Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02815566 2014-08-13
PASTEURELLACEAE BACTERIA COMPRISING A
MUTATED VIRULENCE GENE AND AN ANTI-BACTERIAL
VACCINE PREPARED THEREFROM
This is a division of Canadian Patent Application Serial No. 2,366,520 filed
April 6,
2000.
FIELD OF THE INVENTION
The present invention relates generally to the identification of genes
responsible for virulence of Pasteurella multocida and Actinobacilltts
pleuropneumoniae
bacteria. thereby allowing for production of novel attenuated mutant strains
useful in
vaccines and identification ofnew anti-bacterial agents that target the
virulence genes and
their products.
BACKGROUND OF THE INVENTION
The family Pasteurellaceae encompasses several significant pathogens
that infect a wide variety of animals. In addition to P: multocida, prominent
members
of the family include Pasteurella haemolvtica, Actinobacillus
pleztropneumoniae and
Haemophilus somnus. P. multocida is a gram-negative, nonmotile coccobacillus
which
is found in the normal flora of many wild and domestic animals and is known to
cause
disease in numerous animal species worldwide [Biberstein, In M. Kilian, W.
Frederickson, and E. L. Biberstein (ed.), Haemophilus, Pasteurella, and
Actinobacillus.
Academic Press, London, p. 61-73 (1981)]. The disease manifestations following
infection include septicemias, bronchopneumonias, rhinitis, and wound
infections
[Reviewed in Shewen, et al., In C. L. Gyles and C. 0. Thoen (ed.),
Pathovenesis of
Bacterial Infections in Animals. Iowa State University Press, Ames, p. 216-225
(1993).
Infection by P. multocida generally results from invasion during periods
of stress, but transmission may also occur by aerosol or contact exposure, or
via flea and
tick vectors. In fowl, P. multocida infection gives rise to acute to peracute
septicetnia,
particularly prevalent in domestic turkeys and wild waterfowl under stress
conditions
associated with overcrowding, laying, molting, or severe climatic change. In
cattle, a
similar hemorrhagic septicemia follows infection and manifests conditions
including high
fever and depression, generally followed by quick death. Transmission is most
likely
through aerosol contact, but infection can also arise during periods of
significant climatic
change. In rabbits, infection gives rise to recurring purulent rhinitis,
generally followed
by conjunctivitis, otitis media, sinusitis, subcutaneous abscesses, and
chronic
CA 02815566 2013-05-10
bronchopneumonia. In severe infections, rabbit mortality arises from acute
fibrinous
bronchopneumonia. septicemia, or endotoxemia. Disease states normally arise
during
periods of stress. In pigs, common P. inziltocida disease states include
atrophic rhinitis
and bacterial pneumonia. Similar pneumonia conditions are also detected in
dogs, cats,
goats, and sheep. P. nzultocida is commonly detected in oral flora of many
animals and
is therefore a common contaminant in bite and scratch wounds.
P. multocida strains are normally designated by capsular serogroup and
somatic serotype. Five capsular serogroups (A, B, D, E, and F) and 16 somatic
serotypes
are distinguished by expression of characteristic heat-stable antigens. Most
strains are
host specific and rarely infect more than one or two animals. The existence of
different
serotypes presents a problem for vaccination because traditional killed whole
cell bacteria
normally provide only serotype-specific protection. However, it has been
demonstrated
that natural infection with one serotype can lead to immunological protection
against
multiple serotypes [Shewen, et al., In C. L. Gyles and C. 0. Thoen (Ed.),
Pathogenesis
of Bacterial Infections in Animals. Iowa State University Press, Ames, p. 216-
225
(1993)] and cross protection can also be stimulated by using inactivated
bacteria grown
in vivo [Rimier, et al., Am J Vet Res. 42:2117-2121(1981)]. One live
spontaneous
mutant P. multocida strain has been utilized as a vaccine and has been shown
to stimulate
a strong immune response [Davis, Poultry Digest. 20:430-434 (1987), Schlink,
et al.,
Avian Dis. .31(1):13-21 (1987)]. This attenuated strain, however, has been
shown to
revert to a virulent state or cause mortality if the vaccine recipient is
stressed [Davis,
Poultry Digest. 20:430-434 (1987), Schlink, et al., Avian Dis. 31(1):13-21
(1987)].
Another member of the Pasteurella family, A. pleuropneumoniae exhibits
strict host specificity for swine and is the causative agent of highly
contagious porcine
pleuropneumonia. Infection normally arises in intensive breeding conditions,
and is
believed to occur by a direct mode of transmission. The disease is often fatal
and, as a
result, leads to severe economic loss in the swine producing industry. A.
pleuropneumoniae infection may be chronic or acute, and infection is
characterized by
a hemorrhagic, necrotic bronchopneumonia with accompanying fibrinous
pleuritis. To
date, bacterial virulence has been attributed to structural proteins,
including serotype-
specific capsular polysaccharides, lipopolysaccharides, and surface proteins,
as well as
CA 02815566 2013-05-10
extracellular cytolytic toxins. Despite purification and. in some instances
cloning, of
these virulence factors. the exact role of these virulence factors in .4.
pleurapneumomac
infection is poorly understood_
Twelve serotypes of A. pleuropneumoniae have been identified based on
antigenic differences in capsular polvsaccharides and production of
extracellular toxins.
Serotypes 1, 5, and 7 are most relevant to A. pleuropneumoniae infection in
the United
States, while serotypes 1, 2, 5, 7. and 9 are predominant in Europe. There are
at least
three significant extracellular toxins of A. pleuropneumoniae that are members
of the
haemolysin family and are referred to as RTX toxins. RTX toxins are produced
by many
Gram negative bacteria, including E. coil, Proteus vulgarisa, and Pasteurella
haemolytica, and the proteins generally share structural and functional
characteristics.
Toxins from the various serotypes differ, however, in host specificity, target
cells, and
biological activities.
The major A. pleuropneumoniae RTX toxins include ApxI, ApxII, and
ApxIII. ApxI and Apx11 have haemolytic activity, with ApxI being more potent.
ApxIII
shows no haemolytic activity, but is cytotoxic for alveolar macrophages and
neutrophils.
Most A. pleuropneumoniae serotypes produce two of these three toxins. For
example,
serotypes 1, 5, 9, and 11 express ApxI and ApxII, and serotypes 2, 3, 4, 6,
and 8 express
ApxII and ApxIII. Serotype 10, however, produces only ApxI, and serotypes 7
and 12
express only ApxII. Those A. pleuropneumoniae serotypes that produce both ApxI
and
Apxll are the most virulent strains of the bacteria.
The Apx toxins were demonstrated to be virulence factors in murine
models and swine infection using randomly mutated wild type bacteria [Tascon,
et at..
Mol. Microbial. 14:207-216(1994)]. OtherA. pleuropneumoniae mutants have also
been
generated with targeted mutagenesis to inactivate the gene encoding the AopA
outer
membrane virulence protein [Mulks and Buysee, Gene 165:61-66 (1995)].
In attempts to produce vaccine compositions, traditional killed whole
cell bacteria have provided only serotype-specific protection [MacInnes and
Smart,
Actinobacillus and Haemophilus, Pathogenesis of Bacterial Infections in
Animals
(Second Edition) (1986) Iowa State University Press] however, it has been
demonstrated that natural infection with a highly virulent serotype can
stimulate
strong protective immunity against multiple serotypes [Nielsen, Nord Vet Med.
31:407-13 (1979), Nielsen,. Nord Vet Med. 36:221-234 (1984), Nielsen, Can J
Vet
3
CA 02815566 2013-05-10
Res. 29:580-582 (1988), Nielsen. ACTA Vet Scand. 15:80-89(1994)]. One defined
live-
attenuated vaccine strain producing an inactive form of the ApxII toxin has
shown
promise for cross protection in swine [Prideaux. et al.. Infection & Immunity
67:1962-
1966 (1999)], while other undefined live-attenuated mutants have also shown
promise
[Inzana, etal., Infect 'Inman. 61:1682-6, (1993), Paltineanu, et al.. In
International Pig
Veterinary Society, 1992, p. 214, Utrera, et al.. In International Pig
Veterinary Society,
1992, p. 213].
Because of the problems associated with vaccine formulations comprising
bacterial strains with undefined, spontaneous mutations, there exists a need
in the art for
rational construction of live attenuated bacterial strains for use in vaccines
that will safely
stimulate protective immunity against homologous and heterologous P. multocida
and
A. pleuropneumoniae serotypes. There further exists a need to identify
attenuated
bacterial strains and genes required for bacterial virulence, thereby
facilitating
development of methods to identify anti-bacterial agents.
SUMMARY OF THE INVENTION
In general, the present invention provides materials and methods for
production and use of vaccine compositions comprising attenuated gram negative
bacteria. In one aspect, vaccine compositions of the invention comprise
attenuated
species in the Pasteurellaceae family of bacteria, which is known in the art
and
described, in part, in Dewhirst, et al., J Bacteriol. 174-2002-2013 (1992).
Species in the
family include, but are not limited to, A. actinomycetemcomitans, A.
capsulatus, A. equuli,
A. lignieresii, A. pleuropneumoniae (H. pleuropneumoniae), A. seminis, A. suis
(H suis),
A. ureae (p. ureae), A. capsulatus, Bisgaard taxon 11, H aegyptius, H
aphrophilus, H
aphrophilus (H parainfluenzae), H. ducreyi, H haemoglobinophilus, H
haemolyticus, H
influenzae, H paracuniculus, H paragallinarum, H parahaemolyticus, H
parainfluenzae,
(H. paraphrophilus), H. paraphrohaemolyticus, H. paraphrophilus, H parasuis, H
parasuis type 5, H segnis, H somnus, Haemophilus minor group, Haemophilus
taxon C,
P. aerogenes, P. anatis, P. avium (H Avium), P. canis, P. dagmatis, P.
gallinarum, P.
haemolytica, P. trehalosi (P. haemolytica biotype T), P. langaa, P. multocida,
P.
pnegtmotropica, P. stamatis, P.
4
CA 02815566 2013-05-10
volantium (H. parainfizienzaa P. volantium,Pasteurella species A. Pasteurella
species
B. and Haemophilus paraphrohaemolvticus. Preferably, vaccine compositions
comprise
attenuated Pasteurella haemolvtica. Actinobacillus pleuropneumonicie.
Haemophilus
S01711111S, or Pasteurella multocicla bacteria. In a most preferred
embodiment, vaccine
compositions of the invention comprise attenuated Pasteurella multocida and A.
phieropneumoniae bacterial strains.
One aspect of the invention provides gram negative bacterial organisms
containing a functional mutation in a gene sequence represented by any one of
SEQ ID
NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23. 25, 29.31. 33, 37. 39, 41, 51,
53, 55, 57, 58,
60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108. 110, 112,
114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138. 140, 142, 144, 146,
148, 150, 152,
154, 156, 158, 160, 162, 163, and 164, or species homologs thereof, wherein
the mutation
inhibits or abolishes expression and/or biological activity of an encoded gene
product
(i.e., the polypeptide encoded by a gene); said functional mutation resulting
in attenuated
virulence of the bacterial strain. As understood in the art, species homologs
include
genes found in two or more different species which possess substantial
polynucleotide
sequence homology and possess the same, or similar, biological functions
and/or
properties. Preferably polynucleotide sequences which represent species
homologs will
hybridize under moderately stringent conditions, as described herein by
example, and
possess the same or similar biological activities and or properties. In
another aspect,
polynucleotides representing species homologs will share greater than about
60%
sequence homology, greater than about 70% sequence homology, greater than
about 80%
sequence homology, greater than about 90% sequence homology or greater than
about
95% sequence homology. Functional mutations that modulate (i.e., increase or
decrease)
expression and/or biological activity of a gene product include insertions or
deletions in
the protein coding region of the gene itself or in sequences responsible for,
or involved
in, control of gene expression. Deletion mutants include those wherein all or
part of a
specific gene sequence is deleted. In one aspect, the mutation results in
deletion of at
least about 10%, at least about 20%, at least about 30%, at least about 40% at
least about
50%, at least about 60%, at least about 70%, at least about 80%, at least
about 90%, at
least about 95%, at least about 98%, or at least about 99% of said gene. In
another
5
CA 02815566 2013-05-10
aspect, the mutation results in an insertion in the gene. wherein the
insertion causes
decreased expression of a gene product encoded by the mutated gene and/or
expression
of an inactive gene product encoded by the mutated gene. Also contemplated are
compositions, and preferably vaccine compositions, comprising mutated and
attenuated
gram negative bacterial organisms, optionally comprising a suitable adjuvant
and/or a
pharmaceutically acceptable diluent or carrier. In order for a modified strain
to be
effective in a vaccine formulation, the attenuation must be significant enough
to prevent
the pathogen from evoking severe clinical symptoms, but also insignificant
enough to
allow limited replication and growth of the bacteria in the host.
The invention also provides polynucleotides encoding gene products that
are required for virulence in gram negative bacteria. Polynucleotides of the
invention
include DNA, such as complementary DNA, genomic DNA including complementary
or anti-sense DNA, and wholly or partially synthesized DNA; RNA, including
sense and
antisense strands; and peptide nucleic acids as described, for example in
Corey,
TIB TECH 1.5:224-229 (1997). Virulence gene polynucleotides of the invention
include
those set forth in SEQ ID NOs:1, 3, 7,9, 11, 13, 15, 17, 19, 21, 23, 25, 29,
31, 33, 37,39,
41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104,
106, 108, 110,
112,114,116,118,120,122,124, 126,128,130,132,134,135,136,138,140,142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, or species homologs
thereof,
polynucleotides encoding a virulence gene product encoded by a polynucleotide
of SEQ
ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41,
51, 53, 55, 57,
58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112,
114, 116,
118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144,
146, 148, 150,
152, 154, 156, 158, 160, 162, 163, and 164, or a species homolog thereof, and
polynucleotide that hybridize, under moderately to highly stringent
conditions, to the
noncoding strand (or complement) of any one of the polynucleotides set out in
SEQ ID
NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51,
53, 55, 57, 58, '
60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112,
114, 116, 118,
120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146,
148, 150, 152,
154, 156, 158, 160, 162, 163, and 164, species homologs thereof. The invention
therefore comprehends gene sequences from Pasteurellaceae set out in SEQ ID
NOs: 1,
6
CA 02815566 2013-05-10
3, 7, 9, 11, 11 15, 17, 19, 21. 23. 25. 29. 31. 33, 37, 39, 41, 51. 53, 55.
57, 58. 60, 68. 70.
72, 74, 76, 78, 80. 82, 84, 100. 102, 104, 106. 108, 110. 112. 114, 116, 118.
120, 122,
124, 126, 128, 130, 132, 134, 135.136, 138. 140. 142, 144, 146. 148. 150, 152.
