. 220: 295-301 and Hua et al. J.
Bacteriol. 2003. 185 (24): 7053 - 7067).
[00101] Alternatively, if the economics of the industrial
situation permit some loss of C02 or if a source of reducing
power (required by the C4 pathway) is expensive, then it
would be worthwhile to divert flux through the oxidative
PPP, which gives 2 NADPH for each glucose. To do this, the
EMP enzyme, phosphoglucoisomerase, could be knocked out. It
may also be necessary to convert the resulting NADPH to NADH
using a native or foreign transhydrogenase or diaphorase as
was the case for an E. coli phosphoglucoisomerase knockout
mutant (Canonaco et al. FEMS Microbiol. Lett. 2001. 204:
247-252). A. succinogenes transhydrogenases are encoded on
contig 152 from 24659 - 26191, on contig 152 from 26203 -
27654 and potentially on contig 107 from 11481 - 10150.
(iii) Substrate uptake genes:
[00102] (a) Arabinose: ABC-type arabinose transport
system periplasmic protein on contig 155 from 6574 - 7389;
ABC-type arabinose transport system ATP-binding protein on
contig 155 from 7413 - 8948; ABC-type arabinose transport
system permease component on contig 155 from 8964 - 9932;
L-arabinose isomerase (EC 5.3.1.4) on contig 155 from 12637
-35-
WO 2007/019301 CA 02618694 2008-02-05
PCT/US2006/030425
- 14124; L-xylulokinase (EC 2.7.1.53) on contig 117 from
3876 - 2419; L-xylulokinase (EC 2.7.1.53) on contig 106
from 2250 - 3704; ribulose-5-phosphate-4-epimerase (EC
5.1.3.4) on contig 115 from 2782 - 3474
[00103] (b) Xylose: xylose isomerase (EC 5.3.1.5) on
contig 155 from 21265 - 22578; D-xylulokinase (EC 2.7.1.17)
or L-ribulokinase (EC 2.7.1. 16) on contig 165 from 43481 -
41883; D-xylulokinase (EC 2.7.1.7) on contig 155 from 22646
- 24091; D-xylulokinase (EC 2.7.1.7) on contig 155 from
11012 - 12616; ABC-type xylose or ribose transporter ATP-
binding protein on contig 155 from 40497 - 38974; ABC-type
xylose transporter periplasmic protein on contig 155 from
21013 - 20015; ABC-type xylose transport system permease
component on contig 155 from 18411 -17284; ABC-type xylose
transport system ATP-binding component on contig 155 from
19929 - 18415; xylose operon repressor protein on contig
165 from 44518 - 45636
[00104] (c) Glucose: glucokinase transcriptional
regulator (EC 2.7.1.2) on contig 99 from 4340 - 3426;
glucose specific PTS protein IIA on contig 153 from 411 -
13; glucose or beta-glucoside specific PTS protein IIC on
contig 153 from 27639 - 29498; glucose or beta-glucoside
specific PTS protein IIA on contig 165 from 40420 - 39968
[00105] (d) Fructose: fructose-specific PTS protein IIC
on contig 106 from 5534 - 3858; fructose-specific PTS
protein (IIA/FPr) on contig 106 from 7985 - 6483; fructose-
specific PTS protein IIC on contig 135 from 9001 - 7952;
fructose-specific PTS protein IIB on contig 135 from 9331 -
9014; mannitol/fructose specific PTS protein IIA on contig
135 from 9799 - 9353; 1-phosphofructokinase (EC 2.7.1.56)
on contig 106 from 6480 - 5539; 1-phosphofructokinase (EC
.
-36-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
2.7.1.56) on contig 54 from 6480 - 5539; D-fructokinase on
contig 168 from 10269 - 11198.
[00106] (e) General: PEP phospho-transferase system
enzyme I (EI) on contig 153 from 2202 - 475;
phosphotransferase system, HPr-related protein on contig
153 from 2565 -2308; proton/sugar symport protein on
contig 165 from 41787 - 40432.
[00107] (f) Sucrose: sucrose invertase on contig 168
from 11272 - 12720
[00108] (g) Sugar efflux: potential major facilitator
superfamily sugar permease on contig 145 from 25395 - 26780;
major facilitator superfamily sugar permease on contig 123
from 16827 - 15997
[00109] Substrate uptake strategies: A variety of
substrates may be important for chemical production by A.
succinogenes, including those abundant in common feedstocks,
arabinose, xylose, glucose, fructose, and sucrose. All of
these sugars are most likely taken up by a
phosphotransferase system (PTS), a kinase, an ABC-type
transport system, or by facilitated diffusion (i.e., proton
symport permease). Ideally, we would want to take up each
sugar by a permease to leave more ATP for cell requirements.
