Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02755978 2016-09-30
WO 2010/108183
PCT/US2010/028168
1
POLYPEPTIDE EXPRESSION IN CILIATES
[0001]
FIELD OF THE INVENTION
[0002] The invention relates to recombinant polypeptide production
and, in
particular, methods and compositions for the production of recombinant
polypeptides in
ciliates.
BACKGROUND OF THE INVENTION
[0003] The production of polypeptides derived from natural sources can
be
limited by the expense of purification or suffer from limits on availability
of starting
materials. Heterologous polypeptide production is an alternative to the
recovery of
polypeptides from natural sources and can be used for the production of
polypeptides in
economically relevant amounts that are suitable for a variety of applications.
Exemplary
polypeptides suitable for production in heterologous expression systems
include, but are not
limited to, antibodies, hormones, cytokines, interleukins, enzymes, blood
factors, pesticides
and vaccines. Production of genetically engineered vaccine antigens,
therapeutic
polypeptides, industrial enzymes, biopolymers, and bioremediation agents
constitute a
multibillion dollar-per-year industry.
[0004] Current in vivo platforms for the production of recombinant
polypeptides
are limited to a relatively small number of cell-based systems that employ
bacteria, fungi,
insect and mammalian cells. Although bacteria can offer high yield and low-
cost alternatives
for production of mammalian polypeptides, cell culture systems based on higher
organisms
(e.g., insect or mammalian cells) generally provide polypeptides having
greater fidelity to the
natural polypeptides in terms of polypeptide folding and/or post-translational
processing
(e.g., glycosylation). Whole transgenic plants and animals have also been
harnessed for the
production of recombinant polypeptides, but the long development time from
gene to final
product can be a major drawback with these multicellular organisms,
purification of the
recombinant polypeptides can be difficult, and yield may be low.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
2
[0005] Recombinant gene expression in microbial systems generally
relies on one
of two methods for expression construct maintenance in the host cell: episomal
or
integrative-based expression. Episomal expression vectors can contain the
genetic elements
required for recombinant gene expression (i.e., promoters, terminators, etc.)
and can be
maintained as independent genetic elements, usually based on a dominant drug
selection
system, or with a recessive auxotrophic selection system. Removal of the
selection system
often results in loss of the transgenic expression element as cell culture
routinely confers a
competitive growth advantage to cells that have lost recombinant DNA
constructs.
Integrative expression vectors can be more genetically stable than episomal
expression
vectors since they are generally maintained at specific loci in a host cell's
chromosomes.
This latter approach, however, can suffer from limited copy numbers of the
transgenes
compared to episomal strategies.
[0006] Recombinant gene expression in ciliated protists is facilitated
via a variety
of available expression vectors encompassing all the machinery required for
transgene
expression. These vectors can be incorporated as either episomal or
integrative genetic
elements. For example, traditional methods for the production of transgene-
encoded
polypeptides in ciliates such as Tetrahymena have been based on incorporation
of expression
cassettes into somatic loci on the macronuclear chromosomes. Although some
recombinant
gene expression methods employed in Tetrahymena take advantage of the high-
level
amplification of ribosomal DNA copy number that occurs following sexual
conjugation,
current methods can result in the formation of a recombinant palindrome over
several
generations of propagation. This can result in loss of the transgene and,
consequently, in loss
of expression of any polypeptides encoded by the transgene.
[0007] Increasing yield and maintaining genetic stability is important
in
expression system for many reasons including, but not limited to, reduced
production costs.
Thus, there is a need for improved methods for recombinant polypeptide
production in
ciliates. This invention addresses this need.
SUMMARY OF THE INVENTION
[0008] In one aspect, the invention realtes to a nucleic acid
construct comprising:
(a) a selection cassette encoding a resistance marker, (b) a transgene
cassette encoding a
recombinant polypeptide, and (c) a C3 allele rDNA locus comprising a 17S rDNA
gene that
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
3
does not confer paromomycin resistance to a ciliate transformed with the
nucleic acid
construct.
[0009] In some embodiments, the construct is a linear DNA or RNA. In
other
embodiments, the construct is a circular DNA or RNA.
[0010] In some embodiments, the selection cassette does not confer
paromomycin
resistance to a ciliate transformed with the nucleic acid construct.
[0011] In some embodiments, the 17S rDNA gene is a B allele 17S rRNA.
[0012] In some embodiments, the construct is a vector, a plasmid, a
cosmid, a
chromosome or minichromosome, a transposon, an rDNA or any combination
thereof.
[0013] In some embodiments, the vector is an rDNA vector.In certain
embodiments, the vector is an rDNA rescue vector.
[0014] In another aspect, the invention relates to a method for
producing a
recombinant polypeptide in a ciliate, the method comprising: (a) transforming
the ciliate with
an rDNA vector as described herein, (b) culturing the ciliate and expressing
the recombinant
polypeptide; and (c) isolating the recombinant polypeptide.
[0015] In another aspect, the invention relates to a genetically
modified ciliate
having a micronuclear genotype having a micronuclear rDNA locus comprising one
or more
non-functional rDNA genes. In some embodiments, the non-functional
micronuclear rDNA
locus of the genetically modified ciliate comprises a modification of the
nucleotide sequence
of the micronuclear rDNA locus. In some embodiments, the modification of the
micronuclear rDNA locus results in the formation of a non-functional rDNA
chromosome
after sexual conjugation of the ciliate. In some embodiments, the genetically
modified ciliate
has a conditionally conjugation-lethal phenotype. In certain embodiments, the
rDNA gene is
selected from the group consisting of the 5.8S, 17S or 26S genes. In some
embodiments, the
modification is selected from the group consisting of a deletion, an
insertion, a substitution or
an inversion.
[0016] In another aspect, the invention relates to a method for
producing a
recombinant polypeptide in a ciliate, the method comprising: (a) causing the
genetically
modified ciliate to undergo sexual reproduction by conjugation; (b)
transforming a
genetically modified ciliate having a conditionally conjugation-lethal
phenotype as described
herein, with an rDNA rescue vector comprising a transgene cassette encoding
the
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
4
recombinant polypeptide; (c) culturing the genetically modified ciliate to
produce the
recombinant polypeptide; and (d) isolating the recombinant polypeptide.
BRIEF DESCRIPTION OF THE FIGURES
[0017] Figure 1. Variable rDNA molecules in transformed cells.
Recombinant
rDNA chromosomes of transgenic Tetrahymena thermophila strains are unstable
over time.
Genomic DNA was isolated from wild-type (CU428) and four independent rDNA
transgenic
clones (2, 3, 4 and 5) less than two weeks and again after more than 10 weeks
following
initial selection. During the intervening time, strains were passaged into
fresh media.
Equivalent amounts of nucleic acid were resolved by agarose gel
electrophoresis and rDNA
chromosomes visualized by ethidium bromide staining. Three forms of rDNA
chromosome
were detected: wild-type rDNA (bottom arrow), hybrid rDNA (middle arrow) and
fully
transgenic rDNA (top arrow). Over time, transgenic clones 2, 3 and 5 all show
a shift from
abundant fully transgenic rDNA species to only wild-type rDNA (Clones 2 and 5)
or a
mixture of wild-type, hybrid and fully transgenic (Clone 3). Clone 4 shifts
from a mixture of
hybrid and fully transgenic rDNA to fully transgenic rDNA.
[0018] Figure 2. Fig. 2A shows the basic format of the micronuclear
(mic) rDNA
region. The 5' region includes the origin of replication and the 5' Non-
Transcribed Spacer
(NTS). Arrow indicates the location of the start of transcription of the rDNA
genes. Hatched
line indicates the region containing the rDNA genes. The 3' region downstream
of the rDNA
genes includes the 3' NTS. The chromosome breakage sequences (CBS) which
direct the
excision of the micronuclear rDNA region during the formation of a new
macronucleus are
indicated. In several rDNA transformation vectors, a small MCS is inserted
near the start of
the 3' NTS. Not to scale. Fig.2B shows the general organization of a mic rDNA
Knockout
vector. A functionally independent selection cassette is inserted into a copy
of the
micronuclear version of the rDNA, replacing much of the central region (in the
example
shown, all of the rDNA sequence between bases 1696 and 8894 has been removed).
The
remaining 3' and 5' regions of the micronuclear rDNA, as well adjacent
sequence containing
the CBS regions, can act as targeting sequences for homologous recombination
following
transformation. The construct is cloned and maintained in a suitable plasmid
vector. Not to
scale. Fig.2C shows chromosomal organization of the micronuclear rDNA region
following
successful transformation with the mic Knockout construct. Following
homologous double
recombination between the vector and the micronuclear chromosome carrying the
rDNA
genes, the selection cassette is inserted into the micronuclear chromosome,
replacing much of
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
the central region (in the example shown all of the rDNA sequence between
bases 1696 and
8894) and inactivating the micronuclear rDNA genes. The rest of the mic
chromosome is
unaffected. Not to scale. Fig. 2D shows a general macronuclear rDNA
transformation
vector. The macronuclear transformation vector contains a complete version of
the C3
rDNA, including 3' and 5' CBS regions that direct correct processing of the
cassette into an
rDNA palindrome during macronuclear development. A cassette containing the
gene(s) of
interest and an independent selection cassette can be inserted into a multiple
cloning site
(MCS) in the 3' NTS. The construct is cloned and maintained in a suitable
plasmid vector.
Not to scale. Fig.2E shows processing of the micronuclear rDNA region
transformed with
the mic Knockout construct during macronuclear development. The modified
micronuclear
version of the rDNA is processed into a separate palindromic chromosome as
shown. Fig.2F
shows processing of the macronuclear rDNA transformation vector during
macronuclear
development. The vector rDNA is processed into a separate palindromic
chromosome during
macronuclear formation as shown. Fig. 2G. Recombination can occur between
micronuclear-derived rDNA region and vector-derived rDNA. An example of
recombination
leading to transgene loss. Recombination resulting in the loss of the
transgene carried in the
mac transformation vector can occur at various stages during macronuclear
development and
subsequent cell growth. Recombination is possible between the unprocessed
versions prior to
palindromic formation during macronuclear development, or between the two
palindromic
forms following processing of the rDNA region. Loss of the transgene by
recombination is
possible at any point following successful mac transformation until the
micronuclear version
is completely lost from the cell. In this example one arm of each of the mic-
derived and
vector-derived palindromic chromosome is shown. Recombination in the region
between the
mic selection cassette and the transgene located in the multiple cloning site
(MCS) can lead
to loss of the transgene when the non-functional mic-derived palindrome is
lost from the cell.
Both copies of the transgene in the vector-derived palindrome can potentially
be lost
following intramolecular recombination. Figure 2H shows an example of a mic
Knockout
vector designed to prevent recombinational loss of the transgene. The
micronuclear
Knockout construct must be engineered to prevent recombinational loss. One
example of a
micronuclear Knockout vector designed to prevent loss of the transgene
following
recombination is presented. As in Fig.2G, one arm of each of the mic-derived
and vector-
derived palindromic chromosome is shown. Recombination between the two forms
downstream of the mic selection cassette, leading to association of the
transgene with a non-
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
6
functional mic-derived palindrome, is prohibited. Recombination in the 5'
region will not
result in loss of the transgene region.
[0019] Figure 3. The Tetrahymena rDNA locus and the formation of a
palindromic minichromosome upon conjugation. The C3 allele is shown. Upon
initiation of
sexual reproduction, the micronuclear rDNA locus is removed from the
micronuclear
germline upon chromosome breakage and undergoes rearrangement into 21kb head-
to-head
palindrome bounded by Non-Transcribed Spacers (NTS).
[0020] Figure 4. Sequence of the pD5H8 vector (SEQ ID NO: 1) (13935
bp).
The rDNA gene sequences are located between positions 200-10683 in the
sequence as
shown. The 3' rDNA flanking sequence is shown at positions 10684 to 10815. The
3' and 5'
15 base pair CBS regions are shown between nucelotides 10704 to 10718 and
nucleotides 39
to 53, respectively. The pIC19 vector is shown at between nucleotides 11235-
13560. The 17S
rDNA is located between positions 2784-4536. The capital A at position 4490 is
a mutation
in 17s conferring Pm resistance. The 5.8S rDNA is located between positions
4665-4825.
The 26S rDNA is located between positions 5041-8763. The NotI site at position
9108 is a
unique restriction enzyme site contained in a short multi- cloning site
(derived from pHSS6)
in the 3' non-translated sequence of the 26S rDNA locus. Bases corresponding
to known
differences in the C3 rDNA polymorph (as found in pD5H8) and the B rDNA
polymorph (as
found in host cells) include an adenine substitution at position 269, an
adenine substitution at
position 783, an adenine substitution at position 1213, a 42 base pair
insertion at position
1428, an adenine insertion after position 1524, a thymine substitution at
position 1551, a
thymine substitution at position 1609, a thymine substitution at position
10049, and a
thymine substitution at position 10251. Of these, the most significant is the
42 base pair
insertion at position 1428, and is related to the replicative advantage of C3
rDNA polymorphs
over B rDNA polymorphs.
[0021] Figure 5. pD5H8 Vector. Shown is the position of forward and
reverse
primers used to amplify the knockout fragment. Also shown are the positions of
the rDNA
17S, 5.8S and 26S genes. CBS, chromosome breakage sites; MCS, multiple cloning
site.
[0022] Figure 6. rDNA knockout (KO) vector. Shown is the placement of
the
Neomycin resistance cassette (Neo insert) and the relative positions of
forward and reverse
diagnostic primer annealing sites.
CA 02755978 2016-09-30
WO 2010/108183
PCT/US2010/028168
7
[0023] Figure 7. Alignment of pD5H8 and pTRAS vector 17S rDNA gene. An
alignment of pTRAS and pD5H8 highlights the A4490G mutation that confers
paromomycin
resistance to pD5H8 (A4490) and paromomycin sensitivity to pTRAS (G4490).
[0024] Figure 8. pTRAS vector. Highlighted are the SpeI, BseRl
restriction sites
used in construction of pTRAS and the NotI restriction site used for
introduction of transgene
expression cassettes. Note, numbering for restriction enzymes reflects
position of site in the
vector. CBS, chromosome breakage sites; MCS, multiple cloning site; A4490G
(rDNA gene
numbering), position of reverted 17S rDNA mutation.
[0025] Figure 9. pTIEV4 vector. Neo, neomycin resistance gene marker.
DETAILED DESCRIPTION OF THE INVENTION
[0026]
[0027] Definitions
[0028] All scientific and technical terms used herein, unless
otherwise defined
below, are intended to have the same meaning as commonly understood by one of
ordinary skill
in the art. References to techniques employed herein are intended to refer to
the techniques as
commonly understood in the art, including variations on those techniques or
substitutions of
equivalent or later-developed techniques which would be apparent to one of
skill in the art. In
addition, in order to more clearly and concisely describe the subject matter
which is the
invention, the following definitions are provided for certain terms which are
used in the
specification and appended claims.
[0029] As used herein, the term "ciliate" means a eukaryote belonging to
the
kingdom, Chromalveolata, the superphylum, Alveolata, and the phylum,
Ciliophora. Ciliates, as
used herein, are complex protozoa characterized by the presence of cilia on
their cell surfaces and
dimorphic nuclei consisting of a macronucleus and one or more micronuclei.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
8
[0030] As used herein, "Tetrahymena spp." refers to ciliate protozoa
in the family
of Tetrahymenidae. Exemplary Tetrahymena spp. include but are not limited to,
the species
T. Thermophila and T pyriformis.
[0031] A used herein, the term "rDNA locus" refers to a ciliate gene
encoding one
or more copies of a 5.8S rRNA, 17S rRNA or 26S rRNA that is capable of being
processed
into a minichromosome upon conjugative replication. As used herein, the term
rDNA locus
can refer to a nucleotide sequence encoding any variant, isoform, homolog or
mutant rDNA
known in the art, for example, naturally occurring polymorphisms between B and
C3 rDNA.
As used herein, an rDNA locus can be comprised within any nucleotide sequence,
including,
but not limited to a micronuclear genome or an artificial nucleic acid
construct (e.g., an
rDNA vector).
[0032] As used herein, the term "non-functional rDNA gene" refers to
an rDNA
gene that does not produce a sufficient amount of the encoded rRNA or to an
rDNA gene that
is mutated and/or modified such that the encoded rRNA is not capable of
performing the
normal biological activity of the corresponding wild-type rRNA gene, thereby
resulting in a
ciliate with a conditionally conjugation-lethal phenotype.
[0033] As used herein, the term "non-functional micronuclear rDNA
locus" refers
to an rDNA locus, having one or more non-functional rDNA genes.
[0034] As used herein, the term "conditionally conjugation-lethal"
refers to a
phenotype wherein sexual conjugation by the ciliate (e.g., Tetrahymena spp.)
results in
lethality. A condition of conjugation-lethality can arise from, but is not
limited to, genetic
modifications of the micronuclear genome (e.g., deletion of one or more rDNA
encoding
genes in the micronuclear rDNA locus).
[0035] As used herein, the term "recombinant" means, with respect to
two or
more genetic or polypeptide sequences, that the sequences do not occur in the
same physical
relation to each other in nature and/or do not naturally occur within the same
genome or
polypeptide. For example, a genetic construct may include a coding sequence
which is
operably joined to one or more regulatory sequences, or to one or more other
coding
sequences, and these sequences are considered heterologous to each other if
they are not
operably joined in nature and/or they are not found in the same relation in a
genome in
nature. Similarly, a polypeptide may include a first polypeptide sequence
which is joined by
a standard peptide bond to a second polypeptide sequence, and these sequences
are
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
9
considered heterologous to each other if they are not found in the same
relation in any
polypeptide or proteome in nature.