154, 156,
158, 160, 162, 163, and 164. as well as related gene sequences from other gram
negative
bacterial organisms, including naturally occurring (i.e., species hornolo2s)
and artificially
induced variants thereof. The invention also comprehends polynucleotides which
encode
polypeptides deduced from any one of the polynucleotides set out in SEQ ID
NOs: 1, 3,
7, 9, 11,13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51. 53, 55. 57,
58, 60, 68, 70,
72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114. 116, 118,
120, 122,
124, 126. 128, 130. 132, 134, 135, 136, 138, 140, 142, 144, 146. 148, 150,
152, 154. 156,
158, 160, and 164, and species homolou thereof. Knowledge of the sequence of a
polynucleotide of the invention makes readily available every possible
fragment of that
polynucleotide. The invention therefore provides fragments of a polynucleotide
of the
invention.
The invention further embraces expression constructs comprising
polynucleotides of the invention. Host cells transformed, transfected or
electroporated
with a polynucleotide of the invention are also contemplated. The invention
provides
methods to produce a polypeptide encoded by a polynucleotide of the invention
comprising the steps of growing a host cell of the invention under conditions
that permit,
and preferably promote, expression of a gene product encoded by the
polynucleotide, and
isolating the gene product from the host cell or the medium of its growth.
Identification of polynucleotides of the invention makes available the
encoded polypeptides. Polypeptides of the invention include full length and
fragment,
or truncated, proteins; variants thereof; fusion, or chimeric proteins; and
analogs,
including those wherein conservative amino acid substitutions have been
introduced into
wild-type polypeptides. Antibodies that specifically recognize polypeptides of
the
invention are also provided, and include monoclonal and polyclonal antibodies,
single
chain antibodies, chimeric antibodies, humanized antibodies, human antibodies,
and
complementary determining region (CDR)-grafted antibodies, as well as
compounds that
include CDR sequences which specifically recognize a polypeptide of the
invention. The
7
CA 02815566 2013-05-10
invention also provides anti-idiotype antibodies immunospecific for antibodies
of the
invention.
According to another aspect of the invention, methods are provided for
identifying novel anti-bacterial agents that modulate the function of gram
negative
bacteria virulence genes or gene products. Methods of the invention include
screening
potential agents for the ability to interfere with expression of virulence
gene products
encoded by the DNA sequences set forth in any one of SEQ ID NOS: 1, 3, 7,9,
11, 13,
15.17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57,58, 60, 68, 70,
72,74, 76, 78,
80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124,
126, 128,
130.132,134,135,136,138, 140, 142, 144, 146,148,150,152,154, 156,158,160.162,
163, and 164, or species homologs thereof, or screening potential agents for
the ability
to interfere with biological function of a bacterial gene product encoded in
whole or in
part by a DNA sequence set forth in any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13,
15, 17,
19, 21, 23, 25,29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74,
76, 78, 80, 82,
84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128,
130, 132,
134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160,
162, 163, and
164, species homologs thereof, or the complementary strand thereof, followed
by
identifying agents that provide positive results in such screening assays. In
particular,
agents that interfere with the expression of virulence gene products include
anti-sense
polynucleotides and ribozymes that are complementary to the virulence gene
sequences.
The invention further embraces methods to modulate transcription of gene
products of
the invention through use of oligonucleotide-directed triplet helix formation.
Agents that interfere with the function of virulence gene products include
variants of virulence gene products, binding partners of the virulence gene
products and
variants of such binding partners, and enzyme inhibitors (where the product is
an
enzyme).
Novel anti-bacterial agents identified by the methods described herein are
provided, as well as methods for treating a subject suffering from infection
with gram
negative bacteria involving administration of such novel anti-bacterial agents
in an
amount effective to reduce bacterial presence.
8
CA 02815566 2013-05-10
_
Numerous additional aspects and advantages of the invention will become
apparent to those skilled in the art upon consideration of the following,
detailed
description of the invention which describes presently prepared embodiments
thereof.
DETAILED DESCRIPTION OF THE INVENTION
"Virulence genes," as used herein, are genes whose function or products
are required for successful establishment and/or maintenance of bacterial
infection in a
host animal. Thus, virulence genes and/or the proteins encoded thereby are
involved in
pathogenesis in the host organism, but may not be necessary for growth.
0
"Signature-tagged mutagenesis (STM)," as used herein, is a method
generally described in International Patent Publication No. WO 96/17951, and
includes,
for example, a method for identifying bacterial genes required for virulence
in a murine
model of bacteremia. In this method, bacterial strains that each have a random
mutation
in the genome are produced using transpo son integration; each insertional
mutation carries
a different DNA signature tag which allows mutants to be differentiated from
each other.
The tags comprise 40 bp variable central regions flanked by invariant "arms"
of 20 bp
which allow the cental portions to be co-amplified by polymerase chain
reaction (PCR).
Tagged mutant strains are assembled in microtiter dishes, then combined to
form the
"inoculum pool" for infection studies. At an appropriate time after
inoculation, bacteria
are isolated from the animal and pooled to form the "recovered pool." The tags
in the
recovered pool and the tags in the inoculum pool are separately amplified,
labeled, and
then used to probe filters arrayed with all of the different tags representing
the mutants in
the inoculum. Mutant strains with attenuated virulence are those which cannot
be
recovered from the infected animal, i.e., strains with tags that give
hybridization signals
when probed with tags from the inoculum pool but not when probed with tags
from the
recovered pool. In a variation of this method, non-radioactive detection
methods such as
chemiluminescence can be used.
Signature-tagged mutagenesis allows a large number of insertional mutant
strains to be screened simultaneously in a single animal for loss of
virulence. Screening
nineteen pools of mutant P. multocida strains resulted in the identification
of more than
60 strains with reduced virulence, many of which were confirmed to be
attenuated in
9
CA 02815566 2013-05-10
virulence by subsequent determination of an approximate LD50 for the
individual
mutants. Screening of A. pleuropneumoniae mutants resulted in identification
of more
than 100 strains having mutations in 35 different genes. Of these, mutations
in 22 genes
results in significantly attenuated A. pleuropneumoniae strains. The
nucleotide sequence
of the open reading frame disrupted by the transposon insertion was determined
by
sequencing both strands and an encoded amino acid sequence was deduced.
Novelty of
both the polynucleotide and amino acid sequences was determined by comparison
of the
sequences with DNA and protein database sequences.
The identification of bacterial, and more particularly P. multocida and A.
pleuropneumoniae virulence genes provides for microorganisms exhibiting
reduced
virulence (i.e., attenuated strains), which are useful in vaccines. Such
microorganisms
include Pasteurellaceae mutants containing at least one functional mutation
inactivating
a gene represented by any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19,
21, 23, 25,
29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80,
82, 84, 100, 102,
104,106,108, 110, 112, 114, 116,118, 120, 122, 124, 126,128, 130,132, 134,
135, 136,
138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164.
The
worker of ordinary skill in the art will realize that a "functional mutation"
may occur in
protein coding regions of a gene of the invention, as well as in regulatory
regions that
modulate transcription of the virulence gene RNA.
The worker of ordinary skill will , also appreciate that attenuated P.
multocida and A. pleuropneumoniae strains of the invention include those
bearing more
than one functional mutation. More than one mutation may result in additive or
synergistic degrees of attenuation. Multiple mutations can be prepared by
design or may
fortuitously arise from a deletion event originally intended to introduce a
single mutation.
An example of an attenuated strain with multiple deletions is a Salmonella
typhimurium
strain wherein the cya and crp genes are functionally deleted. This mutant S.
typhimurium strain has shown promise as a live vaccine.
Identification of virulence genes in P. multocida and A. pleuropneumoniae
can provide information regarding similar genes, i.e., species homologs, in
other
pathogenic species. As an example, identification of the aroA gene led to
identification
of conserved genes in a diverse number of pathogens, including P. haemolytica,
CA 02815566 2013-05-10
Aeronzonas hvdrophila. Aeromonas salmonicida. Salmonella tvphinzurizan.
Salmonella
enteritidis. Salmonella dub/in. Salmonella gallanerzan. Bordello pertussis.
Yersinia
entericoliiica, Aletsseria gonorrhoeae. and Bacillus anthracis. In many of
these species,
attenuated bacterial strains bearing mutations in the aroA gene have proven to
be
effective in vaccine formulations. Using the virulence genes sequences
identified in P.
multocida, similar or homologous genes can be identified in other organisms,
particularly
within the Pasteurella family, as well as A. pleuropneunzoniae and
Haenzophilus sonmus.
Likewise, identification of A. pleuropneumoniae virulence genes can permit
identification of related genes in other organisms. Southern hybridization
using the P.
multocida and A. pleuropneumoniae genes as probes can identify these related
genes in
chromosomal libraries derived from other organisms. Alternatively, PCR can be
equally
effective in gene identification across species boundaries. As still another
alternative,
complementation of, for example, a P. multocida mutant with a chromosomal
library
from other species can also be used to identify genes having the same or
related virulence
activity. Identification of related virulence genes can therefore lead to
production of an
attenuated strain of the other organism which can be useful as still another
vaccine
formulation. Examples of P. multocida genes that have been demonstrated to
exist in
other species (e.g. P. haemolytica, A. pleuropneumoniae and H. somnus) include
genes
exbB, atpG. and pnp
= Attenuated P.
multocida strains identified using STM are insertional
mutants wherein a virulence gene has been rendered non-functional through
insertion of
transposon sequences in either the open reading frame or regulatory DNA
sequences. In
one aspect, therefore, the attenuated P. multocida strains, as well as other
gram-negative
mutant bacterial strains of the invention can bear one or more mutations which
result in
an insertion in the gene, with the insertion causing decreased expression of a
gene
product encoded by the mutated gene and/or expression of an' inactive gene
product
encoded by the mutated gene. These insertional mutants still contain all of
the genetic
information required for bacterial virulence and can possibly revert to a
pathogenic state
by deletion of the inserted transposon. Therefore, in preparing a vaccine
formulation, it
is desirable to take the information gleaned from the attenuated strain and
create a
deletion mutant strain wherein some, most, or all of the virulence gene
sequence is
11
=
CA 02815566 2013-05-10
removed. thereby precluding. the possibility that the bacteria will revert to
a virulent state
The attenuated P. multocula strains, as well as other gram-negative mutant
bacterial
strains of the invention therefore include those bearing one or more mutation
which
results in deletion of at least about 10%, at least about 200/0, at least
about 300/0, at least
about 40% at least about 50%, at least about 60%, at least about 70%, at least
about 80%.
at least about 90%, at least about 95%, at least about 98%, or at least about
99% of the
virulence gene.
The vaccine properties ofan attenuated insertional mutant identified using
STM are expected to be the same or similar to those of a bacteria bearing a
deletion in
the same gene. However, it is possible that an insertion mutation may exert
"polar"
effects on adjoining gene sequences, and as a result, the insertion mutant may
possess
characteristic distinct from a mutant strain with a deletion in the same gene
sequence.
Deletion mutants can be constructed using any of a number of techniques well
known and
routinely practiced in the art.
In one example, a strategy using counterselectable markers can be
employed which has commonly been utilized to delete genes in many bacteria.
For a
review, see, for example, Reyrat, et al., Infection and Immunity 66:4011-4017
(1998),
In this technique, a double selection strategy is often employed wherein a
plasmid is
constructed encoding both a selectable and counterselectable marker, with
flanking DNA
sequences dereived from both sides of the desired deletion. The selectable
marker is used
to select for bacteria in which the plasmid has integrated into the genome in
the
appropriate location and manner. The counterselectable marker is used to
select for the
very small percentage of bacteria that have spontaneously eliminated the
integrated
plasmid. A fraction of these bacteria will then contain only the desired
deletion with no
other foreign DNA present. The key to the use of this technique is the
availability of a
suitable counterselectable marker.
In another technique, the cre-lox system is used for site specific
recombination of DNA. The system consists of 34 base pair lox sequences that
are
recognized by the bacterial cre recombinase gene. If the /ox sites are present
in the DNA
in an appropriate orientation, DNA flanked by the lox sites will be excised by
the cre
recombinase, resulting in the deletion of all sequences except for one
remaining copy of
CA 02815566 2013-05-10
the lay sequence. Using standard recombination techniques, it is possible to
delete the
targeted gene of interest in the P. multocida or A. pleuropneumoniae genome
and to
replace it with a selectable marker (e.g.. a gene coding for kanamycin
resistance) that is
flanked by the lox sites. Transient expression (by electroporation of a
suicide plasmid
containing the cre gene under control of a promoter that functions in P.
nzultocida or A.
pleuropneumoniae) of the ere recombinase should result in efficient
elimination of the
lox flanked marker. This process would result in a mutant containing the
desired deletion
mutation and one copy of the lox sequences.
In another approach, it is possible to directly replace a desired deleted
sequence in the P. multocida or A. pleuropneumoniae genome with a marker gene,
such
as green fluorescent protein (GFP), P-galactosidase, or luciferase. In this
technique,
DNA segments flanking a desired deletion are prepared by PCR and cloned into a
suicide
(non-replicating) vector for P. multocida or A. pleuropneumoniae. An
expression
cassette, containing a promoter active in P. multocida or A. pleuropneumoniae
and the
appropriate marker gene, is cloned between the flanking sequences. The plasmid
is
introduced into wild-type P. multocida or A. pleuropneumoniae. Bacteria that
incorporate and express the marker gene (probably at a very low frequency) are
isolated
and examined for the appropriate recombination event (i.e., replacement of the
wild type
gene with the marker gene).
The reduced virulence of these organisms and their immunogenicity may
be confirmed by administration to a subject animal. While it is possible for
an avirulent
microorganism of the invention to be administered alone, one or more of such
mutant
microorganisms are preferably administered in a vaccine composition containing
suitable
adjuvant(s) and pharmaceutically acceptable diluent(s) or carrier(s). The
carrier(s) must
be "acceptable" in the sense of being compatible with the avimlent
microorganism of the
invention and not deleterious to the subject to be immunized. Typically, the
carriers will
be water or saline which will be sterile and pyrogen free. The subject to be
immunized
is a subject needing protection from a disease caused by a virulent form of P.
multocida,
A. pleuropneumoniae, or other pathogenic microorganisms.
It will be appreciated that the vaccine of the invention may be useful in
the fields of human medicine and veterinary medicine. Thus, the subject to be
13
CA 02815566 2013-05-10
immunized may be a human or other animal. for example, farm animals including
cows,
sheep, pigs, horses, goats and poultry (e.g., chickens, turkeys, ducks and
geese)
companion animals such as dogs and cats-, exotic and/or zoo animals; and
laboratory
animals including mice, rats, rabbits, guinea pigs. and hamsters.
The invention also provides polypeptides and corresponding
polynucleotides required for P. multocida or A. pleuropneumoniae virulence.
The
invention includes both naturally occurring and non-naturally occurring
polynucleotides
and polypeptide products thereof. Naturally occurring virulence products
include
distinct gene and polypeptide species as well as corresponding species
homologs
expressed in organisms other than P. multocida or A. pleuropneumoniae strains.
