Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
COMPOSITIONS AND METHODS FOR TREATING PATHOLOGIC
ANGIOGENESIS AND VASCULAR PERMEABILITY
BACKGROUND OF THE INVENTION
Though the formation of the vertebrate vasculature of any organ system is a
complex
process that is orchestrated by a constellation of growth factors and guidance
cues (Jain et al.,
2003), recent studies have increased our understanding of the signaling
cascades that regulate
angiogenesis. For example, it is increasingly clear that molecular programs,
which direct
trajectory of axons and the formation of the neural network, have important
roles in
generating the highly stereotypical pattern of the mature vascular network
(Carmeliet et al.,
2005; Urness et al., 2004; and Jones et al., 2007).
During the initial phase of vascular development in mammals, which is referred
to as
vasculogenesis, endothelial cells differentiate, migrate and coalesce to form
the central axial
vessels, the dorsal aortae and cardinal veins. The second phase, called
angiogenesis, is
characterized by the sprouting of new vessels from the nascent plexus to form
a mature
circulatory system. VEGF (or VPF) is critical for both of these first two
phases: the
differentiation and survival of endothelial cells during vasculogenesis as
well as proliferation
and permeability during angiogenesis. Following this angiogenic remodeling,
the
endothelium secretes platelet-derived growth factor (PDGF), which induces the
recruitment
and differentiation of vascular smooth muscle cells. Subsequently, the
vascular smooth
muscle cells secrete angiopoietins, which ensure proper interaction between
endothelial and
vascular smooth muscle cells. Finally, the vascular smooth muscle cells
deposit matrix
proteins, such as elastin, that inhibit vascular smooth muscle cell
proliferation and
differentiation, thereby stabilizing the mature vessel. Thus, to establish and
maintain a
mature vascular network, the endothelial and smooth muscle compartments of a
vessel must
interact via autocrine and paracrine signaling. The gaps between endothelial
cells (cell
junctions) forming the vascular endothelium are strictly regulated depending
on the type and
physiological state of the tissue. For example, in a mature vascular bed,
endothelial cells do
not behave independently of one another; rather, they form a monolayer that
prevents the
movement of protein, flud and cells from the endothelial lumen into the
surrounding tissue.
Even after development, the vascular system is continually exposed to events,
conditions or pathogens that cause injury, ischemia, and inflammation, which
typically result
in the release of cytokines and angiogenic factors, such as vascular
endothelial growth factor
-1-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
(VEGF). Initially, VEGF was described, purified and cloned as vascular
permeability factor
(VPF), based on its ability to induce blood vessels to leak. VEGF destabilizes
endothelial
cell-cell junctions, leading to endothelial permeability, stimulates
endothelial proliferation
and migration, and promotes vascular sprouting and edema. These functions
serve to
deconstruct a stable vascular network producing leaky new blood vessels. In
many contexts,
the release of cytokines and angiogenic factors in response to injury,
ischemia and
inflammation is desirable, in that such a response leads initiates a
restorative or healing
processes. However, excessive angiogenesis and vascular leak (e.g.,
endothelial
hyperpermeability) underscore the pathologies of several diseases and
pathologic conditions.
For example, in the developed world, pathologic angiogenesis and endothelial
hyperpermeability in the retinal or choroidal vascular beds are the most
common causes of
catastrophic vision loss. New and dysfunctional blood vessels leak, bleed or
stimulate
fibrosis that in turn precipitates edema, hemorrhage, or retinal detachment
compromising
vision. The major diseases sharing this pathogenesis include proliferative
diabetic
retinopathy (DR), non-proliferative diabetic macular edema (DME), and age-
related macular
degeneration (AMD) (Dorrell et al., 2007; Afzal et al., 2007). Approximately
15 million
Americans over the age of 65 suffer from AMD, and 10% of these patients will
experience
visual loss as a result of choroidal neovascularization. Further, more than 16
million
Americans are diabetic, and over 400,000 new patients suffer from retinal
edema or
neovascularization. Given that the current number of 200 million diabetics
worldwide is
likely to double in the next 20 years, and that over 8% of such patients
suffer from
microvascular complications, the number of patients that will experience
vision loss from
diabetic eye disease is unfortunately set to increase rapidly. Though less
prevalent than DR,
DME and AMD, retinopathy of prematurity (ROP) and ischemic retinal vein
occlusion
(IRVO) are also associated with pathologic angiogenesis and endothelial
hyperpermeability
in the retinal or choroidal vascular beds and lack effective treatment.
In addition to diseases of the eye, pathologic angiogenesis is also associated
with
tumor formation and growth. Tumor angiogenesis is the proliferation of a
network of blood
vessels that penetrates into cancerous growths, supplying nutrients and oxygen
and removing
waste products. With angiogenesis tumor growth proceeds, without it, growth is
slowed or
stops entirely. Tumor angiogenesis typically starts with cancerous tumor cells
releasing
molecules that send signals to surrounding normal host tissue, which activates
production of
-2-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
proteins that encourage growth of new blood vessels. Angiogenesis is regulated
by both
activator and inhibitor molecules. Under normal conditions, the inhibitors
predominate,
blocking growth. However, during tumor formation and growth, tumor cells
release
angiogenesis activators, causing such activators to increase in
number/concentration. Such
an increase in angiogenesis activators results in the growth and division of
vascular
endothelial cells and, ultimately, the formation of new blood vessels.
Several different proteins, as well as several smaller molecules, have been
identified
as "angiogenic." Among these molecules, two proteins appear to be the most
important for
sustaining tumor growth: vascular endothelial growth factor (VEGF) and basic
fibroblast
growth factor (bFGF). VEGF and bFGF are produced by many kinds of cancer cells
and by
certain types of normal cells. VEGF and bFGF are first synthesized inside
tumor cells and
then secreted into the surrounding tissue. When they encounter endothelial
cells, they bind to
specific proteins, called receptors, sitting on the outer surface of the
cells. The binding of
either VEGF or bFGF to its appropriate receptor activates a series of relay
proteins that
transmits a signal into the nucleus of the endothelial cells. The nuclear
signal ultimately
prompts a group of genes to make products needed for new endothelial cell
growth. The
activation of endothelial cells by VEGF or bFGF sets in motion a series of
steps toward the
creation of new blood vessels. First, the activated endothelial cells produce
matrix
metalloproteinases (MMPs), a special class of degradative enzymes. These
enzymes are then
released from the endothelial cells into the surrounding tissue. The MMPs
break down the
extracellular matrix--support material that fills the spaces between cells and
is made of
proteins and polysaccharides. Breakdown of this matrix permits the migration
of endothelial
cells. As they migrate into the surrounding tissues, activated endothelial
cells begin to divide
and organize into hollow tubes that evolve gradually into a mature network of
blood vessels.
Additional diseases and disorders characterized by undesirable vascular
permeability
include, for example, edema associated with brain tumors, ascites associated
with
malignancies, Meigs' syndrome, lung inflammation, nephrotic syndrome,
pericardial effusion,
pleural effusion, acute lung injury, inflammatory bowel disease,
ischemia/reperfusion injury
in stroke, myocardial infaretion, and infectious and non-infectious diseases
that result in a
cytokine storm. Though a cytokine storm is the systemic expression of a
healthy and
vigorous immune system, it is an exaggerated immune response caused by rapidly
proliferating and highly activated T-cells or natural killer (NK) cells and
results in the release
-3-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
of more than 150 inflammatory mediators (cytokines, oxygen free radicals, and
coagulation
factors). Both pro-inflammatory cytokines (such as Tumor Necrosis Factor-
alpha,
InterLeukin-1, and InterLeukin-6) and anti-inflammatory cytokines (such as
interleukin 10,
and interleukin 1 receptor antagonist) are elevated in the serum, and it is
the fierce and often
lethal interplay of these cytokines is referred to as a "cytokine storm."
Cytokine storms can occur in a number of infectious and non-infectious
diseases
including, for example, graft versus host disease (GVHD), adult respiratory
distress
syndrome (ARDS), sepsis, avian influenza, smallpox, and systemmic inflammatory
response
syndrome (SIRS). In the absence of prompt intervention, a cytokine storm can
result in
permanent lung damage and, in many cases, death. Many patients will develop
ARDS, which
is characterized by pulmonary edema that is not associated with voume overload
or depressed
left ventricular function. The end stage symptoms of a disease precipitating
the cytokine
storm may include one or more of the following: hypotension; tachycardia;
dyspnea; fever;
ischemia or insufficient tissue perfusion; uncontrollable hemorrhage; severe
metabolism
dysregulation; and multisystem organ failure. Deaths from infections that
precipitate a
cytokine storm are often attributable to the symptoms resulting from the
cytokine storm and
are, therefore, not directly caused by the relevant pathogen. For example,
deaths in severe
influenza infections, such as by avian influenza or "bird flu," are typically
the result of
ARDS, which results from a cytokine storm triggered by the viral infection.
Because of its involvement in angiogenesis and vascular permeability, much
attention
has been focused on vascular endothelial growth factor (VEGF). Nevertheless,
as VEGF is
only one of many angiogenic, permeability and inflammatory factors that
contribute to
angiogenesis and vascular permeability, there is continued value in
identifying pathways and
developing methods that affect VEGF functionality as well as the functionality
of other
angiogenic, permeability, or inflammatory factors.
SUMMARY
A signaling pathway whereby Robo4 signaling can inhibit protrusive events
involved
in cell migration, stabilize endothelial cell-cell junctions, and block
pathological angiogenesis
is described herein. As is shown herein, expression of Robo4 confers
responsiveness to Slit2,
and Slit2-Robo4 signaling negatively regulates cellular protrusive activity
stimulated by cell
adhesion. Such negative regulation is mediated by interaction of Robo4 with
the adaptor
protein, paxillin, and its paralogues, which recruits ARF-GAPs such as GIT 1,
leading to local
-4-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
inactivation of Adp ribosylation factor 6 (ARF6). This signaling pathway
thereby interferes
with adhesion-mediated Rac 1 activation and cell protrusion.
As is further described herein, modulation of ARF GTPase activating proteins
("ARF-
GAP" in the singular or "ARF-GAPs" in the plural) and ARF GTP exchange factors
("ARF-
GEF" in the singular or "ARF-GEFs" in the plural) can be accomplished without
Robo4
signaling, and such modulation can be used to inhibit cellular protrusive
activity, vascular
leak, endothelial permeability, and/or pathologic angiogenesis. Therefore,
multiple targets
for modulation of signaling pathways that contribute to inhibition of cellular
protrusive
activity, vascular leak, endothelial permeability, and/or pathologic
angiogenesis are provided
herein, including, for example, multiple targets defined within in the
presently described
Slit2-Robo4 signaling pathway.
Compounds, compositions and methods for inhibiting vascular permeability and
pathologic angiogenesis by modulating the singnaling pathway delineated herein
are also
described. Moreover, methods for producing and screening compounds and
compositions
capable of modulating the signaling pathway described herein, inhibiting
vascular
permeability, and inhibiting pathologic angiogenesis are also provided.
BRIEF DESCRIPTION OF THE DRAWINGS
The accompanying drawings, which are incorporated in and constitute a part of
this
specification, illustrate several embodiments of the disclosed method and
compositions and
together with the description, serve to explain the principles of the
disclosed method and
compositions. As it is used herein, the term "Mock" indicates a sham
preparation that does
not include an active Slit protein.
FIG. 1 shows Robo4-mediated vascular guidance requires the cytoplasmic tail of
the
receptor. Shown is the results of confocal microscopy of 48 hpf TG(fli:
egfp)yl embryos (A)
un-injected, (B) injected with robo4 morpholino, (C) robo4 morpholino and wild-
type murine
robo4 RNA, and (D) robo4 morpholino and robo44tai1 RNA. Quantification is
shown in
FIG. 7. FIG. 1 E shows model of defective vascular guidance in robo4 morphant
embryos.
5X and 20X images are shown in the left and right panels, respectively. DLAV =
dorsal
longitudinal anastomosing vessel. PAV = parachordal vessel. DA = dorsal aorta.
PCV =
posterior cardinal vein.
FIG. 2 shows Robo4-dependent inhibition of haptotaxis requires the
aminoterminal
half of the cytoplasmic tail. FIG. 2A shows schematic representation of cDNA
constructs
-5-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
used in the haptotaxis migration assays. TM represents the transmembrane
domain. CCO and
CC2 are conserved cytoplasmic signaling motifs found in Robo family members.
HA =
hemagglutinin epitope. FIG. 2B and FIG. 2C show HEK 293 cells were co-
transfected with
GFP and the indicated constructs and 36 hours later subjected to haptotaxis
migration on
membranes coated with 5 g/ml fibronectin and either Mock preparation or Slit2.
Expression
of Robo4 constructs was verified by Western blotting (Inset). Results are
presented as the
mean SE.
FIG. 3 shows Robo4 interacts with Hic-5 and paxillin in HEK 293 cells. FIG. 3A
shows HEK 293 cells were co-transfected with the Robo4 cytoplasmic tail-HA and
Hic-5-V5,
or empty vector (pcDNA3) and Hic-5-V5. Robo4 was immunoprecipitated with HA
antibodies and Hic-5 was detected by western blotting with V5 antibodies. FIG.
3B shows
total cell lysates from Cho-Kl, HEK 293 and NIH 3T3 cells were probed with
antibodies to
Hic-5 and paxillin. FIG. 3C shows HEK 293 cells were co-transfected with
paxillin-V5 and
Robo4 cytoplasmic tail-HA or empty vector (pcDNA3). Robo4 was
immunoprecipitated
from cell lysates with HA antibodies and paxillin was detected by western
blotting with V5
antibodies. FIG. 3D shows HEK 293 cells were transfected with full length
Robo4-HA and
paxillin-V5, and stimulated with Slit2 for 5 minutes. Robo4 was
immunoprecipitated from
cell lysates with HA antibodies and paxillin was detected by western blotting
with V5
antibodies.
FIG. 4 shows paxillin interacts with Robo4 through a novel motif that is
required for
Robo4-dependent inhibition of haptotaxis. FIG. 4A shows schematic
representation of GST-
Robo4 fusion proteins used in pull down assays shown in panel B. FIG. 4B shows
GST-
Robo4 fusion proteins were purified form E. coli and incubated with
recombinant purified
paxillin. Paxillin was detected by western blotting with paxillin-specific
monoclonal
antibodies. FIG. 4C shows schematic representation of GST-Robo4 fusion
proteins used in
pull down assays described in panel D. FIG. 4D shows GST-Robo4 fusion proteins
were
purified form E. coli and incubated with recombinant purified paxillin.
Paxillin was detected
by western blotting with paxillin-specific monoclonal antibodies. FIG. 4E
shows GST-
Robo4 wild-type or GST-Robo4APIM were purified from E. coli and incubated with
recombinant purified paxillin or in vitro transcribedltranslated Mena-V5.
Paxillin and Mena
were detected with paxillin-specific monoclonal antibodies and V5 antibodies,
respectively.
FIG. 4F shows HEK 293 cells were transfected with GFP and the indicated
constructs and 36
-6-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
hours later subjected to haptotaxis migration on membranes coated with 5 g/ml
fibronectin
and either Mock preparation or Slit2. Expression of Robo4 constructs was
verified by
western blotting (Inset). Results are presented as the mean SE.
FIG. 5 shows Robo4 suppresses cell spreading through inactivation of Rac. FIG.
5A,
FIG. 5D, and FIG. 5G show HEK 293 cells were transfected with GFP and the
indicated
constructs and 36 hours later subjected to cell spreading assays on coverslips
coated with
g/ml fibronectin and either Mock preparation or Slit2. Results are presented
as the
mean SE. FIG. 5B and FIG. 5E show HEK 293 cells were transfected with the
indicated
constructs and 36 hours later plated onto dishes coated with 5 g/ml
fibronectin and either
Mock preparation or Slit2. Following a 5-minute incubation, cells were lysed
and GTP-Rac
was precipitated with GST-PBD. Rac was detected by western blotting with a
Racspecific
monoclonal antibody. FIG. 5H shows HUVEC were incubated for 60 minutes with
Slit2,
stimulated with 25 ng/ml VEGF for 5 minutes, lysed and GTP-Rac was
precipitated with
GST-PBD. Rac was detected by western blotting with a Rac-specific monoclonal
antibody.
Slit2-dependent inhibition of (C) and (F) adhesion induced- and (I) VEGF-
induced Rac
activation was quantified by densitometry. Results are presented as mean SE.
FIG. 6 shows a paxillinALim4 mutant does not interact with Robo4, or support
Slit2-
Robo4-mediated inhibition of cell spreading. FIG. 6A shows a schematic
representation of
paxillin constructs used in panels B, C and D. FIG. 6B shows HEK 293 cells
were co-
transfected with the Robo4 cytoplasmic tail-HA and paxillin-V5, or empty
vector (pcDNA3)
and paxillin-V5. Robo4 was immunoprecipitated from cell lysates with HA
antibodies, and
paxillin was detected by western blotting with V5 antibodies. FIG. 6C shows
HEK 293 cells
were co-transfected with the Robo4 cytoplasmic tail-HA and either wild-type
paxillin-V5 or
paxillinOLim4-V5. Robo4 was immunoprecipitated with HA antibodies, and
paxillin was
detected by western blotting with V5 antibodies. FIG. 6D shows Endogenous
paxillin was
knocked down in HEK 293 cells using siRNA and reconstituted with either wild-
type chicken
paxillin or chicken paxillinALim4. Knock down and reconstitution were
visualized by
western blotting with paxillin antibodies and quantified by densitometry.
Paxillin expression
was determined to be 35% of wild-type levels. FIG. 6E shows HEK 293 cells
subjected to
knock down/reconstitution were subjected to spreading assays on coverslips
coated with
5 g/ml fibronectin and either Mock preparation or Slit2. Results are presented
as the
mean SE.
-7-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
FIG. 7 shows the paxillin interaction motif is required for repulsive vascular
guidance.
FIG. 7A shows Quantification of vascular pattering defects in uninjected
(n=66), robo4
morpholino (n=56), robo4 morpholino and wild-type murine robo4 RNA (n=60),
robo4
morpholino and robo44tail RNA (n=17), and robo4 morpholino and robo44PIM RNA
(n=45) injected TG(fli:egfp)yl embryos. Representative images are shown in
FIG. 1. FIG.
7B shows a model of a Slit2-Robo4 signaling axis that inhibits cell migration,
spreading and
Rac activation.
FIG. 8 shows splice-blocking morpholinos suppress expression of robo4 in
zebrafish
embryos. FIG. 8A shows a schematic representation of the robo4 locus in Danio
rerio and
the encoded Robo4 protein. The exon targeted with the splice-blocking
morpholino is
indicated, as is the location of the primers used to amplify robo4 cDNA. FIG.
8B shows RNA
from uninjected embryos and embryos injected with robo4 spliceblocking
morpholinos was
isolated and used to reverse transcribe cDNA. The cDNA was then used to
amplify robo4
and the resulting fragments were separated by agarose gel electrophoresis and
visualized by
ethidium bromide staining.
FIG. 9 shows Hic-5 is a Robo4-interacting protein. FIG. 9A shows a schematic
representation of full-length Hic-5 and the cDNA clones recovered from the
yeast two-hybrid
screen. FIG. 9B shows S. cerevisiae strain PJ694-A was transformed with the
indicated
plasmids and plated to synthetic media lacking Leucine and Tryptophan, or
Leucine,
Tryptophan, Histidine and Alanine. Colonies capable of growing on nutrient
deficient media
were spotted onto the same media, replica plated, and either photographed or
used for the
beta-galactosidase assay.
FIG. 10 shows the paxillin interaction motif lies between CCO and CC2 in the
Robo4
cytoplasmic tail. Schematic representation of the murine Robo4 protein and
identification of
the amino acids comprising the paxillin interaction motif.
FIG. 11 shows the Robo4 cytoplasmic tail does not inhibit Cdc42 activation nor
interact with srGAP 1. FIG. 11A shows HEK 293 cells expressing Robo4 were
plated onto
bacterial Petri dishes coated with 5 g/ml fibronectin and either Mock
preparation or Slit2.
Following a 5-minute incubation, cells were lysed, and GTP-Cdc42 was
precipitated with
GST-PBD. Cdc42 was detected by western blotting with a Cdc42-specific
monoclonal
antibody. FIG. 11 B shows HEK 293 cells were transfected with the indicated
plasmids, and
-8-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Robo 1/Robo4 were immunoprecipitated with HA antibodies. srGAP 1 was detected
by
western blotting with Flag M2 antibodies.
FIG. 12 shows slit reduces retinopathy of prematurity, which is an FDA
standard for
factors that affect diabetic retinopathy, retinopathy of prematurity, and age
related macular
degeneration. FIG. 12A shows percent neovascularization of the retina in
wildtype mice
receiving Mock preparation compared to those receiving Slit protein. There was
a 63%
reduction in neovascularization in mice treated with Slit treated mice as
compared to
wildtype mice. N=6, P<0.003. FIG. 12B shows percent neovascularization of the
retina in
wildtype mice receiving Mock preparation compared to those receiving saline
control. N=5,
P<0.85. FIG. 12C shows percent neovascularization of the retina in knockout
mice compared
to slit. N=1.
FIG. 13 shows slit and netrin can reduce VEGF-induced dermal permeability.
FIG. 14 shows slit can reduce VEGF mediated retinal permeability.
FIG. 15 shows semaphorin like VEGF increases dermal permeability.
FIG. 16 shows that Robo4 blocks Rac-dependent protrusive activity through
inhibition of ARF6. CHO-Kl cells stably expressing allb or allb-Robo4
cytoplasmic tail
were plated on dishes coated with fibronectin or fibronectin and fibrinogen,
lysed and GTP-
ARF6 was precipitated with GST-GGA3. ARF6 was detected by western blotting
with an
ARF6-specific monoclonal antibody (See, FIG. 16A). CHO-K1 cells stably
expressing aIlb
or allb-Robo4 cytoplasmic tail were cotransfected with GFP and either an empty
vector or
the GIT1-PBS, and subjected to spreading assays on coverslips coated with
fibronectin or
fibronectin and fibrinogen. The area of GFP-positive cells was determined
using ImageJ,
with error bars indicating SEM (See, FIG. 16B). HEK 293 cells were co-
transfected with
GFP and the indicated constructs and 36 h later were subjected to spreading
assays on
fibronectin and either Mock preparation or a Slit2 protein (See, FIG. 16C). In
all panels,
error bars indicate mean SE. Expression of Robo4 and ARNO was verified by
western
blotting (data not shown). HEK 293 cells were co-transfected with GFP and the
indicated
constructs and 36 h later were plated on dishes coated with fibronectin and
either Mock
preparation or a Slit2 protein. GTP-Rac was precipitated with GST-PBD and Rac
was
detected with a Racl -specific monoclonal antibody (See, FIG. 16D).
FIG. 17 illustrates the results of immunoprecipitation reactions that
demonstrate the
Robo4 receptor binds to the Slit ligand. FIG. 17A shows the results of
immunoprecipitation
-9-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
of cell lysates from untransfected human embryonic kidney cells (HEK), HEK
cells
transfected with Slit tagged with a myc epitope (Slit-myc), HEK cells
transfected with Robo4
tagged with a HA epitope (Robo4-HA) and HEK cells transfected with a control
vector
(Control-HEK). Western blot analysis of the Slit-myc cell lysates serves as a
control and
demonstrates that the Slit protein has a mass of approximately 210 kD, as
previously reported
(lane 1). Slit-myc protein is also detected by Western blot with an anti-myc
antibody after
Slit-myc and Robo4-HA cell lysates were combined and immunoprecipitated with
an anti-
HA antibody (lane 6). The specificity of this interaction is confirmed by the
absence of
detectable Slit protein with all other combinations of lysates. The same
amount of lysate was
used in each experiment. The lower bands in lanes 2- 6 correspond to
immunoglobulin heavy
chains. FIG. 17B shows the results of immunoprecipitation of conditioned media
from
untransfected HEK cells (HEK CM), HEK cells transfected with Slit tagged with
a myc
epitope (Slit-myc CM), HEK cells transfected with the N-terminal soluble
ectodomain of
Robo4 tagged with the HA epitope (NRobo4-HA CM) and HEK cells transfected with
control vector (Control-HEK CM). The full-length Slit-myc protein (210 KD) and
its C-
terminal proteolytic fragment (70 KD) are detected in Slit-myc CM by an anti-
myc antibody
(lane 1). As in FIG. 17A, Slit-myc protein is also detected by Western blot
after Slit-myc and
Robo4-HA conditioned media are combined and immunoprecipitated with an anti-HA
antibody (lane 6). The specificity of this interaction is confirmed by the
absence of Slit
protein with all other combinations of conditioned media. As shown in FIG. 17C
- FIG. 17F,
Slit protein binds to the plasma membrane of cells expressing Robo4. Binding
of Slit-myc
protein was detected using an anti-myc antibody and an Alexa 594 conjugated
anti-mouse
antibody. Binding is detected on the surface of Robo4-HEK cells (FIG. 17F) but
not Control-
HEK cells (FIG. 17D).
FIG. 18 illustrates that Robo4 expression is endothelial-specific and stalk-
cell centric.
FIG. 18A illustrates retinal flatmounts prepared from P5 Robo4+IAP mice and
stained for
Endomucin (endothelial cells), NG2 (pericytes) and Alkaline Phosphatase (AP;
Robo4). The
top-most arrow pointing to the right in the upper left panel indicates a tip
cell, and the
remaining arrows indicate pericytes (NG2-positive). "T" also indicates tip
cells. FIG. 18B
illustrates retinal flatmounts prepared from adult Robo4+IAP mice and stained
for NG2
(pericytes) and AP (Robo4), with the arrows included in FIG. 18B indicating
pericytes (NG2-
positive). FIG. 18C shows the results of quantitative RT-PCR (qPCR) performed
on the
-10-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
indicated samples using primers specific for PECAM, Robo 1 and Robo4. As used
in FIG.
18C: "HAEC" represents Human Aortic Endothelial Cells; "HMVEC" represents
Human
Microvascular Endothelial Cells; and "HASMC" represents Human Aortic Smooth
Muscle
Cells. FIG. 18D illustrates the results of probing total cell lysates from
HMVEC and
HASMC with antibodies to Robo4, VE-Cadherin, Smooth Muscle Actin and ERK1/2.
FIG. 19 illustrates that Robo4 signaling inhibits VEGF-A-induced migration,
tube
formation, permeability and Src family kinase (SFK) activation. Lung
endothelial cells (ECs)
isolated from Robo4+l+ and Robo4`4Pl'4P mice were used in endothelial cell
migration (FIG.
19A), tube formation (FIG. 19B), in vitro permeability (FIG. 19C), Miles assay
(FIG. 19D)
and retinal permeability assay FIG. 19E). Human microvascular endothelial
cells were
stimulated with VEGF-A in the presence of a Mock preparation or a Slit2
protein for 5
minutes, lysed and subjected to western blotting with phospho-VEGFR2
antibodies FIG.
19F), western blotting with phospho-Src antibodies (FIG. 19G) and Rac
activation assays
(FIG. 19H). In all panels, * represents p<0.05, ** represents p<0.005, ***
represents
p<0.0005, NS indicates "not significant" and error bars represent SEM.
FIG. 20 illustrates that Robo4 signaling inhibits pathologic angiogenesis in
an animal
model of oxygen-induced retinopathy ("OIR") and in an animal model of
choroidal
neovascularization ("CNV"). Neonatal Robo4+1+ and Robo4AP1'4P mice were
subjected to
oxygen-induced retinopathy and perfused with fluorescein isothiocyanate (FITC)-
dextran
(green). Retinal flatmounts were prepared for each condition and analyzed by
fluorescence
microscopy. Arrows indicate areas of pathological angiogenesis (FIG. 20A
through FIG.
20D). Quantification of pathologic angiogenesis observed in FIG. 20A through
FIG. 20D is
provided in FIG. 20 E. In the CNV model, 2-3 month old Robo4+1+ and
Robo4API'4P mice
were subjected to laser-induced choroidal neovascularization. Choroidal
flatmounts were
prepared, stained with isolectin and analyzed by confocal microscopy FI( G.
20F through FIG.
201). Quantification of pathologic angiogenesis observed in FIG. 20F through
FIG. 201 is
provided in FIG. 20J. In all panels, * represents p<0.05, ** represents
p<0.005, ***
represents p<0.0005, NS indicates "not significant" and error bars represent
SEM.
FIG. 21 illustrates that Robo4 signaling inhibits bFGF-induced angiogenesis
and
thrombin-stimulated endothelial hyperpermeability. In carrying out the
experiments that
provided the results illustrated in FIG. 21A, murine lung endothelial cells
were subjected to
tube formation assays on matrigel in the presence of bFGF and Mock preparation
or a Slit2
-11-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
protein. In carrying out the experiments that provided the results illustrated
in FIG. 21 B,
murine lung endothelial cells were subjected to thrombin-induced permeability
assays on
fibronectin-coated Transwells.
FIG. 22 illustrates that Robo4 signaling reduces injury and inflammation in a
model
of acute lung injury. Mice were exposed to intratracheal LPS and treated with
either Slit
protein or a Mock preparation. The concentrations of inflammatory cells and
protein in
bronchoalveolar lavages (BAL) were significantly reduced by treatment with
Slit protein.
FIG. 23 illustrates different constructs for Slit proteins and shows that
recombinant
Slit peptides as small as Slit2-D1 (40kD) are active. In FIG. 23A, different
constructs for the
Slit protein are depicted. The four leucine rich domains (LRR), the epidermal
growth factor
homology region (EGF) and the c-terminal tags (MYC/HIS) are indicated.
Inhibition of
VEGF mediated endothelial cell migration by the different Slit constructs
(2nM) is shown in
FIG. 23B.
FIG. 24 shows the effect of administering a Slit2 protein on the survival of
mice
infected with Avian Flu Virus in accordance with a mouse model of avian flu.
FIG. 25 illustrates the genomic traits of knockout mice described in Example
14.
