SYSTEME MULTIPLASMIDE DE PRODUCTION DE VIRUS INFLUENZA

MULTI PLASMID SYSTEM FOR THE PRODUCTION OF INFLUENZA VIRUS

Abrégé anglais

Vectors and methods for the production of influenza viruses suitable as
recombinant influenza vaccines in cell culture are provided. Bi-directional
expression
vectors for use in a multi-plasmid influenza virus expression system are
provided.

Revendications

What is claimed is:
1. An artificially engineered recombinant or reassortant influenza B virus,
comprising:
a modified NP polypeptide comprising an amino acid substitution at position
114 to
alanine and an amino acid substitution at position 410 to histidine, wherein:
the modified NP polypeptide comprises a threonine at position 55; and
the influenza B virus has a temperature sensitive phenotype.
2. The artificially engineered recombinant or reassortant influenza B virus of
claim 1, wherein
the modified NP polypeptide comprises an amino acid substitution at position
509 to
threonine.
3. The artificially engineered recombinant or reassortant influenza B virus of
claim 2, wherein
amino acid substitutions in the modified NP polypeptide consist of a
substitution at position
114 to alanine, a substitution at position 410 to histidine, and a
substitution at position 509 to
threonine.
4. The artificially engineered recombinant or reassortant influenza B virus of
any one of
claims 1 to 3, comprising a modified PA polypeptide comprising at least one of
an amino acid
substitution at position 431 to methionine and an amino acid substitution at
position 497 to
histidine.
5. The artificially engineered recombinant or reassortant influenza B virus of
any one of
claims 1 to 4, comprising a modified M1 polypeptide comprising at least one of
an amino acid
substitution at position 159 to glutamine and an amino acid substitution at
position 183 to
valine, wherein the influenza B virus has an attenuated phenotype.
6. The artificially engineered recombinant or reassortant influenza B virus of
any one of
claims 1 to 5, comprising a modified PB2 polypeptide comprising an amino acid
substitution
at position 630 to arginine.
7. The artificially engineered recombinant or reassortant influenza B virus of
any one of
claims 1 to 6, which is a 6:2 reassortant influenza B virus.
8. The artificially engineered recombinant or reassortant influenza B virus of
any one of
claims 1 to 7, wherein the titer of the virus grown in cell culture at 33
degrees Celsius is at
least 2 log10 greater compared to the same virus grown at 37 degrees Celsius.
- 101 -

9. The artificially engineered recombinant or reassortant influenza B virus of
any one of
claims 1 to 8, wherein the virus is derived from a B/Ann Arbor/1/66 strain.
10. The artificially engineered recombinant or reassortant influenza B virus
of any one of
claims 5 to 9, which exhibits at least a 2.0 log10 reduction to 5.0 log10
reduction in replication
in a ferret attenuation assay compared to influenza B virus not including the
amino acid
substitutions.
11. The method of claim 10, wherein the influenza B virus exhibits
undetectable replication in
a ferret attenuation assay.
12. An immunogenic composition comprising the artificially engineered
recombinant or
reassortant influenza B virus of any one of claims 1 to 11.
13. Use of an immunogenic composition of claim 12 for stimulating an immune
response.
14. A method for making an artificially engineered recombinant or reassortant
influenza B
virus, comprising:
(a) introducing mutations in an influenza B virus genome that result in a
modified NP
polypeptide comprising an amino acid substitution at position 114 to alanine
and an amino
acid substitution at position 410 to histidine, wherein the modified NP
polypeptide comprises
a threonine at position 55;
(b) introducing a plurality of vectors into a population of cultured host
cells, wherein
the plurality of vectors corresponds to the influenza B virus genome and the
plurality of
vectors comprises the mutations recited in (a);
(c) culturing the population of host cells; and
(d) recovering the artificially engineered recombinant or reassortant
influenza B virus
produced by the host cells of (c), wherein the influenza B virus has a
temperature sensitive
phenotype.
15. The method of claim 14, which comprises introducing a mutation in the
influenza B virus
genome that results in a modified NP polypeptide comprising an amino acid
substitution at
position 509 to threonine.
- 102 -

16. The method of claim 15, which comprises introducing mutations in the
influenza B virus
genome that result in a modified NP polypeptide with amino acid substitutions
consisting of a
substitution at position 114 to alanine, a substitution at position 410 to
histidine, and a
substitution at position 509 to threonine.
17. The method of any one of claims 14 to 16, which comprises introducing a
mutation in the
influenza B virus genome that results in a modified PA polypeptide comprising
at least one of
an amino acid substitution at position 431 to methionine and an amino acid
substitution at
position 497 to histidine.
18. The method of any one of claims 14 to 17, which comprises introducing a
mutation in the
influenza B virus genome that results in a modified M1 polypeptide comprising
at least one of
an amino acid substitution at position 159 to glutamine and an amino acid
substitution at
position 183 to valine, wherein the influenza B virus has an attenuated
phenotype.
19. The method of any one of claims 14 to 18, which comprises introducing a
mutation in the
influenza B virus genome that results in a modified PB2 polypeptide comprising
an amino
acid substitution at position 630 to arginine.
20. The method of any one of claims l 4 to 19, wherein the influenza B virus
is a 6:2
reassortant influenza B virus.
21. The method of any one of claims 14 to 20, wherein the titer of the virus
grown in cell
culture at 33 degrees Celsius is at least 2 log10 greater compared to the same
virus grown at 37
degrees Celsius.
22. The method of any one of claims 14 to 21, wherein the virus is derived
from a B/Ann
Arbor/1/66 strain.
23. The method of any one of claims 14 to 22, further comprising amplifying
the reassortant
influenza B virus of (d) by passage in cultured cells or in hens' eggs.
24. The method of any one of claims 18 to 23, wherein the influenza B virus
exhibits at least a
2.0 log10 reduction to 5.0 log10 reduction in replication in a ferret
attenuation assay compared
to influenza B virus not including the amino acid substitutions.
25. The method of claim 24, wherein the influenza B virus exhibits
undetectable replication in
a ferret attenuation assay.
- 103 -

26. The method of any one of claims 14 to 25 wherein the cells are cultured at
a temperature
of less than or equal to 35 degrees Celsius.
27. The method of any one of claims 14 to 26, wherein the cultured cells or
host cells
independently are chosen from Vero cells, MDCK cells, 293T cells and COS
cells.
28. The method of any one of claims 14 to 27, wherein the mutations are
introduced by site-
directed mutagenesis.
29. An artificially engineered recombinant or reassortant influenza A virus,
comprising:
a modified PB1 polypeptide comprising an amino acid substitution at position
391 to
glutamate and an amino acid substitution at position 581 to glycine, wherein:
the modified PB1 polypeptide comprises a glutamate at position 457; and
the influenza A virus has a temperature sensitive phenotype.
30. The artificially engineered recombinant or reassortant influenza A virus
of claim 29,
wherein the modified PB1 polypeptide comprises an amino acid substitution at
position 661 to
threonine.
31. The artificially engineered recombinant or reassortant influenza A virus
of claim 30,
wherein amino acid substitutions in the modified PB1 polypeptide consist of a
substitution at
position 391 to glutamate, a substitution at position 581 to glycine, and a
substitution at
position 661 to threonine.
32. The artificially engineered recombinant or reassortant influenza A virus
of any one of
claims 29 to 31, comprising a modified PB2 polypeptide comprising an amino
acid
substitution at position 265 to serine.
33. The artificially engineered recombinant or reassortant influenza A virus
of claim 32,
wherein amino acid substitutions in the modified PB2 polypeptide consist of a
substitution at
position 265 to serine.
34. The artificially engineered recombinant or reassortant influenza A virus
of any one of
claims 29 to 33, comprising a modified NP polypeptide comprising an amino acid
substitution
at position 34 to glycine.
- 104 -

35. The artificially engineered recombinant or reassortant influenza A virus
of claim 34,
wherein amino acid substitutions in the modified NP polypeptide consist of a
substitution at
position 34 to glycine.
36. The artificially engineered recombinant or reassortant influenza A virus
of claim 35,
wherein:
amino acid substitutions in the modified PB1 polypeptide consist of a
substitution at
position 391 to glutamate, a substitution at position 581 to glycine, and a
substitution at
position 661 to threonine;
amino acid substitutions in the modified PB2 polypeptide consist of a
substitution at
position 265 to serine; and
amino acid substitutions in the modified NP polypeptide consist of a
substitution at
position 34 to glycine.
37. The artificially engineered recombinant or reassortant influenza A virus
of any one of
claims 29 to 36, which is a 6:2 reassortant influenza A virus.
38. The artificially engineered recombinant or reassortant influenza A virus
of any one of
claims 29 to 37, wherein the titer of the virus grown in cell culture at 33
degrees Celsius is at
least 4 log10 greater compared to the same virus grown at 39 degrees Celsius.
39. The artificially engineered recombinant or reassortant influenza A virus
of any one of
claims 29 to 38, wherein the virus comprises a PR8 polynucleotide.
40. The artificially engineered recombinant or reassortant influenza A virus
of any one of
claims 29 to 39, which has an attenuated phenotype.
41. The artificially engineered recombinant or reassortant influenza A virus
of claim 40,
wherein the influenza A virus exhibits at least a 3.0 logio reduction in
replication in a ferret
attenuation assay compared to influenza A virus not including the amino acid
substitutions.
42. The artificially engineered recombinant or reassortant influenza A virus
of claim 41,
wherein the influenza A virus exhibits undetectable replication in a ferret
attenuation assay.
43. An immunogenic composition comprising the artificially engineered
recombinant or
reassortant influenza A virus of any one of claims 29 to 42.
- 105 -

44. Use of an immunogenic composition of claim 43 for stimulating an immune
response.
45. A method for making an artificially engineered recombinant or reassortant
influenza A
virus, comprising:
(a) introducing mutations in an influenza A virus genome that result in a
modified PB1
polypeptide comprising an amino acid substitution at position 391 to glutamate
and an amino
acid substitution at position 581 to glycine, wherein the modified PB1
polypeptide comprises a
glutamate at position 457;
(b) introducing a plurality of vectors into a population of cultured host
cells, wherein
the plurality of vectors corresponds to the influenza A virus genome and the
plurality of
vectors comprises the mutations recited in (a);
(c) culturing the population of host cells; and
(d) recovering the artificially engineered recombinant or reassortant
influenza A virus
produced by the host cells of (c), wherein the influenza A virus has a
temperature sensitive
phenotype.
46. The method of claim 45, which comprises introducing a mutation in the
influenza A virus
genome that results in a modified PB1 polypeptide comprising an amino acid
substitution at
position 661 to threonine.
47. The method of claim 46, which comprises introducing mutations in the
influenza A virus
genome that result in a modified PB1 polypeptide with amino acid substitutions
consisting of a
substitution at position 391 to glutamate, a substitution at position 581 to
glycine, and a
substitution at position 661 to threonine.
48. The method of any one of claims 45 to 47, which comprises introducing a
mutation in the
influenza A virus genome that results in a modified PB2 polypeptide comprising
an amino
acid substitution at position 265 to serine.
49. The method of claim 48, which comprises introducing a mutation in the
influenza A virus
genome that results in a modified PB2 polypeptide with amino acid
substitutions consisting of
a substitution at position 265 to serine.
50. The method of any one of claims 45 to 49, which comprises introducing a
mutation in the
influenza A virus genome that results in a modified NP polypeptide comprising
an amino acid
substitution at position 34 to glycine.
- 106 -

51. The method of claim 50, which comprises introducing a mutation in the
influenza A virus
genome that results in a modified NP polypeptide with amino acid substitutions
consisting of a
substitution at position 34 to glycine.
52. The method of claim 51, wherein the mutations in the influenza A virus
genome result in:
a modified PB1 polypeptide with amino acid substitutions consisting of a
substitution
at position 391 to glutamate, a substitution at position 581 to glycine, and a
substitution at
position 661 to threonine;
a modified PB2 polypeptide with amino acid substitutions consisting of a
substitution
at position 265 to serine; and
a modified NP polypeptide with amino acid substitutions consisting of a
substitution at
position 34 to glycine.
53. The method of any one of claims 45 to 52, wherein the reassortant
influenza A virus is a
6:2 reassortant influenza A virus.
54. The method of any one of claims 45 to 53, wherein the titer of the virus
grown in cell
culture at 33 degrees Celsius is at least 4 log10 greater compared to the same
virus grown at 39
degrees Celsius.
55. The method of any one of claims 45 to 54, wherein the influenza A virus
comprises a PR8
polynucleotide.
56. The method of any one of claims 45 to 55, further comprising amplifying
the reassortant
influenza A virus of (d) by passage in cultured cells or in hens' eggs.
57. The method of any one of claims 45 to 56, wherein the cultured cells or
host cells
independently are chosen from Vero cells, MDCK cells, 293T cells and COS
cells.
58. The method of any one of claims 45 to 57, wherein the mutations are
introduced by site-
directed mutagenesis.
59. The method of any one of claims 45 to 58, which has an attenuated
phenotype.
60. The method of claim 59, wherein the influenza A virus exhibits at least a
3.0 log10
reduction in replication in a ferret attenuation assay compared to influenza A
virus not
including the amino acid substitutions.
- 107 -

61. The method of claim 60, wherein the influenza A virus exhibits
undetectable replication
in a ferret attenuation assay.
62. The method of any one of claims 45 to 61, wherein the cells are cultured
at a temperature
of less than or equal to 35 degrees Celsius.
63. A method for producing influenza viruses in cell culture, the method
comprising:
i) introducing a plurality of vectors comprising an influenza virus genome
into a
population of host cells, which population of host cells is capable of
supporting replication of
influenza virus;
ii) culturing the population of host cells at a temperature less than or equal
to 35°C;
and,
iii) recovering a plurality of influenza viruses.
64. The method of claim 63, wherein the influenza viruses comprise at least
one of: an
attenuated influenza virus, a cold adapted influenza virus and a temperature
sensitive influenza
virus.
65. The method of claim 63, wherein the influenza viruses possess one or more
phenotypic
attributes selected from the group consisting of: attenuation, temperature
sensitivity and cold
adaptation.
66. The method of claim 63, wherein the influenza viruses are suitable for
administration in
an intranasal vaccine formulation.
67. The method of claim 63, comprising introducing a plurality of vectors
comprising at least
one of a) an influenza A/Ann Arbor/6/60 virus or an artificially engineered
influenza A virus
comprising at least one substituted amino acid, which substituted amino acid
influences the
characteristic biological properties of A/Ann Arbor/6/60; and, b) an influenza
B/Ann
Arbor/1/66 virus or an artificially engineered influenza B virus comprising at
least one
substituted amino acid, which substituted amino acid influences the
characteristic biological
properties of B/Ann Arbor/1/66.
68. The method of claim 67, comprising introducing a plurality of vectors
comprising at least
one of: a) an artificially engineered influenza A virus comprising at least
one substituted
amino acid, which substituted amino acid corresponds to a unique amino acid of
influenza
A/Ann Arbor/6/60; and, b) an artificially engineered influenza B virus
comprising at least one
- 108 -

substituted amino acid, which substituted amino acid corresponds to a unique
amino acid of
influenza B/Ann Arbor/1/66.
69. The method of claim 67, wherein the influenza viruses comprise at least
one of: a) an
influenza A strain virus comprising at least one substituted amino acid
selected from the group
consisting of: PB1 391, PB1 581, PB1 661, PB2 265 and NP34;and, b) an
influenza B strain virus
comprising at least one substituted amino acid selected from the group
consisting of: PB2 630;
PA 431; PA 497; NP55; NP114; NP410; NP510; M1 159 and M1 183.
70. The method of claim 69, wherein the influenza viruses comprise at least
one of: a) an
influenza A strain virus comprising at least one substituted amino acid
selected from the group
consisting of: PB1 391 (K391E), PB1 581 (E581G), PB1 661 (A661T), PB2 265
(N265S) and NP34
(D34G); and, b) influenza B strain viruses comprising at least one substituted
amino acid
selected from the group consisting of: PB2 630(S630R); PA431 (V431M); PA497
(Y497H); NP55
(T55A); NP114 (V114A); NP410 (P410H); NP510 (A510T); M1 159 (H159Q) and M1 183
(M183V).
71. The method of claim 69, wherein the influenza viruses comprise a plurality
of substituted
amino acids.
72. The method of claim 70, wherein the plurality comprises two, three, four,
five, six, seven,
eight or nine substituted amino acids.
73. The method of any one of claims 63 to 72, comprising introducing a
plurality of vectors
comprising an influenza B virus.
74. The method of any one of claims 63 to 72, comprising introducing a
plurality of vectors
comprising an influenza A virus.
75. The method of any one of claims 63 to 72, comprising introducing a
plurality of vectors
comprising: (a) at least 6 internal genome segments of a first influenza
strain; and, (b) at least
one genome segment encoding an immunogenic influenza surface antigen of a
second
influenza strain.
76. The method of any one of claims 63 to 72, comprising introducing a
plurality of vectors
comprising: (a) at least 6 internal genome segments of a first influenza
strain, which influenza
strain is attenuated, cold adapted, and/or temperature sensitive; and, (b) at
least one genome
segment encoding an immunogenic influenza surface antigen of a second
influenza strain.
-109-

77. The method of any one of claims 63 to 72, comprising introducing a
plurality of vectors
comprising: (a) at least 6 internal genome segments of a first influenza
strain, which influenza
strain is attenuated, cold adapted, and temperature sensitive; and, (b) at
least one genome
segment encoding an immunogenic influenza surface antigen of a second
influenza strain.
78. The method of any one of claims 63 to 72, comprising introducing a
plurality of vectors
comprising: (a) at least 6 internal genome segments of influenza B/Ann
Arbor/1/66 or
influenza strain A/Ann Arbor/6/60 or an artificially engineered influenza
virus comprising at
least one substituted amino acid, which substituted amino acid corresponds to
a unique amino
acid of influenza B/Ann Arbor/1/66 or influenza A/Ann Arbor/6/60; and, (b) at
least one
genome segment encoding an immunogenic influenza surface antigen of a
different influenza
strain.
79. The method of claim 78, comprising introducing a plurality of vectors
comprising: (a) 6
internal genome segments of influenza B/Ann Arbor/1/66 or influenza strain
A/Ann
Arbor/6/60 or an artificially engineered influenza virus comprising at least
one substituted
amino acid, which substituted amino acid corresponds to a unique amino acid of
influenza
B/Ann Arbor/1/66 or influenza A/Ann Arbor/6/60; and (b) two genome segments
encoding the
HA and NA antigens of an influenza strain other than B/Ann Arbor/1/66 or A/Ann
Arbor/6/60.
80. The method of claim 78, comprising introducing a plurality of vectors
comprising: (a) 7
internal genome segments of influenza B/Ann Arbor/1/66 or influenza strain
A/Ann
Arbor/6/60 or an artificially engineered influenza virus comprising at least
one substituted
amino acid, which substituted amino acid corresponds to a unique amino acid of
influenza
B/Ann Arbor/1/66 or influenza A/Ann Arbor/6/60; (b) and either a genome
segment encoding
the HA antigen or a genome segment encoding the NA antigen of an influenza
strain other
than B/Ann Arbor/1/66 or A/Ann Arbor/6/60.
81. The method of any one of claims 63 to 72, comprising introducing a
plurality of plasmid
vectors.
82. The method of any one of claims 63 to 81, wherein the population of host
cells comprises
one or more of: Vero cells, Per.C6 cells, MDCK cells, 293T cells, or COS
cells.
83. The method of claim 82, wherein the population of cells comprises a
mixture of at least
two of MDCK cells, 293T cells, and COS cells.
-110-

84. The method of any one of claims 63 to 83, comprising culturing the
population of host
cells at a temperature between about 32°C and 35°C.
85. The method of any one of claims 63 to 83, comprising culturing the
population of host
cells at a temperature between about 32°C and 34°C.
86. The method of any one of claims 63 to 83, comprising culturing the
population of host
cells at a temperature of about 33°C.
87. The method of any one of claims 63 to 86, comprising recovering
recombinant influenza
viruses.
88. The method of any one of claims 63 to 86, comprising recovering
reassortant influenza
viruses.
89. The method of any one of claims 63 to 88, further comprising inactivating
the influenza
viruses.
90. An influenza virus produced by the method of any one of claims 63 to 89.
91. A method for producing a recombinant influenza virus vaccine, the method
comprising:
i) introducing a plurality of vectors comprising an influenza virus genome
into a
population of host cells, which population of host cells is capable of
supporting replication of
influenza virus;
ii) culturing the host cell at a temperature less than or equal to
35°C; and,
iii) recovering an influenza virus capable of eliciting an immune response
upon
administration to a subject.
92. The method of claim 91, wherein the influenza virus possesses at least one
phenotypic
attribute selected from the group consisting of: temperature sensitivity, cold
adaption and
attenuation.
93. The method of claim 91, comprising introducing a plurality of vectors
comprising an
influenza B virus.
94. The method of claim 91, comprising introducing a plurality of vectors
comprising an
influenza A virus.
-111-

95. The method of claim 91, the recombinant influenza virus vaccine comprising
a reassortant
influenza virus.
96. The method of claim 91, wherein the influenza virus vaccine comprises a
live attenuated
influenza virus vaccine.
97. The method of any one of claims 91 to 96, further comprising inactivating
the influenza
virus.
98. An influenza virus vaccine produced by the method of any one of claims 91
to 97.
99. A method for producing influenza B viruses in cell culture, the method
comprising:
i) introducing a plurality of vectors comprising an influenza B virus genome
into a
population of host cells, which population of host cells is capable of
supporting replication of
influenza virus;
ii) culturing the population of host cells under conditions permissive for
viral
replication; and,
iii) recovering a plurality of influenza B viruses.
100. The method of claim 99, comprising a helper free method for producing
influenza B
virus in cell culture, the method comprising introducing a plurality of
vectors comprising an
influenza B virus genome into a population of host cells in the absence of a
helper virus.
101. The method of claim 99 or 100, comprising culturing the population of
host cells at a
temperature less than or equal to 35°C.
102. The method of claim 99 or 100, comprising culturing the population of
host cells at a
temperature between about 32°C and about 35°C.
103. The method of claim 99 or 100, comprising culturing the population of
host cells at a
temperature between about 32°C and about 34°C.
104. The method of claim 99 or 100, comprising culturing the population of
host cells at a
temperature of about 33°C.
105. The method of any one of claims 99 to 104, comprising recovering
recombinant
influenza viruses.
-112-

106. The method of any one of claims 99 to 104, comprising recovering
reassortant influenza
viruses.
107. An influenza virus produced by the method of any one of claims 99 to 105.
108. A method for producing influenza viruses in cell culture, the method
comprising:
i) introducing a plurality of vectors comprising an influenza virus genome
into a
population of Vero cells by electroporation;
ii) culturing the population of Vero cells under conditions permissive for
viral
replication; and,
iii) recovering a plurality of influenza viruses.
109. The method of claim 108, wherein the influenza viruses possess one or
more phenotypic
attributes selected from the group consisting of: attenuation, temperature
sensitivity and cold
adaptation.
110. The method of claim 108, wherein the influenza viruses comprise an
attenuated, cold
adapted, temperature sensitive influenza virus.
111. The method of claim 108, wherein the influenza virus is suitable for
administration in an
intranasal vaccine formulation.
112. The method of claim 108, comprising introducing a plurality of vectors
comprising an
influenza A virus.
113. The method of claim 108, comprising culturing the population of host
cells at a
temperature less than or equal to 35°C.
114. The method of claim 108, comprising culturing the Vero cells in serum
free medium.
115. A bi-directional expression vector comprising:
a plasmid comprising a comprising a first promoter inserted between a second
promoter and a bi-directional polyadenylation site.
116. The vector of claim 115, wherein the first promoter and the second
promoter are situated
in opposite orientations flanking at least one cloning site.
117. The vector of claim 115 or 116, wherein the bi-directional
polyadenylation site
comprises an SV40 polyadenylation site.
-113-

118. The vector of claim 115, 116 or 117, comprising pAD3000.
119. The vector of any one of claims 115 to 118, further comprising a double
stranded nucleic
acid comprising at least one segment of an influenza virus genome inserted
into the cloning
site.
120. The vector of any one of claims 115 to 119, wherein the first and second
promoters are
operably linked to alternative strands of the same double stranded viral
nucleic acid
comprising a segment of the influenza virus genome.
121. The vector of claim 115, the vector comprising:
a plasmid comprising a comprising a first promoter inserted between a second
promoter and an SV40 polyadenylation site;
wherein the first promoter and the second promoter are situated in opposite
orientations flanking at least one segment of an influenza virus.
122. A kit comprising one or more expression vectors as defined in any one of
claims 115 to
121, and one or more of: a cell, a buffer, a culture medium, an instruction
set, a packaging
material, and a container.
123. The kit of claim 122, comprising a plurality of expression vectors each
comprising at
least one segment of an influenza virus genome.
124. The kit of claim 123, comprising a plurality of expression vectors
comprising at least 6
internal genome segments of a first influenza strain, which influenza strain
possesses at least
one phenotypic attribute selected from the group consisting of: temperature
sensitivity, cold
adaptation and attenuation.
125. The kit of claim 123, wherein the plurality of expression vectors
comprises a library of
nucleic acids encoding variant HA and/or NA antigens.
126. A composition comprising:
a productively growing cell culture comprising at least one cell, which at
least one cell
comprises a plurality of vectors, which plurality of vectors comprises an
influenza virus
genome, at a temperature less than or equal to 35°C.
127. The composition of claim 126, further comprising a cell culture medium.
- 114 -

128. The composition of claim 126 or 127, wherein the plurality of vectors
comprise bi-
directional expression vectors.
129. The composition of claim 128, the bi-directional expression vectors
comprising a first
promoter inserted between a second promoter and a SV40 polyadenylation site;
wherein the first promoter and the second promoter are situated in opposite
orientations flanking at least one segment of an influenza virus.
130. A cell culture system comprising;
a productively growing cell culture comprising at least one cell, which at
least one cell
comprises a plurality of vectors, which plurality of vectors comprises an
influenza virus
genome; and,
a regulator for maintaining the culture at a temperature less than or equal to
35°C.
131. The cell culture system of claim 130, further comprising a cell culture
medium.
132. The cell culture system of claim 130 or 131, wherein the plurality of
vectors comprise
bi-directional expression vectors.
133. The cell culture system of claim 132, the bi-directional expression
vectors comprising a
first promoter inserted between a second promoter and a SV40 polyadenylation
site;
wherein the first promoter and the second promoter are situated in opposite
orientations flanking at least one segment of an influenza virus.
-115-

Description

CA 02827114 2013-09-10
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMAND E OLT CE BREVETS
COMPREND PLUS D'LTN TOME.
CECI EST LE TOME ________________________ DE __
NOTE: Pour les tomes additionels, veillez contacter le Bureau 6anadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME I OF
NOTE: For additional volumes please contact the Canadian Patent Office.