[0036] As used herein, the term "nucleotide sequence" means any
molecule
comprising a sequence of covalently joined nucleoside-like chemical units
which has
selective binding affinity for a naturally-occurring nucleic acid of
complementary or
substantially complementary sequence under appropriate conditions (e.g., pH,
temperature,
solvent, ionic strength, electric field strength). Nucleotide sequences
include naturally-
occurring nucleic acids as well as nucleic acid analogues with modified
nucleosides or
internucleoside linkages, and molecules which have been modified with linkers
or detectable
labels which facilitate immobilization on a substrate or which facilitate
detection.
[0037] As used herein, the term "promoter" means a nucleotide sequence
which is
capable of binding RNA polymerase and initiating transcription of a downstream
or 3' coding
sequence.
[0038] As used herein, the term "reporter gene" means any genetic
sequence
which, when expressed, has a biochemical or phenotypic effect which is
detectable.
[0039] As used herein, the term "selectable marker" means any genetic
sequence
which, when expressed, has a biochemical or phenotypic effect which is
dominant and
selectable by the presence or absence of a selection agent. Selectable marker
genes that
confer resistance or tolerance to a normally toxic selection agent cause only
successfully
transfected cells to survive in the presence of the selection agent and are
referred to as
positive selectable markers. Examples of positive selectable marker genes and
their
corresponding selection agents are: aminoglycoside phosphotransferase (APH)
and G418;
dihydrofolate reductase (DHFR) and methotrexate (Mtx); hygromycin-B-
phosphotransferase
(HPH) and hygromycin-B; xanthine-guanine phosphoribosyltransferase (XGPRT) and
mycophenolic acid; and adenosine deaminase (ADA) and 9-13-D-xylofuranosyl
adenine (Xyl-
A). In another example of a positive selectable marker system, thymidine
kinase (TK) and
aminopterin (included, e.g., in hypoxanthine-aminopterin-thymidine (HAT)
medium) can be
used in cells that are initially thymidine kinase deficient (tk-). The
aminopterin will normally
kill tk- cells and, therefore, only successful TK transfectants will survive.
Another positive
selectable marker system is AmpR and ampicillin. Selectable marker genes that
confer
sensitivity or susceptibility to a normally non-toxic selection agent cause
only successfully
transfected cells to die in the presence of the selection agent are referred
to as negative
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
selectable markers. Examples of negative selectable marker genes and their
corresponding
selection agents include: thymidine kinase (TK) and gancyclovir. Phenotypic
selectable
marker genes permit selection based upon morphological or biochemical traits
rather than cell
death or survival. In some cases, the phenotypic marker is detectable only in
the presence of
an additional selection agent. An example of a phenotypic selectable marker
gene and its
additional selection agent is 13-galactosidase (lacZ) and X-gal.
[0040] As used herein with respect to polypeptide preparations, the
term
"substantially pure" means a preparation which contains at least 60% (by dry
weight) the
polypeptide of interest, exclusive of the weight of other intentionally
included compounds.
In some embodiments, the preparation is at least 75%, at least 90%, or at
least 99%, by dry
weight the polypeptide of interest, exclusive of the weight of other
intentionally included
compounds. Purity can be measured by any appropriate method, e.g., column
chromatography, gel electrophoresis, or HPLC analysis. If a preparation
intentionally
includes two or more different polypeptides of the invention, a "substantially
pure"
preparation means a preparation in which the total dry weight of the
polypeptides of the
invention is at least 60% of the total dry weight, exclusive of the weight of
other intentionally
included compounds. For such preparations containing two or more polypeptides
of the
invention, the total weight of the polypeptides of the invention can be at
least 75%, at least
90%, or at least 99%, of the total dry weight of the preparation, exclusive of
the weight of
other intentionally included compounds. Thus, if the polypeptides of the
invention are mixed
with one or more other polypeptides(e.g., serum albumin) or compounds (e.g.,
diluents,
detergents, excipients, salts, polysaccharides, sugars, lipids) for purposes
of administration,
stability, storage, and the like, the weight of such other polypeptides or
compounds is ignored
in the calculation of the purity of the preparation.
[0041] As used herein, the term "transform" means to introduce into a
cell an
exogenous nucleic acid or nucleic acid analog which replicates within that
cell, that encodes a
polypeptide sequence which is expressed in that cell (with or without
integration into the
genome of the cell), and/or that is integrated into the genome of that cell so
as to affect the
expression of a genetic locus within the genome. The term "transform" is used
to embrace all
of the various methods of introducing such nucleic acids or nucleic acid
analogs, including,
but not limited to the methods referred to in the art as transformation,
transfection,
transduction, or gene transfer, and including techniques such as
microinjection, DEAE-
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
11
dextran-mediated endocytosis, calcium phosphate coprecipitation,
electroporation, liposome-
mediated transfection, ballistic injection, viral-mediated transfection, and
the like.
[0042] As used herein, the term "vector" means any genetic construct,
such as a
plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., that is
capable
transferring nucleic acids between cells. Vectors may be capable of one or
more of
replication, expression, and insertion or integration, but need not possess
each of these
capabilities. Thus, the term includes cloning, expression, homologous
recombination, and
knock-out vectors.
[0043] As used herein, the terms "increase" and "decrease" mean,
respectively, to
cause an increase or decrease of at least 5%, as determined by a method and
sample size that
achieves statistically significance (i.e., p < 0.1).
[0044] As used herein, the term "statistically significant" means
having a
probability of less than 10% under the relevant null hypothesis (i.e., p <
0.1).
[0045] As used herein, the recitation of a numerical range for a
variable is
intended to convey that the invention may be practiced with the variable equal
to any of the
values within that range. Thus, for a variable which is inherently discrete,
the variable can be
equal to any integer value within the numerical range, including the end-
points of the range.
Similarly, for a variable which is inherently continuous, the variable can be
equal to any real
value within the numerical range, including the end-points of the range. As an
example, and
without limitation, a variable which is described as having values between 0
and 2 can take
the values 0, 1 or 2 if the variable is inherently discrete, and can take the
values 0.0, 0.1, 0.01,
0.001, . . . , 0.9, 0.99, 0.999, or any other real values > 0 and 2, if the
variable is inherently
continuous.
[0046] The term "about" is used herein to mean approximately, in the
region of,
roughly, or around. When the term "about" is used in conjunction with a
numerical range, it
modifies that range by extending the boundaries above and below the numerical
values set
forth. The term "about" is used herein to modify a numerical value above and
below the
stated value by a variance of 20%.
[0047] As used herein, unless specifically indicated otherwise, the
word "or" is
used in the inclusive sense of "and/or" and not the exclusive sense of
"either/or."
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
12
[0048] As used herein and in the appended claims, the use of singular
forms of
words, and the use of the singular articles "a," "an" and "the," are intended
to include and not
exclude the use of a plurality of the referenced term unless the content
clearly dictates
otherwise.
[0049] In general, the compositions, genetically modified ciliates and
methods
described herein are useful for the production of one or more polypeptides of
interest.
Existing ciliate-based expression systems, employing the ciliate T.
thermophila, enable high
level amplification of transgenes encoding polypeptides of interest, but
suffer from genetic
instability resulting a in loss of transgenes and thus loss of expression and
yield of the desired
polypeptide.
[0050] In one aspect, the system described herein enables high level
amplification
of a transgene encoding a polypeptide of interest in genetically-modified
ciliates.
[0051] In one aspect, the methods and compositions described herein
provide a
polypeptide expression system that enables stable expression of transgenes for
the production
of eukaryotic or prokaryotic polypeptides in ciliates.
[0052] In another aspect, the recombinant polypeptide expression
system of the
invention comprises a genetically modified ciliate having a non-functional
micronuclear
rDNA locus (e.g., a universal recipient line as described below) and wherein
the non-
functional micronuclear rDNA locus causes the ciliate to exhibit a
conditionally conjugation-
lethal phenotype. In some embodiments, the micronuclear rRNA locus is non-
functional due
to a deletion, mutation or substitution in one or more regulatory regions that
regulate the
expression, replication, amplification or stability of the micronuclear
nucleic acid encoding
the rRNA.
[0053] In one aspect, a universal recipient line is provided which
comrises a
genetically modified ciliate having a non-functional micronuclear rDNA locus.
In some
embodiments, the non-functional rRNA locus is the 5.8S rRNA locus. In other
embodiments,
the non-functional rRNA locus is the 17S rRNA locus. In still other
embodiments the non-
functional rRNA locus is the 26S rRNA locus. In other embodiments, the non-
functional
rRNA locus is the any other rRNA locus which, when non-functional, results in
a
conditionally conjugation-lethal phenotype. Defined mutations that inactivate
such rRNA
loci are also known in the art. For example, the rmm10 mutation is a recessive-
lethal and cis-
acting maturation mutant that results in severely defective production of both
monomeric and
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
13
palindromic rDNA in the developing macronucleus (Kapler et at. (1994a)).
Naturally
occurring polymorphisms between the B and C3 alleles are also known in the
art. In some
embodiments, genetically modified ciliates have at least one nonfunctional
micronuclear
rRNA gene. In other embodiments, the genetically modified ciliates can have at
least two
nonfunctional micronuclear rRNA genes. In other embodiments, the genetically
modified
ciliates can have at least three nonfunctional micronuclear rRNA genes. In
some
embodiments, the micronuclear rRNA locus is non-functional due to a deletion,
mutation or
substitution in the micronuclear nucleic acid encoding the rRNA. Methods to
render a
micronuclear rRNA non-functional are well known in the art and can include,
without
limitation, deletion and/or mutation of the gene. Additional methods,
including mutation or
deletion of elements regulating transcription and/or stability of the rRNA,
can also be used in
conjunction with the methods described herein.
[0054] In still other embodiments, the micronuclear rRNA locus is non-
functional
due a deletion, mutation, inversion or substitution in a regulatory region
regulating the
expression of a 5.8S rRNA, 17S rRNA, 26S rRNA or other rRNA from a
macronuclear
chromosome generated from a micronuclear rDNA locus during upon macronuclear
reorganization.
[0055] In still other embodiments, the micronuclear rRNA locus is non-
functional
due to a deletion, mutation, inversion or substitution of a sequence
regulating the
amplification or stability of a macronuclear chromosome generated from a
micronuclear
rDNA locus during upon macronuclear reorganization. In some embodiments, the
deletion,
mutation, inversion or substitution is in a micronuclear sequence that
regulates the formation
of a telomere of the rDNA macronuclear chromosome. In other embodiments, the
deletion,
mutation, inversion or substitution is in a micronuclear sequence that
regulates replication of
the rDNA macronuclear chromosome.
[0056] In certain aspects, ciliates transformed with the rDNA vectors
described
herein can be utilized as hosts for recombinant polypeptide expression.
Accordingly, in
certain aspects, the transformed ciliates can be used as production cell lines
suitable for use as
hosts for recombinant polypeptide expression by transformation of the ciliate
with an rDNA
vector comprising a transgene expression cassette capable of directing
expression of the
transgene.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
14
[0057] In certain aspects, the genetically modified ciliates having a
non-functional
micronuclear rDNA locus described herein can be utilized as hosts for
recombinant
polypeptide expression. Accordingly, in certain aspects, genetically modified
ciliates (e.g.,
Tetrahymena spp.) having a non-functional micronuclear rDNA locus (e.g.,
universal
recipient lines) can be converted to production cell lines suitable for use as
a host for
recombinant polypeptide expression. In some embodiments, a universal recipient
line can be
rendered conjugation competent by transformation of the hosts with an rDNA
rescue vector.
In some embodiments, the rDNA rescue vector can further comprise a transgene
expression
cassette capable of directing expression of the transgene.
[0058] Thus, in other aspects, the invention described herein relates
to rDNA
vectors. In some embodiments, the rDNA vector comprises a complete copy of an
rDNA
locus. In certain embodiments, the rDNA locus in the rDNA vector is a C3 rDNA
allele. In
other embodiments, the rDNA locus in the rDNA vector is a C3 rDNA allele
genetically
modified to include a B allele 17S rDNA gene in place of a C3 allele 17S rDNA
gene. In
other embodiments, the rDNA locus in the rDNA vector is a C3 rDNA allele that
is
conditionally conjugation-lethal in genetically modified ciliates comprising a
non-functional
micronuclear rDNA locus.
[0059] In some embodiments, the rDNA vector described herein comprises
a
complete copy of a micronuclear rDNA locus flanked by functional chromosome
breakage
sequences (CBSs) on the 3' end and the 5' end of the rDNA locus such that
transformation of
a ciliate that is undergoing, or will undergo, macronuclear reorganization
will cause the
rDNA vector to be processed into a macronuclear chromosome (e.g., a
minichromosome). In
further embodiments, the rDNA vector can further comprise one or more cis-
acting
nucleotide sequences that promote amplification of a minichromosome derived
from the
rDNA vector during macronuclear differentiation.
[0060] In another aspect, a conditionally conjugation-lethal ciliate
can be rendered
capable of surviving conjugation by transforming the ciliate with an rDNA
rescue vector
comprising one or more sequences corresponding to a functional rDNA locus. The
conditionally conjugation-lethal ciliate includes a genetically-modified
micronuclear rDNA
locus that is not capable of producing a macronuclear rDNA chromosome capable
of
expressing a sufficient amount of one or more types of rDNA so as to permit
survival of
progeny upon conjugative reproduction of the ciliate (e.g., because one or
more rDNA coding
sequences is missing from the micronuclear rDNA locus, or because one or more
regulatory
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
regions regulating the expression of an rRNA is missing or non-functional in
the
micronuclear genome, or because one or more regulatory regions regulating the
formation of
a macronuclear rDNA chromosome is missing or non-functional in the
micronuclear
genome).
[0061] In some embodiments, the absence of a functional micronuclear
rDNA
locus in the micronucleus can be achieved by partial or complete deletion or
mutation of the
corresponding nucleotide sequences in the micronuclear rDNA. Mutations are
understood to
mean, for example, insertions, deletions, inversions or merely substitution of
individual base
pairs. Gene deletions or mutations can be introduced to the target organism by
methods
known to one skilled in the art, including known methods for introducing
somatic and
germline mutations in Tetrahymena spp. (e.g., Bruns et at. (2000) and Cassidy-
Hanley et at.
(1997)). Additional exemplary methods suitable for use with the methods are
described in,
for example, Sambrook et at., Molecular Cloning, A Laboratory Manual, Cold
Spring
Harbor, N.Y. Such genetically modified ciliates can be rendered conjugation-
competent by
transformation with an rDNA rescue vector.
[0062] In another aspect, the invention provides an rDNA rescue vector
capable
of rescuing the conditionally conjugation-lethal phenotype of the genetically
modified ciliate,
wherein the conditional conjugation-lethal phenotype of the ciliate is due to
a non-functional
rDNA locus in the micronucleus, by transforming the ciliate with a rescue
vector.
[0063] In some embodiments, the rDNA rescue vector comprises all or
part of a
functional rDNA locus. In some embodiments, the rDNA rescue vector can render
conditionally conjugation-lethal genetically modified ciliates capable of
surviving
conjugation by forming a recombinant macronuclear rDNA chromosome. In another
embodiment, the rDNA rescue vector can render conditionally conjugation-lethal
genetically
modified ciliates capable of surviving conjugation by integrating into the
micronuclear
genome such that a functional macronuclear rDNA chromosome is generated upon
conjugative reproduction of the ciliate.
[0064] In further embodiments, a transgene, optionally encoding a
polypeptide of
interest can be incorporated in the rDNA vector or rDNA rescue vector such
that a ciliate
transformed with the rDNA vector or rDNA rescue vector described herein, will
express a
polypeptide encoded by the transgene. In some such embodiments, the rDNA
vector or
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
16
rDNA rescue vector can further comprise one or more operably linked regulatory
nucleotide
sequences that direct the expression of the transgene in the ciliate.
[0065] In yet another aspect, the invention relates to methods useful
for the
production of a recombinant polypeptide in a ciliate, the methods comprising
(a)
transforming a ciliate with an rDNA vector, wherein the vector further
comprises a nucleotide
sequence encoding the recombinant polypeptide; (b) culturing the ciliate to
produce the
recombinant polypeptide; and (c) isolating the recombinant polypeptide.
[0066] In some embodiments, a transgene, optionally encoding a
polypeptide of
interest can be incorporated in an rDNA rescue vector such that conditionally
the rescued
conjugation-lethal genetically modified ciliates will also comprise the
transgene.
Accordingly, the rDNA vector or the rDNA rescue vector can further comprise
operationally
linked regulatory nucleotide sequences that direct the expression of the
transgene in the
ciliate.
[0067] Also described herein are methods and compositions useful for
the
expression of a recombinant polypeptide in a ciliate.
[0068] A transgene cassette encoding a recombinant polypeptide that is
to be
expressed in the cell can also be included within the rDNA vector or the rDNA
rescue vector.
Thus, in some embodiments, the rDNA vector or the rDNA rescue vector can be an
expression vector for expression of recombinant polypeptides in a ciliate. An
expression
vector, according to the invention, can be a nucleic acid molecule, like DNA
or RNA,
circular or linear, for example, a plasmid, a cosmid or an artificial
chromosome, that allows
expression of the recombinant gene in the host cell. Such expression vectors
can be present
episomally in the cell, can be integrated in the micronuclear genome, can be
integrated in the
macronuclear genome, or can be self-replicating.
[0069] In some embodiments, expression of the recombinant polypeptide
can be
achieved by transforming a ciliate having a homozygous B rDNA micronuclear
genotype
with an rDNA vector capable of generating a C3 allelic rDNA minichromosome
upon
macronuclear reorganization.
[0070] In some embodiments, the rDNA vector or the rDNA rescue vector
can
comprise a selection marker that does not confer resistance to growth in a
medium containing
paromomycin.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
17
[0071] For example, the rDNA vector or the rDNA rescue vector as
described
herein can include one or more selection cassettes encoding a selection
marker. The selection
marker can enable selection of cells that have resistance to various biostatic
or biocidal drugs
upon transformation with the vector. In some embodiments, the rDNA vector or
the rDNA
rescue vector can comprise a selection cassette such that transformants can be
selected
against non-transformants by culturing them in media comprising a selection
agent.
