Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02773059 2012-03-26
BEAD EMULSION NUCLEIC ACID AMPLIFICATION
15 HELD OF THE INVENTION
The present invention relates to methods for amplifying nucleic acid templates
from
low copy number to quantities amenable for sequencing on a solid support such
as a bead.
The present invention is also directed to zero bead removal ¨ a method of
enriching for *solid
support containing amplified nucleic acids is also disclosed.
BACKGROUND
The ability to amplify a plurality of nucleic acid sequences, such as .a
genomic library
or a cDNA library, is critical given the inefficiency of current methods of
sequencing.
Current sequencing technologies require millions of copies of nucleic acid per
sequencing
reaction. Furthermore, the sequencing of a human genome would require about
tens of
millions of different sequencing reactions. If the starting material is
limited, amplification of
the initial DNA is necessary before genomic sequencing. The starting material
may be
limited, for example, if the genome to be sequenced is from a trace quantity
of pathogen or
from a prenatal patient. Current techniques for in vitro genome amplification
involve
laborious cloning and culturing protocols that have limited the utility of
genomic sequencing.
Other teclaniquds, such as PCR, while fast and reliable, are unable to amplify
a genome in a
representative fashion.
1
CA 02773059 2012-03-26
While random primed PCR can be easily engineered to amplify a plurality of
nucleic
acids in one reaction, this method is not preferred because the amplified
library is not
representative of the starting library. That is, in a random PCR environment,
some DNA
sequences are preferentially amplified at the expense of other sequences such
that the
amplified product does not represent the starting material. This problem with
PCR may be
overcome if each individual member of a library is amplified in a separate
reaction.
However, this approach may be impractical if many thousands of separate
reaction tubes are
required for the amplification process, as a genomic library or cDNA library
may include
more than 100,000 fragments. Individual amplification of each fragment of
these libraries in
separate reaction is not practical.
SUMMARY OF '111E INVENTION
The present invention provides for a method of amplifying a plurality of
nucleic acids
(e.g., each sequence of a DNA library, transcriptome, or genome) in a rapid
and economical
manner in a single reaction tube. One use of the method of the invention is to
perform
simultaneous clonal amplification (e.g., by PCR) of a plurality of samples (as
many as several
hundred thousand) in one reaction vessel. This invention further provides
means for
encapsulating a plurality of DNA samples individually in a microcapsule of an
emulsion (i.e.,
a microreactor), performing amplification of the plurality of encapsulated
nucleic acid
samples simultaneously, and releasing said amplified plurality of DNA from the
microcapsule,s for subsequent reactions.
In one embodiment, single copies of the nucleic acid template species are
hybridized
to capture beads comprising, e.g., capture oligonucleotides or chemical groups
that bind to
the nucleic acid template. The beads are suspended in complete amplification
solution (see
Example 2 for an example of an amplification solution) and emulsified to
produce
microreactors (typically 100 to 200 microns in diameter). After this,
amplification (e.g.,
PCR) is used to clonally increase copy number of the initial template species
in the
microreactors, and these copies bind to the capture beads in the
microreactors.
In an alternate embodiment, capture beads are added to an amplification
reaction
mixture (e.g., an amplification solution from Example 2) comprising nucleic
acid template
and this mixture is emulsified to produce microreactors. Amplification (e.g.,
PCR) is used to
2
CA 02773059 2012-03-26
clonally increase copy number of the initial template species in the
microreactors, and these
copies bind to the capture beads in the microreactors.
One advantage of the present invention is that the microreactors allow the
simultaneous clonal and discrete amplification of many different templates
without cross
contamination of the amplified products or reagents, or domination of one
particular template
or set of templates (e.g., PCR bias). The amplification reaction, for example,
may be
performed simultaneously with at least 3,000 microreactors per microliter of
reaction mix.
Preferably, each microreactor comprises one or fewer species of amplified
template.
In various embodiments of the invention, the microreactors have an average
size of
about 10 i_int to about 250 gm. In a preferred embodiment, the microreactors
have an average
diameter of about 60 to about 200 m. In a more preferred embodiment, the
microreactors
have an average diameter of about 60 gm, such as an average of 40 pm to 80 m
in diameter.
In an embodiment, the microreactors have an average diameter of about 60 gm.
In another
preferred embodiment, the microreactors have an average volume of about 113
pl. In a most
preferred embodiment, about 3000 microreactors are contained within a
microliter of a 1:2
water to oil emulsion.
The present invention also provides for a method for producing a plurality of
nucleic
acid template-carrying beads wherein each bead comprises up to and more than
1,000,000
copies of a single nucleic acid sequence. In one preferred embodiment, each
bead may
comprise over 20 million copies of a single nucleic acid.
The present invention further provides for a library made by the methods of
the
invention. The library may be made by using, e.g., a genomic DNA library, a
cDNA library,
or a plasmid library as the starting material for amplification. The library
may be derived
from any population of nucleic acids, e.g., biological or synthetic in origin.
The present invention also provides for a method of enriching for those beads
that
contains the product of successful DNA amplification (i.e., by removing beads
that have no
DNA attached thereto).
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 Schematic of the structure of a DNA capture bead.
Figures 2A-2B Schematic
of one embodiment of a bead emulsion amplification
process.
- 3
CA 02773059 2012-03-26
Figure 3 Schematic
of an enrichment process to remove beads that do not have
any DNA attached thereto.
Figure 4 Depiction
of jig used to hold tubes on the stir plate below vertical
syringe pump. The jig was modified to hold three sets of bead emulsion
amplification
reaction mixtures. The syringe was loaded with the PCR reaction mixture and
beads.
Figure 5 Depiction
of optimal placement of syringes in vertical syringe pump
and orientation of emulsion tubes below syringe outlets.
Figure 6 Depiction
of optimal placement of syringe pump pusher block against
syringe plungers, and optimal orientation of jig on the stir plate. Using this
arrangement, the
syringe contents were expelled into the agitated emulsion oil.
Figure 7 Depict-
ion of beads (see arrows) suspended in individual microreactors
according to the methods of the invention.
Figures 8A-8C Schematic
showing the initial stages of bead emulsion
amplification used in conjunction with double ended sequencing. The NHS-
activated bead
(Figure 8A) is attached with capture primers (Figure 8B), and encapsulated in
a microreactor
comprising the DNA capture bead and template (Figure 8C).
Figure 9 Schematic
showing the amplification and capture stages of bead
emulsion amplification used in conjunction with double ended sequencing. The
template is
amplified by solution phase PCR and the amplification products are attached to
the DNA
capture bead.
Figure 10 Schematic
showing the later stages of bead emulsion amplification
used in conjunction with double ended sequencing. The emulsion is broken down
(Figures
10A-10B), the second strand of the amplification product is removed and
enrichment is used
to maximize the number of beads bound with amplification product (Figure 10C),
the
sequencing primers are annealed (Figure 10D), and the first strand is
sequenced (Figure 10E),
followed by the second strand.
DETAILED DESCRIPTION OF INVENTION
Brief Overview Of Bead Emulsion Amplification
A brief overview of one embodiment of the invention is discussed below. A more
detailed description of each individual step of this embodiment will follow.
In this
embodiment, PCR is the chosen amplification technique.
4
CA 02773059 2012-03-26
In one aspect of the invention, bead emulsion amplification is performed by
attaching
a template (e.g., DNA template) to be amplified to a solid support, preferably
in the form of a
generally spherical bead. The bead is linked to a large number of a single
primer species
(i.e., primer B in Figure 2) that is complementary to a region of the template
DNA and the
amplification copies of this template. Alternately, the bead is linked to
chemical groups (e.g.,
biotin) that can bind to chemical groups (e.g., streptavidin) included on the
template DNA
and amplification copies of this template. . The beads are suspended in
aqueous reaction
mixture and then encapsulated in a water-in-oil emulsion. In different aspects
of the
invention, the template DNA is bound to the bead prior to emulsification, or
the template
DNA is included in solution in the amplification reaction mixture. In a
preferred
embodiment, an amplification step is performed prior to distribution of the
nucleic acid
templates onto a multiwell (e.g., picotiter) plate.
In certain embodiments, the emulsion is composed of discrete aqueous phase
microdroplets, e.g., averaging approximately 60 to 200 pm in diameter,
enclosed by a
thermostable oil phase. Each microdroplet contains, preferably, amplification
reaction
solution (i.e., the reagents necessary for nucleic acid amplification). An
example of an
amplification reaction solution would be a PCR reaction mixture (polymerase,
salts, dNTPs;
see Example 2 for an example of one embodiment) and a pair of PCR primers
(primer A and
primer B). See, Figure 2A. In some cases, the template DNA is included in the
reaction
mixture. A subset of the microdroplet population includes the DNA bead and the
template.
This subset of microdroplet is the basis for the amplification. The remaining
microcapsules
do not contain template DNA and will not participate in amplification. In one
embodiment,
the amplification technique is PCR and the PCR primers are present in an 8:1
or 16:1 ratio
(i.e., 8 or 16 of one primer to 1 of the second primer) to perform asymmetric
PCR. In another
embodiment, the ratio of PCR primers may be substantially equal for normal
PCR.
The amplification reaction, such as PCR, may be performedusing any suitable
method. In the following overview, one mechanism of PCR is discussed as an
illustration.
However, it is understood that the invention is not limited to this mechanism.
In the example,
a region of the DNA molecule (B' region) is annealed to an oligonucleotide
immobilized to a
bead (primer B). During thermocycling (Figure 2B), the bond between the single
stranded
template and the immobilized B primer on the bead is broken, releasing the
template into the
surrounding microencapsulated solution. The amplification solution, in this
case, the PCR
5
CA 02773059 2012-03-26
Solution, contains addition solution phase primer A and priiner B (e.g., in a
8:1 or 16:1 ratio).
Solution phase B primers readily bind to the complementary B' region of the
template as
binding kinetics are more rapid for solution phase primers than for
immobilized primers.
In early phase PCR, both A and B strands amplify equally well (Figure 2C). By
midphase PCR (i.e., between cycles 10 and 30) the B primers are depleted,
halting
exponential amplification. The reaction then enters asymmetric amplification
and the
amplicon population becomes dominated by A strands (Figure 2D). In late phase
PCR
(Figure 2E), after 30 to 40 cycles, asymmetric amplification increases the
concentration of A
strands in solution. Excess A strands begin to anneal to bead immobiliwld B
primers.
Thennostable polymerases then utilize the A strand as a template to synthesize
an
immobilized, bead bound B strand of the amplicon.
In finsl phase PCR (Figure 2F), continued thermal cycling forces additional
annealing
to bead bound primers. Solution phase amplification may be minimal at this
stage but
concentration of immobilized B strands increase. Then, the emulsion is broken
and the
immobilized product is rendered single stranded by denaturing (by heat, pH
etc.) which
removes the complimentary A strand. The A primers are annealed to the A'
region of
immobilized strand, and immobilized strand is loaded with sequencing enzymes,
and any
necessary accessory proteins. The beads are then sequenced using recognized
pyrophosphate
techniques (described, e.g., in US patent 6,274,320, 6258,568 and 6,210,891).