Non-naturally occurring virulence products include variants of the naturally
occurring
products such as analogs and virulence products which include covalent
modifications.
In a preferred embodiment, the invention provides virulence polynucleotides
comprising
the sequences set forth in SEQ ID NOs: 1,3, 7, 9, 11, 13, 15, 17, 19, 21, 23,
25, 29, 31,
33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84,
100, 102, 104,
106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134,
135, 136, 138,
140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and
species
homologs thereof, and polypeptides having amino acids sequences encoded by the
polynucleotides.
The present invention provides novel purified and isolated P. multocida
and A. pleuropneumoniae polynucleotides (e.g., DNA sequences and RNA
transcripts,
both sense and complementary antisense strands) encoding the bacterial
virulence gene
products. DNA sequences of the invention include genomic and cDNA sequences as
well as wholly or partially chemically synthesized DNA sequences. Genomic DNA
of
the invention comprises the protein coding region for a polypeptide of the
invention and
includes variants that may be found in other bacterial strains of the same
species.
"Synthesized," as used herein and is understood in the art, refers to purely
chemical, as
opposed to enzymatic, methods for producing polynucleotides. "Wholly"
synthesized
DNA sequences are therefore produced entirely by chemical means, and
"partially"
synthesized DNAs embrace those wherein only portions of the resulting DNA were
produced by chemical means. Preferred DNA sequences encoding P. multocida
14
CA 02815566 2013-05-10
virulence gene products are set out in SEQ ID NOs: 1. 3, 7, 9, 11. 13, 15, 17.
19. 21. 23.
25.29. 31. 33, 37, 39, 41, 51, 53. 55, 57, 58, 60, 68, 70. 72, 74, 76, 78, 80.
82, 84, 100,
102, 104, 106, 108, 110. 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130.
132, 134,
135, 136, 138, 140, 142, 144, 146, 148. 150, 152, 154, 156, 158. 160, 162.
163, and 164,
and species homologs thereof. Preferred A: pleuropiezinzoniae DNA seqUences
encoding
virulence gene products are set out in SEQ ID NOs: 122, 124, 126, 128, 130,
132, 134,
135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162,
163, and 164,
and species hornologs thereof. The worker of skill in the art will readily
appreciate that
the preferred DNA of the invention comprises a double stranded molecule, for
example,
molecules having the sequences set forth in SEQ ID NOs: 1, 3, 7,9. 11, 13, 15,
17, 19,
21, 23, 25,29,31,33, 37,39,41,51, 53,55,57,58,60, 68, 70, 72, 74,
76,78,80,82,84,
100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120. 122, 124, 126, 128.
130, 132,
134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160,
162, 163, and
164, and species homologs thereof, along with the complementary molecule (the
"non-
coding strand" or "complement") having a sequence deducible from the sequence
of SEQ
ID NO: 1,3, 7, 9, 11, 13, 15, 17, 19, 21,23,25,29,31,33, 37, 39, 41,
51,53,55,57, 58,
60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112,
114, 116, 118,
and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146,
148, 150,
152, 154, 156, 158, 160, 162, 163, and 164, according to Watson-Crick base
pairing rules
for DNA. Also preferred are polynucleotides encoding the gene products encoded
by any
one of the polynucleotides set out in SEQ
NOs: 1,3, 7,9, 11, 13, 15, 17, 19, 21, 23,
25,29, 31, 33, 37, 39,41, 51, 53, 55, 57, 58, 60,68, 70, 72, 74, 76, 78, 80,
82, 84, 100,
102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130,
132, 134,
135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162,
163, ant1164,
and species homologs thereof. The invention further embraces species,
preferably
bacterial, homologs of the P. multocida and A. pleuropneumoniae DNA.
The polynucleoti de sequence information provided by the invention makes
possible the identification and isolation of polynucleotides encoding related
bacterial
virulence molecules by well known techniques including Southern and/or
Northern
hybridization, and polymerase chain reaction (PCR). Examples
of related
polynucleotides include polynucleotides encoding polypeptides homologous to a
CA 02815566 2013-05-10
virulence gene product encoded by any one of the polynucleotides set out in
SEQ ID
NOs: 1. 3, 7, 9. 11, 13. 15. 17, 19, 21. 23, 25, 29, 31, 33, 37, 39, 41. 51.
53. 55, 57, 58,
60, 68, 70, 72, 74. 76, 78, 80, 82, 84, 100, 102, 104. 106, 108, 110, 112,
114. 116, 118,
and 120, 122, 124, 126, 128, 130, 132, 134. 135, 136, 138, 140, 142, 144, 146,
148, 150,
152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof, and
structurally related polypeptides sharing one or more biological and/or
physical properties
of a virulence gene product of the invention.
The invention also embraces DNA sequences encoding bacterial gene
products which hybridize under moderately to highly stringent conditions to
the
non-coding, strand, or complement, of any one of the polynucleotides set out
in SEQ ID
NOs: 1,3, 7,9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53,
55, 57, 5-8,
60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112,
114, 116, 118,
and 120. 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146,
148, 150,
152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof. DNA
sequences encoding virulence polypeptides which would hybridize thereto but
for the
degeneracy of the genetic code are contemplated by the invention. Exemplary
high
stringency conditions include a final wash in buffer comprising 0.2X SSC/0.1%
SDS, at
65 C to 75 C, while exemplary moderate stringency conditions include a final
wash in
buffer comprising 2X SSC/0.1% SDS, at 35 C to 45 C. It is understood in the
art that
conditions of equivalent stringency can be achieved through variation of
temperature and
buffer, or salt concentration as described in Ausubel, et al. (Eds.),
Protocols in Molecular
Biology, John Wiley & Sons (1994), pp. 6Ø3 to 6.4.10. Modifications in
hybridization
conditions can be empirically determined or precisely calculated based on the
length and
the percentage of guanosine/cytosine (GC) base pairing of the probe. The
hybridization
conditions can be calculated as described in Sambrook, et al., (Eds.),
Molecular Cloning:
A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor,
New
York (1989), pp. 9.47 to 9.51.
Autonomously replicating recombinant expression constructions such as
plasmid and viral DNA vectors incorporating virulence gene sequences are also
provided.
Expression constructs wherein virulence polypeptide-encoding polynucleotides
are
operatively linked to an endogenous or exogenous expression control DNA
sequence and
16
CA 02815566 2013-05-10
a transcription terminator are also provided. The virulence genes may be
cloned by PCR.
using P. multocida genomic DNA as the template. For ease of inserting the
(gene into
expression vectors. PCR primers are chosen so that the PCR-amplified gene has
a
restriction enzyme site at the 5 end preceding the initiation codon ATG, and a
restriction
enzyme site at the .3* end after the termination codon TAG. TGA or TAA. If
desirable,
the codons in the gene are changed, without changing the amino acids,
according to E.
colt codon preference described by Grosjean and Fiers, Gene, 18:199-209
(1982), and
Konigsberg and Godson, Proc. Natl. Acad. Sci. (USA), 80:687-691(1983).
Optimization
of codon usage may lead to an increase in the expression of the gene product
when
produced in E. coil. If the gene product is to be produced extracellularly,
either in the
periplasm of E. coil or other bacteria, or into the cell culture medium, the
gene is cloned
without its initiation codon and placed into an expression vector behind a
signal
sequence.
According to another aspect of the invention, host cells are provided,
including procaryotic and eukaryotic cells, either stably or transiently
transformed,
transfected, or el ectroporated with polynucleotide sequences of the invention
in a manner
which permits expression o f virulence polypeptides of the invention.
Expression systems
of the invention include bacterial, yeast, fungal, viral, invertebrate, and
mammalian cells
systems. Host cells of the invention are a valuable source of immunogen for
development of antibodies specifically immunoreactive with the virulence gene
product.
Host cells of the invention are conspicuously useful in methods for large
scale production
of virulence polypeptides wherein the cells are grown in a suitable culture
medium and
the desired polypeptide products are isolated from the cells or from the
medium in which
the.cells are grown by, for example, irnmunoaffinity purification or any of
the multitude
of purification techniques well known and routinely practiced in the art. Any
suitable
host cell may be used for expression of the gene product, such as E. coli,
other bacteria,
including P. multocida, Bacillus and S. aureus, yeast, including Pichia
pastoris and
Saccharomyces cerevisiae, insect cells, or mammalian cells, including CHO
cells,
utilizing suitable vectors known in the art. Proteins may be produced directly
or fused
to a peptide or polypeptide, and either intracellularly or extracellularly by
secretion into
the periplasmic space of a bacterial cell or into the cell culture medium.
Secretion of a
= 17
CA 02815566 2013-05-10
protein requires a signal peptide (also known as pre-sequence); a number of
signal
sequences from prokaryotes and eukaryotes are known to function for the
secretion of
recombinant proteins. During the protein secretion process, the signal peptide
is removed
by signal peptidase to yield the mature protein.
To simplify the protein purification process. a purification tag may be
added either at the 5' or 3' end of the gene coding sequence. Commonly used
purification tags include a stretch of six histidine residues (U.S. Patent
Nos. 5,284,933
and 5,310,663), a streptavidin-affinity tag described by Schmidt and Skerra,
Protein
Engineering. 6:109-122 (1993), a FLAG peptide [Hopp et al., Biotechnology,
6:1205-
1210 (1988)], glutathione S-transferase [Smith and Johnson, Gene, 67:31-40
(1988)],
and thioredoxin [LaVallie et al.,Bio/Technology, 11:187-193 (1993)]. To remove
these
peptide or polypeptides, a proteolytic cleavage recognition site may be
inserted at the
fusion junction. Commonly used proteases are factor Xa, thrombin, and
enterokinase.
The invention also provides purified and isolated P. multocida and A.
pleuropneumoniae virulence polypeptides encoded by a polynucleotide ofthe
invention.
Presently preferred are polypeptides comprising the amino acid sequences
encoded by
any one of the polynucleotides set out in SEQ ID NOs : 1, 3, 7, 9, 11, 13, 15,
17, 19, 21,
23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76,
78, 80, 82, 84,
100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128,
130, 132,
134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, and
164, and
species homologs thereof. The invention embraces virulence polypeptides
encoded by
a DNA selected from theiroup consisting of: a) the DNA sequence set out in any
one
of SEQ ED NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39,
41, 5453;
55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108,
110, 112, 114,
116, 11.8õ.and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140,
142, 144, 146,
148, 150, 152, 154, 156, 158, 160, and 164, and species homologs thereof; b)
DNA
molecules encoding P. multocida or A. pleuropneumoniae polypeptides encoded by
any one of SEQ
NOs: 1, 3, 7-,-9; 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41,
51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104,
106, 108, 110,
112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135; 136, 138,
140, 142,
144, 146, 148, 150, 152, 154, 156, 158, 160, and 164, and species homologs
thereof; and
18
CA 02815566 2013-05-10
c) a DNA molecule, encoding a virulence gene product. that hybridizes under
moderately
stringent conditions to the DNA of (a) or (b).
The invention also embraces polypeptides, i.e., species homologs and
orthologs, that have at least about 99%,at least about 95%, at least about
90%, at least
about 85%, at least about 80%, at least about 75%, at least about 70%, at
least about
65%, at least about 60%, at least about 55%. and at least about 50% identity
and/or
homology to the preferred polypeptides of the invention. Percent amino acid
sequence
"identity" with respect to the preferred polypeptides of the invention is
defined herein as
the percentage of amino acid residues in the candidate sequence that are
identical with
the residues in the virulence gene product sequence after aligning both
sequences and
introducing gaps, if necessary, to achieve the maximum percent sequence
identity, and
not considering any conservative .substitutions as part of the sequence
identity. Percent
sequence "homology" with respect to the preferred polypeptides of the
invention is
defined herein as the percentage of amino acid residues in the candidate
sequence that are
identical with the residues in one of the virulence polypeptide sequences
after aligning
the sequences and introducing gaps, if necessary, to achieve the maximum
percent
sequence identity, and also considering any conservative substitutions as part
of the
sequence identity. Conservative substitutions can be defined as set out in
Tables A and
B.
Table A
Conservative Substitutions I
SIDE CHAIN CHARACTERISTIC AMINO ACID
Aliphatic Non-polar G A P
I L V
Polar - uncharged CSTM
NQ
Polar - charged D E
KR
Aromatic HFWY
Other NQDE
Polypeptides of the invention may be isolated from natural bacterial cell
sources or may be chemically synthesized, but are preferably produced by
recombinant
19
CA 02815566 2013-05-10
procedures involving host cells of the invention. Virulence gene products of
the
invention may be full length polypeptides, biologically active fragments, or
variants
thereof which retain specific biological or immunological activity. Variants
may
comprise virulence polypeptide analogs wherein one or more of the specified
(i.e.,
naturally encoded) amino acids is deleted or replaced or wherein one or more
non-specified amino acids are added: (1) without loss of one or more of the
biological
activities or immunological characteristics specific for the virulence gene
product; or (2)
with specific disablement ofa particular biological activity of the virulence
gene product.
Deletion variants contemplated also include fragments lacking portions of the
polypeptide not essential for biological activity, and insertion variants
include fusion
polypeptides in which the wild-type polypeptide or fragment thereof have been
fused to
another polypeptide.
Variant virulence polypeptides include those wherein conservative
substitutions have been introduced by modification of polynucleotides encoding
polypeptides of the invention. Conservative substitutions are recognized in
the art to
classify amino acids according to their related physical properties and can be
defined as
set out in Table A (from WO 97/09433, page 10). Alternatively, conservative
amino acids
can be grouped as defined in Lehninger, [Biochemistry, Second Edition; Worth
Publishers,
Inc. NY:NY (1975), pp.71-77] as set out in Table B.
20
CA 02815566 2013-05-10
Table B
Conservative Substitutions II
SIDE CHAIN
CHARACTERISTIC AMINO ACID
Non-polar (hydrophobic)
A. Aliphatic: ALIVP
B. Aromatic: F W
C. Sulfur-containing:
D. Borderline:
Uncharged-polar
A. Hydroxyl: STY
B. Amides: NQ
C. Sulfhydryl:
D. Borderline:
Positively Charged (Basic): K R H
Negatively Charged (Acidic):
DE
Variant virulence products of the invention include mature virulence gene
products, i.e., wherein leader or signal sequences are removed, having
additional amino
terminal residues. Virulence gene products having an additional methionine
residue at
position -1 are contemplated, as are virulence products having additional
methionine and
lysine residues at positions -2 and -1. Variants of these types are
particularly useful for
recombinant protein production in bacterial cell types. Variants of the
invention also
nclude gene products wherein amino terminal sequences derived from other
proteins have
been introduced, as well as variants comprising amino terminal sequences that
are not
found in naturally occurring proteins.