[0072] Methods for selection of transformed cells harboring
heterologous genes
are known in the art. For example, the vector can further comprise a
selectable cassette
marker to permit selection for transformed cells (e.g., a cycloheximide
resistant cassette)
(Gaertig et at. (1994), Nucleic Acids Res. 22:5391-5398). Selection of
transformants can be
achieved by growing the cultured ciliates in a medium which allows only the
transformants to
survive. Suitable selection agents include antibiotics which will kill all or
most non-
transformants but allow transformants (which also possess an antibiotic
resistance gene) to
survive. A number of antibiotic-resistance markers are known in the art. Any
known
antibiotic-resistance marker can be used to transform and select transformed
host cells in
accordance with the present invention.
[0073] The methods described herein also relate to methods for
expressing a
transgene in genetically modified ciliates. In embodiments, ex-conjugants
transformed with
the rDNA rescue vector comprising the transgene will have a macronuclear rDNA
chromosome encoding all rRNAs necessary for survival of the ciliate in
addition to a
transgene cassette capable of driving expression of a heterologous polypeptide
encoded by
the transgene.
[0074] In yet another aspect, the invention relates to methods useful
for the
production of a recombinant polypeptide in a genetically modified
conditionally conjugation-
lethal ciliate, the methods comprising (a) causing the genetically modified
ciliate to undergo
sexual reproduction by conjugation; (b) transforming the genetically modified
ciliate with a
vector capable of suppressing the conditionally lethal phenotype of the
genetically modified
ciliate, wherein the vector further comprises a nucleotide sequence encoding
the recombinant
polypeptide; (c) culturing the genetically modified ciliate to produce the
recombinant
polypeptide; and (d) isolating the recombinant polypeptide.
[0075] Without being bound by theory, transformation of a
conditionally
conjugation-lethal ciliate with an rDNA rescue vector comprising a functional
rDNA locus
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
18
can result in the introduction of a complete functional rDNA and subsequent
processing of
said rDNA to a functional macronuclear palindromic chromosome which will
replace the
non-functional micronuclear version and render the transformed cell viable. In
some
embodiments, the progeny of such transformed cells will have a non-functional
micronuclear
rDNA locus but a fully functional, vector-derived recombinant rDNA chromosome
in the
macronucleus. In some embodiments, a transgene, optionally encoding a
polypeptide of
interest, can be incorporated in the rDNA rescue vector such that the
conditionally
conjugation-lethal ciliates that are rescued will also comprise the transgene.
Optionally, the
rDNA rescue vector can further comprise operationally linked regulatory
nucleotide
sequences that direct the expression of the transgene in the ciliate.
[0076] The methods disclosed herein also enable selection of
transformed cells
without the addition of an antibiotic or any additional selection marker to
the growth medium
after the conditionally conjugation-lethal genetically modified ciliates
described herein have
been rescued by transformation with an rDNA rescue vector. In some
embodiments, the
parental strain (e.g., conditionally conjugation-lethal genetically modified
ciliates having a
non-functional micronuclear rDNA) can further comprise a selection marker such
that
parental strains can be grown under selective pressure. Such genetically
modified parental
lines can be rendered conjugation-competent by rescue with an rDNA rescue
vector. In some
embodiments, such parent mating lines are homozygous functional heterokaryons
for a non-
functional micronuclear rDNA locus and at least one of the parent lines is a
functional
heterokaryon for a selectable marker. Because only progeny transformed with
the rDNA
rescue vector and expressing the selectable marker will survive, there is no
further need for
selection of ex-conjugants in subsequent cultures after the parents have been
eliminated.
[0077] In some embodiments, the rescue vector can further comprise a
second
selection marker such that ex-conjugants of a parental mating can be selected
against non-
conjugating parental cells by culturing them in media comprising the second
selection
marker. For example, in the case of genetically modified ciliates having a non-
functional
micronuclear rDNA locus, a second selectable marker may be useful during the
mating step
to eliminate non-mating parents and enable isolation of progeny from the
mating of two
parent lines. The second selection agent can be withdrawn from the growth
medium shortly
after the mating step because the selection marker will eliminate non-mating
parental cell and
only those cells successfully transformed with the rescue vector will be
capable of surviving
in the vegetative state. Thus, in one aspect, the methods described herein
allow for the use
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
19
one or more antibiotic agents, including antibiotic agents toxic to humans,
because the use of
such antibiotic agents can be limited to a defined period after transformation
suitable to
eliminate non-transformed and non-mating parent cells. Because the antibiotic
agent can be
used to eliminate non-transformed and non-mating parent cells, transformed ex-
conjugants
can subsequently be cultured in a medium lacking an antibiotic selection
agent. Accordingly,
the antibiotic agents can be diluted or washed away prior to isolation of a
recombinant
polypeptide expressed from ex-conjugants harboring a transgene.
[0078] Ciliates Useful in the Invention
[0079] The invention may be practiced with a variety of different
ciliates. A
ciliate as described herein can be any free-living ciliate characterized by
dimorphic nuclei
consisting of a macronucleus and one or more micronuclei, including but not
limited to
Tetrahymena, Paramecium, Blepharisma, Colpidium, Euplotes, Stylonichia and
Oxytricha
species.
[0080] The free-living ciliate protists are a large and diverse phylum
(Ciliata)
whose members display a structural and functional complexity comparable to
that of higher
metazoa (Fankel (2000); Turkewitz et at. (2002)) and include over 7,000
species with 11
major subdivisions. Tetrahymenids and Paramecium belong to the
Oligohymenophoreans.
Ciliates that include mucocysts useful in the invention include Tetrahymena
species such as
Tetrahymena thermophila and Tetrahymena pyriformis. Paramecium has dense core
granules but does not secrete a polypeptideaceous gel. Both Tetrahymena
thermophila and
Tetrahymena pyriformis produce mucocysts, and both secrete a proteinaceous
gel.
[0081] Tetrahymena spp. are amenable to genetic manipulation, can be
grown on
a large scale and have a doubling time of 1.5-3 hrs. Unlike T thermophila,
which has an
optimal growth temperature of 35 C, the optimal growth temperature for T.
pyriformis is
34 C. Cells reach high-density in a short time on a variety of inexpensive
media and can be
expanded for growth in bioreactors up to several thousand liters in size
(Hellenbroich et at.
(1999); de Coninck et at. (2000)). Methods for transformation, along with
robust, inducible
promoters for driving high-level gene expression have recently been described
for this
system.
[0082] Tetrahymena spp. devote a large part of their metabolism to
membrane
polypeptide production due to the hundreds of cilia that extend from its
surface (Williams et
at. (1980)). Additionally, Tetrahymena spp. lack a cell wall and display high-
mannose N-
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
glycan polypeptide modifications that lack branched, immunogenic structures
(Tanguchi et
at. (1985); Beck et at. (2003); Weide et at. (2006)). Glycosylation patterns
of secreted
polypeptides in Tetrahymena spp. consist of high-mannose N-glycan structures
that display
minimal heterogeneity compared to other microbes such as yeast with glycans
ranging from
Man2G1cNAc2 to Man5G1cNAc2 with a majority of glycans comprising Man3G1cNAc2
structures similar to those which are produced in the endoplasmic reticulum of
mammalian
cells. This glycosylation pattern is unlike the glycosylation pattern produced
in other
microbial systems. For example, such glycosylation is non-existent in
bacteria, and is highly
branched and immunogenic in fungi.
[0083] Tetrahymena spp. produce abundant surface membrane polypeptides
known as immobilization antigens (i-antigens). The expression of i-antigens is
tightly
regulated by environmental conditions (e.g., temperature), thus expression of
a heterologous
polypeptide containing an endogenous GPI anchor can be regulated by changes in
temperature. Preer, The Molecular Biology of Ciliated Protozoa, pp. 301-339
(ed. J. G. Gall),
Academic Press, New York (1986).
[0084] Ciliates can engage in regulated secretion of polypeptides
stored in cortical
secretory organelles (granules) which are discharged in a stimulus-dependent
or regulated
fashion (Miller et at. (1990)). Dense core granules are specialized for
stimulus-dependent
secretory granules that function in exocytosis in ciliates. In Tetrahymena
spp., these dense
core granules are termed mucocysts, whereas the dense core granules of
Paramecium
tetraurelia are termed trichocysts (Hausmann (1978); Rosati and Modeo (2003)).
[0085] Regulated secretion in ciliates can be triggered by the
presence of
chemical mediators known as secretagogues. For example, such mediators can
cause
increased levels of intracellular calcium (Ca2'), which, in turn, trigger
fusion of cortical
granules with the plasma membrane resulting in a release of the granule
contents into the
surrounding extracellular space. Examples of secretagogues useful in the
invention include,
but are not limited to, dibucaine, alcian blue and Ca2 ionophores.
[0086] Mutant strains defective in the release of hydrolytic enzymes
have also
been isolated (Hunseler et at. (1992), Dev. Genet. 13:167-173). In some
embodiments,
mutant strains lacking or exhibiting reduced levels of secreted hydrolytic
proteases can be
used for the production of surface-expressed or secreted heterologous
polypeptides.
[0087] Ciliate Genetics
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
21
[0088] Ciliates exhibit nuclear dimorphism and contain two distinct
types of
nuclei in each cell. The micronucleus (MIC or mic) is diploid and contains
five pairs of
transcriptionally inert chromosomes. The macronucleus is polyploid and
functions as the
transcriptionally active nucleus during vegetative growth. The micronucleus
functions as the
repository for genetic information for progeny produced by conjugation during
sexual
reproduction. During conjugation, the micronucleus undergoes meiosis to give
rise to two
pronuclei that are reciprocally exchanged between sexually mating cells. Upon
fusion of the
haploid gametes to produce a new zygotic micronucleus, the micronucleus
undergoes two
post-zygotic division resulting in the formation of new micronuclei and
macronuclei. Upon
formation of new macronuclei, the old macronuclei are resorbed are not
transmitted to the
sexual progeny. The cells then reproduce asexually until the next round of
conjugation.
[0089] Differentiation of a macronucleus (MAC) from the mitotic
products of
zygotic micronuclei produced upon sexual reproduction involves several
programmed DNA
rearrangements, including but not limited to (1) the deletion of internal
eliminated sequences
(IESs) from the MIC genome, (2) programmed site-specific fragmentation of the
five MIC
chromosomes at specific chromosome breakage sequence (CBS) containing sites to
form
250-300 MAC chromosomes, and (3) amplification to increase the copy numbers of
the
newly formed MAC chromosomes.
[0090] Chromosome breakage
[0091] During programmed site-specific fragmentation, chromosome
breakage
occurs at about 50-200 specific sites along the five germline chromosomes at
locations
defined by a conserved 15bp TAAACCAACCTCTTT (SEQ ID NO: 2) or
TAAACCAACCTCATT (SEQ ID NO: 3) CBS to form new unprocessed MAC
chromosomes (Yao et at. (1987), Cell 48:779-788; Yu and Blackburn (1991), Cell
67:823-
832). CBSs are necessary and sufficient sequence signals for chromosome
breakage in
ciliates such as Tetrahymena. CBS sequences, regardless of copy number,
orientation, and
immediate flanking sequences, can serve as signals for site-specific
chromosome breakage
and telomere addition (Yao et at. (1990)). Subsequent processing results in
the deletion of
about 6 to about 30bp on either side of the CBS and telomeres are then added
de novo to the
end to each newly formed MAC chromosome. Sequences residing adjacent to the
CBS prior
to breakage subsequently flank the new telomeric sequence following the
breakage and
processing events.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
22
[0092] The process of chromosome breakage during MAC differentiation
generates about 250 to about 300 MAC chromosomes having an average size of
about 800kb.
These MAC chromosomes are maintained in the macronucleus during the ensuing
vegetative
cycle of a ciliate such as Tetrahymena.
[0093] During this process, a copy of the rDNA locus is excised from
the
micronuclear germline and undergoes rearrangement into 21kb head-to-head
palindromes
bounded by 5' and 3' Non-Transcribed Spacers (NTS) (Karrer et at. (1976); King
et at.
(1982)).
[0094] Palindrome formation occurs via a mechanism dependent on the
presence
of short inverted repeats and intramolecular recombination. The 5'NTS, which
is both
necessary and sufficient for replication, contains nucleosome free regions
(ori-Dl and ori-D2)
that function as initiation sites for amplification as well as for mediating
replication fork
pausing at pause site elements (MacAlpine et at. (1997)). The NTSs also
function to activate
rRNA transcription (Pan et at. (1995)). This rDNA minichromosome functions as
the
transcriptionally active source for rRNAs (5.8S, 17S, and 26S rRNAs) during
vegetative
growth.
[0095] MAC Chromosome Amplification
[0096] Another stage of genetic reorganization during MAC
differentiation is the
amplification of MAC chromosomes. During the vegetative stage of Tetrahymena
spp.,
transcriptionally active ribosomal RNA genes, which include genes encoding the
5.8S, 17S,
and 26S rRNAs, reside on a small 21kb MAC chromosome comprising two copies of
the
rRNA genes in the form of an inverted repeat. The MAC rRNA chromosome is
formed upon
breakage of the CBSs flanking the rRNA genes during differentiation of zygotic
MIC nucleus
during conjugation. The resulting MAC rRNA chromosome is then amplified and
accumulated to about 9,000 copies per MAC, thereby resulting in an
amplification of about
200-fold over the rest of the genome.
[0097] Vectors
[0098] Recombinant DNA for transformation of the ciliates described
herein can
be a vector, for example, any type of nucleic acid, plasmid, cosmid, virus,
autonomously
replicating sequence, phage, linear or circular, single- or double-strand DNA
or RNA
molecule, that can replicate in the ciliate itself or be incorporated into its
genome. Vectors
suitable for use as high copy number vectors for the delivery of heterologous
DNA to
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
23
Tetrahymena have been developed to take advantage of the process of rDNA
amplification
during macronuclear reorganization (Yu et at. (1989)). Such vectors have the
advantage that
DNA can be cloned and engineered in bacteria prior to transformation into a
Tetrahymena
host and replicate to high copy number. For example, the pD5H8 vector contains
the a 119bp
linker located downstream of the 26S rRNA gene that is operably linked to a C3
rDNA such
that a sequence inserted in the linker is retained in the rDNA following
rearrangement of the
plasmid DNA in conjugating cells to form an episomal plasmid derived
minichromosome.
Upon transformation into a ciliate, the CBS sequences in the rDNA vector are
processed
during macronuclear differentiation to produce an excision product that is the
equivalent of
the rDNA produced from normal processing of a micronuclear rDNA. The excision
product
from the vector is further processed to the macronuclear palindromic form and
subsequently
acts as a source for rDNA in the transformed cell.
[0099] In one aspect, methods described herein relate to the use of an
rDNA
vector that can be maintained as an autonomously replicating minichromosome
when
transformed into a ciliate host cell. The use of such rDNA based technologies
for the
introduction of recombinant DNA in ciliates such as T. thermophila results in
an
approximately 400-fold increase in copy number compared to cells that harbor
transgenes
somatically in the macronucleus (about 45 copies). While this increase in copy
number is not
necessarily linearly related to product yield, rDNA based expression has been
shown to lead
to higher product yield in T. thermophila.
[00100] Two different rDNA alleles are known to exhibit differential
replication
during vegetative growth in Tetrahymena. B and C3 rDNA alleles are both
amplified in the
new macronucleus of heterozygous progeny. The C3 rDNA allele, however, has a
replication
advantage over the B allele rDNA.
[00101] A small deletion in the B rDNA allele is responsible, in part, for its
vegetative maintenance disadvantage (Larson et at. (1986); Yaeger et at.
(1989)). The
process of breakage results in the conversion of the rRNA into a palindrome
via mechanisms
dependent on the presence of short inverted repeat and intramolecular
recombination. Thus,
when introduced into T. thermophila B cell lines, the micronuclear version of
the C3 rDNA is
processed to form a palindrome and is maintained as a stable linear chromosome
over many
generations.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
24
[00102] pIC-19-based rRNA based cloning vectors suitable for use as high copy
number vectors for the delivery of heterologous DNA to Tetrahymena have been
developed
to take advantage of this process of amplification (Yu et at. (1988); Yu et
at. (1989)). The
design of these vectors is based in part on the existence of different rDNA
alleles in
T. thermophila having sequence variations within their respective origins of
replication.
Specifically, rDNA from strain C3 has a replication advantage over a genetic
variant rDNA
from strain B when they are present in the same macronucleus. When both B and
C3 rDNA
are present a macronucleus, the B variant is virtually eliminated within about
30 fissions. In
certain embodiments of the invention described herein, C3 rDNA can become the
sole
macronuclear rDNA species. The methods described herein relate in part to the
replicative
advantage of the C3 rDNA allele in a ciliate such as Tetrahymena having a
homozygous B
allele genotype. In one aspect, the methods described herein relate to the use
of an rDNA
vector (e.g., the pD5H8 vector) comprising a transgene cassette operably
linked to the rDNA
locus of the vector. This feature has been used for the introduction of
transgenes to a
potential copy number of 18,000 per cell.
[00103] Although methods of selecting transformants are readily known to one
skilled in the art, such methods suffer from loss of efficacy due to genetic
instability. For
example, a point mutation in the 17S rDNA, which confers resistance to
neomycin, can be
used for the purpose of direct selection of rDNA transformants (5, 6), however
such vectors
are unstable and are lost within 50 to 80 generations. Specifically, a
disadvantage of current
approaches that utilize the pD5H8 vector is the use of a neomycin
phosphotransferase (neo)
gene (which in Tetrahymena confers resistance to paromomycin) as a selection
marker linked
to a transgene of interest. This selection marker is redundant to the effect
of a point mutation
in the C3 allele 17S rDNA in the rDNA locus comprised in the pD5H8 vector,
which itself
confers resistance to paromomycin, and can be used for the purpose of direct
selection of
rDNA transformants (Spangler et at. (1985); Bruns et at. (1985)).