=
Template design = =
In a preferred embodiment, the nucleic acid template to be amplified by bead
emulsion amplification is a population of DNA such as, for example, a genomic
DNA library
or a cDNA library. It is preferred that each member of the DNA population have
a common
nucleic acid sequence at the first end and a common nucleic acid sequence at a
second end.
This can be accomplished, for example, by ligating a first adaptor DNA
sequence to one end
and a second adaptor DNA sequence to a second end of each member of the DNA
population. Many DNA and cDNA libraries, by nature of the cloning vector
(e.g., Bluescript ,
Stratagene, La Jolla, CA) fit this description of having a common sequence at
a first end and
a second common sequence at a second end of each member DNA. The nucleic acid
template may be of any size amenable to in vitro amplification (including the
preferred
6
=
CA 02773059 2012-03-26
amplification techniques of PCR and asymmetric PCR). In a preferred
embodiment, the
template is about 150 to 750 bp in size, such as, for example about 250 bp in
size.
Binding Nucleic Acid Template to Capture Beads
In one aspect of the invention, a single stranded nucleic acid template to be
amplified
is attached to a capture bead. The template may be captured to the bead prior
to
emulsification or after the emulsion has been formed. In a preferred aspect,
the amplification
copies of the nucleic acid template are attached to a capture bead. As non-
limiting examples,
these attachments may be mediated by chemical groups or oligonucleotides that
are bound to
the surface of the bead. The nucleic acid (e.g., the nucleic acid template,
amplification
copies, or oligonucleotides) may be attached to the solid support (e.g., a
capture bead) in any
manner known in the art.
According to the present invention, covalent chemical attachment of a nucleic
acid to
the bead can be accomplished by using standard coupling agents. For example,
water-soluble
carbodiimide can be used to link the 5'-phosphate of a DNA sequence to amine-
coated
capture beads through a phosphoamidate bond. Alternatively, specific
oligonucleotides can
be coupled to the bead using similar chemistry, and to then DNA ligase can be
used to ligate
the DNA template to the oligonucleotide on the bead. Other linkage chemistries
to join the
oligonucleotide to the beads include the use of N-hydroxysuccinamide (NHS) and
its
derivatives.
In an exemplary method, one end of a linker may contain a reactive group (such
as an
amide group) which forms a covalent bond with the solid support, while the
other end of the
linker contains a second reactive group that can bond with the oligonucleotide
to be
immobilized. In a preferred embodiment, the oligonucleotide is bound to the
DNA capture
bead by covalent linkage. However, non-covalent linkages, such as chelation or
antigen-
antibody complexes, may also be used to join the oligonucleotide to the bead.
As non-limiting examples, oligonucleotides can be employed which specifically
hybridize to unique sequences at the end of the DNA fragment, such as the
overlapping end
from a restriction enzyme site or the "sticky ends" of cloning vectors, but
blunt-end linkers
can also be used. These methods are described in detail in US 5,674,743. It is
preferred that
the beads will continue to bind the immobilized oligonucleotide throughout the
steps in the
methods of the invention.
7
CA 02773059 2012-03-26
In one embodiment of the invention, each capture bead is designed to have a
phuality
of oligonuoleolides that recognize (i.e., are complementary to) a portion of
the nucleic
template, and the amplification copies of this template. In the methods
described herein,
clonal amplification of the template species is desired, so it is preferred
that only one unique
nucleic acid species is attached to any one capture bead.
The beads used herein may be of any convenient size and fabricated from any
number
of known materials. Example of such materials include: inorganics, natural
polymers, and
synthetic polymers. Specific examples of these materials include: cellulose,
cellulose
derivatives, acrylic resins, glass, silica gels, polystyrene, gelatin,
polyvinyl pyrrolidone, co-
polymers of vinyl and actylamide, polystyrene cross-linked with divinylbenzene
or the like
(as described, e.g, in Merrifield, Biochemistry 1964, 3, 1385-1390),
polyacrylamides, latex
gels, polystyrene, dextran, rubber, silicon, plastics, nitrocellulose, natural
sponges, silica gels,
control pore glass, metals, cross-linked dextrans (e.g., SephadexT14) agarose
gel
(Sepharoserld), and other solid phase supports known to those of skill in the
art. In preferred
embodiments, the= capture beads are beads approximately 2 to 100 inn in
diameter, or 10 to
80 m in diameter, most preferably 20 to 40 lira in diameter. In a preferred
embodiment, the
capture beads are Sepharoselm beads. =
=
Emulsification
For use with the present invention, capture beads with or without attached
nucleic
acid template are suspended in a heat stable water-in-oil emulsion. It is
contemplated that a
plurality of the microreactors include only one template and one bead. There
may be many
droplets that do not contain a template or which do not contain a bead.
Likewise there may
be droplets that contain more than one copy of a template. The emulsion may be
formed
according to any suitable method known in the art. One method of creating
emulsion is
= described below but any method for making an emulsion may be used. These
methods are
known in the= art and include adjuvant methods, counter-flow Methods, cross-
current
methods, rotating drum methods, and membrane methods. Furthermore, the size of
the
niicrocapsules may be adjusted by varying the flow rate and speed of the
components. For
example, in dropvvise addition, the size of the drops and the total time of
delivery may be
varied. Preferably, the emulsion contains a density of about 3,000 beads
encapsulated per
microliter.
8
=
CA 02773059 2012-03-26 =
=
==
.=
Various emulsions that are suitable for biologic reactions are referred to
in Griffiths
and Tawfilr, EMBO, 22, pp. 24-35(2003); Ghadeisy et al., Proc. Natl. Acad.
Sci. USA 98, =
= =pp. 4552-4557 (2001); United States Patent No. 6,489,103 and WO
02/22869!
It is noted that Griffiths et al., (U.S. Pat. NO. 6,489,103 and,.
WO 99/02671) 'referS te a method for in Wire sorting of one or more genetic
elements.
encoding a gene products having a desired activity;
This method involves
. compartmentalizing a gene, expressing the gene, and sorting
the compartmentalized. gene =
based on the. expressed product. In contrast to the present invention,. the
microencapsulatid
sorting method of Griffith is not suitable for 'parallel analysis of multiple
microcapsules -
because their nucleic acid product is net anchored and cannot be anchored.
Since the nucleic
= acids of Griffiths are net anchored, they wouldbe mixed together during
demulsification.
The emulsion is preferably generated by adding beads to an a.mplification
solution.
= As used herein, the term "amplification solution" means the suffiCient
Mixture of reagents
that is necessary to perform amplification of teMplate DNA. One example of an
=
amplification solution, a KR amplification solution, is provided in the
Examples below.. It
will be appreciated that various modifications may be made to the
amplification solution =
based on the type Of amplification being perfonned and w.hether the template
DNA is .
= attached to the beads or provided in solution. In one embodiment, the
mixture of beads and
amplification solution is added dropwise into a spinning mixture of
biocorupatible oil (e.g.;
.=
20 light mineral Oil, Sigma) and allowed to emulsify. In another embodiment,
the beads and
= amplification solution are added dropwise into a cross-flow of
bioconrpatible oil. The oil
Used may be supplemented with one or more biocompatible. emulsion
Stabilizers., These
emulsion stabilizers may. include Atloxim 4912, Span 80, and other recognized
and =
commercially available suitable stabilikers. In preferred aspeCts, the
eniulsion is heat stable
= 25 to allow thermal cycling, e.g., to at least 94 C, at least95 C, or at
leritt.96 C. Preferably, the
droplets formed range in.size from about 5 Microns to about 500 microns, more
prefirally .
= from about 10 Microns to about 350 microns, even more preferably from
about 50 to 250
microns, . and.. most preferably from about 100 microns to . about. 200
microns = ,
Advantageously, cross-flow fluid mixing allows for control Of the droplet
formation, and =
30 uniformity
of droplet size. We note that smaller water droplets not containing beads may
be
present in the emulsion.
=
9
=
=
=
. _
CA 02773059 2012-03-26
The microreactors should be sufficiently large to encompass sufficient
amplification
reagents for the degree of amplification required. However, the microreactors
should be
sufficiently small so that a population of microreactors, each containing a
member of a DNA
library, can be amplified by conventional laboratory equipment, e.g., PCR
thermocycling
equipment, test tubes, incubators and the like. Notably, the use of
microreactors allows
amplification of complex mixtures of templates (e.g., genomic DNA samples or
whole cell
RNA) without intermixing of sequences, or domination by one or more templates
(e.g., PCR
selection bias; see, Wagner et al., 1994, Suzuki and Giovarmoni, 1996;
Chandler et al., 1997,
Polz and Cavanaugh, 1998).
With the limitations described above, the optimal size of a microreactor may
be on
average 100 to 200 microns in diameter. Microreactors of this size would allow
amplification of a DNA library comprising about 600,000 members in a
suspension of
microreactors of less than 10 ml in volume. For example, if PCR is the chosen
amplification
method, 10 ml of microreactors would fit into 96 tubes of a regular
thermocycler with 96 tube
capacity. In a preferred embodiment, the suspension of 600,000 microreactors
would have a
volume of less than 1 ml. A suspension of less than 1 ml may be amplified in
about 10 tubes
of a conventional PCR thermocycler. In a most preferred embodiment, the
suspension of
600,000 microreactors would have a volume of less than 0.5 ml.
Another embodiment of the invention is directed to a method of performing
nucleic
acid amplification with a template and a bead, but without attachment of the
template to the
bead. In one aspect, the bead may comprise a linker molecule that can bind the
amplified
nucleic acid after amplification. For example, the linker may be a linker that
can be
activated. Such linkers are well known and include temperature sensitive or
salt sensitive
binding pairs such as streptavidin/biotin and antibodies/antigen. The template
nucleic acid
may be encapsulated with a bead and amplified. Following amplification, the
amplified
nucleic acid may be linked to the beads, e.g., by adjustments in temperature
or salt
concentration.
Amplification
After encapsulation, the template nucleic acid may be amplified, while
attached or
unattached to beads, by any suitable method of amplification including
transcription-based
amplification systems (Kwoh D. et al., Proc. Natl. Acad Sci. (U.S.A.) 86:1173
(1989);
CA 02773059 2012-03-26
Gingeras T. R. et al., WO 88/10315; Davey, C. et al., EP Publication No.
329,822; Miller, H.
I. et al., WO 89/06700), "RACE" (Frohman, M. A., In: PCR Protocols: A Guide to
Methods
and Applications, Academic Press, NY (1990)) and one-sided PCR (Ohara, O. et
al., Proc.
Natl. Acad. Sci. (U.S.A.) 86.5673-5677 (1989)). Still other methods such as di-
oligonucleotide amplification, isothermal amplification (Walker, G. T. et al.,
Proc. Natl.