FIG. 26 illustrates that the Robo4 cytoplasmic tail suppresses fibronectin-
induced
protrusive activity. FIG. 26A is a schematic representation of cDNA constructs
used in the
migration and spreading assays. TM = transmembrane domain. CCO and CC2 are
conserved
cytoplasmic signaling motifs found in Robo family members. FIG. 26B, HEK 293
cells were
co-transfected with GFP and the indicated constructs and 36 h later subjected
to spreading
assays on coverslips coated with 5 g/ml fibronectin and either mock or Slit2.
The area of
GFP-positive cells was determined using ImageJ. Mock indicates a sham
preparation of
Slit2. Expression of Robo4 constructs was verified by Western blotting (data
not shown).
FIG. 26C, CHO-Kl cells stably expressing aIIb or alIb-Robo4 cytoplasmic tail
were
subjected to spreading assays on coverslips coated with fibronectin or
fibronectin and
fibrinogen. Cell area was determined using ImageJ.
FIG. 27 shows the results of an immunoprecipitation experiment, wherein CHO-Kl
cells were transfected with the indicated constructs and 36 h later plated
onto dishes coated
with 5 g/ml fibronectin or 5 g/m1 fibronectin/fibrinogen. Following a 5-min
incubation,
cells were lysed and GTP-Rac was precipitated with GST-PBD. Rac was detected
by western
blotting with a Rac-specific monoclonal antibody.
-12-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
FIG. 28 illustrates that Slit2 inhibits endothelial cell protrusion via GIT1.
FIG. 28A,
ECs were subjected to haptotaxis migration assays on membranes coated with 5
g/ml
fibronectin and either mock or Slit2. Cells on the underside of the filter
were enumerated and
migration on fibronectin/mock membranes was set at 100%. FIG. 28B, ECs were
subjected
to spreading assays on fibronectin and either mock or Slit2. Cell area was
determined using
ImageJ. FIG. 28C, ECs were plated on dishes coated with fibronectin and either
mock or
Slit2, lysed and GTP-ARF6 was precipitated with GST-GGA3. FIG. 28D, ECs were
plated
on dishes coated with VEGF-165 and either mock or Slit2, lysed and GTP-ARF6
was
precipitated with GST-GGA3. ARF6 was detected by western blotting with an ARF6-
specific monoclonal antibody. **p<0.005. Error bars indicate SEM. Mock
indicates a sham
preparation of Slit2.
FIG. 29 depicts a chemical structure for Secin-H3.
FIG. 30 illustrates that ARF6 inhibition prevents neovascular tuft formation
and
endothelial hyperpermeability. DMSO or Secin-H3 were injected into
contralateral eyes of
wild-type mice and subjected to oxygen-induced retinopathy, laser-induced
choroidal
neovascularization and VEGF-165-induced retinal hyperpermeability. In FIG.
30A, retinal
flatmounts were prepared from neonatal mice subjected to OIR, stained with
fluorescent
isolectin and analyzed by fluorescence microscopy. Top panels are low
magnification
images and bottom panels are high magnification images (pathologic neovascular
tufts are
indicated by yellow and white arrows, respectively). FIG. 30B depicts a
quantification of
pathologic neovascularization shown in FIG. 30A. In FIG. 30C, choroidal
flatmounts were
prepared from 2-3 month old mice subjected to laser-induced choroidal
neovascularization,
stained with fluorescent isolectin and analyzed by confocal microscopy. FIG.
30D shows a
quantification of pathologic angiogenesis observed in FIG. 30C. FIG. 30E is a
quantification
of retinal permeability following intravitreal injection of VEGF-165. Vehicle
is DMSO.
*p<0.05. Error bars indicate SEM.
FIG. 31 illustrates that the small molecule Secin-H3 inhibits VEGF induced
ARF6
GTP.
FIG. 32 illustrates that Secin-H3 inhibits VEGF induced migration of HMVECs.
FIG. 33 illustrates that Src kinase activation (phosphorylation) is not
dependent on
ARF6.
FIG. 34 illustrates that GIT1 RNAi increases VEGF induced HMVEC permeability.
-13-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
FIG. 35 is a schematic diagram of pathways described herein.
FIG. 36 illustrates that SecinH3 blocks Arf6 activation and inhibits
pathologic
angiogenesis and endothelial hyperpermeability in animal models of vascular
eye disease.
ECs were pre-treated with SecinH3 or DMSO and subjected to Arf6 activation
FIG. 36A) and
cell migration assays (FIG. 36B). SecinH3 or DMSO were injected into
contralateral eyes of
wild-type mice and subjected to oxygen-induced retinopathy (FIG. 36C), laser-
induced
choroidal neovascularization FIG. 36E) and VEGF-165-induced retinal
hyperpermeability
(FIG. 36G). Retinal flatmounts were prepared from neonatal mice subjected to
OIR (FIG. 36
C), stained with fluorescent isolectin and analyzed by fluorescence
microscopy. Top panels
are low magnification images and bottom panels are high magnification images
of area
outlined by white boxes that emphasize the pathologic neovascular tufts (FIG.
36D).
Quantification of pathologic neovascularization shown in FIG. 36C. Choroidal
flatmounts
were prepared from 2-3 month old mice subjected to laser-induced choroidal
neovascularization, stained with fluorescent isolectin and analyzed by
confocal microscopy
(FIG. 36 E). Quantification of pathologic angiogenesis observed in FIG. 36E
(FIG. 36F).
Quantification of retinal permeability following intravitreal injection of
VEGF-165 (FIG.
36G). Vehicle is DMSO. *p<0.05. Error bars indicate s.e.m.
FIG. 37 Provides images illustrating that Slit2 blocks recruitment of paxillin
to focal
adhesions and SIit2 recruits paxillin to the cell surface.
FIG. 38 Illustrates that Slit2 inhibits endothelial cell protrusion via
ArfGAPs.
Endothelial cells (ECs) were subjected to haptotaxis migration assays on
membranes coated
with 5 g/ml fibronectin and either mock or Slit2 FIG. 38A). Cells on the
underside of the
filter were enumerated and migration on fibronectin/mock membranes was set at
100%. ECs
were subjected to spreading assays on fibronectin and either mock or Slit2
(FIG. 38B). Cell
area was determined using ImageJ. ECs were plated on dishes coated with
fibronectin and
either mock or Slit2, lysed and GTP-Arf6 was precipitated with GST-GGA3 (FIG.
38C).
ECs were plated on dishes coated with VEGF-165 and either mock or Slit2, lysed
and GTP-
Arf6 was precipitated with GST-GGA3 (FIG. 38D). Arf6 was detected by western
blotting
with an Arf6-specific monoclonal antibody. Mock indicates a sham preparation
of
Slit2.**p<0.005. Error bars indicate s.e.m.
FIG. 39 Illustrates that Rho activation was unaltered by Slit2, but Cdc42
activation
was significantly reduced by Slit2.
-14-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
DETAILED DESCRIPTION OF THE INVENTION
Disclosed are materials, compositions, and components that can be used for,
can be
used in conjunction with, can be used in preparation for, or are products of
the disclosed
method and compositions. These and other materials are disclosed herein, and
it is
understood that when combinations, subsets, interactions, groups, etc. of
these materials are
disclosed that while specific reference of each various individual and
collective combinations
and permutation of these compounds may not be explicitly disclosed, each is
specifically
contemplated and described herein. For example, if a polypeptide is disclosed
and discussed
and a number of modifications that can be made to a number of molecules
including the
polypeptide are discussed, each and every combination and permutation of
polypeptide and
the modifications that are possible are specifically contemplated unless
specifically indicated
to the contrary. Thus, if a class of molecules A, B, and C are disclosed as
well as a class of
molecules D, E, and F and an example of a combination molecule, A-D is
disclosed, then
even if each is not individually recited, each is individually and
collectively contemplated.
Thus, is this example, each of the combinations A-E, A-F, B-D, B-E, B-F, C-D,
C-E, and C-F
are specifically contemplated and should be considered disclosed from
disclosure of A, B,
and C; D, E, and F; and the example combination A-D. Likewise, any subset or
combination
of these is also specifically contemplated and disclosed. Thus, for example,
the sub-group of
A-E, B-F, and C-E are specifically contemplated and should be considered
disclosed from
disclosure of A, B, and C; D, E, and F; and the example combination A-D. This
concept
applies to all aspects of this application including, but not limited to,
steps in methods of
making and using the disclosed compositions. Thus, if there are a variety of
additional steps
that can be performed it is understood that each of these additional steps can
be performed
with any specific embodiment or combination of embodiments of the disclosed
methods, and
that each such combination is specifically contemplated and should be
considered disclosed.
It is understood that the disclosed method and compositions are not limited to
the
particular methodology, protocols, and reagents described as these may vary.
It is also to be
understood that the terminology used herein is for the purpose of describing
particular
embodiments only, and is not intended to limit the scope of the present
invention which will
be limited only by the appended claims.
-15-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Unless defined otherwise, all technical and scientific terms used herein have
the
meanings that would be commonly understood by one of skill in the art in the
context of the
present specification.
It must be noted that as used herein and in the appended claims, the singular
forms
"a," "an," and "the" include plural reference unless the context clearly
dictates otherwise.
Thus, for example, reference to "a polypeptide" includes a plurality of such
polypeptides,
reference to "the polypeptide" is a reference to one or more polypeptides and
equivalents
thereof known to those skilled in the art, and so forth.
"Optional" or "optionally" means that the subsequently described event,
circumstance, or material may or may not occur or be present, and that the
description
includes instances where the event, circumstance, or material occurs or is
present and
instances where it does not occur or is not present.
Ranges can be expressed herein as from "about" one particular value, and/or to
"about" another particular value. When such a range is expressed, another
embodiment
includes from the one particular value and/or to the other particular value.
Similarly, when
values are expressed as approximations, by use of the antecedent "about," it
will be
understood that the particular value forms another embodiment. It will be
further understood
that the endpoints of each of the ranges are significant both in relation to
the other endpoint,
and independently of the other endpoint. It is also understood that there are
a number of
values disclosed herein, and that each value is also herein disclosed as
"about" that particular
value in addition to the value itself. For example, if the value "10" is
disclosed, then "about
10" is also disclosed. It is also understood that when a value is disclosed
that "less than or
equal to" the value, "greater than or equal to the value" and possible ranges
between values
are also disclosed, as appropriately understood by the skilled artisan. For
example, if the
value "10" is disclosed the "less than or equal to 10"as well as "greater than
or equal to 10" is
also disclosed. It is also understood that the throughout the application,
data is provided in a
number of different formats, and that this data, represents endpoints and
starting points, and
ranges for any combination of the data points. For example, if a particular
data point "10"
and a particular data point 15 are disclosed, it is understood that greater
than, greater than or
equal to, less than, less than or equal to, and equal to 10 and 15 are
considered disclosed as
well as between 10 and 15. It is also understood that each unit between two
particular units
-16-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13,
and 14 are also
disclosed.
As used herein, the term "subject" refers to an animal or human, preferably a
mammal, subject in need of treatment for a given disease, condition, event or
injury. Thus,
the subject can be a human. The term does not denote a particular age or sex.
Thus, adult and
newborn subjects, as well as fetuses, whether male or female, are intended to
be covered. A
patient refers to a subject afflicted with a disease or disorder. The term
"patient" includes
human and veterinary subjects.
"Inhibit," "inhibiting," and "inhibition" mean to decrease an activity,
response,
condition, disease, or other biological parameter. This can include but is not
limited to the
complete ablation of the activity, response, condition, or disease. This may
also include, for
example, a 10% reduction in the activity, response, condition, or disease as
compared to the
native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60,
70, 80, 90, 100%,
or any amount of reduction in between the specifically recited percentages, as
compared to
native or control levels.
"Promote," "promotion," and "promoting" refer to an increase in an activity,
response, condition, disease, or other biological parameter. This can include
but is not
limited to the initiation of the activity, response, condition, or disease.
This may also include,
for example, a 10% increase in the activity, response, condition, or disease
as compared to
the native or control level. Thus, the increase in an activity, response,
condition, disease, or
other biological parameter can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%,
or more,
including any amount of increase in between the specifically recited
percentages, as
compared to native or control levels.
The term "therapeutically effective" means that the amount of the composition
used is
of sufficient quantity to ameliorate one or more causes or symptoms of a
disease or disorder.
Such amelioration only requires a reduction or alteration, not necessarily
elimination.
The term "carrier" means a compound, composition, substance, or structure
that,
when in combination with a compound or composition, aids or facilitates
preparation,
storage, administration, delivery, effectiveness, selectivity, or any other
feature of the
compound or composition for its intended use or purpose. For example, a
carrier can be
selected to minimize any degradation of the active ingredient and to minimize
any adverse
side effects in the subject.
-17-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
"Alkyl" refers to an optionally substituted hydrocarbon group joined by single
carbon-carbon bonds and having 1 to 8 carbon atoms joined together. The alkyl
hydrocarbon
group may be straight-chain or contain one or more branches. These groups
include methyl,
ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and
the like. "Lower
alkyl" refers to optionally substituted branched- or straight-chain alkyl
having 1 to 4 carbons.
"Alkenyl" refers to an optionally substituted hydrocarbon group containing at
least
one carbon-carbon double bond between the carbon atoms and containing 2-8
carbon atoms
joined together. The alkenyl hydrocarbon group may be branched or straight-
chain.
"Cycloalkyl" refers to an optionally substituted cyclic alkyl or an optionally
substituted non-aromatic cyclic alkenyl and includes monocyclic and multiple
fused ring
structures such as bicyclic and tricyclic. The cycloalkyl may have, for
example, 3 to 15
carbon atoms. In one embodiment, cycloalkyl has 5 to 12 carbon atoms. Examples
of
suitable cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl,
cyclohexyl and the
like.
"Heterocycle" refers to optionally substituted saturated or partially
saturated non-
aromatic ringed moieties including at least one non-carbon atom. Heterocyclic
moieties
typically comprise a single ring or multiple fused ring structures, such as
bicyclic and
tricyclic. In one embodiment, the ring(s) is 5 to 6-membered and typically
contains 1 to 3
non-carbon atoms. Non-carbon atoms for heterocycle may be independently
selected from
nitrogen, oxygen and sulfur.
"Aryl" refers to an optionally substituted aromatic group with at least one
ring having
a conjugated pi-electron ring system, and includes monocyclic and multiple
fused ring
structures such as bicyclic and tricyclic. Aryl includes optionally
substituted carbocyclic aryl.
Examples of suitable aryl groups include phenyl, naphthyl, anthracenyl,
phenanthrenyl and
the like.
"Heterocyclic aryl" refers to an optionally substituted aromatic group with at
least one
ring having a conjugated pi-electron ring system including at least one non-
carbon atom.
Heterocyclic aryl moieties typically comprise one ring or multiple fused ring
structures, such
as bicyclic and tricyclic. Examples of suitable heterocyclic aryl groups
include furanyl,
thienyl, pyrrolyl, imidazolyl, pyridinyl, and the like.
-18-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
"Alkoxy" refers to oxygen joined to an alkyl group. "Lower alkoxy" refers to
oxygen
joined to a lower alkyl group. In one embodiment, the oxygen is joined to an
unsubstituted
alkyl 1 to 4 carbons in length. For example, the alkoxy may be methoxy, ethoxy
and the like.
"Alkylene" refers to an optionally substituted hydrocarbon chain containing
only
carbon-carbon single bonds between the carbon atoms. The alkylene chain has 1
to 6 carbons
and is attached at two locations to other functional groups or structural
moieties. Examples
of suitable alkylene groups include methylene, ethylene and the like.
When referring to an active agent "biologically active" and "desired
biological
activity" refer to an ability to modulate the activity or activation of a
targeted molecule. In
particular, embodiments, when used in conjunction with an the biologically
active agents
described herein, "biologically active" and "desired biological activity"
refer to an ability to
directly or indirectly inhibit or block the activity or activation of a
targeted molecule.
As used herein, "small molecule" refers to low molecular weight compounds. For
example, in particular embodiments, such small molecule compounds are
compounds the
exhibit a molecular weight of between 50 daltons to 800 daltons. In
alternative embodiments,
a small molecule as described herein exhibit a molecular weight selected from
the ranges of
between 100 daltons and 500 daltons and between 250 daltons to 475 daltons.
As used herein, the terms "treat," "treating," and "treatment" refer to a
therapeutic
benefit, whereby the detrimental effect(s) or progress of a particular
disease, condition, event
or injury is prevented, reduced, halted or slowed.
A "therapeutically effective amount" is the amount of compound which achieves
a
therapeutic benefit, such as, for example, retarding a disease in a subject
having a disease or
prophylactically retarding or preventing the onset of a disease. A
therapeutically effective
amount may be an amount which relieves to some extent one or more symptoms of
a disease
or disorder in a subject; returns to normal either partially or completely one
or more
physiological or biochemical parameters associated with or causative of the
disease or
disorder; and/or reduces the likelihood of the onset of the disease of
disorder.
The terms "pathologic" or "pathologic conditions" refer to any deviation from
a
healthy, normal, or efficient condition which may be the result of a disease,
condition, event
or injury.
The term "regulatory sequences" refers to those sequences normally within 100-
1000
kilobases (kb) of the coding region of a locus, but they may also be more
distant from the
-19-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
coding region, which affect the expression of the gene. Such regulation of
expression
comprises transcription of the gene, and translation, splicing, and stability
of the messenger
RNA.
The term "operably linked" refers to a juxtaposition wherein the components so
described are in a relationship permitting them to function in their intended
manner. For
instance, a promoter is operably linked to a coding sequence if the promoter
affects its
transcription or expression. The term "operably linked" may refer to
functional linkage
between a nucleic acid expression control sequence (e.g., a promoter,
enhancer, or array of
transcription factor binding sites) and a second nucleic acid sequence,
wherein the expression
control sequence directs transcription of the nucleic acid corresponding to
the second
sequence.
"Isolated," when used to describe biomolecules disclosed herein, means, e.g.,
a
peptide, protein, or nucleic acid that has been identified and separated
and/or recovered from
a component of its natural environment. Contaminant components of its natural
environment
are materials that would typically interfere with diagnostic or therapeutic
uses for the isolated
molecule(s), and may include enzymes, hormones, and other proteinaceous or non-
proteinaceous materials. Methods for isolation and purification of
biomolecules described
herein are known and available in the art, and one of ordinary skill in the
art can determine
suitable isolation and purification methods in light of the material to be
isolated or purified.
Though isolated biomolecules will typically be prepared using at least one
purification step,
as it is used herein, "isolated" additionally refers to, for example, peptide,
protein, antibody,
or nucleic acid materials in-situ within recombinant cells, even if expressed
in a homologous
cell type.
Further, where the terms "isolated", "substantially pure", and "substantially
homogeneous" are used to describe a monomeric protein they are used
interchangeably
herein. A monomeric protein is substantially pure when at least about 60 to
75% of a sample
exhibits a single polypeptide sequence. A substantially pure protein can
typically comprise
about 60 to 90% W/W of a protein sample, and where desired, a substantially
pure protein
can be greater than about 90%, about 95%, or about 99% pure. Protein purity or
homogeneity can be indicated by a number of means well known in the art, such
as
polyacrylamide gel electrophoresis of a protein sample, followed by
visualizing a single
polypeptide band upon staining the gel. For certain purposes, higher
resolution can be
-20-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
provided by using HPLC or other means well known in the art which are utilized
for
purification.
Throughout the description and claims of this specification, the word
"comprise" and
variations of the word, such as "comprising" and "comprises," means "including
but not
limited to," and is not intended to exclude, for example, other additives,
components, integers
or steps.
PROTEINS & PEPTIDES
As the terms are used herein, "protein" and "peptide" are simply refer to
polypeptide
molecules generally and are not used to refer to polypeptide molecules of any
specific size,
length or molecular weight. Protein variants and derivatives are well
understood to those of
skill in the art and can involve amino acid sequence modifications. For
example, amino acid
sequence modifications typically fall into one or more of three classes:
substitutional,
insertional or deletional variants. Insertions include amino and/or carboxyl
terminal fusions
as well as intrasequence insertions of single or multiple amino acid residues.
Insertions
ordinarily will be smaller insertions than those of amino or carboxyl terminal
fusions, for
example, on the order of one to four residues. Immunogenic fusion protein
derivatives, such
as those described in the examples, are made by fusing a polypeptide
sufficiently large to
confer immunogenicity to the target sequence by cross-linking in vitro or by
recombinant cell
culture transformed with DNA encoding the fusion. Deletions are characterized
by the
removal of one or more amino acid residues from the protein sequence.
Typically, no more
than about from 2 to 6 residues are deleted at any one site within the protein
molecule. These
variants ordinarily are prepared by site specific mutagenesis of nucleotides
in the DNA
encoding the protein, thereby producing DNA encoding the variant, and
thereafter expressing
the DNA in recombinant cell culture. Techniques for making substitution
mutations at
predetermined sites in DNA having a known sequence are well known, for example
M13
primer mutagenesis and PCR mutagenesis. Amino acid substitutions are typically
of single
residues, but can occur at a number of different locations at once; insertions
usually will be
on the order of about from 1 to 10 amino acid residues; and deletions will
range about from 1
to 30 residues. Deletions or insertions preferably are made in adjacent pairs,
i.e. a deletion of
2 residues or insertion of 2 residues. Substitutions, deletions, insertions or
any combination
thereof may be combined to arrive at a final construct. The mutations must not
place the
sequence out of reading frame and preferably will not create complementary
regions that
-21-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
could produce secondary mRNA structure. Substitutional variants are those in
which at least
one residue has been removed and a different residue inserted in its place.
Such substitutions
generally are made in accordance with the following Table 1 and are referred
to as
conservative substitutions.
TABLE 1:Amino Acid Substitutions
Original Residue Exemplary Conservative
Substitutions, others are known in the art.
Ala Ser
Arg Lys; Gln
Asn Gln; His
Asp Glu
Cys Ser
Gln Asn, Lys
Glu Asp
Gly Pro
His Asn;Gln
Ile Leu; Val
Leu Ile; Val
Lys Arg; Gln
Met Leu; Ile
Phe Met; Leu; Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp; Phe
Val Ile; Leu
Substantial changes in function or immunological identity are made by
selecting
substitutions that are less conservative than those in Table 1, i.e.,
selecting residues that differ
more significantly in their effect on maintaining (a) the structure of the
polypeptide backbone
in the area of the substitution, for example as a sheet or helical
conformation, (b) the charge
or hydrophobicity of the molecule at the target site or (c) the bulk of the
side chain. The
substitutions which in general are expected to produce the greatest changes in
the protein
properties will be those in which (a) a hydrophilic residue, e.g. seryl or
threonyl, is
substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl,
phenylalanyl, valyl or
alanyl; (b) a cysteine or proline is substituted for (or by) any other
residue; (c) a residue
having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is
substituted for (or by)
an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue
having a bulky side
chain, e.g., phenylalanine, is substituted for (or by) one not having a side
chain, e.g., glycine,
in this case, (e) by increasing the number of sites for sulfation and/or
glycosylation.
-22-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
For example, the replacement of one amino acid residue with another that is
biologically and/or chemically similar is known to those skilled in the art as
a conservative
substitution. For example, a conservative substitution would be replacing one
hydrophobic
residue for another, or one polar residue for another. The substitutions
include combinations
such as, for example, Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gln; Ser, Thr;
Lys, Arg; and
Phe, Tyr. Such conservatively substituted variations of each explicitly
disclosed sequence are
included within the polypeptides provided herein.
Substitutional or deletional mutagenesis can be employed to insert sites for N-
glycosylation (Asn-X-Thr/Ser) or 0-glycosylation (Ser or Thr). Deletions of
cysteine or
other labile residues also may be desirable. Deletions or substitutions of
potential proteolysis
sites, e.g. Arg, is accomplished for example by deleting one of the basic
residues or
substituting one by glutaminyl or histidyl residues.
Certain post-translational derivatizations are the result of the action of
recombinant
host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues
are frequently
post-translationally deamidated to the corresponding glutamyl and asparyl
residues.
Alternatively, these residues are deamidated under mildly acidic conditions.
Other post-
translational modifications include hydroxylation of proline and lysine,
phosphorylation of
hydroxyl groups of seryl or threonyl residues, methylation of the o-amino
groups of lysine,
arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and
Molecular
Properties, W. H. Freeman & Co., San Francisco pp 79-86 [1983]), acetylation
of the N-
terminal amine and, in some instances, amidation of the C-terminal carboxyl.
It is understood that one way to define the variants and derivatives of the
proteins and
peptides disclosed herein is through defining the variants and derivatives in
terms of
homology/identity to specific known sequences. Specifically disclosed are
variants of these
and other proteins herein disclosed which have at least, 70% or 75% or 80% or
85% or 90%
or 95% homology to the stated sequence. Those of skill in the art readily
understand how to
determine the homology of two proteins. For example, the homology can be
calculated after
aligning the two sequences so that the homology is at its highest level.
Another way of calculating homology can be performed by published algorithms.
Optimal alignment of sequences for comparison may be conducted by the local
homology
algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the
homology
alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by
the search
-23-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85:
2444 (1988),
by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group,
575
Science Dr., Madison, WI), or by inspection.
The same types of homology can be obtained for nucleic acids by for example
the
algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc.
Natl. Acad.
Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989
which are
herein incorporated by reference for at least material related to nucleic acid
alignment.
It is understood that the description of conservative mutations and homology
can be
combined together in any combination, such as embodiments that have at least
70%
homology to a particular sequence wherein the variants are conservative
mutations.
As this specification discusses various proteins and protein sequences it is
understood
that the nucleic acids that can encode those protein sequences are also
disclosed. This would
include all degenerate sequences related to a specific protein sequence, i.e.,
all nucleic acids
having a sequence that encodes one particular protein sequence as well as all
nucleic acids,
including degenerate nucleic acids, encoding the disclosed variants and
derivatives of the
protein sequences. Thus, while each particular nucleic acid sequence may not
be written out
herein, it is understood that each and every sequence is in fact disclosed and
described herein
through the disclosed protein sequence.
It is understood that there are numerous amino acid and peptide analogs which
can be
incorporated into the disclosed compositions. For example, there are numerous
D amino
acids or amino acids which have a different functional substituent then the
amino acids
shown in Table 1. The opposite stereo isomers of naturally occurring peptides
are disclosed,
as well as the stereo isomers of peptide analogs. These amino acids can
readily be
incorporated into polypeptide chains by charging tRNA molecules with the amino
acid of
choice and engineering genetic constructs that utilize, for example, amber
codons, to insert
the analog amino acid into a peptide chain in a site specific way (Thorson et
al., Methods in
Molec. Biol. 77:43-73 (1991), Zoller, Current Opinion in Biotechnology, 3:348-
354 (1992);
Ibba, Biotechnology & Genetic Enginerring Reviews 13:197-216 (1995), Cahill et
al., TIBS,
14(10):400-403 (1989); Benner, TIB Tech, 12:158-163 (1994); Ibba and Hennecke,
Bio/technology, 12:678-682 (1994) all of which are herein incorporated by
reference at least
for material related to amino acid analogs).
-24-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
D-amino acids can be used to generate more stable peptides, because D amino
acids
are not recognized by peptidases and such. Systematic substitution of one or
more amino
acids of a consensus sequence with a D-amino acid of the same type (e.g., D-
lysine in place
of L-lysine) can be used to generate more stable peptides. Cysteine residues
can be used to
cyclize or attach two or more peptides together. This can be beneficial to
constrain peptides
into particular conformations. (Rizo and Gierasch Ann. Rev. Biochem. 61:387
(1992),
incorporated herein by reference).
VASCULAR PERMEABILITY
As used herein, "vascular permeability" refers to the capacity of small
molecules
(e.g., ions, water, nutrients), large molecules (e.g., proteins and nucleic
acids) or even whole
cells (lymphocytes on their way to the site of inflammation) to pass through a
blood vessel
wall.
Diseases and disorders characterized by undesirable vascular permeability
include, for
example, edema associated with brain tumors, ascites associated with
malignancies, Meigs'
syndrome, lung inflammation, nephrotic syndrome, pericardial effusion and
pleural effusion.
Thus, provided is a method of treating or preventing these or any other
disease associated
with an increase in vascular permeability or edema. For example, inhibiting
edema formation
should be beneficial to overall patient outcome in situations such as
inflammation, allergic
diseases, cancer, cerebral stroke, myocardial infarction, pulmonary and
cardiac insufficiency,
renal failure, and retinopathies, to name a few. Furthermore, as edema is a
general
consequence of tissue hypoxia, it can also be concluded that inhibition of
vascular leakage
represents a potential approach to the treatment of tissue hypoxia. For
example, interruption
of blood flow by pathologic conditions (such as thrombus formation) or medical
intervention
(such as cardioplegia, organ transplantation, and angioplasty) could be
treated both acutely
and prophylactically using inhibitors of vascular leakage.
Ischemia/reperfusion injury following stroke and myocardial infarction is also
characterized by vascular permeability and edema. A deficit in tissue
perfusion leads to
persistent post-ischemic vasogenic edema, which develops as a result of
increased vascular
permeability. Tissue perfusion is a measure of oxygenated blood reaching the
given tissue
due to the patency of an artery and the flow of blood in an artery. Tissue
vascularization may
be disrupted due to blockage, or alternatively, it may result from the loss of
blood flow
resulting from blood vessel leakage or hemorrhage upstream of the affected
site. The deficit
-25-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
in tissue perfusion during acute myocardial infarction, cerebral stroke,
surgical
revascularization procedures, and other conditions in which tissue
vascularization has been
disrupted, is a crucial factor in outcome of the patient's condition. Edema
can cause various
types of damage including vessel collapse and impaired electrical function,
particularly in the
heart. Subsequent reperfusion, however, can also cause similar damage in some
patients,
leading to a treatment paradox. While it is necessary, to unblock an occluded
blood vessel or
to repair or replace a damaged blood vessel, the ensuing reperfusion can, in
some cases, lead
to further damage. Likewise, during bypass surgery, it is necessary to stop
the heart from
beating and to have the patient hooked to a heart pump. Some patients who
undergo bypass
surgery, for example, may actually experience a worsening of condition ("post-
pump
syndrome"), which may be the result of ischemia during cessation of cardiac
function during
surgery. An arterial blockage may cause a reduction in the flow of blood, but
even after the
blockage is removed and the artery is opened, if tissue reperfusion fails to
occur, further
tissue damage may result. For example, disruption of a clot may trigger a
chain of events
leading to loss of tissue perfusion, rather than a gain of perfusion.