CA 02827114 2013-09-10
MULTI PLASMID SYSTEM FOR THE PRODUCTION OF INFLUENZA
VIRUS
10
BACKGROUND OF THE INVENTION
[0002] Influenza viruses are made up of an internal ribonucleoprotein
core
containing a segmented single-stranded RNA genome and an outer lipoprotein
envelope
lined by a matrix protein. Influenza A and B viruses each contain eight
segments of single
stranded RNA with negative polarity. The influenza A genome encodes at least
eleven
polypeptides. Segments 1-3 encode the three polypeptides, making up the viral
RNA-
dependent RNA polymerase. Segment 1 encodes the polymerase complex protein
PB2.
The remaining polymerase proteins PB1 and PA are encoded by segment 2 and
segment 3,
respectively. In addition, segment 1 of some influenza A strains encodes a
small protein,
PB1-F2, produced from an alternative reading frame within the PB1 coding
region.
Segment 4 encodes the hemagglutinin (HA) surface glycoprotein involved in cell
attachment and entry during infection. Segment 5 encodes the nucleocapsid
nucleoprotein
(NP) polypeptide, the major structural component associated with viral RNA.
Segment 6
encodes a neuraminidase (NA) envelope glycoprotein. Segment 7 encodes two
matrix
proteins, designated MI and M2, which are translated from differentially
spliced mRNAs.
Segment 8 encodes NS1 and NS2 (NEP), two nonstructural proteins, which are
translated
from alternatively spliced mRNA variants.
[0003] The eight genome segments of influenza B encode 11 proteins.
The three
largest genes code for components of the RNA polymerase, PB1, PB2 and PA.
Segment 4
encodes the HA protein. Segment 5 encodes NP. Segment 6 encodes the NA protein
and
-1-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
the NB protein. Both proteins, NB and NA, are translated from overlapping
reading
frames of a biscistronic mR_NA. Segment 7 of influenza B also encodes two
proteins: M1
and BM2. The smallest segment encodes two products: NS1 is translated from the
full
length RNA, while NS2 is translated from a spliced mRNA variant.
[0004] Vaccines capable of producing a protective immune response specific
for
influenza viruses have been produced for over 50 years. Vaccines can be
characterized as
whole virus vaccines, split virus vaccines, surface antigen vaccines and live
attenuated
virus vaccines. While appropriate formulations of any of these vaccine types
is able to
produce a systemic immune response, live attenuated virus vaccines are also
able to
stimulate local mucosa! immunity in the respiratory tract.
[0005] FluMistTm is a live, attenuated vaccine that protects children
and adults
from influenza illness (Belshe et al. (1998) The efficacy of live attenuated,
cold-adapted,
trivalent, intranasal influenza virus vaccine in children N Engl J Med
338:1405-12;
Nichol et al. (1999) Effectiveness of live, attenuated intranasal influenza
virus vaccine in
healthy, working adults: a randomized controlled trial JAMA 282:137-44).
FluMistTm
vaccine strains contain HA and NA gene segments derived from the currently
circulating
wild-type strains along with six gene segments, PB1, PB2, PA, NP, M and NS,
from a
common master donor virus (MDV). The MDV for influenza A strains of FluMist
(MDV-
A), was created by serial passage of the wt A/Ann Arbor/6/60 (A/AA/6/60)
strain in
primary chicken kidney tissue culture at successively lower temperatures
(Maassab (1967)
Adaptation and growth characteristics of influenza virus at 25 degrees C
Nature 213:612-
4). MDV-A replicates efficiently at 25 C (ca, cold adapted), but its growth is
restricted at
38 and 39 C (ts, temperature sensitive). Additionally, this virus does not
replicate in the
lungs of infected ferrets (att, attenuation). The ts phenotype is believed to
contribute to the
attenuation of the vaccine in humans by restricting its replication in all but
the coolest
regions of the respiratory tract. The stability of this property has been
demonstrated in
animal models and clinical studies. In contrast to the ts phenotype of
influenza strains
created by chemical mutagenesis, the ts property of MDV-A did not revert
following
passage through infected hamsters or in shed isolates from children (for a
recent review,
see Murphy & Coelingh (2002) Principles underlying the development and use of
live
attenuated cold-adapted influenza A and B virus vaccines Viral Immunol 15:295-
323).
-2-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1271,
[0006] Clinical studies in over 20,000 adults and children involving
12 separate
6:2 reassortant strains have shown that these vaccines are attenuated, safe
and efficacious
(Belshe et al. (1998) The efficacy of live attenuated, cold-adapted,
trivalent, intranasal
influenza virus vaccine in children N Engl J Med 338:1405-12; Boyce et al.
(2000) Safety
and immunogenicity of adjuvanted and unadjuvanted subunit influenza vaccines
administered intranasally to healthy adults Vaccine 19:217-26; Edwards et al.
(1994) A
randomized controlled trial of cold adapted and inactivated vaccines for the
prevention of
influenza A disease J Infect Dis 169:68-76 ; Nichol et al. (1999)
Effectiveness of live,
attenuated intranasal influenza virus vaccine in healthy, working adults: a
randomized
controlled trial JAMA 282:137-44). Reassortants carrying the six internal
genes of MDV-
A and the two HA and NA gene segments of the wt virus (6:2 reassortant)
consistently
maintain ca, ts and att phenotypes (Maassab et al. (1982) Evaluation of a cold-
recombinant influenza virus vaccine in ferrets J Infect Dis 146:780-900).
[0007] To date, all commercially available influenza vaccines in the
United States
have been propagated in embryonated hen's eggs. Although influenza virus grows
well in
hen's eggs, production of vaccine is dependent on the availability of eggs.
Supplies of
eggs must be organized, and strains for vaccine production selected months in
advance of
the next flue season, limiting the flexibility of this approach, and often
resulting in delays
and shortages in production and distribution.
[0008] Systems for producing influenza viruses in cell culture have also
been
developed in recent years (See, e.g., Furminger. Vaccine Production, in
Nicholson et al.
(eds) Textbook of Influenza pp. 324-332; Merten et al. (1996) Production of
influenza
virus in cell cultures for vaccine preparation, in Cohen & Shafferman (eds)
Novel
Strategies in Design and Production of Vaccines pp. 141-151). Typically, these
methods
involve the infection of suitable immortalized host cells with a selected
strain of virus.
While eliminating many of the difficulties related to vaccine production in
hen's eggs, not
all pathogenic strains of influenza grow well and can be produced according to
established
tissue culture methods. In addition, many strains with desirable
characteristics, e.g.,
attenuation, temperature sensitivity and cold adaptation, suitable for
production of live
attenuated vaccines, have not been successfully grown in tissue culture using
established
methods.
-3-

CA 02827114 2013-09-10
[0009] Production of influenza viruses from recombinant DNA would
significantly
increase the flexibility and utility of tissue culture methods for influenza
vaccine
production. Recently, systems for producing influenza A viruses from
recombinant
plasmids incorporating cDNAs encoding the viral genome have been reported
(See, e.g.,
Neumann et at. (1999) Generation of influenza A virus entirely from cloned
cDNAs. Proc
Natl Acad Sci USA 96:9345-9350; Fodor et al. (1999) Rescue of influenza A
virus from
recombinant DNA. J. Virol 73:9679-9682; Hoffmann et al. (2000) A DNA
transfection
system for generation of influenza A virus from eight plasmids Proc Natl Acad
Sci USA
97:6108-6113; WO 01/83794). These systems offer the potential to produce
recombinant
viruses, and reassortant viruses expressing the immunogenic HA and NA proteins
from
any selected strain. However, unlike influenza A virus, no reports have been
published
describing plasmid-only systems for influenza B virus.
[0010]
Additionally, none of the currently available plasmid only _systems are
suitable for generating attenuated, temperature sensitive, cold adapted
strains suitable for
live attenuated vaccine production. The present invention provides an eight
plasmid
system for the generation of influenza B virus entirely from cloned cDNA, and
methods
for the production of attenuated live influenza A and B virus suitable for
vaccine "
formulations, such as live virus vaccine formulations useful for intranasal
administration,
as well as numerous other benefits that will become apparent upon review of
the
specification.
-4-

CA 02827114 2013-09-10
SUMMARY OF THE INVENTION
[0010A] Various embodiments of this invention provide an artificially
engineered
recombinant or reassortant influenza B virus, comprising: a modified NP
polypeptide
comprising an amino acid substitution at position 114 to alanine and an amino
acid
substitution at position 410 to histidine, wherein: the modified NP
polypeptide comprises a
threonine at position 55; and the influenza B virus has a temperature
sensitive phenotype.
Also provided is an immunogenic composition comprising such an artificially
engineered
virus as well as use of such a composition for stimulating an immune response.
[0010B] Various embodiments of this invention provide a method for
making an
artificially engineered recombinant or reassortant influenza B virus,
comprising: (a)
introducing mutations in an influenza B virus genome that result in a modified
NP
polypeptide comprising an amino acid substitution at position 114 to alanine
and an amino
acid substitution at position 410 to histidine, wherein the modified NP
polypeptide
comprises a threonine at position 55; (b) introducing a plurality of vectors
into a
population of cultured host cells, wherein the plurality of vectors
corresponds to the
influenza B virus genome and the plurality of vectors comprises the mutations
recited in
(a); (c) culturing the population of host cells; and (d) recovering the
artificially engineered
recombinant or reassortant influenza B virus produced by the host cells of
(c), wherein the
influenza B virus has a temperature sensitive phenotype.
[0010C] Various embodiments of this invention provide an artificially
engineered
recombinant or reassortant influenza A virus, comprising: a modified PB1
polypeptide
comprising an amino acid substitution at position 391 to glutamate and an
amino acid
substitution at position 581 to glycine, wherein: the modified PB1 polypeptide
comprises a
glutamate at position 457; and the influenza A virus has a temperature
sensitive
phenotype. Also provided is an immunogenic composition comprising such an
artificially
engineered virus as well as use of such a composition for stimulating an
immune response.
[0010D] Various embodiments of this invention provide a method for
making an
artificially engineered recombinant or reassortant influenza A virus,
comprising: (a)
introducing mutations in an influenza A virus genome that result in a modified
PB1
polypeptide comprising an amino acid substitution at position 391 to glutamate
and an
amino acid substitution at position 581 to glycine, wherein the modified PB1
polypeptide
comprises a glutamate at position 457; (b) introducing a plurality of vectors
into a
population of cultured host cells, wherein the plurality of vectors
corresponds to the
- 4a -

CA 02827114 2013-09-10
influenza A virus genome and the plurality of vectors comprises the mutations
recited in
(a); (c) culturing the population of host cells; and (d) recovering the
artificially engineered
recombinant or reassortant influenza A virus produced by the host cells of
(c), wherein the
influenza A virus has a temperature sensitive phenotype.
[0010E] Various embodiments of this invention provide a method for
producing
influenza viruses in cell culture, the method comprising: i) introducing a
plurality of
vectors comprising an influenza virus genome into a population of host cells,
which
population of host cells is capable of supporting replication of influenza
virus; ii) culturing
the population of host cells at a temperature less than or equal to 35 C; and,
iii) recovering
a plurality of influenza viruses. Also provided is an influenza virus produced
by such a
method.
[0010F] Various embodiments of this invention provide a method for
producing a
recombinant influenza virus vaccine, the method comprising: i) introducing a
plurality of
vectors comprising an influenza virus genome into a population of host cells,
which
population of host cells is capable of supporting replication of influenza
virus; ii) culturing
the host cell at a temperature less than or equal to 35 C; and, iii)
recovering an influenza
virus capable of eliciting an immune response upon administration to a
subject. Also
provided is an influenza virus vaccine prepared by this method.
[0010G] Various embodiments of this invention provide a method for
producing
influenza B viruses in cell culture, the method comprising: i) introducing a
plurality of
vectors comprising an influenza B virus genome into a population of host
cells, which
population of host cells is capable of supporting replication of influenza
virus; ii) culturing
the population of host cells under conditions permissive for viral
replication; and, iii)
recovering a plurality of influenza B viruses. Also provided is a virus
produced by such a
method.
[0010H] Various embodiments of this invention provide a bi-directional
expression
vector comprising: a plasmid comprising a comprising a first promoter inserted
between a
second promoter and a bi-directional polyadenylation site. Also provided is a
kit
comprising one or more of such expression vectors and one or more of a cell, a
buffer, a
culture medium, an instruction set, packaging material and a container.
[0010I] Various embodiments of this invention provide a composition
comprising:
a productively growing cell culture comprising at least one cell, which at
least one cell
comprises a plurality of vectors, which plurality of vectors comprises an
influenza virus
- 4b -

CA 02827114 2013-09-10
genome, at a temperature less than or equal to 35 C.
[0010J] Various embodiments of this invention provide a cell culture
system
comprising: a productively growing cell culture comprising at least one cell,
which at least
one cell comprises a plurality of vectors, which plurality of vectors
comprises an influenza
virus genome; and, a regulator for maintaining the culture at a temperature
less than or
equal to 35 C.
[0010K] Various embodiments of this invention provide a method for
producing
influenza viruses in cell culture, the method comprising: i) introducing a
plurality of
vectors comprising an influenza virus genome into a population of Vero cells
by
electroporation; ii) culturing the population of Vero cells under conditions
permissive for
viral replication; and, iii) recovering a plurality of influenza viruses.
[0010L1 Various embodiments of this invention provide a helper virus-
free method
for producing infectious influenza B viruses in cell culture, the method
comprising: i)
electroporating a population of Vero cells with a plurality of plasmid vectors
comprising
nucleic acid sequences of an influenza B virus genome; ii) culturing the
population of
Vero cells under conditions permissive for viral replication; and, iii)
recovering a plurality
of infectious influenza B viruses.
[0011] The present invention relates to a multi-vector system for the
production of
influenza viruses in cell culture, and to methods for producing recombinant
and reassortant
influenza viruses, including, e.g., attenuated (att) , cold adapted (ca)
and/or temperature-
sensitive (ts) influenza viruses, suitable as vaccines, including live
attenuated influenza
vaccines, such as those suitable for administration in an intranasal vaccine
formulation.
[0012] In a first aspect the invention provides vectors and methods
for producing
recombinant influenza B virus in cell culture, e.g., in the absence of helper
virus' (i.e., a
helper virus free cell culture system): The methods of the invention involve
introducing a
plurality of vectors, each of which incorporates a portion of an influenza B
virus into a
- population of host cells capable of supporting viral replication. The
host cells are cultured
- 4c -

CA 02827114 2013-09-10
under conditions permissive for viral growth, and influenza viruses are
recovered. In
some embodiments, the influenza B viruses are attenuated viruses, cold adapted
viruses
and/or temperature sensitive viruses. For example, in an embodiment, the
vector-derived
recombinant influenza B viruses are attenuated, cold adapted, temperature
sensitive
viruses, such as are suitable for administration as a live attenuated vaccine,
e.g., in a
intranasal vaccine formulation. In an exemplary embodiment, the viruses are
produced by
introducing a plurality of vectors incorporating all or part of an influenza
B/Ann
Arbor/1/66 virus genome, e.g., a ca B/Ann Arbor/1/66 virus genome.
[0013] For example, in some embodiments, the influenza B viruses are
artificially
engineered influenza viruses incorporating one or more amino acid
substitutions which
influence the characteristic biological properties of influenza strain ca
B/Ann Arbor/1/66.
Such influenza viruses include mutations resulting in amino acid substitutions
at one or
pB158 pB16, pB2265 and Np34,
more of positions PB1391, 61 such as: PB1391 (K391E),
PB1581 (E58IG), PB1661 (A661T), PB2265 (N265S) and NP34 (D34G). Any mutation
(at
one or more of these positions) which individually or in combination results
in increased
temperature sensitivity, cold adaptation or attenuation relative to wild type
viruses is a
suitable mutation in the context of the present invention.
[0014] In some embodiments, a plurality of vectors incorporating at
least the 6
internal genome segments of a one influenza B strain along with one or more
genome
segments encoding immunogenic influenza surface antigens of a different
influenza strain
are introduced into a population of host cells. For example, at least the 6
internal genome
segments of a selected attenuated, cold adapted and/or temperature sensitive
influenza B
strain, e.g., a ca, att, ts strain of B/Ann Arbor/1/66 or an artificially
engineered influenza B
strain including an amino acid substitution at one or more of the positions
specified above,
are introduced into a population of host cells along with one or more segments
encoding
immunogenic antigens derived from another virus strain. Typically the
immunogenic
surface antigens include either or both of the hemagglutinin (HA) and/or
neuraminidase
(NA) antigens. In embodiments where a single segment encoding an immunogenic
surface antigen is introduced, the 7 complementary segments of the selected
virus are also
introduced into the host cells.
-5-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
[0015] In certain embodiments, a plurality of plasmid vectors
incorporating
influenza B virus genome segments are introduced into a population of host
cells. For
example, 8 plasmids, each of which incorporates a different genome segment are
utilized
to introduce a complete influenza B genome into the host cells. Alternatively,
a greater
number of plasmids, incorporating smaller genomic subsequences can be
employed.
[0016] Typically, the plasmid vectors of the invention are bi-
directional expression
vectors. A bi-directional expression vector of the invention typically
includes a first
promoter and a second promoter, wherein the first and second promoters are
operably
linked to alternative strands of the same double stranded cDNA encoding the
viral nucleic
acid including a segment of the influenza virus genome. Optionally, the bi-
directional
expression vector includes a polyadenylation signal and/or a terminator
sequence. For
example, the polyadenylation signal and/or the terminator sequence can be
located
flanking a segment of the influenza virus genome internal to the two
promoters. One
favorable polyadenylation signal in the context of the invention is the SV40
polyadenylation signal. An exemplary plasmid vector of the invention is the
plasmid
pAD3000, illustrated in Figure 1.
[0017] The vectors are introduced into host cells capable of
supporting the
replication of influenza virus from the vector promoter : Favorable examples
of host cells
include Vero cells, Per.C6 cells, BHK cells, PCK cells, MDCK cells, MDBK
cells, 293
cells (e.g., 293T cells), and COS cells. In combination with the pAD3000
plasmid vectors
described herein, Vero cells, 293 cells, and COS cells are particularly
suitable. In some
embodiments, co-cultures of a mixture of at least two of these cell lines,
e.g., a
combination of COS and MDCK cells or a combination of 293T and MDCK cells,
constitute the population of host cells.
[0018] The host cells including the influenza B vectors are then grown in
culture
under conditions permissive for replication and assembly of viruses.
Typically, host cells
incorporating the influenza B plasmids of the invention are cultured at a
temperature
below 37 C, preferably at a temperature equal to, or less than, 35 C.
Typically, the cells
are cultured at a temperature between 32 C and 35 C. In some embodiments,
the cells
are cultured at a temperature between about 32 C and 34 C, e.g., at about 33
C.
Following culture for a suitable period of time to permit replication of the
virus to high
-6-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/1272.
titer, recombinant and/or reassortant viruses are recovered. Optionally, the
recovered
viruses can be inactivated.
[0019] The invention also provides broadly applicable methods
of producing
recombinant influenza viruses in cell culture by introducing a plurality of
vectors
incorporating an influenza virus genome into a population of host cells
capable of
t=
supporting replication of influenza virus, culturing the cells at a
temperature less than or
equal to 35 C, and recovering influenza viruses.
[0020] In certain embodiments, a plurality of plasmid vectors
incorporating
influenza virus genome segments are introduced into a population of host
cells. In certain
embodiments, 8 plasmids, each of which incorporates a different genome segment
are
utilized to introduce a complete influenza genome into the host cells.
Typically, the
plasmid vectors of the invention are bi-directional expression vectors. An
exemplary
plasmid vector of the invention is the plasmid pAD3000, illustrated in Figure
1.
[0021] In some embodiments, the influenza viruses correspond
to an influenza B
virus. In some embodiments, the influenza viruses correspond to an influenza A
virus. In
certain embodiments, the methods include recovering recombinant and/or
reassortant.
influenza viruses capable of eliciting an immune response upon administration,
e.g.,
intranasal administration, to a subject. In some embodiments, the viruses are
inactivated
prior to administration, in other embodiments, live-attenuated viruses are
administered.
Recombinant and reassortant influenza A and influenza B viruses produced
according to
the methods of the invention are also a feature of the invention.
[0022] In certain embodiments, the viruses include an
attenuated influenza virus, a
cold adapted influenza virus, a temperature sensitive influenza virus, or a
virus with any
combination of these desirable properties. In one embodiment, the influenza
virus
incorporates an influenza B/Ann Arbor/1/66 strain virus, e.g., a cold adapted,
temperature
sensitive, attenuated strain of B/Ann Arbor/I/66. In another embodiment, the
influenza
virus incorporates an influenza A/Ann Arbor/6/60 strain virus, e.g., a cold
adapted,
temperature sensitive, attenuated strain of A/Ann Arbor/6/60. In another
embodiment of
the invention, the viruses are artificially engineered influenza viruses
incorporating one or
more substituted amino acid which influences the characteristic biological
properties of,
e.g., ca A/Ann Arbor/6/60 or ca B/Ann Arbor/I/66. Such substituted amino acids
-7-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
-
favorably correspond to unique amino acids of ca A/Ann Arbor/6/60 or ca B/Ann
Arbor/1/66, e.g., in an A strain virus: PB1391 (K391E),Bp = 581
(E581G), PB1661 (A661T),
PB2265 (N265S) and NP34 (D34G); and, in a B strain virus: PB263 (S630R);
PA431
(V431M); PA497 (Y497H); NP 55 (T55A); NP114 (V114A); NP410 (P410H); NP51
(A510T);
M1159 (H159Q) and M1183 (M183V). Similarly, other amino acid substitutions at
any of
these positions resulting in temperature sensitivity, cold adaptation and/or
attenuation are
encompassed by the viruses and methods of the invention.
[0023] Optionally, reassortant viruses are produced by introducing
vectors
including the six internal genes of a viral strain selected for its favorable
properties
regarding vaccine production, in combination with the genome segments encoding
the
surface antigens (HA and NA) of a selected, e.g., pathogenic strain. For
example, the HA
segment is favorably selected from a pathogenically relevant H1,113 or B
strain, as is
routinely performed for vaccine production. Similarly, the HA segment can be
selected
from an emerging pathogenic strain such as an H2 strain (e.g., H2N2), an H5
strain (e.g.,
H5N1) or an H7 strain (e.g., H7N7). Alternatively, the seven complementary
gene
segments of the first strain are introduced in combination with either the HA
or NA
encoding segment. In certain embodiments, the internal gene segments are
derived from
the influenza B/Ann Arbor/1/66 or the AJAnn Arbor/6/60 strain.
[0024] Additionally, the invention provides methods for producing
novel influenza
viruses with desirable properties relevant to vaccine production, e.g.,
temperature
sensitive, attenuated, and/or cold adapted, influenza viruses, as well as
influenza vaccines
including such novel influenza viruses. In certain embodiments, novel
influenza A strain
virus is produced by introducing mutations that result amino acid
substitutions at one or
more specified positions demonstrated herein to be important for the
temperature sensitive
phenotype, e.g., PB1391, PB1581, pB1661, PB2265 and Np34. For example,
mutations are
introduced at nucleotide positions PB11195, PB11766, pB12005, pB2821 and
Npias,
or other
nucleotide positions resulting in an amino acid substitution at the specified
amino acid
position. Any mutation (at one or more of these positions) which individually
or in
combination results in increased temperature sensitivity, cold adaptation or
attenuation
relative to wild type viruses is a suitable mutation in the context of the
present invention.
For example, mutations selected from among PB1391 (K391E), PB1581 (ESSIG),
PB1661
(A661T), PB2265 (N265S) and NP34 (D34G) are favorably introduced into the
genome of a
-8-