If this is not possible, other systems are favorable over a
PTS, because a PTS converts PEP to pyruvate, which may or
may not be easily carboxylated to oxaloacetate or malate.
[00110] Arabinose is most likely internalized by an ABC-
type transport system. Once internalized, it may enter
metabolism by a number of routes (Fig. 1.). Using 13C-
arabinose should reveal which route is most important. One,
-37-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
a few, or all of the genes in this pathway may need to be
overexpressed.
[00111] Xylose is most likely internalized by an ABC-type
transport system and enters central metabolism as xylulose-
5-phosphate in the PPP (Fig. 2). If xylose is co-
metabolized with glucose, the proposed PPP knock outs would
not be detrimental since xylose enters metabolism downstream
of 6-phosphogluconate dehydrogenase. However, it may be
worthwhile to overexpress the PPP enzymes downstream of
xylulose to increase the flux from xylulose to PEP.
Additionally, we have identified what appears to be a xylose
operon repressor protein. It may be worthwhile to knockout
this repressor for situations where xylose is present to
help maximize xylose uptake.
[00112] Glucose is likely taken up by a PTS system or a
hexokinase that has not been identified yet but activity has
been detected by our lab members Pi.l Kim (Kim and Vieille.
Glucose phosphorylation mechanisms in succinate-producing
Actinobacillus succinogenes. Submitted) and Mariet van der
Werf (Van der Werf et al. Arch. Microbiol. 1997. 167: 332-
342). We would want to knock out the PTS systems and
overexpress the hexokinase if it proves to be difficult to
efficiently carboxylate pyruvate to PEP.
[00113] Fructose is likely taken up by a PTS or a
fructokinase and enters glycolysis at fructose-6-phosphate
or fructose 1,6-bisphosphate and glyceraldehyde 3-phosphate
depending on the uptake system (Fig. 3). As with glucose we
would most likely want to knock out the PTS system and
overexpress the fructokinase. Since fructose enters
metabolism early in glycolysis the proposed
phosphoglucoisomerase mutation to increase PPP flux should
-38-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
not be used in situations where fructose is a main carbon
source.
[00114] If sucrose is present, we would want to
overexpress sucrose invertase to efficiently convert sucrose
to glucose and fructose.
[00115] To improve chemical production we may also want to
knockout genes that counter substrate uptake such as sugar
efflux genes. However, depending on what sugars these sugar
efflux permeases act on, it may not be necessary to knock
them out. Indeed, if a sufficient sugar concentration
gradient can cause these sugar efflux permeases to take up
sugars then it may be worthwhile to enhance their sugar
uptake abilities by overexpressing the genes.
(iv) Dicarboxylate transporter genes include:
[00116] TRAP C4-dicarboxylate transport (Dct) system
protein on contig 154 from 18087 - 16792. TRAP-type C4-
dicarboxylate transport system large subunit on contig 159
from 20342 - 19050
[00117] TRAP-type C4-dicarboxylate transport system small
permease component on contig 117 from 7334 - 6057
[00118] TRAP-type C4-dicarboxylate transport system large
protein component on contig 122 from 13540 - 12269
[00119] TRAP-type C4-dicarboxylate transport system
periplasmic component (dicarboxylate-binding protein) on
contig 148 from 27696 - 26689
[00120] TRAP-type C4-dicarboxylate transport system
periplasmic component (dicarboxylate-binding protein) on
contig 159 from 21876 - 20890
[00121] TRAP-type C4-dicarboxylate transport system small
permease component on contig 122 from 14033 - 13551
-39-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[00122] TRAP-type C4-dicarboxylate transport system small
permease component on contig 159 from 20836 - 20345
[00123] TRAP-type C4-dicarboxylate transport system small
permease component on contig 154 from 18563 - 18087
[00124] TRAP-type C4-dicarboxylate transport system small
permease component on contig 148 from 26666 - 26157
[00125] TRAP-type C4-dicarboxylate transport system small
permease component on contig 148 from 12484 - 12975
[00126] TRAP-type C4-dicarboxylate transport system small
permease component on contig 117 from 7813 - 7331
[00127] TRAP-type C4-dicarboxylate transport system
periplasmic component (dicarboxylate-binding protein) on
contig 154 from 19646 - 18669
[00128] TRAP-type C4-dicarboxylate transport system
periplasmic component (dicarboxylate-binding protein) on
contig 148 from 12245 - 11259
[00129] TRAP-type C4-dicarboxylate transport system
periplasmic component (dicarboxylate-binding protein) on
contig 122 from 15018 - 14053
[00130] TRAP-type C4-dicarboxylate transport system
periplasmic component on contig 117 from 5984 - 4998
[00131] TRAP-type C4-dicarboxylate transport system
periplasmic component on contig 117 from 4938 -3949
[00132] TRAP-type C4-dicarboxylate transport system
integral membrane component on contig 77 from 4284 - 3718
NOTE: N-terminus coding region was missing since the coding
region extended beyond the edge of the contig.