Acad. Sci. (U.S.A.) 89:392-396 (1992)), Nucleic Acid Sequence Based
Amplification
(NASBA; see, e.g., Delman B et al., 2002, Mol Biotechnol. 20(2):163-79), whole-
genome
amplification (see, e.g., Hawkins TL et al., 2002, Curr Opin Biotechnol.
13(1):65-7), strand-
displacement amplification (see, e.g., Andras SC, 2001, Mol Biotechnol.
19(1):29-44), rolling
circle amplification (reviewed in U.S. Pat. No. 5,714,320), and other well
known techniques
may be used in accordance with the present invention.
In a preferred embodiment, DNA amplification is performed by PCR. PCR
according
to the present invention may be performed by encapsulating the target nucleic
acidwith a
PCR solution comprising all the necessary reagents for PCR. Then, PCR may be
accomplished by exposing the emulsion to any suitable thennocycling regimen
known in the
art. In a preferred embodiment, 30 to 50 cycles, preferably about 40 cycles,
of amplification
are performed. It is desirable, but not necessary, that following the
amplification procedure
there be one or more hybridization' and extension cycles following the cycles
of
amplification. In a preferred embodiment, 10 to 30 cycles, preferably about 25
cycles, of
hybridization and extension are performed (e.g., as described in 'the
examples). Routinely,
the template DNA is amplified until typically at least 10,000 to 50,000,000
copies are
immobilized on each bead. It is recognized that for nucleic acid detection
applications, fewer
copies of template are required. For nucleic acid sequencing applications we
prefer that at
least two million to fifty million copies, preferably about ten million to
thirty million copies
of the template DNA are immobilized on each bead. The skilled artisan will
recognize that
the size of bead (and capture site thereon) determines how many captive
primers can be
bound (and thus how many amplified templates may be captured onto each bead).
PCR Primer Design
The selection of nucleic acid primers for amplification, such as PCR
amplification, is
well within the abilities of one of skill in the art. Strategies for primer
design may be found
throughout the scientific literature, for example, in Rubin, E. and A.A. Levy,
Nucleic Acids
11
CA 02773059 2012-03-26
Res, 1996. 24(18): p. 3538-45; and Buck, G.A., et al., Biotechniques, 1999.
27(3): p. 528-36.
In a preferred embodiment, primers can be limited to a length of 20 bases (5
tetramers) for
efficient synthesis of bipartite PCR/sequencing primers. Each primer can
include a two-base
GC clamp on the 5' end, a single GC clamp on the 3' end, and all primers can
share similar
T. (+/- TC). In a preferred embodiment, hairpin structures withth the primers
(internal
hairpin stems AG > -1.9 kcal/mol) are strongly discouraged in any of the
designed primers.
In another preferred embodiment, primer dimerization is also controlled; such
that a 3-base
maximum acceptable dimer is allowed. However, this is allowed to occur only in
the final
six 3' bases, and the maximum allowable AG for a 3' dimer is -2.0 kcal/mol.
Preferably, a
penalty is applied to primers in which the 3' ends are too similar to others
in the group. This
prevents cross-hybridization between one primer and the reverse complement of
another
primer.
If the primers are designed according to the criteria described above, the
possibility of
complimentary regions occurring within the genome of interest is not of major
concern,
despite the reported tolerance of PCR to mismatches in complex sample
populations (Rubin,
E. and A.A. Levy. Nucleic Acids Res, 1996. 24(18): p. 3538-45). Although the
probability
of finding a perfect match to a 20 base primer is extremely low (420) (see
Table 1), the
probability of finding shorter non-consecutive matches increases significantly
with the size of
the genome of interest. As a result, the probability of finding a perfect
match for a sequence
of at least 10 of 20 bases is 99.35% for an Adenovirus genome. The probability
of finding a
perfect match for a sequence of 16 bases is 97% for the sequences in the NCBI
database
(approximately 100 times more sequence information than the Adenovirus
genome). The
probability of finding a perfect match for a sequence of 17 to 20 bases is 99%
for the human
genome (approximately 3 billion bases).
12
CA 02773059 2012-03-26
Table 1. The probability of perfect sequence matches for primers increases
with decreasing match length requirements and increasing
size of the genome of interest.
Perfect match% chance for match in NCB;
Match Length probability
% chance for match in Adeno - bacterial database - 488M % chance for match
in Human
35K bases -3B bases
(1/(4Alength)) bases
20 9.1E-13 0.00% 0.04% 0.27%
19 7.3E-12 0.00% 0.65% 4.32%
=
18 4.4E-11 0.00% 5.76% 34.37%
17 2.3E-10 0.00% 35.69% 99.17%
16 1.2E-09 - 0.02% 97.52% > 100%
15 5.6E-09 = 0.12% > 100% > 100%
14 2.6E-08 0.64% > 100% > 100%
13 1.2E-07 3.29% > 100% > 100%
12 5.4E-07 15.68% > 100% > 100%
11 ' 2.4E-06 58.16% > 100% > 100%
1.0E-05 99.35% > 100% > 100%
9 4.6E-05 99.77% > 100% > 100%
8 2.0E-04 > 100% > 100% > 100%
7 8.5E-04 > 100% > 100% > 100%
6 3.7E-03 >100% >100% >100%
5 1.6E-02 >100% >100% >100%
4 6.4E-02 > 100% > 100% > 100%
3 2.5E-01 > 100% > 100% > 100%
2 7.1E-01 >100% >100% >100%
1 1.0E+00 >100% >100% >100%
However, primer cross-hybridization to various regions of the genome is less
problematic than one might expect due to the random DNA digestion used to form
the
nucleic acid templates. The cross-hybridizing regions (CHRs) are fairly
benign. First, it is
5 unlikely
that a CHR would be able to successfully, compete with the perfect match
between
= :the PCR primers in solution and the template. In addition, any primers
that include
mismatches at their 3' end will be at a significant competitive disadvantage.
Even if a CUR
should out compete the intended PCR primer, it would produce a truncated PCR
product,
without a downstream site for the sequencing primer. If the truncated product
could be
10 driven to
the capture bead and immobilized, one of two situations would result. If the
CHR
out-competed the solution¨phase primer, then the immobilized product would
lack a
sequencing primer binding site, and would result in an empty picotiter plate
(PTP) well. If
the CUR out-competed the bead-bound primer, the sequencing primer would still
be present,
and the only effect would be a shorter insert. Neither result would unduly
compromise the
sequencing quality. Given the large amount of genomic material used in the
sample
preparation process (cufrently 25 tig, containing 5.29 x 1016 copies of the 35
Kb Adenovirus
genome), oversampling can be used to provide fragments that lack the complete
CHR, and
allow standard PCR amplification of the region in question.
' 13
CA 02773059 2012-03-26
=
=
=
Breaking .the Emulsion and.Bead Recovery
Following amplification of the mieleic acid teniplate and the attachment of
= amplification copies to the bead, the emulsion is "broken" (also referred
.to as
"domtilsification" in the art). There are Many methods of breaking an
einulsion (see, e.g.,
5 U.S. Patent No. 5,989,892 and references cited therein) and one of skill
in the art would be =
able to select an appropriate method. In the present: invention, one preferred
method of
. breaking the emulsion uses additional oil to ewe the emulsion to separate
into two phases
The oil phase is then 'removed, and a suitable organic solvent (e.gõ hexanes)
is added. After .
= nixing, the oil/organic solvent phase is removed. This stp may be
repeated several times.
10, Finally, the aqueous layers above the beads are removed. The beads are
then washed with a
mixture of an organic solvent and annealini buffer (e.g., one suitable
annealing buffer is
described in the examples), and then washed Again in annealing buffer.
SUitahle organic =
solvents include alcohols such as methanol, ethanol, and the like, -
The beads botmd to amplification products may then be resuspended in aqueous
15 solution for use, for example, in a sequencing reaction according to
known iechnologi' es.
. (See, Sanger, F.. et al., Proc. Natl._ Acad. Sci. U.S.A. 75,
5463,5467 (1977); Maxam, A. M. & =
Gilbert, W. Proc Natl Acad =Sei USA 74, 560-564(1977); Ronaghi, M. et al.,
Science 281, ==
=- 363, 365(1998); Lysov, L et al., DoktAkad Nauk SSS.R. 303, 1508-1511
(1988); Baits &
' Smith- G. C. J. Theor Biol 155, 303-307(1988); Dmanac, R. et
al., Genomict 4, 114-128 =
20 (1989); Khrapko; K. R. et a1, FEBS Lett 256. 118-122 (1989); Pevzner P.
A. J Biomol Stmct
= Dyn 7, 63-73(J989); Southern, E.M. et at, Genomics 13;,1008-1017 (1992).)
If the beads are= to be used in a pyrophosphate-based sequencing reaction
(described,= -
, e.g., in US patent 6,274,320, 6258,5.68 and 6,210,89*
, then it is necessary to remove the second strand of the PCR product and
anneal a
= 25 sequencing primer to the single' stranded template .that is bound to
the bead. The second -
strand May be melted away using. any number of commonly known metheds such as
addition =
of NaOH, application of low ionic (e.g., salt) strength, enzymatic degradation
or
= displacement of the second strand, or heat processing. 'Following this
strand removal step,
= the 'beads .are'pelleted and the supernatant is disaardect The beads are
resuspended in an
30 annealing bUffer, and a sequencing Primer or other ncip.-ampl.**n Other
is added.' The -
= primer is annealed to.the single stranded amplificatiOn product. This can
be accompliihed by
. 14 .
= =
.
.
= =
=
CA 02773059 2012-03-26
using an appropriate annealing buffer and temperature conditions, e.g., as
according to
standard procedures in the art.
Purifying the beads
At this point, the amplified nucleic acid on the bead may be sequenced either
directly
on the bead or in a different reaction vessel. In an embodiment of the present
invention, the
nucleic acid is sequenced directly on the bead by transferring the bead to a
reaction vessel
and subjecting the nucleic acid to a sequencing reaction (e.g., pyrophosphate
or Sanger
sequencing). Alternatively, the beads may be isolated and the nucleic acid may
be removed
from each bead and sequenced. In either case, the sequencing steps may be
performed on
each individual bead. However, this method, while commercially viable and
technically
feasible, may not be most effective because many of the beads will be
"negative" beads (i.e.,
beads without amplified nucleic acid attached). In such cases, the optional
process outlined
below may be used to remove negative beads prior to distribution onto
multiwell (e.g.,
picotiter) plates.
A high percentage of the beads may be negative if the goal is to minimize the
number
of beads that are associated with two =or more different species of nucleic
acid templates. For
optimal pyrophosphate sequencing, each bead should contain multiple copies of
a single
species of nucleic acid. This can be achieved by maximizing the total number
of beads
combined with a single fragment of nucleic acid before amplification. For
example, the
following mathematical model can be used.