CA 02827114 2013-09-10
WO 03/091401 PCT/1JS03/1272,
wild type influenza A strain, e.g., PR8, to produce a temperature sensitive
variant suitable
for administration as a live attenuated vaccine. To increase stability of the
desired
phenotype, a plurality of mutations are typically introduced. Following
introduction of the
selected mutation(s) into the influenza genome, the mutated influenza genome
is
replicated under conditions in which virus is produced. For example, the
mutated
influenza virus genome can be replicated in hens' eggs. Alternatively, the
influenza virus
genome can be replicated in cell culture. In the latter case, the virus is
optionally further
amplified in hens' eggs to increase the titer. Temperature sensitive, and
optionally,
attenuated and/or cold adapted viruses produced according to the methods of
the invention
are also a feature of the invention, as are vaccines including such viruses.
Similarly, novel
recombinant viral nucleic acids incorporating one or more mutations at
positions PB1391,
PB1581, pB1661, pB2265 and Net, e.g., mutations selected from among PB1391
(K391E),
PB1581 (E581G), PB1661 (A661T), PB2265 (N265S) and NP34 (D340), and
polypeptides
with such amino acid substitutions are a feature of the invention.
[0025] Likewise, the methods presented herein are adapted to producing
novel
influenza B strains with temperature sensitive, and optionally attenuated
and/or cold
adapted phenotypes by introducing one or more specified mutations into an
influenza'B
genome. For example, one or more mutations resulting in an amino acid
substitution at a
position selected from among PB2630; Pei; PA497; N14155; Npii4; Npaio; Nolo;
M1159 and
M1183 are introduced into an influenza B strain genome to produce a
temperature sensitive
influenza B virus. Exemplary amino acid substitutions include the following: :
PB263
(S630R); PA431 (V431M); PA497 (Y49711); NP55 (T55A); NP114 (V114A); NP410
(P410H);
NP51 (A510T); M1159 (H159Q) and M1183 (M183V). As indicated above, vaccines
incorporating such viruses as well as nucleic acids and polypeptides
incorporating these
mutations and amino acid substitutions are all features of the invention.
[0026] Accordingly, influenza viruses incorporating the mutations of
the invention
are a feature of the invention regardless of the method in which they are
produced. That
is, the invention encompasses influenza strains including the mutations of the
invention,
e.g., any influenza A virus with an amino acid substitution relative to wild
type at one or
more positions selected from among: PBi391, PB1581, Bp 1661, pB2265 and Np34
or any
influenza B virus with an amino acid substitution relative to wild type at one
or more
positions selected from among: PB2
630; pA43I; PA497; Np55; NplI4; Np410; Np510; mil59
-9-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
-
and M1183, with the proviso that the strains ca AJAnn Arbor/6/60 and B/Ann
Arbor/1/66
are not considered a feature of the present invention. In certain preferred
embodiments,
the influenza A viruses include a plurality of mutations selected from among
PB1391
(K391E), PB 1581 (ESSIG), PW661
(A661T), PB2265 (N265S) and NP34 (D34G); and the
influenza B viruses include a plurality of mutations selected from among PB263
(S630R);
PA431 (V431M); PA497 (Y497H); NP55 (T55A); NP1I4 (V114A); Npaio (p4101E{);
Npsio
(A510T); M1159 (H159Q) and M1183 (M183V), respectively.
[0027] In one embodiment, a plurality of plasmid vectors
incorporating the
influenza virus genome are introduced into host cells. For example, segments
of an
influenza virus genome can be incorporated into at least 8 plasmid vectors. In
one
preferred embodiment, segments of an influenza virus genome are incorporated
into 8
plasmids. For example, each of 8 plasmids can favorably incorporate a
different segment
of the influenza virus genome.
[0028] The vectors of the invention can be bi-directional expression
vectors. A bi-
directional expression vector of the invention typically includes a first
promoter and a
second promoter, wherein the first and second promoters are operably linked to
alternative
strands of the same double stranded viral nucleic acid including a segment of
the influenza
virus genome. Optionally, the bi-directional expression vector includes a
polyadenylation
signal and/or a terminator sequence. For example, the polyadenylation signal
and/or the
terminator sequence can be located flanking a segment of the influenza virus
genome
internal to the two promoters. One favorable polyadenylation signal in the
context of the
invention is the SV40 polyadenylation signal. An exemplary plasmid vector of
the
invention is the plasmid pAD3000, illustrated in Figure 1.
[0029] Any host cell capable of supporting the replication of
influenza virus from
the vector promoters is suitable in the context of the present invention.
Favorable
examples of host cells include Vero cells, Per.C6 cells, 13,11K cells, PCK
cells, MDCK
cells, MDBK cells, 293 cells (e.g., 293T cells), and COS cells. In combination
with the
pAD3000 plasmid vectors described herein, Vero cells, 293 cells, COS cells
are.
particularly suitable. In some embodiments, co-cultures of a mixture of at
least two of
these cell lines, e.g., a combination of COS and MDCK cells or a combination
of 293T =
and MDCK cells, constitute the population of host cells.
-10-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/1272t,
[0030] A feature of the invention is the culture of host cells
incorporating the
plasmids of the invention at a temperature below 37 C, preferably at a
temperature equal
to, or less than, 35 C. Typically, the cells are cultured at a temperature
between 32 C
and 35 C. In some embodiments, the cells are cultured at a temperature
between about 32
C and 34 C, e.g., at about 33 C.
[0031] Another aspect of the invention relates to novel methods for
rescuing
recombinant or reassortant influenza A or influenza 13 viruses (i.e., wild
type and variant
strains of influenza A and/or influenza viruses) from Vero cells in culture. A
plurality of
vectors incorporating an influenza virus genome is electroporated into a
population of
Vero cells. The cells are grown under conditions permissive for viral
replication, e.g., in
the case of cold adapted, attenuated, temperature sensitive virus strains, the
Vero cells are
grown at a temperature below 37 C, preferably at a temperature equal to, or
less than, 35
C. Typically, the cells are cultured at a temperature between 32 C and 35 C.
In some
embodiments, the cells are cultured at a temperature between about 32 C and
34 C, e.g.,
at about 33 C. Optionally (e.g., for vaccine production), the Vero cells are
grown in
serum free medium without any animal-derived products.
[0032] In the methods of the invention described above, viruses are
recovered
following culture of the host cells incorporating the influenza genome
plasinids. In some
embodiments, the recovered viruses are recombinant viruses. In some
embodiments, the
viruses are reassortant influenza viruses having genetic contributions from
more than one
parental strain of virus. Optionally, the recovered recombinant or reassortant
viruses are
further amplified by passage in cultured cells or in hens' eggs.
[0033]
Optionally, the recovered viruses are inactivated. In some embodiments,
the recovered viruses comprise an influenza vaccine. For example, the
recovered
influenza vaccine can be a reassortant influenza viruses (e.g., 6:2 or 7:1
reassortant
viruses) having an HA and/or NA antigen derived from a selected strain of
influenza A or
influenza B. In certain favorable embodiments, the reassortant influenza
viruses have an
attenuated phenotype. Optionally, the reassortant viruses are cold adapted
and/or
temperature sensitive, e.g., an attenuated, cold adapted or temperature
sensitive influenza
B virus having one or more amino acid substitutions selected from the
substitutions of
Table 17. Such influenza viruses are useful, for example, as live attenuated
vaccines for
-11-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
the prophylactic production of an immune response specific for a selected,
e.g., pathogenic
influenza strain. Influenza viruses:e.g., attenuated reassortant viruses,
produced
according to the methods of the invention are a feature of the invention.
[0034] In another aspect, the invention relates to methods for
producing a
recombinant influenza virus vaccine involving introducing a plurality of
vectors
incorporating an influenza virus genome into a population of host cells
capable of
supporting replication of influenza virus, culturing the host cells at a
temperature less than
or equal to 35 C, and recovering an influenza virus capable of eliciting an
immune
response upon administration to a subject. The vaccines of the invention can
be either
influenza A or influenza B strain viruses. In some embodiments, the influenza
vaccine
viruses include an attenuated influenza virus, a cold adapted influenza virus,
or a
temperature sensitive influenza virus. In certain embodiments, the viruses
possess a
combination of these desirable properties. In an embodiment, the influenza
virus contains
an influenza AJAnn Arbor/6/60 strain virus. In another embodiment, the
influenza virus
incorporates an influenza B/Ann Arbor/1/66 strain virus. Alternatively, the
vaccine
includes artificially engineered influenza A or influenza B viruses
incorporating at least
-
one substituted amino acid which influences the characteristic biological
properties of ca
A/Ann Arbor/6/60 or ca/B/Ann Arbor/1/66, such as a unique amino acid of these
strains.
. I
For example, vaccines encompassed by the invention include artificially
engineered
recombinant and reassortant influenza A viruses including at least one
mutation resulting
in an amino acid substitution at a position selected from among PB1391,
PB1581,Bp 166i,
PB2265 and NP34 and artificially engineered recombinant and reassortant
influenza B
viruses including at least one mutation resulting in an amino acid
substitution at a position
pA431, pA497, Np55, Np114, Np410, Np510, M1159 and M1183.
selected from among PB2630
,
[0035] In some embodiments, the virus includes a reassortant influenza
virus (e.g.,
a 6:2 or 7:1 reassortant) having viral genome segments derived from more than
one
influenza virus strain. For example, a reassortant influenza virus vaccine
favorably
includes an HA and/or NA surface antigen derived from a selected strain of
influenza A or
B, in combination with the internal genome segments of a virus strain selected
for its
desirable properties with respect to vaccine production. Often, it is
desirable to select the
strain of influenza from which the HA and/or NA encoding segments are derived
based on
predictions of local or world-wide prevalence of pathogenic strains (e.g., as
described
-12-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272
-
above). In some cases, the virus strain contributing the internal genome
segments is an
attenuated, cold adapted and/or temperature sensitive influenza strain, e.g.,
of A/Ann
Arbor/6/60, B/Ann Arbor/1/66, or an artificially engineered influenza strain
having one or
more amino acid substitutions resulting in the desired phenotype, e.g.,
influenza A viruses
including at least one mutation resulting in an amino acid substitution at a
position
selected from among PB1391, PB1581, pB1661, pB2265 and Np34 and influenza B
viruses
including at least one mutation resulting in an amino acid substitution at a
position
selected from among PB2630, pA431, pA497, NP,
Np114, Np410, Np510,
M1159 and M1183.
For example, favorable reassortant viruses include artificially engineered
influenza A
viruses with one or more amino acid substitution selected from among PB1391
(K391E),
PB1581 (E581G), pB , 661
(A661T), PB2265 (N265S) and NP34 (D34G); and influenza B
viruses including one or more amino acid substitutions selected from among
PB263
(S630R); PA431 (V431M); PA497 (Y497H); NP55 (T55A); NP114 (V114A); NP41
(P410H);
NP51 (A510T); M1159 (H159Q) and M1183 (M183V).
[0036] If desired, the influenza vaccine viruses are inactIvated upon
recovery.
[0037] Influenza virus vaccines, including attenuated live vaccines,
produced by
the methods of the invention are also a feature of the invention. In certain
favorable
embodiments the influenza virus vaccines are reassortant virus vaccines.
[0038] Another aspect of the invention provides plasmids that are bi-
directional
expression vectors. The bi-directional expression vectors of the invention
incorporate a
first promoter inserted between a second promoter and a polyadenylation site,
e.g., an
SV40 polyadenylation site. In an embodiment, the first promoter and the second
promoter
can be situated in opposite orientations flanking at least one cloning site.
An exemplary
vector of the invention is the plasmid pAD3000, illustrated in Figure 1.
[0039] In some embodiments, at least one segment of an influenza virus
genome is
inserted into the cloning site, e.g., as a double stranded nucleic acid. For
example, a vector
of the invention includes a plasmid having a first promoter inserted between a
second
promoter and an SV40 polyadenylation site, wherein the first promoter and the
second
promoter are situated in opposite orientations flanking at least one segment
of an influenza
virus.
-13-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
[0040] Kits including one or more expression vectors of the invention
are also a
feature of the invention. Typically, the kits also include one or more of: a
cell line capable
of supporting influenza virus replication, a buffer, a culture medium, an
instruction set, a
packaging material, and a container. In some embodiments, the kit includes a
plurality of
expression vectors, each of which includes at least one segment of an
influenza virus
genome. For example, kits including a plurality of expression vectors each
including one
of the internal genome segments of a selected virus strain, e.g., selected for
its desirable
properties with respect to vaccine production or administration, are a feature
of the
invention. For example, the selected virus strain can be an attenuated, cold
adapted and/or
temperature sensitive strain, e.g., A/Ann Arbor/6/60 or B/Ann Arbor/1/66, or
an
alternative strain with the desired properties, such as an artificially
engineered strain
having one or more amino acid substitutions as described herein, e.g., in
Table 17. In an
embodiment, the kit includes a expression vectors incorporating members of a
library of
nucleic acids encoding variant HA and/or NA antigens.
[0041] Productively growing cell cultures including at least one cell
incorporating
a plurality of vectors including an influenza virus genome, at a temperature
less than or
equal to 35 C, is also a feature of the invention. The composition can also
include a- cell
culture medium. In some embodiments, the plurality of vectors includes bi-
directional
expression vectors, e.g., comprising a first promoter in'Serted between a
second promoter
and an SV40 polyadenylation site. For example, the first promoter and the
second
promoter can be situated in opposite orientations flanking at least one
segment of an
influenza virus. The cell cultures of the invention are maintained at a
temperature less
than or equal to 35 C, such as between about 32 C and 35 C, typically
between about 32
C and about 34 C, for example, at about 33 C.
[0042] The invention also includes a cell culture system including a
productively
growing cell culture of at least one cell incorporating a plurality of vectors
comprising a an
influenza virus genome, as described above, and a regulator for maintaining
the culture at
a temperature less than or equal to 35 C. For example, the regulator
favorably, maintains
the cell culture at a temperature between about 32 C and 35 C, typically
between about
32 C and about 34 C, e.g., at about 33 C.
-14-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/1272.
[0043] Another feature of the invention are artificially engineered
recombinant or
reassortant influenza viruses including one or more amino acid substitutions
which
influence temperature sensitivity, cold adaptation and/or attenuation. For
example,
artificially engineered influenza A viruses having one or more amino acid
substitution at a
position selected from among: PB1391, PB1581, pB1661, PB2265 and Np34
and artificially
engineered influenza B viruses having one or more amino acid substitutions at
a position
selected from among PB2630, PA431, PA497, NP", Np114, Np410, Np510,
M1159 and M1183 are
favorable embodiments of the invention. Exemplary embodiments include
influenza A
viruses with any one or more of the following amino acid substitutions: PB1391
(K391E),
P131581 (E581G), PB1661 (A661T), PB2265 (N265S) and NP 34 (D34G); and
influenza B
viruses with any one or more of the following amino acid substitutions: PB263
(S630R);
PA431 (V431M); PA497 (Y497H); NP55 (T55A); NP114 (V114A); Npaio
(P410H); NP510
(A5 10T); M1159 (H159Q) and M1183 (M183V). In certain embodiments, the viruses
include a plurality of mutations, such as one, two, three, four, five, six,
seven, eight or nine
amino acid substitutions at positions identified above. Accordingly,
artificially engineered
influenza A viruses having amino acid substitutions at all five positions
indicated above,
e.g., PB1391 (K391E), PB1581 (E581G), PB1661 (A661T), PB2265 (N265S) and NP34
.
(D34G) and artificially engineered influenza B viruses having amino acid
substitutions at
eight or all nine of the positions indicated above, e.g., P13263 (S630R);
PA431 (V431M);
PA497 (Y49711); NP55 (T55A); NP114 (V114A); N13410 (P41011); NP51 (A510T);
M1159
(H159Q) and M1183 (M183V), are encompassed by the invention. In addition, the
viruses
can include one or more additional amino acid substitutions not enumerated
above.
[0044] In
certain embodiments, the artificially engineered influenza viruses are
temperature sensitive influenza viruses, cold adapted influenza viruses and/or
attenuated
influenza viruses. For example, a temperature sensitive influenza virus
according to the
invention typically exhibits between about 2.0 and 5.0 logic reduction in
growth at 39 C
as compared to a wild type influenza virus. For example, a temperature
sensitive virus
favorably exhibits at least about 2.0 logio, at least about 3.0 logio, at
least about 4.0 logio,
or at least about 4.5 logio reduction in growth at 39 C relative to that of a
wild type
influenza virus. Typically, but not necessarily, a temperature sensitive
influenza virus
retains robust growth characteristics at 33 C. An attenuated influenza virus
of the
invention typically exhibits between about a 2.0 and a 5.0 log10 reduction in
growth in a
-15-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
-
ferret attenuation assay as compared to a wild type influenza virus. For
example, an
attenuated influenza virus of the invention exhibits at least about a 2.0
log10, frequently
about a 3.0 logio, and favorably at least about a 4.0 logio reduction in
growth in a ferret
=
attenuation assay relative to wild type influenza virus.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] Figure 1: Illustration of pAD3000 plasmid
[0046] Figure 2: Micrographs of infected cells
[0047] Figure 3: Genotyping analysis of rMDV-A and 6:2 H1N1 reassortant
virus
from plasmid transfection.
[0048] Figure 4: Illustration of eight plasmid system for the production of
influenza B virus.
[0049] Figure 5: A and B. Characterization of recombinant MDV-B virus by RT-
PCR; C and D. Characterization of recombinant B/Yamanashi/166/98 by RT PCR.
[0050] Figure 6: Sequence of pAD3000 in GeneBank format.
[0051] Figure 7: Sequence alignment with MDV-B and eight plasmids.
[0052] Figure 8: RT-PCR products derived from simultaneous
amplification of HA
and NA segments of influenza B strains.
[0053] Figure 9: Bar graph illustrating relative titers of
recombinant and
reassortant virus.
[0054] Figure 10: Bar graph illustrating relative titers of reassortant
virus under
permissive and restrictive temperatures (temperature sensitivity).
[0055] Figure 11: Graphic representation of reassortant viruses
incorporating
specific mutations (knock-in) correlating with temperature sensitivity (left
panel) and
relative titers at permissive and restrictive temperatures (temperature
sensitivity) (right
panel).
[0056] Figure 12: Determination of ts mutations in a minigenome
assay. A. HEp-2
cells were transfected with PB1, PB2, PA, NP and pFlu-CAT, incubated at 33 or
39 C for
-16-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272,
-
18 hr and cell extracts were analyzed for CAT reporter gene expression. B. CAT
mRNA
expression by primer extension assay.
[0057] Figure 13: Schematic illustration of triple-gene recombinants
with wild
type residues in PA, NP, and M1 proteins.
[0058] Figure 14: Tabulation of growth of single-gene and double-gene
recombinant viruses.
[0059] Figure 15: Tabulation of amino acid residue of the
nucleoprotein
corresponding to non-ts phenotype.
[0060] Figure 16: Schematic diagram of recombinant PR8 mutants. The
mutations
introduced in PB1 and/or PB2 genes are indicated by the filled dots.
[0061] Figure 17: Bar graph illustrating relative titers at 33 C and
39 C.
[0062] Figure 18: Photomicrographs illustrating plaque morphology of
PR8
mutants at various temperatures. MDCK cells were infected with virus as
indicated and
incubated at 33, 37 and39 C for three days. Virus plaques were visualized by
immunostaining and photographed.
[0063] Figure 19: Protein synthesis at permissive and nonpermissive
temperatures.
MDCK cells were infected with viruses as indicated and incubated at 33 or 39
C
overnight. Radiolabeled labeled polypeptides were electrophoresed on an SDS-
PAGE and
autoradiographed. Viral proteins, HA, NP, M1 and NS are indicated.
[0064] Figure 20: A. Line graphs illustrating differential replication of
MDV-A
and MDV-B in Per.C6 cells relative to replication in MDCK cells; B. Line graph
illustrating differential replication of MDV-A single gene reassortants in
Per.C6 cells.
DETAILED DESCRIPTION
[0065] Many pathogenic influenza virus strains grow only poorly in
tissue culture,
and strains suitable for production of live attenuated virus vaccines (e.g.,
temperature
sensitive, cold adapted and/or attenuated influenza viruses) have not been
successfully
grown in cultured cells for commercial production. The present invention
provides a
multi-plasmid transfection system which permits the growth and recovery of
influenza
virus strains which are not adapted for growth under standard cell culture
conditions.
-17-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
[0066] In a first aspect, the methods of the invention provide
vectors and methods
for producing recombinant influenza B virus in cell culture entirely from
cloned viral
DNA. In another aspect, the methods of the present invention are based in part
on the
development of tissue culture conditions which support the growth of virus
strains (both A
strain and B strain influenza viruses) with desirable properties relative to
vaccine
production (e.g., attenuated pathogenicity or phenotype, cold adaptation,
temperature
sensitivity, etc.) in vitro in cultured cells. Influenza viruses are produced
by introducing a
plurality of vectors incorporating cloned viral genome segments into host
cells, and
culturing the cells at a temperature not exceeding 35 C. When vectors
including an
influenza virus genome are transfected, recombinant viruses suitable as
vaccines can be
recovered by standard purification procedures. Using the vector system and
methods of
the invention, reassortant viruses incorporating the six internal gene
segments of a strain
selected for its desirable properties with respect to vaccine production, and
the
immunogenic HA and NA segments from a selected, e.g., pathogenic strain, can
be rapidly
and efficiently produced in tissue culture. Thus, the system and methods
described herein
are useful for the rapid production in cell culture of recombinant and
reassortant influenza
A and B viruses, including viruses suitable for use as vaccines, including
live attenuated
vaccines, such as vaccines suitable for intranasal administration.
,
[0067] Typically, a single Master Donor Virus '(MDV) strain is
selected for each of
the A and B subtypes. In the case of a live attenuated vaccine, the Master
Donor Virus
strain is typically chosen for its favorable properties, e.g., temperature
sensitivity, cold
adaptation and/or attenuation, relative to vaccine production. For example,
exemplary
Master Donor Strains include such temperature sensitive, attenuated and cold
adapted
strains of A/Ann Arbor/6/60 and B/Ann Arbor/1/66, respectively. The present
invention
elucidates the underlying mutations resulting in the ca, ts and att phenotypes
of these virus
strains, and provides methods for producing novel strains of influenza
suitable for use as
donor strains in the context of recombinant and reassortant vaccine
production.
[0068] For example, a selected master donor type A virus (MDV-A), or
master
donor type B virus (MDV-B), is produced from a plurality of cloned viral cDNAs
constituting the viral genome. In an exemplary embodiment, recombinant viruses
are
produced from eight cloned viral cDNAs. Eight viral cDNAs representing either
the
selected MDV-A or MDV-B sequences of PB2, PB1, PA, NP, HA, NA, M and NS are
-18-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272,
cloned into a bi-directional expression vector, such as a plasmid (e.g.,
pAD3000), such
that the viral genomic RNA can be transcribed from an RNA polymerase I (poll)
promoter from one strand and the viral inRNAs can be synthesized from an RNA
polymerase iT (pol II) promoter from the other strand. Optionally, any gene
segment can
be modified, including the HA segment (e.g., to remove the multi-basic
cleavage site).
[0069] Infectious recombinant MDV-A or MDV-B virus is then recovered
following transfection of plasmids bearing the eight viral cDNAs into
appropriate host
cells, e.g., Vero cells, co-cultured MDCKJ293T or MDCK/COS7 cells. Using the
plasmids
and methods described herein, the invention is useful, e.g., for generating
6:2 reassortant
influenza vaccines by co-transfection of the 6 internal genes (PB1, PB2, PA,
NP, M and
NS) of the selected virus (e.g., MDV-A, MDV-B) together with the HA and NA
derived
from different corresponding type (A or B) influenza viruses. For example, the
HA
segment is favorably selected from a pathogenically relevant H1, 113 or B
strain, as is
routinely performed for vaccine production. Similarly, the HA segment can be
selected
from a strain with emerging relevance as a pathogenic strain such as an 112
strain (e.g.,
H2N2), an H5 strain (e.g., H5N1) or an H7 strain (e.g., H7N7). Reassortants
incorporating seven genome segments of the MDV and either the HA or NA gene of-
a
selected strain (7:1 reassortants) can also be produced. In addition, this
system is useful
for determining the molecular basis of phenotypic characteristics, e.g., the
attenuated (att),
cold adapted (ca), and temperature sensitive (ts) phenotypes, relevant to
vaccine
production.
DEFINITIONS
[0070] Unless defined otherwise, all scientific and technical terms
are understood
to have the same meaning as commonly used in the art to which they pertain.
For the
purpose of the present invention the following terms are defined below.
[0071] The terms "nucleic acid," "polynucleotide," "polynucleotide
sequence" and
"nucleic acid sequence" refer to single-stranded or double-stranded
deoxyribonucleotide
or ribonucleotide polymers, or chimeras or analogues thereof. As used herein,
the term
optionally includes polymers of analogs of naturally occurring nucleotides
having the
essential nature of natural nucleotides in that they hybridize to single-
stranded nucleic
acids in a manner similar to naturally occurring nucleotides (e.g., peptide
nucleic acids).
-19-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
Unless otherwise indicated, a particular nucleic acid sequence of this
invention
encompasses complementary sequences, in addition to the sequence explicitly
indicated.
[0072] The term "gene" is used broadly to refer to any nucleic acid
associated with
a biological function. Thus, genes include coding sequences and/or the
regulatory
sequences required for their expression. The term "gene" applies to a specific
genomic
sequence, as well as to a cDNA or an mRNA encoded by that genomic sequence.
[0073] Genes also include non-expressed nucleic acid segments that,
for example,
form recognition sequences for other proteins. Non-expressed regulatory
sequences
include "promoters" and "enhancers," to which regulatory proteins such as
transcription
factors bind, resulting in transcription of adjacent or nearby sequences. A
"Tissue
specific" promoter or enhancer is one which regulates transcription in a
specific tissue
type or cell type, or types.
[0074] The term "vector" refers to the means by which a nucleic can
be propagated
and/or transferred between organisms, cells, or cellular components. Vectors
include
plasmids, viruses, bacteriophage, pro-viruses, phagemids, transposons, and
artificial
chromosomes, and the like, that replicate autonomously or can integrate into a
chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a
naked
DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the
same
strand, a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA,
a
liposome-conjugated DNA, or the like, that are not autonomously replicating.
Most
commonly, the vectors of the present invention are plasmids.
[0075] An "expression vector" is a vector, such as a plasmid, which
is capable of
promoting expression, as well as replication of a nucleic acid incorporated
therein.
Typically, the nucleic acid to be expressed is "operably linked" to a promoter
and/or
enhancer, and is subject to transcription regulatory control by the promoter
and/or
enhancer.
[0076] A "bi-directional expression vector" is typically
characterized by two
alternative promoters oriented in the opposite direction relative to a nucleic
acid situated
between the two promoters, such that expression can be initiated in both
orientations
resulting in, e.g., transcription of both plus (+) or sense strand, and
negative (-) or
antisense strand RNAs. Alternatively, the bi-directional expression vector can
be an
-20-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272
ambisense vector, in which the viral mRNA and viral genomic RNA (as a cRNA)
are
expressed from the same strand.
[0077] In the context of the invention, the term "isolated" refers to
a biological
material, such as a nucleic acid or a protein, which is substantially free
from components
that normally accompany or interact with it in its naturally occurring
environment. The
isolated material optionally comprises material not found with the material in
its natural
environment, e.g., a cell. For example, if the material is in its natural
environment, such as
a cell, the material has been placed at a location in the cell (e.g., genome
or genetic
element) not native to a material found in that environment. For example, a
naturally
occurring nucleic acid (e.g., a coding sequence, a promoter, an enhancer,
etc.) becomes
isolated if it is introduced by non-naturally occurring means to a locus of
the genome (e.g.,
a vector, such as a plasmid or virus vector, or amplicon) not native to that
nucleic acid.
Such nucleic acids are also referred to as "heterologous" nucleic acids.
[0078] The term "recombinant" indicates that the material (e.g., a
nucleic acid or
protein) has been artificially or synthetically (non-naturally) altered by
human
intervention. The alteration can be performed on the material within, or
removed from, its
natural environment or state. Specifically, when referring to a virus, e.g.,
an influenza
virus, the virus is recombinant when it is produced by the expression of a
recombinant
nucleic acid.
[0079] The term "reassortant," when referring to a virus, indicates that
the virus
includes genetic and/or polypeptide components derived from more than one
parental viral
strain or source. For example, a 7:1 reassortant includes 7 viral genomic
segments (or
gene segments) derived from a first parental virus, and a single complementary
viral
genomic segment, e.g., encoding hemagglutinin or neuraminidase, from a second
parental
virus. A 6:2 reassortant includes 6 genomic segments, most commonly the 6
internal
genes from a first parental virus, and two complementary segments, e.g.,
hemagglutinin
and neuraminidase, from a different parental virus.
[0080] The term "introduced" when referring to a heterologous or
isolated nucleic
acid refers to the incorporation of a nucleic acid into a eukaryotic or
prokaryotic cell
where the nucleic acid can be incorporated into the genome of the cell (e.g.,
chromosome,
plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon,
or
-21-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
-
transiently expressed (e.g., transfected inRNA). The term includes such
methods as
"infection," "transfection," "transformation" and "transduction." In the
context of the
invention a variety of methods can be employed to introduce nucleic acids into
prokaryotic
cells, including electroporation, Calcium phosphate precipitation, lipid
mediated
transfection (lipofection), etc.
[0081] The term "host cell" means a cell which contains a
heterologous nucleic
acid, such as a vector, and supports the replication and/or expression of the
nucleic acid,
and optionally production of one or more encoded products including a
polypeptide and/or
a virus. Host cells can be prokaryotic cells such as E. coli, or eukaryotic
cells such as
yeast, insect, amphibian, avian or mammalian cells, including human cells.
Exemplary
host cells in the context of the invention include Vero (African green monkey
kidney)
cells, Per.C6 cells (human embryonic retinal cells), MIK (baby hamster kidney)
cells,
primary chick kidney (PCK) cells, Madin-Darby Canine Kidney (MDCK) cells,
Madin-
Darby Bovine Kidney (MDBK) cells, 293 cells (e.g., 293T cells), and COS cells
(e.g.,
COSI, COS7 cells). The term host cell encompasses combinations or mixtures of
cells
including, e.g., mixed cultures of different cell types or cell lines.
[0082] The terms "temperature sensitive," "cold adapted" and
"attenuated" are
well known in the art. For example, the term "temperature sensitive" ("ts")
indicates that
4;
the virus exhibits a 100 fold or greater reduction in titer at 39 C relative
to 33 C for
influenza A strains, and that the virus exhibits a 100 fold or greater
reduction in titer at 37
C relative to 33 C for influenza B strains. For example, the term "cold
adapted" ("Ca")
indicates that the virus exhibits growth at 25 C within 100 fold of its
growth at 33 C.
For example, the term "attenuated" ("att") indicates that the virus replicates
in the upper
airways of ferrets but is not detectable in lung tissues, and does not cause
influenza-like
illness in the animal. It will be understood that viruses with intermediate
phenotypes, i.e.,
viruses exhibiting titer reductions less than 100 fold at 39 C (for A strain
viruses) or 37
C (for B strain viruses), exhibiting growth at 25 C that is more than 100
fold than its
growth at 33 C (e.g., within 200 fold, 500 fold, 1000 fold, 10,000 fold
less), and/or
exhibit reduced growth in the lungs relative to growth in the upper airways of
ferrets (i.e.,
=
partially attenuated) and/or reduced influenza like illness in the animal,
which possess one
or more of the amino acid substitutions described herein are also useful
viruses
-22-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272,
encompassed by the invention. Growth indicates viral quantity as indicated by
titer,
plaque size or morphology, particle density or other measures known to those
of skill in
the art.
[0083] The expression "artificially engineered" is used herein to
indicate that the
virus, viral nucleic acid or virally encoded product, e.g., a polypeptide, a
vaccine,
comprises at least one mutation introduced by recombinant methods, e.g., site
directed
mutagenesis, PCR mutagenesis, etc. The expression "artificially engineered"
when
referring to a virus (or viral component or product) comprising one or more
nucleotide
mutations and/or amino acid substitutions indicates that the viral genome or
genome
segment encoding the virus (or viral component or product) is not derived from
naturally
occurring sources, such as a naturally occurring or previously existing
laboratory strain of
virus produced by non-recombinant methods (such as progressive passage at 25
C), e.g., a
wild type or cold adapted A/Ann Arbor/6/60 or B/Ann Arbor/1/66strain.
Influenza Virus
[0084] The genome of Influenza viruses is composed of eight segments of
linear
(-) strand ribonucleic acid (RNA), encoding the immunogenic hemagglutinin (HA)
and
neuraminidase (NA) proteins, and six internal core polypeptides: the
nucleocapsid
nucleoprotein (NP); matrix proteins (M); non-structural proteins (NS); and 3
RNA
polymerase (PA, PB1, PB2) proteins. During replication, the genomic viral RNA
is
transcribed into (+) strand messenger RNA and (-) strand genomic cRNA in the
nucleus of
= the host cell. Each of the eight genomic segments is packaged into
ribonucleoprotein
complexes that contain, in addition to the RNA, NP and a polymerase complex
(PB1, PB2,
and PA).
[0085] In the present invention, viral genomic RNA corresponding to
each of the
eight segments is inserted into a recombinant vector for manipulation and
production of
influenza viruses. A variety of vectors, including viral 'Vectors, plasmids,
cosmids, phage,
and artificial chromosomes, can be employed in the context of the invention.
Typically,
for ease of manipulation, the viral genomic segments are inserted into a
plasmid vector,
providing one or more origins of replication functional in bacterial and
eukaryotic cells,
and, optionally, a marker convenient for screening or selecting cells
incorporating the
plasmid sequence. An exemplary vector, plasmid pAD3000 is illustrated in
Figure 1.
-23-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728 -
[0086] Most commonly, the plasmid vectors of the invention are bi-
directional
expression vectors capable of initiating transcription of the inserted viral
genomic segment
in either direction, that is, giving rise to both (+) strand and (-) strand
viral RNA
molecules. To effect hi-directional transcription, each of the viral genomic
segments is
inserted into a vector having at least two independent promoters, such that
copies of viral
genomic RNA are transcribed by a first RNA polymerase promoter (e.g., Poll),
from one
strand, and viral mRNAs are synthesized from a second RNA polymerase promoter
(e.g.,
Pol II). Accordingly, the two promoters are arranged in opposite orientations
flanking at
least one cloning site (i.e., a restriction enzyme recognition sequence)
preferably a unique
cloning site, suitable for insertion of viral genomic RNA segments.
Alternatively, an
"ambisense" vector can be employed in which the (+) strand mRNA and the (-)
strand
viral RNA (as a cRNA) are transcribed from the same strand of the vector.
Expression vectors
[0087] The influenza virus genome segment to be expressed is operably
linked to
an appropriate transcription control sequence (promoter) to direct mRNA
synthesis. A
variety of promoters are suitable for use in expression vectors for regulating
transcription
of influenza virus genome segments. In certain embodiments, e.g., wherein the
vector is
the plasmid pAD3000, the cytomegalovirus (CMV) DNA dependent RNA Polymerase II
(Pol 1) promoter is utilized. If desired, e.g., for regulating conditional
expression, other
promoters can be substituted which induce RNA transcription under the
specified
conditions, or in the specified tissues or cells. Numerous viral and
mammalian, e.g.,
human promoters are available, or can be isolated according to the specific
application
contemplated. For example, alternative promoters obtained from the genomes of
animal
and human viruses include such promoters as the adenovirus (such as Adenovirus
2),
papilloma virus, hepatitis-B virus, polyoma virus, and Simian Virus 40 (SV40),
and
various retroviral promoters. Mammalian promoters include, among many others,
the
actin promoter, immunoglobulin promoters, heat-shock_promoters, and the like.
In
addition, bacteriophage promoters can be employed in conjunction with the
cognate RNA
polymerase, e.g., the T7 promoter.
[0088]
Transcription is optionally increased by including an enhancer sequence.
Enhancers are typically short, e.g., 10-500 bp, cis-acting DNA elements that
act in concert
with a promoter to increase transcription. Many enhancer sequences have been
isolated
-24-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272,
from mammalian genes (hemoglobin, elastase, albumin, alpha.-fetoprotein, and
insulin),
and eukaryotic cell viruses. The enhancer can be spliced into the vector at a
position 5' or
3' to the heterologous coding sequence, but is typically inserted at a site 5'
to the promoter.
Typically, the promoter, and if desired, additional transcription enhancing
sequences are
chosen to optimize expression in the host cell type into which the
heterologous DNA is to
be introduced (Scharf et al. (1994) Heat stress promoters and transcription
factors Results
Probl Cell Differ 20:125-62; Kriegler et al. (1990) Assembly of enhancers,
promoters, and
splice signals to control expression of transferred genes Methods in Enzymol
185: 512-
27). Optionally, the amplicon can also contain a ribosome binding site or an
internal
ribosome entry site (IRES) for translation initiation.
[0089] The vectors of the invention also favorably include sequences
necessary for
the termination of transcription and for stabilizing the mRNA, such as a
polyadenylation
site or a terminator sequence. Such sequences are commonly available from the
5' and,
occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. In
one
embodiment, e.g., involving the plasmid pAD3000, the SV40 polyadenylation
sequences
provide a polyadenylation signal.
[0090] In addition, as described above, the expression vectors
optionally include
one or more selectable marker genes to provide a phenotypic trait for
selection of
transformed host cells, in addition to genes previously listed, markers such
as
dihydrofolate reductase or neomycin resistance are suitable for selection in
eukaryotic cell
culture.
[0091] The vector containing the appropriate DNA sequence as
described above,
as well as an appropriate promoter or control sequence, can be employed to
transform a
host cell permitting expression of the protein. While the vectors of the
invention can be
replicated in bacterial cells, most frequently it will be desirable to
introduce them into
mammalian cells, e.g., Vero cells, BHK cells, MDCK cell, 293 cells, COS cells,
for the
purpose of expression.
Additional Expression Elements
[0092] Most commonly, the genome segment encoding the influenza
virus protein
includes any additional sequences necessary for its expression, including
translation into a
functional viral protein. In other situations, a minigene, or other artificial
construct
-25-