[00133] TRAP-type C4-dicarboxylate transport system
integral membrane component on contig 148 from 26147 - 24867
[00134] TRAP-type C4-dicarboxylate transport system
integral membrane component on contig 148 from 12987 - 14288
-40-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[00135] TRAP-type C4-dicarboxylate transport system
component on contig 154 from 18563 - 18087
Dicarboxylate transporter strategies:
[00136] Since there are many candidates for dicarboxylate
transport, we would identify which genes are important for a
particular chemical production by knocking out each gene in
turn and examining the effect on the specific chemical
production rate. Once the appropriate genes are identified
for excreting a specific chemical we would overexpress those
genes.
(v) Glycine synthesis genes
[00137] Serine deaminase or threonine ammonia-lyase (EC
4.3.1.19), on contig 141 from 10270 - 11808
[00138] Glycine hydroxymethyltransferase (EC 2.1.2.1) on
contig 137 from 2950 - 1682.
[00139] Both of these genes would be overexpressed if
glycine availability were found to be limiting 5-
aminolevulinate production.
-41-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
Table 1. Actinobacillus succinogenes nucleotide sequences of
genes and open reading frames (ORFs) identified.
phosophoenolpyruvate carboxykinase
malate dehydrogenase
fumarase
fumarate reductase
succinyl-CoA synthetase
glutamyl-tRNA reductase
2-oxoglutarate dehydrogenase
glutamate dehydrogenase
aspartate ammonia-lyase
aspartate transaminase
pyruvate kinase
pyruvate dehydrogenase
pyruvate-formate lyase
acetaldehyde dehydrogenase
alcohol dehydrogenase
acylphosphatase
aldehyde dehydrogenase
acetate kinase
phosphate acetyl-transferase
oxaloacetate decarboxylase
-42-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
EXAMPLE 1
[00140] In agreement with DOE/JGI, the A. succinogenes
130Z (ATCC 55618) genome was sequenced and the sequence was
used to identify the genes that are important for producing
C4-related compounds. The sequences of these genes are
disclosed herein as SEQ ID NO:1 through SEQ ID NO:119.
[00141] A. succinogenes nucleotide sequences of genes and
open reading frames (ORFs) of the C3 and C4 pathways are
disclosed below. A. succinogenes 130Z can be purchased from
the American Type Culture Collection (ATCC) . The genomic
DNA sequenced herein came from a strain obtained from ATCC.
pckA, encoding PEPCK, and mdh, encoding malate
dehydrogenase, have both been expressed in E. coli. PEPCK
has been overexpressed in A. succinogenes.
[00142] SEQ ID NO:1 is the A. succinogenes PEPCK encoding
gene sequence. (PEPCK accession #: AY308832.1 GI:34582584
>gil345825841gblAY308832.11 A. succinogenes PEPCK gene,
complete cds).
[00143] SEQ ID NO:2 is the ORF encoding A. succinogenes
malate dehydrogenase on Contig 160 (Lab member Maris
Laivenieks previously sequenced this gene and pckA encoding
PEPCK) EC 1.1..1.37 >SPTR top hit: 'Q5U907 NAD(H)-dependent
malate dehy - 41924: 42862.
[00144] SEQ ID NO:3 is malate DH accession #: AY773261.1
GI:54873671>gil548736711gblAY773261.11 A. succinogenes
plasmid pKNJ NAD(H)-dependent malate dehydrogenase (mdh)
gene, complete cds
[00145] SEQ ID NO:4 is the ORF encoding A. succinogenes
fumarase on Contig 92 EC 4.2.1.2 (>SPTR top hit: 'Q65UJ3
-43-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
FumC protein. Mannheimia suc - 3526: 4920).
[00146] ORFs encoding A. succinogenes fumarate reductase
on Contig 120: The frdB is split into 2 overlapping ORFs
(FRD iron-sulfur protein and frdB). EC 1.3.99.1 or 1.3.5.1.