For the general case of N number of DNAs randomly distributed with M number of
beads, the relative bead population associated with any number of DNAs depends
on the ratio
of N/M. The fraction of beads associated with N DNAs R(N) may be calculated
using the
Poisson distribution:
R(N) = exp - (N/M) x (N/M)N/N! (where x is the multiplication symbol)
Table 2, below, shows some calculated values for various N/M (the average DNA
fragment-to-bead ratio) and N (the number of fragments associated with a
bead).
Table 2
N/M 0.1 0.5 1 2
R(0) 0.9 0.61 0.37 0.13
R(1) 0.09 0.3 0.37 0.27
R(N>1) 0.005 0.09 0.26 0.59
15
CA 02773059 2012-03-26
In Table 2, the top row denotes the various ratios of N/M. R(0) denotes the
fraction
of beads with no DNA, R(1) denotes the fraction of beads with one DNA (before
amplification), and R(N > 1) denotes the fraction of DNA with more than one
DNA (before
amplification).
Table 2 indicates that the maximum fraction of beads associated with a single
DNA
fragment is 0.37 (37%) and this occurs at a fragment-to-bead ratio of one-to-
one. In this
mixture, about 63% of the beads cannot be used for sequencing because they are
associated
with no DNA or they are associated with more than one species of DNA. However,
controlling the fragment-to-bead ratio requires complex calculations, and
variability can
produce bead batches with a significantly smaller fraction of useable beads.
This inefficiency can be significantly ameliorated if beads containing
amplicon
(originating from the association with at least one fragment) are separated
from those without
amplicon (originating from beads with no associated fragments). An amplicon is
defined as
any nucleic acid molecules produced by an in vitro nucleic amplification
technique. To
increase efficiency, binding can be performed usinglow fragment-to-bead ratios
(N/M < 1).
This minimizes the number of beads associated with more than one DNA. A
separation step
can be used to remove most or all of the beads with no DNA, leaving an
enriched population
of beads with one or more species of amplified DNA. This enriched population
may be
analyzed by any method of sequencing such as, for example, pyrophosphate
sequencing.
Because the fraction of beads with one amplicon (N = 1) is enriched, any
method of
sequencing can be applied more efficiently.
As an example, with an average fragment-to-bead ratio of 0.1, 90% of the beads
will
cany no amplicon, 9% of the beads will carry one amplicon, and 0.5% of the
beads will carry
more than one amplicon. The enrichment described herein below will remove the
90% of the
zero amplicon beads leaving a population of beads where the fraction available
for
sequencing (N = 1) is:
1 - (0.005/0.09) = 94%.
Dilution of the fragment to bead mixture, along with separation of beads
containing
amplicon can yield an enrichment of 2.5 fold over the optimal unenriched
method. For
example, 94%/37% (See Table 2, above, N/M = 1) = 2.5. An additional benefit of
the
enrichment procedure described herein below is that the ultimate fraction of
beads useful for
sequencing is relatively insensitive to variability in N/M. Thus, complex
calculations to
16
CA 02773059 2012-03-26
derive the optimal N/M ratio are either unnecessary or may be performed with
lower levels of
precision. Accordingly, the methods of the invention can be easily adapted for
use by less
trained personnel or automation. An additional benefit of these methods is
that the zero
amplicon beads may be recycled and reused. While recycling is not necessary,
it may reduce
cost or the total bulk of reagents making the method of the invention more
suitable for some
purposes such as, for example, Portable sampling, remote robotic sampling, and
the like. In
addition, the collective benefits of the disclosed methods (e.g., adaptation
for less trained
personnel, automation, and recycling of reagents) will reduce the costs of the
methods. The
enrichment procedure is described in more detail below.
The enrichment procedure may be used to treat beads that have been amplified
in the
bead emulsion method described above. The amplification is designed so that
each amplified
nucleic acid molecule contains the same sequence at its 3' end. The nucleotide
sequence may
be a 20 mer but may be any sequence from 15 bases or more such as 25 bases, 30
bases, 35
bases, 40 bases, or longer. While longer oligonucleotide ends are functional,
they are not
necessary. This 3' sequence may be introduced at the end of an amplified
nucleic acid by one
of skill in the art. For example, if PCR is used for amplification of a DNA
template, the
sequence may be included as part of one member of the PCR primer pair.
A schematic of the enrichment process is depicted in Figure 3. In this
process, the
amplicon-bound bead is mixed with four empty beads to create a fragment-
diluted
amplification bead mixture. In step 1, a biotinylated primer complementary to
the 3' end of
the amplicon is annealed to the amplicon. In step 2, DNA polymerase and the
four natural
= deoxynucleotide triphosphates (dNTPs) are added to the bead mixture and
the biotinylated
primer is extended. This extension is to enhance the bonding between the
biotinylated primer
and the bead-bound DNA. This step may be omitted if the biotinylated primer.¨
DNA bond
is strong (e.g., in a high ionic environment). In Step 3, streptavidin coated
beads susceptible
to attraction by a magnetic field (referred to herein as "magnetic
streptavidin beads") are
introduced to the bead mixtures. Magnetic beads are commercially available,
for example,
from Dynal (M290). The streptavidin capture moieties binds biotin groups
hybridized to the
amplicons, thereby binding the amplicon-bound beads to the magnetic
stieptavidin beads.
In step 5, a magnetic field (represented by a magnet) is applied near the
reaction
mixture, which causes the magnetic streptavidin beads/amplicon bound bead
complexes to be
positioned along one side of the tube most proximal to the magnetic field.
Magnetic beads
17
CA 02773059 2012-03-26
without amplicon bound beads attached are also expected to be positioned along
the same
side. Beads without amplicons remain in solution. The bead mixture is washed
and the
beads not bound by the magnet (i.e., the empty beads) are removed and
discarded. In step 6,
the extended biotinylated primer strand is separated from the amplicon strand
by "melting."
This step that can be accomplished, for example, by heat or a change in pH.
The heat may be
60 C in low salt conditions (e.g., in a low ionic environment such as 0.1X
SSC). The change
in pH may be accomplished by the addition of NaOH. Next, the mixture is washed
and the
supernatant containing the amplicon bound beads is recovered, while the
magnetic beads are
retained by a magnetic field. The resultant enriched beads may be used for DNA
sequencing.
It is noted that the primer on the DNA capture bead may be the same as the
primer of step 2,
above. In this case, annealing of the amplicon-primer complementary strands
(with or
without extension) is the source of target-capture affinity.
The biotin streptavidin pair could be replaced by a variety of capture-target
pairs. For
example, capture-target pairs can employ reversible (e.g., cleavable) or
irreversible linkages.
Non-limiting examples of reversible linkages include thiol-thiol,
digoxigenin/anti-
digoxigenin, and linkages using . VECTREX0 Avidin DLA (Vector Laboratories,
Burlingame, CA), CaptAvidinTM, NeutrAvidinTm, and D-desthiobiotin (Molecular
Probes,
Inc., Eugene, OR).
As described above, step 2 of the enrichment process is optional. If step 2 is
omitted,
it may not be necessary to separate the magnetic beads from the amplicon bound
beads. The
amplicon bound beads, with the magnetic beads attached, may be used directly
for
sequencing. For example, separation may not be necessary if sequencing is to
be performed
in a microtiter or picotiter plate and the amplicon bound bead-magnetic bead
complex can fit
'inside the well of the plate.
While the use of magnetic capture beads is convenient, capture moieties can
encompass other binding surfaces. For example, streptavidin can be chemically
bound to a
surface such as the inner surface of a tube. In this case, the amplified bead
mixture may be
flowed through the tube. The amplicon bound beads will tend to be retained
until "melting"
while the empty =beads will flow through. This arrangement may be particularly
advantageous for automating the bead preparation process.
While the embodiments described above are particularly useful, other methods
to
separate beads can be envisioned. For example, the capture beads may be
labeled with a
18
CA 02773059 2012-03-26
fluorescent moiety which would make the target-capture bead complex
fluorescent. The
target capture bead complex may be separated by flow cytomety or fluorescence
cell sorter.
Using large capture beads would allow separation by filtering or other
particle size separation
techniques. Since both capture and target beads are capable of fonning
complexes with a
number of other beads, it is possible to agglutinate a mass of cross-linked
capture-target
beads. The large size of the agglutinated mass would make sepa.ration possible
by simply.
washing away the unagglutinated empty beads. These methods described are
described in
more detail, for example, in Bauer, J.; J. Chromatography B, 722 (1999) 55-69
and in Brody
et al., Applied Physics Lett. 74 (1999) 144-146.
In one embodiment, the invention encompasses a method for amplifying one or
more
nucleic acids comprising the steps of: a) forming a water-in-oil emulsion to
create a plurality
of aqueous microreactors wherein at least one of the microreactors comprises a
single nucleic
acid template, a single bead capable of binding to the nucleic acid, and
amplification reaction
=15 solution containing reagents necessary to perform nucleic acid
amplification; b) amplifying
the nucleic acids in the microreactors to form amplified copies of the nucleic
acids; and c)
binding the amplified copies to the beads in the microreactors.
The amplification reaction solution used with this method may be a polymerase
chain
reaction solution comprising nucleotide triphosphates, a thermostable
polymerase, and
nucleic acid primers suspended in a buffer compatible with polymerase chain
reaction
conditions. The polymerase chain reaction is xnay be an asymmetric polymerase
chain
reaction or a symmetric polymerase chain reaction. As examples, amplification
may be
= carried = out by transcription-based amplification, rapid amplification
of cDNA ends,
continuous flow amplification, or rolling circle amplification.
For use with this method, a majority of the microreactors may include a single
nucleic
= acid. The method may be performed with at least 10,000 nucleic acids, or
at least 50,000.
nucleic acids. Each bead used with the method can be used to capture more than
10,000
amplification copies of a nucleic acid template. In various embodiments,
9e,emulsion.,
additionally contains emulsion stabilizers. The emulsion stabilizers may be
Atloxlm 4912, Span
80, or combinations or mixtures thereof. The emulsion may be heat stable,
e.g., to 95 C, and
may be formed by the dropwise addition of the nucleic acid templates, beads,
and
amplification reaction sol,ution into an oil. The microreactors may have an
average size of 50
19
CA 02773059 2012-03-26
to 250 um in diameter.
In another embodiment, the invention encompasses a library comprising a
plurality of
nucleic acid molecules, wherein each nucleic acid molecule is separately
immobilized to a
different bead, and wherein each bead comprises over 1,000,000 clonal
amplification copies
of each nucleic acid molecule, wherein the library is contained in a single
vessel. As
examples, the nucleic acid molecules may be genomic DNA, cDNA, episomal DNA,
BAC
DNA, or YAC DNA. The genomic DNA may be animal, plant, viral, bacterial, or
fungal
genomic DNA. Preferably, the genomic DNA is human genomic DNA or human cDNA.
In
certain aspects, the bead, e.g., a Sepharoselm bead, has a diameter of 2
microns to 100 microns.