Additional diseases and disorders characterized by undesirable vascular
permeability
include, for example, infectious and non-infectious diseases that may result
in a cytokine
storm. A cytokine storm can be precipitated by a number of infectious and non-
infectious
diseases including, for example, graft versus host disease (GVHD), adult
respiratory distress
syndrome (ARDS), sepsis, avian influenza, smallpox, and systemmic inflammatory
response
syndrome (SIRS).
PATHOLOGIC ANGIOGENESIS
Angiogenesis and angiogenesis related diseases are closely affected by
cellular
proliferation. As used herein, the term "angiogenesis" means the generation of
new blood
vessels into a tissue or organ. Under normal physiological conditions, humans
or animals
undergo angiogenesis only in very specific restricted situations. For example,
angiogenesis is
normally observed in wound healing, fetal and embryonal development and
formation of the
corpus luteum, endometrium and placenta. The term "endothelium" is defined
herein as a thin
layer of flat cells that lines serous cavities, lymph vessels, and blood
vessels. These cells are
defined herein as "endothelial cells." The term "endothelial inhibiting
activity" means the
capability of a molecule to inhibit angiogenesis in general. The inhibition of
endothelial cell
proliferation also results in an inhibition of angiogenesis.
-26-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Both controlled and uncontrolled angiogenesis are thought to proceed in a
similar
manner. Endothelial cells and pericytes are surrounded by a basement membrane
and form
capillary blood vessels. Angiogenesis begins with the erosion of the basement
membrane by
enzymes released by endothelial cells and leukocytes. The endothelial cells,
which line the
lumen of blood vessels, then protrude through the basement membrane.
Angiogenic
stimulants induce the endothelial cells to migrate through the eroded basement
membrane.
The migrating cells form a "sprout" off the parent blood vessel, where the
endothelial cells
undergo mitosis and proliferate. The endothelial sprouts merge with each other
to form
capillary loops, creating the new blood vessel.
New blood vessels may also form in part by vasculogenesis. Vasculogenesis is
distinguished from angiogenesis by the source of the endothelial cells.
Vasculogenesis
involves the recruitment of endothelial progenitor cells known as angioblasts.
These
angioblasts can come from the circulation or from the tissue. Vasculogenesis
is regulated by
similar signaling pathways as angiogenesis. Thus, the term "angiogenesis" is
used herein
interchangeably with vasculogenesis such that a method of modulating
angiogenesis can also
modulate vasculogenesis.
Pathologic angiogenesis, which may be characterized as persistent,
dysregulated or
unregulated angiogenesis, occurs in a multiplicity of disease states, tumor
metastasis and
abnormal growth by endothelial cells and supports the pathological damage seen
in these
conditions. The diverse disease states in which pathologic angiogenesis is
present have been
grouped together as angiogenic-dependent, angiogenic-associated, or angiogenic-
related
diseases. These diseases are a result of abnormal or undesirable cell
proliferation, particularly
endothelial cell proliferation.
Diseases and processes mediated by abnormal or undesirable endothelial cell
proliferation, including, but not limited to, hemangioma, solid tumors,
leukemia, metastasis,
telangiectasia psoriasis scleroderma, pyogenic granuloma, myocardial
angiogenesis, plaque
neovascularization, coronary collaterals, ischemic limb angiogenesis, corneal
diseases,
rubeosis, neovascular glaucoma, diabetic retinopathy (DR), retrolental
fibroplasia, non-
proliferative diabetic macular edema (DME), arthritis, diabetic
neovascularization, age-
related macular degeneration (AMD), retinopathy of prematurity (ROP), ischemic
retinal vein
occlusion (IRVO), wound healing, peptic ulcer, fractures, keloids,
vasculogenesis,
hematopoiesis, ovulation, menstruation, and placentation.
-27-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
ROBO4 SIGNALING PATHWAY
The Robo family of proteins is a family of transmembrane proteins known to
interact
with Slit proteins to guide axonal pathfinding in the nervous system. Robos
have been
identified in vertebrates, and Robo 1-3 are predominantly expressed in the
nervous system
(Marillat et al., 2002). In contrast, Robo4, also known as Magic Roundabout,
is exclusively
or predominantly expressed in the vasculature (See, e.g., Park et al., 2003;
Huminiecki et al.,
2002; and Huminiecki et al., 2002; Seth et al., 2005). Robo4 is further
distinguished from
Robol-3 by its divergent sequence: the ectodomain of the neuronal Robos
contains five
immunoglobulin (Ig) domains and three fibronectin type III (FNIII) repeats,
while Robo4
contains two Ig domains and two FNIII repeats (Huminiecki et al., 2002; Park
et al., 2003).
In addition, Robol-3 possess four conserved cytoplasmic (CC) motifs, CCO, CC1,
CC2 and
CC3 (Kidd et al., 1998; Zallen et al., 1998), of which, only CCO and CC2 are
present in
Robo4 (Huminiecki et al., 2002; Park et al., 2003).
Published reports have proposed that Robos can promote angiogenesis in both
Slit-
dependent and Slit-independent ways. For example, it was reported that Slit2
stimulation of
Robol induced migration and tube formation in vitro, and promoted tumor
angiogenesis in
vivo (Feng et al., 2004). Moreover, a study conducted in 2004 showed blocking
Robo4
activity with a soluble Robo4 ectodomain inhibited migration and tube
formation in vitro,
consistent with a positive role for Robo4 during angiogenesis. Further, this
study reported
that Slit proteins do not bind to Robo4, thereby implicating an unknown ligand
for the
receptor (Suchting et al., 2004). The notion that Robo4 is proangiogenic has
also emerged
from recent data showing that overexpression of Robo4 augments endothelial
cell adhesion
and migration independently of Slit (Kaur et al., 2006).
A signaling pathway whereby Robo4 signaling inhibits protrusive events
involved in
cell migration, stabilize endothelial cell-cell junctions, and block
pathological angiogenesis is
described herein. The signaling pathway described herein is illustrated in
FIG. 35 and
provides multiple targets that may be modulated in a manner that affects, for
example, cell
motility, vascular permeability, and angiogenisis. "Modulation" as used herein
includes
changing the activity of a target, and "manipulation" as used herein includes
a change in the
cellular state. As disclosed herein, initiation of Robo4 signaling by ligands
of Robo4, such as
a Slit-2 Protein as disclosed herein, negatively regulates cell motility and
inhibits vascular
permeability. In particular, Slit2 elicits a repulsive cue in the endothelium
via activation of
-28-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Robo4, defining a novel signal transduction cascade responsible for such
activity. As
described herein, Slit2 activation of Robo4, among other things, inhibits Rac
activation and,
hence, Rac initiated or mediated cell motility and cell spreading.
The teachings provided herein establish a Slit2-dependent association between
Robo4
and the adaptor protein paxillin, with the experimental data detailed herein
providing
biochemical and cell biological evidence that this interaction facilitates
Robo4-dependent
inhibition of cell migration, cell spreading, and Rac activation. In
particular, Robo4
activation initiates paxillin activation of GITI and, in turn, GIT1 inhibition
of ARF6. Robo4
activation preserves endothelial barrier function, blocks VEGF signaling
downstream of the
VEGF receptor, and inhibits cellular protrusive activity, vascular leak,
endothelial
permeability, and/or pathologic angiogenesis. Robo4 activation not only blocks
VEGF
signaling, but inhibits signaling from multiple angiogenic, permeability and
inflammatory
factors, including thrombin and bFGF.
As is further disclosed herein, modulation of ARF-GAP activity can be targeted
to
inhibit cellular protrusive activity, vascular leak, endothelial permeability,
and/or pathologic
angiogenesis. In particular, activation of ARF-GAPs can inhibit activation of
ARF6, and
inhibition of ARF6 activity is shown to inhibit cellular protrusive activity,
vascular leak,
endothelial permeability, and pathologic angiogenesis. In addition, the
examples provided
herein illustrate that inactivation of ARF-GAPs, such as the ARF-GAP GIT1, can
reverse the
stabilizing effect of Robo4 signaling on endothelial integrity. Activation of
the ARF-GAP
GIT1 inhibits activation of ARF6, resulting in an inhibition of VEGF-induced
endothelial cell
responses. As such, the direct or indirect modulation of ARF6 activity
represents a target for
controlling vascular permeability and angiogenesis.
In addition to ARF-GAPs, modulation of one or more ARF-GEFs, such as one or
more cytohesins, including the ARNO family of cytohesins, can be targeted to
inhibit cellular
protrusive activity, vascular leak, endothelial permeability, and/or
pathologic angiogenesis.
Without being bound by a particular theory, it is thought that an effect of
Slit2-Robo4
signaling is inhibition or prevention of GTP loading of one or more ARFs. In
particular,
again without being bound by a particular theory, it is believed that an
effect of Slit2-Robo4
signaling is inhibition or prevention of GTP loading of ARF6 and/or ARF 1. ARF-
GEFs,
including those disclosed herein, facilitate GTP loading of ARF6 and
inhibition of ARF-GEF
activity inhibits ARF activation or activity. As described herein, inhibitors
of ARF-GEFs,
-29-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
such as inhibitors of cytohesins, including ARNO and the ARNO family of
cytohesins,
ARNO results in inhibition of ARF activity as well as inhibition of cellular
protrusive
activity, vascular leak, endothelial permeability, and/or pathologic
angiogenesis.
COMPOSITIONS
Compositions for inhibiting vascular permeability and pathologic angiogenesis
are
provided herein.
Compositions for modulating activity of ARFs are provided herein. In one
embodiment, the composition inhibits, either directly or indirectly the
activity or activation of
an ARF selected from one or both of ARF6 and ARF 1. In one such embodiment,
the
composition includes one or more active agents that directly inhibits an ARF
selected from
one or both of AFR6 and ARF1. In such an embodiment, the one or more active
agents may
include one or more ligand of ARF6 and/or ARF 1. In another such embodiment,
the one or
more active agents are selected from one or more small molecules, proteins,
peptides or
nucleic acids that directly inhibits activity or activation of ARF6 and/or ARF
1. In another
embodiment, the composition includes one or more active agents that indirectly
inhibits an
ARF selected from one or both of AFR6 and ARF 1. In such an embodiment, the
one or more
active agents may include an upstream modulator of ARF6 or ARF 1 activity or
activation,
wherein such upstream modulator is selected from one or more small molecules,
proteins,
peptides or nucleic acids that directly inhibits activity or activation of an
upstream modulator
of ARF6 or ARFI activity, such as, for example, the Robo4 receptor, an ARF-
GAP, such as
GITI or an ARF-GEF, such as ARNO or other cytohesin. In another embodiment, a
composition as described herein includes one or more active agents that
inhibit ARF6
activation of Rac. In one such embodiment, the one or more active agents may
be selected
from one or more small molecules, proteins, peptides or nucleic acids that act
directly or
indirectly on or through ARF6 as described herein to inhibit Rac activation by
VEGF.
In one embodiment, a composition for modulating the activity of one or more
ARFs
may include an active agent that indirectly inhibits ARF6 activity or
activation by modulating
activation, activity or availability of an accessory protein required for ARF6
activity or
activation. In one such embodiment, a composition as described herein may
include one or
more active agents that directly or indirectly inhibit one or more ARF-GEFs,
such as, for
example, a cytohesin or a member of the ARNO family of cytohesins, such that
the activity
or activation of one or more ARF family proteins, such as ARF6 and/or ARF1, is
reduced. In
-30-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
one such embodiment, a composition as described herein may include one or more
active
agents that bind ARNO and decrease the activity of individual ARNO proteins
such that
fewer ARF6 and/or ARF 1 proteins are in a GTP-bound state, thereby reducing
the pool of
active ARF6 proteins. In one embodiment of a composition that includes one or
more active
agents that directly or indirectly inhibit one or more ARF-GEFs, the one or
more active
agents may be a ligand of a targeted ARF-GEF. In another such embodiment of a
composition that includes one or more active agents that directly or
indirectly inhibit one or
more ARF-GEFs, the one ore more active agents may be selected from one or more
small
molecules, proteins, peptides or nucleic acids that directly inhibits
activity, activation, or
availability of the targeted ARF-GEF. In another embodiment of a composition
that includes
one or more active agents that directly or indirectly inhibit one or more ARF-
GEFs, the one
or more active agents may be any agent that operates by any mechanism to
inhibit the
availability, activation or activity of one or more ARF-GEFs.
In another embodiment, a composition for modulating the activity of one or
more
ARFs may include one or more active agents that increase the activity,
activation, or
availability of one or more ARF-GAPs, such that the activity or activation of
one or more
ARF proteins, such as ARF6 and/or ARF1 is reduced. For example, a composition
as
described herein may include one or more active agents that directly or
indirectly increase the
activity, activation, or availability of GIT1 such that fewer ARF proteins,
for example ARF6
and/or ARFI, are activated, thereby reducing a signal cascade acting through
or propagated
by ARF6. In one such embodiment, the one or more active agents may include a
ligand of
GITI that binds directly to GITI and increases the activation or activity of
GIT1 such that the
activity or activation of one or more ARF proteins, such as ARF6 and/or ARF1
is reduced.
Where a composition includes one or more active agents that directly increases
the activity,
activation or availability activity of one or more ARF-GAPs, the one or more
active agents
may be include one or more small molecules, proteins, peptides or nucleic
acids that directly
or indirectly increase activity, activation or availability of the targeted
ARF-GAP.
Alternatively, in another embodiment of a composition that includes one or
more active
agents that increase the activity, activation, or availability of one or more
ARF-GAPs, the one
or more active agents may be any agent that operates by any mechanism to
promote the
availability, activation or activity of one or more ARF-GAPs.
-31-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
In one embodiment, the composition provided herein comprises a ligand of a
Robo4
receptor. In one such embodiment, the ligand of Robo4 can be any composition
or molecule
that can act through Robo4 to negatively regulate cell motility. In another
such embodiment,
the ligand of Robo4 can be any composition or molecule that can act through
Robo4 to
inhibit vascular permeability. In yet another such embodiment, the ligand of
Robo4 can be
any composition or molecule that can act through Robo4 to inhibit Rac
activation by VEGF.
In still a further embodiment, a composition as described herein includes a
ligand of a Robo4
receptor, wherein the ligand can act through Robo4 to initiate paxillin
activation of GIT1. In
another embodiment, a composition as described herein includes a ligand of a
Robo4
receptor, wherein the ligand can act through Robo4 to activate Git I
inhibition of ARF6. In a
further embodiment, a composition as described herein includes a ligand of a
Robo4
receptor, wherein the ligand can act through Robo4 in a manner that results in
one or more of
the following preservation of endothelial barrier function, blocking of VEGF
signaling
downstream of the VEGF receptor, inhibition of vascular leak, inhibition of
pathologic
angiogenesis, signal inhibition of multiple angiogenic, permeability and
inflammatory
factors.
Where the composition of the present invention includes a ligand of Robo4, the
ligand
be any composition or molecule that binds the extracellular domain of Robo4.
Alternatively,
a ligand of Robo4 can be any composition or molecule that acts through the
Robo4 receptor
to inhibit Rac activation by VEGF. Even further, a ligand of Robo4 can be any
composition
or molecule that acts through the Robo4 receptor to activate Gitl inhibition
of ARF6. Still
further, a ligand of Robo4 can be any composition or molecule that acts
through the Robo4
receptor to activate Paxillin activation of Gitl. In another aspect, a ligand
of Robo4 can be
any composition or molecule that mimics the Robo4 receptor to activate
Paxillin activation of
Gitl. In one embodiment, a ligand of Robo4 included in a composition according
to the
present description comprises an isolated polypeptide of about 5, 10, 15, 20,
25, 30, 40, 50,
60, 70, 80, 90, 100, 200, 300, 400 amino acids in length.
Where a composition as described herein includes a ligand of Robo4, such
ligand can
be a Slit ligand, such as Slit2 ligand, or a fragment or variant thereof that
binds and activates
Robo4. In specific embodiments, the Slit ligand, or fragment or variant
thereof, binds to and
activates Robo4 in a manner that results in one or more of the following:
inhibition of Rac,
inhibition of ARF6; preservation of endothelial barrier function; blocking of
VEGF signaling
-32-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
downstream of the VEGF receptor; inhibition of vascular leak; inhibition of
pathologic
angiogenesis; and signal inhibition of multiple angiogenic, permeability and
inflammatory
factors. For example, the ligand of Robo4 can comprise an amino acid sequence
selected
from Slitl (SEQ ID NO: 1), Slit2 (SEQ ID NO: 2), Slit3 (SEQ ID NO: 3),
fragments of Slitl,
such as the fragment represented by SEQ ID NO: 4, fragments of Slit2, such as
the fragment
represented by SEQ ID NO: 5, and fragments of Slit3, such as the fragment
represented by
SEQ ID NO: 6. In other embodiments, the ligand of Robo4 may be selected from
the Slit2
ligands represented by SEQ ID NO: 7 through SEQ ID NO: 15. In particular, a
Robo4 ligand
according to the present description may be selected from Slit2N (SEQ ID NO:
7), the Slit2
represented by SEQ ID NO: 8, S1it20P (SEQ ID NO: 9), Slit2 D 1(SEQ ID NO: 10),
Slit2
DI-D2 (SEQ ID NO: 11), Slit2 D1-D3 (SEQ ID NO: 12), Slit2 D1-D4 (SEQ ID NO:
13),
Slit2 D 1-E5 (SEQ ID NO: 14), and Slit2 D 1-E6 (SEQ ID NO: 15), or fragments
thereof that
bind Robo4. For example, in some embodiments, a fragment of such amino acid
sequences
can be at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100
amino acids long.
The ligand of Robo4 can comprise an amino acid sequence having at least about
70%, at least
about 75%, at least about 80%, at least about 85%, at least about 90%, at
least about 95%, or
at least about 100% sequence identity to and amino acid sequence selected from
an amino
acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and any
of SEQ
ID NO: 4 through SEQ ID NO: 15, or a fragment thereof that interacts with
Robo4 in a
manner that results in one or more of the following: inhibition of Rac;
inhibition of ARF6;
preservation of endothelial barrier function; blocking of VEGF signaling
downstream of the
VEGF receptor; inhibition of vascular leak; inhibition of pathologic
angiogenesis; and signal
inhibition of multiple angiogenic, permeability and inflammatory factors.
In some embodiments, a Slit fragment suitable as a Robo4 ligand as described
herein
may comprise the N-terminal region of a Slit. For example, the ligand of Robo4
can
comprise amino acids 1-1132 of Slitl (SEQ ID NO: 4), amino acids 1-1119 of
Slit2 (SEQ ID
NO: 5), amino acids 1-1118 of Slit3 (SEQ ID NO: 6), or any of the n-terminal
fragments
illustrated in FIG. 23 and detailed SEQ ID NO: 7 through SEQ ID NO: 15. In
particular
embodiments, the ligand of Robo4 can comprise a polypeptide consisting
essentially of an
amino acid sequence selected from any one of SEQ ID NO: 4 through SEQ ID NO:
15. In
some embodiments, as reflected in the amino acid sequences of SEQ ID NO: 7
through SEQ
ID NO: 15, a Slit fragment included in a composition of the present invention
does not
-33 -
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
comprise the N-terminal most amino acids. For example, in some embodiments,
the amino
acid sequence may lack about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or
100 N-terminal
amino acids of a natural Slit. In other embodiments, the Slit fragment may not
comprise the
C-terminal most about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100
amino acids of a
natural Slit.
For example, in particular embodiments, the ligand of Robo4 can comprise a
polypeptide consisting essentially of amino acids 281-511 (SEQ ID NO: 16) of
Slitl or amino
acids 271-504 of Slit2 (SEQ ID NO: 17). Thus, the ligand of Robo4 can comprise
SEQ ID
NO:15 or SEQ ID NO: 16 or a fragment thereof that binds Robo4. The ligand of
Robo4 can
comprise an amino acid sequence having at least about 70%, at least about 75%,
at least
about 80%, at least about 85%, at least about 90%, at least about 95%, or at
least about 100%
sequence identity to SEQ ID NO: 16 or SEQ ID NO: 17 or a fragment thereof that
interacts
with Robo4 in a manner that results in one or more of the following:
inhibition of Rac;
inhibition of ARF6; preservation of endothelial barrier function; blocking of
VEGF signaling
downstream of the VEGF receptor; inhibition of vascular leak; inhibition of
pathologic
angiogenesis; and signal inhibition of multiple angiogenic, permeability and
inflammatory
factors.
In one embodiment, a composition for modulating the activity of one or more
ARFs
according to the present description includes a small molecule active agent
capable of
modulating the activity of an upstream activator of one or more ARFs. In one
such
embodiment, the small molecule active agent promotes the availability,
activation or activity
of one or more ARF-GAPs as described herein. In another such embodiment, the
small
molecule active agent inhibits the availability, activation or activity of an
ARF-GEF as
described herein. In another such embodiment, the small molecule active agent
inhibits the
activity of a cytohesin in a manner that results in one or more of the
following: inhibition of
Rac; inhibition of ARF6; preservation of endothelial barrier function;
blocking of VEGF
signaling downstream of the VEGF receptor; inhibition of vascular leak;
inhibition of
pathologic angiogenesis; and signal inhibition of multiple angiogenic,
permeability and
inflammatory factors.
In yet another such embodiment, small molecule active agent inhibits the
activity of a
cytohesin selected from the ARNO family of cytohesins in a manner that results
in one or
more of the following: inhibition of Rac; inhibition of ARF6; preservation of
endothelial
-34-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
barrier function; blocking of VEGF signaling downstream of the VEGF receptor;
inhibition
of vascular leak; inhibition of pathologic angiogenesis; and signal inhibition
of multiple
angiogenic, permeability and inflammatory factors. In another embodiment, the
small
molecule active agent inhibits the activity of ARNO in a manner that results
in one or more
of the following: inhibition of Rac; inhibition of ARF6; preservation of
endothelial barrier
function; blocking of VEGF signaling downstream of the VEGF receptor;
inhibition of
vascular leak; inhibition of pathologic angiogenesis; and signal inhibition of
multiple
angiogenic, permeability and inflammatory factors. It is to be understood that
in each
embodiment including a small molecule active agent, one or more active agents
as described
herein may be included in the composition.
In a specific embodiment, a composition for inhibiting vascular permeability
and/or
pathologic angiogenesis includes SecinH3, the structure of which is provided
in FIG. 29.
SecinH3 is a known inhibitor of cytohesins (see, for example, Hafner et al.,
Inhibition of
cytohesins by SecinH3 leads to hepatic insulin resistance, Nature (2006), 444,
941-944, and
International Patent App. Publication No. WO 2006/053903). As is described in
detail
herein, in the present context, Secin-H3 inhibits ARF6 activation, VEGF
induced ARF6-
GTP, VEGF induced migration of endothelial cells, neovascular tuft formation
in models of
oxygen-induced retinopathy and choroidal neovascularization, and retinal
hyperpermeability
caused by VEGF. Thus, in one embodiment, a composition as described herein
includes the
SecinH3, which inhibits cytohesin activity, such as, for example the activity
of ARNO, in a
manner that results in one or more of the following: inhibition of Rac;
inhibition of ARF6;
preservation of endothelial barrier function; blocking of VEGF signaling
downstream of the
VEGF receptor; inhibition of vascular leak; inhibition of pathologic
angiogenesis; and signal
inhibition of multiple angiogenic, permeability and inflammatory factors.
In another embodiment, a composition as described herein includes one or more
small
molecule active agents selected from compounds that inhibit the availability,
activation or
activity of an ARF-GEF, such as a cytohesin, a cytohesin selected from the
ARNO family of
cytohesins, or ARNO in a manner that results in one or more of the following:
inhibition of
Rac; inhibition of ARF6; preservation of endothelial barrier function;
blocking of VEGF
signaling downstream of the VEGF receptor; inhibition of vascular leak;
inhibition of
pathologic angiogenesis; and signal inhibition of multiple angiogenic,
permeability and
- 35 -
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
inflammatory factors. In such an embodiment, a composition as described herein
may
include one or more compounds having the following chemical formula (Formula
1):
H
R3 N jr-" Z / RI
N) N 0
/
N
R2
wherein:
R' and R3 are independently chosen from optionally substituted aryl,
optionally
substituted heteroaryl, optionally substituted cycloalkyl, or optionally
substituted heterocycle;
R2 is chosen from hydrogen, lower alkoxy, lower alkyl, halogen or hydroxy;
Z is chosen from 0, S, NH, alkylene or a single bond; or
pharmaceutically acceptable salts, solvates or hydrates thereof.
In one such embodiment, the one or more compounds are selected from compounds
as
described by Formula 1, wherein R3 is substituted with 1 to 5 substituents
independently
chosen from halogen, lower alkyl, lower alkoxy, heteroatom lower alkyl,
hydroxy, or
methylene dioxy, wherein two substituents together may form a fused cycloalkyl
or
heterocyclic ring structure. In another such embodiment, the one or more
compounds are
selected from compounds as described by Formula 1, wherein R' is chosen from
unsubstituted aryl or unsubstituted heteroaryl; R2 is chosen from hydrogen,
lower alkoxy, or
lower alkyl; R3 is chosen from aryl, optionally substituted with 1 to 5
substituents
independently chosen from halogen, lower alkyl, lower alkoxy, or methylene
dioxy, wherein
two substituents together may form a fused cycloalkyl or heterocyclic ring
structure; and Z is
chosen from 0, S, or a single bond.
In another embodiment, a composition as described herein includes one or more
small
molecule active agents selected from compounds that inhibit the availability,
activation or
activity of an ARF-GEF, such as a cytohesin, a cytohesin selected from the
ARNO family of
cytohesins, or ARNO in a manner that results in one or more of the following:
inhibition of
Rac; inhibition of ARF6; preservation of endothelial barrier function;
blocking of VEGF
signaling downstream of the VEGF receptor; inhibition of vascular leak;
inhibition of
pathologic angiogenesis; and signal inhibition of multiple angiogenic,
permeability and
-36-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
inflammatory factors. In such an embodiment, a composition as described herein
may
include one or more compounds having the following chemical formula (Formula
2):
Xm N R1
N/ N 0
N
R2
wherein:
R' is chosen from optionally substituted aryl, optionally substituted
heteroaryl,
optionally substituted cycloalkyl, or optionally substituted heterocycle;
R2 is chosen from hydrogen, lower alkoxy, lower alkyl, halogen or hydroxy;
Z is chosen from 0, S, NH, alkylene or a single bond;
X is independently chosen from halogen, lower alkyl, lower alkoxy, heteroatom
lower
alkyl, hydroxy, or methylene dioxy, wherein two substituents together may form
a fused
cycloalkyl or heterocyclic ring structure;
mis0to5;or
pharmaceutically acceptable salts, solvates or hydrates thereof.
In one such embodiment, the one or more compounds are selected from the
following
compounds:
-37-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
`'--0
0
I c / (
N S ~
N/ 0
N
H3C0
/ I
F ~ N
S \
~
I
N/ N / 0
N
H3CH2CO
F
H
~ N
XX1N1i>
N
or H3CH2CO
or pharmaceutically acceptable salts, solvates or hydrates thereof.
In another embodiment, a composition according to the present description
includes a
nucleic acid that directly or indirectly modulates the activity of a targeted
molecule as
described herein. Nucleic acids that may be included in composition as
described herein may
be selected from, for example, aptamers, antisense molecules, siRNA,
ribozymes, and triple
helix molecules. Techniques for the production and use of such molecules are
known to
those of skill in the art, such as described herein or in U.S. Patent No.
5,800,998,
incorporated herein by reference.
Antisense RNA and DNA molecules act to directly block the translation of mRNA
by
binding to targeted mRNA and preventing protein translation. With respect to
antisense
DNA, oligodeoxyribonucleotides derived from the translation initiation site,
e.g., between the
-38-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
-10 and +10 regions of the target sequence are preferred. For example, an
antisense RNA or
DNA molecule may be included in a composition as described herein in a manner
that
reduces translation of one or more ARF proteins, including ARF6 or ARFI, or an
upstream
activator of an ARF protein, such as an ARF-GEF, including, for example, a
cytohesin or a
member of the ARNO family of cytohesins.
In one embodiment, a nucleic acid included in a composition as described
herein is a
small interfering RNA (siRNA) compounds or a modified equivalent thereof. In
another
embodiment, a nucleic acid included in a composition as described herein is a
double-
stranded small interfering RNA (siRNA) compound or a modified equivalent
thereof. For
example, an siRNA included in a composition as described herein may reduce
levels of one
or more ARF proteins, including ARF6 or ARF 1, or an upstream activator of an
ARF protein,
such as an ARF-GEF, including, for example, a cytohesin or a member of the
ARNO family
of cytohesins.
As is generally known in the art, siRNA compounds are RNA duplexes comprising
two complementary single-stranded RNAs of 21 nucleotides that form 19 base
pairs and
possess 3' overhangs of two nucleotides (See, Elbashir et al., Nature 411:494
498 (2001); and
PCT Publication Nos. WO 00/44895; WO 01/36646; WO 99/32619; WO 00/01846; WO
01/29058; WO 99/07409; and WO 00/44914). When appropriately targeted via its
nucleotide
sequence to a specific mRNA in cells, a siRNA can specifically suppress gene
expression
through a process known as RNA interference (RNAi) (See, e.g., Zamore &
Aronin, Nature
Medicine, 9:266 267 (2003)). siRNAs can reduce the cellular level of specific
mRNAs, and
decrease the level of proteins coded by such mRNAs. siRNAs utilize sequence
complementarity to target an mRNA for destruction, and are sequence-specific.