SEQ ID NO:5 is frdA. (>PRIAM: Succinate dehydrogenase. -
8954: 10744). SEQ ID NO:6 is the FRD iron-sulfur protein
(>SPTR top hit: 'Q7VPM7 Fumarate reductase iron-sulf -
10896: 10970). SEQ ID NO:7 is FrdB. The first 11 bases
overlap with the iron-sulfur protein ORF. (>SPTR top hit:
'Q65S00 FrdB protein. Mannheimia suc - 10960: 11541). SEQ
ID NO:8 is frdC. The first four bases overlap with the C-
terminus of frdB product. (>SPTR top hit: 'Q65RZ9 FrdC
protein. Mannheimia suc - 11538: 11927). SEQ ID NO:9 is
frdD (>SPTR top hit: 'Q65RZ8 FrdD protein. Mannheimia suc
- 11947: 12291).
[00147] ORFs encoding A. succinogenes succinyl-CoA
synthetase on Contig 154: EC 6.2.1.5 SEQ ID NO:10 is the
Beta-subunit (>PRIAM: Succinate--CoA ligase [ADP-forming].
- 44853: 46013). Most of alpha-subunit is missing, however
the N-terminus is found on the edge of contig 154 down
stream of the beta-subunit gene, where it would be expected
when compared to other genomes. It was found by blasting
the alpha-subunit nucleotide sequence against the A.
succinogenes draft genome sequence. SEQ ID NO:11 is the
sequence 260 attttaattaataaaaacactaaagtgatctgccaggg-
attcaccggcggacaagg 205. It was surprising though that the
sequence didn't match from 260: 1. The open reading frames
was taken without stop codons from 260:1 and a BLASTp search
was performed against all bacteria in the nr database (88
amino acids). The search turned up nearly exact identity to
succinyl-CoA alpha-subunits across all 88 amino acids
-44-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
queried and included a conserved CoA-binding site. SEQ ID
NO:12 is the sequence 260attttaattaataaaaacactaaagtga-
tctgccagggattcaccggcggacaaggcaccttccacagcgaacaggcattggcatacg
gcacgaaattagtgggcggtaccagtccgggtaaaggcggtacgacgcatttgggattgc
cggtgtttgatacggtacgcgaagcggtgcaaaaaaccggagccaccgccagcgtgattt
atgtgccggcaccgttctgtaaggacgccattctggaagcgattgacgccgg 1.
[00148] ORFs encoding A. succinogenes 2-oxoglutarate
dehydrogenase on contig 154: SEQ ID NO:14 is the E2 (EC
2.3.1.61) Dihydrolipoamide succinyltransferase > - 43546:
44664. SEQ ID NO:15 is the El (EC 1.2.4.2)
(>SPTR top hit: 'Q65SU8 SucA protein. Mannheimia suc -
40638: 43463). SEQ ID NO:16 is the E3 Found on Contig 100
(EC 1.8.1.4)- note: same ORF as for pyruvate dehydrogenase
(this is normal) (>SPTR top hit: 'Q65SW9 Lpd protein.
Mannheimia succ - 4439: 5863).
[00149] SEQ ID NO:17 is the ORF encoding A. succinogenes
glutamate dehydrogenase on contig 159 (EC 1.4.1.4)
(>PRIAM: Glutamate dehydrogenase (NADP+). - 12909: 14258).
[00150] SEQ ID NO:13 is the ORF encoding A. succinogenes
aspartate ammonia-lyase on contig 148 (EC 4.3.11) (>SPTR top
hit: 'Q7VNH2 AspA protein. Haemophilus ducreyi - 5361:
3934).
[00151] SEQ ID NO:119 is the ORF encoding A. succinogenes
aspartate transaminase on contig 154 (EC 2.6.1.1) (>SPTR top
hit: 'P44425 aspartate ammonia-lyase. Haemophilus influenzae
- 13745: 14935).
[00152] SEQ ID NO:18 an ORF encoding A. succinogenes
pyruvate kinase on Contig 122 (EC 2.7.1.40) (>PRIAM:
Pyruvate kinase. - 7757: 9193).
[00153] ORFs encoding A. succinogenes pyruvate
dehydrogenase on Contig 100: SEQ ID NO:19 is EC 1.2.4.1
-45-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
(>SPTR top hit: 'P45119 Pyruvate dehydrogenase El co - 2:
2437). SEQ ID NO:20 is EC 2.3.1.12 (>PRIAM:
Dihydrolipoamide S-succinyltransferase. - 2498: 4381).