The invention also encompasses a method for amplifying a nucleic acid
comprising
the steps of a) providing a nucleic acid template to be amplified; b)
providing a solid
support material comprising a generally spherical bead having a diameter about
10 to about
80 m, wherein the bead is capable of binding to the nucleic acid template; c)
mixing the
nucleic acid template and the bead in an amplification reaction solution
containing reagents
necessary to perform a nucleic acid amplification reaction in a water-in-oil
emulsion; d)
amplifying the nucleic acid template to form amplified copies of the nucleic
acid template;
and e) binding the amplified copies to the bead.
As an option, the method can. include an enrichment step to isolate beads
which bind
amplified copies of the nucleic acid away from beads to which no nucleic acid
is bound. This
enrichment step may be performed by electrophoresis, cell sorting, or affinity
purification
(e.g., with magnetic beads that bind nucleic acid). Preferably, at least
100,000 copies of each
target nucleic acid molecule are bound to each bead, at least 1,000,000 copies
of each target
nucleic acid molecule are bound to each bead, or at least 1 to 20,000,000
copies of each target
nucleic acid molecule are bound to each bead. In various aspects, the beads
are Sepharose
= 25 beads and amplified copies are bound to the beads by a binding pair
such as antigen/antibody,
ligand/receptor, polyhistidinetnickel, or avidin/biotin. The method can also
include the steps
of: f) separating the template carrying beads and magnetic bead; and g)
removing the
magnetic beads with a magnetic field. This separation may be achieved by
incubation at a
temperature greater than 45 C or by incubating the template canying beads and
the magnetic
beads in a solution with a basic pH.
The invention further encompasses a kit for conducting nucleic acid
amplification of
a nucleic acid template comprising: a) a nucleic acid capture bead; b) an
emulsion oil; c) one
=
CA 02773059 2012-03-26
or more emulsion stabilizers; and d) instructions for employing the kit.
Additionally, the invention encompasses a method for producing a clonal
population
of nucleic acids, comprising: a) providing a plurality of nucleic acid
templates from 50-800
bp in length and beads capable of binding to the nucleic acid templates; b)
mixing the nucleic
acid templates and the beads in a biological reaction solution containing
reagents necessary to
amplify the nucleic acid templates; and c) forming an emulsion to create a
plurality of
microreactors comprising the nucleic acid templates, beads, and biological
reaction solution,
wherein at least one of the microreactors comprises a single nucleic acid
template and a
single bead encapsulated in the biological reaction solution, wherein the
microreactors are
contained in the same vessel.
In accordance with this method, the nucleic acids can be transcribed and
translated to
generate at least 10,000 copies of an expression product. The expression
product may be
bound to the beads by a binding pair selected from the group consisting of
antigen/antibody,
ligand/receptor, 6Xhis/nickel-nitrilotriacetic acid, and FLAG tag/FLAG
antibody binding
pairs. In certain aspects, the method produces a clonal population of
proteins, such as
antibodies, antibodies fragments, and engineered antibodies. The emulsion may
comprise a
plurality of thermostable microreactors, wherein the microreactors are 50 to
200 pm in
diameter and comprise a biological reaction solution. The biological reaction
solution may
comprise reagents for performing polymerase chain reaction amplification
reactions or
coupled transcription and translation reactions. Preferably, a plurality of
rnicroreactors
comprise a nucleic acid template, e.g., one or fewer nucleic acid templates,
and one or fewer
beads that bind to the nucleic acid templates.
EXAMPLES
BEAD EMULSION PCR
The following procedures, including capture of the template DNA, DNA
amplification, and recovery of the beads bound to amplified template, can be
performed in a
single tube. The emulsion format ensures the physical separation of the beads
into 100-200
pxn "microreactors" within this single tube, thus allowing for clonal
amplification of the
various templates. Immobilization of the amplification product is achieved
through extension
21
CA 02773059 2012-03-26
of the template along the oligonucleotides bound to the DNA capture beads.
Typical, the
copy number of the immobilized template ranges from 10 to 30 million copies
per bead. The
DNA capture beads affixed with multiple copies of a single species of nucleic
acid template
are ready for distribution onto PTPs.
The 300,000 75-picoliter wells etched in the PTP surface provide a unique
array for
the sequencing of short DNA templates in a massively parallel, efficient and
cost-effective
manner. However, this requires fairly large quantities (millions of copies) of
clonal templates
in each reaction well. The methods of the invention allow the user to clonally
amplify single-
stranded genomic template species thorough PCR reactions conducted in standard
tubes or
microtiter plates. Single copies of the template species may be mixed with
capture beads,
resuspended into complete PCR amplification solution, and emulsified into
microreactors
(100 to 200 inn in diameter), after which PCR amplification generates 107¨fold
amplification
of the initial template species. This procedure is much simpler and more cost-
effective than
previous methods.
Example 1: Binding Nucleic Acid Template to Capture Beads
This example describes preparation of a population of beads that preferably
have only
one unique nucleic acid template attached thereto. Successful clonal
amplification depends
on the delivery of a controlled number of template species (0.5 to 1) to each
bead. Delivery
of excess species can result in PCR amplification of a mixed template
population, preventing
generation of meaningful sequence data while a deficiency of species will
result in fewer
wells containing template for sequencing. This can reduce the extent of genome
coverage
provided by the sequencing phase. As a result, it is preferred that the
template concentration
be accurately determined through replicated quantitation, and that the binding
protocol be
followed as outlined below.
Template Quality Control
The success of the Emulsion PCR reaction is related to the quality of the
template
species. Regardless of the care and detail paid to the amplification phase,
poor quality
templates will impede successful amplification and the generation of
meaningful sequence
data. To prevent unnecessary loss of time and money, it is important to check
the quality of
the template material before initiating the Emulsion PCR phase of the process.
Preferably,
22
=
CA 02773059 2012-03-26
=the library should pass two quality control steps before it is used in
Emulsion PCR. Its
concentration and the distribution of products it contains should be
determined. Ideally, the
library should appear as a heterogeneous population of fragments with little
or no visible
adapter dimers (e.g., --90 bases). Also, amplification with PCR primers should
result in a
product smear ranging, for example, from 300 to 500 bp. Absence of
amplification product
may reflect failure to properly ligate the adaptors to the template, while the
presence of a
single band of any size may reflect contamination of the template.
Preparation of the PCR solution
The main consideration for this phase is to prevent contamination of the PCR
reaction
mixture with stray amplicons. Contamination of the PCR reactions with a
residual amplicon
is one of the critical issues that can cause failure of a sequencing run. To
reduce the
possibility of contamination, proper lab technique should be followed, and
reaction mixture
preparation should be conducted in a clean room in a UV-treated laminar flow
hood.
PCR Reaction Mix:
For 200 id PCR reaction mixture (enough for amplifying 600,000 beads), the
following reagents were combined in a 0.2 ml PCR tube:
Table 3
Stock Final Microliters
HIFI Buffer 10 X 1X 20
treated nucleotides 10 mM 1 mM 20
Mg 50 mM 2 mM 8
BSA 10% 0.1% 2
Tween 80 1 % 0.01 % 2
Ppase 2 U 0.003 U 0.333333
Primer MMPla 100 uM 0.625 u.M 1.25
Primer MMPlb 10 uM 0.078 uM 1.56
Taq polymerase 5 U 0.2 U 8
Water 136.6
Total 200
The tube was vortexed thoroughly and stored on ice until the beads are
annealed with
template.
23
CA 02773059 2012-03-26
DNA Capture Beads:
1. 600,000 DNA capture beads were transferred from the stock tube
to a 1.5 ml
microfuge tube. The exact amount used will depend on bead concentration of
formalized
reagent.
2. The beads were pelleted in a benchtop mini centrifuge and supernatant
was
removed.
3. Steps 4-11 were performed in a PCR Clean Room.
4. The beads were washed with 1 mL of 1X Annealing Buffer.
5. The capture beads were pelleted in the microcentrifuge. The tube was
turned
180 and spun again.
6. All but approximately 10 f.d of the supernatant was removed from the
tube
containing the beads. The beads were not disturbed.
7. 1 mL of 1X Annealing Buffer was added and this mixture was incubated for
1
minute. The beads were then pelleted as in step 5.
8. All but approximately 100 uL of the material from the tube was removed.
9. The remaining beads and solution were transferred to a PCR tube.
10. = The 1.5 mL tube was washed with 150 jaL of IX Annealing Buffer by
pipetting up and down several times. This was added to the PCR tube containing
the beads.
11. The beads were pelleted as in step 5 and all but 10 j.tL of supernatant
was
removed, taking care to not disturb the bead pellet.
12. An aliquot of quantitated single-stranded template DNA (sstDNA) was
removed. The final concentration was 200,000-sst DNA molecules/pi.
13. 3 id of the diluted sstDNA was added to PCR tube containing the beads.
This
was equivalent to 600,000 copies of sstDNA.
14. The tube was vortexed gently to mix contents.
15. The sstDNA was annealed to the capture beads in a PCR
thermocycler with
the program 80Atmeal stored in the EPCR folder on the MJ Thermocycler, using
the
following protocol:
= 5 minutes at 65 C;
= Decrease by 0.1 C /sec to 60 C;
= Hold at 60 C for 1 minute;
= Decrease by 0.1 C /sec to 50 C;
24
CA 02773059 2012-03-26
= Hold at 50 C for 1 minute;
= Decrease by 0.1 C/sec to 40 C;
= Hold at 40 C for 1 minute;
= Decrease by 0.1 C /sec to 20 C; and
= Hold at 10 C until ready for next step.
In most cases, beads were used for amplification immediately after template
binding.
If beads were not used immediately, they should were stored in the template
solution at 4 C
until needed. After storage, the beads were treated as follows.
16. As in step 6, the beads were removed from the thermocycler,
centrifuged, and
annealing buffer was removed without disturbing the beads.
17. The beads were stored in an ice bucket until emulsification (Example
2).
18. The capture beads included, on average, 0.5 to 1 copies of sstDNA bound
to
each bead, and were ready for emulsification.
Example 2: Emulsification
This example describes how to create a heat-stable water-in-oil emulsion
containing
about 3,000 PCR microreactors per microliter. Outlined below is a protocol for
preparing the
emulsion.
1. 200 I of PCR solution was added to the 600,000 beads (both components
from Example 1).
2. The solution was pipetted up and down several times to resuspend the
beads.
3. The PCR-bead mixture was allowed to incubate at room temperature for 2
minutes to equilibrate the beads with PCR solution.
4. 400 1 of Emulsion Oil was added to a UV-irradiated 2 ml rnicrofuge
tube.
5. An "amplicon-free" 1/4" stir magnetic stir bar was added to the tube of
Emulsion Oil.
An amplicon-free stir bar was prepared as follows. A large stir bar was used
to hold a
1/4" stir bar. The stir bar was then:
= Washed with DNA-Off (drip or spray);
= Rinsed with picopure water;
= Dried with a Kimwipe edge; and
= UV irradiated for 5 minutes.