[00104] Because a neo resistance cassette linked to transgene in pD5H8 is
redundant to paromomycin resistance derived from the mutated 17S C3 rDNA
allele, loss of
transgene expression products can occur due to genetic instability by
uncoupling of
paromomycin resistance from the transgene expression cassette. Without being
bound by
theory, such uncoupling can occur by recombination and loss of the transgene
even when
paromomycin resistance is maintained by expression of the mutated 17S C3 rDNA
from the
rDNA vector derived rDNA minichromosome. Again, without being bound by theory,
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
another source of genetic instability can stem from hybrid palindromes of
recombinant rDNA
chromosomes where one arm contains the transgene cassette and the other
contains WT
rDNA. Over time, strains containing hybrid rDNA chromosomes can revert to WT
rDNA
and result in loss of the transgene.
[00105] In one aspect, the methods described herein relate to the use of an
rDNA
vector comprising a selection maker other than a neomycin phosphotransferase
(neo) gene
linked to the transgene. In one embodiment, an rDNA vector, as described
herein, can
comprise (1) a C3 rDNA locus, (2) a selection maker other than a neomycin
phosphotransferase (neo) gene, and (3) a transgene cassette, wherein the C3
rDNA locus, the
selection marker other than a neomycin phosphotransferase (neo) gene, and the
transgene
cassette are bounded by a 5' and a 3' CBS such that macronuclear
reorganization in a ciliate
transformed with the vector will result in the formation of a macronuclear
minichromosome
capable of expressing vector-derived rDNA, the selection marker and a
polypeptide encoded
by the transgene cassette.
[00106] The rDNA vector described herein can comprise an rDNA locus allele
wherein the mutated C3 17S rDNA allele in the rDNA locus has been modified
such that it
can no longer confer resistance to paromomycin. In some embodiments, the 17S
C3 rDNA
allele in the rDNA locus of the rDNA vector can be replaced with a 17S rDNA
allele from a
B rDNA locus allele. In other embodiments, the 17S rDNA allele in the rDNA
locus of the
rDNA vector can be replaced with a 17S rDNA from any other known 17S rDNA
allele that
does not confer resistance to paromomycin. In further embodiments, the 26S
rDNA can be
replaced with a mutated version conferring resistance to anisomycin (Sweeney
et at. (1991))
[00107] In some embodiments, an rDNA vector, as described herein, can comprise
(1) a C3 rDNA locus, (2) a selection maker other than a neomycin
phosphotransferase (neo)
gene, and (3) a transgene cassette, wherein the C3 rDNA locus and the
transgene cassette are
bounded by a 5' and a 3' CBS as well as a section marker such that
macronuclear
reorganization in a ciliate transformed with the vector will result in the
formation of a
macronuclear minichromosome capable of expressing vector-derived rDNA and a
polypeptide encoded by the transgene cassette. An rDNA vector, as described
herein, can
include one or more selection marker genes.
[00108] In some embodiments, a selection marker can be operably integrated
into
the rDNA vector such that it can confer resistance to one or more biostatic or
biocidal drugs
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
26
when the rDNA vector is maintained in an episomal state. In other embodiments,
the
selection marker can be operably integrated into the rDNA vector such that it
can confer
resistance to one or more biostatic or biocidal drugs when a minichromosome
derived from
the rDNA vector is generated during macronuclear reorganization. In still
further
embodiments, the selection marker can be operably integrated into the rDNA
vector such that
it can confer resistance to one or more biostatic or biocidal drugs when the
rDNA vector is
maintained in an episomal state and when a minichromosome derived from the
rDNA vector
is generated during macronuclear reorganization.
[00109] A number of selection markers are suitable for use with the vectors
and
methods described herein. Such selectable marker genes and their corresponding
selection
agents include, but are not limited to: aminoglycoside phosphotransferase
(APH) and G418;
dihydrofolate reductase (DHFR) and methotrexate (Mtx); hygromycin-B-
phosphotransferase
(HPH) and hygromycin-B; balsticidin and blasticidin resistance gene (bsr);
xanthine-guanine
phosphoribosyltransferase (XGPRT) and mycophenolic acid; adenosine deaminase
(ADA)
and 9-13-D-xylofuranosyl adenine (Xyl-A); and ribosomal polypeptide L29 (CYH2)
and
cycloheximide. Another selectable marker system employs AmpR and ampicillin.
Selectable
marker genes that confer sensitivity or susceptibility to a normally non-toxic
selection agent
cause only successfully transfected cells to die in the presence of the
selection agent are
referred to as negative selectable markers. Phenotypic selectable marker genes
permit
selection based upon morphological or biochemical traits rather than cell
death or survival.
In some cases, the phenotypic marker is detectable only in the presence of an
additional
selection agent.
[00110] Homologous Recombination
[00111] In one aspect, the subject matter disclosed herein relates to an
expression
vector for expression of recombinant polypeptides in ciliates. An expression
vector,
according to the invention, can be a nucleic acid molecule, like DNA or RNA,
circular or
linear, for example, a plasmid, a cosmid or an artificial chromosome, that
allows expression
of a recombinant gene in a host cell (e.g., Tetrahymena). Such expression
vectors can be
present episomally in the cell (i.e., be self-replicating) or can be
integrated into the genome of
the host cell. Integration events can occur randomly or by homologous
recombination. In
some embodiments, the methods and compositions described herein relate to an
expression
vector that undergoes homologous recombination with the genome of a host cell.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
27
[00112] Gene targeting by means of homologous recombination between
homologous exogenous DNA and endogenous chromosomal sequences is useful for
the
creation of genetically modified organisms. Homologous recombination relies,
in part, on the
ability of nucleic acids to base pair with complementary sequences. In the
case of
homologous recombination, the base pairing enables the interaction of two
separate nucleic
acid molecules so that strand breakage and repair can take place. Thus, the
method relies on
sequence homology to bring two complementary sequences into close proximity,
at which
point recombination can cause one complementary sequence to replace the other
by virtue of
the breaking of certain bonds and the formation of others.
[00113] One skilled in the art can design a vector suitable for homologous
recombination. Briefly, a target gene or region can be selected within a host
cell for
modification by homologous recombination. Such modifications can include, but
are not
limited to, one or more deletions, mutations or insertions. For example, a
deletion that
renders a target gene inactive can be used in conjunction with the methods
described herein.
The homologous sequences flanking the deletion are said to "flank" the
mutation. Flanking,
in this context, simply means that target homologous sequences are located
both upstream (5')
and downstream (3') of the mutation. For homologous recombination to occur
upon
introduction of the vector into a cell, these sequences should correspond to
some sequences
upstream and downstream of the target gene or target region. The construct is
then
introduced into the cell, thus permitting recombination between the cellular
sequences and
the construct.
[00114] Various methods for selecting cells that have undergone homologous
recombination are well known in the art. For example, an expression vector
designed to
result in the stable integration of a recombinant nucleic acid by homologous
recombination
can include one or more selection markers genes. The selection marker enables
selection of
cells that have integrated the construct into their genomic DNA by conferring
resistance to
various biostatic or biocidal drugs. In addition, a heterologous gene that is
to be expressed in
the cell also may be included within the construct. Thus, the use this type of
construct
enables (i) the modification of an endogenous gene, (ii) the inclusion of a
selectable marker
for identifying such an event and (iii) introduce a heterologous gene for
expression.
[00115] Universal Recipient Lines With Non-Functional Micronuclear rDNA Loci
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
28
[00116] Described herein are methods and compositions useful for the
expression
of a recombinant polypeptide in a ciliate. In some embodiments, expression of
the
recombinant polypeptide can be achieved by transforming a genetically modified
ciliate
lacking one or more micronuclear rDNA genes or having one or more non-
functional
micronuclear rDNA genes with an rDNA rescue vector encoding the missing or non-
functional rDNA gene(s). Cells lacking one or more micronuclear rDNA genes or
having
one or more non-functional micronuclear rDNA genes will be conditionally
viable and unable
to survive sexual reproduction through conjugation. Accordingly,
transformation of such
cells with a rescue vector capable of correcting the rRNA deficiency will
render such cells
conjugation competent. In some embodiments, the rDNA rescue vector can further
comprise
a transgene expression cassette such that cells rendered conjugation competent
by the
methods described herein will also express a recombinant polypeptide encoded
by the
transgene.
[00117] Such genetically modified conjugation incompetent ciliate host cells
will
be viable in the vegetative state as heterokaryons because rRNA genes are not
expressed from
the micronuclear genome during vegetative growth and there will accordingly be
no impact
on the viability of such cells until the cell engages in sexual reproduction
by conjugation. In
some embodiments, the conditional lethality of the genetic modification will
occur upon exit
from the vegetative state (e.g., macronuclear differentiation upon
conjugation).
[00118] Without being bound by theory, the heterokaryonic cells will no longer
be
viable because the progeny of the cells will obtain their rRNA-encoding genes
from the
micronuclei of the parental strains and when macronuclei are resorbed upon
sexual
reproduction by conjugation, the absence of one or more functional rDNA genes
will cause
lethality. Accordingly, the conditional conjugation-lethality of the genetic
modification will
be evident upon macronuclear differentiation (i.e., upon sexual reproduction).
For example,
such genetically modified ciliate host cells will be viable in the vegetative
state due to
somatic rRNA expression derived form the macronucleus. Cell viability can be
restored in
such conditionally conjugation-lethal genetically modified ciliate hosts cell
lacking one or
more micronuclear rDNA genes or having one or more non-functional micronuclear
rDNA
genes by transformation with an rDNA rescue vector.
[00119] The universal recipient cells described herein can be created using
standard techniques known in the art. For example, Tetrahymena cells can be
transformed
with a homologous recombination vector capable of replacing one or more
functional rDNA
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
29
genes in the micronuclear rDNA locus with a nucleotide sequence that reduces
or abolishes
function or expression of the rRNA upon macronuclear reorganization in the
vegetative state.
The homologous recombination vector can further comprise a selection marker
such that cells
in which the micronuclear rDNA locus is nonfunctional by homologous
recombination can be
selected by growth in a biostatic or biocidal drug. Such cells will remain
viable in the
vegetative state because macronuclear chromosomes capable of expressing all of
the rRNA
genes required for survival will already be present in the macronucleus. Such
cells can be
selected on the basis of a selection marker encoded in the homologous
recombination vector
such that only those cells undergoing homologous recombination, and thus only
those cells
now lacking one or more micronuclear rDNA genes or having one or more non-
functional
micronuclear rDNA genes will propagate in the presence of appropriately
selected biostatic
and biocidal drugs. The universal recipient will not be capable of undergoing
sexual
conjugation because, after macronuclear reorganization following conjugation,
the
micronuclear rDNA locus will be non-functional and will be incapable of giving
rise to a
macronuclear rDNA chromosome capable of expressing the rRNAs necessary for
survival of
the cell in the vegetative state. In some embodiments, the universal recipient
cells can be
heterokaryons carrying a selectable marker that does not interfere with
downstream
selections. Many suitable selection markers are known in the art, including,
for example,
6-methylpurine.
[00120] The universal recipient cells described herein can further comprise
any
known polymorph of the rDNA locus. In one embodiment, the universal recipient
cell can
have a B rDNA locus polymorph. In another embodiment, the universal recipient
cell can
have a C3 rDNA locus polymorph. Without being bound by theory, in some
embodiments,
universal recipient cells having a C3 rDNA locus polymorph can comprise a 17S
rRNA
encoding gene comprising a point mutation that confers resistance to
paromomycin and
hygromycin such that the cells can be grown in paromomycin or hygromycin.
[00121] rDNA Rescue
[00122] In some embodiments, the rescue event can occur in the absence of
homologous recombination. For example, where the recipient cell line has a
deletion of all or
substantially all of the micronuclear rDNA locus, transformation with an rDNA
rescue vector
comprising a complete copy of an rDNA locus will not allow recombination
between
micronuclear DNA and the rDNA rescue vector. Accordingly, any transgene
cassette
comprised within the rDNA rescue vector will not be lost by phenotypic
assortment. In one
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
embodiment, rescue of universal recipient cells can be performed by
transformation with an
rDNA rescue vector comprising a complete copy of the micronuclear rDNA locus
flanked by
functional CBS regions on both the 3' and 5' ends. In some embodiments, the
rDNA locus in
the rDNA rescue vector can be a B polymorph rDNA locus. In other embodiments,
the
rDNA locus in the rDNA rescue vector can be a C3 polymorph rDNA locus. The CBS
sequences in the transformation vector are then processed like other CBS
regions naturally
present in the genome, and produce an excision product that is the equivalent
of the rDNA
produced from normal processing of the micronuclear rDNA flanking CBS regions.
The
excision product from the vector is further processed to the macronuclear
palindromic form
and subsequently acts as the source for rDNA in the rescued cell.
[00123] In some embodiments, the rDNA rescue vector can further comprise a
transgene cassette of interest (e.g., the transgene cassette can be in the 3'
non-transcribed
sequence of an rDNA gene). In some embodiments, a transgene cassette can be
inserted into
the 3' non translated sequence of the rDNA locus in the rDNA rescue vector.
[00124] In some embodiments, the universal recipient cells described herein
can be
transformed with a homologous recombination vector having both a transgene
cassette and
one or more functional rDNA genes.
[00125] In other embodiments, the rDNA rescue vector can comprise a selection
marker, such that cells that have been transformed with the rescue vector,
whether or not they
have undergone homologous recombination with the rDNA rescue vector, can also
be
selected by growth in a biostatic or biocidal drug.
[00126] In some embodiments, the rDNA rescue vector can comprise a selection
marker and a transgene cassette such that cells transformed with the rDNA
rescue vector can
be grown in a selective medium whether or not the rDNA rescue vector undergoes
homologous recombination with any micronuclear genomic sequence in the
universal
recipient cell.
[00127] The rDNA rescue vectors described herein can further comprise any rRNA
encoding nucleotide sequence or polymorph. In some embodiments, the rDNA
rescue vector
can comprise an rRNA-encoding nucleotide sequence corresponding to a B
polymorph
rRNA. In other embodiments, the rDNA rescue vector can comprise an rRNA-
encoding
nucleotide sequence corresponding to a C3 polymorph rRNA. Without being bound
by
theory, in some embodiments, an rDNA rescue vector comprising a C3 rDNA locus
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
31
polymorph can comprise a 17S rRNA encoding gene comprising a point mutation
that
confers resistance to paromomycin or hygromycin such that the cells
transformed with the
vector can be grown in paromomycin or hygromycin upon homologous recombination
following macronuclear reorganization.
[00128] rDNA Knockout Vectors
[00129] A vector useful for generating a universal recipient cell having a non-
functional or deleted micronuclear rDNA locus can comprise an rDNA knockout
cassette
suitable for replacing the micronuclear DNA segment extending from a sequence
between the
5' CBS flanking the micronuclear rDNA locus and the 3' CBS flanking the
micronuclear
rDNA locus. Accordingly, the two regions of homology between the rDNA knockout
construct and the rDNA rescue construct can be designed to complement one
another such
that deletion, substitution, insertion or inversion of one or more nucleic
acids by homologous
recombination with an rDNA knockout vector can be reversed by homologous
recombination
with the rDNA rescue vector.
[00130] In some embodiments, a selection marker can be operably integrated
into
the rDNA knockout vector such that it can confer resistance to one or more
biostatic or
biocidal drugs when the rDNA knockout vector is integrated or maintained in an
episomal
state. In other embodiments, the selection marker can be operably integrated
into the rDNA
knockout vector such that it can confer resistance to one or more biostatic or
biocidal drugs
when a minichromosome derived from the rDNA knockout vector is generated
during
macronuclear reorganization. In still further embodiments, the selection
marker can be
operably integrated into the rDNA knockout vector such that it can confer
resistance to one or
more biostatic or biocidal drugs when the rDNA knockout vector is maintained
in an
episomal state and when a minichromosome derived from the rDNA knockout vector
is
generated during macronuclear reorganization.
[00131] DNA Vectors
[00132] Recombinant DNA for transformation of the genetically modified
ciliates
described herein can be a vector, for example, any type of nucleic acid,
plasmid, cosmid,
virus, autonomously replicating sequence, phage, linear or circular, single-
or double-strand
DNA or RNA molecule, that can replicate in the target organism itself or be
incorporated into
its genome.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
32
[00133] A heterologous nucleic acid transformed into a ciliate can be
maintained
extrachromosomally on an autonomous plasmid. Heterologous nucleic acids can
also be
introduced into the ciliate host on an expression vector that is capable of
integrating into the
host's genome. For example, expression vectors capable of homologous
recombination with
a highly expressed gene that is endogenous to the ciliate host, such as a beta-
tubulin gene are
known in the art.
[00134] Expression vectors useful for transforming ciliates in accordance with
the
methods described herein include but are not limited to rDNA rescue vectors
(e.g.,
replacement vectors), rDNA vectors, and rDNA-based vectors. Rescue vectors
accomplish
DNA-mediated transformation by replacing or altering endogenous genes using
homologous
recombination. Integration of the heterologous nucleic acid into the host's
genome at the
targeted site is accomplished via homologous recombination involving a
crossover event with
the vector containing the heterologous nucleic acid. An example of an
expression vector
useful for genomic incorporation of a heterologous nucleic acid by replacement
is one that
targets a transgene to the beta-tubulin locus and is selectable by growth in
appropriate drugs
(Gaertig et at. (1999)).