SEQ ID NO:21 is EC 1.8.1.4 (>SPTR top hit: 'Q65SW9 Lpd
protein. Mannheimia succ - 4439: 5863).
[00154] SEQ ID NO:22 is a truncated ORF encoding an A.
succinogenes pyruvate formate lyase on Contig 126 - EC
2.3.1.54. 1 .. 2023bp
[00155] SEQ ID NO:23 is an ORF encoding A. succinogenes
acetaldehyde dehydrogenase on Contig 135. (EC 1.2.1.10)
Acetyl-CoA E--> Acetaldehyde (>SPTR top hit: 'Q65QG3 EutG
protein. Mannheimia suc - 211: 2835).
[00156] SEQ ID NO:24 is an ORF encoding A. succinogenes
alcohol dehydrogenase on contig 164 (E.C. 1.1.1.1) (>SPTR
top hit: 'Q8DWE2 Putative alcohol dehydrogenase - 4399:
5517).
[00157] SEQ ID NO:25 is an ORF encoding A. succinogenes
acylphosphatase on Contig 64 (EC 3.6.1.7) (>SPTR top hit:
'Q9CNN1 Hypothetical protein PM0396. - 3935: 4207).
[00158] SEQ ID NO:26 is an ORF encoding A. succinogenes
aldehyde dehydrogenase on Contig 83 EC 1.2.1.3 (>SPTR top
hit: 'Q65SA2 PutA protein. Mannheimia suc - 1656: 1886).
[00159] SEQ ID NO:27 is an ORF encoding A. succinogenes
aldehyde dehydrogenase on Contig 83 (>SPTR top hit: 'Q65SA2
PutA protein. Mannheimia suc - 1883: 3139).
[00160] SEQ ID NO:28 is ORF encoding A. succinogenes
acetate kinase on Contig 93 from 1070: 3. About 350 amino
acids out of the 420 expected are present (EC 2.7.2.1).
[00161] An ORF encoding phosphate acetyl-transferase
cannot currently be located but it is believed to be present
based on similarity to closely related genomes and acetate
-46-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
production by A. succinogenes
[00162] ORFs encoding A. succinogenes oxaloacetate
decarboxylase on Contig 169: EC 4.1.1.3. SEQ ID NO:29 is
oadG (>SPTR top hit: 'Q65WL3 OadG protein. Mannheimia suc
- 74868: 75137). SEQ ID NO:30 is oadA (>SPTR top hit:
'Q65WL4 OadA protein. Mannheimia suc - 75157: 76965). SEQ
ID NO:31 is oadB (>PRIAM: Oxaloacetate decarboxylase. -
76976: 78283).
EMP genes
[00163] SEQ ID NO:32 is ORF encoding A. succinogenes
phosphoglucoisomerase (EC 5.3.1.9) on contig 135 from 14164
- 15858
[00164] SEQ ID NO:33 is ORF encoding A. succinogenes 6-
phosphofructokinase (EC 2.7.1.11) on contig 163 from 33518 -
34483
[00165] SEQ ID NO:34 is ORF encoding A. succinogenes
triosephosphate isomerase (EC 5.3.1.1) on contig 154 from
16095 - 15022
[00166] SEQ ID NO:35 is ORF encoding A. succinogenes
triosephosphate isomerase (EC 5.3.1.1) on contig 154 from
40514 - 41299
[00167] SEQ ID NO:36 is ORF encoding A. succinogenes
triosephosphate isomerase (EC 5.3.1.1) on contig 163 from
42329 - 43099
[00168] SEQ ID NO:37 is ORF encoding A. succinogenes
fructose-1, 6-bisphosphatase (EC 3.1.3.11) (gluconeogenic)
on contig 74 from 2747 - 3760
[00169] SEQ ID NO:38 is two ORFs encoding the N-terminus
of A. succinogenes fructose 1,6-bisphosphate aldolase on
contig 138 from 376 - 1 Note: the complete sequence is not
-47-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
known as the ORF extends beyond the contig. The sequence was
divided into 2 ORFs due to low sequence quality causing a
frame shift. (Fructose uptake path)
[00170] SEQ ID NO:39 is ORF encoding A. succinogenes
glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12) on
contig 127 from 13295 - 12330. Note: an estimated 60 bases
coding for about 20 amino acids is missing as the 5'-end of
this ORF extends beyond the edge of the contig.