CA 02773059 2012-03-26
6. The magnetic insert of a Dynal 11112C-S tube holder was removed. The
tube of
Emulsion Oil was placed in the tube holder. The tube was set in the center of
a stir plate set
at 600 rpm. =
7. The tube was vortexed extensively to resuspend the beads. This ensured
that
there was minimal clumping of beads.
8. Using a P-200 pipette, the PCR-bead mixture was added drop-wise to the
spinning oil at a rate of about one drop every 2 seconds, allowing each drop
to sink to the
level of the magnetic stir bar and become emulsified before adding the next
drop. The
solution turned = into a homogeneous milky white liquid with a viscosity
similar to
mayonnaise.
9. Once the entire PCR-bead mixture was been added, the microfuge tube was
flicked a few times to mix any oil at the surface with the milky emulsion.
10. Stirring was continued for another 5 minutes.
11. Steps 9 and 10 were repeated.
12. The stir bar was removed from the emulsified material by dragging it out
of
the tube with a larger stir bar.
13. 10 pi, of the emulsion was removed and placed on a microscope slide.
The
emulsion was covered with a cover slip and the emulsion was inspected at 50X
magnification
(10X ocular and 5X objective lens). A t'good" emulsion was expected to include
primarily
single beads in isolated droplets (microreactors) of PCR solution in oil.
14. A suitable emulsion oil mixture with emulsion stabilizers was made as
follows. The components for the emulsion mixture are shown in Table 4.
Table 4
Quantity
Ingredient = Source Ref. Number
Required
Sigma Light Mineral Oil 94.5 g Sigma M-5904
Atlox TM 4912 1 g Uniqema NA
Span() 80 4.5 g Uniqema NA
The emulsion oil mixture was made by prewarrning the Atloxlm 4912 to 60 C in a
water
bath. Then, 4.5 grams of Span 80 was added to 94.5 grams of mineral oil to
form a mixture.
Then, one gram of the prewanned Atloxlm 4912 was added to the mixture. The
solutions were
placed in a closed container and mixed by shaking and inversion. Any sign that
the Atloxlm
26
CA 02773059 2012-03-26
was settling or solidifying was remedied by warming the mixture to 60 C,
followed by
additional shaking.
Example 3: Amplification
This example describes amplification of the template DNA in the bead ¨
emulsion mixture.
According to this protocol of the invention, the DNA amplification phase of
the processtakes
3 to 4 hours. After the amplification is complete, the emulsion may be left on
the
thennocycler for up to 12 hours before beginning the process of isolating the
beads. PCR
thermocycling was performed by placing 50 to 100 I of the emulsified reaction
mixture into
individual PCR reaction chambers (i.e., PCR tubes). PCR was performed as
follows:
1. The emulsion was transferred in 50-100 laL amounts into approximately 10
separate PCR tubes or a 96-well plate using a single pipette tip. For this
step, the water-in-oil
emulsion was highly viscous.
2. The plate was sealed, or the PCR tube lids were closed, and the
containers
were placed into in a MJ thennocycler with or without a 96-well plate adaptor.
3. The PCR thermocycler was programmed to run the following program:
= 1 cycle (4 minutes at 94 C) Hotstart Initiation;
= 40 cycles (30 seconds at 94 C, 30 seconds at 58 C, 90 seconds at 68 C);
= 25 cycles (30 seconds at 94 C, 6 minutes at 58 C); and
= Storage at 14 C.
4. After completion of the PCR reaction, the amplified material was
removed in
order to proceed with breaking the emulsion and bead recovery.
Example 4: Breaking the Emulsion and Bead Recovery
This example describes how to break the emulsion and recover the beads with
amplified template thereon. Preferably, the post-PCR emulsion should remain
intact. The
lower phase of the emulsion should, by visual inspection, remain a milky white
suspension.
If the solution is clear, the emulsion may have partially resolved into its
aqueous and oil
phases, and it is likely that many of the beads will have a mixture of
templates. If the
emulsion has broken in one or two of the tubes, these samples should not be
combined with
the others. If the emulsion has broken in all of the tubes, the procedure
should not be
continued.
27
CA 02773059 2012-03-26
1. All PCR reactions
from the original 600 IA sample were combined into a
single 1.5 ml microfuge tube using a single pipette tip. As indicated above,
the emulsion was
quite viscous. In some cases, pipetting was repeated several times for each
tube. As much
material as possible was transferred to the 1.5 ml tube.
2. The remaining
emulsified material was recovered from each PCR tube by
adding 50 1.t1 of Sigma Mineral Oil into each sample. Using a single pipette
tip, each tube was
pipetted up and down a few times to resuspend the remaining material.
3. This material was
added to the 1.5 ml tube containing the bulk of the
emulsified material.
4. The sample was vortexed for 30 seconds.
5. The sample was spun for 20 minutes in the tabletop microfuge tube at
13.2K
rpm in the Eppendorf microcentrifuge.
6. The emulsion separated into two phases with a large white interface. As
much
of the top, clear oil phase as possible was removed. The cloudy material was
left in the tube.
Often a white layer separated the oil and aqueous layers. Beads were often
observed pelleted
at the bottom of the tube.
7. The aqueous layer above the beads was removed and saved for analysis
(gel
analysis, Agilent 2100, and Taqman). If an interface of white material
persisted above the
aqueous layer, 20 microliters of the underlying aqueous layer was removed.
This was
performed by penetrating the interface material with a pipette tip and
withdrawing the solution
from underneath.
8. In the PTP Fabrication and Surface Chemistry Room Fume Hood, 1 ml of
Hexanes was added to the remainder of the emulsion.
9. The sample was vortexed for 1 minute and spun at full speed for lminute.
10. In the PTP
Fabrication and Surface Chemistry Room Fume Hood, the top,
oil/hexane phase was removed and placed into the organic waste container. .
11. 1 ml of 1X Annealing Buffer was added in 80% Ethanol to the remaining
aqueous phase, interface, and beads.
12. The sample was vortexed for 1 minute or until the white substance
dissolved.
13. The sample was
centrifuged for 1 minute at high speed. The tube was rotated
180 degrees, and spun again for 1 minute. The supernatant was removed without
disturbing
the bead pellet.
28
CA 02773059 2012-03-26
14. The beads were washed with 1 ml of 1X Annealing Buffer containing 0.1%
Tween 20 and this step was repeated.
Example 5: Single Strand Removal and Primer Annealing
If the beads are to be used in a pyrophosphate-based sequencing reaction, then
it is
necessary to remove the second strand of the PCR product and anneal a
sequencing primer to
the single stranded template that is bound to the bead. This example describes
a protocol for
accomplishing that.
1. The beads were washed with 1 ml of water, and spun twice for 1 minute.
The
tube was rotated 180 between spins. After spinning, the aqueous phase was
removed.
2. The beads were washed with 1 ml of 1 mM EDTA. The tube was spun as in
step 1 and the aqueous phase was removed.
3. 1 ml of 0.125 M NaOH was added and the sample was incubated for 8
minutes.
4. The sample was vortexed briefly and placed in a microcentrifuge.
5. After 6 minutes, the beads were pelleted as in step 1 and as much
solution as
possible was removed.
6. At the completion of the 8 minute NaOH incubation, 1 ml of 1X Annealing
Buffer was added.
7. The sample was briefly vortexed, and the beads were pelleted as in step
1. As
much supernatant as possible was removed, and another 1 ml of 1X Annealing
buffer was
added.
8. The sample was briefly vortexed, the beads were pelleted as in
step 1, and 800
I of 1X Annealing Buffer was removed.
9. The beads were transferred to a 0.2 ml PCR tube.
10. The beads were transferred and as much Annealing Buffer as possible was
removed, without disturbing the beads.
11. 100 I of IX Annealing Buffer was added.
12. 4 1 of 100 M sequencing primer was added. The sample was vortexed
just
prior to annealing.
13. Annealing was performed in a MJ thermocycler using the "80Anneal"
program.
29
CA 02773059 2012-03-26
14. The beads were washed three times with 200 I of IX Annealing Buffer
and
resuspended with 100 1 of IX Annealing Buffer.
15. The beads were counted in a Hausser Hemacytometer. Typically, 300,000
to
500,000 beads were recovered (3,000-5,000 beads/pL).
16. Beads were stored at 4 C and could be used for sequencing for 1 week.
Example 6: Optional Enrichment Step
The beads may be enriched for amplicon containing bead using the following
procedure. Enrichment is not necessary but it could be used to make subsequent
molecular
biology techniques, such as DNA sequencing, more efficient.
Fifty microliters of 10 M (total 500 pmoles) of biotin-sequencing primer was
added
to the Sepharoselm beads containing amplicons from Example 5. The beads were
placed in a
thermocycler. The primer was annealed to the DNA on the bead by the
thermocycler
annealing program of Example 2.
After annealing, the sepharose beads were washed three times with Annealing
Buffer
containing 0.1% Tween 20. The beads, now containing ssDNA fragments annealed
with
biotin-sequencing primers, were concentrated by centrifugation and resuspended
in 200 I of
BST binding buffer. Ten microliters of 50,000 unit/nil Bst-polymerase was
added to the
resuspended beads and the vessel holding the beads was placed on a rotator for
five minutes.
Two microliters of 10mM dNTP mixture (i.e., 2.5 I each of 10 mM dATP, dGTP,
dCTP and
dTTP) was added and the mixture was incubated for an' additional 10 minutes at
room
temperature. The beads were washed three times with annealing buffer
containing 0.1%
Tween 20 and resuspended in the original volume of annealing buffer.
Fifty microliters of Dynal Streptavidin beads (Dynal Biotech Inc., Lake
Success, NY;
M270 or MyOneTm beads at 10 mg/ml) was washed three tirnes with Annealing
Buffer
containing 0.1% Tween 20 and resuspended in the original volume in Annealing
Buffer
containing 0.1% Tween 20. Then the Dynal bead mixture was added to the
resuspended
sepharose beads. The mixture was vortexed and placed in a rotator for 10
minutes at room
temperature.
The beads were collected on the bottom of the test tube by centrifugation at
2300 g
(500 rpm for Eppendorf Centrifuge 5415D). The beads were resuspended in the
original
volume olArmealing Buffer containing 0.1% Tween 20. The mixture, in a test
tube, was
CA 027730592012-03-26
placed in a magnetic separator (Dynal). The beads were washed three times with
Annealing
Buffer containing 0.1% Tween 20 and resuspended in the original volmne in the
same buffer.
The beads without amplicons were removed by wash steps, as previously
described. Only
Sepharose beads containing the appropriated DNA fragments were retained.
. The magnetic beads were separated from the sepharose beads by addition of
500 gl of
=
0.125 M NaOH. The inixture was vortexed and the magnetic beads were removed by
magnetic separation. The Sepharose beads remaining in solution was transfvued
to another
tube and washed with 400 I of 50 mM Tris Acetate until the pH was stabilized
at 7.6.