CA 02827114 2013-09-10
WO 03/091401 PCMJS03/12728
encoding the viral proteins, e.g., an HA or NA protein, can be employed. In
this case, it is
often desirable to include specific initiation signals which aid in the
efficient translation of
the heterologous coding sequence. These signals can include, e.g., the ATG
initiation
codon and adjacent sequences. To insure translation of the entire insert, the
initiation
codon is inserted in the correct reading frame relative to the viral protein.
Exogenous
transcriptional elements and initiation codons can be of various origins, both
natural and
synthetic. The efficiency of expression can be enhanced by the inclusion of
enhancers
appropriate to the cell system in use.
[0093] If desired, polynucleotide sequences encoding additional
expressed
elements, such as signal sequences, secretion or localization sequences, and
the like can be
incorporated into the vector, usually, in-frame with the polynucleotide
sequence of
interest, e.g., to target polypeptide expression to a desired cellular
compartment,
membrane, or organelle, or into the cell culture media. Such sequences are
known to
those of skill, and include secretion leader peptides, organelle targeting
sequences (e.g.,
nuclear localization sequences, ER retention signals, mitochondrial transit
sequences),
membrane localization/anchor sequences (e.g., stop transfer sequences, GPI
anchor
sequences), and the like.
Influenza virus vaccine
[0094]
Historically, influenza virus vaccines have been produced in embryonated
hens' eggs using strains of virus selected based on empirical predictions of
relevant
strains. More recently, reassortant viruses have been produced that
incorporate selected
hemagglutinin and neuraminidase antigens in the context of an approved
attenuated,
temperature sensitive master strain. Following culture of the virus through
multiple
passages in hens' eggs, influenza viruses are recovered and, optionally,
inactivated, e.g.,
using formaldehyde and/or D-propiolactone. However, production of influenza
vaccine in
this manner has several significant drawbacks. Contaminants remaining from the
hens'
eggs are highly antigenic, pyrogenic, and frequently regilt in significant
side effects upon
administration. More importantly, strains designated for production must be
selected and
distributed, typically months in advance of the next flu season to allow time
forProduction
and inactivation of influenza vaccine. Attempts at producing recombinant and
reassortant
vaccines in cell culture have been hampered by the inability of any of the
strains approved
for vaccine production to grow efficiently under standard cell culture
conditions.
-26-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/1272
[0095] The present invention provides a vector system, and
methods for producing
recombinant and reassortant viruses in culture which make it possible to
rapidly produce
vaccines corresponding to one or many selected antigenic strains of virus. In
particular,
conditions and strains are provided that result in efficient production of
viruses from a
multi plasmid system in cell culture. Optionally, if desired, the viruses can
be further
amplified in Hens' eggs.
[0096] For example, it has not been possible to grow the
influenza B master strain
B/Ann Arbor/1/66 under standard cell culture conditions, e.g., at 37 C. In
the methods of
the present invention, multiple plasmids, each incorporating a segment of an
influenza
virus genome are introduced into suitable cells, and maintained in culture at
a temperature
less than or equal to 35 C. Typically, the cultures are maintained at between
about 32 C
and 35 C, preferably between about 32 C and about 34 C, e.g., at about 33
C.
[0097] Typically, the cultures are maintained in a system, such
as a cell culture
incubator, under controlled humidity and CO2, at constant temperature using a
temperature
regulator, such as a thermostat to insure that the temperature does not exceed
35 C.
[0098] Reassortant influenza viruses can be readily obtained by
introducing a.
subset of vectors corresponding to genomic segments of a master influenza
virus, in
combination with complementary segments derived from strains of interest
(e.g., antigenic
variants of interest). Typically, the master strains are selected on the basis
of desirable
properties relevant to vaccine administration. For example, for vaccine
production, e.g.,
for production of a live attenuated vaccine, the master donor virus strain may
be selected
for an attenuated phenotype, cold adaptation and/or temperature sensitivity.
In this
context, Influenza A strain ca A/Ann Arbor/6/60; Influenza B strain ca B/Ann
Arbor/1/66;
or another strain selected for its desirable phenotypic properties, e.g., an
attenuated, cold
adapted, and/or temperature sensitive strain, such as an artificially
engineered influenza A
strain as described in Example 4; or an artificially engineered influenza B
strain
incorporating one or more of the amino acid substitutions specified in Table
17 are
= favorably selected as master donor strains.
[0099] In one embodiment, plasmids incorporating the six
internal genes of the
influenza master virus strain, (i.e., PB1, PB2, PA, NP, NB, Ml, BM2, NS1 and
NS2) are
transfected into suitable host cells in combination with hemagglutinin and
neuraminidase
-27-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728
segments from an antigenically desirable strain, e.g., a strain predicted to
cause significant
local or global influenza infection. Following replication of the reassortant
virus in cell
culture at appropriate temperatures for efficient recovery, e.g., equal to or
less than 35 C,
such as between about 32 C and 35 C, for example between about 32 C and
about 34
C, or at about 33 C, reassortant viruses is recovered. Optionally, the
recovered virus can
be inactivated using a denaturing agent such as formaldehyde or -
propiolactone.
Attenuated, temperature sensitive and cold adapted influenza virus vaccines
[0100] In one aspect, the present invention is based on the
determination of the
mutations underlying the ts phenotype in preferred Master Donor Strains of
virus. To
determine the functional importance of single nucleotide changes in the MDV
strain
genome, reassortant viruses derived from highly related strains within the
A/AA/6/60
lineage were evaluated for temperature sensitivity. The isogenic nature of the
two parental
strains enables the evaluation of single nucleotide changes on the ts
phenotype.
Accordingly, the genetic basis for the ts phenotype of MDV-A is mapped at the
nucleotide
level to specific amino acid residues within PB1, PB2, and NP.
[0101] Previous attempts to map the genetic basis of the ts
phenotype of ca
A/AAJ6/60 utilized classical coinfection/reassortant techniques to create
single and
multiple gene reassortants between A/AAJ6/60 and an Unrelated wt strain. These
studies
suggested that both PB2, and PB1 contributed to the ts phenotype (Kendal et
al. (1978)
Biochemical characteristics of recombinant viruses derived at sub-optimal
temperatures:
= evidence that ts lesions are present in RNA segments 1 and 3, and that
RNA 1 codes for
the virion transcriptase enzyme, p. 734-743. In B. W. J. Mahy, and R.D. Barry
(ed.)
Negative Strand Viruses, Academic Press; Kendal et al. (1977) Comparative
studies of
wild-type and cold mutant (temperature sensitive) influenza viruses: genealogy
of the
matrix (M) and the non-structural (NS) proteins in recombinant cold-adapted
H3N2
viruses J Gen Virol 37:145-159; Kendal et al. (1979) Comparative studies of
wild-type and
cold-mutant (temperature sensitive) influenza viruses: independent segregation
of
temperature-sensitivity of virus replication from temperature-sensitivity of
virion
transcriptase activity during recombination of mutant A/Ann Arbor/6/60 with
wild-type
H3N2 strains J Gen Virol 44:443-4560; Snyder et al. (1988) Four viral genes
independently contribute to attenuation of live influenza A/Ann Arbor/6/60
(H2N2) cold-
-28-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272
adapted reassortam virus vaccines J Virol 62:488-95). Interpretation of these
studies,
however, was confounded by constellation effects, which were caused by mixing
gene
segments from two divergent influenza A strains. Weakened interactions could
have
occurred through changes between the A/AAJ6/60 and wt gene segments other than
those
specifically involved in expression of the ts phenotype from the A/AA/6/60
background.
Constellation effects were also shown to confound the interpretation of
association of the
M gene segment with the att phenotype (Subbarao et al. (1992) The attenuation
phenotype
conferred by the M gene of the influenza A/Ann Arbor/6/60 cold-adapted virus
(H2N2) on
the A/Korea/82 (H3N2) reassortant virus results from a gene constellation
effect Virus
Res 25:37-50).
[0102] In the present invention, mutations resulting in amino acid
substitutions at
positions PB1391, PB1581, pB1661, pB2265 and Np34 are identified as
functionally important
in conferring the temperature sensitive phenotype on the MDV-A strain virus.
As will be
understood by those of skill in the art, mutations in nucleotides at positions
PB1"95,
pB 11766, pB 120os, PB2821 and NP146 designate amino acid substitutions at
PB1391, PB1581,
pB166t, pB2265 and NP',
respectively. Thus, any nucleotide substitutions resulting in
substituted amino acids at these positions are a feature of the invention.
Exemplary -
mutations PB1391 (K391E), PB1581 (E581G), PB1661 (A661T), PB2265 (N265S) and
NP34
(D34G), singly, and more preferably in combination, result in a temperature
sensitive
phenotype. Simultaneous reversion of these mutations to wild type abolishes
the ts
phenotype, while introduction of these mutations onto a wild-type background
results in
virus with a ts phenotype. Consistent with the stability of these phenotypes
during passage
of the virus, no single change can individually revert the temperature
sensitivity profile of
the resulting virus to that of wild-type. Rather, these changes appear to act
in concert with
one another to fully express the ts phenotype. This discovery permits the
engineering of
additional strains of temperature sensitive influenza A virus suitable for
master donor
viruses for the production of live attenuated influenza vaccines.
[0103] Similarly, substitutions of individual amino acids in a
Master Donor Virus-
, B strain are correlated with the ts phenotype as illustrated in Table
17. Thus, the methods
presented herein are adapted to producing novel influenza B strains with
temperature
sensitive, and optionally attenuated and/or cold adapted phenotypes by
introducing one or
more specified mutations into an influenza B genome. For example, one or more
-29-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
mutations resulting in an amino acid substitution at a position selected from
among
pB7630; pA431; PA497; NP55; Np114; Np410; Np510; M1 - 159
and M1183 are introduced into an
influenza B strain genome to produce a temperature sensitive influenza B
virus.
Exemplary amino acid substitutions include the following: PB263 (S630R);
PA431
(V431M); PA497 (Y497H); NP55 (T55A); NP114 (V114A); NP410 (P410H);
NP51 (A510T);
M1159 (H159Q) and M1183 (M183V).
[0104] Influenza viruses incorporating the mutations of the invention
are a feature
of the invention regardless of the method in which they are produced. That is,
the
invention encompasses influenza strains including the mutations of the
invention, e.g., any
influenza A virus with an amino acid substitution relative to wild type at one
or more
positions selected from among: PB1391, PB1581, pB1661; pB2265 and Np34
or any influenza
B virus with an amino acid substitution relative to wild type at one or more
positions
selected from among: PB2630; pA431; PA497;
NP55 ; Np114; Np410; Np510; m..1159
and M1183,
with the proviso that the strains ca A/Ann Arbor/6/60 and B/Ann Arbor/1/66 are
not
considered a feature of the present invention. In certain preferred
embodiments, the
influenza A viruses include a plurality of mutations (e.g., two, or three, or
four, or five, or
more mutations) selected from among PB1391 (K391E), PB1581 (E581G), PB1661
(A661T),
PB2265 (N265S) and NP: 4 (D34G); and the influenza B viruses include a
plurality of
,
mutations selected from among PB263 (S630R); PA431 (V431M); PA497 (Y497H);
NP55
(T55A); NP114 (V114A); NP41 (P410H); NP51 (A510T); M1159 (H159Q) and M1183
(M183V), respectively. For example, in addition to providing viruses with
desired
phenotypes relevant for vaccine production, viruses with a subset of
mutations, e.g., 1, or
2, or 3, or 4, or 5 selected mutations, are useful in elucidating the
contribution of
additional mutations to the phenotype of the virus. In certain embodiments,
the influenza
viruses include at least one additional non-wild type nucleotide (e.g.,
possibly resulting in
an additional amino acid substitution), which optionally refines the desired
phenotype or
confers a further desirable phenotypic attribute.
Cell Culture
[0105] Typically, propagation of the virus is accomplished in the
media
compositions in which the host cell is commonly cultured. Suitable host cells
for the
replication of influenza virus include, e.g., Vero cells, Per.C6 cells, MK
cells, MDCK
cells, 293 cells and COS cells, including 293T cells, COS7 cells. Commonly, co-
cultures
-30-