[00171] SEQ ID NO:40 is ORF encoding A. succinogenes 3-
phosphoglycerate kinase (EC 2.7.2.3) on contig 138 from 1655
- 480
[00172] SEQ ID NO:41 is ORF encoding A. succinogenes
phosphoglycerate mutase (EC 5.4.2.1) on contig 133 from 4053
- 3370
[00173] SEQ ID NO:42 is ORF encoding A. succinogenes
phosphoglycerate mutase (EC 5.4.2.1) on contig 162 from
48008 - 48652
[00174] SEQ ID NO:43 is ORF encoding A. succinogenes
enolase (EC 4.2.1.11) on contig 157 from 33951 - 33061
Note: this is only the C-terminus of the enolase. The region
coding the N-terminus extends beyond the edge of the contig.
PPP genes
[00175] SEQ ID NO:44 is ORF encoding A. succinogenes
glucose-6-phosphate dehydrogenase (EC 1.1.1.49) on contig
146 from 10225 - 8738
[00176] SEQ ID NO:45 is ORF encoding A. succinogenes 6-
phosphogluconate dehydrogenase (EC 1.1.1.44) on contig 115
from 5548- 4094
[00177] SEQ ID NO:46 is ORF encoding A. succinogenes 6-
phosphogluconolactonase (EC 3.1.1.31) on contig 115 from
-48-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
8607 - 7906
[00178] SEQ ID NO:47 is ORF encoding A. succinogenes 6-
phosphogluconate dehydrogenase (EC 1.1.1.44) on contig 141
from 5548 - 4094
[00179] An ORF encoding A. succinogenes encoding ribulose-
phosphate 3-epimerase (EC 5.1.3.1) was not found on any
contigs but will likely be found in the complete genome
sequence. Closely related Pasteurellaceae have this gene.
[00180] SEQ ID NO:48 is ORF encoding A. succinogenes
ribose-5-phosphate isomerase (EC 5.3.1.6) on contig 154 from
20162 - 19710
[00181] SEQ ID NO:49 is ORF encoding A. succinogenes
encoding ribose 5-phosphate isomerase (EC 5.3.1.6) on contig
154 from 37092 - 36643
[00182] SEQ ID NO:50 is ORF encoding A. succinogenes
encoding ribose 5-phosphate isomerase (EC 5.3.1.6) on contig
56 from 2978 - 2337
[00183] SEQ ID NO:51 is ORF encoding A. succinogenes
encoding ribose 5-phosphate isomerase (EC 5.3.1.6) on contig
168 from 64945 - 64286
[00184] SEQ ID NO:52 is ORF encoding A. succinogenes
transketolase N-terminal subunit (EC 2.2.1.1) on contig 159
from 37734 - 36904
[00185] SEQ ID NO:53 is ORF encoding A. succinogenes
transketolase C-terminal subunit (EC 2.2.1.1) on contig 159
from 36911 - 35976
[00186] SEQ ID NO:54 is ORF encoding A. succinogenes
transketolase (EC 2.2.1.1) on contig 86 from 2744 - 738
[00187] SEQ ID NO:55 is ORF encoding A. succinogenes
transaldolase (EC 2.2.1.2) on contig 105 from 6033 - 5368
[00188] SEQ ID NO:56 is ORF encoding A. succinogenes
-49-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
transaldolase (EC 2.2.1.2) on contig 135 from 12149 - 13102
(iii) Substrate uptake genes
(a) arabinose
[00189] SEQ ID NO:57 is ORF encoding A. succinogenes
arabinose transporter periplasmic protein on contig 155 from
6574 - 7389
[00190] SEQ ID NO:58 is ORF encoding A. succinogenes
arabinose transporter ATP-binding protein on contig 155 from
7413 - 8948
[00191] SEQ ID NO:59 is ORF encoding A. succinogenes ABC-
type arabinose transport system permease component on
contig 155 from 8964 - 9932
[00192] SEQ ID NO:60 is ORF encoding A. succinogenes L-
arabinose isomerase (EC 5.3.1.4) on contig 155 from 12637 -
14124
[00193] SEQ ID NO:61 is ORF encoding A. succinogenes L-
xylulokinase (EC 2.7.1.53) on contig 117 from 3876 - 2419
[00194] SEQ ID NO:62 is ORF encoding A. succinogenes L-
xylulokinase (EC 2.7.1.53) on contig 106 from 2250 - 3704
[00195] SEQ ID NO:63 is ORF encoding A. succinogenes
ribulose-5-phosphate-4-epimerase (EC 5.1.3.4) on contig 115
from 2782 - 3474
(b) Xylose
[00196] SEQ ID NO:64 is ORF encoding A. succinogenes
xylose isomerase (EC 5.3.1.5) on contig 155 from 21265 -
22578
[00197] SEQ ID NO:65 is ORF encoding A. succinogenes D-
xylulokinase (EC 2.7.1.17) or L-ribulose kinase (EC 2.7.1.