The invention also embraces variant polypeptides having additional amino
acid residues which result from use of specific expression systems. For
example, use of
commercially available vectors that express a desired polypeptide as a fusion
protein with
glutathione-S-transferase (GST) provide the desired polypeptide having an
additional
glycine residue at position -1 following cleavage of the GST component from
the desired
polypeptide. Variants which result from expression using other vector systems
are also
contemplated.
Also comprehended by the present invention are antibodies (e.g.,
monoclonal and polyclonal antibodies, single chain antibodies, chimeric
antibodies,
21
CA 02815566 2013-05-10
humanized, human, and CDR-grafted antibodies. including compounds which
include
CDR sequences which specifically recognize a polypeptide of the invention) and
other
binding proteins specific for virulence gene products or fragments thereof.
The term
"specific for" indicates that the variable regions of the antibodies of the
invention
recognize and bind a virulence polypeptide exclusively (i.e., are able to
distinguish a
single virulence polypeptides from related virulence polypeptides despite
sequence
identity, homology, or similarity found in the family of polypeptides), but
may also
interact with other proteins (for example. S. aureits protein A or other
antibodies in
ELISA techniques) through interactions with sequences outside the variable
region of the
antibodies, and in particular, in the constant region of the molecule.
Screening assays to
determine binding specificity of an antibody of the invention are well known
and
routinely practiced in the art. Fora comprehensive discussion of such assays,
see Harlow
et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory;
Cold
Spring Harbor , NY (1988), Chapter 6. Antibodies that recognize and bind
fragments
of the virulence polypeptides of the invention are also contemplated, provided
that the
antibodies are first and foremost specific for, as defined above, a virulence
polypeptide
of the invention from which the fragment was derived.
The DNA and amino acid sequence information provided by the present
invention also makes possible the systematic analysis of the structure and
function of the
virulence genes and their encoded gene products. Knowledge of a polynucleotide
encoding a virulence gene product of the invention also makes available anti-
sense
polynucleotides which recognize and hybridize to polynucleotides encoding a
virulence
polypeptide of the invention. Full length and fragment anti-sense
polynucleotides are
provided. The worker of ordinary skill will appreciate that fragment anti-
sense molecules
of the invention include (i) those which specifically recognize and hybridize
to a specific
RNA (as determined by sequence comparison of DNA encoding a virulence
polypeptide
of the invention to DNA encoding other known molecules) as well as (ii) those
which
recognize and hybridize to RNA encoding variants of the family of virulence
proteins.
Antisense polynucleotides that hybridize to RNA encoding other members of the
virulence family of proteins are also identifiable through sequence comparison
to identify
characteristic, or signature, sequences for the family of molecules.
22
CA 02815566 2013-05-10
The invention further contemplates methods to modulate slime expression
through use of ribozymes. For a review. see Gibson and Shillitoe. Mol.
Biotech. 7:125-
137 (1997). Ribozyme technology can be utilized to inhibit translation of mRNA
in a
sequence specific manner through (i) the hybridization of a complementary RNA
to a
target mRNA and (ii) cleavage of the hybridized mRNA through nuclease activity
inherent to the complementary strand. Ribozymes can be identified by empirical
methods
but more preferably are specifically designed based on accessible sites on the
target
mRNA [Bramlage, et al.. Trends in Biotech 16:434-438 (1998)]. Delivery
ofribozymes
to target cells can be accomplished using either exogenous or endogenous
delivery
techniques well known and routinely practiced in the art. Exogenous delivery
methods
can include use of targeting liposomes or direct local injection. Endogenous
methods
include use of viral vectors and non-viral plasmids.
Ribozymes can specifically modulate expression of virulence genes when
designed to be complementary to regions unique to a polynucleotide encoding a
virulence
gene product. "Specifically modulate" therefore is intended to mean that
ribozymes of
the invention recognizes only a single polynucleotide. Similarly, ribozymes
can be
designed to modulate expression of all or some of a family of proteins.
Ribozymes of
this type are designed to recognize polynucleotide sequences conserved in all
or some of
the polynucleotides which encode the family of proteins.
The invention further embraces methods to modulate transcription of a
virulence gene of the invention through use of oligonucleotide-directed
triplet helix
formation. For a review, see Lavrovsky, et al., Biochern. Mol. Med. 62:11-22
(1997).
Triplet helix, formation is accomplished using sequence specific
oligonucleotides which
hybridize to double stranded DNA in the major groove as defined in the Watson-
Crick
model. Hybridization of a sequence specific oligonucleotide can thereafter
modulate
activity of DNA-binding proteins, including, for example, transcription
factors and
polymerases. Preferred target sequences for hybridization include
transcriptional
regulatory regions that modulate virulence gene product expression.
Oligonucleotides
which are capable of triplet helix formation are also useful for site-specific
covalent
modification of target DNA sequences. Oligonucleotides useful for covalent
23
CA 02815566 2013-05-10
modification are coupled to various DNA damaging agents as described in
Lavrovskv,
et al. [supra].
The identification of P. multocida and A. pleuropneumoniae virulence
genes renders the genes and gene products useful in methods for identifying
anti-bacterial
agents. Such methods include assaying potential agents for the ability to
interfere with
expression of virulence gene products represented by the DNA sequences set
forth in any
one of SEQ ID NOS: 1,3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37.
39, 41, 51,
53, 55. 57, 58, 60, 68, 70, 72, 74. 76, 78, 80, 82, 84, 100, 102, 104, 106,
108, 110, 112,
114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 13-6, -138,
140, 142, 144,
146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and-164, and species
homologs thereof
(i.e., the genes represented by DNA sequences of SEQ ID NOS: 1, 3, 7, 9, 11,
13, 15, 17,
19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72,
74, 76, 78, 80,82,
84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126,
128, 130,
132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158,
160, 162, 163,
and 164, encode the virulence gene product, or the DNA sequences of SEQ ID
NOS: 1,
3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55,
57, 58, 60, 68, 70,
72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,
and 120,
122, 124, 126, 128, 130, 132, 134õ.135, 136, 138, 140, 142, 144, 146, 148,
150, 152, 154,
156, 158, 160, 162, 163, and 164, are adjacent the gene encoding the virulence
gene
product, or are involved in regulation of expression of the virulence gene
product), or
assaying potential agents for the ability to interfere with the function of a
bacterial gene
product encoded in whole or in part by a DNA sequence set forth in any one of
SEQ ID
NOs: 1,3, 7,9, II, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53,
55,-57, 58,
60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112,
114, 116, 1 1 a,
and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146,
148, 150,
152, 154, 156, 158, 160, 162, 163, and 164, species homologs thereof, or the
complementary strand thereof, followed by identifying agents that are positive
in such
assays. Polynucleotides and polypeptides useful in these assays include not
only the
genes and encoded polypeptides as disclosed herein, but also variants thereof
that have
substantially the same activity as the wild-type genes and polypeptides.
24
CA 02815566 2013-05-10
The virulence gene products produced by the methods described above are
used in high throughput assays to screen for inhibitory agents. The sources
for potential
agents to be screened are chemical compound libraries, fermentation media of
Streptonnweles. other bacteria and fungi, and cell extracts ofplants and other
vegetations.
For proteins with known enzymatic activity, assays are established based on
the activity,
and a large number of potential agents are screened for ability to inhibit the
activity. For
proteins that interact with another protein or nucleic acid, binding assays
are established
to measure such interaction directly, and the potential agents are screened
for ability to
inhibit the binding interaction.
The use of different assays known in the art is contemplated according to
this aspect of the invention. When the function of the virulence gene product
is known
or predicted by sequence similarity to a known gene product, potential
inhibitors can be
screened in enzymatic or other types of biological and/or biochemical assays
keyed to the
function and/or properties of the gene product. When the virulence gene
product is
known or predicted by sequence similarity to a known gene product to interact
with
another protein or nucleic acid, inhibitors of the interaction can be screened
directly in
binding assays. The invention contemplates a multitude of assays to screen and
identify
inhibitors of binding by the virulence gene product. In one example, the
virulence gene
product is immobilized and interaction with a binding partner is assessed in
the presence
and absence of a putative inhibitor compound. In another example, interaction
between
the virulence gene product and its binding partner is assessed in a solution
assay, both in
the presence and absence of a putative inhibitor compound. In both assays, an
inhibitor
is identified as a compound that decreases binding between the virulence gene
product
and its binding partner. Other assays are also contemplated in those instances
wherein
the virulence gene product binding partner is a protein. For example,
variations of the
di-hybrid assay are contemplated wherein an inhibitor of protein/protein
interactions is
identified by detection of a positive signal in a transformed or transfected
host cell as
described in PCT publication number WO 95/20652, published August 3, 1995.
Candidate inhibitors contemplated by the invention include compounds
selected from libraries of potential inhibitors. There are a number of
different libraries
used for the identification of small molecule modulators, including: (1)
chemical
CA 02815566 2013-05-10
libraries. (2) natural product libraries. and (3) combinatorial libraries
comprised of
random peptides, oli2onucleotides or organic molecules. Chemical libraries
consist of
structural analogs of known compounds or compounds that are identified as
"hits" or
"leads" via natural product screening. Natural product libraries are
collections of
microorganisms, animals, plants, or marine organisms which are used to create
mixtures
for screening by: (1) fermentation and extraction of broths from soil, plant
or marine
microorganisms or (2) extraction of plants or marine organisms. Natural
product
libraries include polyketides. non-ribosomal peptides, and variants (non-
naturally
occurring) thereof. For a review, see Science 282:63-68 (1998). Combinatorial
libraries
are composed of large numbers of peptides, oli2onucleotides, or organic
compounds as
a mixture. They are relatively easy to prepare by traditional automated
synthesis
methods, PCR, cloning, or proprietary synthetic methods. Of particular
interest are
peptide and oligonucleotide combinatorial libraries. Still other libraries of
interest
include peptide, protein, peptidomimetic, multiparallel synthetic collection,
recombinatorial, and polypeptide libraries. For a review of combinatorial
chemistry and
libraries created therefrom, see Myers, Curr. Opin. Biotechnol. 8:701-707
(1997).
Identification of modulators through use of the various libraries described
herein permits
modification of the candidate "hit" (or "lead") to optimize the capacity of
the "hit" to
modulate activity.
Still other candidate inhibitors contemplated by the invention can be
designed and include soluble forms of binding partners, as well as binding
partners as
chimeric, or fusion, proteins. Binding partners as used herein broadly
encompasses
antibodies, antibody fragments, and modified compounds comprising antibody
domains
that are immunospecific for the expression product of the identified virulence
gene.
Other assays may be used when a binding partner (i.e., ligand) for the
virulence gene product is not known, including assays that identify binding
partners of
the target protein through measuring direct binding of test binding partner to
the target
protein, and assays that identify binding partners of target proteins through
affinity
ultrafiltration with ion spray mass spectroscopy/HPLC methods or other
physical and
analytical methods. Alternatively, such binding interactions are evaluated
indirectly
using the yeast two-hybrid system described in Fields and Song, Nature,
340:245-246
26
CA 02815566 2013-05-10
(1989), and Fields and Sterriglanz, Trends in Genetics, 10:286-292(1994). The
two-hybrid
system is a genetic assay for detecting interactions between two proteins or
polypeptides.
It can be used to identify proteins that bind to a known protein of interest,
or to delineate
domains or residues critical for an interaction. Variations on this
methodology have been
developed to clone genes that encode DNA-binding proteins, to identify
peptides that bind
to a protein, and to screen for drugs. The two-hybrid system exploits the
ability of a pair
of interacting proteins to bring a transcription activation domain into close
proximity with
a DNA-binding domain that binds to an upstream activation sequence (UAS) of a
reporter
gene, and is generally performed in yeast. The assay requires the construction
of two
hybrid genes encoding (1) a DNA-binding domain that is fused to a first
protein and (2)
an activation domain fused to a second protein. The DNA-binding domain targets
the first
hybrid protein to the UAS of the reporter gene; however, because most proteins
lack an
activation domain, this DNA-binding hybrid protein does not activate
transcription o f the
reporter gene. The second hybrid protein, which contains the activation
domain, cannot
by itself activate expression of the reporter gene because it does not bind
the UAS.
However, when both hybrid proteins are present, the noncovalent interaction of
the first
and second proteins tethers the activation domain to the UAS, activating
transcription of
the reporter gene. When the virulence gene product (the first protein, for
example) is
already known to interact with another protein or nucleic acid, this assay can
be used to
detect agents that interfere with the binding interaction. Expression of the
reporter gene
is monitored as different test agents are added to the system; the presence of
an inhibitory
agent results in lack of a reporter signal.
When the function of the virulence gene product is unknown and no
ligands are known to bind the gene product, the yeast two-hybrid assay can
also be used
to identify proteins that bind to the gene product. In an assay to identify
proteins that
bind to the first protein (the target protein), a large number of hybrid genes
each encoding
different second proteins are produced and screened in the assay. Typically,
the second
protein is encoded by a pool of plasmids in which total cDNA or genomic DNA is
ligated
to the activation domain. This system is applicable to a wide variety of
proteins, and it
is not even necessary to know the identity or function of the second binding
protein. The
27
CA 02815566 2013-05-10
system is highly sensitive and can detect interactions not revealed by other
methods: even
transient interactions may trigger transcription to produce a stable niRNA
that can be
repeatedly translated to yield the reporter protein.
Other assays may be used to search for agents that bind to the target
protein. One such screening method to identify direct binding of test ligands
to a target
protein is described in U.S. Patent No. 5,585,277. This method relies on the
principle that
proteins generally exist as a mixture of folded and unfolded states, and
continually
alternate between the two states. When a test ligand binds to the folded form
of a target
protein (i.e., when the test ligand is a ligand of the target protein), the
target protein
molecule bound by the ligand remains in its folded state. Thus, the folded
target protein
is present to a greater extent in the presence of a test ligand which binds
the target protein,
than in the absence of a ligand. Binding of the ligand to the target protein
can be
determined by any method which distinguishes between the folded and unfolded
states of
the target protein. The function of the target protein need not be known in
order for this
assay to be performed. Virtually any agent can be assessed by this method as a
test ligand,
including, but not limited to, metals, polypeptides, proteins, lipids,
polysaccharides,
polynucleotides and small organic molecules.
Another method for identifying ligands for a target protein is described in
Wieboldt
etal., Anal. Chem., 69:1683-1691 (1997). This technique screens combinatorial
libraries
of 20-30 agents at a time in solution phase for binding to the target protein.
Agents that
bind to the target protein are separated from other library components by
centrifugal
ultrafiltration. The specifically selected molecules that are retained on the
filter are
subsequently liberated from the target protein and analyzed by HPLC and
pneumatically
assisted electrospray (ion spray) ionization mass spectroscopy. This procedure
selects
library components with the greatest affinity for the target protein, and is
particularly
useful for small molecule libraries.
The inhibitors/binders identified by the initial screens are evaluated for
their effect on virulence in in vivo mouse models of P. multocida infections.