[00135] Methods for creating mitotically stable transformants of
ciliates (e.g.,
Tetrahymena spp.) are known in the art. For example, methods for generating
Tetrahymena
spp. having targeted gene knockouts by homologous DNA recombination are known
in the
art (Bruns & Cassidy-Hanley in: Methods in Cell Biology, Vol. 62, Asai &
Forney (eds.),
Academic Press (1999), pp. 501-512); Hai et at. in: Methods in Cell Biology,
Vol. 62, Asai &
Forney (eds.), Academic Press (1999) 514-531; Gaertig et at. (1999), Nature
Biotech.
17:462-465; Cassidy-Hanley et at. (1997), Genetics 146:135-147).
[00136] A replacement vector can include a 5' region, followed by a
heterologous
coding region, followed by a 3' region, wherein at least a portion of each of
the 5' and 3'
regions is complementary to 5' and 3' regions on an endogenous gene of the
host, to allow for
genomic integration of the heterologous coding region via homologous
recombination. The
5' and 3' regions of the vector can also comprise regulatory elements, such as
a promoter and
a terminator. The necessary regulatory elements can also be supplied by the
endogenous
gene into which the heterologous coding region integrates. Suitable regulatory
regions
include, but are not limited to promoters, termination sequences, signal
peptides and
propolypeptide domains involved in the expression and secretion of
polypeptides. For
example, such regulatory elements can provide efficient heterologous
expression of
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
33
polypeptides in ciliates under control of promoters and/or terminators which
are derived from
genes in ciliates. Such vectors can comprise naturally occurring promoters
and/or
terminators from polypeptides secreted at a high level in ciliates. The
expression of
recombinant polypeptides in ciliates can be driven by strong promoters,
pre/pro sequences
and terminators. In some embodiments, the promoters and/or terminators can be
selected
from polypeptides secreted at a high level independent of the cell-cycle in
Tetrahymena spp.
(see, e.g.,U U.S. Patent Publication 2006/0127973; W02003/078566). Inducible
promoters
from Tetrahymena spp. genes have also been described that allow robust
expression of
heterologous genes. For example, heat-inducible promoters of the heat shock
polypeptide
family of the ciliate Tetrahymena spp. are also suitable for use with the
methods described
herein. Suitable heat shock promoters from Tetrahymena spp. are known in the
art (see, e.g.,
W02007/006812).
[00137] Expression vectors can also be maintained extrachromosomally in
ciliates.
For example, such extrachromosomal elements can be rDNA-based vectors
containing an on
from Tetrahymena spp. Such vector can further comprise a 5' regulatory region
from an
endogenous Tetrahymena spp. gene containing a promoter region operably linked
to the
heterologous coding region and/or a 3' regulatory region from the same or a
different
Tetrahymena spp. gene. Suitable regulatory regions from ciliate genes are well
known in the
art.
[00138] Vectors suitable for use with the methods described herein include,
but are
not limited to: the pXS76 shuttle vector (which can be used for insertion of
transgenes
downstream of a cadmium-inducible promoter from the MTT1 metallothionein
gene), rDNA
vectors (Tondravi et at. (1986), Proc. Natl. Acad. Sci USA 83:4396; Yu et at.
(1989), Proc.
Natl. Acad. Sci USA 86: 8487-8491), high copy number ribosomal DNA vectors
(such as
pD5H8). For example, an rDNA-based vectors can be a circular vector containing
5' non-
translated sequences comprising two or more on sequences from Tetrahymena spp.
One or
more nucleic acid fragments containing heterologous coding regions (e.g., a
transgene or a
selectable marker) can also be added to the vector using methods known to one
skilled in the
art. Such vectors can further comprise 5' untranslated regions of a
Tetrahymena spp. genes
and a 3' untranslated regions of a Tetrahymena spp. genes. These untranslated
regions can be
inserted upstream and downstream of the selectable marker and/or the
transgene.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
34
[00139] The nucleotide sequences herein can be cloned using standard cloning
procedures in the art, as described by Sambrook et at., Molecular Cloning: A
Laboratory
Manual, Second Edition, Cold Springs Laboratory, Cold Spring Harbor, N.Y.
(1989).
[00140] One skilled in the art will also appreciate that for a transgene to be
expressed in a ciliate, such as Tetrahymena, additional regulatory factors
much be operatively
linked to a coding sequence. These regulatory regions include, but are not
limited to a
promoter, a polyadenylation sequence, a transcriptional start site, a
translation start site and
the like. For example, a functional promoter can have, among other things, one
or more
TATA boxes, CCAAT boxes, GC boxes or enhancer sequences. A transgene suitable
for use
with the methods and compositions described herein can also include a
terminator functional
in one or more types of ciliates. A signal sequence that directs
polyadenylation of mRNA
may also be required in order to achieve expression of a desired transgene in
a ciliate. One of
skill in the art will further recognize that the coding sequence of the
functional gene will also
contain elements that direct translation of the encoded mRNA in the target
organism. For
example, a start codon (for example, ATG), a stop codon (TGA), an A-rich
region before the
start (translation initiation site), one or more Kozak sequences, and a poly-A
site can all be
required for the expression of a transgene in a ciliate. It is also possible
to modify transgenes
such that codon usages specific for a ciliate such as Tetrahymena is employed
(Wuitschick &
Karrer (1999)). Thus in one embodiment, any functional promoter, terminator,
polyadenylation signal or any other regulatory region that required to express
a transgene in
the context of the rDNA rescue vector (or any macronuclear chromosomes derived
therefrom) can be used in conjunction with the methods and compositions
described herein.
One skilled in the art will readily be able to devise a strategy to cause a
transgene to be
expressed according to the methods described herein.
[00141] Such regulatory elements can provide efficient expression of
recombinant
polypeptides in ciliates under control of promoters and/or terminators which
are derived from
genes in ciliates such as Tetrahymena spp. The expression of recombinant
polypeptides in
ciliates can be driven by strong promoters, pre/pro sequences and terminators.
In some
embodiments, the promoters and/or terminators can be selected from
polypeptides secreted at
a high level independent of the cell-cycle in Tetrahymena spp (see, e.g., U.S.
Patent
Publication 2006/0127973; W02003/078566). Inducible promoters from ciliate
genes have
also been described that allow robust expression of heterologous genes. For
example, heat-
inducible promoters of the heat shock polypeptide family of the ciliate
Tetrahymena spp. are
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
also suitable for use with the methods described herein. Suitable heat shock
promoters from
Tetrahymena spp. are known in the art (see, e.g., W02007/006812).
[00142] Polypeptide Production
[00143] In one aspect, the methods described herein relate to the production
of a
recombinant polypeptide in ciliates. In some embodiments, the ciliate can have
a
micronuclear rDNA locus homozygous for the B rDNA allele such that
transformation of the
ciliate with an rDNA vector comprising a C3 rDNA locus, will result a ciliate
having both
micronucleus derived B allele rDNA minichromosomes and an rDNA vector derived
C3
rDNA minichromosomes. In other embodiments, the rDNA vector derived C3 rDNA
minichromosomes can further comprise an rDNA vector-derived transgene
cassette. In other
embodiments, the rDNA vector can further comprise an rDNA vector-derived
selection
marker.
[00144] In yet another aspect, the invention relates to methods useful for the
production of a recombinant polypeptide in a ciliate, the methods comprising
(a)
transforming a ciliate with an rDNA vector or an rDNA rescue vector, wherein
the vector
further comprises a nucleotide sequence encoding the recombinant polypeptide;
(b) culturing
the ciliate to produce the recombinant polypeptide; and (c) isolating the
recombinant
polypeptide. In some embodiments, the ciliate has a homozygous B rDNA allele
micronuclear genotype.
[00145] Without being bound by theory, the replicative advantage of the C3
rDNA
minichromosome will eventually result in the elimination of the B rDNA allele
minichromosome during vegetative growth such that the only source of rRNA
expression will
be the rDNA vector derived C3 minichromosome.
[00146] Transformation
[00147] Genes can be introduced into ciliates using established protocols or
any
method known to one skilled in the art. Transformation of ciliates can be
achieved by
microinjection (Tondravi and Yao (1986), Proc. Natl. Acad. Sci. USA 83:4369-
4373),
electroporation (Gaertig and Gorovsky (1992), Proc. Natl. Acad. Sci. USA
89:9196-9200), or
biolistically (Cassidy-Hanley et at. (1997), Genetics 146:135-147).
Alternatively,
transformation of the somatic macronucleus or the generative micronucleus is
also possible in
Tetrahymena spp.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
36
[00148] Transformation can be performed at different times during meiosis
during
conjugation depending on whether the target is micronuclear transformation or
macronuclear
transformation. In some embodiments, universal recipient cells can be
transformed with an
rDNA rescue vector during the early stages on conjugation. In other
embodiments, universal
recipient cells can be transformed with an rDNA rescue vector during the
vegetative state
(e.g., a starvation induced vegetative state) as long as transformation occurs
prior to
fertilization. In some embodiments, biolistic transformation can be used for
micronuclear
transformation. In other embodiments, micronuclear transformation can be used
to create the
universal recipient cells.
[00149] Transformation performed during conjugation can be highly conjugation
stage specific, as well as have time and temperature dependence. For example,
in the case of
macronuclear transformation, transformation has to occur late in conjugation
when the cells
are normally processing the native CBS regions in the genome. In the case of
micronuclear
transformation, for example for the creation of universal recipient strains
having a non-
functional micronuclear rDNA locus, or for the creation of parent strains
having one or more
non-functional rDNA genes, conjugating cells must be transformed early in
mating prior to
the completion of meiosis and haploid zygote nucleus formation. See Cassidy-
Hanley et at.
(1997). Flanking regions of homology are essential for all homologous
transformation, and
biolistic transformation can be used for micronuclear transformation.
[00150] All cells in a population may not necessarily be transformed during a
transformation protocol. Nevertheless, the true progeny survivors of the
genetically modified
ciliates described herein transformed with an rDNA rescue vector comprising a
transgene
cassette will be capable of expressing a heterologous polypeptide encoded by
the transgene.
Thus, although conjugation is not completely synchronous in ciliates,
synchronization need
only be sufficient to yield some survivors. However, there is also a
workaround involving
selection against non-maters based on parent strains that are functional
heterokaryons for a
selectable marker. Parental strains which are functional heterokaryons, (i.e.,
strains which
carry a non-expressed selectable marker in the micronucleus but not in the
macronucleus)
will not express the selectable marker. Any cells which do not undergo
conjugation and the
formation of a new macronucleus will be killed by the selection agent. Mating
brings the
micronuclear gene into expression in the newly formed macronucleus in progeny
cells, and
true progeny will therefore be resistant to the selection agent. As a result
only true progeny
will survive selection.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
37
[00151] In some embodiments, ciliate cells can be transformed with a chimeric
gene by particle bombardment (also known as biolistic transformation) (Cassidy-
Hanley et at.
(1997), Genetics 146:135-147). Particle bombardment transformation can be
achieved in
several ways. For example, inert or biologically active particles can be
propelled at cells
under conditions effective to penetrate the outer surface of the cell and to
be incorporated
within the interior thereof. When inert particles are utilized, the vector can
be introduced into
the cell by coating the particles with the vector containing the chimeric
gene. Alternatively,
the target cell can be surrounded by the vector so that the vector is carried
into the cell by the
wake of the particle. Other variations of particle bombardment, now known or
hereafter
developed, can also be used.
[00152] Microcarrier bombardment can also be used to transform ciliate cells
by
means of DNA-loaded gold particles (U.S. Pat. No. 6,087,124; EP 0 847 444;
W01998/001572). In this approach, microcarrier bombardment with DNA-coated
gold is
used as a means of introducing heterologous genes into ciliates. In some
embodiments,
microcarrier bombardment can be used to transform ciliates and introduce genes
into the
(germline) micronucleus. In other embodiments, DNA-coated tungsten particles
can be used
for biolistic transformation.
[00153] Methods for selection of transformed cells harboring heterologous
genes
are known in the art. For example, the vector can further comprise a
selectable cassette
marker to permit selection for transformed cells (e.g., a neo 2 cassette)
(Gaertig et at. (1994),
Nucleic Acids Res. 22:5391-5398. Selection of transformants can be achieved by
growing the
cultured ciliates in a medium which allows only the transformants to survive.
Suitable
selection agents include antibiotics which will kill all non-transformants but
allow
transformants (which also possess an antibiotic resistance gene) to survive. A
number of
antibiotic-resistance markers are known in the art. Any known antibiotic-
resistance marker
can be used to transform and select transformed host cells in accordance with
the present
invention. For example, a Tetrahymena cells homozygous for a B allele
micronuclear rDNA
locus can be transformed with an rDNA vector comprising (1) a transgene
cassette capable of
driving expression of a recombinant polypeptide encoded by the transgene and
(2) a selection
marker that does not confer resistance to a selection agent other than
paromomycin.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
38
[00154] Recombinant Polypeptides/Peptides
[00155] The genetically modified ciliates described herein can be used to
express a
recombinant polypeptide or peptide of any species and of any size. For
example, the
genetically modified ciliates described herein can be transformed with an rDNA
vector or an
rDNA rescue vector comprising a transgene cassette capable of driving
expression of a
recombinant polypeptide encoded by the transgene. In some embodiments, the
recombinant
polypeptide or peptide can be a therapeutically useful polypeptide or peptide.
In other
embodiments, the polypeptide can be a mammalian polypeptide, for example a
human
polypeptide, and can be, for example, a growth factor, a cytokine, a chemokine
or a blood
polypeptide. The recombinant polypeptide or peptide can be expressed primarily
in an
inactive form in the host cell. In certain embodiments, the recombinant
polypeptide or
peptide is between about lkDa to about 10kDa, between about 10kDa to about
20kDa,
between about 20kDa to about 50kDa, between about 50kDa to about 100kDa,
between about
100kDa to about 200kDa, between about 200kDa to about 400kDa, between about
400kDa to
about 800kDa, between about 800kDa to about 1,500kDa, or greater than
1,500kDa. In
certain embodiments, the recombinant polypeptide or peptide is a peptide of at
least 5, 10, 15,
20, 30, 40, 50 or 100 amino acids.
[00156] In some embodiments, the nucleotide sequence of the transgene encoding
the recombinant peptide can be modified to have properties that promote for
translation in the
Tetrahymena or genetically modified ciliates described herein. For example, in
Tetrahymena,
the ATG start codon, the TGA stop codon, and A-rich regions before translation
initiation
sites, Kozak sequences, poly-A site can be operably linked to a heterologous
coding
sequence. Codon usage corresponding to Tetrahymena spp. has also been
described, and
methods to modify heterologous coding sequences in accordance with codon
usage, for
example through silent mutagenesis, or through mutagenesis resulting in
conservative amino
acid substitutions are readily known to one skilled in the art (Wuitschick and
Karrer (1999)).
[00157] Transgenes suitable for use with the methods and genetically modified
ciliates described herein include genes encoding polypeptides that are, e.g.,
at least about
60%, 70%, 75%, 80%, 90%, 95%, or at least about 99% or more identical to any
available
polypeptide.