Thus, they
can be highly target-specific, and in mammals have been shown to target mRNAs
encoded by
different alleles of the same gene. Because of this precision, side effects
typically associated
with traditional drugs may be reduced or eliminated. In addition, they are
relatively stable,
and like antisense and ribozyme molecules, they can also be modified to
achieve improved
pharmaceutical characteristics, such as increased stability, deliverability,
and ease of
manufacture. Moreover, because siRNA molecules take advantage of a natural
cellular
pathway, i. e. , RNA interference, they are highly efficient in destroying
targeted mRNA
molecules
-39-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
In-vivo inhibition of specific gene expression by RNAi has been achieved in
various
organisms including mammals. For example, Song et al., Nature Medicine, 9:347
351 (2003)
demonstrate that intravenous injection of Fas siRNA compounds into laboratory
mice with
autoimmune hepatitis specifically reduced Fas mRNA levels and expression of
Fas protein in
mouse liver cells. The gene silencing effect persisted without diminution for
10 days after
the intravenous injection. The injected siRNA was effective in protecting the
mice from liver
failure and fibrosis. Song et al., Nature Medicine, 9:347 351 (2003). Several
other
approaches for delivery of siRNA into animals have also proved to be
successful (See, e.g.,
McCaffery et al., Nature, 418:38 39 (2002); Lewis et al., Nature Genetics,
32:107 108 (2002);
and Xia et al., Nature Biotech., 20:1006 1010 (2002)).
The siRNA compounds provided according to the present description can be
synthesized using conventional RNA synthesis methods. For example, they can be
chemically synthesized using appropriately protected ribonucleoside
phosphoramidites and a
conventional DNA/RNA synthesizer. Various applicable methods for RNA synthesis
are
disclosed in, e.g., Usman et al., J. Am. Chem. Soc., 109:7845 7854 (1987) and
Scaringe et al.,
Nucleic Acids Res., 18:5433 5441 (1990). Custom siRNA synthesis services are
available
from commercial vendors such as Ambion (Austin, Tex., USA), Dharmacon Research
(Lafayette, Colo., USA), Pierce Chemical (Rockford, Ill., USA), ChemGenes
(Ashland,
Mass., USA), Proligo (Hamburg, Germany), and Cruachem (Glasgow, UK).
A composition as described herein may be prepared as a pharmaceutical
formulation.
For example, in addition to one or more small molecules, proteins, peptides or
nucleic acids,
a composition as described may include a pharmaceutically acceptable carrier
to provide a
formulation that is suitable for therapeutic administration. As used herein,
"pharmaceutically
acceptable" refers to a material that is not biologically or otherwise
undesirable, i.e., the
material may be administered to a subject, along with the desired composition
(e.g., a desired
ligand, protein, peptide, nucleic acid, small molecule therapeutic, etc.),
without causing any
undesirable biological effects or interacting in a deleterious manner with any
of the other
components of the pharmaceutical composition in which it is contained. The
carrier would
naturally be selected to minimize any degradation of the active ingredient and
to minimize
any adverse side effects in the subject, as would be well known to one of
skill in the art.
A pharmaceutical composition according to the present description may be
prepared
in any for suitable for administration, such as a tableted composition, a
powder composition
-40-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
for encapsulation, a solution composition for encapsulation or parenteral
delivery, an
emulsion, or a suspension, such as a formulation that incorporates is
incorporated into
microparticles, a matrix material or liposomes. A pharmaceutical composition
as described
herein may include components that targeted to a particular cell type via
antibodies,
receptors, or receptor ligands. The following references are examples
formulation
technologies targeting specific proteins to tumor tissue (Senter, et al.,
Bioconjugate Chem.,
2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989);
Bagshawe, et al., Br.
J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9,
(1993); Battelli, et
al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie,
Immunolog.
Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062-
2065, (1991)).
Pharmaceutical carriers and their formulations are described, for example, in
Remington: The
Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing
Company,
Easton, PA 1995. Typically, an appropriate amount of a pharmaceutically-
acceptable salt is
used in the formulation to render the formulation isotonic. Examples of the
pharmaceutically-acceptable carrier include, but are not limited to, saline,
Ringer's solution
and dextrose solution. The pH of the solution is preferably from about 5 to
about 8, and more
preferably from about 7 to about 7.5. Further carriers include sustained
release preparations
such as semipermeable matrices of solid hydrophobic polymers containing the
antibody,
which matrices are in the form of shaped articles, e.g., films, liposomes or
microparticles. It
will be apparent to those persons skilled in the art that certain carriers may
be more preferable
depending upon, for instance, the route of administration and concentration of
composition
being administered. In addition to one or more carriers, a pharmaceutical
composition as
described herein may include one or more thickener, flavoring, diluent,
buffer, preservative,
antimicrobial agents, antiinflammatory agents, anesthetics, surface active
agent, and the like.
The herein disclosed compositions, including pharmaceutical composition, may
be
administered in a number of ways depending on whether local or systemic
treatment is
desired, and on the area to be treated. For example, the disclosed
compositions can be
administered intravenously, intraperitoneally, intramuscularly,
subcutaneously, intracavity,
transdermally orally, parenterally (e.g., intravenously), intratracheally,
ophthalmically,
vaginally, rectally, intranasally, topically or the like, including topical
intranasal
administration or administration by inhalant.
-41-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Parenteral administration of the composition, if used, is generally
characterized by
injection. Injectables can be prepared in conventional forms, either as liquid
solutions or
suspensions, solid forms suitable for solution of suspension in liquid prior
to injection, or as
emulsions. A revised approach for parenteral administration involves use of a
slow release or
sustained release system such that a constant dosage is maintained. See, e.g.,
U.S. Patent No.
3,610,795, which is incorporated by reference herein.
The compositions disclosed herein may be administered prophylactically to
patients
or subjects who are at risk for vascular permeability or pathologic
angiogenesis. Thus, the
method can further comprise identifying a subject at risk for vascular
penneability or
pathologic angiogenesis prior to administration of the herein disclosed
compositions.
The exact amount of the compositions required will vary from subject to
subject,
depending on the species, age, weight and general condition of the subject,
the severity of the
allergic disorder being treated, the particular nucleic acid or vector used,
its mode of
administration and the like. Thus, it is not possible to specify an exact
amount for every
composition. For example, effective dosages and schedules for administering
the
compositions may be determined empirically, and making such determinations is
within the
skill in the art. The dosage ranges for the administration of the compositions
are those large
enough to produce the desired effect in which the symptoms disorder are
affected. The
dosage should not be so large as to cause adverse side effects, such as
unwanted cross-
reactions, anaphylactic reactions, and the like. Generally, the dosage will
vary with the age,
condition, sex and extent of the disease in the patient, route of
administration, or whether
other drugs are included in the regimen. The dosage can be adjusted by the
individual
physician in the event of any counterindications. Dosage can vary, and can be
administered
in one or more dose administrations daily, for one or several days. Guidance
can be found in
the literature for appropriate dosages for given classes of pharmaceutical
products. For
example, guidance in selecting appropriate doses for antibodies can be found
in the literature
on therapeutic uses of antibodies, e.g., Handbook of Monoclonal Antibodies,
Ferrone et al.,
eds., Noges Publications, Park Ridge, N.J., (1985) ch. 22 and pp. 303-357;
Smith et al.,
Antibodies in Human Diagnosis and Therapy, Haber et al., eds., Raven Press,
New York
(1977) pp. 365-389
-42-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
METHODS
Methods of screening for or evaluating an agent that inhibits cellular
protrusive
activity, vascular leak, endothelial permeability, and/or pathologic
angiogenesis are provided
herein. In one embodiment, the method comprises determining the ability of
said agent to
affect the activation or activity of GIT1, including Robo4-mediated activation
of GIT1. For
example, Robo4-mediated activation of Gitl can be determined by the steps
comprising:
contacting a first cell expressing Robo4 with a candidate agent, contacting a
second cell
essentially identical to the first cell but substantially lacking Robo4 with
the candidate agent,
and assaying for GIT1 activation in the first and second cells, wherein
detectably higher Gitl
activation in the first cell as compared to the second cell indicates Robo4-
mediated Gitl
activation by said agent.
As disclosed herein, Robo4-mediated Gitl activation results in ARF6
inactivation.
ARF6 is involved in VEGF-mediated activation of Rac, which activates Pak,
which activates
MEK, which activates ERK, which promotes vascular permeability. Thus, as
disclosed herein
GITI activation can be assayed by detecting any of the components of the
signaling pathway
that is either activated or inactivated, and Robo4-mediated GIT1 activation
can be assayed by
detecting ARF6 inactivation, Rac inactivation, Pak inactivation, MEK
inactivation, or ERK
inactivation. It is understood that any other known or newly discovered method
of
monitoring this signaling pathway can be used in the disclosed methods.
Also provided is a method of screening for or evaluating an agent that
inhibits cellular
protrusive activity, vascular leak, endothelial permeability, and/or
pathologic angiogenesis,
comprising determining the ability of said agent to inhibit ARF6, Rac, Pak,
MEK, or ERK.
For example, in one embodiment, Robo4-mediated inhibition of ARF6, Rac, Pak,
MEK, or
Erk is determined by the steps comprising: contacting a first cell expressing
Robo4 with a
candidate agent, contacting a second cell essentially identical to the first
cell but substantially
lacking Robo4 with the candidate agent, assaying for inhibition of ARF6, Rac,
Pak, MEK,
ERK, or a combination thereof, in the first and second cells, wherein
detectably lower ARF6,
Rac, Pak, MEK, or ERK activation in the first cell as compared to the second
cell indicates
Robo4-mediated ARF6, Rac, Pak, MEK, or ERK inhibition by said agent.
Alternatively, the
ability of an agent to inhibit ARF6, Rac, Pak, MEK, or ERK in the absence of
Robo4
signaling may also be determined. In one such embodiment, the method
comprises:
- 43 -
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
contacting a first cell is with a candidate agent; contacting a second cell
identical to the first
cell with a control lacking the candidate agent; and assaying for inhibition
ARF6, Rac, Pak,
MEK, ERK, or a combination thereof, in the first and second cells, wherein
detectably lower
ARF6, Rac, Pak, MEK, or ERK activation in the first cell as compared to the
second cell
indicates inhibition of ARF6, Rac, Pak, MEK, or ERK inhibition by said agent.
Activation of signaling proteins such as Rac, Pak, MEK, ERK can be assayed by
detecting the phosphorylation of said proteins. Cell-based and cell-free
assays for detecting
phosphorylation of proteins are well known in the art and include the use of
antibodies,
including, for example, anti-Phosphoserine (Chemicori AB1603) (Chemicon,
Temecula,
CA), anti-Phosphothreonine (Chemicori AB 1607), and anti-Phosphotyrosine
(Chemicon
AB1599). Site-specific antibodies can also be generated specific for the
phosphorylated form
of DDX-3. The methods of generating and using said antibodies are well known
in the art.
The herein disclosed assay methods can be performed in the substantial absence
of
VEGF, TNF, thrombin, or histamine. Alternatively, the disclosed assay methods
can be
performed in the presence of a biologically active amount of VEGF, TNF,
thrombin, or
histamine.
"Activities" of a molecule, such as a protein or peptide molecule, include,
for
example, transcription, translation, intracellular translocation, secretion,
phosphorylation by
kinases, cleavage by proteases, homophilic and heterophilic binding to other
proteins,
ubiquitination.
In one embodiment, the method of screening described herein is a screening
assay,
such as a high-throughput screening assay. Thus, the contacting step can be in
a cell-based or
cell-free assay. For example, vascular endothelial cells can be contacted with
a candidate
agent either in vivo, ex vivo, or in vitro. The cells can be on in monolayer
culture but
preferably constitute an epithelium. The cells can be assayed in vitro or in
situ or the protein
extract of said cells can be assayed in vitro for the detection of activated
(e.g.,
phosphorylated) Rac, Pak, MEK, ERK. Endothelial cells can also be engineered
to express a
reporter construct, wherein the cells are contacted with a candidate agent and
evaluated for
reporter expression. Other such cell-based and cell-free assays are
contemplated for use
herein.
In a specific embodiment, a method for identifying an agent that inhibits
cellular
protrusive activity, vascular leak, endothelial permeability, and/or
pathologic angiogenesis
-44-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
involves an aptamer-displacement screen assay as described, for example, by
Hafner et al.
(Displacement of protein-bound aptamers with small molecules screened by
fluorescence
polarization, Nat Protoc (2008), 3, 579-587). In particular, such a method can
be used to
identify and confirm the activity of small molecules, such as those described
herein, for
inhibiting the activity of a targeted ARF-GEF, such as a cytohesin, a
cytohesin belonging to
the ARNO family of cytohesins or ARNO. In confirming such activity, active
agents capable
of inhibiting cellular protrusive activity, vascular leak, endothelial
permeability, and/or
pathologic angiogenesis can be identified. Such an aptamer-displacement screen
assay
utilizes displacement of a fluorescence-labeled aptamer protein inhibitor to
identify small
molecules with activity analogous to the fluorescence-labeled aptamer protein
inhibitor. The
association of the aptamer with its target is detected by fluorescence
polarization. The
fluorescence-labeled aptamer exhibits low polarization in the non-bound state.
When bound
to the target protein, the fluorescence polarization of the fluorescence-
labeled aptamer is
increased. If a small molecule displaces the aptamer from the protein, the
fluorescence
polarization of the fluorescence-labeled aptamer decreases, thereby allowing
identification of
small molecule candidates exhibiting activities analogous to the fluorescence
labeled
aptamer.
In general, candidate agents can be identified from libraries of natural
products or
synthetic (or semi-synthetic) extracts or chemical libraries according to
methods known in the
art. Those skilled in the field of drug discovery and development will
understand that the
precise source of test extracts or compounds is not critical to the screening
procedure(s) of
the invention. Accordingly, virtually any number of chemical extracts or
compounds can be
screened using the exemplary methods described herein. Examples of such
extracts or
compounds include, but are not limited to, plant-, fungal-, prokaryotic- or
animal-based
extracts, fermentation broths, and synthetic compounds, as well as
modification of existing
compounds. Numerous methods are also available for generating random or
directed
synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical
compounds,
including, but not limited to, saccharide-, lipid-, peptide-, polypeptide- and
nucleic acid-based
compounds. Synthetic compound libraries are commercially available, e.g., from
Brandon
Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, WI).
Alternatively, libraries
of natural compounds in the form of bacterial, fungal, plant, and animal
extracts are
commercially available from a number of sources, including Biotics (Sussex,
UK), Xenova
-45-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
(Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, Fla.), and
PharmaMar,
U.S.A. (Cambridge, Mass.). In addition, natural and synthetically produced
libraries are
produced, if desired, according to methods known in the art, e.g., by standard
extraction and
fractionation methods. Furthermore, if desired, any library or compound is
readily modified
using standard chemical, physical, or biochemical methods. In addition, those
skilled in the
art of drug discovery and development readily understand that methods for
dereplication
(e.g., taxonomic dereplication, biological dereplication, and chemical
dereplication, or any
combination thereof) or the elimination of replicates or repeats of materials
already known
for their effect should be employed whenever possible.
When a crude extract is found to have a desired activity, further
fractionation of the
positive lead extract is necessary to isolate chemical constituents
responsible for the observed
effect. Thus, the goal of the extraction, fractionation, and purification
process is the careful
characterization and identification of a chemical entity within the crude
extract having an
activity that stimulates or inhibits vascular permeability. The same assays
described herein
for the detection of activities in mixtures of compounds can be used to purify
the active
component and to test derivatives thereof. Methods of fractionation and
purification of such
heterogenous extracts are known in the art. If desired, compounds shown to be
useful agents
for treatment are chemically modified according to methods known in the art.
Compounds
identified as being of therapeutic value may be subsequently analyzed using
animal models
for diseases or conditions in which it is desirable to regulate vascular
permeability.
Methods for inhibiting cellular protrusive activity, vascular leak,
endothelial
permeability, and/or pathologic angiogenesis in a subject are also provided
herein. As is
detailed herein, activation of Robo4 inhibits or reduces the activation of
ARF6, and thereby
inhibits vascular permeability. As described herein, activation of Robo4
signaling achieves
such effects through initiation of paxillin activation of GIT1, which, in
turn, leads to GITI
inhibition of ARF6. Therefore, in one embodiment, a method for inhibiting
cellular
protrusive activity, vascular leak, endothelial permeability, and/or
pathologic angiogenesis as
described herein comprises administering a therapeutically effective amount of
a composition
as described herein to a subject in need thereof. In one such embodiment, the
method
includes administering a therapeutically effective amount of a Robo4 ligand
according to the
present description to achieve an effect selected from one or more of
inhibition of Rac,
inhibition of Rac activation by VEGF, preservation of endothelial cell barrier
function,
-46-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
inhibition of VEGF signaling downstream of the VEGF receptor, inhibition of
vascular leak,
and inhibition of multiple angiogenic, permeability and inflammatory factors.
However, as is further described herein, the inhibition of vascular
permeability or
pathologic angiogenesis resulting from Robo4 signaling can also be achieved
without
activation of Robo4, in particular, modulation of one or more downstream steps
in the Robo4
signaling pathway described herein can also inhibit cellular protrusive
activity, vascular leak,
endothelial permeability, and/or pathologic angiogenesis. In one such
embodiment, a method
as described herein comprises modulating one or more of the steps in the Robo4
signaling
pathway such to achieve an effect selected from one or more of inhibition of
Rac, inhibition
of Rac activation by VEGF, preservation of endothelial cell barrier function,
inhibition of
VEGF signaling downstream of the VEGF receptor, inhibition of vascular leak,
and
inhibition of multiple angiogenic, permeability and inflammatory factors.
In one such embodiment, a method as described herein comprises directly or
indirectly inhibiting activation of ARF6. For example, in one embodiment, a
method for
inhibiting cellular protrusive activity, vascular leak, endothelial
permeability, and/or
pathologic angiogenesis includes inhibiting an upstream activator of ARF6. In
one such
embodiment, the method includes inhibiting the activity of one or more ARF-GEF
or other
cytohesin family GEFs such that the activity of one or more protein of the ARF
family of
proteins is reduced. For example, the method may include providing a
composition including
one or more molecules that decrease the activity, activation or availability
of a cytohesin,
such as ARNO or a cytohesin belonging to the ARNO family of cytohesins, such
that fewer
ARF6 proteins are in a GTP-bound state, thereby reducing the pool of active
ARF proteins.
In another such embodiment, the method includes promoting the activity of an
upstream
inhibitor of ARF6. In one such embodiment, the method includes increasing the
activity of
one or more ARF-GAP such that the activity or activation of one or more
protein from the
ARF family of proteins is reduced. For example, the method may include
providing a
composition that includes one or more molecules that increase the activity or
availability of
individual Gitl proteins such that fewer ARF proteins are activated, thereby
reducing a signal
cascade acting through or propogated by the ARF proteins. In such embodiments,
where
activity of the ARF family of proteins is targeted, the ARF protein(s)
affected may be
selected from, for example, ARF6 and ARF 1.
-47-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
In each of the methods for inhibiting cellular protrusive activity, vascular
leak,
endothelial permeability, and/or pathologic angiogenesis, a composition as
described herein
may be used to directly inhibit ARF6 activity, to inhibit an upstream
activator of ARF6, or to
promote an upstream inhibitor of ARF6. In a specific embodiment, a method for
inhibiting
cellular protrusive activity, vascular leak, endothelial permeability, and/or
pathologic
angiogenesis comprises inhibiting ARF6 activity by administration of a small
molecule,
protein, peptide or nucleic acid as described herein. In another embodiment, a
method for
inhibiting vascular permeability or pathologic angiogenesis comprises
inhibiting ARF6
activity by administration of an activator of an ARF-GAP, such as Gitl. In yet
another
embodiment, a method for inhibiting cellular protrusive activity, vascular
leak, endothelial
permeability, and/or pathologic angiogenesis comprises administering an
inhibitor of ARF6
activation of Rac.
In specific embodiments, a method for vascular leak or endothelial
permeability as
described herein includes inhibiting cellular protrusive activity, vascular
leak, endothelial
permeability, and/or pathologic angiogenesis experienced by a subject that is
associated with
a disease state selected from infectious and non-infectious diseases that may
result in a
cytokine storm, graft versus host disease (GVHD), adult respiratory distress
syndrome
(ARDS), sepsis, avian influenza, smallpox, and systemmic inflammatory response
syndrome
(SIRS), ischemia/reperfusion injury following stroke or myocardial infarction,
edema
associated with brain tumors, ascites associated with malignancies, Meigs'
syndrome, lung
inflammation, nephrotic syndrome, pericardial effusion and pleural effusion,
inflammation,
allergic diseases, cancer, cerebral stroke, myocardial infarction, pulmonary
and cardiac
insufficiency, renal failure, and retinopathies.
Additionally, in specific embodiment, a method for inhibiting pathologic
angiogenesis
as described herein includes inhibiting pathologic angiogenesis experienced by
a subject that
is associated with a disease state selected from hemangioma, solid tumors,
leukemia,
metastasis, telangiectasia psoriasis scleroderma, pyogenic granuloma,
myocardial
angiogenesis, plaque neovascularization, coronary collaterals, ischemic limb
angiogenesis,
corneal diseases, rubeosis, neovascular glaucoma, diabetic retinopathy (DR),
retrolental
fibroplasia, non-proliferative diabetic macular edema (DME), arthritis,
diabetic
neovascularization, age-related macular degeneration (AMD), retinopathy of
prematurity
-48-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
(ROP), ischemic retinal vein occlusion (IRVO), wound healing, peptic ulcer,
fractures,
keloids, vasculogenesis, hematopoiesis, ovulation, menstruation, and
placentation.
In another embodiment, a method of treating or preventing avian flu is
provided,
wherein the method comprises identifying a subject having or at risk of having
said avian flu,
and administering to the subject a therapeutically effective amount of a
composition as
described herein.
In another embodiment, a method of treating or preventing adult respiratory
distress
syndrome (ARDS) is provided, wherein the method comprises identifying a
subject having or
at risk of having said ARDS, and administering to the subject a
therapeutically effective
amount of a composition as described herein.
In another embodiment, a method of treating or preventing systemic
inflammatory
response syndrome (SIRS) is provided, wherein the method comprises identifying
a subject
having or at risk of having said SIRS, and administering to the subject a
therapeutically
effective amount of a composition as described herein.
In another embodiment, a method of treating or preventing graft versus host
disease
(GVHD) is provided, wherein the method comprises identifying a subject having
or at risk of
having said RDS, and administering to the subject a therapeutically effective
amount of a
composition as described herein.
In another embodiment, a method of treating or preventing tumor formation or
growth
is provided, wherein the method comprises identifying a subject having or at
risk of having
said tumor formation or growth, and administering to the subject a
therapeutically effective
amount of a composition as described herein.
In another embodiment, a method of treating or preventing respiratory distress
syndrome (RDS) is provided, wherein the method comprises identifying a subject
having or
at risk of having said RDS, and administering to the subject a therapeutically
effective
amount of a composition as described herein.
In another embodiment, a method of treating or prevention ischemic retinal
vein
occlusion (IRVO) in a subject is provided, wherein the method comprises
identifying a
subject having or at risk of having said IRVO, and administering to the
subject a
therapeutically effective amount of a composition as described herein.
In another embodiment, a method of treating or preventing non-proliferative
diabetic
macular edema (DME) in a subject is provided, wherein the method comprises
identifying a
-49-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
subject having or at risk of having said DME, and administering to the subject
a
therapeutically effective amount of a composition as described herein.
In another embodiment, a method of treating or preventing retinopathy of pre-
maturity (ROP) is provided, wherein the method comprises identifying a subject
having or at
risk of having said ROP, and administering to the subject a therapeutically
effective amount
of a composition as described herein.
In another embodiment, a method of treating or preventing diabetic retinopathy
(DR)
in a subject is provided, wherein the method comprises identifying a subject
having or at risk
of having said DR, and administering to the subject a therapeutically
effective amount of a
composition as described herein.
In another embodiment, a method of treating or preventing wet macular
degeneration
(AMD) in a subject is provided, wherein the method comprises identifying a
subject having
or at risk of having said AMD, and administering to the subject a
therapeutically effective
amount of a composition as described herein.
In another embodiment, a method of treating or preventing ischemia in a
subject is
provided, wherein the method comprises identifying a subject having or at risk
of having said
ischemia, and administering to the subject a therapeutically effective amount
a composition
as described herein.
In another embodiment, a method of treating or preventing hemorrhagic stroke
in a
subject is provided, wherein the methods comprises identifying a subject
having or at risk of
having said hemorrhagic stroke, and administering to the subject a
therapeutically effective
amount of a composition as described herein.
In another embodiment, a method of treating or preventing reperfusion injury,
such as
that observed in myocardial infarction and stroke, in a subject is provided,
wherein the
method comprises identifying a subject having or at risk of having said
reperfusion injury,
and administering to the subject a therapeutically effective amount of a
composition as
described herein.
In another embodiment, a method of treating or preventing a dermal vascular
blemish
or malformation in a subject is provided, wherein the method comprises
identifying a subject
having or at risk of having said blemish, and administering to the skin of the
subject a
therapeutically effective amount of a composition as described herein.
-50-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
In some aspects, subjects are identified by medical diagnosis. For example,
subjects
with diabetic retinopathy and macular degeneration can be identified by
visualization of
excess blood vessels in the eyes. Acute lung injury can be diagnosed by lung
edema in the
absence of congestive heart failure. Ischemic stroke can be diagnosed by
neurologic
presentation and imaging (MRI and CT). Other known or newly discovered medical
determinations can be used to identify subjects for use in the disclosed
methods.
In addition, subjects can be identified by genetic predisposition. For
example, genes
that predispose patients to age related macular degeneration have been
identified (Klein RJ, et
al, 2005; Yang Z, et al. 2006; Dewan A, et al. 2006). Likewise, genetic
mutations that
predispose patients to vascular malformations in the brain have been
identified (Plummer
NW, et al., 2005). Other known or newly discovered genetic determinations can
be used to
identify subjects for use in the disclosed methods.
EXAMPLES
The Examples that follow are offered for illustrative purposes only and are
not
intended to limit the scope of the compositions and methods described herein
in any way. In
each instance, unless otherwise specified, standard materials and methods were
used in
carrying out the work described in the Examples provided. All patent and
literature
references cited in the present specification are hereby incorporated by
reference in their
entirety.
The practice of the present invention employs, unless otherwise indicated,
conventional techniques of chemistry, molecular biology, microbiology,
recombinant DNA,
genetics, immunology, cell biology, cell culture and transgenic biology, which
are within the
skill of the art (See, e.g., Maniatis, T., et al. (1982) Molecular Cloning: A
Laboratory Manual
(Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.); Sambrook, J., et
al. (1989)
Molecular Cloning: A Laboratory Manual, 2d Ed. (Cold Spring Harbor Laboratory,
Cold
Spring Harbor, N.Y.); Ausubel, F. M., et al. (1992) Current Protocols in
Molecular Biology,
(J. Wiley and Sons, NY); Glover, D. (1985) DNA Cloning, I and II (Oxford
Press); Anand,
R. (1992) Techniques for the Analysis of Complex Genomes, (Academic Press);
Guthrie, G.
and Fink, G. R. (1991) Guide to Yeast Genetics and Molecular Biology (Academic
Press);
Harlow and Lane (1988) Antibodies: A Laboratory Manual (Cold Spring Harbor
Laboratory,
Cold Spring Harbor, N.Y.); Jakoby, W. B. and Pastan, I. H. (eds.) (1979) Cell
Culture.
Methods in Enzymology, Vol. 58 (Academic Press, Inc., Harcourt Brace
Jovanovich (NY);
-51-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984);
Transcription And
Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells
(R. I.
Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press,
1986); B.
Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods
In
Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian
Cells (J.
H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods
In
Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell
And
Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987);
Handbook Of
Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds.,
1986);
Hogan et al. (eds) (1994) Manipulating the Mouse Embryo. A Laboratory Manual,
2 nd
Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. A
general
discussion of techniques and materials for human gene mapping, including
mapping of
human chromosome 1, is provided, e.g., in White and Lalouel (1988) Ann. Rev.
Genet.
22:259 279. The practice of the present invention employs, unless otherwise
indicated,
conventional techniques of chemistry, molecular biology, microbiology,
recombinant DNA,
genetics, and immunology. (See, e.g., Maniatis et al., 1982; Sambrook et al.,
1989; Ausubel
et al., 1992; Glover, 1985; Anand, 1992; Guthrie and Fink, 1991).
Nothing herein is to be construed as an admission that the present invention
is not
entitled to antedate such disclosure by virtue of prior invention. No
admission is made that
any reference constitutes prior art. The discussion of references states what
their authors
assert, and applicants reserve the right to challenge the accuracy and
pertinence of the cited
documents. It will be clearly understood that, although a number of
publications are referred
to herein, such reference does not constitute an admission that any of these
documents forms
part of the common general knowledge in the art.
EXAMPLE 1
Robo4 is Required for Vascular Guidance in vivo: During the past decade, the
zebrafish has become an attractive model for analysis of vascular development
(Weinstein,
2002), and was chosen to investigate the biological importance of Robo4 in
vivo. To suppress
Robo4 gene expression, a previously described splice-blocking morpholino that
targets the
exonl0-intronl0 boundary of Robo4 pre-mRNA (Bedell et al., 2005) was used. To
verify the
efficacy of the Robo4 morpholino, RNA was isolated from un-injected and
morpholino-
injected embryos, and analyzed by RT-PCR with primers flanking the targeted
exon (FIG.
-52-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
8A). Injection of the Robo4 morpholino resulted in complete loss of wild-type
RNA when
compared to the un-injected control, indicating that morphant zebrafish are
functionally null
for Robo4 (FIG. 8B).