Models of
bacteremia, endocarditis, septic arthritis, soft tissue abscess, or pneumonia
may be
utilized. Models involving use of other animals are also comprehended by the
invention.
28
CA 02815566 2013-05-10
For example. rabbits can be challenged with a wild type P. multocida strain
before or
after administration of varying amounts o fa putative inhibitor/binder
compound. Control
animals, administered only saline instead of putative inhibitor/binder
compound provide
a standard by which deterioration of the test animal can be determined. Other
animal
models include those described in the Animal and Plant Health Inspection
Sevice.
USDA, January 1, 1994 Edition, 113.69-113.70; Panciera and Corstvet. Am. J.
Vet.
Res. 45:2532-2537; Ames, et al., Can. J. Comp. Med. 49:395-400(1984); and
Mukkur.
Infection and Immunitv /8:583-585 (1977). Inhibitors/binders that interfere
with
bacterial virulence are can prevent the establishment of an infection or
reverse the
outcome of an infection once it is established.
Any adjuvant known in the art may be used in the vaccine composition,
including oil-based adjuvants such as Freund's Complete Adjuvant and Freund's
Incomplete Adjuvant, mycolate-based adjuvants (e.g., trehalose dimycolate),
bacterial
lipopolysaccharide (LPS), peptidoglycans (i.e., mureins, mucopeptides, or
glycoproteins
such as N-Opaca, muramyl dipeptide [MDP], or MDP analogs), proteoglycans
(e.g.,
extracted from Klebsiella pneumoniae), streptococcal preparations (e.g.,
0K432),
BiostimTM (e.g., 01K2), the "Iscoms" of EP 109 942, EP 180 564 and EP 231 039,
aluminum hydroxide, saponin, DEAE-dextran, neutral oils (such as miglyol),
vegetable
oils (such as arachis oil), liposomes, Pluronic polyols, the Ribi adjuvant
system (see,
for example GB-A-2 189 141), or interleukins, particularly those that
stimulate cell
mediated immunity. An alternative adjuvant consisting of extracts of
Amycolata, a
bacterial genus in the order Actinomycetales, has been described in U.S.
Patent No.
4,877,612. Additionally, proprietary adjuvant mixtures are commercially
available. The
adjuvant used will depend, in part, on the recipient organism. The amount of
adjuvant
to administer will depend on the type and size of animal. Optimal dosages may
be
readily determined by routine methods.
The vaccine compositions optionally may include vaccine-compatible
pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid,
or solid
diluents that serve as pharmaceutical vehicles, excipients, or media. Any
diluent known
in the art may be used. Exemplary diluents include, but are not limited to,
polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and
29
CA 02815566 2013-05-10
propylhydroxybenzoate. talc, alginates, starches, lactose, sucrose, dextrose,
sorbitol.
mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil
oftheobroma.
The vaccine compositions can be packaged in forms convenient for
delivery. The compositions can be enclosed within a capsule, caplet, sachet,
cachet,
gelatin, paper, or other container. These delivery forms are preferred when
compatible
with entry of the immunogenic composition into the recipient organism and,
particularly,
when the immunogenic composition is being delivered in unit dose form. The
dosage
units can be packaged, e.g., in tablets, capsules, suppositories or cachets.
The vaccine compositions may be introduced into the subject to be
immunized by any conventional method including, e.g.. by intravenous,
intradermal,
intramuscular, intramammary, intraperitoneal, or subcutaneous injection; by
oral,
sublingual, nasal, anal, or vaginal, delivery. The treatment may consist of a
single dose
or a plurality of doses over a period of time.
The invention also comprehends use of an attenuated bacterial strain of
the invention for manufacture of a vaccine medicament to prevent or alleviate
bacterial
infection and/or symptoms associated therewith. The invention also provides
use of
inhibitors of the invention for manufacture of a medicament to prevent or
alleviate
bacterial infection and/or symptoms associated therewith.
The present invention is illustrated by the following examples. Example
1 describes constructions of P multocida mutants. Example 2 relates to
screening for P.
multocida mutants. Example 3 addresses methods to determine virulence of the P
multocida mutants. Example 4 describes cloning of P. multocida virulence
genes.
Example 5 addresses identification of genes in other species related to P.
multocida
virulence genes. Example 6 describes construction of A. pleuropneumoniae
mutants.
Example 7 addresses screening for attenuated A. pleuropneumoniae mutants.
Example
8 relates to identification ofA. pleuropneumoniae virulence genes. Example 9
describes
competition challenge of A. pleuropneumoniae mutants and wild type bacteria.
Example
10 characterizes A. pleuropneumoniae genes identified. Example 11 addresses
efficacy
of A. pleuropneumoniae mutant to protect against wild type bacterial
challenge.
30
CA 02815566 2013-05-10
Example 1
Construction of a Library of Tagged-Transposon P. multocida Mutants
A library oftag2ed-transposon mutants was constructed in parental vector
pLOPI(m [Herrero, etal.. J Bactertol. I 7 2:6557 -67 (1990)1 which has
previously been
demonstrated to be functional and random in P. Inaltocida [Lee, et al., Vet
Alicrobiol.
50:143-8 (1996)]. Plasmid pLOF/Km was constructed as a modification of suicide
vector
pGP704 and included a transposase gene under control of the Tac promoter as
well as the
= mini-Tn10 transposable element encoding kanarnycin resistance.
Plasmid pTEF-1 was =
constructed as described below by modifying pLOF/Km to accept sequence tags
which
contained a semi-random [NK]35 sequence.
Plasmid pLOF/Km was first modified to eliminate the unique Kpnl
restriction site in the multiple cloning region and then to introduce a new
Kpill site in the
mini-Tn10 region. The plasmid was digested with 4111 and the resulting
overhanging
ends were filled in with Klenow polymerase according to manufacturer's
suggested
protocol. Restriction digests and ligations described herein were performed
according
to manufacturer's suggested protocols (Gibco BRL, Gaithersburg, MD and
Boehringer
Mannheim, Indianapolis, IN). The blunt end product was self-ligated to produce
a
plasmid designated pLOF/Krn--KpnI which was transformed into E.coli DH5a:Apir
for
amplification. E.coli DH5a: (),pir (1)80dlacZAM15, recAl, endAl, gyrA96, thi-
1,
hsdR17(rk-, mk, supE44, relAl, deoR, A(1acZYA-argF)U169, was propagated at 37
C
in Luria-Bertani (LB) medium. Plasmids were prepared using QIAGEN%pinPreptfrom
Q1AGEN Inc. (Santa Clarita, CA) and digested with SfiI which cuts at a unique
site
within the mini-Tn10 transposable element. A Sfir-KpnI-SfiI adaptor was
prepared by
annealing oligonucleotides TEF1 (SEQ ID NO: 86) and TEF3 (SEQ ID NO:,87) and
the
resulting double-stranded adapter was ligated into the SfiI site to create
plasmid pTEF-1.
Oligonucleotides TEF1 and TEF3 (as well as all other oligonucleotides
described herein)
were synthesized by Genosys Biotechnologies (The Woodlands, TX).
TEF1 5 -AGGCCGGTACCGGCCGCCT SEQ ID NO:, 86
TEF3 5'-CGGCCGGTACCGGCCTAGG SEQ ID NO: 87
*Trade-mark
31
CA 02815566 2013-05-10
Unique sequence tags for insertion into the Kpirl site of pTEF-1 were
prepared as follows. PCR was carried out to generate double stranded DNA tags
using
a GeneAmp XL PCR Kit (PE Applied Biosystems, Foster City, CA) under conditions
including 250 EIM each dNTP, 1.5 mM Mg(0Ac)2, 100 pmol each primer TEF14 (SEQ
ID NO: 88) and TEF15 (SEQ ID NO: 89), 1 riv. TEF26 (SEQ ID NO: 90) as template
DNA and 2.5 units recombinant T112 DNA Polymerase XL.
TEF14 5'-CATGGTACCCATTCTAAC
SEQ ID NO: 88
TEF15 -CTAGGTACCTACAACCTC SEQ ID NO: 89
TEF26 SEQ ID NO: 90
5.-CTAGGTACCTACAACCTCAAGCTT-NK.}35-
AAGCTIGGTTAGAATGGGTACCATG
Reaction conditions included an initial incubation at 95 C for one minute,
followed by
thirty cycles of 30 seconds at 95 C, 45 seconds at 45 C, and 15 seconds at 72
C,
followed by a final incubation at 72 C for two minutes. The PCR products were
digested with Kim' and purified using a QIAGEN Nucleotide Removal Kit (QIAGEN,
Inc., Chatsworth, GA) according to the manufacturer's suggested protocol. The
unique
tag sequences were ligated into the mini-Tn10 element of linearized pTEF-1,
previously
digested with Kpnl and dephosphorylated with calf intestinal alkaline
phosphatase
(Boehringer Mannheim) using standard procedures. The resulting plasmid library
was
transformed into E.coli DH5a:),.pir. Colony blot analysis was performed
according to
the DIG *Users Guide (Boehringer-Mannheim) with hybridization and detection
performed as follows.
Hybridizations were essentially performed according to the Genius Non-
Radioactive User's Guide (Boehringer Mannheim Biochemicals), the product sheet
for
the DIG-PCR labeling kit (Boehringer Mannheim Biochemicals), and the product
sheet
for CSPD (Boehringer Mannheim Biochemicals). For preparation of probes, a 100
I
primary PCR reaction was set up using Amplitaqt'CR buffet(PE Applied
Biosystems),
*Trade-mark .
32
CA 02815566 2013-05-10
200 p.IVI dNTPs, 140 pmol each of primers TEF5 (SEQ ID NO: 91) and TEF6 (SEQ
ID
NO: 92), 2 mM MgC12, 2.5 units Amplitaq (PE Applied Biosystems) and I ricz
ofplasmid
DNA.
TEF5 5.-TACCTACAACCTCAAGCT SEQ
ID NO: 91
TEF6 5'-
TACCCATTCTAACCAAGC SEQ ID NO: 92
Cycle conditions included an initial incubation at 95 C for two minutes,
followed by 35
cycles of 95 C for 30 seconds, 50 C for 45 seconds, 72 C for 15 seconds and a
final
incubation at 72 C for three minutes. The amplification products were
separated using
electrophoresis on a 2% - 3:1 NuSieve GTG (FMC BioProducts, Rockland, ME,
USA):Agarose gel and the 109 bp product was excised and purified. Gel
extractions
were carried out using a QIAGEN Gel Extraction kit (QIAGEN). Approximately 15
ng
of-the primary product was labeled in a 50 I.Ll PCR reaction using the DIG PCR
Kit, 50
pmol each of primers TEF24 and TEF25, and a 1:1 mix of DIG Probe Synthesis Mix
with
2 mM dNTP stock solution.
TEF24 5 '-
TACCTACAACCTCAAGCTT SEQ ID NO: 93
TEF25 -
TACCCATTCTAACCAAGCTT SEQ lID NO: 94
PCR conditions included an initial incubation at 95 C for four minutes,
followed by 25
cycles of 95 C for 30 seconds, 50 C for 45 seconds, 72 C for 15 seconds and a
final
incubation at 72 C for three minutes. The labeled PCR product was digested
with
HindIII in a total reaction volume of 90 ill and purified from the constant
primer arms
using a 2% - 3:1 NuSieve GIG (FMC BioProducts):Agarose gel. The region
containing
the labeled variable tag was excised and the entire gel slice was dissolved
and denatured
in 10 ml of DIG EasyHyb*at 95 C for ten minutes.
Dot blots were prepared using a Hybond -1\1' membrane (Amersham-
Pharmacia Biotech). Target DNA for each tag was prepared in 96 well plates
using
*Trademark
33
CA 02815566 2013-05-10
approximately 30 ng of PCR product. An equal volume of 0.1 N NaOH was added to
denature the sample and each sample was applied to the membrane with minimal
vacuum
using a Minifold ITN' Dot-Blot Apparatus from Schleicher and Schuell (Keene,
NH,
USA). Each well was washed with 150 .1 of Neutralization Solution (0.5 M Tris
1.3 M
NaC1, pH 7.5) and 150 p.1 of 2X SSC. Membranes were UV-crosslinked in a
Stratalinker*(Stratagene, La Jolla, CA, USA) and prehybridized for one hour in
20 mls
DIG EasyHyb Buffer at 42 C. The denatured probe was added and hybridization
carried
out overnight at 42 C. The membrane was Washed two times in 2X SSC containing,
0.1% SDS for five minutes each wash. Two high stringency washes were performed
in
50 ml of pre-warmed 0.1X SSC buffer containing 0.1% SDS at 68 C for 15 minutes
before proceeding with standard Genius Detection protocols (Genius Manual ).
It is desirable to use a non-radioactive detection system for safety, lower
cost, ease of use, and reduction of hazardous materials. In initial
experiments using
similar procedures previously described [Mei, et al., Mol Microbiol. 26:399-
407
(1997)], unacceptable background levels of hybridization were obtained in
negative
controls. In order to decrease background, tag length was increased by 30 bp
to a total
of 70, amplification primers were lengthened to include all sequence flanking
the variable
region, a lower concentration of dig-dUTP was used, and the conserved
sequences
flanking the sequence tag region were removed by gel purification. Most
significantly,
PCR was used to generate [NK]35 sequence tags as the target DNA in dot blots
rather than
the entire plasmids containing the tagged transposons after detecting
background
hybridization from the transposon itself. Using these modifications background
was
eliminated making chemiluminescentinon-radioactive screening more effective.
Approximately four hundred different transformants resulting from the
ligation of pTEF-1 with the PCR generated sequence tags were screened by
colony blot
and the 96 strongest hybridizing colonies were assembled into microtiter
plates for
further use. Even though the likelihood of duplicated tags was very low, half
of the plate
of master tags was probed against the other to confirm that no tags were
duplicated. The
plasmids containing these tags were purified and transformed into E.coliS17 -
1:Xpir (pir,
recA, thi, pro, hsd, (r-m+), RP4-2, (Tc::Mu), (Km::Tn7), [TmpR], [SmR]), and
the
transformed bacteria propagated at 37 C in Luria-Bertani (LB) medium. Each of
the 96
*Trade-mark
34
CA 02815566 2013-05-10
E.colt S17-1:Xpir transfonnants containing the tagged plasmid pTEF-1 was used
in
conjugative matings to generate transposon mutants of P. multocicia. P.
multocida strain
TF5 is a spontaneous nalidixic acid resistant mutant derived from UC6731, a
bovine
clinical isolate. P. multocida strains were grown on brain heart infusion
(BHI) media
(Difco Laboratories, Detroit, MI, USA) at 37 C and in 5% CO, when grown on
plates.