[00158] Transgenes suitable for use with the methods and compositions
described
can be any naturally occurring or synthetic (artificial) therapeutic,
diagnostic, bio-molecule,
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
39
peptides, polypeptides, or polypeptides that can be modified as discussed by
the present
invention. Some examples of transgenes include, but are not limited to, e.g.,
alpha-1
antitrypsin, angiostatin, antihemolytic factor, antibodies (including an
antibody or a
functional fragment or derivative thereof selected from: Fab, Fab',
F(ab)<sub>2</sub>, Fd, Fv, ScFv,
diabody, tribody, tetrabody, dimer, trimer or minibody), angiogenic molecules,
angiostatic
molecules, apolipopolypeptide, apopolypeptide, asparaginase, adenosine
deaminase, atrial
natriuretic factor, atrial natriuretic polypeptide, atrial peptides,
angiotensin family members,
Bone Morphogenic Polypeptide (BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7,
BMP-8a, BMP-8b, BMP-10, BMP-15, etc.); C-X-C chemokines (e.g., T39765, NAP-2,
ENA-
78, Gro-a, Gro-b, Gro-c, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG), Calcitonin, CC
chemokines (e.g., monocyte chemoattractant polypeptide-1, monocyte
chemoattractant
polypeptide-2, monocyte chemoattractant polypeptide-3, monocyte inflammatory
polypeptide-lalpha, monocyte inflammatory polypeptide-lbeta, RANTES, 1309,
R83915,
R91733, HCC1, T58847, D31065, T64262), CD40 ligand, C-kit Ligand, Ciliary
Neurotrophic Factor, Collagen, Colony Stimulating Factor (CSF), Complement
factor 5a,
Complement inhibitor, Complement receptor 1, cytokines, (e.g., epithelial
Neutrophil
Activating Peptide-78, GROalpha/MGSA, GRObeta, GROgamma, MIP-lalpha, MIP-
ldelta,
MCP-1), deoxyribonucleic acids, Epidermal Growth Factor (EGF), Erythropoietin
("EPO",
representing a preferred target for modification by the incorporation of one
or more non-
natural amino acid), Exfoliating toxins A and B, Factor IX, Factor VII, Factor
VIII, Factor X,
Fibroblast Growth Factor (FGF), Fibrinogen, Fibronectin, G-CSF, GM-CSF,
Glucocerebrosidase, Gonadotropin, growth factors, Hedgehog polypeptides (e.g.,
Sonic,
Indian, Desert), Hemoglobin, Hepatocyte Growth Factor (HGF), Hepatitis
viruses, Hirudin,
Human serum albumin, Hyalurin-CD44, Insulin, Insulin-like Growth Factor (IGF-
I, IGF-II),
interferons (e.g., interferon-alpha, interferon-beta, interferon-gamma,
interferon-epsilon,
interferon-zeta, interferon-eta, interferon-kappa, interferon-lamda,
interferon-tau, interferon-
c, interferon-omega), glucagon-like peptide (GLP-1), GLP-2, GLP receptors,
glucagon, other
agonists of the GLP-1R, natriuretic peptides (ANP, BNP, and CNP), Fuzeon and
other
inhibitors of HIV fusion, Hurudin and related anticoagulant peptides,
Prokineticins and
related agonists including analogs of black mamba snake venom, TRAIL, RANK
ligand and
its antagonists, calcitonin, amylin and other glucoregulatory peptide
hormones, and Fc
fragments, exendins (including exendin-4), exendin receptors interleukins
(e.g., IL-1, IL-2,
IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, etc.), I-CAM-
1/LFA-1,
Keratinocyte Growth Factor (KGF), Lactoferrin, leukemia inhibitory factor,
Luciferase,
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
Neurturin, Neutrophil inhibitory factor (NIF), oncostatin M, Osteogenic
polypeptide,
Parathyroid hormone, PD-ECSF, PDGF, peptide hormones (e.g., Human Growth
Hormone),
Oncogene products (Mos, Rel, Ras, Raf, Met, etc.), Pleiotropin, Polypeptide A,
Polypeptide
G, Pyrogenic exotoxins A, B, and C, Relaxin, Renin, ribonucleic acids, SCF/c-
kit, Signal
transcriptional activators and suppressors (p53, Tat, Fos, Myc, Jun, Myb,
etc.), Soluble
complement receptor I, Soluble I-CAM 1, Soluble interleukin receptors (IL-1,
2, 3, 4, 5, 6, 7,
9, 10, 11, 12, 13, 14, 15), soluble adhesion molecules, Soluble TNF receptor,
somatomedin,
somatostatin, somatotropin, streptokinase, superantigens, Staphylococcal
enterotoxins (SEA,
SEB, SEC1, SEC2, SEC3, SED, SEE), Steroid hormone receptors (such as those for
estrogen,
progesterone, testosterone, aldosterone, LDL receptor ligand and
corticosterone), superoxide
dismutase (SOD), Toll-like receptors (such as Flagellin), Toxic shock syndrome
toxin
(TSST-1), Thymosin alphal, Tissue plasminogen activator, transforming growth
factor
(TGF-alpha, TGF-beta), Tumor necrosis factor beta (TNF-beta), Tumor necrosis
factor
receptor (TNFR), Tumor necrosis factor-alpha (TNF-alpha), transcriptional
modulators (for
example, genes and transcriptional modular polypeptides that regulate cell
growth,
differentiation and/or cell regulation), Vascular Endothelial Growth Factor
(VEGF), virus-
like particle, VLA-4NCAM-1, Urokinase, signal transduction molecules,
estrogen,
progesterone, testosterone, aldosterone, LDL, corticosterone amidase, amino
acid racemase,
acylase, dehalogenase, dioxygenase, CD4OL/CD40, diarylpropane peroxidase,
epimerase,
epoxide hydrolase, esterase, isomerase, kinase, glucose isomerase,
glycosidase, glycosyl
transferase, haloperoxidase, monooxygenase, lipase, lignin peroxidase, nitrile
hydratase,
nitrilase, protease, phosphatase, subtilisin, trnasaminase, nuclease, a
cytokine, Factor VII,
Factor VIII, Factor IX, Follitropin, G-CSF, GM-CSF, GLP-1, human growth
hormone,
interferon-alpha, interferon-beta, interferon-gamma, interferon-omega.,
interferon-tau, a
transcriptional modulator that modulates cell growth, differentiation, or
regulation,
expression activator, inflammatory molecule, growth factor, growth factor
receptor, and
oncogene product.
[00159] Target molecules include transcriptional modulators, signal
transduction
molecules and oncogene products, which may be found in prokaryotes, viruses,
and
eukaryotes, including fungi, plants, yeasts, insects, and animals, including
mammals,
providing a wide range of therapeutic targets. It will be appreciated that
expression and
transcriptional activators regulate transcription by many mechanisms, e.g., by
binding to
receptors, stimulating a signal transduction cascade, regulating expression of
transcription
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
41
factors, binding to promoters and enhancers, binding to polypeptides that bind
to promoters
and enhancers, unwinding DNA, splicing pre-mRNA, polyadenylating RNA, and
degrading
RNA.
[00160] Examples of transcriptional modulators or expression activators
include
but are not limited to: cytokines, inflammatory molecules, growth factors,
their receptors, and
oncogene products, e.g., interleukins (e.g., IL-1, IL-2, IL-8, etc.),
interferons, FGF, IGF-I,
IGF-II, FGF, PDGF, TNF, TGF-alpha, TGF-beta, EGF, KGF, SCF/c-Kit, CD4OL/CD40,
VLA-4NCAM-1, ICAM-1/LFA-1, and hyalurin/CD44; signal transduction molecules
and
corresponding oncogene products, e.g., Mos, Ras, Raf, and Met; and
transcriptional activators
and suppressors, e.g., p53, Tat, Fos, Myc, Jun, Myb, Rel, and steroid hormone
receptors such
as those for estrogen, progesterone, testosterone, aldosterone, the LDL
receptor ligand and
corticosterone.
[00161] Other transgenes suitable for use with the methods and genetically
modified ciliates described herein include genes encoding enzymes (e.g.,
industrial enzymes)
or portions thereof. Examples of enzymes include, but are not limited to,
e.g., amidases,
amino acid racemases, acylases, dehalogenases, dioxygenases, diarylpropane
peroxidases,
epimerases, epoxide hydrolases, esterases, isomerases, kinases, glucose
isomerases,
glycosidases, glycosyl transferases, haloperoxidases, monooxygenases (e.g.,
p450s), lipases,
lignin peroxidases, nitrile hydratases, nitrilases, proteases, phosphatases,
subtilisins,
transaminase, and nucleases.
[00162] Other transgenes suitable for use with the methods and genetically
modified ciliates described herein include genes encoding vaccine
polypeptides, e.g., in
polypeptides from infectious fungi, e.g., Aspergillus, Candida species;
bacteria, particularly
E. coli, which serves a model for pathogenic bacteria, as well as medically
important bacteria
such as Staphylococci (e.g., S. aureus), or Streptococci (e.g., S.
pneumoniae); protozoa such
as sporozoa (e.g., Plasmodia), rhizopods (e.g., Entamoeba) and flagellates
(Trypanosoma,
Leishmania, Trichomonas, Giardia, etc.); viruses such as (+) RNA viruses
(examples include
Poxviruses, e.g., vaccinia; Picornaviruses, e.g., polio; Togaviruses, e.g.,
rubella; Flaviviruses,
e.g., HCV; and Coronaviruses), (-) RNA viruses (e.g., Rhabdoviruses, e.g.,
VSV;
Paramyxovimses, e.g., RSV; Orthomyxovimses, e.g., influenza; Bunyaviruses; and
Arenaviruses), dsDNA viruses (Reoviruses, for example), RNA to DNA viruses,
i.e.,
Retroviruses, e.g., HIV and HTLV, and certain DNA to RNA viruses such as
Hepatitis B.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
42
[00163] Other transgenes suitable for use with the methods and genetically
modified ciliates described herein include genes encoding agriculturally
related polypeptides
such as insect resistance polypeptides (e.g., the Cry polypeptides), starch
and lipid production
enzymes, plant and insect toxins, toxin-resistance polypeptides, Mycotoxin
detoxification
polypeptides, plant growth enzymes (e.g., Ribulose 1,5-Bisphosphate
Carboxylase/Oxygenase, "RUBISCO"), lipoxygenase (LOX), and Phosphoenolpyruvate
(PEP) carboxylase are also suitable target molecules.
[00164] Transgenes suitable for use with the methods and genetically modified
ciliates described herein include genes encoding can be modified according to
any method
known in the art to altering one or more therapeutic, diagnostic, or enzymatic
properties of
the target polypeptide. Examples of therapeutically relevant properties
include serum half-
life, shelf half-life, stability, immunogenicity, therapeutic activity,
detectability (e.g., by the
inclusion of reporter groups (e.g., labels or label binding sites)) in the non-
natural amino
acids, specificity, reduction of LD50 or other side effects, ability to enter
the body through
the gastric tract (e.g., oral availability), or the like. Examples of relevant
diagnostic
properties include shelf half-life, stability (including thermostability),
diagnostic activity,
detectability, specificity, or the like. Examples of relevant enzymatic
properties include shelf
half-life, stability, specificity, enzymatic activity, production capability,
resistance to at least
one protease.
EXAMPLES
[00165] The following examples illustrate the present invention, and are set
forth to
aid in the understanding of the invention, and should not be construed to
limit in any way the
scope of the invention as defined in the claims which follow thereafter.
Example 1: Genetically Modified Ciliates
[00166] Genetic instability (e.g., loss of transgenes) in Tetrahymena
strains
containing recombinant rDNA chromosomes can be shown by loss of the transgene
polypeptide product and direct visualization of recombination of the
recombinant rDNA
chromosome (Figure 1). Genetic instability poses a serious limitation to the
use of transgenic
T. thermophila strains for polypeptide production purposes and would preclude
them from
use in the production of therapeutic polypeptides. Genetic stability of
strains containing
transgenes in both 'arms' of the palindrome can be problematic in the presence
of rDNA
palindromes lacking the insert in 1 or both arms. Once the cell contains only
rDNA with
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
43
inserts in both arms, stability will be relatively complete. In most cases
strains created
following transformation with an rDNA vector contain a mixture of complete
transgenic,
hybrid (one arm wild-type and one arm transgene) and wild-type rDNA
chromosomes
(Figure 1).
[00167] As described herein, the current invention employs genetically
distinct and
novel T. thermophila strains that are genetically modified to be used in
conjunction with
rDNA based expression vectors leading to the generation of genetically stable
recombinant
rDNA chromosomes. These genetically modified strains can be useful for the
production of a
polypeptide of interest from a transgene.
[00168] Elements of the polypeptide production system described herein can
comprise:
1) A universal recipient cell line optimized for efficient insertion of a
cassette
containing a given transgene into an rDNA mini-chromosome. The universal
recipient line is a homozygous heterokaryon for a lethal micronuclear knock-
out of
one or more rDNA genes in the rDNA locus (rDNAK /rDNAK ).
2) An rDNA rescue vector. This vector contains a complete micronuclear rDNA
sequence complete with adjacent CBS sequences (see Fig.2D).
[00169] In one embodiment, the replacement insert contains no additional
selective
marker. Accordingly, rescue of the rDNA KO, with consequent restoration of
rDNA
expression from a macronuclear rDNA chromosome, is necessary and sufficient
for
homozygous progeny viability.
[00170] A "production cell line" is generated by transformation with the rDNA
rescue vector in a cross of two mating types of the universal recipient cell
line, followed by
selection against cells that have failed to develop a new macronucleus. Only
the progeny
from the desired transformants will survive as exconjugants.
[00171] This system exploits the advantages of high rDNA copy number for
increased gene expression. Because the maximum transcription level is
potentially very high,
it would compensate for the use of a weaker but less toxic promoter than MTT1.
Additionally it confers maximum flexibility for adjusting expression levels to
below the point
at which a particular transgene might reduce growth rate (and could thus
select for mutations
that knock down gene expression, i.e., instability) during the prolonged
growth with the high
level of gene expression required in the bioreactor.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
44
[00172] The production line is stable because there is essentially no
probability of
separating the rDNA rescue sequence from the transgene by homologous
recombination. It is
thus free of the recombination-mediated instability observed for replicative
rDNA vectors
designed to out-replicate the ever-present endogenous rDNA. The transgene can
be lost only
through excision by a spontaneous, homology-independent deletion event.
[00173] Because the transgene "piggy-backs" on the rDNA rescue segment, the
vector provides built-in selection for transgene insertion in generating the
production cell
line. Thus, even the insertion of a deleterious transgene can be selected for.
[00174] The approach allows improvement of production cells lines by the
classical, preconception-free approach of shotgun mutagenesis followed by
selection or
screening for increased production. The desirable mutations can be sought
either in the MIC
or directly in the MAC.
[00175] As described herein, universal recipient lines can be engineered to be
homozygous heterokaryons for a knockout of one or more rDNA genes in the
micronuclear
rDNA locus. These lines can also comprise an extraneous DNA cassette. These
cell lines
can be genetically pre-engineered in their MIC for any desired features (e.g.,
appropriate
glycosylation). All these elements can be independently developed and then
combined by
crossing ¨ an advantage of a MIC-based system.
[00176] Fertile cell lines of two different mating cells can be used. One of
the two
cell lines should also be a homozygous heterokaryon for a selective drug
resistance marker
(e.g., cycloheximide), to as be able to select against cells that failed to
differentiate a new
macronucleus. The advantage of using only one drug resistant line is that drug
resistant
homozygote heterokaryons, if/when needed, can be regenerated from the progeny
after
assortment and a star cross.
[00177] Generating production cell lines by inserting the transgene into the
Universal Recipient cell lines. To insert the transgene, two different mating
type versions of
universal recipient (UR) cell lines can be crossed to one another and
differentiating
macronuclei can be transformed with the rescue vector. In the rDNA knockout
approach,
only the vector derived rDNA will yield a functional rDNA palindromic
chromosome in the
mac. The mic version may be processed during mac formation but should be
rapidly lost
during subsequent growth since it contains no functional rDNA and no
selectable marker.
Only the vector derived rDNA should be maintained in the progeny cells.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
[00178] Constructing the Universal Recipient cell lines with an rDNA KO. An
example of a strategy to generate a micronuclear rDNA knockout strain is shown
in Example
4.
[00179] MAC-based shotgun mutagenesis optimization of a production cell line.
Vegetatively growing production cell lines can be mutagenized and can be
screened for
higher transgene expression. Such screens can be performed using, for example,
high
throughput Western dot blots or mass spectrometry or any other method suitable
for detecting
the expression of a gene known in the art.
[00180] A MIC-based method for shotgun optimization of production cell lines.
One or both production cell lines can be mutagenized and crossed to one
another in order to
perform a classical selection for MIC mutations that boost expression. For
example, Fl cells
can be grown vegetatively and periodically screened for assortants with high
level of
expression using, for example, high throughput Western dot blots or mass
spectrometry or
any other method suitable for detecting the expression of a gene known in the
art.
[00181] Rescue by Macronuclear Transformation. Macronuclear transformation
can also be used with the methods described in this example. In another
embodiment,
micronuclear transformation can be used with the methods described in this
example. MIC-
and MAC-based systems are not mutually exclusive and, can be developed side-by-
side.
[00182] One consideration associated with rDNA based expression methods is
that
of the formation of a palindrome following excision and recombination from the
vector at the
CBS sites. Palindrome formation can be incomplete when recombination with one
arm of the
wild type sequence gives rise to a hybrid. Subsequent recombination can occur
either
between hybrids or between hybrid and wild type to form more wild type.
Phenotypic
assortment gives rise to the various final configurations. In most cases
strains contain a
mixture of complete transgenic, hybrid (one arm wild-type and one arm
transgene) and wild-
type rDNA chromosomes upon transformation with an rDNA vector actually (Figure
1).
Strains containing transgenes in both arms of the palindrome are genetically
stable whereas
strains that contain hybrid rDNA chromosomes (a large percentage of
transformants)
recombine and revert to a wild-type rDNA palindrome over many generations.
Strains
containing only palindromic molecules with transgenes in both arms are stable.
Strains
containing any mix of double transgene, hybrid and wild type molecules are
potentially
unstable. This re-conversion can result in a loss of the transgene and thus in
loss of target
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
46
polypeptide expression. Viability of progeny resulting from conjugation is
conditional upon
transformation with a vector encoding the corresponding functional rRNA, and
optionally a
transgene of interest. Thus, cells which pair (e.g., the first step in
conjugation) but do not
subsequently undergo the complete process of mating before becoming committed,
or cells
which separate after aborting the differentiation of new macronuclei (and
keeping the
parental macronucleus), are not affected and can survive conjugation.
Example 2: Exemplary Protocol for Generating a Universal Recipient Cell Line
Lacking a
Functional Micronuclear rDNA Locus (rDNA Knockout Strains).
[00183] A summary of this protocol is shown in Example 4.
[00184] Described in this example is the generation of a T. thermophila strain
that
contains a mutation in the rDNA locus such that one or more rRNA encoding
genes in the
micronuclear rDNA locus are non functional (e.g. knocked out). This strain
will ensure that
only rDNA derived form the transformation vector is present in the MAC
following
transformation. (since only successful transformants will survive). Strains
deficient in the
rDNA will be transformed in the macronucleus with a novel vector that contains
the
transgene and the complete rDNA. Subsequent maintenance of recombinant rDNA
chromosomes is ensured since only the sexual progeny resulting from successful
transformation will survive.
[00185] This method has the advantages that (1) it can ensure genetic
stability of
strains, and (2) the cell lines are stably transformed, thereby enabling
selection of cell lines
that carry the transgene by mutagenizing the MAC.
[00186] As used herein "Mpr" refers to 6-methylpurine resistance, "Mps" refers
to
6-methylpurine susceptibility, "Pmr" refers to paromomycin resistance and
"Pms" refers to
susceptibility.
[00187] Parent strains:
(1) CU428 Mpr/Mpr (mps, VII) and homozygous for mutation conferring resistance
to 6-methylpurine in micronucleus. They are sensitive to 6-methylpurine (6mp)
in
macronucleus. Mating type VII. The 6mp will be necessary for the subsequent
macronuclear transformation with rescue vector.
(2) B2086 Mps/Mps (mps, MT II) (mps is needed to allow assortment of
macronuclear in progeny). Wild type strain. Mating type II.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
47
[00188] Vector:
[00189] Plasmid containing the rDNAI( construct with paromomycin (Pmr)
selectable marker cassette plus appropriate flanking targeting sequences.