TG(flil: egfp)1' zebrafish embryos, which express green fluorescent protein
under the
control of the endothelialspecific f il promoter, and permit detailed
visualization of the
developing endothelium in vivo were utilized to evaluate the consequence of
morpholino-
mediated knockdown of Robo4 on vascular development (FIG. 1 A; Lawson and
Weinstein,
2002). At 48 hpf, Robo4 MO-injected embryos exhibited wild-type formation of
the primary
axial vessels (dorsal aorta and posterior cardinal vein), as well as the
dorsal longitudinal
anastomotic vessel and parachordal vessel, indicating that vasculogenesis and
angiogenesis,
respectively, are not affected by reduction of Robo4 levels (FIG. 1 B, right
panel). However,
a striking degree of abnormality was observed in the architecture of the
intersegmental
vessels in Robo4 morphants. In wild-type embryos, the intersegmental vessels
arise form the
dorsal aorta and grow toward the dorsal surface of the embryo, tightly apposed
to the somitic
boundary. It is this precise trajectory between the somites that defines the
characteristic
chevron shape of the intersegmental vessels (FIG. lA, right panel). Rather
than adopting this
stereotypical pattern, the intersegmental vessels of Robo4 morphant embryos
grew the wrong
direction (FIG. 1 B, right panel: white arrows indicate abnormal vessels). At
48 hpf, 60% of
embryos injected with the Robo MO exhibited this defect, compared to 5% in
wild-type
embryos. Importantly, Robo4 morphants were indistinguishable from control
embryos by
phase microscopy, indicating that the observed vascular patterning defects
were not a result
of gross morphological perturbation. Together, these data demonstrate a
requirement for
Robo4 during zebrafish vascular development and suggest that functional output
from the
receptor elicits a repulsive guidance cue.
EXAMPLE 2
The Robo4 Cytoplasmic Tail is required for Vascular Guidance in vivo: It was
next
determined whether the vascular defects observed in Robo4 morphants could be
suppressed
by reconstitution of robo4. robo4 MO and wildtype murine Robo4 RNA, which is
refractory
to the morpholino, were injected into TG(fli1: egfp)yl embryos and vascular
patterning was
analyzed at 48 hpf. Robo4 RNA restored the stereotypic patterning of the trunk
vessels in
approximately 60% of morphant embryos, confirming the specificity of gene
knockdown
(FIG. 1B and C, right panels).
-53-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
The ability of the robo4 to regulate vascular development is likely a
consequence of
its ability to transmit cytoplasmic signals. To substantiate this notion,
Robo4 MO and a
mutant form of murine Robo4 lacking the portion of the receptor that interacts
with
cytoplasmic components (robo40tail) was co-injected and vessel architecture
evaluated at 48
hpf. Unlike wild-type Robo4 RNA, robo4Atail was unable to rescue patterning
defects in
morphant embryos (FIG. 1 B and D, right panels). These data demonstrate that
information
contained in the cytoplasmic tail of Robo4 is critical for vascular guidance
during zebrafish
embryogenesis. All together, these in vivo analyses indicate that Robo4
activity is required
for precisely defining the trajectory of the intersegmental vessels during
vertebrate vascular
development (FIG. 1 E).
EXAMPLE 3
The Robo4 Cytoplasmic Tail is required for Inhibition of Haptotaxis: Slit2-
Robo4
signaling inhibits migration of primary endothelial cells towards a gradient
of VEGF, and of
HEK 293 cells ectopically expressing Robo4 towards serum (Park et al., 2003;
Seth et al.,
2005). In addition to soluble growth factors, immobilized extracellular matrix
proteins such
as fibronectin play a critical role in cellular motility (Ridley et al.,
2003), and gradients of
fibronectin can direct migration in a process called haptotaxis. Indeed it has
been shown that
fibronectin is deposited adjacent to migrating endothelial cells in the early
zebrafish embryo
(Jin et al., 2005). The observation that Robo4 is required for proper
endothelial cell migration
in vivo (FIG. 1), indicated the ability of Slit2-Robo4 signaling to modulate
fibronectin-
induced haptotaxis. HEK 293 cells were transfected with Robo4 or Robo4ATail
(FIG. 2A)
and subjected to haptotaxis migration assays on membranes coated with a
mixture of
fibronectin and Slit2 (Slit2N (SEQ ID NO: 7)). Slit2 inhibited fibronectin-
induced migration
of cells expressing Robo4, but not Robo4ATail, demonstrating that the Robo4
cytoplasmic
tail is critical for repulsive activity of the receptor (FIG. 2B).
The region of the Robo4 cytoplasmic tail that is required for inhibition of
cell
migration was next defined. HEK 293 cells were transfected with Robo4 deletion
constructs
(FIG. 2A) and subjected to haptotaxis migration assays. Fibronectin-dependent
migration of
cells expressing Robo4-NH2, but not Robo4-COOH was inhibited by Slit2 (FIG.
2C),
demonstrating that the N-terminal half of the Robo4 cytoplasmic tail is
necessary and
sufficient for modulation of cell motility.
-54-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
To assess whether Slit2-Robo4 signaling inhibited spreading, we transfected
HEK
293 cells with Robo4, Robo4 ED-TM or empty vector (pcDNA3) and subjected them
to
adhesion and spreading assays on fibronectin. Although cells expressing Robo4
adhered
normally to coverslips coated with fibronectin and Slit2 (data not shown),
they spread
significantly less than cells transfected with Robo4 ED-TM or pcDNA3 (FIG.
26B),
indicating that Slit2-Robo4 signaling modulates intracellular pathways that
control cell
spreading.
The inability of Robo4 ED-TM to inhibit spreading showed that the Robo4
cytoplasmic domain is required for this activity; to test whether it is
sufficient for inhibition
of spreading, we generated an allb Integrin-Robo4 chimeric protein, in which
the
cytoplasmic domain of Robo4 was fused to the C-terminal tail of the integrin
allb subunit
((xIIb-Robo4), thus enabling us to initiate Robo4 signaling with fibrinogen, a
ligand for
aIIbP3 integrin. We plated Chinese Hamster Ovary (CHO-Kl) cells expressing
allb and (33
subunits (aIIb:(33) or allb-Robo4 and (33 subunits ((xIlb-Robo4:(33) on
fibronectin alone or a
mixture of fibronectin/fibrinogen. altb:(33 expressing cells spread to the
same extent on
either matrix, while spreading of allb-Robo4:(33 expressing cells was
significantly inhibited
in the presence of fibrinogen (FIG. 26C).
We next defined the region of the Robo4 cytoplasmic tail that is required for
inhibition of cell migration. HEK 293 cells were transfected with Robo4
deletion constructs
(FIG. 26A) and subjected to haptotaxis migration assays. Fibronectin-dependent
migration of
cells expressing Robo4-NH2, but not Robo4-COOH was inhibited by Slit2 (Slit2N
(SEQ ID
NO: 7)) (FIG. 2C), demonstrating that the N-terminal half of the Robo4
cytoplasmic tail is
necessary and sufficient for modulation of cell motility.
EXAMPLE 4
Paxillin Family Members are Robo4-interacting Proteins: Identification of the
region
of the Robo4 cytoplasmic tail that confers functional activity allowed the
search for
cytoplasmic components that might regulate Robo4 signal transduction. Using
the N-
terminal half of the Robo4 tail as a bait, a yeast two-hybrid screen of a
human aortic cDNA
library was performed, which identified a member of the paxillin family of
adaptor proteins,
Hic-5, as a potential Robo4-interacting protein (FIG. 8). To verify this
interaction, Hic-5
plasmids were isolated and re-transformed into yeast with Robo4 or empty
vector. Only
strains co-expressing Robo4 and Hic-5 were competent to grow on nutrient
deficient medium
-55-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
and induce robust betagalactosidase activity (FIG. 8B). To further confirm
this interaction,
co-immunoprecipitation experiments were performed using mammalian cells co-
transfected
with Hic-5 and the Robo4 cytoplasmic tail. Hic-5 was found in anti-Robo4
immunoprecipitates of HEK 293 cells expressing Robo4 and Hic-5, but not Hic-5
alone (FIG.
3A). Collectively, these data demonstrate that Hic-5 specifically interacts
with the Robo4
cytoplasmic tail in both yeast and mammalian cells.
Hic-5 and its paralog, paxillin, can exhibit cell-type specific expression
(Turner, 2000;
Yuminamochi et al., 2003). For this reason, it was determined which of these
proteins were
expressed in HEK 293 cells, the cell line used in the haptotaxis migration
assays. Western
blotting of cell lysates from CHO-Kl, HEK 293 and NIH3T3 cells with antibodies
to Hic-5
or paxillin detected paxillin in all cell lines, whereas Hic-5 was only found
in CHO-K1 and
NIH3T3 cells (FIG. 3B). This not only suggested that Hic-5 and paxillin could
interact with
Robo4 to regulate cell migration, but that paxillin was the likely binding
partner in HEK 293
cells. With this latter idea in mind, co-immunoprecipitation experiments were
performed
using mammalian cells expressing paxillin and the Robo4 cytoplasmic tail. As
was observed
with Hic-5, paxillin was identified in anti-Robo4 immunoprecipitates of HEK
293 cells
expressing paxillin and Robo4, but not paxillin alone (FIG. 3C).
Since Slit2 is a physiological ligand of Robo4 (Park et al., 2003; Hohenester
et al.,
2006), it was determined whether Slit2 stimulation regulated the interaction
between Robo4
and paxillin. HEK 293 cells expressing Robo4 were incubated in the presence or
absence of
Slit2 (Slit2N (SEQ ID NO: 7)). In the presence of Slit2, endogenous paxillin
was detected in
Robo4 immunoprecipitates. In sharp contrast, in the absence of Slit2, no
paxillin was
detected in the immunoprecipitates (FIG. 3E). Thus, engagement of Robo4 by
Slit2
stimulated its association with paxillin.
EXAMPLE 5
Identification of the Paxillin Interaction Motif of Robo4: To precisely define
the
region of Robo4 that is required for interaction with paxillin a series of GST-
Robo4 fusion
proteins spanning the entire length of the cytoplasmic tail were created (FIG.
4A). In vitro
binding assays with purified recombinant paxillin demonstrated that the amino
terminal half
of the Robo4 tail (494-731) is necessary and sufficient for direct interaction
with paxillin
(FIG. 4B). Four additional GST-Robo4 fusion proteins encompassing
approximately 70
amino acid fragments of the amino terminal half of the cytoplasmic tail were
then generated
-56-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
(FIG. 4C). In vitro binding assays revealed that paxillin selectively
interacts with a fragment
of the Robo4 tail residing between the CCO and CC2 motifs (604-674; FIG. 4D).
To
determine whether this region of Robo4 was necessary for interaction with
paxillin amino
acids 604-674 were deleted from the cytoplasmic tail and this mutant GST-Robo4
fusion
protein subjected to in vitro binding assays. While interaction with paxillin
was attenuated, so
was interaction with a known Robo4-binding protein, Mena, indicating that
elimination of
amino acids 604-674 affects the conformation of the Robo4 tail. To circumvent
this issue,
smaller deletions were created within this 70 amino acid stretch and
additional in vitro
binding assays performed. Using this approach a mutant GST-Robo4 fusion
protein was
identified lacking 36 amino acids (604-639; FIG. 9) that lost binding to
paxillin, but retained
binding to Mena (FIG. 4E). This region of Robo4 is heretofore referred to as
the paxillin
interaction motif (PIM).
EXAMPLE 6
The Paxillin Interaction Motif is required for Robo4-dependent Inhibition of
Haptotaxis: It was next determined whether the paxillin interaction motif of
Robo4 is
important for functional activity of the receptor. A mutant form of full
length Robo4 lacking
amino acids 604-639 (Robo4APIM) was generated by site directed mutagenesis and
used in
haptotaxis migration assays. Robo4APIM failed to mediate Slit2-directed
inhibition of
migration towards a gradient of fibronectin (FIG. 4F), demonstrating that the
region of the
Robo4 tail necessary for paxillin binding is likewise required for Robo4-
dependent inhibition
of protrusive activity.
EXAMPLE 7
Slit2-Robo4 Signaling Inhibits Cell Spreading and Rac and ARF6: The ability of
immobilized Slit2 to inhibit the migration of cells expressing Robo4 on
fibronectin could
potentially result from negative regulation of adhesion and/or spreading on
this ECM protein.
To determine whether Slit2-Robo4 signaling influences these processes, HEK 293
cells were
transfected with Robo4 or empty vector (pcDNA3) and subjected to adhesion and
spreading
assays on fibronectin. Although cells expressing Robo4 adhered normally to
coverslips
coated with fibronectin and Slit2 (Slit2N (SEQ ID NO: 7)), they were
significantly less
spread than cells transfected with pcDNA3 (FIG. 5A). These data indicate that
Slit2-Robo4
signaling modulates intracellular pathways that control cell spreading.
-57-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
The ability of a cell to spread on an ECM protein, such as fibronectin, is
regulated by
activation of the Rho family of small GTPases, which include Rho, Cdc42 and
Rac migration
(Nobes and Hall, 1995; Nobes and Hall, 1998). Of these proteins, Rac plays an
essential role
in promoting the actin polymerization that leads to cell spreading and
migration (Nobes and
Hall, 1995; Nobes and Hall, 1998). This established relationship between Rac
and cell
spreading indicated that Slit2-Robo4 signaling might inhibit adhesion-
dependent activation of
Rac. To evaluate this, HEK 293 cells were transfected with Robo4 or pcDNA3,
plated onto
dishes coated with fibronectin and Slit2 (Slit2N (SEQ ID NO: 7)) and Rac-GTP
levels were
assayed using GST-PBD pull down assays. Additionally, cells expressing
aIIb:(33 or aIIb-
Robo4:(33 were plated on fibronectin and fibrinogen, and Rac-GTP levels were
analyzed.
Cells expressing Robo4 or aIIb-Robo4:(33 exhibited significantly less adhesion-
stimulated
Rac activation when compared to cells transfected with pcDNA3 or aIlb:03 (FIG.
513, 5C
and FIG. 27). We repeated these experiments with the Robo4APIM, and found that
cells
expressing this mutant receptor were refractory to Slit2 (FIG. 5E).
Cdc42 activation was also examined in cells expressing Robo4. We found that
Cdc42
activation in cells expressing Robo4 was unaltered by exposure to Slit2 (FIG.
11A). This
result is supported by the observation that Robo4 does not interact with the
Robol binding-
protein srGAP 1, a known GTPase activating protein for Cdc42 (FIG. 11 B).
Together, these
data demonstrate that Slit2-Robo4 signaling specifically inhibits adhesion-
induced activation
of Rac.
To confirm that Robo4-dependent inhibition of cell spreading was due
principally to
suppression of Rac activation, we co-transfected HEK 293 cells with Robo4 and
a dominant
active form of Rac, Rac (G12V), and subjected them to spreading assays. Cells
expressing
Rac (G12V) were refractory to Robo4-dependent inhibition of cell spreading
(FIG. 5G),
demonstrating that Slit2-Robo4 signaling blocks protrusive activity by
inhibiting Rac.
Our finding that Robo4 interacts with paxillin and inhibits protrusive
activity
prompted us to determine whether Robo4 signaling impinges upon the ARF6
pathway. Cells
expressing aIIb-Robo4: (33 were plated on fibronectin alone, or fibronectin
and fibrinogen,
and ARF6-GTP levels were analyzed using a GST-GGA3 affinity precipitation
technique.
While fibronectin stimulated activation of ARF6, fibrinogen reduced Arf6-GTP
levels in cells
expressing aIIb-Robo4:(33 (FIG. 16A). This result demonstrated that Robo4
signaling
-58-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
inhibits ARF6 activation and suggested that Robo4's ability to block Rac
activity stems from
its regulation of ARF6.
EXAMPLE 8
The Paxillin Interaction Motif is required for Robo4-dependent Inhibition of
Cell
Spreading and Rac Activation: Whether Robo4APIM was competent to inhibit
fibronectin-
induced cell spreading and Rac activation was next evaluated. HEK 293 cells
were
transfected with Robo4APIM, plated onto fibronectin and Slit2 coated surfaces
and subjected
to spreading or Rac assays. This mutant form of the receptor was incapable of
inhibiting cell
spreading and adhesion-dependent Rac activation (FIG. 5D, E and F),
demonstrating that the
paxillin interaction motif is essential for functional activity of Robo4 in
vitro.
To confirm that Robo4-dependent inhibition of cell spreading was due
principally to
suppression of Rac activation, HEK 293 cells were co-transfected with Robo4
and a
dominant active form of Rac, Rac (G12V), and subjected to spreading assays.
Cells
expressing Rac (G12V) were refractory to Robo4-dependent inhibition of cell
spreading
(FIG. 5G), demonstrating that Slit2-Robo4 signaling blocks spreading by
inhibiting Rac
activity.
EXAMPLE 9
Slit2 Inhibits VEGF-induced Rac Activation in Primary Human Endothelial Cells:
Slit2 inhibits VEGF-stimulated migration of several primary human endothelial
cell lines
(Park et al., 2003), and Rac plays an essential role for in VEGF-induced cell
motility (Soga et
al., 2001a; Soga et al., 2001b). It was therefore determined whether Slit2-
Robo4 signaling
could inhibit Rac activation in an endogenous setting. Human Umbilcal Vein
Endothelial
Cells (HUVEC) were stimulated with VEGF in the presence and absence of Slit2
(Slit2N
(SEQ ID NO: 7)), and GTP-Rac levels were analyzed using GST-PBD pull down
assays.
Slit2 treatment completely suppressed VEGF-stimulated Rac activation (FIG. 5H
and I),
demonstrating that endogenous Slit2-Robo4 signaling modulates Rac activation.
EXAMPLE 10
Lim4 of Paxillin is required for Interaction with Robo4 and Robo4-dependent
Inhibition of Cell Spreading: Although Robo4APIM maintains its interaction
with Mena
(FIG. 4E), it is possible that this mutation perturbed interaction of Robo4
with proteins other
than paxillin. To address this issue definitively, paxillin mutants were
generated that disrupt
association with Robo4. Paxillin is a modular protein composed of N-terminal
-59-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
leucine/aspartic acid (LD) repeats and C-terminal Lim domains (FIG. 6A).
Analysis of the
clones recovered from the yeast two-hybrid screen (see FIG. 9A) indicated that
the Lim
domains, particularly Lim3 and Lim4, are important for interaction with Robo4.
To validate
this notion, co-immunoprecipitation experiments were performed using HEK 293
cells co-
transfected with the Robo4 tail and either paxillin-LD or paxillin-Lim.
Paxillin-Lim, but not
paxillin-LD was found in Robo4 immunoprecipitates (FIG. 6B), demonstrating
that the Lim
domains of paxillin are necessary and sufficient for interaction with Robo4.
To clarify which
Lim domain is required for binding to Robo4, serial deletions were made from
the carboxy
terminus of paxillin, cotransfected with the Robo4 tail into HEK 293 cells,
and
coimmunoprecipitation experiments performed. Deletion of the Lim4 domain of
paxillin
completely abrogated binding to Robo4 (FIG. 6C), demonstrating that this
region of paxillin
is critical for its ability to interact with Robo4.
Delineation of the Robo4 binding site on paxillin allowed direct evaluation of
the role
of paxillin in Robo4-dependent inhibition of cell spreading. Endogenous
paxillin was
knocked-down in HEK 293 cells using siRNA and reconstituted with wild type
chicken
paxillin (Ch-paxillin) or Ch-paxillin ALim4 (FIG. 6D). These cells were then
subjected to
spreading assays on coverslips coated with fibronectin and Slit2 (Slit2N (SEQ
ID NO: 7)).
Cells expressing Ch-paxillin ALim4 were refractory to Robo4-dependent
inhibition of cell
spreading, while cells expressing Ch-paxillin exhibited the characteristic
reduction in cell
area (FIG. 6E). These data confirm that interaction of paxillin with the Robo4
enables Slit2-
Robo4 signaling to suppress cell spreading.
EXAMPLE I1
The Paxillin Interaction Motif is required for Vascular Guidance in vivo: The
requirement of the paxillin interaction motif of Robo4 during zebrafish
vascular development
was assessed. As described previously, injection of robo4 MO into TG (flil:
egfp)" embryos
caused disorganization of the intersegmental vessels (see FIG. 1B). Co-
injection of
robo44PIM RNA exacerbated the defects caused by the robo4 MO, while wild-type
robo4
RNA suppressed these defects (FIG. 7A). The inability of both robo44tail and
robo44PIM
RNA to rescue vascular patterning defects in morphant embryos demonstrates
that the 36
amino acid paxillin interaction motif is a critical signal transduction module
in the Robo4
cytoplasmic tail. Further, these data indicate that the interaction between
paxillin and Robo4
is essential for proper patterning of the zebrafish vasculature.
-60-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
EXAMPLE 12
Robo4 blocks Rac-dependent protrusive activity through inhibition of ARF6: Our
determination that Robo4 interacts with paxillin and inhibits protrusive
activity prompted us
to determine whether Robo4 impinges upon the ARF6 pathway. Cells expressing
allb-
Robo4: (33 were plated on fibronectin alone, or fibronectin and fibrinogen,
and ARF6-GTP
levels were analyzed using a GST-GGA3 affinity precipitation technique. While
fibronectin
stimulated activation of ARF6, fibrinogen reduced ARF6-GTP levels in cells
expressing
alIb-Robo4:P3 (FIG. 16A). This result demonstrated that Robo4 signaling
inhibits ARF6
activation and suggested that Robo4's ability to block Rac activity stems from
its regulation
of ARF6.
Next we analyzed the requirement of a paxillin-GITI complex in Robo4-dependent
inhibition of protrusive activity. The paxillin binding sequence (PBS) on GITI
is found at
the carboxy-terminus of the protein and has been shown to prevent interaction
of GITI and
paxillin (Uemura et al., 2006). Cells were transfected with aIIb-Robo4:(33 and
either an
empty vector or the GITI-PBS and subjected to spreading assays on fibronectin
or
fibronectin and fibrinogen. As described previously, cells expressing alIb-
Robo4:P3
displayed a decrease in cell area when plated on fibrinogen, but this was lost
in cells
transfected with the GIT1-PBS (FIG. 16B). We repeated this experiment in cells
expressing
full length Robo4 plated on fibronectin or fibronectin and Slit2 (Slit2N (SEQ
ID NO: 7)), and
similar to the chimeric receptor experiment, the GITI-PBS prevented the Slit2-
dependent
decrease in cell area (FIG. 16C). These data demonstrate that a functional
paxillin-GITI
complex is required for Slit2-Robo4 signaling.
To determine whether Slit2-Robo4 signaling inhibits protrusive activity by
inactivating ARF6, we co-expressed the ARF6 guanine nucleotide exchange factor
ARNO
with Robo4 and performed spreading assays. Overexpression of ARNO blocked the
ability
of Slit2 to reduce cell area, indicating that a principal effect of Slit2-
Robo4 signaling is to
prevent GTP-loading of ARF6 (FIG. 16C). If ARNO restored the ability of Robo4-
expressing cells to spread on Slit2, we reasoned that it should likewise re-
establish Rac
activation in response to fibronectin. Indeed, overexpression of ARNO led to
normal levels
of GTP-Rac in cells plated on fibronectin and Slit2 (FIG. 16D). Together these
experiments
demonstrate that Slit2-Robo4 signaling inactivates ARF6, which leads to the
local blockade
-61-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
of Rac activation and the subsequent inhibition of the membrane protrusion
necessary for cell
spreading and migration.
EXAMPLE 13
Immunoprecipitation Demonstrates Interaction Between Slit Ligand and Robo4
Receptor: Cell lysates from untransfected human embryonic kidney cells (HEK),
HEK cells
transfected with Slit tagged with a myc epitope (Slit-myc), HEK cells
transfected with Robo4
tagged with a HA epitope (Robo4-HA) and HEK cells transfected with a control
vector
(Control-HEK) were immunopreciptated. Slit-myc protein was detected by Western
blot
with an anti-myc antibody after Slit-myc and Robo4-HA cell lysates were
combined and
immunoprecipitated with an anti-HA antibody (FIG. 17A, lane 6). The
specificity of this
interaction was confirmed by the absence of detectable Slit protein with all
other
combinations of lysates (FIG. 17A, lanes 2-5). The same amount of lysate was
used in each
experiment. A Western blot analysis of the Slit-myc cell lysates served as a
control and
demonstrated that the Slit protein has a mass of approximately 210 kD in
accordance with
previous reports (FIG. 17A, lane 1). The lower bands shown in lanes 2-6 of
FIG. 17A
correspond to immunoglobulin heavy chains.
Conditioned media from untransfected HEK cells (HEK CM), HEK cells transfected
with Slit tagged with a myc epitope (Slit-myc CM), HEK cells transfected with
the N-
terminal soluble ectodomain of Robo4 tagged with the HA epitope (NRobo4-HA CM)
and
HEK cells transfected with control vector (Control-HEK CM) was also
immunoprecipitated.
The full-length Slit-myc protein (210 KD) and its C-terminal proteolytic
fragment (70 KD)
were detected in Slit-myc CM by an anti-myc antibody (FIG. 17B, lane 1). Slit-
myc protein
was also detected by Western blot after Slit-myc and Robo4-HA conditioned
media were
combined and immunoprecipitated with an anti-HA antibody (FIG. 17B, lane 6).
The
specificity of this interaction was confirmed by the absence of Slit protein
with all other
combinations of conditioned media.
As is shown in FIG. 17C through FIG. 17F, Slit protein binds to the plasma
membrane of cells expressing Robo4. Binding of Slit-myc protein was detected
using an
anti-myc antibody and an Alexa 594 conjugated anti-mouse antibody. As can be
seen in FIG.
17D and FIG. 17F, binding was detected on the surface of Robo4-HEK cells (FIG.
17F) but
not Control-HEK cells (FIG. 17D).
-62-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
EXAMPLE 14
Robo4 Knockout Mouse: To ascertain the functional significance of Robo4 in
vivo,
knockout mice were produced using standard techniques. To produce the knockout
mice,
exons one through five of the gene expressing Robo4 were replaced with an
alkaline
phosphatase (AP) reporter gene using homologous recombination. This allele,
Robo4AP,
lacked the exons encoding the immunoglobulin (IgG) repeats of the Robo4
ectodomain,
which are predicted to be required for interaction with Slit proteins. The
Robo4+ AP animals
were intercrossed to generate mice that were homozygous for the targeted
allele. An
illustration of the genomic structure of the mice is provided in FIG. 25.
Robo4APIAP animals
were viable and fertile, and exhibited normal patterning of the vascular
system. These data
indicate that Robo4 is not required for sprouting angiogenesis in the
developing mouse, and
point to an alternate function for Robo4 signaling in the mammalian
endothelium. Alkaline
phosphatase activity was detected in these animals throughout the endothelium
of all vascular
beds in the developing embryos and in the adult mice, which confirmed that the
Robo4AP
allele is a valid marker of Robo4 expression.
EXAMPLE 15
Robo4 Activation Stabilizes Mature Vessels: The central region of the murine
retinal
vascular plexus, comprised specifically of stalk cells, is an example of the
differentiated/stabilized phenotype characteristic of a mature, lumenized
vascular tube. We
reasoned, therefore, that Robo4 expression in the stalk might maintain this
phenotype by
inhibiting processes that are stimulated by pro-angiogenic factors, such as
VEGF-A. The
effect of Robo4 signaling on processes stimulated by VEGF-A was evaluated
using a VEGF-
A endothelial cell migration assay and a VEGF-A tube formation assay. Both
such assays are
routinely used to investigate angiogenesis in vitro.
In order to conduct the endothelial cell migration and tube formation assays,
endothelial cells from the lungs of Robo4+~+ and Robo4A"P mice were isolated
and their
identity confirmed using immunocytochemistry and flow cytometry. These cells
were then
utilized in VEGF-A-dependent endothelial cell migration and tube formation
assays. The
Slit2 molecule used in these assays was Slit2N (SEQ ID NO: 7). As is shown in
FIG. 19A
and FIG. 19B, Slit2 inhibited both migration and tube formation of Robo4+1+
endothelial
cells. However, the inhibitory activity of Slit2 was lost in Robo4A"P
endothelial cells.
These results demonstrate that Slit2 inhibits endothelial cell migration and
tube formation in
- 63 -
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
a Robo4-dependent manner, and indicate that activation of Robo4 by Slit2
serves to stabilize
the vascular endothelium of mature vessels.
EXAMPLE 16
Robo4 Activation Preserves Endothelial Barrier Function: In a mature vascular
bed,
endothelial cells do not behave independently of one another; rather they form
a monolayer
that prevents the movement of protein, fluid and cells from the endothelial
lumen into the
surrounding tissue. This barrier function was modeled in vitro using a
Transwell assay to
analyze the transport of horseradish peroxidase (HRP), across confluent cell
monolayers of
endothelial cells taken from the lungs of Robo4+~+ and Robo4A"P mice.
Stimulation of
Robo4+1+ and Robo4APIAP endothelial cells with VEGF-A, a known permeability-
inducing
factor, enhanced the accumulation of HRP in the lower chamber of the
Transwell. As is
shown in FIG. 19C, however, pre-treatment of the cell monolayers with a Slit2
protein
(Slit2N (SEQ ID NO: 7)) prevented this effect in Robo4+1+, but not Robo4'4PlAP
endothelial
cells.
Next, the influence of Slit2 on endothelial barrier function in vivo was
evaluated. A
Miles assay was performed by injecting Evans Blue into the tail vein of
Robo4+1+ and
Robo4APlAP mice. VEGF-A in the absence and presence of a Slit2 protein (Slit2N
(SEQ ID
NO: 7)) was subsequently injected into the dermis. Analogous to the in vitro
assay, VEGF-
A-stimulated leak of Evans Blue into the dermis could be prevented by
concomitant
administration of Slit2 protein in Robo4+1+, but not in Robo4APIAP mice (shown
in FIG. 19D).
These observations were extended by evaluating the ability of Slit2 to
suppress VEGF-A
induced hyperpermeability of the retinal endothelium. In particular, it was
found that
intravitreal injection VEGF-A in Robo4+~+ mice induced leak of Evans Blue from
retinal
blood vessels. However, such VEGF-A induced leak of Evans Blue from the
retinal blood
vessels was suppressed in Robo4+1+ mice by co-injection of the Slit2 protein
Slit2N (SEQ ID
NO: 39) (FIG. 19E). This experiment was repeated in retinas of Robo4'4"P mice,
and it was
found that Robo4AP AP were refractory to treatment with Slit2N (SEQ ID NO:
39). These data
demonstrate that Robo4 mediates Slit2-dependent inhibition of VEGF-A-induced
endothelial
hyperpermeability in vitro and in vivo.