Matings were set up by growing each E.coli S17-1:Xpir /pTEF I :[NK.]35 clone
and the
TF5 strain to late log phase. Fifty ILl of culture for each tagged-pTEF-1
clone was mixed
with 200111 of the TF5 culture and 50 of each mating mixture was spotted onto
0.22
TM filters previously placed on BHI plates containing 100 mM IPTG and 10 mM
M2S0,. Following overnight incubation at 37 C with 5% CO,. mating mixtures
were
washed off of each filter into 3 ml of PBS and 25 p.1 of each was plated onto
BHIN5 Km
plates. Following selective overnight growth, colonies were assembled into
microtiter
plates by toothpick transfer into 200 p.1 BHIN501(5 making sure that each
well in a
microtiter plate always contained a transposon mutant with the same sequence
tag.
Following overnight growth, 50 p.1 of 75% glycerol was added to each well and
plates
were stored frozen at -80 C.
Nineteen pools were assembled by transferring the transposon mutants to
microtiter plates making sure that each well contained a transposon mutant
with the
appropriate tag for that well. In other words, a specific well in each
microtiter plate
always contained a transposon mutant with the same sequence tag even though
the
location of the transposon within those mutants may be different.
Example 2
Murine Screening for Attenuated P. multocida Mutants
Nineteen pools of Pasteurella multocida transposon mutants were
screened using a murine model of septicemia. Frozen plates of pooled P.
multocida
transposon mutants were removed from -80 C storage and subcultured by
transferring
10 111 from each well to a new 96 well round bottom plate (Corning Costar,
Cambridge,
MA, USA) containing 200 of brain heart infusion (DIFCO) with 50
tig/mlnalidixic
acid (Sigma) and 50 p-g/m1 kanamycin (Sigma) (BHIN50K50). Plates were
incubated
without shaking overnight at 37 C in 5% CO2. Overnight plates were subcultured
by
transferring 10 41 from each well to a new flat bottomed 96-well plate
(Corning Costar)
CA 02815566 2013-05-10
containing 100 ,u1 of BHI per well and incubating at 37 C with shaking at
approximately 150 rpm. The 0D540 was monitored using a micro-titer plate
reader. At
an 013540 of approximately 0.2 to 0.25, each plate was pooled to form the
"input pool"
by combining 100 41 from each of the wells of the micro-titer plate. The
culture was
diluted appropriately in BHI to doses of approximately 104, 105, 106 CFU/ml
and 0.2 ml
of each dilution was used to infect female 14-16 g BALB/c mice by
intraperitoneal
adiministration. At two days post-infection, one or two surviving mice were
euthanized
and the spleens harvested. The entire spleen was homogenized in 1.0 ml sterile
0.9%
saline. Dilutions of the homogenate from 10' to 10 were prepared and plated
onto
BHIN5 K" plates. Following overnight growth, at least 20,000 colonies were
pooled
in 10 mls BHI broth to form the "recovered pool" and 0.5 ml of the recovered
pool was
centrigued at 3,500 X g and the pellet used to prepare genomic DNA according
to a
previously described protocol [Wilson, In F.M. Ausubel, etal., (ed.), Current
Protocols
in Molecular Biology, vol. 1. John Wiley and Sons, New York, p.2.4.1-2.4.5.
(1997)1
Initial experiments with virulent wild-type P. multocida indicated that
organisms could be recovered from the spleen, lungs, kidneys, and liver
indicating a truly
septicemic model of infection. Dot blots for both the "input" and "recovered"
pools were
performed as described in Example 1 and evaluated both by visual inspection
and by
semi-quantitative analysis. Hybridization was carried out as described in
Example 1
except that 5 p.g of genomic DNA from input and recovered pools was used as
template.
Semi-quantitative analysis indicates whether a significant reduction in a
single clone has
occurred. If a mutant is unable to survive within the host, then the recovered
signal
should be very low compared to the input signal yielding a high
input/recovered ratio.
Most mutants will grow as well in vivo as in vitro and therefore a ratio of
their signals
should be approximately equal to 1. Clones selected by quantitative analysis
as being
highly reduced in the recovered pool were selected for further study.
Additional clones
with questionable input/recovered ratios were also selected after visually
evaluating films
made from the dot blots.
36
CA 02815566 2013-05-10
=
=
Example 3
Determination of Virulence for P. multocida Candidate Mutants
Each potential mutant which exhibited reduced recovery from splenic
tissue was isolated from the original pool plate and used individually in a
challenge
experiment to verify and roughly estimate the attenuation caused by the
transposon
mutation. Individual candidate mutants from in vivo screens were grown on
Sheep
Blood Agar plates overnight in 5% CO:, at 37 C. Approximately six colonies of
each
mutant were inoculated into BHI broth and allowed to grow for six hours.
Dilutions were
prepared and five mice each were infected as described above with 102, 103. 10
and 105
CFU each. Attenuation was determined by comparing mortality after six days
relative
to the wild type. Surviving mice were presumed to be protected and then
challenged with
a dose of wild type P. muhocida at a concentration approximately 200-fold
greater than
the LID50 for the wild type strain. Survival rate was then determined for each
challenged
group of mice.
Results indicated that 62 of 120 potential transposon mutants were
attenuated, having an approximate LD50 of at least 10 fold higher than the
wild type
strain. The clones and their approximate LD50 values are listed in Table 1. A
control
experiment with the wild type strain was run in parallel with each set of
challenges and
in all cases mortality in wild type-challenged groups was 100%.
In addition to LD50 values, Table I also provides data from vaccination
and challenge experiments. Briefly, groups of mice (n = 5 to 10) were
vaccinated by
intraperitoneal injection with the individual P. multocida strains shown in
Table 1 at a
dose that was approximately 200 times greater than the LD50 of the virulent,
wild type
strain. Animals were observed for 28 days after which mortality figures were
calculated.
=
37
1
CA 02815566 2013-05-10
Table 1
P. multocida Virulence Genes
Nucleotide Representative Possible Vaccination Challenge LD50
SEQ ID Isolate Gene # survivors/total # survivors/
NO: Function total
-- wild type - 0/10 - <10
23 PM1B1 guaB 10/10, 10/10, 9/10, 9/10 4.3
x 106
10/10
11 PM1D1 , dsbB , 10/10,5/10 10/10,5/5 8.4x
104
3 PM1BD7 atpG 5/5, 10/10 10/10 >3 x 105
_
74 PM1BEll yhc.1 10/10 5/10 >2 x 105
(H10145)
70 PMIBF6 yabK 3/5, 8/10 9/9 >2 x 105
(H11020)
19 PM2G8 fhaC 4/5, 9/10 9/9 >4 x 105
_
76 PM3C9 yia0 3/5 >6 x 105
(1-110146)
'
118 PM3G11 link() 4/5,10/10 10/10 >3 x 105
31 PM7B4 iroA 0/5
(UnkB)
,
17 PM4C6 fhaB 2/5, 10/10,9/10 10/10, 9/9 >3 x
106
(fhaB2)
9 PM4G10-T9 dnaA 4/5 >5 x 105
1 PM4D5-T5 atpB 5/5 >4 x 105
,
53 PM4D5-T1 UnkC2 5/5 >4 x 105
15 PM4F2 fhaB 3/5, 6/10, 10/10 6/6, 10/10 >3 x 105
(fhaB 1)
. -
41 PM5F7 mreB 4/5 1 x 103
7 PM5E2 devB 0/5, 3/10 2/3 ?
-
68 PM6H5-T1 xylA 5/5 >3 x 105
78 PM6H8 yigF 5/5,9/10 9/9 >3 x 105
(H10719)
108 PM7D12 pnp 5/5, 9/10 9/9
51 PM8C1R1-T2 UnkC1 5/5 -6 x 105
0
37a
CA 02815566 2013-05-10
37 PM8C1-T3 mg1B 5/5 ¨6 x 105
58 PM8C1R1-T6 UnkD1 5/5 ¨6 x 105
45 PM I OH7 purF 3/5, 8/10, 8/10 8/8, 8/8 >3 x 105
(H11207)
-
25 PM10H10-T2 H11501 5/5 >1 x 104
72 PMI1G8-T2 ygiK 5/5 >2.4 x 103
-
21 PM! 1G8-T4 greA 5/5 >2.4 x 103
84 PM12H6 yyam 3/5, 0/10 -2.2 x 103
(H10687)
33 PM15G8-T2 kdtB 5/5 >1.2 x 105
116 PM15G8-T1 UnkK 5/5 >1.2 x 105
104 PMI6G11-T1 hmbR 3/5 >1.9 x 105
29 PM16G11-T2 hxuC 3/5
>1.9 x 105
35 PM16H8 IgtC 5/5, 10/10 10/10 >2.4 x
105
80 PM16H3 yleA 5/5, 10/10 >2.0 x
105
(1110019)
1
49 PM17H6-T1 sopE 4/5 -6 x 105
120 PM17H6 UnkP 4/5 -6 x 105
,
,
5 PM18F5-T8 cap5E 5/5
>2.4 x 105
-
82 PM18F5-T10 yojB 5/5 >2.4 x
105
(1110345)
13 PM19A1 exbB 5/5, 10/10 , 10/10
>1.2x 105
-
112 PM19D4 rd i 5/5,8/10 8/8 , -1.6x 105
39 PM20Al2 mioC 3/5, 8/10 8/8 -2 x 104
(1110669)
60 PM20C2 UnIc.D2 5/5, 10/10 10/10 >8.2 x
106
37b
CA 02815566 2013-05-10
Polynucleotide sequences for the disclosed mutations in the fhaC, yia0, and
yleA
genes are set out in SEQ ID Nos 19, 76, and 80 respectively. The polypeptide
sequences
encoded by these polynucleotide sequences are set out in SEQ ID Nos 20, 77,
and 81
respectively.
Example 4
Cloning and Identification of Genes Required for P. multocida Virulence
Each transposon mutant which was verified to be attenuated was analyzed
further to determine the identity of the disrupted open reading frame. DNA
from each
mutant was amplified, purified, and digested with restriction enzymes that
were known not
to cut within the transposon and generally produced 4-8 kb fragments that
hybridized with
the transposon. Using selection for kanamycin resistance encoded by the
transposon, at
least one fragment for each transposon mutant was cloned.
Southern hybridization with multiple restriction enzymes was performed
for each attenuated mutant using a labeled 1.8 kb Mlui fragment from pLOF/Ktn
as a probe
to identify a suitable sized fragment for cloning. The mini-Tnl 0 element and
38
CA 02815566 2013-05-10
flanking DNA from each mutant was cloned into pUC19 and the flanking sequence
determined using internal primers TEF32 and TEF40. primer walking and in some
cases
universal pUC-19 primers.
TEF-32 GGCAGAGCATTACGCTGAC SEQ ID NO: 95
TEF-40 GTACCGGCCAGGCGGCCACGCGTATTC SEQ ID NO:96
Sequencing reactions were performed using the BieDyeTm Dye Terminator
Chemistry
.
kit from PE Applied Biosystems (Foster City, CA) and run on an ABI Prism
377*DNA
Sequencer. Double stranded sequence for putative interrupted open reading
frames was
obtained for each clone. Sequencer 3.0toftware (Genecodes, Corp., Ann Arbor,
MI) was
used to assemble and analyze sequence data. GCG programs [Devereux, et al.,
1997.
Wisconsin Package Version 9.0,*9.0 ed. Genetics Computer Group, Inc., Madison]
were
used to search for homologous sequences in currently available databases.
In 37% of the clones that were identified as being attenuated, there were
multiple insertions of the mini-Tn10 transposable element. Each insertion
including its
flanking sequence was cloned individually into pGP704 and mated into the wild-
type
strain to produce new mutants of P. multocida, each carrying only one of the
multiple
original insertions. Individual mutants were retested individually to
determine the
insertion responsible for the attenuated phenotype. The nucleotide sequence of
the
disrupted, predicted open reading frame was determined by sequencing both
strands, and
the predicted amino acid sequence was used to search currently available
databases for
similar sequences. Sequences either matched known genes, unknown genes, and
hypothetical open reading frames previously sequenced or did not match any
previously
identified sequence. For those genes having homology to previously identified
sequences, potential functions were assigned as set out in Table 1.
Example 5
Identification of Related Genes in Other Species
In separate experiments, STM was also performed using Actinobacillus
pleuropneumoniae (App). One of the App strains contained an insertion in a
gene that
was sequenced (SEQ ID NO: 97) and identified as a species homolog of the P.
multocida
*Trademark 39
.=
CA 02815566 2013-05-10
atpG gene. This result suggested the presence in other bacterial species of
homologs to
previously unknown P. multocida genes that can also be mutated to produce
attenuated
strains of the other bacterial species for use in vaccine compositions. In
order to
determine if homologs of other P. multocida genes exists in other bacterial
species,
Southern hybridization was performed on genomic DNA from other species using
the A.
pleuropneumoniae atpG gene as a probe.
Actinobacillus plettropneumoniae, Pasteurella haemolytica (Ph), P.
multocida, and Haemophilus somnus (Hs) genomic DNA was isolated using the CTAB
method and digested with EcoRI and HindIII for two hours at 37 C. Digested DNA
was
separated on a 0.7% agarose gel at 40V in TAE buffer overnight. The gel was
immersed
sequentially in 0.1 M HCL for 30 minutes, twice in 0.5 M Na011/1.5 M NaC1 for
15
minutes each, and twice in 2.5 M NaC1/1 M Tris, pH 7.5. The DNA was
transferred to
nitrocellulose membranes (Amersham Hybondi\V) overnight using 20X SSC buffer
(3
M NaC1/0.3 M sodium citrate). The DNA was crosslinked to the membrane using a
UV
Stratalinker on autocrosslink setting (120 millijoules). The membrane was
prehybridized
in 5X SSC/ 1% blocking solution/0.1% sodium lauroyl sarcosine/0.02% SDS at 50
C for
approximately seven hours and hybridized overnight at 50 C in the same
solution
containing a PCR generated atgG probe.
The probe was prepared using primers DEL-1389 (SEQ 1D NO: 98) and
TEF-46 (SEQ ID NO: 99) in a with a GeneAmp XL PCR kit in a GeneArnp PCR System
2400. Template was genomic A. pleuropneumoniae DNA.
DEL-1389 TCTCCATTCCCTTGCTGCGGCAGGG SEQ ID NO: 98
TEF-46 GGAATTACAGCCGGATCCGGG SEQ ID NO: 99
The PCR was performed with an initial heating step at 94 C for five minutes,
30 cycles =
of denaturation t 94 C for 30 sec, annealing at 50 C for 30 sec, and
elongation at 72 C
for three minutes, and a final extension step at 72 C for five minutes. The
amplification
products were separated on an agarose gel, purified using a QIAquick gel
purification kit
(QIAGEN), and labeled using a DIG-High Primer kit (Boehringer Mannheim). The
blot
was removed from the hybridization solution and rinsed in 2X SSC and washed
two
times for five minutes each wash in the same buffer. The blot was then washed
two
*Trade-mark 40
CA 02815566 2013-05-10
times for 15 minutes each in 0.5X SSC at 60 C. H0111010201.15 bands were
visualized
using a DIG Nucleic Acid Detection Kit (Boehrineer Mannheim).