16) on contig 165 from 43481 - 41883
-50-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[00198] SEQ ID N0:66 is ORF encoding A. succinogenes D-
xylulokinase (EC 2.7.1.17) on contig 155 from 22646 - 24091
[00199] SEQ ID N0:67 is ORF encoding A. succinogenes D-
xylulokinase (EC 2.7.1.17) on contig 155 from 11012 - 12616
[00200] SEQ ID NO:68 is ORF encoding A. succinogenes ABC-
type xylose or ribose transporter ATP-binding protein on
contig 155 from 40497 - 38974
[00201] SEQ ID N0:69 is ORF encoding A. succinogenes ABC-
type xylose transporter periplasmic protein on contig 155
from 21013 - 20015
[00202] SEQ ID NO:70 is ORF encoding A. succinogenes ABC-
type xylose transport system permease component on contig
155 from 18411 -17284
[00203] SEQ ID NO:71 is ORF encoding A. succinogenes ABC-
type xylose transport system ATP-binding component on contig
155 from 19929 - 18415
[00204] SEQ ID NO:72 is ORF encoding A. succinogenes
xylose operon repressor protein on contig 165 from 44518 -
45636
(c) Glucose
[00205] SEQ ID NO:73 is ORF encoding A. succinogenes
glucokinase transcriptional regulator (EC 2.7.1.2) on contig
99 from 4340 - 3426
[00206] SEQ ID NO:74 is ORF encoding A. succinogenes
glucose specific PTS protein IIA on contig 153 from 411 -
13
[00207] SEQ ID NO:75 is ORF encoding A. succinogenes
glucose or beta-glucoside specific PTS protein IIC on
contig 153 from 27639 - 29498
[00208] SEQ ID NO:76 is ORF encoding A. succinogenes
-51-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
glucose or beta-glucoside specific PTS protein IIA on
contig 165 from 40420 - 39968
(d) Fructose
[00209] SEQ ID NO:77 is ORF encoding A. succinogenes
fructose specific PTS protein IIC on contig 106 from 5534 -
3858
[00210] SEQ ID NO:78 is ORF encoding A. succinogenes
mannitol/ fructose specific PTS protein (IIA) on contig 106
from 7985 - 6483
[00211] SEQ ID NO:79 is ORF encoding A. succinogenes
fructose or mannose specific PTS protein IIC on contig 135
from 9001 - 7952
[00212] SEQ ID NO:80 is ORF encoding A. succinogenes
fructose specific PTS protein IIB on contig 135 from 9331 -
9014
[00213] SEQ ID NO:81 is ORF encoding A. succinogenes
mannitol/fructose specific PTS protein IIA on contig 135
from 9799 - 9353
[00214] SEQ ID NO:82 is ORF encoding A. succinogenes 1-
phosphofructokinase (EC 2.7.1.56) on contig 106 from 6480 -
5539
[00215] SEQ ID NO:83 is ORF encoding A. succinogenes 1-
phosphofructokinase (EC 2.7.1.56) on contig 54 from 6480 -
5539
[00216] SEQ ID NO:84 is ORF encoding A. succinogenes
fructokinase on contig 168 from 10269 - 11198
(e) General
[00217] SEQ ID NO:85 is ORF encoding A. succinogenes
phosphoenolpyruvate phosphotransferase system enzyme I(EI)
-52-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
on contig 153 from 2202 - 475
[00218] SEQ ID NO:86 is ORF encoding A. succinogenes
phosphotransferase system, HPr-related protein on contig 153
from 2565 -2308.