EXAMPLE 17
Robo4 Blocks VEGF Signaling Downstream of the VEGF Receptor: The ability of
VEGF-A to promote angiogenesis and permeability is dependent upon activation
of
-64-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
VEGFR2, which occurs by autophosphorylation following ligand binding.
Subsequently, a
number of non-receptor tyrosine kinases, serine/threonine kinases and small
GTPases are
activated to execute VEGF-A signaling in a spatially and temporally specific
manner. To
determine where Slit2-Robo4 signaling intersects the VEGF-A-VEGFR2 pathway,
VEGFR2
phosphorylation following stimulation with VEGF-A and Slit2 was analyzed using
Slit2N
(SEQ ID NO: 7). Slit2N (SEQ ID NO: 7) had no effect on VEGF-A-induced VEGFR2
phosphorylation (FIG. 19F), indicating that the Slit2-Robo4 pathway must
intersect VEGF-A
signaling downstream of the receptor. Attention was then focused on the Src
family of non-
receptor tyrosine kinases, Fyn Yes and Src, due to their well-documented role
in mediating
VEGF-A-induced angiogenesis and permeability (Eliceiri et al., 2002; Eliceiri
et al., 1999).
Treatment of endothelial cells with Slit2N (SEQ ID NO: 7) reduced VEGF-A-
stimulated
phosphorylation of c-Src (FIG. 19G). Recently, several reports have shown that
Src-
dependent activation of the Rho family small GTPase, Rac1, is essential for
VEGF-A-
induced endothelial cell migration and permeability (Gavard et al., 2006;
Garrett et al., 2007).
Treatment of endothelial cell monolayers with Slit2N (SEQ ID NO: 7) prevented
VEGF-A-
dependent Rac 1 activation (FIG. 19H). These biochemical experiments indicate
that the
Slit2-Robo4 pathway suppresses VEGF-A-induced endothelial migration and
hyperpermeability via inhibition of an Src-Racl signaling axis.
EXAMPLE 18
Activation of Robo4 Reduces Vascular Leak and Pathologic Angiogenesis in CNV
and
OIR Models: A murine model of oxygen-induced retinopathy (OIR) that mimics the
ischemia-induced angiogenesis observed in both diabetic retinopathy and
retinopathy of
prematurity was used to investigate the effect of Robo4 signaling on retinal
vascular disease.
In this model, P7 mice were maintained in a 75% oxygen environment for five
days and then
returned to 25% oxygen for an additional five days. The perceived oxygen
deficit initiates a
rapid increase in VEGF-A expression in the retina, leading to pathological
angiogenesis
(Ozaki et al., 2000; Werdich et al., 2004. Robo4+1+ mice and Robo4A"P mice
were evaluated
using this model. Intravitreal administration of Slit2N (SEQ ID NO: 7).
markedly reduced
angiogenesis in Robo4+ + mice, but not in Robo4A"P mice (FIG. 20A - FIG. 20E,
where
arrows indicate areas of pathological angiogenesis). Furthermore, Robo4APIAP
mice displayed
more aggressive angiogenesis than Robo4+~+ mice following exposure to
hyperoxic
conditions (See, e.g., FIG. 20A and 20C).
- 65 -
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
In addition to the described OIR model, laser-induced choroidal
neovascularization,
which mimics age-related macular degeneration, is commonly used to study
pathological
angiogenesis in the mouse (Lima et al., 2005). In this model, a laser is used
to disrupt
Bruch's membrane, which allows the underlying choroidal vasculature to
penetrate into the
subretinal pigment epithelium. To discern the effect of Robo4 signaling on
this pathological
process, 8-12 week old Robo4+~+ and Robo4AP~AP mice were subjected to laser-
induced
choroidal neovascularization followed by intravitreal injection of Slit2N (SEQ
ID NO: 7).
Similar to the results achieved in the mouse model of oxygen-induced
retinopathy,
intravitreal administration of S1it2N reduced angiogenesis in Robo4+1+ mice,
but not in
Robo4A"P mice (See FIG. 20F - FIG. 20J). Together, the oxygen-induced
retinopathy and
choroidal neovascularization models indicate that two vascular beds with
distinct
characteristics, one a tight blood-brain barrier and the other a fenestrated
endothelium, are
protected from pathological insult by activation of Slit2-Robo4 signaling.
EXAMPLE 19
Robo4 Inhibits Signaling From Multiple Factors That Destabilize the Mature
Vessel:
The effect of Robo4 activation by a Slit2 molecule on the activity of bFGF,
and angiogenic
factor, and thrombin, the endothelial permeability factor, was evaluated. As
shown in FIG.
21, Slit2N (SEQ ID NO: 7) blocked bFGF-induced endothelial tube formation and
thrombin-
induced permeability. These studies demonstrate that Slit-Robo4 signaling is
capable of
inhibiting the signaling induced by multiple angiogenic and permeability
factors and support
the concept that the Slit-Robo4 pathway protects the mature vascular beds from
multiple
angiogenic, permeability and cytokine factors.
To reinforce that Robo4 signalizing protects vasculature from multiple
angiogenic,
permeability and cytokine factors, the effect of Robo4 activation by Slit2N
(SEQ ID NO: 7)
was evaluated in a mouse model of acute lung injury. In this model, the
bacterial endotoxin
LPS was dosed to the mice via intratracheal administration. Exposure to the
bacterial
endotoxin leads to a cytokine storm that causes catastrophic destabilization
of the pulmonary
vascular bed and results in non-cardiogenic pulmonary edema (Matthay et al.,
2005).
Following intratracheal administration of LPS, the mice were treated with
Slit2N (SEQ ID
NO: 7) or Mock preparation, which was a sham protein extract that served as a
control. As
shown in FIG. 22, the concentrations of inflammatory cells and protein in
bronchoalveolar
lavages (BAL) from mice treated with Slit2N (SEQ ID NO: 7) were significantly
lower than
-66-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
in the mice treated with the Mock preparation. These results demonstrate that
activating
Robo4 under these circumstances provides potent vascular stabilization and
suggest that
Slit2-Robo4 is a potent vascular stabilization pathway that works to preserve
the integrity of
the mature endothelium and maintain vascular homeostasis against an extreme
form of
cytokine storm.
EXAMPLE 20
Administration of Slit2 Protein Reduces Mortality in Mouse Model of Avian Flu:
In
the following example, the effect of Slit protein on the survival of mice
infected with Avian
Flu Virus was analyzed. A total of 120 female BALB/c mice were inoculated
intranasally
with 50 l of a 1:400 dilution of the Avian Flu Virus, strain
H5N1/Duck/Mn/1525/81. The
mice used in this example were obtained from Charles River and had an average
weight
ranging from 18-20 grams. With reference to Table 2, the mice were randomly
divided into 6
cages of 20 mice each, and each group were subjected to daily treatments for 5
days.
Survivorship (death) and body weight were observed during and after treatment.
TABLE 2
# mice Group Infected Compound Dosage Treatment Schedule
/Cage # y or n
20 1 Y PSS 50 l volume Qd X 4 or 5 (5 if
possible) beg -4 before
virus exposure, I.V.
20 2 Y SLIT "Mock" 15.625 gl Same as # 1
1 SLIT/Mock +
34.375 gl PSS per
mouse
20 3 Y SLIT "Mock" 1.5625 gl Same as # 1
2 SLIT/Mock + 48.44
l PSS per mouse
20 4 Y SLIT - Conc. 1 15.625 1 of 800 Same as # 1
g/ml SLIT +
34.375 l PSS per
mouse
-67-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
# mice Group Infected Compound Dosage Treatment Schedule
/Cage # y or n
20 5 y SLIT - Conc. 2 1.5625 l of 800 Same as # I
g/ml SLIT + 48.44
l PSS per mouse
20 6 Y Ribavirin 75 mg/kg/day 0.1 ml I.P. BID X 5
days
Briefly, as shown in Table 2, Group 1 was treated with physiological saline
solution
(PSS) a negative control. Groups 2 and 3 were treated with a Mock preparation.
Groups 4
and 5 were treated with different concentrations of a Slit protein (Slit2N
(SEQ ID NO: 7)).
As a positive control, the 20 mice of group 6 were treated with
intraperitoneally with 75
mg/kg/day of Ribavirin brought up in a total volume of 0.1mL PSS.
The results of the analysis are illustrated in FIG. 24 and detailed in Table
3. After 23
days, the mice treated with Slit protein in Groups 4 and 5 had a lower
mortality than those
mice that did not receive Slit protein in Groups 1, 2, and 3. The Group 4
mice, treated with
12.5 g of Slit per dose, had a 25% survivability rate. The Group 5 mice,
treated with 1.25
g of Slit per dose, had a 50% survivability rate. In contrast to the
survivorship of Groups 4
and 5, only 5% (1/20) of the negative control mice in Group 1, treated with
PSS, survived
past 23 days.
Table 3 shows that at 14 days after inoculation, the average body weights of
the
survivors in Groups 1, 2, and 3 were significantly lower than the Slit treated
survivors in
Groups 4 and 5. Moreover, 10/20 mice in Group 5, which was the lower of the
Slit treatment
concentrations, survived with body weights averaging 17.6 grams at 21 days,
nearly as high
as the starting average body weight of 17.7 grams. Therefore, those infected
mice treated
with Slit protein were able to maintain their body weights better than the
untreated mice.
-68-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
TABLE 3
Day 0 1 2 3 4 5 6 7 8 9
Cage Alive 20 20 20 20 20 19 17 11 8 3
#1 Total 20 20 20 20 20 20 20 20 20 20
Av. 17.6
wt.
Cage Alive 20 20 20 20 20 20 19 14 7 3
#2 Total 20 20 20 20 20 20 20 20 20 20
Av. 17.6
wt.
Cage Alive 20 20 20 20 20 20 19 12 8 6
#3 Total 20 20 20 20 20 20 20 20 20 20
Av. Wt. 17.6
Cage Alive 20 20 20 20 20 20 17 13 10 7
#4 Total 20 20 20 20 20 20 20 20 20 20
Av. Wt. 17.4
Cage Alive 20 20 20 20 20 20 20 17 12 11
#5 Total 20 20 20 20 20 20 20 20 20 20
Av. Wt. 17.7
Cage Alive 20 20 20 20 20 20 20 20 20 20
#6 Total 20 20 20 20 20 20 20 20 20 20
Av. 17.5
wt.
-69-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
TABLE 3 (continued)
11 12 13 14 15 16 17 18 19 20 21 22 23
Cage Alive 2 2 1 1 1 1 1 1 1 1 1 1 1 1
# 1 Total 20 20 20 20 20 20 20 20 20 20 20 20 20 20
Av. 12.5 16.0
wt.
Cage Alive 2 2 2 2 2 2 2 2 2 2 2 2 2 2
# 2 Total 20 20 20 20 20 20 20 20 20 20 20 20 20 20
Av. 12.5 15.3
wt.
Cage Alive 5 4 4 4 4 3 3 3 3 3 3 3 3 3
# 3 Total 20 20 20 20 20 20 20 20 20 20 20 20 20 20
Av. 13.0 16.1
Wt.
Cage Alive 6 5 5 5 5 5 5 5 5 5 5 5 5 5
# 4 Total 20 20 20 20 20 20 20 20 20 20 20 20 20 20
Av. 16.0 18.5
Wt.
Cage Alive 10 10 10 10 10 10 10 10 10 10 10 10 10 10
# 5 Total 20 20 20 20 20 20 20 20 20 20 20 20 20 20
Av. 15.4 17.6
Wt.
Cage Alive 20 20 20 20 20 20 20 20 20 20 20 20 20 20
# 6 Total 20 20 20 20 20 20 20 20 20 20 20 20 20 20
Av. 17.2 18.3
wt.
-70-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
EXAMPLE 21
Fragments of Slit Proteins Work to Activate Robo4: FIG. 23 illustrates various
constructs of the Slit2 protein. As has already been described herein, the
150kD protein
Slit2N (SEQ ID NO: 7), has been found to be effective in in vitro and in vivo
models,
including Miles assays, assays for retinal permeability, tube formation and
endothelial cell
migration and in OIR and CNV models of ocular disease. Moreover, as is shown
in FIG. 23,
the (40kD) protein S1itD1 (SEQ ID NO: 42) and Slit2N (SEQ ID NO: 39)
constructs exhibits
similar activity to full length Slit2 (SEQ ID NO: 40) in a VEGF-induced
endothelial cell
migration assay.
EXAMPLE 22
Slit2 Inhibits Cell Protrusion in Endothelial Cells via ARF-GAPs: Our
experiments
utilized model cell systems to decipher the signal transduction cascade
downstream of
Robo4. To determine whether this molecular mechanism is important for Robo4
function in
primary cells we subjected human microvascular endothelial cells to haptotaxis
migration
assays on transwells coated on the underside with a mixture of fibronectin and
Slit2 (Slit2N
(SEQ ID NO: 7)). Analogous to HEK cells, Slit2 blocked fibronectin-driven cell
migration
(FIG. 28A). Next we performed spreading assays on coverslips coated with the 9-
11
fragment of fibronectin (a ligand for alph5betal integrin) and Slit2 (Slit2N
(SEQ ID NO: 7))
and again found that Slit2 suppressed cellular protrusive activity stimulated
by integrin
ligation (FIG. 28B). To analyze the role of GITI in Slit2-dependent inhibition
of cell
protrusion, we pre-treated endothelial cells with a small molecule inhibitor
of Arf-GAPs,
Qsl l, and then subjected them to spreading assays on 9-11 and Slit2 (Slit2N
(SEQ ID NO:
7)). Arf-GAP inhibition prevented the reduction in cell area elicited by Slit2
(FIG. 28B)
demonstrating that Arf-GAP activity is essential for Slit2-dependent
inhibition of cell
protrusion.
EXAMPLE 23
Slit2 Blocks ARF6 Activation in Response to Fibronectin and VEGF-165: These
cell
biological data suggested that Slit2-Robo4 signaling in endothelial cells
should block ARF6
activation in response to integrin ligation. To confirm this idea, we plated
endothelial cells
onto dishes coated with fibronectin and Slit2, and ARF6-GTP levels were
analyzed using the
GST-GGA3 affinity precipitation technique. Consistent with results from CHO
cells (FIG.
16A), Slit2 (Slit2N (SEQ ID NO: 7)) blocked the fibronectin-induced increase
in ARF6-GTP
-71-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
(FIG. 28C). In addition to fibronectin, the angiogenic and permeability-
inducing factor
VEGF-165, which exists in vivo as an extracellular matrix bound form, has been
suggested to
activate ARF6. To clarify the effect of VEGF-165 and Slit2 (Slit2N (SEQ ID NO:
7)) on
ARF6 activity we plated endothelial cells on dishes coated with both proteins,
and ARF6-
GTP levels were analyzed using the GST-GGA3 affinity precipitation technique.
VEGF-165
activated ARF6 and Slit2 prevented this activation (FIG. 28D) demonstrating
that Slit2
inhibits both extracellular matrix protein- and growth factor-induced ARF6
activation.
EXAMPLE 24
Inhibition ofARF6 Prevents Pathologic Angiogenesis and Vascular Leak: Robo4
mediates Slit2-dependent inhibition of neovascular tuft formation and
endothelial
hyperpermeability (REF), processes that are initiated and perpetuated by
extracellular matrix
proteins, such as fibronectin, and growth factors, such as VEGF (REFs). The
involvement of
ARF6 in integrin and VEGF receptor signaling, and the ability of Slit2 to
block ARF6
activation in response to fibronectin and VEGF- 165 led us to speculate that
ARF6 might be a
critical nexus in the signaling pathways regulating pathologic angiogenesis
and vascular leak.
To test this hypothesis, we injected a small molecule inhibitor of Cytohesin
Arf-GEFs,
SecinH3 (FIG. 29), into the eyes of wild-type mice and subjected these animals
to oxygen-
induced retinopathy (OIR), laser-induced choroidal neovascularization (CNV)
and VEGF-
165-induced retinal permeability assays. SecinH3, but not a DMSO control
inhibited
neovascular tuft formation in OIR (FIG. 30A and FIG. 30B) and CNV (FIG. 30C
and FIG.
30D), and retinal hyperpermeability caused by VEGF-165 (FIG. 30E), thus
demonstrating the
central involvement of Arf-GTPases in these pathological processes and
demonstrating that
blockade of Arf activation is a potential therapy for diseases characterized
by pathologic
angiogenesis and vascular leak.
EXAMPLE 25
Secin-H3 Inhibits VEGF Induced ARF6-GTP: To test whether Secin-H3 attenuated
the accumulation of ARF6-GTP, human microvessel endothelial cells (HMVEC) were
either
not treated (FIG. 31 Leftmost lane), treated with 20ng/m1VEGF\ DMSO (FIG. 31
Middle
lane) or treated with 20ng/ml VEGF\ 50 M Secin-H3 (FIG. 31 Rightmost lane).
Cell lysates
were probed with an ARF6-GTP antibody or an ARF6 antibody; relative amounts of
these
ARF6 species were compared via a western blot. The cells were then washed
twice with ice-
cold PBS and lysed in 50mM Tris pH 7.0, 500mM NaCI, 1mM MgC12, ImM EGTA, 1mM
-72-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
DTT, 0.5% NP-40, 1X protease inhibitors, 1X phosphatase inhibitors and 50
g/ml GST-
GGA3-VHS-GAT. The lysate was centrifuged for 5 min at 14,000 rpm and the
supernatant
was incubated with 50 1 of glutathione agarose for 30 min at 4 C. Following
three washes
with lysis buffer, bound proteins were eluted with 2X sample buffer. Arf6 was
detected by
western blotting with Arf6-specific antibodies The results of these
experiments demonstrate
that the small organic molecule Secin-H3 blocks the accumulation of ARF6-GTP
(compare
FIG. 31, top panel middle lane and top panel right lane).
EXAMPLE 26
Secin-H3 Inhibits VEGF Induced Migration of HMVECs: A cell migration assay was
performed using a modified Boyden chamber Transwell assay to test whether
Secin-H3 (FIG.
29) can inhibit VEGF induced HMVEC migration in an in vitro assay. Cells were
plated as
described herein, and subjected to either a control treatment or an
experimental treatment.
The control treatment comprised 0.2% BSA and DMSO and the experimental
treatment
comprised 0.2% BSA + 15 ng/ml VEGF-165 and DMSO + l5 M Secin-H3. 50 gl of 0.2%
BSA, the experimental treatment comprised0.2% BSA \ 15 ng/ml VEGF-165, 0.2%
BSA \ 15
ng/ml VEGF-165\DMSO, and 0.2% BSA \ 15 ng/ml VEGF-165 \ 15gM Secin-H3 were
plated into each well of a 48-well Boyden chamber apparatus (NeuroProbe, Cabin
John,
MD), and the wells were overlayed with an 8 m pore polycarbonate membrane
(NeuroProbe) that had been previously coated with 50 gg/ml human fibronectin
(Biomedical
Technologies, Inc., Stoughton, MA). Then 3.75 x 10' cells human microvessel
endothelial
cells (HMVEC) were added to the upper chambers, and the migration was allowed
to proceed
for 3 h at 37 C (5% COZ). The membranes were then removed, fixed in methanol,
stained with
a Hema 3 stain set (Fisher Scientific, Pittsburgh, PA), and placed (migrated-
side down) onto
50 x 75 mm glass slides. Cells present on the migrated side of the membrane
were manually
counted (three random 200X fields per well), and data points for each
experiment represent
the average number of migrated cells from six separate wells (three 200X
fields counted per
well).
Results depicted in FIG. 32 show that cells treated with VEGF-165 demonstrate
a cell
migration response, which is not attenuated by further treatment with DMSO.
Treatment
with Secin-H3 attenuated the VEGF-165 induced cell migration response.
-73-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
EXAMPLE 27
GITI RNAi Increases VEGF Induced HMVEC Permeability: FIG. 34 illustrates the
results from HMVEC permeability assays in which the question was tested as to
whether a
reduction in expression of GIT1 via RNAi could enhance VEGF induced
permeability. Cells
were plated as described herein and transfected with either a control siRNA or
a GIT1
siRNA. Each siRNA group was split and half of the cells were treated with VEGF-
165. As
depicted in FIG. 34, VEGF induced permeability was enhanced in the GIT1 siRNA
cells
compared to the other cells.
EXAMPLE 28
Secin-H3 Inhibits Arf6 activation, VEGF Induced Migration of Endothelial
Cells,
Neovascular Tuft Formation in Models of OIR and CNV, and Retinal
Hyperpermeability
Caused by VEGF-165: We determined the effect of SecinH3 on VEGF signaling by
pre-
treating endothelial cells with the inhibitor or vehicle control and
performing Arf6 activation
and cell migration assays. SecinH3 prevented both VEGF-induced Arf6 activation
and
VEGF-induced cell migration (FIG. 36 A, B). Next, we injected SecinH3 into the
eyes of
wild-type mice and subjected these animals to oxygen-induced retinopathy
(OIR), laser-
induced choroidal neovascularization (CNV) and VEGF- 165 -induced retinal
permeability
assays. SecinH3, but not a vehicle control of DMSO inhibited neovascular tuft
formation in
OIR (FIG. 36 C, D) and CNV (FIG. 36 E, F), and retinal hyperpermeability
caused by
VEGF-165 (FIG. 36 G), thus demonstrating the central involvement of Arf-
GTPases in these
pathological processes.
Oxygen-induced retinopathy: Briefly, P7 pups along with nursing mothers were
placed in 80% oxygen, which was maintained by Pro-OX oxygen controller
(BioSpherix).
Pups were removed on P12 and given an intraocular injection of SecinH3 at a
final
concentration of 21.6 M. Mice were sacrificed on P17, eyes enucleated and
fixed for 2 hours
in 4% paraformaldehyde. Retinas were then dissected and stained overnight
using Alexa
Fluor 488 conjugated isolectin 1:50 (Invitrogen). Retinal flatmounts were
generated and
images taken using Axiovert 200 fluorescence microscopy (Carl Zeiss).
Neovascularization
was quantified using AxioVision software (Carl Zeiss). Data are presented as
mean s.e. for
14 wild-type mice.
Laser-induced choroidal neovascularization: Briefly, two-three month old mice
were
anesthetized with Avertin (2-2-2 Tribromoethanol, 0.4 mg/g; Acros Organics)
and the pupils
-74-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
dilated with 1% tropicamide (Alcon). An Iridex OcuLight GL 532 nm laser
photocoagulator
(Iridex) with slit lamp delivery system was used to create three burns 3 disc
diameters from
the optic disc at 3, 6, and 9 o'clock with the following parameters: 150mW
power, 75um spot
size, and 0.1 second duration. Production of a bubble at the time of laser
indicating rupture
of Bruch's membrane is an important factor in obtaining CNV; therefore, only
burns in which
a bubble was produced were included in this study. Immediately after laser
treatment and 3
days later, mice were given an intravitreal injection of SecinH3 at a final
concentration of
21.6 M. One week after laser treatment, mice were sacrificed and choroidal
flat mounts
generated. Alexa 488 conjugated isolectin (Sigma) was used to stain CNV. Flat
mounts
were examined using a Zeiss LSM 510 confocal microscope (Carl Zeiss) and CNV
quantified
using ImageJ software (NIH). Data are presented as mean s.e. for at least 15
wild-type
mice.
Retinal Permeability: Retinal permeability was assessed as previously
described24.
Briefly, 8-10 week old mice were anesthetized with Avertin (2-2-2
Tribromoethanol, 0.4
mg/g; Acros Organics). Mice were given an intraocular injection of 1.5 L of
35.7 g/mL
VEGF-165 (R&D Systems Inc) and either 216 M of SecinH3 in 2% DMSO (we
estimated
the final concentration to be 21.6 M and DMSO to be 0.2%) or 2% DMSO alone.
Six hours
later, 50 L of 60mg/mL Evans Blue solution was administered via the tail vein.
After two
hours, mice were sacrificed and perfused with citrate-buffered formaldehyde to
remove
intravenous Evans Blue. Eyes were enucleated and retinas dissected. Evans Blue
dye was
eluted in 0.4mL formamide for 18 hours at 70 C. The extract was ultra-
centrifuged through a
5kD filter for 2 hours. Absorbance was measured at 620nm. Background
absorbance was
measured at 740nm and subtracted out. Data are presented as mean s.e. for
six wild-type
mice.
EXAMPLE 29
Slit2 blocks recruitment of paxillin to focal adhesions: To assess the effect
of Slit
ligation of Robo4 on the subcellular distribution of paxillin, cells were
permitted to adhere to
cover slips coated with fibronectin in the presence or absence of Slit2, and
stained for
endogenous paxillin. In the absence of Slit2 (Mock), HEK cells expressing full
length Robo4
spread normally and formed abundant focal adhesions near the cell periphery
that stained for
paxillin (FIG. 37A, top panel). In contrast, cells plated on Slit2 (Slit2N
(SEQ ID NO: 7)) and
fibronectin exhibited reduced spreading, stained significantly less for F-
actin, and formed
-75-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
much fewer and smaller paxillin-stained focal adhesions (FIG. 37A, bottom
panel). Control
HEK cells (not expressing Robo4) adhered on Fibronectin and Slit2 exhibited no
differences
in morphology when compared with adhesion on Fibronectin alone (data not
shown),
indicating the effect of Slit is dependent on Robo4.
We repeated the assay with bovine aortic endothelial (BAE) cells, which
endogenously express Robo4. On substrata coated with fibronectin and Slit2
(Slit2N (SEQ
ID NO: 7)), BAE cells exhibited reduced spreading compared to cells adhered to
fibronectin
alone (Mock), indicating a similar inhibitory effect of Slit2-Robo4 signaling
(FIG. 37B).
BAE cells adhered to fibronectin and Slit2 formed small paxillin-stained
structures different
from the mature focal adhesions of fibronectin-adherent cells that were larger
and elongated
(FIG. 37B). The inhibitory effect of Slit2 on cell spreading appears to be
transient, as cells
adhered for longer periods of time, with or without Slit2, exhibited similar
degrees of
spreading and focal adhesion formation (data not shown). Together with the
observation that
Slit2 induces recruitment of paxillin to Robo4, we propose that Robo4 ligation
reduces the
availability of paxillin for recruitment to adhesive structures, thereby
contributing to reduced
cell spreading and migration.
EXAMPLE 30
Slit2 recruits paxillin to the cell surface: Our data suggest that in Robo4-
expressing
cells, Slit2 treatment redistributes paxillin from focal adhesions to the cell
surface, where it
co-localizes with the receptor. To determine the veracity of this notion, we
analyzed the
subcellular distribution of paxillin and Robo4 in cells incubated in the
absence and presence
of a Slit2 protein (Slit2N (SEQ ID NO: 7)). Because Slit2 blocks cell
spreading, and thus
prevents clear visualization of the plasma membrane, we performed these
experiments in
endothelial cells pre-spread on fibronectin. In cells treated with Mock,
paxillin was found
almost exclusively in focal adhesions, while Robo4 was localized to the cell
surface (FIG.
37C, top panel). In cells treated with Slit2, however, a significant portion
of paxillin
appeared at the cell surface and co-localized with Robo4; this alteration in
localization was
coincident with a reduction of paxillin in focal adhesions (FIG. 37C, bottom
panel). These
data reveal that Slit2 stimulation of Robo4 redistributes paxillin from focal
adhesion to the
cell surface, where it is accessible to Robo4.
-76-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
EXAMPLE 31
The Paxillin Interaction Motif (PIM) is required for Slit2 signaling in
Endothelial
Cells: Next, we determined the requirement of paxillin binding to Robo4 for
Slit2-dependent
inhibition of cell spreading. We expressed Robo4APIM or LacZ in endothelial
cells and
performed spreading assays on fibronectin, in the absence and presence of a
Slit2 protein
(Slit2N (SEQ ID NO: 7)). Cells expressing Robo4APIM (GFP+) spread equivalently
on both
Mock and Slit2, while untransfected cells expressing endogenous Robo4 (GFP-)
were
markedly inhibited on Slit2, but not Mock (FIG. 38 C and D). These data
indicate that
paxillin binding to Robo4 is necessary for Slit2 to modulate cellular
protrusive activity.
EXAMPLE 32
Slit2 blocks activation of Rac and Arf6 in Endothelial Cells: These cell
biological data
suggested that Slit2-Robo4 signaling in endothelial cells should block Rac and
Arf6
activation in response to integrin ligation. To confirm this idea, we plated
endothelial cells
onto dishes coated with fibronectin and a Slit2 protein (Slit2N (SEQ ID NO:
7)), and
analyzed Rac-GTP and Arf6-GTP levels. Consistent with results from HEK and CHO
cells,
Slit2 efficiently blocked the fibronectin-induced increase in Rac-GTP (FIG. 38
E) and Arf6-
GTP levels (FIG. 38 F). In addition to fibronectin, the angiogenic and
permeability-inducing
factor VEGF-165, exists in vivo as a component of the extracellular matrix. To
ascertain the
effect of VEGF-165 and Slit2 on Arf6 activity, we plated endothelial cells on
dishes coated
with both proteins, and analyzed Arf6-GTP levels. While VEGF-165 alone
activated Arf6,
addition of Slit2 prevented this activation (FIG. 37 D), demonstrating that
Slit2 inhibits both
extracellular matrix protein- and growth factor-induced Arf6 activation.
To gain insight into the regulation of Rho and Cdc42 by Slit2, we plated
endothelial
cells on fibronectin in the absence and presence of Slit2 (Slit2N (SEQ ID NO:
7)) and
analyzed Rho-GTP and Cdc42-GTP levels. While Rho activation was unaltered by
Slit2,
Cdc42 activation was significantly reduced (FIG. 39). The effect of Slit2 on
Cdc42 was
somewhat surprising given that Robo4 does not interact with the Robo 1 binding-
protein
srGAPl, a known GTPase activating protein for Cdc42 (FIG. 39).