Single bands were detected in Pasteurella haemolvtica, Haemophilia
S01711111S and A. pleuropneumoniae using EcoRI digested DNA. Two bands were
detected
using EcoRi digested DNA from Pasteurella multocida.
Example 6
Construction of a Library of Tagged-Transposon P. multocida Mutants
Transposon mutagenesis using pLOF/Krn has previously been reported
to be functional and random in A. pleuropneumoniae [Tascon, et al.. J
Bacteriol.
175:5717-22 (1993)]. To construct tagged transposon mutants of A.
pleuropneumoniae,
each of 96 E. colt S17-1:Apir transformants containing pre-selected taped
plasmids
(pTEF-1:[NK]35) was used in conjugative matine,s to generate transposon
mutants of A.
pleuropnewnoniae strain AP225, a serotype 1 spontaneous nalidixic acid
resistant mutant
derived from an in vivo passaged ATCC 27088 strain. A. pleuropneumoniae
strains were
grown on Brain Heart Infusion (BHI) (Difco Laboratories, Detroit, MI) media
with 10
p.e/m1B-nicotinamide adenine dinucleotide (V' ), (Sigma, St. Louis, Missouri)
at 37 C
and in 5% CO2 when grown on plates. E. coli S17-1:Xpir (Xpir, recA, thi, pro,
hsdR(rk-
,mk+), RP4-2, (TcR::Mu), (KmR::Tn7), [Tmpl, [Smi) was propagated at 37 C in
Luria-
Bertani (LB) medium. Antibiotics when necessary were used at 100 g/m1
ampicillin
(Sigma), 50 g/m1 nalidixic acid (Nn(Sigma), and 50 (V) or 100 (1(100) g/m1
of
kanamycin (Sigma).
Matings were set up by growing each E. coli S17-1:Xpir/pTEF1:[N1q35
clone and the AP225 strain to late log phase. A 50 I aliquot of culture for
each tagged-
pTEF-1 clone was mixed with 150 ,1 of the APP225 culture, and then 50 p,1 of
each
mating mixture was spotted onto 0.22 M filters previously placed onto BHIV1
plates
containing 100 1.1M IPTG and 10 mM MgSO4. Following overnight incubation at 37
C
with 5% CO2, mating mixtures were washed off of each filter into 2 ml of PBS
and 200
p,1 of each was plated onto BHIVIN50K1 plates. After selective overnight
growth,
colonies were assembled into microtiter plates by toothpick transfer into 200
I
BHIV I=150K5 making sure that each well in a microtiter plate always
contained a
41
CA 02815566 2013-05-10
transposon mutant with the same sequence tag. Following.. overnight growth. 50
ill of
75% glycerol was added to each well and plates were stored frozen at -80 C.
APP does not appear to have as much bias towards multiple insertions of
the mini-Tn10 element as did P. multocida. Only approximately 3% of the
mutants were
determined to contain multiple insertions, which is in agreement with the 4%
previously
reported [Tascon, et at, J Bacteriol. 175:5717-22 (1993)]. A problem in APP
consisted
of identifying numerous mutants (discussed below) containing insertions into
23S RNA
regions: 28 total mutants with insertions into 13 unique sites. This may
indicate that 23S
RNA contains preferential insertion sites and that the growth of APP is
affected by these
insertions enough to result in differential survival within the host. Southern
blot analysis
using an APP 23S RNA probe suggests that APP may contain only three ribosomal
operons as compared to five in H. influenzae [Fleischmann, et at.. Science
269:496-512
(1995)] and seven complete operons in E. coli [Blattner, etal., Science
277:1453-1474
(1997)]. This site preference and its effect on growth rate may be a
significant barrier to
"saturation mutagenesis" since a significant number of clones will contain
insertions into
these rRNAs and large volume screening will be necessary to obtain additional
unique
attenuating mutations.
Example 7
Porcine Screening for Attenuated A. pleuropneumoniae Mutants
Twenty pools of A. pleuropneumoniae transposon mutants, containing a
total of approximately 800 mutants, were screened using a porcine
intratracheal infection
model. Each pool was screened in two separate animals.
Frozen plates of pooled A. pleuropneumoniae transposon mutants were
removed from -80 C storage and subcultured by transferring 201.11 from each
well to a
new 96 well round bottom plate (Corning Costar, Cambridge, MA, USA) containing
180
pl of BHIVIN"V. Plates were incubated without shaking overnight at 37 C in 5%
CO2. Overnight plates were then subcultured by transferring 10 41 from each
well to a
new flat bottomed 96 well plate (Coming Costar) containing 100 p,1 of BHIV I
per well
and incubating at 37 C with shaking at 150 rpm. The 0D562 was monitored using
a
microtiter plate reader. At an 0D562 of approximately 0.2 to 0.25, each plate
was pooled
to form the "input pool" by combining 100 1 from each of the wells of the
microtiter
CA 02815566 2013-05-10
plate. The culture was diluted appropriately in BHI to approximately 2 X 10'
CFU/ml.
For each diluted pool, 4.0 ml was used to infect 10-20 kg SPF pigs (Whiteshire-
Hamroc,
Albion, IN) by intratracheal administration using a tracheal tube. At
approximately 20
hours post-infection, all surviving animals were euthanized and the lungs
removed.
Lavag,e was performed to recover surviving bacteria by infusing 150 mls of
sterile PBS
into the lungs, which were then massaged to distribute the fluid. The lavage
fluid was
recovered, and the process was repeated a second time. The lavage fluid was
centrifuged
at 450 x g for 10 minutes to separate out large debris. Supematants were then
centrifuged
at 2,800 x g to pellet the bacteria. Pellets were resuspended in 5 mls BHI and
plated in
dilutions ranging from 102 to 10' onto BHIVI 1\Inc,' plates. Following
overnight
growth, at least 100,000 colonies were pooled in 10 mls BHI broth to form the
"recovered pools-. A 0.7 ml portion of each recovered pool was used to prepare
genomic
DNA by the CTAB method [Wilson. In Ausubel, el al., (eds.), Current Protocols
in
Molecular Biology, vol. 1. John Wiley and Sons, New York, p. 2.4.1-2.4.5
(1997)].
Recovery from the animals routinely was in the 10 CFU range from lung
lavage.
Dot blots were performed and evaluated both by visual inspection and by
semi-quantitative analysis as described previously. All hybridizations and
detections
were performed as described. Briefly, probes were prepared by a primary PCR
amplification, followed by agarose gel purification of the desired product and
secondary
PCR amplification incorporating dig-dUTP. Oligonucleotides including TEF5,
TEF6,
TEF24, TEF25, TEF48 and TEF62, were synthesized by Genosys Biotechnologies
(The
Woodlands, TX). Primers TEF69, TEF65, and TEF66 were also used for inverse PCR
reactions and sequencing.
TEF69 GACGTTTCCCGTTGAATATGGCTC
SEQ ID NO: 166
TEF65 GCCGGATCCGGGATCATATGACAAGA
SEQ ID NO: 167
TEF66 GACAAGATGTGTATCCACCTTAAC
SEQ ID NO: 168
The labeled PCR product was then digested with HindIII to separate the
constant primer arms from the unique tag region. The region containing the
labeled
variable tag was excised and the entire gel slice was then dissolved and
denatured in DIG
43
CA 02815566 2013-05-10
EasyHyb. Dot blots were prepared and detected using the standard CSPD
detection
protocol. Film exposures were made for visual evaluation, and luminescent
counts per
second (LCPS) were determined for each dot blot sample. The LCPS,npõ, / LCPS
recovered
ratio for each mutant was used to determine mutants likely to be attenuated.
Clones selected as being present in the input pool but highly reduced in
the recovered pool were selected for further study. Additional clones with
questionable
input/recovered ratios were also selected after visually evaluating films made
from the
dot blots. A total of 110 clones were selected.
Example 8
Identification of A. pleuropneumoniae Virulence Genes
A partial flanking sequence was determined for each of the 110 mutants
by inverse PCR and direct product sequencing. Inverse PCR was used to generate
flanking DNA products for direct sequencing as described above. Sequencing
reactions
were performed using the BigDye' Dye Terminator Chemistry kit from PE Applied
Biosystems (Foster City, CA) and run on an ABI Prism 377 DNA Sequencer.
Sequencher 3.0 software (Genecodes, Corp., Ann Arbor, MI) was used to assemble
and
analyze sequence data. GCG programs [Devereux and Haeberli, Wisconsin Package
Version 9.0, 9.0 ed. Genetics Computer Group, Inc., Madison (1997)] were used
to
search for homologous sequences in currently available databases.
Table 2 shows the A. pleuropneumoniae genes identified and extent to
which open reading frames were determinable. Sequence identification numbers
are
provided for nucleotide sequences as well as deduced amino acid sequences
where
located.
44
CA 02815566 2013-05-10
=
Table 2
A. pleuropneumoniae Open Reading Frames
Complete Open Reading Frame NO Start Codon - Stop Codon
atpH SEQ ID NO: 134 dksA SEQ ID NO:
136
aptG SEQ ID NO: 132 dnaK
SEQ ID NO: 138
exbB SEQ ID NO: 140 HI0379
SEQ ID NO: 144
OmpP5 SEQ ID NO: 152
OmpP5-2 SEQ ID NO: 150 NO Start Codon - NO Stop Codon
tig SEQ ID NO: 160 pnp SEQ ID NO:
154
fkpA SEQ ID NO: 142 apvA-or 1
SEQ ID NO: 122
hupA SEQ ID NO: 146 apvA-or 2
SEQ ID NO: 124
rpmF SEQ ID NO: 158 apvB
SEQ ID NO: 126
apvD
SEQ ID NO: 130
Start Codon - NO Stop Codon
lpdA SEQ ID NO: 148 RNA or Noncodine Sequences
potD SEQ NO: 156 tRNA-leu
SEQ ID NO: 162
yaeE SEQ ID NO: 164 tRNA-glu
SEQ ID NO: 163
apvC SEQ ID NO: 128
-)0
The putative identities listed in Table 3 (below, Example 9) were assigned
by comparison with bacterial databases. The 110 mutants represented 35 groups
of
unique transposon insertions. The number of different mutations per loci
varied, with
some clones always containing an insertion at a single site within an ORF to
clones
containing insertions within different sites of the same ORF. Three multiple
insertions
were detected in the 110 mutants screened as determined by production of
multiple PCR
bands and generation of multiple sequence electropherograms.
Example 9
Competition Challenge of A. pleuropneumoniae Mutants with Wild Type APP225
A representative clone from each of the unique attenuated mutant groups
identified above that was absent or highly reduced in the recovered population
was
isolated from the original pool plate and used in a competition challenge
experiment with
the wild type strain (AP225) to verify the relative attenuation caused by the
transposon
mutation. Mutant and wild type strains were grown in BHIVI to an 0D590 of 0.6
¨ 0.9.
Approximately 5.0 x I 6 CFU each of the wild type and mutant strains were
added to 4
mls BHI. The total 4 ml dose was used infect a 10-20 kg SPF pig by
intratracheal
CA 02815566 2013-05-10
administration with a tracheal tube. At approximately 20 hours post-infection,
all
surviving animals were euthanized and the lungs removed. Lung lavages were
performed
as described above. Plate counts were carried out on BHIV'N and BHIVI('N'K''
to
determine the relative numbers of wild type to mutant in both the input
cultures and in
the lung lavage samples. A Competitive Index (CI) was calculated as the
[mutant CR'
/ wild type CFU],õpõ, / [mutant CFU wild type CTU]recovered'
Of the 35 potential transposon mutants, 22 were significantly attenuated,
having a competitive index (Cl) of less than 0.2. A transposon mutant that did
not seem
to be attenuated based on the STM screening results was chosen from one of the
pools
as a positive control. This mutant had a CI in vivo of approximately 0.6. An
in vitro
competition was also done for this mutant resulting in a Cl of 0.8. The mutant
was
subsequently determined to contain an insertion between 2 phenylalanine
tRNA's.
Competitive indices for unique attenuated single-insertion mutants are
listed in Table 3. Competitive indices for atpG, pnp, and exbB App mutants
indicated
that the mutants were unable to compete effectively with the wild type strains
and were
therefore attenuated.
Table 3
Virulence and Proposed Function of A. pleuropneumoniae Mutants
Mutant Similarity Putative or Known Functions C.I.
AP20A6 atpH ATP synthase .009
AP7F10 atpG ATP synthase .013
AP 17C6 IpdA dihydrolipoamide dehydrogenase .039
API 1E7 exbB transport of iron compounds
.003,.003,.006
AP3H7 potD Spennidine/putrescine transport .308
AP8H6 OmpP5 Adhesin / OmpA homolog .184
AP18H8 OmpP5-2 Adhesin / OznpA homolog .552
API 3E9 tig Peptidyl-prolyl isomerase .050
AP13 C2 .fkp.4 Peptidyl-prolyl isomerase <.001
API 5C11 PnP Polynucleotide phosphorylase .032
API 8F12 hupA Histone ¨ like protein .001
AP20F8 dksA Dosage dependent suppressor of dnaK mutations .075
AP5G4 dna K Heat shock protein ¨ molecular chaperone .376
46
CA 02815566 2013-05-10
AP17C9 tRNA-leti Protein
Synthesis ieene retaliation? I .059
AP5D6 IRNA-gln Protein Synthesis .055
AP18B2 rprnF Protein Synthesis .111
AP10E7 yae.-1 Unknown .001
AP19A5 HI0379 Unknown .061
AP10C10 apwl Unknown .157
API 8F5 apvI3 Unknown .103
AP2A6 apvC Unknown .091
AP2C11 apli) Unknown _014
Accuracy of the CI appeared to be very good as the exbB mutant was
competed within three different animals yielding Cl's of 0.003, 0.003 and
0.006. The use
of a Competitive Index number to assign attenuation based upon one competition
in a
large animal study was further confirmed based on preliminary vaccination
results in pigs
with 7 mutants (n-=-8) described below in Example 1 I .
Example 10
Characterization of Attenuated A. pleuropneumoniae Virulence Genes
The A. pleuropneumoniae genes identified represent four broad functional
classes: biosynthetic enzymes, cellular transport components, cellular
regulation
components and unknowns.
The atpG gene, encoding the Fl-? subunit of the F0F1 H -ATPase
complex, can function in production of ATP or in the transport of protons by
hydrolyzing
ATP. A related atpG attenuated mutant was also identified in P. multocida.