Example 7: Nucleic Acid Sequencing Using Bead Emulsion PCR
The following experiment was performed to test the efficacy of the bead
emulsion
PCR. For this protocol, 600,000 Sepharosem beads, with an average diameter of
25-35 gm (as
supplied my the manufacturer) were covalently attached to capture primers at a
ratio of 30-50
million copies per bead. The beads with covakntly attached capture primers
were mixed
with 1.2 million copies of single stranded Adenovirus Library. The library
constructs
included a sequence that was complimentary to the capture primer on the
beads'.
The adenovirus library was annealed to the beads using the procedure &scribed
in
Example 1. Then, the beads were resuspended in complete PCR solution. The PCR
Solution
and beads were emulsified in 2 volumes of spinning emulsification oil using
the same
procedure described in Example 2. The emulsified (encapsulated) beads were
subjected to
amplification by PCR as outlined in Example 3. The emulsion was broken as
outlined in
Example 4. DNA on beads was rendered single stranded, sequencing primer was
annealed
using the procedure of Example 5.
Next, 70,000 beads were sequenced shnultaneously by pyrophosphate sequencing
using a pyrophosphate sequencer from 454 Life Sciences (New Haven, CT) (see co-
pending
application of Lohman et al., filed concurrently herewith entitled Methods of
'Amplifying and
Sequencing Nucleic Acids" USSN 60/476,592 filed June 6, 2003). Multiple
batches of
= 70,000 beads were sequenced and the data were listed in Table 5, below.
Table 5
lamed
Alignment Error Alignments Coverage
Read Error
Tolerance
None Single Multiple Unique
0% 47916 1560 1110 54.98% 0.00%
31
CA 02773059 2012-03-26
5% 46026 3450 2357 83.16% 1.88%
10% 43474 6001 , 1 3742 95.64% 4.36%
Table 5 shows the results obtained from BLAST analysis comparing the sequences
obtained from the pyrophosphate sequencer against Adenovirus sequence. The
first column
shows the error tolerance used in the BLAST program. The last column shows the
real error
as determined by direct comparison to the known sequence.
BEAD EMULSION PCR FOR DOUBLE ENDED SEQUENCING
Example 8: Template Duality Control
As indicated previously, the success of the Emulsion PCR reaction was found to
be
related to the quality of the single stranded template species. Accordingly,
the quality of the
template material was assessed with two separate quality controls before
initiating the
Emulsion PCR protocol. First, an aliquot of the single-stranded template was
run on the 2100
BioAnalyz.er (Agilient). An RNA Pico Chip was used to verify that the sample
included a
heterogeneous population of fragments, ranging in size from approximately 200
to 500 bases.
Second, the library was quantitated using the RiboGreene fluorescence assay on
a Bio-Tek
FL600 plate fluorometer. Samples detennined to have DNA concentrations below 5
ng/ 1
were deemed too dilute for use. -
Example 9: DNA Capture Bead Synthesis
a
Packed beads from a 1 mL N-hydroxysuccinimide ester (NHS)-activated
Sepharoselm
BP affinity column (Amersham Biosciences, Piscataway, NJ) were removed from
the
column. The 30 ¨25 1.,IM size beads were selected by serial passage through 30
and 25 tun
pore filter mesh sections (Sefar Anterica, Depew, NY, USA). Beads that passed
through the
first filter, but were retained by the second were collected and activated as
described in the
product literature (Amersham Phannacia Protocol # 71700600AP). Two different
amine-
labeled HEG (hexaethyleneglycol) long capture primers were obtained,
corresponding to ihe
5' end of the sense and antisense strand of the template to., be amplified,
(5'-Amine-3 HEG
spacers gettacctgaccgacctctgcctateccctgttgcgtgtc-3'; SEQ ID NO:1; and 5'-Amine-
3 HEG
spacers ccattccccagctcgtcftgccatctgttccctccctgtc-3'; SEQ NO:2) (IDT
Technologies, =
Coralville, IA, USA). The primers were designed to capture of both stands of
the
32
CA 02773059 2012-03-26
amplification products to allow double ended sequencing, i.e., sequencing the
first and
second strands of the amplification products. The capture primers were
dissolved in 20 mM
phosphate buffer, pH 8.0, to obtain a final concentration of 1mM. Three
microliters of each
primer were bound to the sieved 30 ¨ 25 gm beads. The beads were then stored
in a bead
storage buffer (50 mM Tris, 0.02% Tween and 0.02% sodium azide, pH 8). The
beads were
quantitated with a hemacytometer (Hausser Scientific, Horsham, PA, USA) and
stored at 4 C
until needed.
Example 10: PCR Reaction Mix Preparation and Formulation
As with any single molecule amplification technique, contamination of the
reactions
with foreign or residual amplicon from other experiments could interfere with
a sequencing
run. To reduce the possibility of contamination, the PCR reaction mix was
prepared in a in a
UV-treated laminar flow hood located in a PCR clean room. For each 600,000
bead
emulsion PCR reaction, the following reagents were mixed in a 1.5 ml tube: 225
gl of
reaction mixture (1X Platinum HiFi Buffer (Invitrogen)), 1 triM dNTPs, 2.5
.mM MgS0.4
(InviOgen), 0.1% BSA, o.cri% Tween , 0.003 U/gl thennostable PPi-ase (NEB),
0.125 gM
forward primer (5'-gcttacctgaccgacctctg-3'; SBQ ID NO:3) and 0.125 uh4 reverse
primer (5'-
N
ccattccccagctcgtottg-3'; SBQ ID NO:4) (]DT Technologies, Coralville, IA, USA)
and 02
U/p1Platialtting Hi-Fi Taq Polymerase (lrivitrogen). Twenty-five microliters
of the reaction
mixture was removed and stored in an individual 200 p.1 PCR tube for use as a
negative
control. Both the reaction mixture and negative controls were stored on ice
until needed.
Example 11: Binding Template Species to DNA Capture Beads
Successful . clonal DNA amplification for sequencing relates to the delivery
of a
controlled number of template species to each bead. For the experiments
described herein
= below, the typical target template concentration was determined to be 0.5
template copies per
capture bead. At this concentration, Poisson distribution dictates that 61% of
the beads have ,
no associated template, 30% have one species of template, and 9% have two or
more
template species. Delivery of excess species can result in the binding and
subsequent
amplification of a mixed population (2 or more species) on a single bead,
preventing the
generation of meaningful sequence data. However, delivery of too few species
will result in
fewer wells containing template (one species per bead), reducing the extent of
sequencing
33
=
CA 02773059 2012-03-26
coverage. Consequently, it was deemed that the single-stranded library
template
concentration was important.
Template nucleic acid molecules were annealed to complimentary primers on the
DNA capture beads by the following method, conducted in a UV-treated laminar
flow hood.
Six hundred thousand DNA capture beads suspended in bead storage buffer (see
Example 9,
above) were transferred to a 200 pl PCR tube. The tube was centrifuged in a
benchtop mini
centrifuge for 10 seconds, rotated 180 , and spun for an additional 10 seconds
to ensure even
pellet formation. The supernatant was removed, and the beads were washed with
200 1 of
Annealing Buffer (20 mM Tris, pH 7.5 and 5 mM magnesium acetate). The tube was
vortexed for 5 seconds to resuspend the beads, and the beads were pelleted as
before. All but
approximately 10 1 of the supernatant above the beads was removed, and an
additional 200
1 of Annealing Buffer was added. The beads were again vortexed for 5 seconds,
allowed to
sit for 1 minute, and then pelleted as before. All but 10 1 of supernatant
was discarded.
= Next, 1.5 pi of 300,000 molecules/p.1 template library was added to the
beads. The
tube was vortexed for 5 seconds to mix the contents, and the templates were
annealed to the
beads in a controlled denaturation/annealing program preformed in an MJ
thermocycler. The
= program allowed incubation for 5 minutes at 80 C, followed by a decrease
by 0.1 C/sec to
70 C, incubation for 1 minute at 70 C, decrease by 0.1 C/sec to 60 C, hold at
60 C for 1
minute, decrease by 0.1 C/sec to 50 C, hold at 50 C for 1 minute, decrease by
0.1 C/sec to
20 C, hold at 20 C. Following completion of the annealing process, the beads
were removed
from the thermocycler, centrifuged as before, and the Annealing Buffer was
carefully
decanted. The capture beads included on average 0.5 copy of single stranded
template DNA
bound to each bead, and were stored on ice until needed.
Example 12: Emulsification
The emulsification process creates a heat-stable water-in-oil emulsion
containing
10,000 discrete PCR microreactors per microliter. This serves as a matrix for
single
molecule, clonal amplification of the individual molecules of the target
library. The reaction
mixture and DNA capture beads for a single reaction were emulsified in the
following
manner. In a UV-treated laminar flow hood, 200 gl of PCR solution (from
Example 10) was
added to the tube containing the 600,000 DNA capture beads (from Example 11).
The beads
were resuspended through repeated pipetting. After this, the PCR-bead mixture
was
34
CA 02773059 2012-03-26
incubated at room temperature for at least 2 minutes, allowing the beads to
equilibrate with
the PCR solutidn. At the same time, 450 I of Emulsion Oil (4.5 % (w:w) Span
80, I%
(w:w) Atlox 4912 (Uniqema, Delaware) in light mineral oil (Sigma)) was
aliquotted into a
flat-topped 2 ml centrifuge tube (Dot Scientific) containing a sterile 1/4
inch magnetic stir bar
(Fischer). This tube was then placed in a custom-made plastic tube holding
jig, which was
then centered on a Fisher Isotemp digital stirring hotplate (Fisher
Scientific) set to 450 RPM.
The PCR-bead solution was vortexed for 15 seconds to resuspend the beads. The
solution was then drawn into a 1 ml disposable plastic syringe (Benton-
Dickenson) affixed
with a plastic safety syringe needle (Henry Schein). The syringe was placed
into a syringe
pump (Cole-Parmer) modified with an aluminum base unit orienting the pump
vertically
rather than horizontally (e.g., Figures 4-6). The tube with the emulsion oil
was aligned on the
stir plate so that it was centered below the plastic syringe needle and the
magnetic stir bar
was spinning properly. The syringe pump was set to dispense 0.6 ml at 5.5
ml/hr. The PCR-
bead solution was added to the emulsion oil in a dropwise fashion. Care was
taken to ensure
that the droplets did not contact the side of the tube as they fell into the
spinning oil.
Once the emulsion was formed, great care was taken to minimize agitation of
the
emulsion during both the emulsification process and the post-emulsification
aliquotting steps.
It was found that vortexing, rapid pipetting, or excessive mixing could cause
the emulsion to
break, destroying the discrete microreactors. In forming the emulsion, the two
solutions
turned into a homogeneous milky white mixture with the viscosity of
mayonnaise. The
contents of the syringe were emptied into the spinning oil. Then, the emulsion
tube was
removed from the holding jig, and gently flicked with a forefinger until any
residual oil layer
at the top of the emulsion disappeared. The tube was replaced in the holding
jig, and stirred
with the magnetic stir bar for an additional minute. The stir bar was removed
from the
emulsion by running a magnetic retrieval tool along the outside of the tube,
and the stir bar
was discarded.