Materials and Methods
Reagents: HEK 293 and COS-7 cells, and all IMAGE clones were from ATCC. SP6
and T7 Message Machine kits were from Ambion. HUVEC, EBM-2 and bullet kits
were
from Cambrex. Yeast two-hybrid plasmids and reagents were from Clontech. FBS
was from
-77-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Hyclone. Anti-HA affinity matrix, Fugene6 and protease inhibitor cocktail were
from Roche.
Goat Anti-Mouse-HRP and Goat Anti-Rabbit-HRP secondary antibodies were from
Jackson
ImmunoResearch. Anti-V5 antibody, DAPI, DMEM, Lipofectamine 2000, Penicillin-
Streptomycin, Superscript III kit, Trizol and TrypLE Express were from
Invitrogen. Anti-
Flag M2, Phosphatase Inhibitor Cocktails, Soybean Trypsin Inhibitor and Fatty
acid-free
Bovine Serum Albumin (BSA) were from Sigma. Human fibronectin was from
Biomedical
Technologies and Invitrogen. Costar Transwells and Amicon Ultra- 15
Concentrator Columns
were from Fisher. Rosetta2 E. coli were from Novagen. Glutathione-Sepharose
4B, parental
pGEX-4T1 and ECL PLUS were from Amersham-Pharmacia. Coomassie Blue and PVDF
were from BioRad. Quick change site-directed mutagenesis kit was from
Stratagene. Normal
Rat IgGagarose conjugate was from Santa Cruz. Robo4 morpholinos were from Gene
Tools.
Oligonucleotides for PCR were from the University of Utah Core Facility.
A1exa564-
Phalloidin, Anti-GFP and Goat Anti-Rabbit A1ex488 were from Molecular Probes.
Low melt
agarose was from NuSieve. T7 in vitro transcription/translation kit was form
Promega.
Molecular Biology: The Robo4-HA, Slit2-Myc-His and chicken paxillin plasmids
have been previously described (Park et al., 2003; Nishiya et al., 2005).
Robo4-NH2 was
amplified from Robo4-HA and cloned into EcoRV/Notl of pcDNA3-HA. Robo4-COOH
was
amplified from Robo4-HA by overlap-extension PCR and cloned into EcoRV/Notl of
pcDNA3-HA. The amino terminal half of the human Robo4 cytoplasmic tail (AA 465-
723)
was amplified by PCR and cloned into (EcoRUBamHI) of pGBKT7. Murine Robo4
fragments were amplified by PCR and cloned into BamHI/EcoRl of pGEX-4T1.
Murine Hic-
5, Mena and paxillin (including deletions) were amplified from IMAGE clones by
PCR and
cloned into EcoRV/Notl of pcDNA3-V5. GST-Robo4APIM and full-length Robo4APIM
were generated by site-directed mutagenesis of relevant wild-type constructs
using Quick
Change. The integrity of all constructs was verified by sequencing at the
University of Utah
Core Facility.
Embryo Culture and Zebrafish Stocks: Zebrafish, Danio rerio, were maintained
according to standard methods (Westerfield, 2000). Developmental staging was
carried out
using standard morphological features of embryos raised at 28.5 C (Kimmel et
al., 1995).
The Tg (fli:EGFPf 1 transgenic zebrafish line used in this study was described
in Lawson and
Weinstein, 2002. Imaged embryos were treated with 0.2mM 1-phenyl-2-thio-urea
(PTU) after
24 hpf to prevent pigment formation.
-78-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Antisense Depletion of robo4: Antisense morpholino oligonucleotides (MO)
directed
against the exon 10 / intron 10 splice site of robo4 (5'-
tttttagcgtacctatgagcagtt-3', SEQ ID
NO:28) were dissolved in 1 X Danieau's Buffer at a concentration of 5 ng/nl,
respectively.
Before injection, the morpholino was heated at 65 C for 5 minutes, cooled
briefly, mixed
with a negligible amount of dye to monitor injection efficiency, and
approximately lnl was
injected into the streaming yolk of 1-2 cell stage embryos.
Reverse Transcription (RT) PCR: RNA was extracted from 20 uninjected and 20
robo4 MO-injected embryos using Trizol, reagent and subsequent cDNA synthesis
was
performed using Superscript III primed by a mixture of both random hexamers
and oligo dT
primers. robo4 was amplified from cDNA by PCR with a forward primer in exon 8
(5'-
caacaccagacacttacgagtgcc -3', SEQ ID NO:29) and a reverse primer in exon 12
(5'-
ttcgaaggccagaattctcctggc -3', SEQ ID NO:30) using the following parameters:
(94 C for 4',
94 C for 30", 58 C for 30", 68 C for 45", 68 C for 1'). To identify the linear
range of the
PCR reaction, cDNA was amplified for 23, 25, 27 and 30 cycles. (3-actin was
amplified using
a forward primer (5'-cccaaggccaacagggaaaa, SEQ ID NO:31) and a reverse primer
(5'-
ggtgcccatctcctgctcaa-3', SEQ ID NO:32) from all samples to control for cDNA
input.
Whole-Mount Indirect Immunof uorescence: Briefly, age-matched 24 and 48 hpf
embryos were dechorionated and fixed in 4% PFA / 4% sucrose / PBS overnight at
4 C. The
embryos were then washed in PBS / 0.1% Tween-20, dehydrated to absolute
methanol, re-
hydrated back to PBS-Tween 20, further permeabilized in PBS / 1% Triton-X,
rinsed in PBS
/ 1% Triton-X / 2% BSA, blocked at room temperature in PBS / 1% Triton-X / 2%
BSA /
10% Sheep Serum / 1% DMSO, then incubated in IgG purified anti-GFP (1:400) in
blocking
solution overnight at 4 C. The following day embryos were washed vigorously in
PBS / 1%
Triton-X / 2% BSA, then incubated in goat-anti-Rabbit Alexa 488 conjugated
secondary
antibody (1:200) in blocking solution overnight at 4 C. The following day the
embryos were
washed extensively in PBS / 1% Triton-X / 2% BSA, then embedded in 1% low melt
agarose
in PBS and photographed on Leica confocal microscope and processed using Adobe
Photoshop software.
Cell Culture: HEK 293 and COS-7 cells were cultured in DMEM supplemented with
10% FBS and 1% penicillin / streptomycin. Human microvascular endothelial
cells
(HMVEC) were cultured in EGM-2 MV and human umbilical vein endothelial cells
-79-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
(HUVEC) were cultured in EGM-2 supplemented with 10% FBS. ECs were routinely
used
between passages 2 and 5.
Transfection: HEK293 and COS-7 cells were transfected with Fugene6 or
Lipofectamine2000 according to the manufacturer's protocol.
Preparation of Concentrated Slit2 Protein: COS-7 cells were transiently
transfected
with empty pSECTAG2 or pSECTAG2::hSlit2. Forty-eight hours later, the cells
were washed
twice with PBS and incubated with 6mi salt extraction buffer (10mM HEPES, pH
7.5, 1M
NaCI and IX protease inhibitors) for 15 minutes at 25 C. Salt extraction was
repeated and the
samples were centrifuged at 10,000 rpm for 20 minutes to pellet cell debris.
The supernatant
was loaded on Amicon Ultra-15 concentrator columns/100 kDa cutoff and
centrifuged until
12m1 of salt extracts was reduced to approximately 500 1. The concentrated
protein
preparations were analyzed by Coomassie Blue staining, and stored at 4 C for
up to one
week. Using this protocol, Slit2 concentrations of 20-50 g/ml were routinely
obtained. In
addition to preparing concentrated protein from cells transfected with Slit2
plasmid, the
identical protocol was performed on cells transfected with an empty vector
(pSECTAG2).
This resulting preparation was referred to as a "Mock" preparation, and it was
used as a
control in all experiments analyzing the effect of Slit2.
Haptotaxis Migration Assay.= Cells were removed from tissue culture dishes
with
TrypLE Express, washed once with 0.1% trypsin inhibitor, 0.2% fatty acid-free
BSA in
DMEM or EBM-2, and twice with 0.2% BSA in the relevant media. The washed cells
were
counted and resuspended at 0.3 x 105 cells / ml. 1.5 x 105 were loaded into
the upper chamber
of 12 m Costar transwells pre-coated on the lower surface with 5 g/ml
fibronectin. The
effect of Slit2 on haptotaxis was analyzed by co-coating with 0.5 g/ml Slit2
or an equivalent
amount of Mock preparation. Cell migration was allowed to proceed for 6 hours,
after which
cells on the upper surface of the transwell were removed with a cotton swab.
The cells on the
lower surface were fixed with 4% formaldehyde for 5 minutes and washed three
times with
PBS. For HEK 293 cells, the number of GFP-positive cells (HEK 293) on the
lower surface
was enumerated by counting six lOX fields on an inverted fluorescence
microscope. The
number of migrated cells on fibronectin/Mock-coated membranes was considered
100% for
data presentation and subsequent statistical analysis.
Yeast Two Hybrid Assay: pGBKT7::hRobo4 465-723 was transformed into the yeast
strain PJ694A, creating PJ694A-Robo4. A human aortic cDNA library was cloned
into the
-80-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
prey plasmid pACT2 and then transformed into PJ694A-Robo4. Co-transformed
yeast strains
were plated onto SD -Leu-Trp (-LT) to analyze transformation efficiency and SD
-Leu-Trp-
His-Ade (-LTHA) to identify putative interacting proteins. Yeast strains
competent to grow
on SD -LTHA were then tested for expression of (3-galactosidase by the filter
lift assay. Prey
plasmids were isolated from yeast strains capable of growing on SD -LTHA and
expressing
-galactosidase, and sequenced at the University of Utah Core Facility.
Immunoprecipitation: Cell lysates were prepared in 50mM Tris-Cl, pH 7.4, 50mM
NaCI, 1mM DTT, 0.5% Triton X-100, phosphatase and protease inhibitors,
centrifuged at
14K for 20 minutes to pellet insoluble material, cleared with normal IgG
coupled to agarose
beads for 60 minutes, and incubated for 2 hours at 4 C with relevant
antibodies coupled to
agarose beads. The precipitates were washed extensively in lysis buffer and
resuspended in
2X sample buffer (125mM Tris-Cl, pH 6.8, 4% SDS, 20% Glycerol, 0.04%
bromophenol
blue and 1.4M 2-mercaptoethanol).
GST Pull Down Assay: Rosetta2 E. coli harboring pGEX-4T1::mRobo4 were grown
to OD600 of 0.6 and induced with 0.3mM IPTG. After 3-4 hours at 30 C, 220rpm,
the cells
were lysed by sonication in 20mM Tris-Cl pH 7.4, 1% Triton X-100, 1 g/ml
lysozyme,
1 mM DTT and protease inhibitors. The GST-fusion proteins were captured on
glutathione-
Sepharose 4B, washed once with lysis buffer without lysozyme and then twice
with
binding/wash buffer (50mM Tris-Cl, pH 7.4, 150mM NaCl, 1mM DTT, 1% Triton X-
100,
0.1% BSA and protease inhibitors). The GST-fusion proteins were incubated with
60nM
purified recombinant paxillin overnight at 4 C, washed extensively in
binding/wash buffer,
and resuspended in 2X sample buffer.
Western Blotting: Immunoprecipitates and GST-fusion proteins were incubated
for 2
minutes at 100 C, separated by SDS polyacrylamide gel electrophoresis (SDS-
PAGE) and
transferred to a polyvinyldifluoride (PVDF) membrane. PVDF membranes were
incubated
with 5% nonfat dry milk in PBS + 0.1% Tween20 (PBST) (PBST-M) for 60 minutes
at 25 C.
Blocked membranes were incubated with primary antibody (anti-Flag M2 at
1:2000; anti-HA
at 1:10,000; anti-Hic-5 at 1:500; anti-paxillin at 1:10,000; anti-Rac at
1:1,000 and anti-Cdc42
at 1:500) in PBST-M for 60 minutes at 25 C, or overnight at 4 C. Membranes
were washed 3
x 10 minutes in PBST and then incubated with secondary antibody (goat anti-
mouse or goat
anti-rabbit horseradish peroxidase at 1:10,000) for 60 minutes at 25 C.
Membranes were
washed 3 x 10 minutes in PBST and visualized with ECL PLUS.
-81-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
In vitro Transcription/Translation: Mena-V5 was synthesized with the T7 Quick
Coupled in vitro Transcription/Translation system according to the
manufacturer's protocol.
SpreadingAssay: Cells were plated onto coverslips coated with 5 g/ml
fibronectin or
in some instances, where indicated, 30 g/ml 9-11 fragment of fibronectin.
Following a 30
minute incubation at 5% COZ and 37 C, the cells were washed three times with
ice-cold PBS
and fixed with 3.7% formaldehyde for 10 minutes at room temperature. The cells
were then
permeabilized with 0.2% Triton X-100 for three minutes, washed three times
with PBS +
0.1% Tween20 (PBST) and incubated with 10 g/ml Rhodamine-Phalloidin for one
hour at
room temperature. Following three more washes in PBS-T, the coverslips were
mounted in
Pro-Long Gold and analyzed by confocal microscopy. The total area of at least
150 cells in
three independent experiments was determined using ImageJ.
siRNA-mediated knockdown of paxillin: HEK 293 cells were transfected with
100nM
siRNA duplexes (5'-CCCUGACGAAAGAGAAGCCUAUU-3', SEQ ID NO: 19 and 5'-
UAGGCUUCUCUUUCGUCAGGGUU-3') using LipofectAMINE 2000, according to the
manufacturer's instructions. 48 h after transfection, cells were processed for
biochemical
analysis or cell spreading assays. Paxillin reconstitution was accomplished by
transfection
with an expression vector encoding chicken paxillin, which has the nucleotide
sequence 5'-
CCCCTACAAAAGAAAAACCAA-3' within the siRNA target site. Knockdown and
reconstitution were visualized by western blotting with paxillin antibodies
and quantified by
densitometry.
Rac and Cdc42 Activation Assay: Cells were detached from cell culture dishes,
held in
suspension for one hour in DMEM + 0.2% BSA, and plated onto bacterial Petri
dishes coated
with 5 g/ml fibronectin for five minutes. The cells were then washed twice
with ice-cold
PBS and lysed in 50mM Tris pH 7.0, 500mM NaC1, 1mM MgC12, 1mM EGTA, 1mM DTT,
0.5% NP-40, 1X protease inhibitors, 1X phosphatase inhibitors and 20 g/ml GST-
PBD. The
lysate was centrifuged for five minutes at 14,000 rpm and the supernatant was
incubated with
30 l of glutathione agarose for 30 minutes at 4 C. Following three washes
with lysis buffer,
bound proteins were eluted with 2X sample buffer. Rac and Cdc42 were detected
by western
blotting with antibodies specific to each protein. Rac activation levels were
normalized to
total Rac and the highest value in each experiment was assigned a value of 1.
Generation of Robo4 APIAP mice and genotyping: The Robo4 targeting vector was
electroporated into embryonic stem (ES) cells. ES cells heterozygous for the
targeted allele
-82-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
were injected into blastocysts and then transferred to pseudopregnant females.
Chimeric
males were identified by the presence of agouti color and then mated to
C57BL/6 females to
produce ES-cell derived offspring. Genotype was confirmed by Southern blot
analysis of tail
DNA. Genomic DNA from ear punch or tail samples was used for PCR genotyping
under
the following conditions; denaturation at 94 C for 30 seconds, annealing at 60
C for 30
seconds, and extension at 72 C for 60 seconds, 40 cycles. The following two
primers were
used for genotyping of Robo4: 5' cccttcacagacagactctcgtatttcc 3' (forward) and
5'cccagacctacattaccttttgccg 3'(reverse) and for AP: 5'ggcaacttccagaccattggcttg
3'(forward)
and 5' ggttaccactcccactgacttccctg 3' (reverse).
Embryos and expression analysis: Staging of embryos, in situ hybridization,
paraffin
sectioning and whole-mount PECAM-1 immunohistochemistry were performed. For
Northern Blot analysis, 20 g of total RNA was loaded per lane after isolation
with TRIZOL.
32P-labelled probe was generated using prime It II Random-Primer labeling kit
(Stratagene).
Lung lysates were prepared with lysis buffer [1% NP-40, 150mM NaCI, 50mM Tris-
Cl (pH
7.5), 1 mM EDTA and protease inhibitor cocktail (Roche)]. Robo4 protein from
the lung
lysates was detected by Western blot analysis using a polyclonal anti-Robo4
antibody as
previously described.
Alkaline phosphatase (AP) staining: Embryos or tissues were fixed in 4%
paraformaldehyde and 2mM MgC12 in PBS overnight at 4 C with shaking. Samples
were
washed three times for 15 min in PBST (PBS, 0.5% Tween 20). Endogenous
alkaline
phosphatase was inactivated at 65 C for 90 min in PBS with 2mM MgCl2, then
washed in AP
buffer (100mM Tris-Cl, pH9.5, 100mM NaCI, 50mM MgCl2,, 0.1% Tween 20, 2mM
Levamisole) twice for 15 minutes. Staining was carried out in BM purple
substrate
(Boehringer Mannheim) for embryos (Boehringer Mannheim) or NBT/BCIP for adult
tissues.
Staining was stopped in PBS, with 5mM EDTA.
Whole mount immunohistochemistry after AP staining: Alkaline phosphatase (AP)
staining on fixed and dissected retinas was performed as described above.
Staining was
stopped in PBS -5mM EDTA. Retinas were washed twice in PBS and post-fixed 5
minutes in
4% paraformaldehyde, phosphate-buffered saline at RT, then washed twice in
PBS. After 2h
hours incubation in PBlec (PBS, pH 6.8,1% Triton-X100, 0.1 mM CaCl 0.1 mM MgCI
0.1
mM MnCI), retinas were incubated with antibodies overnight at 4 C. Pericytes
were labeled
using rabbit anti-NG2 antibody (1:200; Chemicon) and endothelial cells were
labeled using
-83-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
rat anti-endomucin (Clone V.7C7 kindly provided by Dietmar Vestweber; diluted
1:20).
After 3 washes in PBS-T (PBS, pH 7.4,1% Triton-X100), samples were incubated
with
secondary antibodies conjugated with the appropriate fluorochrome-Alexa Fluor
488 or 568
(Molecular Probes; Invitrogen) in PBS. After washing and a brief postfixation
in 4% PFA,
the retinas were flat mounted and coversliped using Mowiol/DABCO (Sigma-
Aldrich)
Samples were analyzed by conventional light and fluorescence microscopy using
a Zeiss
Stereomicroscope Stemi SV 11 Bioquad equipped with a Zeiss Axiocam HRc digital
camera
and by confocal laser scanning microscopy using a Zeiss LSM Meta 510. AP
staining was
visualized using the 633nm HeNe laser and reflection settings. Digital images
were processed
using Volocity (4.0 Improvision) and compiled in Adobe Photoshop CS2.
Immunohistochemistry: Whole-mount triple immunofluorescence confocal
microscopy was performed. Briefly, antibodies to PECAM, NP1, CX40, 2H3, BFABP
and
aSMA were used to label the limb skin of Robo4 +/+ or Robo4 -/- embryos at
E15.5.
Binding and activity of Robo4 agonists on Robo4 expressing HEK cells: Stable
cell
lines expressing Robo4-HA (Robo4-HEK), or the pcDNA3 vector alone (Control-
HEK),
were seeded in 6-well culture dishes precoated with 100 g/ml poly-L- lysine.
Cells were
incubated with HEK CM or Slit-myc CM at 37 C. After lhr incubation with
conditioned
media, followed by three washes in PBS, cells were fixed in 4 %
paraformaldehyde for 20
min. Cells were then washed three times with PBS and incubated with mouse anti-
myc
antibody (Santa Cruz Biotech) and anti-mouse Alexa 594-conjugated secondary
antibody
(Molecular Probes). The ability of those agonists, which bind to Robo4 to
inhibit migration,
was performed according to Park KW, Morrison CM, Sorensen LK, et al., "Robo4
is a
vascular-specific receptor that inhibits endothelial migration," Dev
Bio12003;261(1):251-67.
Isolation of murine lung endothelial cells: Sheep anti-rat IgG Dynal beads
(Dynal
Biotech) were conjugated with either anti-PECAM-1 or anti-ICAM-2 monoclonal
antibody
(BD Pharmingen) at 5 g of antibody per 100 L of beads. The beads were
precoated and
stored at 4 C (4x10g beads/mL of PBS with 0.1% BSA) for up to 2 weeks. The
lungs from
three adult mice were harvested. The lung lobes were dissected from visible
bronchi and
mediastinal connective tissue. The lungs were washed in 50mL cold isolation
medium (20%
FBS-DMEM) to remove erythrocytes, minced with scissors and digested in 25mL of
pre-
warmed Collagenase (2mg/mL, Worthington) at 37 C for 45 minutes with gentle
agitation.
The digested tissue was dissociated by triturating 12 times through a 60 cc
syringe attached to
-84-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
a 14 gauge metal cannula and then filtered through sterile 70 m disposable
cell strainer
(Falcon). The suspension was centrifuged at 400 x g for 10 minutes at 4 C. The
cell pellet
was resuspended in 2ml cold PBS and then incubated with PECAM-l coated beads
(15 L/mL of cells) at room temperature for 10 minutes. A magnetic separator
was used to
recover the bead-bound cells, which were washed in isolation medium, and then
resuspended
in complete medium (EGM-2 MV, Lonza). The cells were plated in a single
fibronectin-
coated 75-cm2 tissue culture flask and nonadherent cells were removed after
overnight
incubation. The adherent cells were washed with PBS and 15 ml of complete
medium was
added. Cultured cells were fed on alternate days with complete medium. When
the cultures
reached 70 to 80% confluency, they were detached with trypsin-EDTA,
resuspended in 2 ml
PBS and sorted for a second time using ICAM-2 conjugated beads (15 L/mL of
cells). The
cells were washed and plated as above. Passages 2 to 5 were used for
functional assays.
Cell Culture: Human dermal microvascular endothelial cells (HMVEC, Cambrex)
were grown in EGM-2 MV, and used between passages 3 and 6.
Immunocytochemistry: 8 well chamber slides (Lab-Tek) were coated with 1.5
g/cm2
fibronectin for two hours prior to plating cells. Murine lung endothelial
cells were plated
overnight at 37 C (100,000 cells/well) in complete medium, EGM-2 MV. The cells
were
then washed three times in PBS, and fixed in 4% paraformaldehyde for 10
minutes at room
temperature. After three additional washes in PBS, the cells were washed in 1%
Triton X-
100 in PBS for 15 minutes at room temperature followed by three washes in PBST
(0.1%
Triton X-100 in PBS). The cells were then blocked in 2% BSA in PBS for 20
minutes at
room temperature and incubated with primary antibody in 2% BSA: rat anti-PECAM-
1
(Pharmigen), rabbit anti-Von Willebrand Factor (vWF) (DAKO) for 1 hour at room
temperature. After incubation with primary antibody, the cells were washed in
PBST and
incubated with secondary antibody in 2% BSA: Alexa Fluor 488 donkey anti-rat
IgG and
Alexa Fluor 594 donkey anti-rabbit IgG (Molecular Probes) for 1 hour at room
temperature.
The cells were washed once in PBST, once in PBS, mounted in Vectashield
mounting media
(Vector Laboratories), and photographed by a confocal microscopy.
Fluorescence-Activated Cell Sorting (FACS): Murine lung endothelial cells were
detached from the culture dish by brief trypsinization (no more than 2
minutes) at 37 C.
Proteolysis was arrested by the addition of trypsin inhibitor in EBM-2 + 0.1%
BSA. The
cells were washed twice in FACS buffer (PBS without Ca2+ and Mg2+ + 0.1% BSA)
and
-85-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
then resuspended in 1mL FACS buffer. Analysis of the expression of cell
surface markers
was performed with two-step immunofluorescence staining. The cells were
incubated for 30
minutes at 4 C with purified monoclonal antibodies: rat anti-PECAM -1, rabbit
anti-vWF.
The cells were then washed two times in FACS buffer and resuspended in 1mL
FACS buffer.
The cells were then incubated for 30 minutes at 4 C with fluorescent secondary
antibody:
Alexa Fluor 488 donkey anti-rat IgG and Alexa Fluor 594 donkey anti-rabbit IgG
(Molecular
Probes). The cells were again washed twice, resuspended in 1mL FACS buffer and
analyzed
with the FACS.
Cell migration assay: Cells were labeled with Ce1lTracker Green CMFDA
(Molecular Probes) for 1 hour, washed and then starved overnight in EBM-2
supplemented
with 0.1% BSA. Cells were trypsinized, washed and resuspended to 300,000
cells/mL.
100 L of cell suspension (30,000 cells) was loaded onto 8- m HTS FluoroBlock
filters (BD
Falcon) that had been previously coated on both sides with 5 g/mL human
fibronectin. Test
factors were diluted in EBM-2 /0.1% BSA and placed in the lower chamber. After
incubation at 37 C for 3 hours, two 5X fields from each well were
photographed on an
inverted fluorescence microscope (Axiovert 200). The number of migrated cells
was
enumerated by counting fluorescent cells. Basal migration of Robo4+1+ cells
was set at 1.
Data are presented as mean S.E. of three independent experiments in
triplicate.
Tube formation assay: Tube formation was performed as previously described5.
In
brief, lung endothelial cells isolated from Robo4+1+ and Robo4APIAP mice were
plated onto
matrigel-coated wells of a 48-well dish, and starved overnight in 0.5% serum.
The cells were
then stimulated with 0.48nM VEGF-A in the absence or presence of Slit2 for 3.5
hours, and
then photographed. Average tube length was determined using ImageJ software.
Data are
presented as mean S.E. of three independent experiments in duplicate.
In vitro permeability assay: Lung endothelial cells (ECs) isolated from
Robo4+/+ and
Robo4APIAP mice were plated onto 3.0 m Costar transwells pre-coated with 1.5
g/cm2 human
fibronectin and grown to confluency. Cells were starved overnight, pre-treated
with 0.3nM
Slit2 for 30-60 minutes and then stimulated with 2.4nM VEGF-A for 3.5 hours.
Horseradish
peroxidase (HRP) was added to the top chamber at a final concentration of 100
g/ml, and 30
minutes later the media was removed from the lower chamber. Aliquots were
incubated with
0.5 mM guaiacol, 50 mM Na2HPO4, and 0.6 mM H202, and formation of 0-
phenylenediamine was determined by measure of absorbance at 470 nm. Basal
permeability
-86-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
of monolayers was set at 100%. The data is presented as mean S.E. of three
independent
experiments in triplicate.
VEGF Induced Retinal Permeability: In brief, 8-10 week old mice were
anesthetized
with Avertin (2-2-2 Tribromoethanol, 0.4 mg/g; Acros Organics, Morris Plains,
NJ). Mice
were given an intraocular injection of 1.4uL of 35.7ug/mL VEGF-A (R&D Systems
Inc.
Minneapolis, MN) with 50ng Slit2N (SEQ ID NO: 39). An injection with
equivalent volume
of Mock preparation was given in the contralateral eye. As indicated, other
conditions of
1.4uL of saline, Mock preparation, or slit were administered. Six hours later,
mice were
given an I.V. injection via the tail vein of 50uL Evans Blue 60mg/mL. After
two hours, mice
were sacrificed and perfused with citrate-buffered para-formaldehyde to remove
intravenous
Evans Blue. Eyes were enucleated and retinas dissected. Evans Blue dye was
eluted in
0.3mL formamide for 18 hours at 70 C. The extract was ultra-centrifuged
through a 5kD
filter for 2 hours. Absorbance was measured at 620nm. Background absorbance
was
measured at 740nm and subtracted out.
Adenoviral expression of Robo4: Robo4 was expressed via adenovirus as
previously
described.
Miles Assay: Evans Blue was injected into the tail vein of 6-8 week old mice,
and
thirty minutes later either saline, or lOng of VEGF-A in the absence and
presence of 100ng
Slit2 was injected into the dermis. After an additional thirty minutes, punch
biopsies were
preformed and Evans Blue was eluted from the dermal tissue in formamide for 18
hours at
60 C. Following centrifugation, the absorbance was measured at 620nm. The
amount of
dermal permeability observed in saline injected animals was set at 1. Data are
presented as
mean S.E. of five individual mice with each treatment in duplicate (six
total injections per
animal).
Biochemical assays: HMVEC were grown to confluence on fibronectin-coated
dishes
and starved overnight in EBM-2 + 0.2% BSA. The next day, the cells were
stimulated with
50ng/mL VEGF-A for 5 minutes, washed twice with ice-cold PBS and lysed in 50mM
Tris
pH 7.4, 150mM NaCl, 10mM MgCl2, 1 mM DTT, 10% Glycerol, 1% NP-40, 0.5% Sodium
Deoxycholate, 0.1% SDS, 1X protease inhibitors, IX phosphatase inhibitors.
Lysates were
combined with 2X sample buffer, separated by SDS-PAGE and probed with
antibodies to
phospho-VEGFR2, phospho-p42/44 and phospho-Src (Cell Signaling) at 1:1000. For
Rac
activation assays, crude membrane preps were generated9 and GTP-Rac was
precipitated with
-87-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
20 g/ml GST-PBD. Following three washes with lysis buffer, bound proteins
were eluted
with 2X sample buffer. Racl was detected by western blotting with monoclonal
antibodies
(BD Biosciences).
ARF6 Activation Assay: Cells were detached from cell culture dishes, held in
suspension
for 1 h in DMEM + 0.2% BSA, and plated onto bacterial Petri dishes coated with
5 g/ml
fibronectin for 5 min. The cells were then washed twice with ice-cold PBS and
lysed in
50mM Tris pH 7.0, 500mM NaCI, 1mM MgC12, 1mM EGTA, 1mM DTT, 0.5% NP-40, 1X
protease inhibitors, 1X phosphatase inhibitors and 50 g/ml GST-GGA3-VHS-GAT.
The
lysate was centrifuged for 5 min at 14,000 rpm and the supernatant was
incubated with 50 l
of glutathione agarose for 30 min at 4 C. Following three washes with lysis
buffer, bound
proteins were eluted with 2X sample buffer. ARF6 was detected by western
blotting with
ARF6-specific antibodies.