CA 02827114 2013-09-10
including two of the above cell lines, e.g., MDCK cells and either 293T or COS
cells are
employed at a ratio, e.g., of 1:1, to improve replication efficiency.
Typically, cells are
cultured in a standard commercial culture medium, such as Dulbecco's modified
Eagle's
medium supplemented with serum (e.g., 10% fetal bovine serum), or in serum
free
medium, under controlled humidity and CO2 concentration suitable for
maintaining neutral
buffered pH (e.g., at pH between 7.0 and 7.2). Optionally, the medium contains
antibiotics to prevent bacterial growth, e.g., penicillin, streptomycin, etc.,
and/or additional
nutrients, such as L-glutamine, sodium pyruvate, non-essential amino acids,
additional
supplements to promote favorable growth characteristics, e.g., trypsin, p-
mercaptoethanol,
and the like.
[0106] Procedures for maintaining mammalian cells in culture
have been
extensively reported, and are known to those of skill in the art. General
protocols are
provided, e.g., in Freshney (1983) Culture of Animal Cells: Manual of Basic
Technique,
Alan R. Liss, New York; Paul (1975) Cell and Tissue Culture, 5th ed.,
Livingston,
Edinburgh; Adams (1980) Laboratory Techniques in Biochemistry and Molecular
Biology-Cell Culture for Biochemists, Work and Burdon (eds.) Elsevier,
Amsterdam.
Additional details regarding tissue culture procedures of particular interest
in the
production of influenza virus in vitro include, e.g., Merten et al. (1996)
Production of
influenza virus in cell cultures for vaccine preparation:In Cohen and
Shafferman (eds)
Novel Strategies in Design and Production of Vaccines,
Additionally, variations in such procedures adapted to the present invention
are
readily determined through routine experimentation.
[0107] Cells for production of influenza virus can be cultured
in serum-containing
or serum free medium. In some case, e.g., for the preparation of purified
viruses, it is
desirable to grow the host cells in serum free conditions. Cells can be
cultured in small
scale, e.g., less than 25 ml medium, culture tubes or flasks or in large
flasks with agitation,
in rotator bottles, or on microcarrier beads (e.g., DEAE-Dextran microcarrier
beads, such
as DormacellTM, Pfeifer & LangenTM; SuperbeadTM, Flow Laboratories; styrene
copolymer-tri-
.
methylamine beads, such as HillexTM, SoloHillTM, Ann Arbor) in flasks, bottles
or reactor
cultures. Microcarrier beads are small spheres (in the range of 100-200
microns in
diameter) that provide a large surface area for adherent cell growth per
volume of cell
culture. For example a single liter of medium can include more than 20 million
-31-

CA 02827114 2013-09-10
microcarrier beads providing greater than 8000 square centimeters of growth
surface. For
commercial production of viruses, e.g., for vaccine production, it is often
desirable to
culture the cells in a bioreactor or fermenter. Bioreactors are available in
volumes from
under 1 liter to in excess of 100 liters, e.g., Cyt03TM Bioreactor (Osmonics,
Minnetonka,
MN); NBS bioreactors (New Brunswick Scientific, Edison, N.J.); laboratory and
commercial scale bioreactors from B. Braun Biotech International (B. Braun
Biotech,
Melsungen, Germany).
[0108] Regardless of the culture volume, in the context of the
present invention, it
is important that the cultures be maintained at a temperature less than or
equal to 35 C, to
insure efficient recovery of recombinant and/or reassortant influenza virus
using the multi
plasrnid system described herein. For example, the cells are cultured at a
temperature
between about 32 C and 35 C, typically at a temperature between about 32 C
and about
34 C, usually at about 33 C.
[0109] Typically, a regulator, e.g., a thermostat, or other device
for sensing and
maintaining the temperature of the cell culture system is employed to insure
that the
temperature does not exceed 35 C during the period of virus replication.
Introduction of vectors into host cells
[0110] Vectors comprising influenza genome sgments are introduced
(e.g.,
transfected) into host cells according to methods well known in the art for
introducing
heterologous nucleic acids into eukaryotic cells, including, e.g., calcium
phosphate co-
precipitation, electroporation, microinjection, lipofection, and transfection
employing
polyamine transfection reagents. For example, vectors, e.g., plasmids, can be
transfected
into host cells, such as COS cells, 293T cells or combinations of COS or 293T
cells and
MDCK cells, using the polyamine transfection reagent TransIT-LT1 TM (Mirus)
according to
the manufacturer's instructions. Approximately 1 lig of each vector to be
introduced into
the population of host cells with approximately 2 IA of TransIT-LT1TM diluted
in 160111
medium, preferably serum-free medium, in a total vol. of 200 [tl. The
DNA:transfection
reagent mixtures are incubated at room temperature for 45 min followed by
addition of
800 ill of medium. The transfection mixture is added to the host cells, and
the cells are
cultured as described above. Accordingly, for the production of recombinant or
reassortant
viruses in cell culture, vectors incorporating each of the 8 genome segments,
(PB2, PB 1,
-32-

CA 02827114 2013-09-10
PA, NP, M, NS, HA and NA) are mixed with approximately 20 1 TransIT-LT1 and
transfected into host cells. Optionally, serum-containing medium is replaced
prior to
transfection with serum-free medium, e.g., Opti-MEM ITm, and incubated for 4-6
hours.
[0111] Alternatively, electroporation can be employed to introduce
vectors
incorporating influenza genome segments into host cells. For example, plasmid
vectors
incorporating an influenza A or influenza B virus are favorably introduced
into Vero cells
using electroporation according to the following procedure. In brief, 5 x 106
Vero cells,
e.g., grown in Modified Eagle's Medium (MEM) supplemented with 10% Fetal
Bovine
Serum (FBS) are resuspended in 0.4 ml OptiMEMTm and placed in an
electroporation
cuvette. Twenty micrograms of DNA in a volume of up to 25 I is added to the
cells in
the cuvette, which is then mixed gently by tapping. Electroporation is
performed
according to the manufacturer's instructions (e.g., BioRad Gene Pulser 1JTM
with
Capacitance Extender P1u5TM connected) at 300 volts, 950 microFarads with a
time constant
of between 28-33 nisec. The cells are remixed by gently tapping and
approximately 1-2
minutes following electroporation 0.7 ml MEM with 10% FBS is added directly to
the
cuvette. The cells are then transferred to two wells of a standard 6 well
tissue culture dish
containing 2 ml MEM, 10% FBS or OPTI-MEM without serum. The cuvette is washed
to
recover any remaining cells and the wash suspension is divided between the two
wells.
Final volume is approximately 3.5 mls. The cells are then incubated under
conditions
permissive for viral growth, e.g., at approximately 33 C for cold adapted
strains.
Recovery of viruses
[0112]
Viruses are typically recovered from the culture medium, in which infected
(transfected) cells have been grown. Typically crude medium is clarified prior
to
concentration of influenza viruses. Common methods include filtration,
ultrafiltration,
adsorption on barium sulfate and elution, and centrifugation. For example,
crude medium
from infected cultures can first be clarified by centrifugation at, e.g., 1000-
2000 x g for a
time sufficient to remove cell debris and other large particulate matter,
e.g., between 10
and 30 minutes. Alternatively, the medium is filtered through a 0.8 in
cellulose acetate
filter to remove intact cells and other large particulate matter. Optionally,
the clarified
medium supernatant is then centrifuged to pellet the influenza viruses, e.g.,
at 15,000 x g,
for approximately 3-5 hours. Following resuspension of the virus pellet in an
appropriate
buffer, such as STE (0.01 M Tris-HC1; 0.15 M NaCI; 0.0001 M EDTA) or phosphate
-33-
.

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
buffered saline (PBS) at pH 7.4, the virus is concentrated by density gradient
centrifugation on sucrose (60%-12%) or potassium tartrate (50%40%). Either
continuous
or step gradients, e.g., a sucrose gradient between 12% and 60% in four 12%
steps, are
=
suitable. The gradients are centrifuged at a speed, and for a time, sufficient
for the viruses
to concentrate into a visible band for recovery. Alternatively, and for most
large scale
commercial applications, virus is elutriated from density gradients using a
zonal-centrifuge
rotor operating in continuous mode. Additional details sufficient to guide one
of skill
through the preparation of influenza viruses from tissue culture are provided,
e.g., in
Funninger. Vaccine Production, in Nicholson et al. (eds) Textbook of Influenza
pp. 324-
332; Merten et al. (1996) Production of influenza virus in cell cultures for
vaccine
preparation, in Cohen & Shafferman (eds) Novel Strategies in Design and
Production of
Vaccines pp. 141-151, and United States patents no. 5,690,937. If desired, the
recovered
viruses can be stored at -80 C in the presence of sucrose-phosphate-glutamate
(SPG) as a
stabilizer
Methods and Compositions for prophylactic administration of vaccines
[0113] Recombinant and reassortant viruses of the invention can be
administered
prophylactically in an appropriate carrier or excipient to stimulate an immune
response
specific for one or more strains of influenza virus. Typically, the carrier or
excipient is a
pharmaceutically acceptable carrier or excipient, such as Sterile water,
aqueous saline
solution, aqueous buffered saline solutions, aqueous dextrose solutions,
aqueous glycerol
solutions, ethanol, allantoic fluid from uninfected Hens' eggs (i.e., normal
allantoic fluid
"NAF") or combinations thereof. The preparation of such solutions insuring
sterility, pH,
isotonicity, and stability is effected according to protocols established in
the art.
Generally, a carrier or excipient is selected to minimize allergic and other
undesirable
effects, and to suit the particular route of administration, e.g.,
subcutaneous, intramuscular,
intranasal, etc.
[0114] Generally, the influenza viruses of the invention are
administered in a
quantity sufficient to stimulate an immune response specific for one or more
strains of
=
influenza virus. Preferably, administration of the influenza viruses elicits a
protective
immune response. Dosages and methods for eliciting a protective immune
response
against one or more influenza strains are known to those of skill in the art.
For example,
inactivated influenza viruses are provided in the range of about 1-1000 HID50
(human
-34-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12',
infectious dose), i.e., about 105 -108 pfu (plaque forming units) per dose
administered.
Alternatively, about 10-50 lig, e.g., about 15 j.tg HA is administered without
an adjuvant,
with smaller doses being administered with an adjuvant. Typically, the dose
will be
adjusted within this range based on, e.g., age, physical condition, body
weight, sex, diet,
time of administration, and other clinical factors. The prophylactic vaccine
formulation is
systemically administered, e.g., by subcutaneous or intramuscular injection
using a needle
and syringe, or a needleless injection device. Alternatively, the vaccine
formulation is
administered intranasally, either by drops, large particle aerosol (greater
than about 10
microns), or spray into the upper respiratory tract. While any of the above
routes of
delivery results in a protective systemic immune response, intranasal
administration
confers the added benefit of eliciting mucosal immunity at the site of entry
of the influenza
virus. For intranasal administration, attenuated live virus vaccines are often
preferred,
e.g., an attenuated, cold adapted and/or temperature sensitive recombinant or
reassortant
influenza virus. While stimulation of a protective immune response with a
single dose is
preferred, additional dosages can be administered, by the same or different
route, to
achieve the desired prophylactic effect.
[0115] Alternatively, an immune response can be stimulated by ex vivo
or in vivo
targeting of dendritic cells with influenza viruses. For example,
proliferating dendritic
cells are exposed to viruses in a sufficient amount and for a sufficient
period of time to
permit capture of the influenza antigens by the dendritic cells. The cells are
then
transferred into a subject to be vaccinated by standard intravenous
transplantation
methods.
[0116] Optionally, the formulation for prophylactic administration of
the influenza
viruses, or subunits thereof, also contains one or more adjuvants for
enhancing the
immune response to the influenza antigens. Suitable adjuvants include:
saponin, mineral
gels such as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic
polyols, polyanions, peptides, oil or hydrocarbon emulsions, bacille Calmette-
Guerin
(BCG), Corynebacterium parvum, and the synthetic adjuvants QS-21 and MF59.
[0117] If desired, prophylactic vaccine administration of influenza
viruses can be
performed in conjunction with administration of one or more immunostimulatory
molecules. Irnmunostimulatory molecules include various cytokines,
lympholcines and
-35-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728
chemokines with immunostimulatory, immunopotentiating, and pro-inflammatory
activities, such as interleulcins IL-
1, IL-2, M-3, IL-4, IL-12, IL-13); growth factors
(e.g., granulocyte-macrophage (GM)-colony stimulating factor (CSF)); and other
immunostimulatory molecules, such as macrophage inflammatory factor, F1t3
ligand,
137.1; B7.2, etc. The immunostimulatory molecules can be administered in the
same
formulation as the influenza viruses, or can be administered separately.
Either the protein
or an expression vector encoding the protein can be administered to produce an
immunostimulatory effect.
[0118] In another embodiment, the vectors of the invention including
influenza
genome segments can be employed to introduce heterologous nucleic acids into a
host
organism or host cell, such as a mammalian cell, e.g., cells derived from a
human subject,
in combination with a suitable pharmaceutical carrier or excipient as
described above.
Typically, the heterologous nucleic acid is inserted into a non-essential
region of a gene or
gene segment, e.g., the M gene of segment 7. The heterologous polynucleotide
sequence
can encode a polypeptide or peptide, or an RNA such as an antisense RNA or
ribozyme.
The heterologous nucleic acid is then introduced into a host or host cells by
producing
recombinant viruses incorporating the heterologous nucleic, and the viruses
are
administered as described above.
[0119]
Alternatively, a vector of the invention including a heterologous nucleic
acid can be introduced and expressed in a host cells by co-transfecting the
vector into a
cell infected with an influenza virus. Optionally, the cells are then returned
or delivered to
the subject, typically to the site from which they were obtained. In some
applications, the
cells are grafted onto a tissue, organ, or system site (as described above) of
interest, using
established cell transfer or grafting procedures. For example, stem cells of
the
hematopoietic lineage, such as bone marrow, cord blood, or peripheral blood
derived
hematopoietic stem cells can be delivered to a subject using standard delivery
or
transfusion techniques.
[0120]
Alternatively, the viruses comprising a heterologous nucleic acid can be
delivered to the cells of a subject in vivo. Typically, such methods involve
the
administration of vector particles to a target cell population (e.g., blood
cells, skin cells,
liver cells, neural (including brain) cells, kidney cells, uterine cells,
muscle cells, intestinal
-36-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12i_
cells, cervical cells, vaginal cells, prostate cells, etc., as well as tumor
cells derived from a
variety of cells, tissues and/or organs. Administration can be either
systemic, e.g., by
intravenous administration of viral particles, or by delivering the viral
particles directly to
a site or sites of interest by a variety of methods, including injection
(e.g., using a needle
or syringe), needleless vaccine delivery, topical administration, or pushing
into a tissue,
organ or skin site. For example, the viral vector particles can be delivered
by inhalation,
orally, intravenously, subcutaneously, subdermally, intradermally,
intramuscularly,
intraperitoneally, intrathecally, by vaginal or rectal administration, or by
placing the viral
particles within a cavity or other site of the body, e.g., during surgery.
[0121] The above described methods are useful for therapeutically and/or
prophylactically treating a disease or disorder by introducing a vector of the
invention
comprising a heterologous polynucleotide encoding a therapeutically or
prophylactically
effective polypeptide (or peptide) or RNA (e.g., an antisense RNA or ribozyme)
into a
population of target cells in vitro, ex vivo or in vivo. Typically, the
polynucleotide
encoding the polypeptide (or peptide), or RNA, of interest is operably linked
to
appropriate regulatory sequences as described above in the sections entitled
"Expression
Vectors" and "Additional Expression Elements." Optionally, more than one
heterologous
coding sequence is incorporated into a single vector or virus. For example, in
addition to a
polynucleotide encoding a therapeutically or prophylactically active
polypeptide or RNA,
the vector can also include additional therapeutic or prophylactic
polypeptides, e.g.,
antigens, co-stimulatory molecules, cytokines, antibodies, etc., and/or
markers, and the
like.
[0122] The methods and vectors of the present invention can be used
to
therapeutically or prophylactically treat a wide variety of disorders,
including genetic and
acquired disorders, e.g., as vaccines for infectious diseases, due to viruses,
bacteria, and
the like.
Kits
[0123] To facilitate use of the vectors and vector systems of the
invention, any of
the vectors, e.g., consensus influenza virus plasmids, variant influenza
polypeptide
=
plasmids, influenza polypeptide library plasmids, etc., and additional
components, such as,
buffer, cells, culture medium, useful for packaging and infection of influenza
viruses for
experimental or therapeutic purposes, can be packaged in the form of a kit.
Typically, the
-37-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
-
kit contains, in addition to the above components, additional materials which
can include,
e.g., instructions for performing the methods of the invention, packaging
material, and a
container.
Manipulation of viral nucleic acids and Proteins
[0124] In the context of the invention, influenza virus nucleic acids
and/or proteins
are manipulated according to well known molecular biology techniques. Detailed
protocols for numerous such procedures, including amplification, cloning,
mutagenesis,
transformation, and the like, are described in, e.g., in Ausubel et at.
Current Protocols in
Molecular Biology (supplemented through 2000) John Wiley & Sons, New York
("Ausubel"); Sambrook et al. Molecular Cloning - A Laboratory Manual (2nd
Ed.), Vol.
1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989
("Sambrook"),
and Berger and Kimmel Guide to Molecular Cloning Techniques, Methods in
Enzymology volume 152 Academic Press, Inc., San Diego, CA ("Berger").
[0125] In addition to the above references, protocols for in vitro
amplification
techniques, such as the polymerase chain reaction (PCR), the ligase chain
reaction (LCR),
QP-replicase amplification, and other RNA polymerase mediated techniques
(e.g..
NASBA), useful e.g., for amplifying cDNA probes of the invention, are found in
Mullis et
al. (1987) U.S. Patent No. 4,683,202; PCR Protocols A Guide to Methods and
Applications (Innis et al. eds) Academic Press Inc. San Diego, CA (1990)
("Innis");
Arnheim and Levinson (1990) C&EN 36; The Journal Of NIH Research (1991)
3:81;
Kwoh et al. (1989) Proc Natl Acad Sci USA 86, 1173; Guatelli et al. (1990)
Proc Natl
Acad Sci USA 87:1874; Lome11 et al. (1989) J Clin Chem 35:1826; Landegren et
al.
(1988) Science 241:1077; Van Brunt (1990) Biotechnology 8:291; Wu and Wallace
(1989) Gene 4: 560; Barringer et al. (1990) Gene 89:117, and Sooknanan and
Malek
(1995) Biotechnology 13:563. Additional methods, useful for cloning nucleic
acids in the
context of the present invention, include Wallace et al. U.S. Pat. No.
5,426,039. Improved
methods of amplifying large nucleic acids by PCR are summarized in Cheng et
al. (1994)
Nature 369:684 and the references therein.
[0126] Certain polynucleotides of the invention, e.g.,
oligonucleotides can be
synthesized utilizing various solid-phase strategies including mononucleotide-
and/or
trinucleotide-based phosphoramidite coupling chemistry. For example, nucleic
acid
-38-

CA 02827114 2013-09-10
sequences can be synthesized by the sequential addition of activated monomers
and/or
trimers to an elongating polynucleotide chain. See e.g., Caruthers, M.H. et
al. (1992)
Meth Enzymol 211:3.
[0127] In lieu of synthesizing the desired sequences, essentially any
nucleic acid
can be custom ordered from any of a variety of commercial sources, such as The
Midland
Certified Reagent Company, The Great American Gene Company, ExpressGen, Inc.,
Operon Technologies, Inc., and many others.
[0128] In addition, substitutions of selected amino acid residues in
viral
polypeptides can be accomplished by, e.g., site directed mutagenesis. For
example, viral
polypeptides with amino acid substitutions functionally correlated with
desirable
phenotypic characteristic, e.g., an attenuated phenotype, cold adaptation,
temperature
sensitivity, can be produced by introducing specific mutations into a viral
nucleic acid
segment encoding the polypeptide. Methods for site directed mutagenesis are
well known
in the art, and described, e.g., in Ausubel, Sambrook, and Berger, supra.
Numerous kits
for perforrning site directed mutagenesis are commercially available, e.g.,
the ChameleonTM
Site Directed Mutagenesis Kit (Stratagene, La Jolla), and can be used
according to the
manufacturers instructions to introduce, e.g., one or more amino acid
substitutions
described in Table 6 or Table 17, into a genome segment encoding a influenza A
or B
polypeptide, respectively.
EXAMPLES
EXAMPLE 1: CONSTRUCTION OF pAD3000
[0129] The plasmid pHW2000 (Hoffmann et al. (2000) A DNA transfection
system
for generation of influenza A virus from eight plasmids Proc Natl Acad Sci USA
97:6108-
6113) was modified to replace the bovine growth hormone (BGH) polyadenylation
signals
with a polyadenylation signal sequences derived from Simian virus 40 (SV40).
[0130] Sequences derived from SV40 were amplified with Taq
MasterMixTm
(Qiagen) using the following oligonucleotides, designated in the 5' to 3'
direction:
polyA.1: AACAATTGAGATCTCGGTCACCTCAGACATGATAAGATACATTGATGAGT (SEQ ID NO:1)
polyA.2: TATAACTGCAGACTAGTGATATCCTTGTTTATTGCAGCTTATAATGGTTA (SEQ ID NO:2)
-39-