[00219] SEQ ID NO:87 is ORF encoding A. succinogenes
proton/sugar symport protein on contig 165 from 41787 -
40432
(f) Sucrose
[00220] SEQ ID NO:88 is ORF encoding A. succinogenes
sucrose invertase on contig 168 from 11272 - 12720
(g) Sugar efflux
[00221] SEQ ID NO:89 is ORF encoding A. succinogenes
potential major facilitator superfamily sugar permease on
contig 145 from 25395 - 26780
[00222] SEQ ID NO:90 is ORF encoding A. succinogenes major
facilitator superfamily sugar permease on contig 123 from
16827 - 15997
(iv) Dicarboxylate transporters
[00223] SEQ ID NO:91 is ORF encoding A. succinogenes TRAP
C4-dicarboxylate transport (Dct) system protein on contig
154 from 18087 - 16792
[00224] SEQ ID NO:92 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system large subunit on
contig 159 from 20342 - 19050
[00225] SEQ ID NO:93 is ORF encoding A. succinogenes TRAP-
type C4-dicarboxylate transport system small permease
component on contig 117 from 7334 - 6057
[00226] SEQ ID NO:94 is ORF encoding A. succinogenes TRAP-
-53-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
type C4-dicarboxylate transport system large protein
component on contig 122 from 13540 - 12269
[00227] SEQ ID NO:95 is ORF encoding A. succinogenes TRAP-
type C4-dicarboxylate transport system periplasmic component
(dicarboxylate-binding protein) on contig 148 from 27696 -
26689
[00228] SEQ ID NO:96 is ORF encoding A. succinogenes TRAP-
type C4-dicarboxylate transport system periplasmic component
(dicarboxylate-binding protein) on contig 159 from 21876 -
20890
[00229] SEQ ID NO:97 is ORF encoding A. succinogenes TRAP-
type C4-dicarboxylate transport system small permease
component on contig 122 from 14033 - 13551
[00230] SEQ ID NO:98 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system small permease
component on contig 159 from 20836 - 20345
[00231] SEQ ID NO:99 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system small permease
component on contig 154 from 18563 - 18087
[00232] SEQ ID NO:100 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system small permease
component on contig 148 from 26666 - 26157
[00233] SEQ ID NO:101 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system small permease
component on contig 148 from 12484 - 12975
[00234] SEQ ID NO:102 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system small permease
component on contig 117 from 7813 - 7331
[00235] SEQ ID NO:103 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system periplasmic
component (dicarboxylate-binding protein) on contig 154 from
-54-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
19646 - 18669
[00236] SEQ ID NO:104 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system periplasmic
component (dicarboxylate-binding protein) on contig 148 from
12245 - 11259
[00237] SEQ ID NO:105 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system periplasmic
component (dicarboxylate-binding protein) on contig 122 from
15018 - 14053
[00238] SEQ ID NO:106 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system periplasmic
component on contig 117 from 5984 - 4998
[00239] SEQ ID NO:107 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system periplasmic
component on contig 117 from 4938 -3949
[00240] SEQ ID NO:108 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system integral
membrane component on contig 77 from 4284 - 3718 NOTE: N-
terminus coding region was missing since the coding region
extended beyond the edge of the contig.
[00241] SEQ ID NO:109 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system integral
membrane component on contig 148 from 26147 - 24867 -
[00242] SEQ ID NO:110 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system integral
membrane component on contig 148 from 12987 - 14288
[00243] SEQ ID NO:111 is ORF encoding A. succinogenes
TRAP-type C4-dicarboxylate transport system component on
contig 154 from 18563 - 18087
(v) Glycine synthesis
-55-
CA 02618694 2008-02-05
WO 2007/019301 PCT/US2006/030425
[00244] SEQ ID NO:112 is ORF encoding A. succinogenes
serine deaminase or threonine ammonia-lyase (EC 4.3.1.19),
on contig 141 from 10270 - 11808.
[00245] SEQ ID NO:113 is ORF encoding A. succinogenes
glycine hydroxymethyltransferase (EC 2.1.2.1) on contig 137
from 2950 - 1682.
Entner-Doudoroff pathway genes:
[00246] SEQ ID NO:114 is ORF encoding A. succinogenes 2-
keto-3-deoxy-6-phosphogluconate aldolase (EC 4.2.1.14) on
contig 148 from 19472 - 18834.
[00247] SEQ ID N0:115 is ORF encoding A. succinogenes 2-
keto-3-deoxy-6-phosphogluconate aldolase (EC 4.1.2.14) on
contig 159 from 15090 - 14452.
Transhydrogenases:
[00248] SEQ ID NO:116 is ORF encoding A. succinogenes
NAD/NADP transhydrogenase alpha subunit on contig 152 from
24659 - 26191.
[00249] SEQ ID NO:117 is ORF encoding A. succinogenes
NAD/NADP transhydrogenase beta subunit on contig 152 from
26203 - 27654.
[00250] SEQ ID NO:118 is ORF encoding A. succinogenes NADH
dehydrogenase on contig 107 from 11481 - 10150.
[00251] While the present invention is described herein
with. reference to illustrated embodiments, it should be
understood that the invention is not limited hereto. Those
having ordinary skill in the art and access to the teachings
herein will recognize additional modifications and
embodiments within the scope thereof. Therefore, the
present invention is limited only by the Claims attached
herein.
-56-
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME DE _2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME OF
NOTE: For additional volumes please contact the Canadian Patent Office.