Twenty microliters of the emulsion was taken from the middle of the tube using
a
P100 pipettor and placed on a microscope slide. The larger pipette tips were
used to
minimize shear forces. The emulsion was inspected at 50X magnification to
ensure that it
was comprised predominantly of single beads in 30 to 150 micron diameter
microreactors of
PCR solution in oil (Figure 7). After visual examination, the emulsions were
immediately
amplified.
CA 02773059 2012-03-26
Example 13: Amplification
The emulsion was aliquofted into 7-8 separate PCR tubes. Each tube included
approximately 75 III of the emulsion. The tubes were sealed and placed in a MJ
thermocycler
along with the 25 1.11 negative control described above. The following cycle
times were used:
1 cycle of incubation for 4 minutes at 94 C (Hotstart Initiation), 30 cycles
of incubation for
30 seconds at 94 C, and 150 seconds at 68 C (Amplification), and 40 cycles of
incubation for
30 seconds at 94 C, and 360 seconds at 68 C (Hybridization and Extension).
After
completion of the PCR program, the tubes were removed and the emulsions were
broken
immediately or the reactions were stored at 10 C for up to 16 hours prior to
initiating the
breaking process.
Example 14: Breaking the emulsion and bead recovery
Following amplification, the emulstifications were examined for breakage
(separation
of the oil and water phases). Unbroken emulsions were combined into a single
1.5 ml
microcentrifuge tube, while the occasional broken emulsion was discarded. As
the emulsion
samples were quite viscous, significant amounts remained in each PCR tube. The
emulsion
remaining in the tubes was recovered by adding 75 ttI of mineral oil into each
PCR tube and
pipetting the mixture. This mixture was added to the 1.5 ml tube containing
the bulk of the
emulsified material. The 1.5 ml tube was then vortexed for 30 seconds. After
this, the tube
was centrifuged for 20 minutes in the benchtop microcentrifuge at 13.2K rpm
(full speed).
After centrifugation, the emulsion separated into two phases with a large
white
interface. The clear, upper oil phase was discarded, while the cloudy
interface material was
left in the tube. In a chemical fume hood, 1 ml hexanes was added to the lower
phase and
interface layer. The mixture was vortexed for 1 minute and centrifitged at
full speed for 1
minute in a benchtop microcentrifuge. The top, oil/hexane phase was removed
and
discarded. After this, 1 ml of 80% Ethanol/1X Annealing Buffer was added to
the remaining
aqueous phase, interface, and beads. This mixture was vortexed for 1 minute or
until the
white material from the interface was dissolved. The sample was then
centrifuged in a
benchtop microcentrifuge for 1 minute at full speed. The tube was rotated 180
degrees, and
spun again for an additional minute. The supernatant was then carefully
removed without
disturbing the bead pellet.
36
CA 02773059 2012-03-26
The white bead pellet was washed twice with 1 ml Annealing Buffer containing
0.1%
Tween 20. The wash solution was discarded and the beads were pelleted after
each wash as
described above. The pellet was washed with 1 ml Picopure water. The beads
were pelleted
with the centrifuge-rotate-centrifuge method used previously. The aqueous
phase was
carefully removed. The beads were then washed with 1 ml of 1 mM EDTA as
before, except
that the beads were briefly vortexed at a medium setting for 2 seconds prior
to pelleting and
supernatant removal.
Amplified DNA, immobilized on the capture beads, was treated to obtain single
stranded DNA. The second strand was removed by incubation in a basic melt
solution. One
ml of Melt Solution (0.125 M NaOH, 0.2 M NaC1) was subsequently added to the
beads. The
pellet was resuspended by vortexing at a medium setting for 2 seconds, and the
tube placed in
a Thermolyne LabQuake tube roller for 3 minutes. The beads were then pelleted
as above,
and the supernatant was carefully removed and discarded. The residual Melt
solution was
neutralized by the addition of 1 ml Mmealing Buffer. After this, the beads
were vortexed at
medium speed for 2 seconds. The beads were pelleted, and the supernatant was
removed as.
before. The Annealing Buffer wash was repeated, except that only 800 1 of the
Annealing
Buffer was removed after centrifugation. The beads and remaining Annealing
Buffer were
transferred to a 0.2 ml PCR tube. The beads were used immediately or stored at
4 C for up to
48 hours before continuing on to the enrichment process.
Example 15: Bead Enrichment
The bead mass included beads with amplified, immobilized DNA strands, and
empty
or null beads. As mentioned previously, it was calculated that 61% of the
beads lacked
template DNA during the amplification process. Enrichment was used to
selectively isolate
beads with template DNA, thereby maximizing sequencing efficiency. The
enrichment
process is described in detail below.
The single stranded beads from Example 14 were pelleted with the centrifuge-
rotate-
centrifuge method, and as much supernatant as possible was removed without
disturbing the
beads. Fifteen microliters of Annealing Buffer were added to the beads,
followed by 2 I of
100 M biotinylated, 40 base enrichment primer (5'-Biotin- tetra-
ethyleneglycol spacers
ccattccccagctcgtcttgccatctgttccctccctgtetcag-3'; SEQ ID NO:5). The primer
was
complimentary to the combined amplification and sequencing sites (each 20
bases in length)
37
CA 02773059 2012-03-26
on the 3' end of the bead-immobilized template. The solution was mixed by
vortexing at a
medium setting for 2 seconds, and the enrichment primers were annealed to the
immobilized
DNA strands using a controlled denaturation/annealing program in an MS
thermocycler. The
program consisted of the following cycle times and temperatures: incubation
for 30 seconds
at 65 C, decrease by 0.1 C/sec to 58 C, incubation for 90 seconds at 58 C,
and hold at 10
C.
While the primers were annealing, Dynal MyOne"' streptavidin beads were
resuspend by gentle swirling. Next, 20 ill of the MYOneTM beads were added to
a 1.5 ml
microcentrifuge tube containing 1 ml of Enhancing fluid (2 M NaC1, 10 mM Tris-
HCI, 1 mM
EDTA, pH 7.5). The MyOne bead mixture was vortexed for 5 seconds, and the tube
was
placed in a Dynal MPC-S magnet. The paramagnetic beads were pelleted against
the side of
the microcentrifuge tube. The supernatant was carefully removed and discarded
without
disturbing the MyOneTM beads. The tube was removed from the magnet, and 100 I
of
enhancing fluid was added. The tube was vortexed for 3 seconds to resuspend
the beads, and
stored on ice until needed.
Upon completion of the annealing program, 100 1 of annealing buffer was added
to
the PCR tube containing the DNA capture beads and enrichment primer. The tube
vortexed
for 5 seconds, and the contents were transferred to a fresh 1.5 ml
microcentrifuge tube. The
PCR tube in which the enrichment primer was annealed to the capture beads was
washed
once with 200 I of annealing buffer, and the wash solution was added to the
1.5 ml tube.
The beads were washed three times with 1 ml of annealing buffer, vortexed for
2 seconds,
and pelleted as before. The supernatant was carefully removed. After the third
wash, the
beads were washed twice with 1 ml of ice cold Enhancing fluid. The beads were
vortexed,
pelleted, and the supernatant was removed as before. The beads were
resuspended in 150 pi
ice cold Enhancing fluid and the bead solution was added to the washed MyOneTM
beads.
The bead mixture was vortexed for 3 seconds and incubated at room temperature
for 3
minutes on a LabQuake tube roller. The streptavidin-coated MyOneTm beads were
bound to
the biotinylated enrichment primers annealed to immobilized templates on the
DNA capture
beads. The beads were then centrifuged at 2,000 RPM for 3 minutes, after which
the beads
were vortexed with 2 second pulses until resuspended. The resuspended beads
were placed
on ice for 5 minutes. Following this, 500 I of cold Enhancing fluid was added
to the beads
and the tube was inserted into a Dynal MPC-S magnet. The beads were left
undisturbed for
38
CA 02773059 2012-03-26
60 seconds to allow pelleting against the magnet. After this, the supernatant
with excess
MyOneTm and null DNA capture beads was carefully removed and discarded.
The tube was removed from the MPC-S magnet, and 1 ml of cold enhancing fluid
added to the beads. The beads were resuspended with gentle finger flicking. It
was
important not to vortex the beads at this time, as forceful mixing could break
the link between
the MyOneTM and DNA capture beads. The beads were returned to the magnet, and
the
supernatant removed. This wash was repeated three additional times to ensure
removal of all
null capture beads. To remove the annealed enrichment primers and MyOneTM
beads, the
DNA capture beads were resuspended in 400 I of melting solution, vortexed for
5 seconds,
and pelleted with the magnet. The supernatant with the enriched beads was
transferred to a
separate 1.5 ml microcentrifuge tube. For maximum recovery of the enriched
beads, a
second 400 1.t1 aliquot of melting solution was added to the tube containing
the MyOneTm
beads. The beads were vortexed and pelleted as before. The supernatant from
the second
wash was removed and combined with the first bolus of enriched beads. The tube
of spent
MyOneTm beads was discarded.
The microcentrifuge tube of enriched DNA capture beads was placed on the Dynal
MPC-S magnet to pellet any residual MyOneTM beads. The enriched beads in the
supernatant
were transferred to a second 1.5 ml microcentrifuge tube and centrifuged. The
supernatant
was removed, and the beads were washed 3 times withl ml of annealing buffer to
neutralize
the residual melting solution. After the third wash, 800 I of the supernatant
was removed,
and the remaining beads and solution were transferred to a 0.2 ml PCR tube.
The enriched
beads were centrifuged at 2,000 RPM for 3 minutes and the supernatant
decanted. Next, 20
I of annealing buffer and 3 I of two different 100 M sequencing primers (5%
ccatctgttccctccctgtc-3'; SEQ NO:6; and 5'-cctatcccctgttgegtgtc-3'
phosphate; SEQ ID
NO:7) were added. The tube was vortexed for 5 seconds, and placed in an MJ
thermocycler
for the following 4-stage annealing program: incubation for 5 minutes at 65 C,
decrease by
0.1 C/sec to 50 C, incubation for 1 minute at 50 C, decrease by 0.1 C/sec to
40 C, hold at
40 C for 1 minute, decrease by 0.1 C /sec to 15 C, and hold at 15 C.
Upon completion of the annealing program, the beads were removed from
thermocycler
and pelleted by centrifugation for 10 seconds. The tube was rotated 180% and
spun for an
additional 10 seconds. The supernatant was decanted and discarded, and 200 I
of annealing
buffer was added to the tube. The beads were resuspended with a 5 second
vortex, and
39
CA 02773059 2012-03-26
pelleted as before. The supernatant was removed, and the beads resuspended in
100 1
annealing buffet: At this point, the beads were quantitated with a Multisizer
3 Coulter
Counter (Beekman Coulter). Beads were stored at 4 C and were stable for at
least 1 week.
=
=
=
=
=
=
=