Another alp
gene, atpH, that encodes the F1 6 subunit was also identified. Phenotypes of
atp mutants
include non-adaptable acid-sensitivity phenotype [Foster, J BacterioL 173:6896-
6902
(1991)1, loss of virulence in Salmonella typhimurium [Garcia del Portillo, et
al., Infect
Immun. 61:4489-4492 (1993)] and P. multocida (above) and a reduction in both
transformation frequencies and induction of competence regulatory genes in
Haernophilus influenzae Rd [Gwinn, et al., J BacterioL 179:7315-20 (1997)].
LpdA is a dihydrolipoamide dehydrogenase that is a component of two
enzymatic complexes: pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase.
47
CA 02815566 2013-05-10
While the relationship to virulence is unknown. production of LpdA is induced
in
Salmonella tyl-,himurium when exposed to a bactericidal protein from human
which may
suggest that this induction may be involved in attempts to repair the outer
membrane [Qi.
et al.. Alol Microbiol. / 7:523-31 (1995)].
Transport of scarce compounds necessary for growth and survival are
critical in vivo. ExbB is apart of the TonB transport complex [Hantke, and
Zimmerman.
Microbiology Letters. 99:31-35 (1981)], interacting with TonB in at least two
distinct
ways [Karlsson, et al., Mol Microbiol. 8:389-96 (1993), Karlsson. et al., Mol
Microbiol.
8:379-88 (1993)]. Iron acquisition is essential for pathogens. In this work,
attenuated
exbB mutants in both APP and P. multocida have been identified. Several TonB-
dependent iron receptors have been identified in other bacteria [Biswas, et
al., Mol.
Microhiol. 24:169-179 (1997), Braun, FEMS Microbiol Rev. /6:295-307 (1995),
Elkins,
et al., Infect Immun. 66:151-160 (1998), Occhino, et aL, Mol Microbiol.
29:1493-507
(1998),Stojiljkovic and Srinivasan, J Bacteriol. 179:805-12 (1997)].
A.
pleuropneumoniae produces 2 transferrin-binding proteins, which likely depend
on the
ExbBlExbD/TonB system, for acquisition of iron. PotD is a periplasmic binding
protein
that is required for spermidine (a polyamine) transport [Kashiwagi, et al., J
Biol Chem.
268:19358-63 (1993)]. Another member of the Pasteurellaceae family,
Pasteurella
haemolytica, contains a homologue of potD (Lpp38) that is a major immunogen in
convalescent or outer membrane protein vaccinated calves [Pandher and Murphy,
Vet
MicrobioL .51:331-41 (1996)]. In P. haemolytica, PotD appeared to be
associated with
both the inner and outer membranes. The role of PotD in virulence or in
relationship to
protective antibodies is unknown although previous work has shown potD mutants
of
Streptococcus pneumoniae to be attenuated [Polissi, et al., Infect. Immun.
66:5620-9
(1998)].
Relatively few "classical virulence factors," such as adhesins or toxins
with the exception of homologues to OMP P5 of Haemophilus influenzae, were
identified. H. influenzae OMP P5 is a major outer membrane protein that is
related to
the OmpA porin family of proteins [Munson, et al., M Infect Immun. 61:4017-
20(1993)].
OMP P5 in nontypeable Haemophilus influenzae has been shown to encode a
fimbrial
subunit protein expressed as a filamentous structure [Sirakova, et al., Infect
Immun.
48
CA 02815566 2013-05-10
62:2002-20(1994)] that contributes to virulence and binding of both mucin and
epithelial
cells [Miyamoto and Bakaletz, Microb Pathog. 21:343-56 (1996), Reddy. etal..
Infect
Ininuin. 64:1477-9 (1996), Sirakova, et al., Infect 11111171111. 62:2002-20
(1994)]. A
significant finding was identification of two distinct ORF's that appear to
encode OMP
P5 homologues. This is also the case with two very similar proteins, MOMP and
OmpA2
from Haemophilia chicreyi. It remains to be determined whether both are
functionally
involved in the production of fimbriae and whether the presence of two such
ORFs
represents a divergent duplication with redundant or complementing functions.
Interestingly, the two OMP P5 mutants seem to have disparate CI values,
suggesting a
difference in essentiality or functionality for only one copy. OMP P5 has been
shown to
undergo molecular variation during chronic infections [Duim, et al., Infect
Immun.
65:1351-1356 (1997)], however, this appears to be restricted to a single gene
undergoing
point mutations resulting in amino acid changes rather than "type switching"
due to
differential expression of multiple genes.
Protein folding enzymes are important accessories for the efficient folding
of periplasmic and extracellular proteins, and two genes were identified whose
products
have peptidyl-prolyl isomerase activity: fIcpA and tig (trigger factor). FkpA
is a
periplasmic protein that is a member of the FK506-binding protein family [Home
and
Young, Arch MicrobioL 163:357-65 (1995); Missialcas, etal., Mol Microbiol.
21:871-84
(1996)]. FkpA has been shown to contribute to intracellular survival of
Salmonella
typhimurium [Horne, et aL, Infect Immun. 65:806-10 (1997)] and a Legionella
pneumophila homolog, mrp [Engleberg, etal., Infect Immun. 57:1263-1270
(1989)], is
responsible for virulence and infection of macrophages [Cianciotto, et al., I
Infect. Dis.
162:121-6 (1990); Cianciotto, et al., Infect. Immun. 57:1255-1262 (1989)].
Tig, or
trigger factor [Crooke and Widmer, Proc. Natl. Acad. Sci. USA. 84:5216-20
(1987),
Guthrie, and Widmer, J Bacteria 172:5555-62 (1990), reviewed in Hesterkamp,
and
Bukau., FEBS Lett. 389:32-4 (1996)], is a peptidyl prolyl isomerase containing
a typical
FKBP region [Cal]ebaut and Momon, FEBS Lett. 374:211-215 (1995)1 but is
unaffected
by FK506 [Stoller, etal., EMBO J. /4:4939-48 (1995)]. Tig has been shown to
associate
with the ribosomes and nascent polypeptide chains [Hesterkamp, et al., Proc
Nail Acad
Sci USA 93:4437-41(1996), Stoller, et al., EMB01 /4:4939-48 (1995)]. Possible
roles
49
CA 02815566 2013-05-10
include an unknown influence on cell division [Guthrie, and Widmer. J
Bacteriol.
1 72:5 55 5-62 (1990)] in E. coil, a role in the secretion and activation of
the Streptococcus
pyogenes cysteine proteinase [Lyon, et al.. EMBO 1 1 7:6263-75 (1998)] and
survival
under starvation conditions in Bacillus subtilis [Gothel, et al..
BiochenzistrI= 37:1 3 3 9 2-9
(1998)].
Bacterial pathogens employ many mechanisms to coordinately regulate
gene expression in order to survive a wide variety of environmental conditions
within the
host. Differences in mRNA stability can modulate gene expression in
prokaryotes
[Belasco and Higgins, Gene 72:15-23 (1988)]. For example, on- (vacB) is
required for
expression of plasmid borne virulence genes in Shigella flexneri [Tobe, et
al., J
Bacteriol. 174:6359-67 (1992)] and encodes the RnaseR ribonuclease [Cheng, et
al., J.
Biol. Chem. 273:14077-14080 (1998)]. PNP is a polynucleotide phosphorylase
that is
involved in the degradation of mRNA. Null pnp / rnr mutants are lethal,
suggesting a
probable overlap of function. It therefore is possible that both rnr and pnp
are involved
in the regulation of virulence gene expression. Apnp mutant ofP. multocida is
avimlent
in a mouse septicemic model (Example 2)]. Other pnp-associated phenotypes
include
competence deficiency and cold sensitivity in Bacillus subtilis [Wang and
Bechhofer, J
Bacteriol. 178:2375-82 (1996)].
HupA is a bacterial histone-like protein, which in combination with HupB
constitute the I-[U protein in E. coli. Reports have suggested that hupA and
hupB single
mutants do not demonstrate any observable phenotype [Huisman, et al., J
Bacteriol.
171:3704-12 (1989), Wada, et al., J Mol Biol. 204:581-91 (1988)], however,
hupA-hupB
double mutants have been shown to be cold sensitive, sensitive to heat shock
and blocked
in many forms of site-specific DNA recombination [Wada, et al., JMol Biol.
204:581-91
(1988), Wada, et al.. Gene. 76:345-52 (1989)]. One limited data previously
indicated
that hupA is directly involved in virulence [Turner, et al., Infect Immun.
66:2099-106
(1998)]. The mechanism of hupA attenuation remains unknown.
DnaK is a well known and highly conserved heat shock protein involved
in regulatory responses to various stressful environmental changes [reviewed
in Lindquist
and Craig, Annu Rev Genet. 22:631-77 (1988)]. DnaK is also one of the most
significantly induced stress proteins in Yersinia enterocolitica after being
phagocytosed
CA 02815566 2013-05-10
by macrophages ['Yamamoto, et al.. Microhiol Immunol. 38:295-300 (1994)] and a
Bruce/la suis dnaK mutant failed to multiply within human macrophage-like
cells
[Kohler, et al., it/Jo! Alicrohzol. 20:701-12 (1996)].
In contrast. another intracellular
pathogen. Listeria monocytogenes, did not show induction of dnaK after
phaeocytosis
[Hanawa, et al., Infect Immun. 63:4595-9 (1995)]. A dnaK mutant of Vihrio
cholera
affected the production of ToxR and its regulated virulence factors in vitro
but similar
results were not obtained from in vivo grown cells [Chakrabarti, et al..
Infect Immun.
67:1025-1033 (1999)]. The CI of A. pleuropneumonia dnaK mutant was higher than
most of the attenuated mutants although still approximately half of the
positive control
strain.
DksA is a dosage dependent suppressor of filamentous and temperature.
sensitive growth in a (kali mutant of E. coli [Kang and Craig, J Bacteriol.
/72:2055-64
(1990)]. There is currently no defined molecular function for DksA, but the
gene has
been identified as being critical for the virulence of Salmonella typhimuriunz
in chickens
and newly hatched chicks [Turner, et al., Infect Immun. 66:2099-106 (1998)].
In that
work, it was noted that the dksA mutant did not grow well with glucose or
histidine but
did grow well with glutamine or glutamate as the sole carbon source. This
observation
may indicate that the dksA mutant is somehow impaired in the biosynthesis of
glutamate
[Turner, etal., Infect Immun. 66:2099-106 (1998)].
Three genes were identified that have roles in protein synthesis: tRNA-
leu, tRNA-g/u and rpmF. Excluding protein synthesis, tRNA's also have a wide
variety
of functional roles in peptidoglycan synthesis [Stewart, etal., Nature 230:36-
38 (1971)],
porphyrin ring synthesis [Jahn, et al., Trends Biochem Sci. 17:215-8 (1992)],
targeting
of proteins for degradation [Tobias, etal., Science 254:1374-7(1991)], post-
translational
addition of amino acids to proteins [Leibowitz and Soffer,B.B.R.C. 36:47-53
(1969)] and
mediation of bacterial-eukaryotic interactions [Gray, et al., .1 Bacteriol.
174:1086-98
(1992), Hromockyj, etal., Mol Microbiol. 6:2113-24(1992)]. More specifically,
tRNA-
leu is implicated in transcription attenuation [Carter, et al., Proc. Natl.
Acad. Sci. USA
83:8127-8131 (1986)], lesion formation by Pseudomonas syringae [Rich and
Willis, J
Bacteriol. 179:2247-58 (1997)] and virulence of uropathogenic E. coli
[Dobrindt, etal..
FEMS Microbiol Lett. 162:135-141 (1998), Ritter, et al., Mol Microbiol. 17:109-
21
51
CA 02815566 2013-05-10
=
(1995)]. It is unknown whether the tRNA that we have identified represents a
minor
species of tRNA-leu in A. pleuropneumoniae. Regardless, it is possible that
tRNA-leu
may have any one of a wide range of functions. RpmF is a ribosomal protein
whose gene
is also part of an operon containing fatty acid biosynthesis enzymes in E.
co/i. Further
work will be required to indicate if this is the case in A. pleuropneumoniae,
although the
same clustering offab genes and rpmF occurs in Haernophilus influenzae
[Fleischmann,
etal., Science 269:496-512 (1995)]. The expression of the fah genes is not
necessarily
dependent on transcripts originating upstream of rpmF as there has been a
secondary
promoter identified within rpmF [Zhang and Cronan, Jr., J Bacteria /803295-303
(1998)].
The final class of attenuated mutants includes mutations within genes of
unknown function or genes that have not been previously identified. Homologs
of yaeA
and HI0379 have previously been identified in Escherichia coli [Blattner, et
al., Science
277:1453-1474 (1997)] and Haetnophilus influenzae [Fleischmann, et al..
Science
269:496-512 (1995)], respectively. The remaining unknowns have been designated
Actinobacillus Rleuropneumoniae Nirulence genes (apv). The apvC gene shows
significant similarity to H10893, however, the proposed similarity of H10893
as a
transcriptional repressor similar to the fatty acid response regulator Bm3R1
[Palmer, J
Biol Chem. 273:18109-16 (1998)] is doubtful. The apvD gene is also most
similar to a
putative membrane protein (b0878) with unknown function from E. coil
[Blattner, et al.,
Science 277:1453-1474(1997)]. Two other unknowns, apvA and apvB had no
significant
matches in the public databases.
Example 11
Safety and Efficacy of A. pleuropneumoniae Mutants
Nine groups (n=8) of SPF pigs (4-5 weeks old, 3-10 kg) were used to
determine the safety and efficacy of seven A. pleuropneumoniae mutants as live
attenuated vaccine strains. Seven groups were infected intranasally with 1010
CFU of
each mutant on day 1. One group was vaccinated on days 1 and 15 with the
commercially available vaccine Pleuromune*(Bayer), and one naive group was not
vaccinated. On day 29, all groups were challenged intranaslally with 1-5 x 105
CFU per
*Trademark
52
CA 02815566 2013-05-10
pig of wild type APP225. All surviving animals were euthanized and necropsied
on day
42 of the study. Results are shown in Table 4.
Table 4
Efficacy of A. plearoprzeunioniae Mutants
% Mortality following intranasal
challenge
Vaccine
Vaccination Challenge
Pleuromune 0 37.5
exbB 0 0
tig 12.5 0
fkpA 12.5 0
H10385 50.0 0
pnp 0 0
yaeE 0 0
atpG 0 0
None N/A 50.0
The exbB, atpG, pnp, and yaeA mutants caused no mortality when
administered at a dosage of 1010 CFU intranasally. ThefkpA and tig mutant
groups had
one death each and the HI0379 group (highest April 6, 2000CI of the 7 mutants
tested
shown in Example 9) had four deaths. Wildtype LD50 using this model was
generally 1
x 10' CFU, indicating that each of these mutants is at least 100 fold
attenuated and that
there is a reasonable correlation between Cl and attenuation.
Numerous modifications and variations in the invention as set forth in the
above illustrative examples are expected to occur to those skilled in the art.
Consequently only such limitations as appear in the appended claims should be
placed
on the invention.
53