CA 02827114 2013-09-10
=
[0131] The plasmid pSV2His was used as a template. A fragment
consistent with
the predicted 175 bp product was obtained and cloned into pcDNA3.1, using a
Topo TA
cloning vector (Invitrogen) according to the manufacturer's directions. The
desired 138
bp fragment containing the SV40 polyadenylation signals was excised from the
resulting
plasmid with EcoRV and BstEll, isolated from an agarose gel, and ligated
between the
unique Pvull and BstEII sites in pHW2000 using conventional techniques (see,
e.g.,
Ausubel, Berger, Sambrook). The resulting plasmid, pAD3000 (Figure 1), was
sequenced
and found to contain the SV40 polyadenylation site in the correct orientation.
Nucleotides
295-423 in pAD3000 correspond to nucleotides 2466-2594, respectively, in SV40
strain
777 (AF332562).
EXAMPLE 2: EIGHT PLASMID SYSTEM FOR PRODUCTION OF MDV-A
[0132] A cold-adapted influenza virus type A strain A/AA/6/60 variant
has
commonly been used as a master donor virus for the production of nasally
administered
Influenza A vaccines. This strain is an exemplary Master Donor Virus (MDV) in
the
context of the present invention. For simplicity, this strain A/AA/6/60
variant is
designated herein MDV-A. MDV-A viral RNA was extracted using the RNeasyTM mini
kit
(Qiagen) and the eight corresponding cDNA fragments were amplified by RT-PCR
using
the primers listed in Table 1.
Table 1. Sequence of the primers used for cloning MDV-A eight segments
SEQ Primer Sequence (5'-3')
ID.
MDV-A FORWARD PRIMERS
SEQ ID AmiPB2long CAC TTA TAT TCA CCT GCC TCA GGG AGC GAA AGC AGG TC
. NO:3
SEQ ID BsmBI-PB1 TAT TCG TCT CAG GGA GCG AAA GCA GGC AAA
NO:4
SEQ ID BsmBI-PA TAT TCG TCT CAG GGA GCG AAA GCA GGT ACT
NO:5
SEQ ID BsmBI-NP TAT TCG TCT CAG GGA GCA AAA GCA GGG TAG A
NO:6
SEQ ID Amilik-kmg CAC TTA TAT TCA CCT GCC TCA GGG AGC AAA AGC AGG GG
NO:7
SEQ ID BsmBI-NA TAT TCG TCT CAG GGA GCA AAA GCA GGA GTG A
NO:8
SEQ ID BsmBI-M TAT TCG TCT CAG GGA GCA AAA GCA GGT AGA T
NO:9
SEQ ID BsmBI-NS TAT TCG TCT CAG GGA GCA AAA GCA GGG TGA
NO:10
-40-

CA 02827114 2013-09-10
MDV-A REVERSE PRIMERS
SEQ ID AarIPB2-long CCT AAC ATA TCA CCT GCC TCG TAT TAG TAG AAA CAA GGT CGT TT
-
N0:11
SEQ ID BsmBI-PB I ATA TCG TCT CGT ATT AGT AGA AAC AAG GCA TTT
NO:12
SEQ ID BsrriBI-PA ATA TCG TCT CGT ATT AGT AGA AAC AAG GTA CTT
NO:13
SEQ ID BsrnBI-NP ATA TCG TCT CGT ATT AGT AGA AAC AAG GGT ATT
NO:14
SEW]) AarI HA-long CCT AAC ATA TCA CCT GCC TCG TAT TAG TAG AAA CAA GGG TGT T
NO:15
SEQ ID BsmBI-NA ATA TCG TCT CGT ATT AGT AGA AAC AAG GAG TTT
NO:16
SEQ ID BsinBI-M ATA TCG TCT CGT ATT AGT AGA AAC AAG GTA GTT
NO:17 =
SEQ ID BsrnBI-NS ATA TCG TCT CGT ATT AGT AGA AAC AAG GGT GTT
NO:18
[0133] With the exception of the influenza genome segments encoding
HA and
PB2, which were amplified using the primers containing Aar I restriction
enzyme
recognition site, the remaining 6 genes were amplified with primers containing
the BsmB I
restriction enzyme recognition site. Both AarI and BsmB I cDNA fragments were
cloned
between the two BsmB I sites of the pAD3000 vector.
[0134] Sequencing analysis revealed that all of the cloned cDNA
fragments
contained mutations with respect to the consensus MDY-A sequence, which were
likely
introduced during the cloning steps. The mutations found in each gene segment
are
summarized in Table 2.
Table 2. Mutations introduced into the MDV-A clones in pAD3000
Gene segment Mutation positions (nt) Amino acid changes
PB2 A954(G/C/T), G1066A, Silent, Gly to Ser, Val to
Ala,
T1580C, T1821C Silent
PB1 C1117T Arg to Stop
PA G742A, A11630, A16150, Gly to Ser, Asp to Gly, Arg
to
T1748C, C2229de1 Gly, Met to Thr, non-coding
HA A902C, C1493T Asn to His, Cys to Arg
NP C113A, T1008C Thr to Asn, silent
NA C1422T Pro to Leu
A191G Thr to Ala
NS C38T Silent
[0135] All the mutations were corrected back to the consensus 1VIDV-A
sequence
Using a QuikChangeTM Site-directed Mutagenesis Kit (Stratagene) and synthetic
oligonucleotide primers as shown in Table 3.
-41-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728
Table 3. Primers used for correcting the mutations in the MDV-A clones
HJ67 PB2A954G 5/P/gcaagctgtggaaatatgcaaggc(SEQ ID NO: 19)
HJ68 PB2A954G.as gccttgcatatttccacagcttgc (SEQ ID NO:20)
HJ69 PB2G1066A 5/P/gaagtgcttacgggcaatcttcaaac (SEQ ID NO:21)
PB2 HJ70 P32G1066A.as gtttgaagattgcccgtaagcacttc (SEQ ID NO:22)
HJ71 PB2T1580A 5/P/cctgaggaggtcagtgaaacac (SEQ ID NO:23)
HJ72 PB2T1580A.as gtgtttcactgacctcctcagg (SEQ ID NO:24)
HJ73 PB21821C 5/P/gtttgttaggactctattccaac (SEQ ID NO:25)
=HJ74 PB21821C.as gttggaatagagtcctaacaaac (SEQ
ID N0:26)
PB1 HJ75 PB1C1117T gacagtaagctccgaacacaaatac (SEQ ID NO:27)
HJ76 PB1C1117T.as gtatttgtgttcggagcttcatgc (SEQ ID NO:28)
HJ77 PA-G742A _5/P/cgaaccgaacggctacattgaggg (SEQ ID NO:29)
HJ78 PA-G742A.as ccctcaatgtagccgttcggttcg (SEQ ID NO:30)
HJ79 PA-A1163G 5/P/cagagaaggtagatttgacgactg (SEQ ID NO:31)
HJ80 PA-A1163G.as cagtcgtcaaagtctaccttctctg (SEQ ID NO:32)
PA HJ81 PA-A1615G 5/P/cactgacccaagacttgagccac (SEQ ID NO:33)
HJ82 PA-A1615G.as gtggctcaagtcttgggtcagtg (SEQ ID NO:34)
HJ83 PA-T1748C 5/Pfcaaagattaaaatgaaatggggaatg (SEQ ID NO:35)
HJ84 PA-T1748C.as cattccccatttcattttaatctttg (SEQ ID NO:36)
HJ85 PA-C2229 5/P/gtaccttgtttctactaataacccgg (SEQ ID N0:37)
HJ86 PA-C2230.as ccgggttattagtagaaacaaggtac (SEQ ID NO:38)
HJ87 HA-A902C 5/P/ggaacacttgagaactgtgagacc (SEQ ID NO:39)
HA HJ88 HA-A902C.as ggtctcacagttctcaagtgttcc (SEQ ID NO:40)
HJ89 HA-C1493T 5/P/gaattttatcacaaatgtgatgatgaatg (SEQ ID NO:41)
HJ90 HA-C1493T.as cattcatcatcacatttgtgataaaattc (SEQ ID NO:42)
HJ91 NP-C113A 5/P/gccagaatgcaactgaaatcagagc (SEQ ID NO:43)
NP HJ92 NP-C113A.as gctctgatttcagtttcattctggc (SEQ ID NO:44)
HJ93 NP-T1008C 5/P/ccgaatgagaatccagcacacaag (SEQ ID NO:45)
JIJ94 NP-T1008C.as cttgtgtgctggattctcattcgg (SEQ ID NO:46)
HJ95 NA-C1422T catcaatttcatgcctatataagctttc (SEQ ID NO:47)
NS HJ96 NA-C1422T.as gaaagcttatataggcatgaaattgatg (SEQ ID NO:48)
HJ97 NS-C38T
cataatggatcct'aacactgtgtcaagc (SEQ ID NO:49)
HJ98 NS-C38T.as
gcttgacacagtgttaggatccattatg (SEQ ID NO:50)
PA HJ99 PA6C375T
ggagaatagattcatcgagattggag (SEQ ID No:51)
HJ100 PA6C375T.as
ctccaatctcgatgaatctattctcc (SEQ ID NO:52)
EXAMPLE 3: GENERATION OF INFECTIOUS RECOMBINANT MDV-A AND
REASSORTED INFLUENZA VIRUS
[0136] Madin-Darby canine kidney (MDCK) cells and human COS7 cells
were
maintained in modified Eagle Medium (MEM) containing 10% fetal bovine serum
(FBS).
Human embryonic kidney cells (293T) were maintained in Opti-MEM I (Life
Technologies) containing 5% FIBS. MDCK and either COS7 or 293T cells were co-
cultured in 6-well plates at a ratio of 1:1 and the cells were used for
transfection at a
confluency of approximately 80%. 293T and COS7 cells have a high transfection
efficiency, but are not permissive for influenza virus replication. Co-culture
with MDCK
cells ensures efficient replication of the recombinant viruses. Prior to
transfection, serum- -
containing media were replaced with serum free medium (Opti-MEM I) and
incubated for
-42-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12
4-6 hours. Plasmid DNA transfection was performed using TransIT-LT1 (Mirus) by
mixing 1 g of each of the 8 plasmid DNAs (PB2, PB1, PA, NP, M, NS, HA and NA)
with 20 1 of TransIT-LT1 diluted in 160 I Opti-MEM I in a total volume of
200 I. The
DNA:transfection reagent mixtures were incubated at room temperature for 45
min
followed by addition of 800 I of Opti-MEM I. The transfection mixture was
then added
to the co-cultured MDCK/293T or M1DCK/COS7 cells. The transfected cells were
incubated at 35 C or 33 C for between 6 hours and 24 hours, e.g., overnight,
and the
transfection mixture was replaced with 1 ml of Opti-MEM I in each well. After
incubation
at 35 C or 33 C for 24 hours, lml of Opti-MEM I containing 1 g/m1 TPCK-
trypsin was
added to each well and incubated for an additional 12 hours. The recovered
virus was then
amplified in confluent MDCK cells or directly amplified in embryonated chick
eggs.
MDCK cells in 12-well plate were infected with 0.2 ml of the transfection
mixture for 1
hour at room temperature, the mixture was then removed and replaced with 2m1
of Opti-
MEM I containing 1 g/mITPCK-trypsin. The cells were incubated at 35 C or 33
C for
3-4 days. The amplified viruses were stored at ¨80 C in the presence of SPG
stabilizer or
plaque-purified and amplified in MDCK cells or chicken embryonic eggs.
Functional expression of MDV-A polymerase proteins
[0137] Functional activity of the four MDV-A polymerase proteins,
PB2, PB1, PA
and NP, were analyzed by their ability to replicate an influenza virus
minigenome
encoding an EGFP reporter gene. A set of 8 expression plasmids (see, e.g.,
Table 4)
(Hoffmann et al. (2001) Eight plasmid rescue system for influenza A virus;
Options for the
control of influenza International Congress Series 1219:1007-1013) that
contained the
cDNAs of A/PR/8/34 strain (H1N1) and an influenza virus minigenome containing
a
reporter gene encoding the enhanced green fluorescent protein (EGFP, pHW72-
EGFP).
[0138] The MDV-A PB1, PB2, PA and NP or PB1, PA, NP (-PB2 as a negative
control) were transfected into the co-cultured MDCK/23T cells together with a
plasmid
representing an influenza A virus EGFP minigenome (pHW72-EGFP)(Hoffmann et al.
(2000) "Ambisense" approach for the generation of influenza A virus: vRNA and
mRNA
synthesis from one template Virology 15:267(2):310-7). The transfected cells
were
observed under phase contrast microscope or fluorescence microscope at 48
hours post-
transfection. Alternatively, flow cytometry can be employed to detect EGFP
expression.
-43-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
-
[0139] As shown in Figure 2, green fluorescence, indicating
expression of the
EGFP minigenome was observed in the cells transfected with PB2, PB1, PA and NP
of
MDV-A, but not in the cells transfected with only three polymerase proteins.
This
indicated that the MDV-A polymerase proteins in pAD3000 were functional.
[0140] In other assays a minigenome including the chloramphenicol acetyl
transferase (CAT) gene, designated pFlu-CAT is utilized to measure polymerase
activity.
In such an assay, CAT expression is measured at the protein (e.g., by ELISA)
or RNA
level, as an indicator of minigenome replication.
Analysis of the MDV-A plasmids by single gene reassortant experiment
[0141] Each of the 8 MDV-A genome segments cloned in pAD3000 was shown to
be functionally expressed in a reassortant experiment by co-transfecting a
single gene
segment from MDA-A together with the complementary seven segments from control
A/PR/8/34 strain. All eight single genome segment plasmids in combination with
complementary control segments generated infectious reassortant virus, which
caused
cytopathic effects in infected MDCK cells, indicating that all eight plasmids
encode
functional MDV-A proteins. Table 4.
Table 4. Recovery of 7+1 reassortants by plasmids
Virus PB2 PB1 PA NP
gene
segment _
1 PMDV-A-PB2 pHW191-PB2 pHW191-PB2 pHW191-PB2
2 PHW192-PB1 pMDV-A-PB1 pHW192-PB1 pHW192-PB1
3 PHW193-PA pHW193-PA pMDV-A-PA pHW193-PA
4 PHW195-NP pHW195-NP pHW195-NP pMDV-A-NP
5 PHW 197-M pHW197-M pHW197-M pHW 197-M
6 P1-1W198-NS pHW198-NS pHW198-NS pHW198-NS
7 PHW194-HA pHW194-HA pHW194-HA p11W194-HA
8 PHW-196-NA pHW-196-NA pHW-196-NA pHW-196-NA
CPE (+) ( ) (+) (-1)
Virus M NS HA NA
gene
segment
1 PHW191-PB2 pHW191-PB2 pHW191-PB2 pHW191-PB2
2 PHW192-PB1 pHW192-PB 1 pHW192-PB1 _pHW192-PB1
3 P11W193-PA pHW193-PA pHW193-PA pHW193-PA
4 PHW195-NP pHW195-NP pHW195-NP pHW195-NP
5 PMDV-A-M pHW197-M pHW197-M pHW197-M
6 PHW198-NS pMDV-A-NS pHW198-NS pHW198-NS
7 PHW194-HA pHW194-HA pMDV-A-HA pHW194-HA
8 PHW-196-NA pHW-196-NA pHW-196-NA pMDV-A-NA
CPE (+) (4) (4) (-1)
-44-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12i.
[0142] To further determine the packaging constraints of influenza A
virus, the NS
segment was separated into two separate gene segments: one encoding the NS1
genomic
segment and the other encoding the NS2 genomic segment. The nine plasmids
incorporating the genomic segments of influenza A were transfected into
MDCK/COS
cells as described above, and the recovered viruses were amplified in
embryonated
chicken eggs prior to titration on MDCK cells. Reduced plaque size was
observed for the
nine-plasmid system as compared to the eight-plasmid system described above.
RT-PCR
analysis demonstrated that only the NS2 segment was present in the virions,
and that the
NS1 gene segment was not packaged.
= Recovery of MDV-A and 6:2 reassortant viruses
[0143] Following the procedures described above, three days post
transfection
with either the 8 MDV-A plasmids (recombinant), or with plasmids incorporating
the 6
MDV-A internal genes, and HA and NA derived from AJPR/8/34 (6:2 reassortant),
transfected culture supernatants were used to infect fresh MDCK cells, and the
infected
cells were incubated at 33 C for three days in the presence of lpg/m1TPCK-
trypsin. The
cytoplasmic effect of the recombinant virus on infected MDCK cells was
observed using a
microscope. Expression of viral hemagglutinin was monitored using a standard
hemagglutination assay (HA). HA assays were performed by mixing 50 1 of
serially 2-
fold diluted culture supernatants with 50 1 of 1% chick red blood cells in 96-
well plates.
A HA titer of approximately 1:254-1:1024 was detected for the amplified
viruses derived
from either the transfected 8 MDV-A plasmids, or the 6:2 reassortant virus.
The
transfection reaction using the 8 A/PR/8/34 plasmid obtained from Dr. E.
Hoffman was
used as a positive control. Infectious influenza viruses were produced from
these three
transfection reactions as indicated in Table 5.
-45-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
-
Table 5. Plasmids used for recovery of AJPR/8/34, MDV-A and 6:2 reassortant
Virus gene A/PR/8/34 (H1N1) rMDV-A(H2N2) 6:2 reassortant
segment
1 pHW191-PB2 (AD731) pMDV-A-PB2#2 (AD760) pMDV-A-PB2#2 (AD760)
2 pHW192-PB1(AD732) pMDV-A-PB 1 (AD754) pMDV-A-PB1 (AD754)
3 pHW193-PA (AD733) pMDV-A-PA (AD755) pMDV-A-PA (AD755)
4 pHW195-NP (AD735) pMDV-A-NP#1 (AD757) pMDV-A-NP#1 (AD757)
pHW197-M (AD737) pMDV-A-M (AD752) pMDV-A-M (AD752)
6 pHW198-NS (AD738) pMDV-A-NS (AD750) pMDV-A-NS (AD750)
7 pHW194-HA (AD734) pMDV-A-HA (AD756) pHW194-HA (AD734)
8 pHW-196-NA(AD735) pMDV-A-NA#4 (AD759) pHW196-NA (AD736)
CPE +
[0144] RT-PCR was performed to map the genotypes of the recovered
viruses.
Viral RNA was isolated from the infected cell culture supernatant using the
RNeasy mini
5 Kit (Qiagen) and the eight influenza virus segments were amplified by RT-
PCR using
primers specific to each MDV-A gene segment and H1- and N1-specific primers.
As
shown in Figure 3, rMDV-A contained PB2, PB1, NP, PA, M and NS that were
specific to
MDV-A and HA and NA specific to the H2 and N2 subtype. The 6:2 reassortant
contained
the 6 internal genes derived from M7DV-A, and the HA and NA derived from
AfPR/8/34
(H1N1). This confirmed that viruses generated from the transfected plasmids
had the
correct genotypes.
[0145] The rescued viruses were titrated by plaque assay on MDCK
cells and the
plaques were confirmed to be influenza virus by immunostaining using chicken
serum
raised against MDV-A. MDCK cells at 100% confluency on 12-well plates were
infected
with 100 I of 10-fold serially diluted virus at RT for 1 hour with gentle
rocking. The
inoculum was removed and the cells were overlaid with 1X L15 containing 0.8 %
agarose
and 1 g/mITPCK-trypsin. The plates were incubate at 35 C or 33 C for three
days, fixed
-46-

CA 02827114 2013-09-10
with 100% methanol, blocked by 5% milk in PBS, and incubated with 1:2000
diluted
chicken anti-MIDV-A antiserum for' 1 hour followed by incubation with FIRP-
conjugated
rabbit anti-chicken IgG for 1 hr. The plaques were visualized by addition of
the HRP
substrate solution (DAKO). All the recovered viruses exhibited positive
immunostaining.
EXAMPLE 4: MAPPING THE GENETIC BASIS OF CA, TS, AU PHENOTYPES OF
MDV-A
[0146] The 1VIDV-A influenza virus vaccine strain has several
phenotypes relevant
to the production of vaccines, e.g., live attenuated vaccines: cold adaptation
(ca),
temperature sensitivity (ts) and attenuation (att). Sequence comparison of the
MDV-A
strain with the non-ts virulent wt A/AA/6/60 strain revealed that a minimal of
17nt
differences between these two strains (Table 6). Several of the changes in the
MDV-A
sequence are unique to this strain as compared to all the available influenza
type A viruses
in the GeneBankTm database, suggesting that one or more of these amino acid
substitutions is
functionally related to the att, ca and ts phenotype(s). The single amino acid
change at
PB282I was the only nucleotide position that had been previously reported as a
determinant
in the ts phenotype of MDV-A (Subbarao et al. (1995) Addition of Temperature-
Sensitive
Missense Mutations into the PB2 Gene of Influenza A Transfectant Viruses Can
Effeet an
Increase in Temperature Sensitivity and Attenuation and Permits the Rational
Design of a
Genetically Engineered Live Influenza A Virus Vaccine J. Virol. 69:5969-5977).
[0147] In order to pinpoint the minimal substitutions involved in the MDV-A
phenotypes, the nucleotides in the MDV-A clone that differ from wt AJAA/6/60
were
individually changed to those of wt A/AA/6/60 (i.e., "reverted"). Each
reverted gene
segment was then introduced into host cells in combination with complementary
segments
of MDV-A to recover the single gene reassortants. In addition, the reverted
gene segment
and the corresponding MDV-A segment can also be transfected in combination
with
segments derived from other wild type strains, e.g., strain A/PR/8/34, to
assess the
contribution of each gene segment to the virus phenotypes. Using the
recombinant MDV-
A plasmid system described above, site-directed mutagenesis was performed to
further
modify the six internal genes to produce a non-ts reassortant. A total of 15
nucleotides
substitution mutations were introduced into the six MDV-A plasmids to
represent the
recombinant wild type A/AAJ6/60 genome (rWt, F1u064) as listed in Table 6.
Madin-
-47-

CA 02827114 2013-09-10
Darby canine kidney (MDCK) cells and COS-7 cells were maintained and
transfected as
described above. The recovered virus was then passaged in MDCK cells once,
followed
by amplification in the allantoic cavities of embryonic chicken eggs.
Transfection and
virus growth in MDCK and eggs were performed at 33 C, a temperature permissive
for
both ca and wt viruses to minimize any temperature selection pressures. Virus
genotype
was confirmed by sequence analysis of cDNA fragments amplified from viral RNA.
Table 6. Sequence Comparisons of "wt" A/AA/6/60 and MDV-A
RNA Base E1OSE2 MDV-A rWT
Segment (amino acid) (F1u044)
Position
PI32 141 A G A
821 (265) A (Asn) G(Ser) A
1182 A
1212
1933
PB1 123 A
1195 (391) A (Lys) G (Glu) A
1395 (457) G (Glu) T (Asp)
1766 (581) A (Glu) G (Gly) A
=
2005 (661) G (Ala) A (Thr) A
2019
PA 20
1861 (613) A (Lys) G (Q1u)
2167/8 (715) TT (Leu) CC (Pro) TT
NP 146 (34) A (Asp) G (Gly)
1550 '5A' '6A' '6A'
969 (M2-86) G (Ala) T (Ser)
NS 483 (NS1-153) G (Ala) A (Thr)
Numbers in bold represent the differences between rMDV-A and rWt.
Words in bold (15) are the changes between rmdv-a and rwt.
[0148] Phenotypic characteristics were determined by procedures known
in the art,
e.g., as previously described in United States Patent 6,322,967 to Parkin
entitled
"Recombinant tryptophan mutants of influenza,"
Briefly, temperature sensitivity of the recombinant viruses was determined by
plaque assay on MDCK cells at 33, 38 and 39 C. MDCK cells in 6-well plates
Were
infected with 400 gl of 10-fold serially diluted virus and adsorbed at room
temperature for
60 min. The innoculants were removed and replaced with Ix LI5/MEM containing
1%
agarose and 1 jig/ml TPCK-trypsin. The infected cells were incubated at 33 C
in a CO2
-48-