[00190] Mate:
[00191] CU428 x B2086 and Transform (biolistic) at crescent stage of
conjugation
3.5-4.5 hours after initial pairing (temperature dependent). Allow cells to
complete
conjugation. Parents are: Mpr/Mpr (mps, VII) ; Mps/Mps (mps, MT II)
[00192] Progeny:
(1) transformed [Mpr/Mps, rDNAwT/rDNAI( pmr (mpr, pmr)], and
(2) non-transformed [Mpr/Mps, rDNAwT/rDNAwT (mpr, pms)]. Select with
paromomycin to identify transformants. Replicate pmr clones into 6-mp and
select
with 6-methylpurine to eliminate vegetative transformants (not progeny). Save
pmr,
mpr clones. Serial transfer in absence of drugs at 2 temperatures. The
critical period
during which temperature affects mating type frequencies is during MAC
differentiation.
[00193] Another factor is early (before 9 hr) vs. late (¨ 24 hr) re-feeding
(after
mixing cells to start the cross at 35 C). Early re-feeding and high
temperature work in
tandem to increase mt IV, while the opposite conditions decrease it and
increase other mating
types.
[00194] Two conditions can be used [(1) re-feeding before 9 hours in a 35 C
cross,
and (2) re-feeding at 48 hrs in a 25 C cross] to mature clones to different
mating types and
phenotypically assort macronuclei to pms and mps. Test phenotypic assortment.
This
produces clones that are Mpr/Mps, rDNAwT/rDNApmr (mps, pms) in different
mating types.
[00195] Mate mature clones to "star" line lacking functional micronucleus and
isolate mating pairs (RdI pairs) and individual ex-conjugants for each pair.
This mating
creates 100% homozygous micronuclei in each mating pair and aborts prior to
the formation
of a new macronucleus. The resultant pairs will represent all 4 of the meiotic
products from
the parent micronucleus:
[00196] Mpr/Mpr, rDNAwT/rDNAwT (mps, pms)
[00197] Mps/Mps, rDNAwT/rDNAwT (mps, pms)
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
48
[00198] Mps/Mps, rDNAK pmr/rDNAKI3pmr (mps, pms )
[00199] Mpr/Mpr, rDNAKI3pmr/rDNAK pmr (mps, pms )
[00200] Grow exconjugants. Starve and mate exconjugants from each individual
pair (RdII mating) to bring micronuclei into expression. This mating can be a
test cross (e.g.
to a cycloheximide heterokaryon) to identify which exconjugants are homozygous
in their
MIC for Mpr and the rDNAK pmr. Mating strains that both carry the rDNAK will
be lethal.
[00201] Wait 24 hours for mating to be completed. Re-feed.
[00202] Replicate to paromomycin to select for KO construct in RdI
micronucleus
and from paromomycin to 6-methylpurine to identify those RdI micronuclei also
homozygous for Mpr. From the RdI clones identified as homozygous in the
micronucleus for
the rDNAK and Mpr by the phenotype of the RdII macronucleus, select the non-
star
exconjugate identified by mating type.
[00203] Save at least 2 different mating types.
Example 3 - Micronuclear Knockout Vector
[00204] There are several considerations that can be important for the design
of the
micronuclear rDNA knockout vector (see Figures 2,3, 4 and 5). These can
include, but are
not limited to: (1) CBS function at both 3' and 5' sites should not be
impaired because initial
micronuclear selection must be based on macronuclear expression, (2) the
replication fork
barrier (RFB) located near the start of the 5' NTS should be maintained in the
micronucleus
following knockout to prevent destabilization of micronuclear chromosome 1
(this is
important for future use of strain), (3) the 5' region of rDNA, which is
required for
palindrome replication, should be retained in the micronuclear KO vector
construct to permit
maintenance and selection in the new transformant macronucleus, (4) the 3'
rDNA sequence
in the micronuclear KO construct must be distal to the MCS site in the 3' NTS
to prevent
possibility of loss of the transgene by recombination during or after anlagen
development
(this is possible because there are about 1500 bp downstream of that site
which can be used
for targeting), and (5) the sites previously shown to give functional
palindrome formation and
lower copy number (300 copies on average) can be used to provide selection
against fewer
copies of the micronuclear version.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
49
[00205] As shown in Figure 4 and 5, the pD5H8 vector has an overall size of
about
13935 base pairs. The rDNA gene sequences are located between positions 200-
10683 in the
sequence as shown.
[00206] Deletion of these sequences can make the vector shorter and more
amenable for transformation. Another advantage of using this flanking region
is that the
shorter construct gives on average 370 copies of rDNA upon macronuclear
transformation
whereas constructs with a longer flanking region result in up to 10,000 copies
of the
construct. This reduction in copy number enables better selectability for a
resistance marker.
[00207] The micronuclear knockout cassette can be placed between positions
5742
and 12940 of pD5H8. Doing so (1) fulfills the requirements for processing and
palindrome
formation at the 5' end, (2) does not disturb the Replication Fork Barrier
(RFB) such that
micronuclear chromosome 1 stability is unaffected, (3) loss of the gene of
interest by
recombination with any remaining KO construct from the micronucleus is
prevented, (4) at
least 1500 bases are provided for targeting the transformation, (5) expression
of the
micronuclear version is enabled for selection purposes but the number of
micronucleus
derived palindromes made in the new macronucleus is minimized (300 or so from
studies of
macronuclear transformation with similar construct vs. 10,000), (6) increasing
the speed with
which the construct is lost in developing nuclei when selection is not present
minimizing the
expenditure of resources (by not causing the cell to make something that is
not needed for
cell survival.
[00208] Deletion of the 5' flank should proceed upstream beyond 1646 bp to
avoid
destabilizing micronuclear chromosome 1, since it has been shown that further
removal of
the upstream region causes fragmentation of the entire micronuclear chromosome
1 (Yakisch
and Kapler, 2006). However, the 5' flank could be extended downstream into the
17S if
desired. Limiting the 5' flanking region to between bases 1646 ¨ 2412 in the
rDNA bases
5742 ¨ 6458 in pD5H8 sequence) decreases the number of copies of the defective
micronuclear palindrome made during conjugation but still ensures that
sufficient copies are
produced to allow macronuclear expression of the selection cassette present in
the
micronuclear knockout cassette. Using the 1646 bp site makes for a slightly
shorter
transformation vector for micronuclear knockout. The region between 1646 and
8261 can be
deleted and still give sufficient palindrome formation and not affect the
stability of
micronuclear chromosome 1 (Blomberg et at. (1997)).
CA 02755978 2011 09 19
WO 2010/108183
PCT/US2010/028168
[00209] As described herein, extending the length of the 3' retained region is
an
option but will give higher copy number of the mic version following
conjugation.
Example 4: Generation of micronuclear rDNA knockout
[00210] Parent strains:
CU428 Mpr/Mpr (mps, VII)
Homozygous for mutation conferring resistance to 6-methylpurine in
micronucleus. Sensitive to 6-methylpurine (6mp) in macronucleus. Mating
type VII. The 6mp will be necessary for the subsequent mac transformation
with rescue vector.
B2086 Mps/Mps (mps, MT II)
Wild type strain. Mating type II.
[00211] Vector:
Plasmid containing either the CBS KO construct or the rDNA KO construct with
paromomycin (Pmr) selectable marker cassette plus appropriate flanking
targeting
sequences.
[00212] Mate: CU428 x B2086
[00213] Transform (biolistic) at crescent stage of conjugation 3.5-4.5
hours after
initial pairing (temperature dependent).
[00214] Allow cells to complete conjugation.
Parents: Mpr/Mpr (mps, VII) ; Mps/Mps (mps, MT II)
Progeny: transformed Mpr/Mps, rDNA/KOpmr (mpr, pmr)
non-transformed: Mpr/Mps, rDNA/rDNA (mpr, pms)
[00215] Select with paromomycin to identify transformants. Carry out all
initial
treatments at different temperatures to generate different mating types.
[00216] Replicate pmr clones into 6-mp and select with 6-methylpurine to
eliminate vegetative transformants (not progeny).
[00217] Save pmr, mpr clones. Serial transfer in absence of drugs at different
temperatures to mature clones and to phenotypically assort macs to pms and
mps. This
produces clones that are Mpr/Mps, rDNA/KOpmr (mps, pms) in different mating
types.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
51
[00218] Mate mature clones to "star" line lacking functional micronucleus and
isolate mating pairs (RdI pairs) and individual ex-conjugants for each pair.
This mating
creates 100% homozygous micronuclei in each mating pair and aborts prior to
the formation
of a new mac. The resultant pairs will represent all 4 of the meiotic products
from the parent
mic. The 25% of the clones shown in red are the desired genotype and
phenotype. These
clones can be identified by doing a second round of mating (RdII - essentially
a self mating)
and isolating individual RdII pairs form each RdI clone. Homozygous KO lines
will not
produce viable RdII progeny. Mpr phenotype can be determined by outcrossed to
a diploid
wild type strain (outcross to a diploid will produce viable progeny), and
testing for
methylpurine resistance.
Mpr/Mpr, rDNA/rDNA (mps, pms )
Mps/Mps, rDNA/rDNA (mps, pms )
Mps/Mps, KOpmr/ KOpmr (mps, pms )
Mpr/Mpr, KOpmr/ KOpmr (mps, pms )
Example 5: rDNA KO Tetrahymena Spp. Strains
[00219] Materials. Tetrahymena cells will be cultured in NEFF medium (0.25%
proteose peptone, 0.25% yeast extract, 0.55% glucose, 33 mM FeCl3)
supplemented, when
required, with paromomycin at a final concentration of 100 mg/ml. All medium
components
can be acquired from VWR. Restriction enzymes used in cloning and Phusion
polymerase for
PCR can be purchased from New England Biolabs. Electrocompetent Escherichia
coli Top
can be purchased from Invitrogen. For Biolistic transformations DNAdelTM 5550d
gold
carrier particle suspension can be purchased from Seashell Technology and
filter paper from
Whatman.
[00220] Methods: Construction of an rDNA knockout (KO) vector. To create the
backbone of the rDNA KO vector, forward (5'-
TTAGGTACCACCAAACCAAAAGACCTAA) (SEQ ID NO: 4) and reverse (5'-
TTAGGTACCTATTTTCACTAAGTCTAATTTAATTTAG) (SEQ ID NO: 5) primers will
be used to amplify all of rDNA vector pD5H8 except that portion which contains
the 17s,
5.8s and 26s rDNA sequences but while maintaining the chromosomal breakage
sites (CBS)
and the ability to form a functional palindrome (Figure 6). Both primers will
contain KpnI
sites that are incorporated into both ends of the amplified product. The 5,924
bp product will
be digested with KpnI, gel purified away from the rDNA portion of the vector
and
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
52
dephosphorylated. Amplification of the neomycin resistance gene cassette will
be performed
using forward (5'- TTAGGTACCATCTTCAAAGTATGGATTAATTATTTC) (SEQ ID
NO: 6) and reverse (5'- TTAGGTACCCTGCATTTTTCCAGTAAAAAT) (SEQ ID NO: 7)
primers using vector pTIEV4 as template. Amplification of the neomycin
resistance cassette
will result in a 1,477 bp DNA fragment with KpnI restriction sites at both the
5' and 3' ends.
This product will be gel purified then digested with KpnI. The neomycin
resistance cassette
insert will be ligated into the digested backbone and the ligation will be
transformed into Top
E.coli. Ampicillin resistant colonies will be screened by colony PCR using
forward
primer (5'-ATGAAGCAGACTCGCTTAAAAATG) (SEQ ID NO: 8) and reverse primer
(5'-ATTTTTGCATCAATTTCCACTTA) (SEQ ID NO: 9). Plasmid DNA will be purified
from colonies that show amplification of a 1,830 bp product. Plasmid DNA will
then be sent
for complete sequencing using a set of primers designed to anneal about every
500 base pairs
to ensure there were no additional mutations and confirm construction of the
rDNA knockout
vector (Figure 7).
[00221] Generation of an rDNA KO Tetrahymena strain. Germ line biolistic
transformation of conjugating Tetrahymena thermophila cells will be performed
in the
following way; B2086 and CU428 T. thermophila strains will be grown in
modified NEFF
medium (0.25% proteose peptone, 0.25% yeast extract, 0.55% glucose, 33 mM
FeCl3) at
30 C. One hundred ml of each logarithmically growing culture will be
centrifuged at 1,100 x
g for 2 minutes in oil centrifuge tubes, washed in 10 mM Tris pH 7.4 and
resuspended in
fresh 10 mM Tris pH 7.4 (starvation medium) at a concentration of 200,000 ¨
250,000
cells/ml. Cells will be incubated for 9-18 hours at 30 C. After starvation,
B2086 and CU428
cell cultures will be counted and cell concentration will be readjusted to
200,000 cells/ml. To
induce conjugation, 100 ml of each strain will be mixed together in a 4 L
flask and incubated
for 30 minutes at 30 C. An on/off shaking method will be used to ensure
synchronous pairing
in the following way; after a 30 minute stationary incubation, the cells in
the flask will be
subjected to shaking (100 rpm) for 30 minutes. The shaker will be stopped for
15 minutes and
then turned back on again for 15 minutes. The last time the shaker is stopped
will be counted
as the start of mating (0 hours post-mixing), since cell pairing is inhibited
by shaking.
[00222] Four transformations will be performed at 2.5, 3, 3.5 and 4 hours post-
mixing using Biolistic PDS-1000/He Particle Delivery System (BIO-RAD). For
each
transformation, 30 ill of DNAdelTM 5550d gold carrier particle suspension
(Seashell
Technology) will be coated with 4 ilg of linearized rDNA KO construct
according to the
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
53
manufacturer's instructions. 50 ml of conjugating cells are concentrated to ¨1
ml by
centrifugation at 1,100 x g in oil centrifuge tubes for 2 minutes. Cells will
be spread on a
round 90 mm hardened paper filter (Whatman, Cat. # 1450-090) pre-wet with 1.5
ml 10 mM
Tris pH 7.4 inside a Petri dish. After the bombardment, the filter with the
cells will be
transferred into a 500 ml flask containing 50 ml 10 mM Tris pH 7.4. The flasks
will be
incubated overnight on a slow shaker at 30 C. At 18 hours post-mixing, 25 ml 3
x NEFF
medium will be added to the 50 ml of cell culture. At 28 hours post-mixing, 75
p1100 mg/ml
paromomycin will be added (final paromomycin concentration, 100 lg/m1). Cells
will be
aliquoted into 96 well microplates (150 ill per well). After 3-4 days, the
microplates will be
examined and 5 ill from each of the wells containing paromomycin-resistant
cells will be
transferred into 150 ill NEFF medium containing 15 lg/m1 6-methylpurine
(Sigma) on a 96
well microplate. At least one well containing the cells resistant to both
paromomycin and 6-
methylpurine will be identified. Twelve single cells will be isolated from
this well into 12
small drops of NEFF medium on a Petri dish. After the cells divide and form
colonies in the
drops, 12 single cell colonies will be transferred onto a 96 well microplate
containing NEFF
medium. These single cell clones will be grown in NEFF medium for 10 days (1
ill of the
cells was transferred into 150 ill of NEFF medium every day). After the cells
become
sexually mature (-60 cell fissions), they will be starved in 10 mM Tris pH 7.4
and mixed in
different combinations to select 2 strains of different mating types.
Approximately 100 single
cells will be isolated from each of the two strains of different mating types
into drops of
NEFF medium. 2 days later, the cells will be transferred to a NEFF medium on a
96 well
microplate and then replica plated to NEFF medium containing 100
ilg/m1paromomycin.
Single cell clones of two different mating types that assort to paromomycin-
sensitive
phenotype will be tested for Mendelian segregation: cells will be starved and
mated with
starved CU427 cells, which are homozygous for a cycloheximide resistance
marker.
Approximately 100 single pairs from this mating will be isolated at 10 hours
post-mixing into
drops of NEFF media. After the conjugation is completed and the progeny have
given rise to
cell colonies, the cells will be transferred into NEFF media containing 15
lg/m1
cycloheximide on a 96 well microplate and, a day later, they will be replica
plated from the
cycloheximide to paromomycin (100 jig/ml in NEFF). The number of paromomycin-
resistant colonies will be about half of that of cycloheximide-resistant
colonies, which will
confirm that the rDNA KO strains obtained are indeed germ line transformants.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
54
[00223] Round I genomic exclusion will be performed to make homozygous rDNA
knock-out heterokaryons. Each of the two heterozygous rDNA KO strains of
different mating
types will be starved and mated to "star" strain B*VI. Approximately 50 single
pairs will be
isolated from each mating at 5 hours post-mixing into NEFF medium drops. When
some of
the pairs separate (¨ 10 hours post-mixing), the two cells from each separated
pair will be
isolated into two different drops. The Petri dishes with the NEFF medium drops
will be
incubated for two days to allow Round I products to divide several times. The
single cell
colonies will be then transferred into microtiter plates containing NEFF
medium. To
distinguish between the "star" and "non-star" sides of each pair of Round I
exconjugants, the
cells will be replica plated to NEFF medium containing 15 ng/ml 6-
methylpurine. The 6-
methylpurine resistant cells will be marked as "non-star" sides, since they
will be derived
from the germ line transformants and not from the B*VI strain. The "non-star"
Round I
exconjugants homozygous for rDNA knock-out in the micronucleus will be
identified by
mating to CU427 as described above in the Mendelian segregation test. One
hundred percent
of the cycloheximide-resistant progeny from the CU427 mating will be
paromomycin-
resistant if the Round I exconjugants were homozygous for rDNA knock-out. The
"non-star"
exconjugants of Round I mating that meet this requirement will be identified
as homozygous
rDNA knock-out heterokaryons.
[00224] Results. To confirm that pD5H8 vector, which contains genes encoding
for ribosomal RNA, can be utilized to introduce rDNA into the progeny of the
homozygous
rDNA knock-outs, it will be transformed into developing new macronuclei of the
conjugating
homozygous rDNA knock-outs. One hundred ml of each of the two homozygous rDNA
knock-outs of different mating types will be grown, starved and mated as
described above.