Statistical Analysis: Statistical significance was determined using the
Student's t-test or
ANOVA, where appropriate.
-88-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
REFERENCES
Afzal A, Shaw LC, Ljubimov AV, Boulton ME, Segal MS, Grant MB. Retinal and
choroidal microangiopathies: Therapeutic opportunities. Microvasc Res 2007.
Armour KL, Clark MR, Hadley AG, Williamson LM. Recombinant human IgG
molecules lacking Fcgamma receptor I binding and monocyte triggering
activities. Eur J
Immunol 1999; 29(8):2613-24.
Balasubramanian, N., Scott, D.W., Castle, J.D., Casanova, J.E. & Schwartz,
M.A.
Arf6 and microtubules in adhesion-dependent trafficking of lipid rafts. Nature
cell biology 9,
1381-1391 (2007).
Bashaw, G.J., Kidd, T., Murray, D., Pawson, T., and Goodman, C.S. (2000).
Repulsive axon guidance: Abelson and Enabled play opposing roles downstream of
the
roundabout receptor. Cell 101, 703-715.
Battye, R., Stevens, A., and Jacobs, J.R. (1999). Axon repulsion from the
midline of
the Drosophila CNS requires slit function. Development 126, 2475-2481.
Battye R, Stevens A, Perry RL, Jacobs JR. Repellent signaling by Slit requires
the
leucine-rich repeats. J Neurosci 2001; 21(12):4290-8.
Bedell, V.M., Yeo, S.Y., Park, K.W., Chung. J., Seth, P., Shivalingappa, V.,
Zhao, J.,
Obara, T., Sukhatme, V.P., Drummond, I.A., Li, D.Y., and Ramchandran, R.
(2005).
roundabout4 is essential for angiogenesis in vivo. Proc. Natl. Acad. Sci.
U.S.A. 102,
6373-6378.
Brooks, P.C., Clark, R.A., and Cheresh, D.A. (1994). Requirement of vascular
integrin alpha v beta 3 for angiogenesis. Science 264, 569-571.
Brooks, P.C., Montgomery, A.M., Rosenfeld, M., Reisfeld, R.A., Hu, T., Klier,
G.,
and Cheresh, D.A. (1994). Integrin alpha v beta 3 antagonists promote tumor
regression by
inducing apoptosis of angiogenic blood vessels. Cel130, 1157-1164.
Brose, K., Bland, K.S., Wang, K.H., ARNOtt, D., Henzel, W., Goodman, C.S.,
Tessier-Lavigne, M., and Kidd, T. (1999). Slit proteins bind Robo receptors
and have an
evolutionarily conserved role in repulsive axon guidance. Cell 19, 795-806.
Brown DM, Kaiser PK, Michels M, Soubrane G, Heier JS, Kim RY, Sy JP,
Schneider S; ANCHOR Study Group. Ranibizumab versus verteporfin for
neovascular age-
related macular degeneration. N Engl J Med. 2006 355(14):1432-44.
-89-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Brown, M.C., and Turner, C.E. (2004). Paxillin: adapting to change. Physiol.
Rev.
84, 1315-1339.
Byzova, T.V., Goldman, C.K., Pampori, N., Thomas, K.A., Bett, A., Shattil,
S.J., and
Plow, E.F. (2000). A mechanism for modulation of cellular responses to VEGF:
activation
of the integrins. Mol. Cel16, 851-860.
Carmeliet P, Tessier-Lavigne M. Common mechanisms of nerve and blood vessel
wiring. Nature 2005; 436(7048):193-200.
Cheng HJ, Nakamoto M, Bergemann AD, Flanagan JG. Complementary gradients in
expression and binding of ELF-1 and Mek4 in development of the topographic
retinotectal
projection map. Cell 1995; 82(3):371-81.
Chun DW, Heier JS, Topping TM, Duker JS, Bankert JM. A pilot study of multiple
intravitreal injections of ranibizumab in patients with center-involving
clinically significant
diabetic macular edema. Ophthalmology 2006; 113(10):1706-12.
Cross MJ, Dixelius J, Matsumoto T, Claesson-Welsh L. VEGF-receptor signal
transduction. Trends in biochemical sciences 2003; 28(9):488-94.
Culotti JG, Merz DC. DCC and netrins. Curr Opin Cell Biol 1998; 10(5):609-13.
Diabetic Retinopathy Clinical Research Network, Scott IU, Edwards AR, Beck RW,
Bressler NM, Chan CK, Elman MJ, Friedman SM, Greven CM, Maturi RK, Pieramici
DJ,
Shami M, Singerman LJ, Stockdale CR. A phase II randomized clinical trial of
intravitreal
bevacizumab for diabetic macular edema. Ophthalmology. 2007 114(10):1860-7.
Dickson BJ. Molecular mechanisms of axon guidance. Science 2002;
298(5600):1959-64.
Dong QG, Bernasconi S, Lostaglio S, et al. A general strategy for isolation of
endothelial cells from murine tissues. Characterization of two endothelial
cell lines from the
murine lung and subcutaneous sponge implants. Arterioscler Thromb Vasc Biol
1997;
17(8):1599-604.
Dorrell M, Uusitalo-Jarvinen H, Aguilar E, Friedlander M. Ocular
neovascularization: basic mechanisms and therapeutic advances. Surv
Ophthalmol. 2007 52
Suppl 1:S3-19.
Drescher U, Kremoser C, Handwerker C, Loschinger J, Noda M, Bonhoeffer F.
In vitro guidance of retinal ganglion cell axons by RAGS, a 25 kD tectal
protein related to
ligands for Eph receptor tyrosine kinases. Cell 1995; 82(3):359-70.
-90-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
D'Souza-Schorey, C., and Chavrier, P. (2006). ARF proteins: roles in membrane
traffic and beyond. Nat. Rev. Mol. Cell. Biol. 7, 347-358.
Eliceiri BP, Cheresh DA. (2000). Role of alpha v integrins during
angiogenesis.
Cancer J. 6, S245-249.
Eliceiri BP, Paul R, Schwartzberg PL, Hood JD, Leng J, Cheresh DA. Selective
requirement for Src kinases during VEGF-induced angiogenesis and vascular
permeability.
Molecular cell 1999; 4(6):915-24.
Eliceiri BP, Puente XS, Hood JD, et al. Src-mediated coupling of focal
adhesion
kinase to integrin alpha(v)beta5 in vascular endothelial growth factor
signaling. The Journal
of cell biology 2002; 157(1):149-60.
Francis, S.E., Goh, K.L., Hodivala-Dilke, K., Bader, B.L., Stark, M.,
Davidson, D.,
and Hynes, R.O. (2002). Central roles of alpha5betal integrin and fibronectin
in vascular
development in mouse embryos and embryoid bodies. Arterioscler. Thromb. Vasc.
Biol. 22,
927-933.
Garrett TA, Van Buul JD, Burridge K. VEGF-induced Rac1 activation in
endothelial
cells is regulated by the guanine nucleotide exchange factor Vav2.
Experimental cell
research 2007; 313(15):3285-97.
Gavard J, Gutkind JS. VEGF controls endothelial-cell permeability by promoting
the
beta-arrestin-dependent endocytosis of VE-cadherin. Nature cell biology 2006;
8(11):1223-34.
Gerhardt H, Golding M, Fruttiger M, et al. VEGF guides angiogenic sprouting
utilizing endothelial tip cell filopodia. The Journal of cell biology 2003;
161(6):1163-77.
Goldfinger, L.E., Han, J., Kiosses, W.B., Howe, A.K., and Ginsberg, M.H.
(2003).
Spatial restriction of alpha4 integrin phosphorylation regulates lamellipodial
stability and
alpha4betal-dependent cell migration. J. Cell Biol. 162, 731-741.
Markus Hafner, Anton Schmitz, Imke Gru"ne, Seergazhi G. Srivatsan, Bianca
Paul,
Waldemar Kolanus, Thomas Quast, Elisabeth Kremmer, Inga Bauer & Michael
Famulok
(2006). Inhibition of cytohesins by SecinH3 leads to hepatic insulin
resistance. Nature. 444,
941-944.
Hagel, M., George, E.L., Kim, A., Tamimi, R., Opitz, S.L., Turner, C.E.,
Imamoto, A., and Thomas, S.M. (2002). The adaptor protein paxillin is
essential for normal
-91-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
development in the mouse and is a critical transducer of fibronectin
signaling. Mol. Cell.
Biol. 22, 901-915.
Han, J., Liu, S., Rose, D.M., Schlaepfer, D.D., McDonald, H., and Ginsberg,
M.H.
(2001). Phosphorylation of the integrin alpha 4 cytoplasmic domain regulates
paxillin
binding. J. Biol. Chem. 276, 40903-40909.
Hohenester E, Hussain S, Howitt JA. Interaction of the guidance molecule Slit
with
cellular receptors. Biochem Soc Trans 2006; 34(Pt 3):418-21.
Hohenester, E., Hussain, S., and Howitt, J.A. (2006). Interaction of the
guidance
molecule Slit with cellular receptors. Biochem. Soc. Trans. 34, 418-421.
Hong K, Hinck L, Nishiyama M, Poo MM, Tessier-Lavigne M, Stein E. A ligand-
gated association between cytoplasmic domains of UNC5 and DCC family receptors
converts
netrin-induced growth cone attraction to repulsion. Cell 1999; 97(7):927-41.
Howitt JA, Clout NJ, Hohenester E. Binding site for Robo receptors revealed by
dissection of the leucine-rich repeat region of Slit. Embo J 2004; 23(22):4406-
12.
Hu, H., Li, M., Labrador, J.P., McEwen, J., Lai, E.C., Goodman, C.S., and
Bashaw, G.J. (2005). Cross GTPase-activating protein (CrossGAP)/Vilse links
the
Roundabout receptor to Rac to regulate midline repulsion. Proc. Natl. Acad.
Sci. U.S.A. 102,
4613-4618.
Huminiecki, L., and Bicknell, R. (2000). In silico cloning of novel
endothelialspecific
genes. Genome Res. 10, 1796-1806.
Huminiecki L, Gorn M, Suchting S, Poulsom R, Bicknell R. Magic roundabout is a
new member of the roundabout receptor family that is endothelial specific and
expressed at
sites of active angiogenesis. Genomics 2002; 79(4):547-52.
Huminiecki, L., Gorn, M., Suchting, S., Poulsom, R., and Bicknell, R. (2002).
Magic
roundabout is a new member of the roundabout receptor family that is
endothelial specific
and expressed at sites of active angiogenesis. Genomics 79, 547-552.
Ikeda, S. et al. Novel role of ARF6 in vascular endothelial growth factor-
induced
signaling and angiogenesis. Circulation research 96, 467-475 (2005).
Jain RK. Molecular regulation of vessel maturation. Nat Med 2003; 9(6):685-93.
Jin, S.W., Beis, D., Mitchell, T., Chen, J.N., and Stainier, D.Y. (2005).
Cellular and
molecular analyses of vascular tube and lumen formation in zebrafish.
Development 132,
5199-5209.
-92-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Jones CA, Li DY. Common cues regulate neural and vascular patterning. Curr
Opin
Genet Dev. 2007 Aug; 17(4):332-6.
Kanellis, J., Garcia, G.E., Li, P., Parra, G., Wilson, C.B., Rao, Y., Han, S.,
Smith, C.W., Johnson, R.J., Wu, J.Y., and Feng, L. (2004). Modulation of
inflammation by
slit protein in vivo in experimental crescentic glomerulonephritis. Am. J.
Pathol. 165,
341-352.
Katoh Y, Katoh M. Comparative genomics on SLIT1, SLIT2, and SLIT3 orthologs.
Oncol Rep 2005; 14(5):1351-5.
Kaur, S., Castellone, M.D., Bedell, V.M., Konar, M., Gutkind, J.S., and
Ramchandran, R. (2006). Robo4 signaling in endothelial cells implies
attraction guidance
mechanisms. J. Biol. Chem. 281, 11347-11356.
Kidd, T., Bland, K.S., and Goodman, C.S. (1999). Slit is the midline repellent
for the
robo receptor in Drosophila. Cell 96, 785-794.
Kidd, T., Brose, K., Mitchell, K.J., Fetter, R.D., Tessier-Lavigne, M.,
Goodman, C.S.,
and Tear, G. (1998). Roundabout controls axon crossing of the CNS midline and
defines a
novel subfamily of evolutionarily conserved guidance receptors. Ce1192, 205-
215.
Kidd, T., et al. Roundabout controls axon crossing of the CNS midline and
defines a
novel subfamily of evolutionarily conserved guidance receptors. Cell 92, 205-
215 (1998).
Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., and Schilling, T.F.
(1995).
Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-3 10.
Lantry LE. Ranibizumab, a mAb against VEGF-A for the potential treatment of
age-
related macular degeneration and other ocular complications. Curr Opin Mol
Ther. 2007
9(6):592-602.
Lauffenburger, D.A., and Horwitz, A.F. (1996). Cell migration: a physically
integrated molecular process. Ce1184, 359-369.
Lawson, N.D., and Weinstein, B.M. (2002). In vivo imaging of embryonic
vascular
development using transgenic zebrafish. Dev. Biol. 248, 307-318.
Li, H.S., Chen, J.H., Wu, W., Fagaly, T., Zhou, L., Yuan, W., Dupuis, S.,
Jiang, Z.H.,
Nash, W., Gick, C., Ornitz, D.M., Wu, J.Y., and Rao, Y. (1999). Vertebrate
slit, a secreted
ligand for the transmembrane protein roundabout, is a repellent for olfactory
bulb axons. Cell
19, 807-818.
- 93 -
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Li Q, Olsen BR. Increased angiogenic response in aortic explants of collagen
XVIII/endostatin-null mice. Am J Patho12004; 165(2):415-24.
Lim YC, Garcia-Cardena G, Aliport JR, et al. Heterogeneity of endothelial
cells from
different organ sites in T-cell subset recruitment. Am J Pathol 2003;
162(5):1591-601.
Lima e Silva R, Saishin Y, Saishin Y, et al. Suppression and regression of
choroidal
neovascularization by polyamine analogues. Investigative ophthalmology &
visual science
2005; 46(9):3323-30.
Little M, Rumballe B, Georgas K, Yamada T, Teasdale RD. Conserved modularity
and potential for alternate splicing in mouse and human Slit genes. Int J Dev
Biol 2002;
46(4):385-91.
Liu, S., and Ginsberg, M.H. (2000). Paxillin binding to a conserved sequence
motif
in the alpha 4 integrin cytoplasmic domain. J. Biol. Chem. 275, 22736-22742.
Liu, S., Kiosses, W.B., Rose, D.M., Slepak, M., Salgia, R., Griffin, J.D.,
Turner, C.E.,
Schwartz, M.A., and Ginsberg, M.H. (2002). A fragment of paxillin binds the
alpha 4
integrin cytoplasmic domain (tail) and selectively inhibits alpha 4-mediated
cell migration.
J. Biol. Chem. 277, 20887-20894.
Liu, S., Thomas, S.M., Woodside, D.G., Rose, D.M., Kiosses, W.B., Pfaff, M.,
and
Ginsberg, M.H. (1999). Binding of paxillin to alpha4 integrins modifies
integrin-dependent
biological responses. Nature 402, 676-681.
Long, H., et al. Conserved roles for Slit and Robo proteins in midline
commissural
axon guidance. Neuron 42, 213-223 (2004).
Lundstrom, A., Gallio, M., Englund, C., Steneberg, P., Hemphala, J.,
Aspenstrom, P.,
Keleman, K., Falileeva, L., Dickson, B.J., and Samakovlis, C. (2004). Vilse, a
conserved
Rac/Cdc42 GAP mediating Robo repulsion in tracheal cells and axons. Genes Dev.
18,
2161-2171.
Mahabeleshwar, G.H., Feng, W., Reddy, K., Plow, E.F. & Byzova, T.V. Mechanisms
of integrin-vascular endothelial growth factor receptor cross-activation in
angiogenesis.
Circulation research 101, 570-580 (2007).
Marillat, V., Cases, 0., Nguyen-Ba-Charvet, K.T., Tessier-Lavigne, M., Sotelo,
C.,
and Chedotal, A. (2002). Spatiotemporal expression patterns of slit and robo
genes in the rat
brain. J. Comp. Neurol. 442, 130-155.
-94-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Matthay MA, Zimmerman GA. (2005). Acute lung injury and the acute respiratory
distress syndrome: four decades of inquiry into pathogenesis and rational
management. Am
J Respir Cell Mol Biol.; 33(4):319-27.
Nakamura, K., Yano, H., Uchida, H., Hashimoto, S., Schaefer, E., and Sabe, H.
(2000). Tyrosine phosphorylation of paxillin alpha is involved in
temporospatial regulation
of paxillin-containing focal adhesion formation and F-actin organization in
motile cells.
J. Biol. Chem. 275, 27155-27164.
Navankasattusas, S., K.J. Whitehead, A. Suli, L.K. Sorensen, A.H. Lim, J.
Zhao, K.R.
Thomas, C.B. Chien, and D.Y. Li. The netrin receptor, Unc5b, promotes
angiogenesis in
specific vascular beds. Development (in press).
Nishiya, N., Kiosses, W.B., Han, J., and Ginsberg, M.H. (2005). An alpha4
integrin-
paxillin-Arf-GAP complex restricts Rac activation to the leading edge of
migrating cells.
Nat. Cell Biol. 7, 343-352.
Nobes, C.D., and Hall, A. (1995). Rho, rac, and cdc42 GTPases regulate the
assembly of multimolecular focal complexes associated with actin stress
fibers, lamellipodia,
and filopodia. Cell 81, 53-62.
Nobes, C.D. & Hall, A. Rho GTPases control polarity, protrusion, and adhesion
during cell movement. The Journal of cell biology 144, 1235-1244 (1999).
Ojima T, Takagi H, Suzuma K, Oh H, Suzuma I, Ohashi H, Watanabe D,
Suganami E, Murakami T, Kurimoto M, Honda Y, Yoshimura N. EphrinAl inhibits
vascular
endothelial growth factor-induced intracellular signaling and suppresses
retinal
neovascularization and blood-retinal barrier breakdown. Am J Pathol. 2006 Jan;
168(1):331-9.
Ozaki H, Seo MS, Ozaki K, et al. Blockade of vascular endothelial cell growth
factor
receptor signaling is sufficient to completely prevent retinal
neovascularization. Am J Pathol
2000; 156(2):697-707.
Park KW, Crouse D, Lee M, et al. The axonal attractant Netrin-1 is an
angiogenic
factor. Proc Natl Acad Sci U S A 2004; 101(46):16210-5.
Park KW, Morrison CM, Sorensen LK, et al. Robo4 is a vascular-specific
receptor
that inhibits endothelial migration. Dev Biol 2003; 261(1):251-67.
-95-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Park, K.W., Morrison, C.M., Sorensen, L.K., Jones, C.A., Rao, Y., Chien, C.B.,
Wu, J.Y., Urness, L.D., and Li, D.Y. (2003). Robo4 is a vascular-specific
receptor that
inhibits endothelial migration. Dev. Biol. 261, 251-267.
Raper JA. Semaphorins and their receptors in vertebrates and invertebrates.
Curr
Opin Neurobio12000; 10(1):88-94.
Reutershan J, Morris MA, Burcin TL, Smith DF, Chang D, Saprito MS, Ley K.
Critical role of endothelial CXCR2 in LPS-induced neutrophil migration into
the lung. J Clin
Invest. 2006 116(3):695-702.
Ridley, A.J., Schwartz, M.A., Burridge, K., Firtel, R.A., Ginsberg, M.H.,
Borisy, G.,
Parsons, J.T., and Horwitz, A.R. (2003). Cell migration: integrating signals
from front to
back. Science. 302, 1704-1709.
Rosenfeld PJ, Brown DM, Heier JS, et al. Ranibizumab for neovascular age-
related
macular degeneration. N Engl J Med 2006; 355(14):1419-31.
Ruhrberg C, Gerhardt H, Golding M, et al. Spatially restricted patterning cues
provided by heparin-binding VEGF-A control blood vessel branching
morphogenesis.
Genes & development 2002; 16(20):2684-98.
Salgia, R., Li, J.L., Ewaniuk, D.S., Wang, Y.B., Sattler, M., Chen, W.C.,
Richards, W., Pisick, E., Shapiro, G.I., Rollins, B.J., Chen, L.B., Griffin,
J.D., and
Sugarbaker, D.J. (1999). Expression of the focal adhesion protein paxillin in
lung cancer and
its relation to cell motility. Oncogene. 18, 67-77.
Seeger, M., Tear, G., Ferres-Marco, D., and Goodman, C.S. (1993). Mutations
affecting growth cone guidance in Drosophila: genes necessary for guidance
toward or away
from the midline. Neuron 10, 409-426.
Senger, D.R., Claffey, K.P., Benes, J.E., Perruzzi, C.A., Sergiou, A.P., and
Detmar, M. (1997). Angiogenesis promoted by vascular endothelial growth
factor:
regulation through alphalbetal and alpha2betal integrins. Proc. Natl. Acad.
Sci. U.S.A. 94,
13612-13617.
Seth, P., Lin, Y., Hanai, J., Shivalingappa, V., Duyao, M.P., and Sukhatme,
V.P.
Magic roundabout, a tumor endothelial marker: expression and signaling.
Biochem.
Biophys. Res. Commun. 332, 533-541.
-96-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Seth P, Lin Y, Hanai J, Shivalingappa V, Duyao MP, Sukhatme VP. Magic
roundabout, a tumor endothelial marker: expression and signaling. Biochem
Biophys Res
Commun 2005; 332(2):533-41.
Shields RL, Namenuk AK, Hong K, et al. High resolution mapping of the binding
site on human IgG 1 for Fc gamma RI, Fc gamma RII, Fc gamma RIII, and FcRn and
design
of IgGI variants with improved binding to the Fc gamma R. J Biol Chem 2001;
276(9):6591-604.
Smith LE, Wesolowski E, McLellan A, et al. Oxygen-induced retinopathy in the
mouse. Investigative ophthalmology & visual science 1994; 35(1):101-11.
Soga, N., Connolly, J.O., Chellaiah, M., Kawamura, J., and Hruska, K.A.
(2001). Rac
regulates vascular endothelial growth factor stimulated motility. Cell Commun.
Adhes. 8,
1-13.
Soga, N., Namba, N., McAllister, S., Cornelius, L., Teitelbaum, S.L., Dowdy,
S.F.,
Kawamura, J., and Hruska, K.A. (2001). Rho family GTPases regulate
VEGFstimulated
endothelial cell motility. Exp. Cell Res. 269, 73-87.
Soldi, R., Mitola, S., Strasly, M., Defilippi, P., Tarone, G., and Bussolino,
F. (1999).
Role of alphavbeta3 integrin in the activation of vascular endothelial growth
factor
receptor-2. EMBO J. 18, 882-892.
Stein E, Tessier-Lavigne M. Hierarchical organization of guidance receptors:
silencing of netrin attraction by slit through a Robo/DCC receptor complex.
Science 2001;
291(5510):1928-38.
Suchting, S., Heal, P., Tahtis, K., Stewart, L.M., and Bicknell, R. (2005).
Soluble
Robo4 receptor inhibits in vivo angiogenesis and endothelial cell migration.
FASEB J. 19,
121-138.
Turner, C.E. (2000). Paxillin interactions. J. Cell Sci. 113, 139-140. Wang,
K.H.,
Brose, K., ARNOtt, D., Kidd, T., Goodman, C.S., Henzel, W., and Tessier-
Lavigne, M.
(1999). Biochemical purification of a mammalian slit protein as a positive
regulator of
sensory axon elongation and branching. Cell 96, 771-784.
Turner, C.E. Paxillin and focal adhesion signalling. Nature cell biology 2,
E231-236
(2000).
-97-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Uemura A, Kusuhara S, Katsuta H, Nishikawa S. Angiogenesis in the mouse
retina:
a model system for experimental manipulation. Experimental cell research 2006;
312(5):676-83.
Urness LD, Li DY. Wiring the vascular circuitry: from growth factors to
guidance
cues. Curr Top Dev Biol 2004; 62:87-126.
Wang, B., Xiao, Y., Ding, B.B., Zhang, N., Yuan, X., Gui, L., Qian, K.X.,
Duan, S.,
Chen, Z., Rao, Y., and Geng, J.G. (2003). Induction of tumor angiogenesis by
Slit-Robo
signaling and inhibition of cancer growth by blocking Robo activity. Cancer
Cell 4, 19-29.
Wang, K.H. et al. Biochemical purification of a mammalian slit protein as a
positive
regulator of sensory axon elongation and branching. Cell 96, 771-784 (1999).
Watanabe D, Suzuma K, Matsui S, Kurimoto M, Kiryu J, Kita M, Suzuma I,
Ohashi H, Ojima T, Murakami T, Kobayashi T, Masuda S, Nagao M, Yoshimura N,
Takagi H. Erythropoietin as a retinal angiogenic factor in proliferative
diabetic retinopathy.
N Engl J Med. 2005 353(8):782-92.
Weinstein, B.M. (2002). Plumbing the mysteries of vascular development using
the
zebrafish. Semin. Cell Dev. Biol. 13, 515-522.
Werdich XQ, McCollum GW, Rajaratnam VS, Penn JS. Variable oxygen and retinal
VEGF levels: correlation with incidence and severity of pathology in a rat
model of oxygen-
induced retinopathy. Exp Eye Res 2004; 79(5):623-30.
West, K.A., Zhang, H., Brown, M.C., Nikolopoulos, S.N., Riedy, M.C.,
Horwitz, A.F., and Turner, C.E. (2001). The LD4 motif of paxillin regulates
cell spreading
and motility through an interaction with paxillin kinase linker (PKL). J. Cell
Biol. 154,
161-176.
Westerfield, M. (2000). The zebrafish book. A guide for the laboratory use of
zebrafish (Danio rerio). 4th ed. (Univ. of Oregon Press, Eugene).
Wilkinson DG, Bhatt S, Herrmann BG. Expression pattern of the mouse T gene and
its role in mesoderm formation. Nature 1990; 343(6259):657-9.
Wilson BD, li M, Park KW, et al. Netrins promote developmental and therapeutic
angiogenesis. Science 2006; 313(5787):640-4.
Wojciak-Stothard, B., Potempa, S., Eichholtz, T., and Ridley, A.J. (2001). Rho
and
Rac but not Cdc42 regulate endothelial cell permeability. J. Cell Sci. 114,
1343-1355.
-98-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Wong, K., Ren, X.R., Huang, Y.Z., Xie, Y., Liu, G., Saito, H., Tang, H., Wen,
L.,
Brady-Kalnay, S.M., Mei, L., Wu, J.Y., Xiong, W.C., and Rao, Y. (2001). Signal
transduction in neuronal migration: roles of GTPase activating proteins and
the small
GTPase Cdc42 in the Slit-Robo pathway. Cell 107, 209-221.
Wu, J.Y., Feng, L., Park, H.T., Havlioglu, N., Wen, L., Tang, H., Bacon, K.B.,
Jiang, Z., Zhang, X., and Rao, Y. (2001). The neuronal repellent Slit inhibits
leukocyte
chemotaxis induced by chemotactic factors. Nature 410, 948-952.
Wu, W., Wong, K., Chen, J., Jiang, Z., Dupuis, S., Wu, J.Y., and Rao, Y.
(1999).
Directional guidance of neuronal migration in the olfactory system by the
protein Slit.
Nature 400, 331-336.
Xu Q, Qaum T, Adamis AP. Sensitive blood-retinal barrier breakdown
Quantitation
using evans blue. Invest Ophthalmol Vis Sci. 2001; 42(3):789-94.
Yano, H., Mazaki, Y., Kurokawa, K., Hanks, S.K., Matsuda, M., and Sabe, H.
(2004).
Roles played by a subset of integrin signaling molecules in cadherinbased cell-
cell adhesion.
J. Cell Biol. 166, 283-295.
Yano, H., Uchida, H., Iwasaki, T., Mukai, M., Akedo, H., Nakamura, K.,
Hashimoto, S., and Sabe, H. (2000). Paxillin alpha and Crk-associated
substrate exert
opposing effects on cell migration and contact inhibition of growth through
tyrosine
phosphorylation. Proc. Natl. Acad. Sci. U.S.A. 97, 9076-908 1.
Yu, T.W., Hao, J.C., Lim, W., Tessier-Lavigne, M., and Bargmann, C.I. (2002).
Shared receptors in axon guidance: SAX-3/Robo signals via UNC-34/Enabled and a
Netrin-
independent UNC-40/DCC function. Nat. Neurosci. 5, 1147-1154.
Yuan, W., Zhou, L., Chen, J.H., Wu, J.Y., Rao, Y., and Ornitz, D.M. (1999).
The
mouse SLIT family: secreted ligands for ROBO expressed in patterns that
suggest a role in
morphogenesis and axon guidance. Dev. Biol. 212, 290-306.
Yuminamochi, T., Yatomi, Y., Osada, M., Ohmori, T., Ishii, Y., Nakazawa, K.,
Hosogaya, S., and Ozaki, Y. (2003). Expression of the LIM proteins paxillin
and Hic-5 in
human tissues. J. Histochem. Cytochem. 51, 513-521.
Zallen, J.A., Yi, B.A., and Bargmann, C.I. (1998). The conserved
immunoglobulin
superfamily member SAX-3/Robo directs multiple aspects of axon guidance in C.
elegans.
Ce1192, 217-227.
-99-
CA 02693001 2009-12-30
WO 2009/129408 PCT/US2009/040848
Zhang, Q. et al. Small-molecule synergist of the Wnt/beta-catenin signaling
pathway.
Proceedings of the National Academy of Sciences of the United States of
America 104, 7444-
7448 (2007).
Zhu, Y., Li, H., Zhou, L., Wu, J.Y., and Rao, Y. (1999). Cellular and
molecular
guidance of GABAergic neuronal migration from an extracortical origin to the
neocortex.
Neuron 23, 473-485.
-100-