I
CA 02827114 2013-09-10
,
WO 03/091401
PCT/US03/127. _
incubator or in water-tight containers containing 5% CO2 submerged in
circulating water
baths maintained at 38 0.1 C or 39 0.1 C (Parkin et al. (1996) Temperature
sensitive
mutants of influenza A virus generated by reverse genetics and clustered
charged to
alanine mutagenesis. Vir. Res. 46:31-44). After three days' incubation, the
monolayers
were immunostained using chicken anti-MDV polyclonal antibodies and the
plaques were
,
enumerated. Plaque counts obtained at each of the temperatures were compared
to assess
the ts phenotype of each virus and each assay was performed a minimum of three
times.
The shut-off temperature was defined as the lowest temperature that had a
titer reduction
of 100-fold or greater compared to 33 C.
[0149] Infectious virus obtained from the cocultured COS-7/MDCK cells
transfected with the eight plasmids (pMDV-PB2, pMDV-PB1, pMDV-PA, pMDV-NP,
pMDV-HA, pMDV-NA, pMDV-M, and pMDV-NS) was amplified in chicken
embryonated eggs, and was shown to exhibit the characteristic ts phenotype of
nonrecombinant, biological derived MDV-A (Table 7). Neither MDV-A nor rMDV-A
formed distinct plaques at 39 C, although both formed easily visualized
plaques at 33 C.
Table 7. Replication of MDV/Wt reassortants at various temperatures
-
Virus with 33 C 38 C 33 C/38 C 39 C 33
C/39 C
Wt genes
MDV 8.91 6.10 2.82 <4.01. >4.91
rMDV-A 8.72 6.19 2.53 <4.0 >4.72
Wt (E1OSE2) 8.86 8.87 -0.01 8.87 -0.01
-
rWT (F1u064) 9.02 9.07 -0.05 8.96 0.06
_ Wt-PB2 8.46 7.87 0.59 5.80* 2.66
Wt-PB1 8.92 8.74 0.18 7.86* 1.06
Wt-NP 8.40 7.24 1.15 <4.0 >4.40
=
Wt-PA 8.57 6.10 2.48 <4.0 >4.57
Wt-M 8.80 6.68 2.12 <4.0 >4.80
Wt-NS 8.72 6.10 2.62 <4.0 >4.72
. Wt-PB1/PB2 8.94 8.89 0.05 8.10* 0.85
Wt-PB1/PB2/NP 8.52 8.38 0.14 - 8.41 _ 0.1
_
* Indicates reduction in plaque size compared to rWt.
I The underlined indicates that no plaques were detected at 10-4-fold dilution
[0150] In order to perform a systematic, detailed analysis of the genetic
basis of
the ts phenotype of MDV-A, the sequences of several closely related non-ts,
non-att wt =
A/AA16/60 strains with 17-48 nt differences from the ca A/AA/6/60, including
the highly
-49-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728
related isolate, wt A/AA/6/60 E1OSE2, were utilized for comparison. A total of
19 nt
differences exist between E1OSE2 and MDV-A (Table 6). E1OSE2 was shown to be
non-ts
(Table 7) and non-att in ferrets. In order to generate a recombinant non-ts
virus, the
MDV-A plasmids were altered by site directed mutagenesis to incorporate 15 of
the 19
differences representing 10 amino acids changes. Four of the nucleotide
positions, PB2-
1182, 1212, PB1-123, and NP-1550, that differed between MDV-A and E1OSE2 were
not
altered from the MDV-A sequence, since these nucleotides were observed in
other non-ts
isolates of A/AA/6/60 and, therefore, not expected to have a role in
expression of the ts
phenotype (Herlocher et al. (1996) Sequence comparisons of A/AA/6/60 influenza
viruses:
mutations which may contribute to attenuation. Virus Research 42:11-25).
Recombinant
virus (rWt, F1u064), encoding the 15 nucleotide changes, was obtained from the
cocultured COS-7/MDCK cells transfected with a set of 8 plasmids, pWt-PB2, pWt-
PB1,
pWt-PA, pWt-NP, pWt-M, pWt-NS, pMDV-HA, and pMDV-NA. Sequencing analysis
indicated that rWt contained the designed genetic changes and was non-ts at 39
C,
identical to the biologically derived wt A/AA/6/60. These observations
demonstrated that
the ts phenotype mapped to a subset of these 15 nt changes.
Contribution of the six internal gene segments to virus ts phenotype
[0151] The effect of each wt gene segment on the M_DV-A ts phenotype
was
assessed by creating recombinant, single-gene reassortants (Table 7).
Introduction of wt
PB2 into rMDV-A resulted in a virus that was only non-ts at 38 C; however, it
remained
ts at 39 C. The reduction in virus titer at 38 C and 39 C (relative to 33 C)
was 0.6 logic)
and 2.7 logio , respectively, as measured by plaque assay in MDCK cells. The
reassortant
containing the wt PB1 gene segment was non- ts, with respect to its ability to
form plaques
at both 38 and 39 C. The plaque size of this recombinant, however, was
influenced by
increased temperature and was significantly reduced at 39 C as compared to
rWt.
Introduction of the wt NP gene segment into rMDV-A resulted in a virus that
was also
non-ts at 38 C, but in contrast to the wt PB2 recombinant, the virus
containing the wt NP
gene segment did not form plaques at 39 C. Introduction of wt PA, M or NS gene
segments independently into rMDV-A did not alter the ts phenotype, indicating
that these
three gene segments had minimal role in maintenance of this phenotype.
[0152]
Because neither wt PB1, wt PB2 or wt NP expressed individually on the
MDV-A background could create a plaque efficiency and plaques size profile
identical to
-50-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/127.
non-ts rWT, these gene segments were introduced into MDV-A in various
combinations.
The combination of wt P131 and wt PB2 resulted in a virus that was non-ts at
both 38 and
39 C (Table 7). Although the plaque size was larger than that of either single
gene
reassortant, it was significantly smaller than rWt. The triple combination of
wt
PB1/PB2/NP in rMDV-A resulted in a virus that was similar or identical to rWt
in its
plaguing efficiency and plague size at 39 C. Therefore, whereas the wt PB2,
PB1 and NP
gene segments only partially reverted the ts phenotype when introduced
individually, the
combination of all three wt gene segments was able to fully revert the ts
phenotype to a
non-ts behavior identical to rWt.
[0153] In order to determine whether these 3 gene segments were capable of
imparting the characteristic MDV-A ts phenotype to rWt, the six internal gene
segments
derived from MDV-A were introduced into rWt individually or in combination.
Introduction of single PB1, PB2, or NP gene segment into rWt resulted in a
reduction of
virus titer at 38 C and a greater reduction at 39 C, however, none of these
single gene
reassortants was as restricted at high temperature as rMDV-A (Figure 10). The
PA, M and
NS gene segments derived from MDV-A did not influence the non-ts phenotype of
rWt.
Consistent with the previous reasortments, it was demonstrated that
introduction of both
MDV-A PB1 and PI32 genes into rWt backbone greatly increased virus ts
phenotype at 38
C; however, complete reversion of virus ts phenotype 'required addition of the
NP gene.
Thus, the PB1, PB2 and NP gene segments derived from MDV-A were important in
conferring the complete ts phenotype.
Mapping the genetic loci that determined MDV-A ts phenotype.
[0154] The specific differences between the PB1, PB2 and NP gene
segments of
rWt and rMDV-A were addressed systematically to identify those changes that
played a
significant role in the ts phenotype. The NP gene of rMDV-A differed from rWt
NP only
at nt 146 (G34D, Table 6). The PB2 gene of rMDV-A differed from rWt at three
sites, but
only nt 821 resulted in an amino acid change (N265S, fable 6) and presumably
represented the ts locus located in the PB2 gene segment. The PB1 gene of MDV-
A
differed from wt PB1 at 6 nt positions, of which 4 were coding changes (Table
6). Each of
the wt amino acid residue substitutions was substituted individually into the
PB1 gene
segment of rMDV-A to assess their role in the ts phenotype. 1395G (Glu-457)
and 2005G
(Ala) did not affect the MDV-A ts phenotype. 1195A (Lys-391) and 1766A (Glu-
581)
-51-

1
CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728 -
each resulted in a slight reduction in the ts phenotype at 38 C, but had no
effect at 39 C
(Table 8). These data indicated that 1195A and 1766A were the likely ts loci
in the PB1
gene segment. However, combination of both 1195A and 1766A did not produce a
ts
phenotype similar to wt PB1 (Table 6). Addition of 20050 but not 1395A to PB1-
.
1195A/1766A further decreased the virus ts phenotype at 39 C, demonstrating
that 2005A
,
also had a role in the expression of the ts phenotype specified by the PB1
segment of
MDV-A.
Table 8: Mapping the residues in PB1 that determine ts phenotype
Virus 33 C 38 C 33 C/ 38 C 39 C 33 C/
39 C
with Wt sequence logloPFUha.
rMDV-A 8.67 6.00 2.67 <4.01 >4.67
rWt 9.04 9.01 0.03 9.03 0.01
PB1-1195A 8.06 6.68 1.38 <4.0 >4.06
PB1-1395G 8.72 5.88 2.85 <4.0 >4.72
PB1-1766A 8.07 6.70 1.37 <4.0 >4.07
PB1-2005G 8.76 6.31 2.45 <4.0 >4.76
PB1-1195A1766A 8.65 7.60 1.05 5.98* 2.68
PB1-1195A139501766A 8.84 8.13 0.71 6.38* 2.46
20 PB1-1195A1766A2005G 8.79 8.12 0.66 7.14* 1.64
PB1/PB2/NP 8.26 8.63 0.12 i 8.59 0.16
PB2/NP 8.81 8.21 0.59 7.56* 1.25
PB1-1195A1PB2AW 8.86 8.81 0.05 7.60* 1.26
PB1-1766A/PB2/NP 9.33 8.84 0.50 8.71* 0.62
. 25 PB1-1766A2005G/PB2/NP 8.30 8.22 0.08
8.11* 0.18
PB1-1766A1395G/PB2/NP 8.88 8.85 0.03 8.39* 0.49
PB1-1195A1766A/PB2/NP 8.45 8.48 0.06 8.10 0.35
* Indicates reduction in plaque size compared to rWt.
1 The underlined indicates that no plaques were detected at 104-fold dilution.
30 [0155] PB1 single site mutations were then intrgduced together
with wt PB2 and
wt NP into rMDV-A. Wt PB2/NP and rMDV-A reassortant was non-ts at 38 C and had
a
titer reduction of 1.25 logio at 39 C but its plaque size was much reduced
compared to .
rWt. Addition of either PI31-1195A or 1766A did not significantly change the
phenotype
of wt P132/NP reassortant. Only the combination of PB1-1195A and 1766A,
together with =
35 a wt PB2 and wt NP, resulted in a virus that had the same non-ts
phenotype as wt
-
-52-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/127
PB1/PB2/NP and rMDV-A reassortant (Table 8). Addition of PB1-1395G or 2005G to
wt
PB1-1766/PB2/NP did not convert the virus to a characteristic rWt non-ts
phenotype.
These data, therefore, demonstrated that the four amino acids distributed in
the three PB1,
PB2 and NP genes could completely revert the MDV-A ts phenotype.
Host cell restriction of MDV-A and reassortant viruses
[0156] In addition to the temperature sensitivity and attenuation
phenotypes
exhibited by the MDV-A virus and reassortant viruses with one or more MDV-A
derived
segment as described above, the MDV-A virus exhibited host cell restriction as
indicated
by reduced growth in Per.C6 cells relative to growth in MDCK cells. MDV-A and
reassortant viruses with MDV-A derived PB1 and PB2 segments exhibited
significantly
reduced growth in Per.C6 cells relative to their growth in MDCK cells, as
shown in Figure
A and B.
Engineering of a temperature sensitive, attenuated virus strain
[0157] To determine whether the five amino acids identified in the
PB1, PB2 and
15 NP gene segments of MDV-A would reproduce the ts and aft phenotypes of
MDV-A,
PB1-391E, 581G, 661T, PB2-265S, NP-34G were introduced into a divergent wild
type
virus strain (AJPR/8/34; "PR8"), and the resulting virus exhibited 1.9 logio
reduction in
virus titer at 38 C and 4.6 logo reduction at 39 C, which was very similar
to that of
rMDV-A (Figure 11).
20 [0158] Sequence comparison between the PB1, PB2 and NP genes of ca
A/AA/6/60 (MDV-A) and A/PRJ8/34 revealed that the four substituted amino acids
identified in the PB1 and PB2 genes of MDV-A are unique. NP34 is conserved
between
MDV-A and PR8, Therefore, the three ts sites, PB1391 (K391E), PB1581 (E581G)
and
pB .661
(A661T), identified in the PB1 gene of MDV-A were introduced into PB1 of
A/PR/8/34 and the PB2265 (N265S) was introduced into PB2 of A/PR/8/34 by site-
directed
mutagenesis. The mutations introduced into the PB1 and PB2 genes were verified
by
sequencing analysis. The primer pairs used for mutagenesis reaction are listed
as in Table
9. These viruses are shown schematically in Figure 16.
-53-

CA 02827114 2013-09-10
=
WO 03/091401 PCT/US03/12728
-
Table 9. Primers used for introducing ts mutations into PR8 PB1 and PB2 genes
111240 PR8-PB 1A1195G 5' GAAAGAAGATTGAAGAAATCCGACCGCTC (SEQ ID NO:79)
HI241 PR8-PB1A1195G.as 5' GAGCGGTCGGATTTCTTCAATCTTCTTTC (SEQ ID NO:80)
HJ242 PR8-PB1A1766G 5' GAAATAAAGAAACTGTGGGGGCAAACCCGTTCC (SEQ ID NO:81)
111243 PR8-PB1A1766G.as 5' GGAACGGGTTTGCCCCCACAGTTTC'TTTATTTC (SEQ ID NO:82)
111244 PR8-PB1G2005A 5' GTATGATGCTGTTACAACAACACACTC C (SEQ ID NO:83)
H1245 PR8-PB1G2005A.as 5' GGAGTGTGTTGTTGTAACAGCATCATAC (SEQ ID NO:84)
11.1246 PR8-PB2A821G 5'
ATTGCTGCTAGGAGCATAGTGAGAAGAGC (SEQ ID NO:85)
HJ247 PR8-PB2A821G.as 5' GCTCTTCTCACTATGCTCCTAGCAGCAAT (SEQ ID NO:86)
[0159] To examine if the is mutations introduced into PB1 and PB2
genes of PR8
confer the ts phenotype in vitro, a minigenome assay was performed. The
influenza
minigenome reporter, designated pFlu-CAT, contained the negative sense CAT
gene
cloned under the control of the poi I promoter. Expression of the CAT protein
depended
on the expression of influenza PB1, PB2, PA, and NP proteins.
[0160] Briefly, HEp-2 cells were transfected with 1 lig of each of
PB1, PB2, PA,
NP and pFlu-CAT minigenome by lipofectamine 2000 (Invitrogen). After overnight
(approximately 18 hour) incubation at 33 C or 39 C, the cell extracts were
analyzed for
CAT protein expression by CAT ELISA kit (Roche Bioscience). The level of CAT
mRNA was measured by primer extension assay. At 48 hr post-transfection, total
cellular
RNA was extracted by TRIzol reagent (Invitrogen) and 1/3 of RNA was mixed with
an
excess of DNA primer (5'-ATGTTCTTTACGATGCGA.TTGGG) labeled at its 5' end
with [r-32PFATP and T4 polynucleotide kinase in 6u1 Of water. Following
denaturing at 95
C for 3 min, primer extension was performed after addition of 50 U of
superscript reverse
transcriptase (Invitrogen) in the reaction buffer provided with the enzyme
containing
0.5mM dNTP for 1 hr at 42 C. Transcription products were analyzed on 6%
polyacrylamide gels containing 8M urea in TBE buffer and were detected by
autoradiograph.
[01611 As
shown in Fig. 12A and B, the PB1 gene carrying three amino acid
substitutions (PR8-3s), PB1391 (K391E), PB1581 (E581G) and PB1661 (A661T), had
reduced activity at 33 C compared to PR8 control. A greater reduction in CAT
protein
expression (Fig. 12A) was observed for this mutant at 39 C, indicating PB1
gene with the
three introduced MDV-A ts sites exhibited temperature sensitive replication in
this in vitro
assay. Introduction of PB2265 (N265S) into PR8 had very little effect on its
activity at both =
permissive (33 C) and nonpermissive temperatures (39 C). Combination of both
PB1-3s
-54.

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12
and PB2- is resulted in greater reduction in protein activity (PR8-4s), which
appeared to be
even more ts than MDV-A. As expected, a low level activity (15%) was detected
in cells
transfected with PB1, PB2, PA, NP genes derived from MDV-A at 39 C compared
to wt
A/AA/6/60 (wt AJAA).
[0162] PR8 mutant viruses were generated and recovered as described above.
In
brief, co-cultured cos7 and MDCK cells were transfected with eight plasmids
encoding
PR8 HA, NA, PB1, PB2, PA, NP, M and NS genes derived from PR8. To make a virus
carrying four ts loci (PR8-4s), PB1-3s containing three changes in PB1 at
positions nt
1195 (K391E), nt 1766 (E5810) and nt 2005 (A661T) and PB1-1s containing one
change
in PB2 at position 821 (N265S) were used. In addition, PR8 virus carrying
either three
mutations in PB1 (PR8-3s) or one mutation in PB2 (PR8-1s) was also recovered
separately. These viruses are shown schematically in Figure 16. All four of
the
recombinant mutant PR8 viruses grew to very high titer in embryonic eggs,
reaching a titer
of 9.0 logl0pfu/m1 or greater as shown in Table 10.
[0163] To examine viral protein synthesis in infected cells, MDCK cells
were
infected with virus at an m.o.i of 5 and cells were labeled with 35S-Trans at
7 hr post-
infection for 1hr. The labeled cell lysate was electrophoresed on 1.5%
polyacrylamide gel
containing SDS and autoradiographed. Protein synthesis was also studied by
Western
blotting. Virus infected cells were harvested at 8 hr postinfection and
electrophoresed on
4-15% gradient gel. The blot was probed with anti-M1 antibody or chicken anti-
MDV-A
polyclonal antibody, followed by incubation with HRP-conjugated secondary
antibody.
The antibody-conjugated protein bands were detected by the Chemiluminescent
Detection
System (Invitrogen) followed by exposure to X-ray film.
[0164] As
shown in Fig. 19, all had a similar level of protein synthesis at 33 C,
however, at 39 C the level of protein synthesis was reduced slightly for PR8-
ls but
greatly reduced in PR8-3s and PR8-4s infected cells. Western blotting analysis
also
showed that reduced protein synthesis in the order of PR8-4s>PR8-3s>PR8-1s.
Thus, the
reduced replication of the ts mutants was likely the result of their reduced
replication at the
nonpermissive temperatures.
[0165] Temperature
sensitivity of the PR8 mutant viruses was determined by
plaque assay on MDCK cells at 33 C, 37 C, 38 C and 39 C. The recovered
viruses
-55-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728
were amplified in embryonic eggs and introduced into cells as described above.
After
incubation of virus-infected cells for three days at the designated
temperatures, cell
monolayers were inamunostained using chicken anti-lVLDV polyclonal antibodies
and the
plaques were enumerated. Plaque counts obtained at each of the temperatures
were
compared to assess the ts phenotype of each virus. The shut-off temperature
was defined
as the lowest temperature that had a titer reduction of 100-fold or greater
compared to 33
C.
[0166] As shown in Table 10 and Fig. 17, all mutants replicated well
at 33 C
although a slight reduction in virus titer was observed. At 38 C, a
significant reduction in
virus titer was observed for all the mutants. At 39 C, a reduction in virus
titer greater than
4.0 logo was observed for viruses carrying the three ts loci in the PB1 gene
(PR8-3s and
PR8-4s). PR8-1s was also ts at 39 C. The ts phenotype of PR8-4s was very
similar to that
of MDV-A that had a reduction of 4.6 logo at 39 C compared to 33 C. Although
all the
three PR8 mutants did not have greater than 2.0 logio reduction in virus titer
at 37 C, their
plaque morphology was different from those at 33 C. As shown in Fig. 18, the
plaque
size for each mutant was only slightly reduced at 33 C compared to PR8. A
significant
reduction in plaque size at 37 C was observed for PR8-3s and greater for PR8-
4s. PR8-1s
did not have significant reduction in plaque size at 37 At
39 C, only a few pin-point
sized plaques were observed for both PR8-3s and PR8-4s. The plaque size of
approximately 30% of that wt PR8 was observed for PR8-1s.
Table 10. Temperature sensitivity of PR8 with the introduced ts loci
Virus titer (log1opfu/m1)
Virus 33 C 37 C 38 C 39 C
MDV-A 8.6 7.0 6.4 4*
Wt A/AA 8.7 8.7 8.9 8.3
PR8 9.6 9.5 9.5 9
PB8-1s 9.4 8.9 7.7 7.4
PB8-3s 9.2 8.8 7.8 5.2
PB8-4s 9.5 7.8 7.1 4.4
A titer of 4.0 was assigned when no virus was detected at 10,000 dilutions.
[0167]
Attenuation of the mutant PR8 viruses was examined in ferrets. , In brief,
male ferrets 9-10 weeks old were used to assess virus replication in the
respiratory tracts
of an animal host. Ferrets were housed individually and inoculated
intranasally. with 8.5
logiopfu of virus. Three days after infection, ferrets were sedated with
ketamine-HCL,
-56-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12",
lungs and nasal turbinates (NT) were harvested. The lung tissue homogenates
were serially
diluted and titrated in 10-day-old embryonated chicken eggs. Virus titer
(logioEID50/m1) in
lungs was calculated by the Karber methods. Virus replication in NT was
determined by
plaque assay and expressed as logiopfu/ml.
[0168] The levels of virus replication in lungs and nasal turbinates were
measured
by ElD50 or plaque assays (Table 11). Three days after infection, PR8
replicated to a level
of 5.9 log1oE1D50/gram lung tissues. However, PR8-ls exhibited a 3.0 logio
reduction in
replication of ferret lungs and very little replication was detected for PR8-
3s. No
replication was detected for PR8-4s that was studied in two virus groups
infected with
virus obtained independently. Virus detection limit in ferret lungs by ETD50
assay is 1.5
log10 and thus a titer of 1.5 log1oEID50 was assigned for PR8-4s. As a
control, MDV-A
did not replicate in ferret lungs and wt A/AA/6/60 replicated to a titer of
4.4 logio. Virus
replication in nasal turbinates (NT) was examined by plaque assay on MDCK
cells. PR8
replicated to a titer of 6.6 logiopfu/g in the nose. Only slight reductions in
virus titer were
observed for PR8-Is and PR8-3s. A reduction of 2.2 logio was observed for PR8-
4s (A),
whereas a 4.3 logio reduction was observed for PR8-4s (B), which carried a
change in the
PB1 gene (E390G). The greatly reduced replication of PR8-4s (B) correlates
well with its
ts phenotype at 37 C. An infectious dose of 8.5 loglOpfu was used here
instead of 7.0
loglOpfu that was usually used for evaluating the attenuation Phenotype of MDV-
A
derived influenza vaccines. This result indicated that PR8 carrying the four
ts loci derived
from MDV-A was attenuated in replication in the lower respiratory tracts of
ferrets.
Table 11. Replication of PR8 mutants in ferrets
Virus Ferrets Dose Virus titer in lungs Virus titer in
nasal turbinates
(logiopfu) (log10E1D50/g SE) (logio/g SE)
PR8 4 8.5 5.9 0.3 6.6 0.1
PR8-ls 4 8.5 3.8 0.4 5.9 0.2
PR8-3s 4 8.5 1.7 0.1 5.8 0.3
PR8-4s (A) 4 8.5 1.5 0.0a 4.6 0.2
PR8-4s (B)b 4 8.5 1.5 0.0 2.3 0.3
MDV-A 4 8.5 1.5 0.0 4.6 0.1
Wt A/AA 4 8.5 4.4 0.1 5.4 0.1
-57-