Four biolistic transformations will be performed as described above between
9.5 and 10.5
hours post-mixing. For each transformation, 30 ill of DNAdelTM S550d gold
carrier particle
suspension are coated with 4 ng of pD5H8 vector according to manufacturer's
instructions.
After the bombardment, the filter with the cells will be transferred into a
500 ml flask
containing 50 ml NEFF. The flasks are incubated on a slow shaker for ¨20 hours
at 30 C. At
¨30 hours post-mixing, 25 ml NEFF medium containing 300 ng/ml paromomycin will
be
added to the 50 ml of cell culture (final paromomycin concentration, 100
ng/m1). Cells will
be aliquoted into 96 well microplates (150 n1 per well). After 3-4 days, the
microplates will
be examined to identify paromomycin-resistant cells confirming complementation
of the null
rDNA alleles in the homozygous knockout strain with the pD5H8 derived rDNA
genes.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
Example 6: Creation of the paromomycin-sensitive rDNA vector pTRAS
[00225] Materials. Tetrahymena cells were cultured in NEFF medium (0.25%
proteose peptone, 0.25% yeast extract, 0.55% glucose, 33 mM FeCl3)
supplemented, when
required, with paromomycin at a final concentration of 100 mg/ml. All medium
components
were acquired from VWR. Restriction enzymes used in cloning and Phusion
polymerase for
PCR were purchased from New England Biolabs. Electrocompetent Escherichia coli
Top 10
were purchased from Invitrogen. For Biolistic transformations DNAdelTM S550d
gold carrier
particle suspension was purchased from Seashell Technology and filter paper
from Whatman.
[00226] Methods. Construction of an rDNA vector containing a wild-type 17S
rDNA gene: pTRAS. The reversion of the rDNA vector pD5H8 from the mutant
paromomycin resistant form to the wild-type paromomycin sensitive form (17S
rDNA;
A4490G) was performed by site-directed mutagenesis with overlap extension
(S0Eing) PCR.
Amplification of the 410bp upstream segment was performed using pD5H8 plasmid
as
template DNA with the primer pair TR-WTF1 (5'-TTCCGTTAACGAACGAGACCT) (SEQ
ID NO: 10) and TR-WTR2 (5'-
AGATACCTTGTTACGACTTCTTGTTGTTCCAAATGGTAG) (SEQ ID NO: 11). Primer
TR-WTR2 incorporates the A to G reversion and the PCR product contains an
endogenous
upstream SpeI restriction site. Amplification of the 1173bp downstream segment
was
performed from pD5H8 plasmid DNA with the TR-WTF2 (5'-
CTACCATTTGGAACAACAAGAAGTCGTAACAAGGTATCT) and TR-WTR1 (5'-
GACTCCTTCAATCTGAACCCA) primer pair. TR-WTR2 also incorporates the A to G
reversion and the PCR product contains an endogenous downstream BseRI site.
These two
amplification products were then used as the template in a SOEing PCR with TR-
WTF1 and
TR-WTR1 resulting in a 1496bp product. This amplified product was digested
using SpeI
and BseRI restriction enzymes and gel purified resulting in a 1065bp DNA
fragment that
contains the A to G reversion. pD5H8 plasmid was also digested with SpeI and
BseRI and
the 12,870 bp piece gel purified. These two DNA fragments were ligated
together and
transformed into E. coli. Plasmids were purified from multiple colonies and
sequencing was
used to confirm the A to G reversion and ensure no additional mutations had
occurred (Fig
7). The final construct was named pTRAS (Tetragenetics rDNA Antibiotic
Sensitive) and is
shown in Figure 8.
[00227] Construction of a pTRAS vector containing a neomycin resistance gene
marker. To confirm the ability of the new pTRAS vector to restore paromomycin
resistance
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
56
using a transgene cassette, an expression cassette containing a neomycin
resistance marker
gene was cloned into the pTRAS vector. The source of the neomycin resistance
marker gene
was from the somatic integration vector pTIEV4 (Figure 9). This vector is
routinely used to
create expression cassettes that place transgenes under the control of the
powerful
Tetrahymena MTT5 inducible promoter and that are subcloned into an rDNA vector
(e.g.
pD5H8) for introduction and high-level expression in Tetrahymena. A pTIEV4
derived NotI
fragment (4307 bp) consisting of the MTT5 promoter, transgene, MTT1
terminator,
neomycin resistance marker gene and the MTT5 terminator sequence was ligated
into the
NotI restriction site of either pTRAS or pD5H8. NotI is a unique restriction
site in both
pD5H8 and pTRAS. For the purposes of this experiment the transgene
incorporated into the
expression cassette was a previously cloned Tetrahymena codon optimized gene
encoding the
human G-protein coupled receptor, CCR5. The use of this transgene was
arbitrary and was
only used for the purposes of this example. This ligation was transformed into
E.coli and
individual colonies were screened for the presence of insert by colony PCR
using forward
(5'-CTTGAATACAATCATGAGTTCACC) (SEQ ID NO: 12) and reverse (5'-
GCAATTATGAATTACAACATCAACA) (SEQ ID NO: 13) primers. Plasmids were then
purified from colonies that amplified the appropriate 1350bp product.
Additionally these
plasmids were digested with NotI to excise the transgene insert and confirm
its presence.
[00228] Transformation of Tetrahymena cells with pD5H8, pTRAS and pTRAS +
neomycin resistance gene marker. To prepare DNA for biolistic transformation
into
conjugating Tetrahymena strains, Escherichia coli Top 10 strains carrying
plasmids pTRAS,
pD5H8 and pTRAS + neomycin resistance gene marker were cultured in 25m1Luria-
Bertani
(LB) broth supplemented with ampicillin (100 g/ml). Plasmids were prepared
using the
HiSpeed Plasmid Midi Kit (Qiagen Cat No. 12643) according to manufacturer's
instructions
then concentrated to 1.5-2 g/ 1 by ethanol precipitation. B2086 and CU428 T.
therm ophila
strains were grown in modified NEFF medium (0.25% proteose peptone, 0.25%
yeast extract,
0.55% glucose, 33 mM FeCl3) at 30 C. One hundred ml of each logarithmically
growing
culture was centrifuged at 1,100 x g for 2 minutes in oil centrifuge tubes,
washed in 10 mM
Tris pH 7.4 and resuspended in fresh 10 mM Tris pH 7.4 (starvation medium) at
a
concentration of 200,000 ¨250,000 cells/ml. Cells were incubated for 9-18
hours at 30 C.
After starvation, B2086 and CU428 cell cultures were counted and cell
concentration was
readjusted to 200,000 cells/ml. To induce conjugation, 100 ml of each strain
were mixed
together in a 4 L flask. Four transformations were performed between 9.5 and
10.5 hours
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
57
post-mixing using a Biolistic PDS-1000/He Particle Delivery System (BIO-RAD).
For each
transformation, 20 ill of DNAdelTM 5550d gold carrier particle suspension were
coated with
4 ug of DNA construct according to manufacturer's instructions. Fifty ml of
conjugating cells
were concentrated to ¨1 ml by centrifugation at 1,100 x g in oil centrifuge
tubes for 2
minutes. Cells were spread on a round 90 mm hardened paper filter (Whatman)
pre-wet with
1.5 ml 10 mM Tris pH 7.4 inside a Petri dish. After the bombardment, the
filter with the cells
was transferred into a 500 ml flask containing 50 ml NEFF medium. The flasks
were
incubated on a slow shaker for ¨20 hours at 30 C. At 30 hours post-mixing, 25
ml NEFF
medium containing 300 ug/m1paromomycin was added to the 50 ml of cell culture
(final
paromomycin concentration, 100 ug/m1). Cells were aliquoted into 96 well
microplates (150
ill per well). After 3-4 days, the microplates were examined and 5 ill from
each of the wells
containing paromomycin-resistant cells were transferred into 150 ul NEFF
medium
containing 100 ug/m1paromomycin on a master 96 well microplate.
[00229] Results. To verify the paromomycin sensitivity of the pTRAS vector it
was biolistically transformed into conjugating Tetrahymena cells. As controls,
pD5H8 and
pTRAS + neomycin resistance gene marker were transformed into the same batch
of
conjugating cells. Since pD5H8 has the 17S rDNA gene point mutation A4490G, it
should
survive biolistic transformation followed by selection with paromomycin.
However, pTRAS
should not survive the neomycin selection because the A4490G mutation has been
reverted
back to the wild-type gene rendering strains carrying this plasmid paromomycin
sensitive.
Lastly, the insertion of an expression cassette containing a neomycin
resistance marker gene
should restore neomycin resistance to the pTRAS vector and transformants
should be
recovered with paromomycin selection after biolistic transformation. Biolistic
transformations were performed in triplicate and the results are summarized in
Table 1. In
each case, cells transformed with pD5H8 led to the recovery of paromomycin
resistance
clones. However, paromomycin resistant clones were never recovered when cells
were
transformed with pTRAS unless pTRAS additionally contained the neomycin
resistance gene
marker.
Table 1. Generation of paromomycin resistant clones following transformation
of
Tetrahymena cells with pD5H8, pTRAS and pTRAS + neomycin resistance gene
marker
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
58
pTRAS + Neomycin
Transformation pD5H8 pTRAS resistance gene marker
1 + 0 +
2 + 0 +
3 + 0 +
Generation of paromomycin resistant clones following transformation of
Tetrahymena cells
with pD5H8, pTRAS and pTRAS + Neomycin resistance gene marker. Transformations
were
carried out three times. A + symbol denotes the recovery of paromomycin
resistant colonies
whereas 0 indicates the absence of paromomycicn resistant clones following
transformation.
References
1. Pan, W.C., Orias, E., Flacks, M., and Blackburn, E.H. (1982). Allele-
specific, selective
amplification of a ribosomal RNA gene in Tetrahymena thermophila. Cell 3, 595-
604.
2. Orias, E., Larson, D., Hu, Y.F., Yu, G.L., Karttunen, J., Lovlie, A.,
Haller, B., and
Blackburn, E.H. (1988). Replacement of the macronuclear ribosomal RNA genes of
a mutant
Tetrahymena using electroporation. Gene 2, 295-301.
3. Yu, G.L., and Blackburn, E.H. (1989). Transformation of Tetrahymena
thermophila with a
mutated circular ribosomal DNA plasmid vector. Proc. Natl. Acad. Sci. U. S. A.
21, 8487-
8491.
4. Yu, G.L., Hasson, M., and Blackburn, E.H. (1988). Circular ribosomal DNA
plasmids
transform Tetrahymena thermophila by homologous recombination with endogenous
macronuclear ribosomal DNA. Proc. Natl. Acad. Sci. U. S. A. 14, 5151-5155.
5. Spangler, E.A., and Blackburn, E.H. (1985). The nucleotide sequence of the
17S ribosomal
RNA gene of Tetrahymena thermophila and the identification of point mutations
resulting in
resistance to the antibiotics paromomycin and hygromycin. J. Biol. Chem. 10,
6334-6340.
6. Bruns, P.J., Katzen, A.L., Martin, L., and Blackburn, E.H. (1985). A drug-
resistant
mutation in the ribosomal DNA of Tetrahymena. Proc. Natl. Acad. Sci. U. S. A.
9, 2844-286.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
59
7. Blomberg, P., Randolph, C., Yao, C.H., and Yao, M.C. (1997). Regulatory
sequences for
the amplification and replication of the ribosomal DNA minichromosome in
Tetrahymena
thermophila. Mol. Cell. Biol. 12, 7237- 747.
8. Bruns, P. J., and D. Cassidy-Hanley, 2000. Biolistic Transformation of
Macro and
Micronuclei, in Methods in Cell Biology: Tetrahymena thermophila , eds. D.
Asai and J.
Forney, Acdemic Press (San Diego).
9. Cassidy-Hanley D. M., Bowen J., Lee J.H., Cole E., VerPlank L.A., Gaertig
J., Gorovsky
M.A., and Bruns P.J. (1997) Germline and somatic transformation of mating
Tetrahymena
thermophila by particle bombardment. Genetics 146(1), 135-147.
10. Karrer KM and Gall JG (1976) The Macronuclear Ribosomal DNA of Tetrahymena
pyriformis is a Palindrome. J Mol Biol, 140, 421-453.
11. King BO and Yao M-C (1982) Tandemly Repeated Hexanucleotide at Tetrahymena
rDNA Free End is Generated from a Single Copy during Development. Cell 31, 177-
182.
12. Yao M-C, Yao C-H and Monks B (1990) The Controlling sequence for Site-
Specific
Chromosome Breakage in Tetrahymeno. Cell 63, 763-772.
13. Macalpine DM, Zhang Z and Kapler GM. (1997) Type I elements mediate
replication
fork pausing at conserved upstream sites In the Tetrahymena thermophila
ribosomal DNA
minichromosome. Mol. Cell Biol. 17, 4517-4525
14. Pan WJ, Gallagher RC and Blackburn EH. (1995) Replication of an rrna gene
origin
plasmid in the Tetrahymena thermophila Macronucleus is prevented by
transcription through
the origin from an RNA polymerase I promoter. Mol. Cell Biol. 15, 3372-3381
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
15. Larson DD, Blackburn EH, Yaeger PC, and Orias E (1986) Control of rdna
replication in
tetrahymena involves a as-acting upstream repeat of a promoter element. Cell
47, 229-240.
16. Yaeger PC, Orias E, Shaiu WL, Larson DD and Blackburn EH (1989) The
replication
advantage of a free linear rdna gene is 1¨estored by somatic recombination in
tetrahymena
thermophila Mol. Cell Biol. 9, 452-460.
17. Gaertig J, Gu L, Hai B and Gorovsky MA (1994) High frequency vector-
mediated
transformation and gene replacement in Tetrahymena. Nucleic Acids Res. 11,
5391-5398.
18. Turkewitz AP, Orias E and Kapler G (2002) Functional genomics: the coming
of age for
Tetrahymena thermophila. Trends Genet. 18, 35-40.
19. Frankel, J. (2000). Cell biology of Tetrahymena thermophila. Methods Cell
Biol. 27-125.
20. Hellenbroich D, Valley U, Ryll T, Wagner R, Tekkanat N, Kessler W, Ross A
and
Deckwer WD (1999) Cultivation of Tetrahymena thermophila in a 1.5-m3 airlift
bioreactor.
Appl. Microbiol. Biotechnol. 51, 447-455.
22. de Coninck, J., Bouquelet, S., Dumortier, V., Duyme, F., and Verdier-
Denantes, I. (2000).
Inducstrial media and fermentation processes for improved growth and protease
production
by Tetrahymena thermophila Bill. J. Industr. Microbiol. Biotech. 4, 285.
23. Skriver L and Williams NE (1980) Regeneration of cilia in starved
Tetrahymena
thermophila involves induced synthesis of ciliary polypeptides but not
synthesis of membrane
lipids. Biochem. J. 188, 695-704.
24. Taniguchi, T., Mizuochi, T., Banno, Y., Nozawa, Y., and Kobata, A. (1985).
Carbohydrates of lysosomal enzymes secreted by Tetrahymena pyriformis. J.
Biol. Chem. 26,
13941-13946.
25. Weide, T., Herrmann, L., Bockau, U., Niebur, N., Aldag, I., Laroy, W.,
Contreras, R.,
Tiedtke, A., and Hartmann, M.W. (2006). Secretion of functional human enzymes
by
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
61
Tetrahymena thermophila. BMC Biotechnol. 19.
26. Yao MC, Zheng K and Yao CH (1987) A conserved nucleotide sequence at the
sites of
developmentally regulated chromosomal breakage in Tetrahymena. Cell. 48, 779-
788.
27. Yu GL and Blackburn EH (1991) Developmentally programmed healing of
chromosomes
by telomerase in Tetrahymena. Cell. 67, 823-832.
28. Tondravi MM and Yao MC (1986) Transformation of Tetrahymena thermophila by
microinjection of ribosomal RNA genes. Proc. Natl. Acad. Sci. USA. 83, 4369-
4373.
29. Wuitschick JD and Karrer KM (1999) Analysis of genomic G + C content,
codon usage,
initiator codon context and translation termination sites in Tetrahymena
thermophila.
Eukaryot. Microbiol. 46, 239-247.
30. Gaertig J and Gorovsky MA (1992) Efficient mass transformation of
Tetrahymena
thermophila by electroporation of conjugants. Proc. Natl. Acad. Sci. USA. 89,
9196-9200.
31. Sweeney R, Yao CH, and Yao MC (1991) A Mutation in the Large Subunit
Ribosomal
RNA Gene of Tetrahymena Confers Anisomycin Resistance and Cold
Sensitivity.Tetrahymena thermophila mutants defective in the developmentally
programmed
maturation and maintenance of the rDNA minichromosome. Genetics. 1991
Feb;127(2):327-
334
32. Kapler GM, Orias E, Blackburn EH. A weak germ-line excision mutation
blocks
developmentally controlled amplification of the rDNA minichromosome of
Tetrahymena
thermophila. Kapler GM, Blackburn EH. Genes Dev. 1994 Jan;8(1):84-95.b
33. R. S. Coyne and M. C. Yao. Evolutionary Conservation of Sequences
Directing
Chromosome Breakage and Rdna Palindrome Formation in Tetrahymenine Ciliates.
Genetics. 1996 December; 144(4): 1479-1487.
CA 02755978 2011 09 19
WO 2010/108183 PCT/US2010/028168
62
34. Kapler GM, Blackburn EH. 1994 A weak germ-line excision mutation blocks
developmentally controlled amplification of the rDNA mini-chromosome of
Tetrahymena
thermophila. Genes Dev. 8:84-95.
35. Yakisich JS, and Kapler GM. Deletion of the Tetrahymena thermophila rDNA
replication
fork barrier region disrupts macronuclear rDNA excision and creates a fragile
site in the
micronuclear genome. Nucleic Acids Res. 2006 Jan 30;34(2):620-34.