CA 02827114 2013-09-10
a) no virus was detected and a titer of 1.5 log10ElD50/g was assigned
b) The virus contains an additional change in PB1-1193 (E390G)
[0169] In both the ts and att assays, the PR8 mutant virus exhibited
both ts and att
phenotypes that were very similar to that of MDV-A. These data indicate that
introduction
of the unique amino acid substitutions of the MDV-A into a divergent influenza
virus
strain results in a virus exhibiting the temperature sensitive and attenuated
phenotypes
desirable for producing, e.g., live attenuated, vaccines. Additionally, the
ts, att, PR-8 virus
grew to a high titer that suitable for use as a master donor virus for the
production of live
attenuated or inactivated influenza vaccines. These results indicate that the
five MDV-A
mutations: PB1-391E, PB1-581G, PB1-661T, PB2-265S, and NP-34G can impart the
ts
and att phenotypes to any influenza A strains. Similarly, novel ts, att B
strains suitable for
vaccine production can be produced by introducing the mutations of the MDV-B
strain
into influenza B strain viruses. In addition to producing live attenuated
virus vaccines,
introduction of these mutations into donor strains will lead to the production
of safer
inactivated vaccines.
EXAMPLE 5: EIGHT PLASMID SYSTEM FOR PRODUCTION OF MDV-B
[0170] Viral RNA from a cold adapted variant of influenza B/Ann
Arbor/1/66
4
(ca/Master Ann Arbor/1/66 P1 Aviron 10/2/97), an exemPlary influenza B master
donor
strain (MDV-B) was extracted from 100 1 of allantoic fluid from infected
embryonated
eggs using the RNeasy KitTM (Qiagen, Valencia, CA), and the RNA was eluted
into 40111
H20. RT-PCR of genomic segments was performed using the One StepTM RT-PCR kit
(Qiagen, Valencia, CA) according to the protocol provided, using 1 1 of
extracted RNA
for each reaction. The RT-reaction was performed 50 min at 50 C, followed by
15 min at
94 C. The PCR was performed for 25 cycles at 94 C for 1 min, 54 C for 1
min, and 72
C for 3 min. The P-genes were amplified using segment specific primers with
BsrirBI -
sites that resulted in the generation of two fragments (Table 12).
-58-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12i
Table 12. RT-PCR primers for amplification of the eight vRNAs of influenza ca
B/Ann
Arbor/1/66.
Forward primer Reverse primer
PBI Bm-PB1b-1: (SEQ ID NO:53) Bm-PB1b-1200R: (SEQ ID
NO:54)
[I A] TATTCGTCTCAGGGAGCAGAAGCGGAGCCTTTAAGATG
TATTCGTCTCGATGCCGTTCCTTCTTCATTGAAGAATGG
PBI Bm-PB1b-1220: (SEQ ID NO:55) Bm-PB1b-2369R: (SEQ ID
NO:56)
[I B] TATTCGTCTCGGCATCTTTGTCGCCTGGGATGATGATG
ATATCGTCTCGTATTAGTAGAAACACGAGCCTT
PB2 Bm-PB2b-1: (SEQ ID NO: 57) Bm-PB2b-1.145R: (SEQ ID NO:
58)
[2A] TATTCGTCTCAGGGAGCAGAAGCGGAGCGTITTCAAGATG
TATTCGTCTCTCTCATTTTGCTCTTTTTTAATATTCCCC
PB2 Bm-P32b-1142: ( SEQ ID NO : 5 9 ) Bm-PB2b-2396R: ( SEQ ID NO :
6 0 )
[213] TATTCGTCTCATGAGAATGGAAAAAcTAcTAATAAATTCAGC
ATATCGTCTCGTATTAGTAGAAACACGAGCATT
PA Rm-Pab-1: (SEQ ID NO:61) Rm-PAb-1261R: =(SEQ ID
NO:62)
[3A] TATTcgrercAccGAGcAGAAGcGarGccrivGA
TATTcarercccAGGGccerrrrAcTTGTcAGAGTGc
PA Bm-Pab-1283: (SEQ ID NO:63) Bin-PAb-2308R: (SEQ ID
NO:64)
[313] TATTCGTCTCTCCTGGATCTACCAGAAATAGGGCCAGAC
ATATCGTCTCGTATTAGTAGAAACACGTGCATT
HA MDV-B 51BsmBI-HA: (SEQ ID NO:65) MDV-B 31BsmBI-HA: (SEQ ID NO:66)
TATTCGTCTCAGGGAGCAGA.AGCAGAGCATTTTCTAATATC
ATATCGTCTCGTATTAGTAGTAACAAGAGCATTTTTC
NP Ba-NPb-1: (SEQ ID NO:67) Ba-NPb-1842R: (SEQ ID NO:68)
TATTGGTCTCAGGGAGCAGAAGCACAGCATTTTCTTGT
ATATGGTCTCGTATTAGTAGAAACAACAGCATTTTT
NA MDV-B 518smBI-NA: (SEQ ID NO:69) MDV-B 31BsmBI-NA: (SEQ ID NO:70)
TATTcGrercAGGGAGcAGAAccAGAGenTcrrcTcAAAAc
ATATcGTercGTATTAGTAGTAAcAAGAccATTrrrcAG
M MDV-B 51BsmBI-M: (SEQ ID NO:71) MDV-B 3114smBI-M: (SEQ ID Np:72)
TATTcwercAGGGAGcAGAziccAcGcAcTrreTTAAAATG
ATATcGrercGTATTAGTAGAAAcAncceAcrrmccAG
NS MDV-B 51BamBI-NS: (SEQ ID NO:73) MDV-R 3113smBI-NS: (SEQ ID NO:74)
TATTCGTCTCAGGGAGCAGAAGCAGAGGATTTGTTTAGTC
ATATCGTCTCGTATTAGTAGTAACAAGAGGATTTTTAT
[0171] The sequences complementary to the influenza sequences are shown in
=
bold. The 5`-ends have recognition sequences for the restriction endonucleases
BsmBI
(Bm) or BsaI (Ba).
Cloning of plasmids
[0172] PCR fragments were isolated, digested with BsmBI (or
BsaI for NP) and
inserted into pAD3000 (a derivative of pliVs/2000 which allows the
transcription of
negative sense vRNA and positive mRNA) at the BsmBI site as described above.
Two to
four each of the resultant plasmids were sequenced and compared to the
consensus
sequence of MDV-B based on sequencing the RT-PCR fragments directly. Plasmids
= which had nucleotide substitutions resulting in amino acid changes
different from the
consensus sequence were "repaired" either by cloning of plasmids or by
utilizing the
-59-
=

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728 -
Quikchange kit (Stratagene, La Jolla, CA). The resultant B/Ann Arbor/1/66
plasmids were
designated pAB121-PB1, pAB122-PB2, pAB123-PA, pAB124-HA, pAB125-NP,
pAB126-NA, pAB127-M, and pAB128-NS. Using this bi-directional transcription
system
all viral RNAs and proteins are produced intracellularly, resulting in the
generation of
infectious influenza B viruses (Figure 4).
[0173] It
is noteworthy that pAB121-PB1 and pAB124-HA had 2 and pAB128-
,
NS had 1 silent nucleotide substitution compared to the consensus sequence
(Table 13).
These nucleotide changes do not result in amino acid alterations, and are not
anticipated to
affect viral growth and rescue. These silent substitutions have been retained
to facilitate
genotyping of the recombinant viruses.
Table 13. Plasmid set representing the eight segments of B/Ann Arbor/1/66 (MDV-
B)
Seg. plasmids nucleotides protein
PB1 PAB121-PB1 A924>G924; C1701>T1701 silent
PB2 PAB122-PB2 consensus
PA PAB123-PA consensus
HA PAB124-HA T150>C150; T153>C153 silent
NP PAB125-NP consensus
NA PAB126-NA consensus
M PAB127-M consensus
NS PAB128-NS A416>G416 NS1: silent
[0174] For
construction of the plasmids with nucleotide substitution in PA, NP,
and M1 genes the plasmids pAB123-PA, pAB125-NP, pAB127-M were used as
templates. Nucleotides were changed by Quikchange kit (Stratagene, La Jolla,
CA).
Alternatively, two fragments were amplified by PCR using primers which
contained the
desired mutations, digested with BsinBI and inserted into pAD3000-BsmBI in a
three
fragment ligation reaction. The generated plasmids were sequenced to ensure
that the
cDNA did not contain unwanted mutations.
[0175] The
sequence of template DNA was determined by using Rhodamine or
dRhodamine dye-terminator cycle sequencing ready reaction kits with AmpliTaq
DNA
polymerase FS (Perkin-Elmer Applied Biosystems, Inc,Foster City, CA). Samples
were
separated by electrophoresis and analyzed on PE/ABI model 373, model 373
Stretch, or
model 377 DNA sequencers.
-60-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/127.
[0176] In a separate experiment, viral RNA from influenza
B/Yamanshi/166/98
was amplified and cloned into pAD3000 as described above with respect to the
MDV-B
strain, with the exception that amplification was performed for 25 cycles at
94 C for 30
seconds, 54 C for 30 seconds and 72 C for 3 minutes. Identical primers were
used for
amplification of the B/Yamanashi/166/98 strain segments, with the substitution
of the
following primers for amplification of the NP and NA segments: MDV-B 5'BsmBI-
NP:
TATTCGTCTCAGGGAGCAGAAGCACAGCATTTTCTTGTG (SEQ ID NO:75) and MDV-B
nisinBI-NP:ATATCGTCTCGTATTAGTAGAAACAACAGCATTTTTTAC (SEQ ID NO:76)
and Bm-NAb-1: TATTCGTCTCAGGGAGCAGAAGCAGAGCA (SEQ ID NO:77) and Bm-
NAb-1557R:ATATCGTCTCGTATTAGTAGTAACAAGAGCATTTT (SEQ ID NO:78),
respectively. The B/Yamanashi/166/98 plasmids were designated pAB251-PB1,
pAB252-
PB2, pAB253-PA, pAB254-HA, pAB255-NP, pAB256-NA, pAB257-M, and pAB258-
NS. Three silent nucleotide differences were identified in PA facilitating
genotyping of
recombinant and reassortant B/Yamanashi/166/98 virus.
EXAMPLE 6: GENERATION OF INFECTIOUS RECOMBINANT INFLUENZA B
AND REASSORTED INFLUENZA VIRUS
[0177] To overcome the obstacles encountered in attempting to grow
influenza B
in a helper virus free cell culture system, the present invention provides
novel vectors and
protocols for the production of recombinant and reassortant B strain influenza
viruses.
The vector system used for the rescue of influenza B virus is based on that
developed for
the generation of influenza A virus (Hoffmann et al. (2000) A DNA transfection
system for
generation of influenza A virus from eight plasmids Proc Natl Acad Sci USA
97:6108-
6113; Hoffmann & Webster (2000) Unidirectional RNA polymerase I-polymerase ii
transcription system for the generation of influenza A virus from eight
plasmids J Gen
Virol 81:2843-7). 293T or COS-7 cells (primate cells with high transfection
efficiency and
poll activity) were co-cultured with MDCK cells (permissive for influenza
virus), 293T
cells were maintained in OptiMEM 1-AB medium containing 5% FBS cells, COS-7
cells
were maintained in DMEM 1-AB medium containing 10% FBS. MDCK cells were
maintained in lx MEM, 10 % FBS with the addition of antibiotic and antimycotic
agents.
Prior to transfection with the viral genome vectors, the cells were washed
once with 5 ml
PBS or medium without FBS. Ten ml trypsin-EDTA was added to confluent cells in
a 75
cm2 flask (MDCK cells were incubated for 20-45 min, 293T cells were incubated
for 1
-61-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12728 -
min). The cells were centrifuged, and resuspended in 10 ml OptiMEM 1-AB. One
ml of
each suspended cell line was then diluted into18 ml OptiMEM 1-AB, and mixed.
The cells
were then aliquoted into a 6 well plate at 3 nil/well. After 6-24 hours, 1 Ag
of each
plasmid was mixed in an 1.5 ml Eppendorf tube with OptiMEM 1-AB to the
plasmids ( x
Al plasmids + x al OptiMEM 1-AB + x I TransIT-LT1 = 200 Al); 2 Al TransIT-LT1
per
Ag of plasmid DNA. The mixture was incubated at room temperature for 45 min.
Then
800 Al of OptiMEM 1-AB was added. The medium was removed from the cells, and
the
transfection mixture was added to the cells (t = 0) at 33 C for 6-15 hours.
The
transfection mixture was slowly removed from the cells, and 1 ml of OptiMEM 1-
AB was
added, and the cells were incubated at 33 C for 24 hours. Forty-eight hours
following
transfection, 1 ml of OptiMEM 1-AB containing 1 TPCK-trypsin was added to
the
cells. At 96 hours post-transfection, 1 ml of OptiMEM 1-AB containing 1 jig/ml
TPCK-
trypsin was added to the cells.
[0178]
Between 4 days and 7 days following transfection 1 ml of the cell culture
supernatant was withdrawn and monitored by HA or plaque assay. Briefly, 1 ml
of
supernatant was aliquoted into an Eppendorf tube and centrifuge at 5000 rpm
for 5 mm.
Nine hundred Al of supernatant was transferred to a new tube, and serial
dilutions were
performed at 500 Al/well to MDCK cells (e.g., in 12 well plates). The
supernatant was
,
incubated with the cells for 1 hour then removed, and replaced with infection
medium
(1xMEM) containing lAg/m1 of TPCK-trypsin. HA assay or plaque assays were then
performed. For example, for the plaque assays supernatants were titrated on
MDCK cells
which were incubated with an 0.8% agarose overlay for three days at 33 C. For
infection
of eggs the supernatant of transfected cells were harvested six or seven days
after
transfection, 100 Al of the virus dilutions in Opti-MEM I were injected into
11 days old
embryonated chicken eggs at 33 C. The titer was determined three days after
inoculation
by TCID50 assay in MOCK cells.
[0179] To
generate MDV-B, either co-cultured 293T-MDCK or COS-7-MDCK
cells were transfected with 1 jig of each plasmid. When examined at 5 to 7
days post-
transfection the co-cultured MOCK cells showed cytopathic effects (CPE),
indicating the
generation of infectious MDV-B virus from cloned cDNA. No CPE was observed in
cells
transfected with seven plasmids (Table 14). To determine the efficiency of the
DNA
transfection system for virus generation, supernatants of cells were titrated
seven days
-62-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/12',
after transfection on MDCK cells and the virus titer was determined by plaque
assay. The
virus titer of the supernatant of co-cultured 293T-MDCK was 5.0 x 106 pfu/ml
and 7.6 x
106pfu/m1 in COS7-MDCK cells.
Table 14. Generation of infectious Influenza-B virus from eight plasmids
segment 1 2 3 4
PB1 pAB121-PB1 PAB121-PB1 ---
PB2 pAB122-PB2 pAB122-PB2 PAB122-PB2 pAB122-PB2
PA pAB 123-PA pAB123-PA pAB123-PA pAB123-PA
HA pAB124-HA pAB124-HA pAB124-HA pAB124-HA
NP pAB125-NP pAB125-NP pAB125-NP pAB125-NP
NA pAB 126-NA pAB 126-NA pAB126-NA pAB 126-NA
pAB127-M pAB127-M pAB127-M pAB127-M
NS pAB 128-NS pAB128-NS pAB128-NS pAB128-NS
co-cultured 293T-MDCK cells co-cultured COS-7-MDCK cells
CPE
pfu/m1 5.0 x 106
0 7.6x 106 0
[0180] Transiently co-cultured 293T-MDCK (1, 2) or co-cultured
COS7-MDCK
cells (3, 4) were transfected with seven or eight plasmids. Cytopathic effect
(CPE) was
monitored seven days after transfection in the co-cultured MDCK cells. Seven
days after
transfection the supernatants of transfected cells were titrated on MDCK
cells. The data of
pfu/ml represent the average of multiple, (e.g., three or' four) transfection
experiments.
[0181] Comparable results were obtained in transfection
experiments utilizing the
B/Yamanashi/166/98 plasmid vectors. These results show that the transfection
system
allows the reproducible de novo generation of influenza B virus from eight
plasmids.
Genotyping of recombinant Influenza B
[0182] After a subsequent passage on MDCK cells, RT-PCR of the supernatant
of
infected cells was used to confirm the authenticity of the generated virus. RT-
PCR was
performed with segment specific primers for all eight segments (Table 12). As
shown in
Figure 5A, PCR products were generated for all segments. Direct sequencing of
the PCR
= products of the PB1, HA, and NS segments revealed that the four
nucleotides analyzed
were the same as found in the plasmid pAB121-PB1, pAB124-HA, and pAB128-NS.
These results confirmed that the generated virus was generated from the
designed
-63-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12728
-
plasmids and exclude (in addition to the negative controls) any possible
laboratory
contamination with the parent virus (Figure 5B).
[0183] Similarly, following transfection with the B/Yamanashi/166/98
plasmid
vectors, virus was recovered and the region encompassing nucleotides 1280-1290
of the
PA segment were amplified. Sequencing confirmed that the recovered virus
corresponded
=
to the plasmid-derived recombinant B/Yamanashi/166/98 (Figures 5C and D).
Phenotyping of rMDV-B
[0184] The MDV-B virus shows two characteristic phenotypes:
temperature
sensitivity (ts) and cold adaptation (ca). By definition a 2 log (or higher)
difference in
virus titer at 37 C compared to 33 C defines ts, ca is defined by less than 2
log difference
in virus growth at 25 C compared to 33 C. Primary chicken kidney (PCK) cells
were
infected with the parent virus MDV-B and with the transfected virus derived
from
plasmids to determine the viral growth at three temperatures.
[0185] For plaque assay confluent MDCK cells (ECACC) in six well
plates were
used. Virus dilutions were incubated for 30-60 min. at 33 C. The cells were
overlayed
with an 0.8 % agarose overlay. Infected cells were incubated at 33 C or 37
C. Three days
after infection the cells were stained with 0.1% crystal violet solution and
the number of
plaques determined.
[0186] The ca-ts phenotype assay was performed by TOD50 titration of
the virus
samples at 25, 33, and 37 C. This assay format measures the TC1D50 titer by
examining
the cytopathic effect (CPE) of influenza virus on primary chick kidney cell
monolayers in
96-well cell culture plates at different temperatures (25 C, 33 C, 37 C).
This assay is not
dependent on the plaque morphology, which varies with temperature and virus
strains;
instead it is dependent solely on the ability of influenza virus to replicate
and cause CPE.
Primary chicken kidney (PCK) cell suspension, prepared by trypsinization of
the primary
tissue, were suspended in MEM (Earl's) medium containing 5% FCS. PCK cells
were
seeded in 96 well cell culture plates for 48 hours in order to prepare
monolayer with >90%
confluency. After 48hrs, the PCK cell monolayer were washed for one hour with
serum
free MEM medium containing 5mM L-Glutamine, antibiotics, non-essential amino
acid,
referred as Phenotype Assay Medium (PAM). Serial ten-fold dilution of the
virus samples
were prepared in 96 well blocks containing PAM. The diluted virus samples were
then
-64-

CA 02827114 2013-09-10
WO 03/091401
PCT/US03/127.
plated onto the washed PCK monolayer in the 96 well plates. At each dilution
of the virus
sample, replicates of six wells were used for infection with the diluted
virus. Un-infected
cells as cell control were included as replicate of 6 wells for each sample.
Each virus
= sample was titered in 2-4 replicates. Phenotype control virus with pre-
determined titers at
25 C, 33 C, and 37 C is included in each assay. In order to determine the ts
phenotype of
the virus samples, the plates were incubated for 6 days at 33 C and 37 C in
5% CO2 cell
culture incubators. For ca-phenotype characterization the plates were
incubated at 25 C
for 10 days. The virus titer was calculated by the Karber Method and reported
as Logo
Mean (n=4) TOD50Titer/ml + Standard Deviation. The standard deviations of the
virus
titers presented in Fig.1-3 ranged from 0.1 to 0.3. The difference in virus
titer at 33 C and
37 C were used to determine the ts phenotype and difference in titer at 25 C
and 33 C of
the virus were used to determine the ca phenotype.
[0187] The plasmid derived recombinant MDV-B (recMDV-B) virus
expressed
the two characteristic phenotypes in cell culture, ca and ts, as expected. The
ca phenotype,
efficient replication at 25 C, is functionally measured as a differential in
titer between 25
C and 33 C of less than or equal to 2 log10 when assayed on PCK cells. Both
the
parental MDV-I3 and recMDV-B expressed ca; the difference between 25 C and 33
C
was 0.3 and 0.4 log10, respectively (Table 15). The ts phenotype is also
measured by
observing the titers at two different temperatures on PCK cells; for this
phenotype,
however, the titer at 37 C should be less than the titer at 33 C by 2 log10
or more. The
difference between 33 C and 37 C for the parental MDV-B and recMDV-B was 3.4
and
3.7 log10, respectively (Table 15). Thus, the recombinant plasmid-derived MDV-
B virus
expressed both the ca and ts phenotypes.
[0188] The recombinant virus had a titer of 7.0 logo
TCID50/m1 at 33 C and 3.3
TCID50/m1 at 37 C and 8.8 logo TOD50/m1 at 25 C (Table 15). Thus, the
recombinant
virus derived from transfection with the eight influenza MDV-B genome segment
plasmids has both the ca and ts phenotype.
-65-

CA 02827114 2013-09-10
WO 03/091401 PCIIUS03/12728
Table 15. Phenotype assay for MDV-B and rMDV-B zenerated from plasmids
Temperature (0C) Phenotype
25 33 37
Virus
Log10 TCID50/m1 (Mean + SD)
ca B/Ann Arbor/01/66 (MDV-B) 8.8 + 0.3 8.5 + 0.05 5.1 + 0.1 ca, ts
RecMDV-B 7.4 + 0.3 7.0 + 0.13 3.3 + 0.12 ca, ts
Rec53-MDV-B 5.9 + 0.1 5.7 + 0.0 5.3 + 0.1
ca, non-ts
Primary chicken kidney cells were infected with the parent virus MDV-B and the
plasmid-
derived recombinant virus (recMDV-B). The virus titer was determined at three
different
temperatures.
EXAMPLE 7: PRODUCTION OF REASSORTANT B/YAMANASHI/166/98 VIRUS
[0189] The HA and NA segments of several different strains
representing the
major lineages of influenza B were amplified and cloned into pAD3000,
essentially as
described above. The primers were optimized for simultaneous RT-PCR
amplification of
the HA and NA segments. Comparison of the terminal regions of the vRNA
representing
the non coding region of segment 4 (HA) and segment 6 (NB/NA) revealed that
the 20
terminal nucleotides at the 5' end and 15 nucleotides at the 3'end were
identical between
the HA and NA genes of influenza B viruses. A primer pair for RT-PCR
(underlined
sequences are influenza B virus specific) Bm-NAb-1: AT TCG TCT CAG GGA GCA
GAA GCA GAG CA (SEQ ID NO:79); Bm-NAb-1557R: ATA TCG TCT CGT AU
AGT AGT AAC AAG AGC ATT U (SEQ ID NO:80) was synthesized and used to
simultaneously amplify the HA and NA genes from various influenza B strains
(Fig. 8).
The HA and NA PCR-fragments of B/Victoria/504/2000, B/Hawaii/10/2001, and
B/Hong
Kong/330/2001 were isolated, digested with BsmBI and inserted into pAD3000.
These
results demonstrated the applicability of these primers for the efficient
generation of
plasmids containing the influenza B HA and NA genes from several different
wild type
viruses representing the major lineages of influenza B..The RT-PCR 'products
can be used
for sequencing and/or cloning into the expression plasmids.
[0190] In order to demonstrate the utility of B/Yamanashi/166/98 (a -
B/Yamagata/16/88-like virus) to efficiently express antigens from various
influenza B
lineages, reassortants containing PB1, PB2, PA, NP, M, NS from
B/Yamanashi/166/98
and the HA and NA from strains representing both the Victoria and Yamagata
lineages (6
-66-

CA 02827114 2013-09-10
WO 03/091401 PCT/1JS03/127.
+2 reassortants) were generated. Transiently cocultured COS7-MDCK cells were
cotransfected with six plasmids representing B/Yamanashi/166/98 and two
plasmids
containing the cDNA of the HA and NA segments of two strains from the
B/Victoria/2/87
lineage, B/Hong Kong/330/2001 and B/Hawaii/10/2001, and one strain from the
B/Yamagata/16/88 lineage, B/Victoria/504/2000, according to the methods
described
above.. Six to seven days after transfection the supernatants were titrated on
fresh MDCK
cells. All three 6+2 reassortant viruses had titers between 4¨ 9 x 106 pfu/ml
(Table 16).
These data demonstrated that the six internal genes of B/Yamanashi/166/98
could
efficiently form infectious virus with HA and NA gene segments from both
influenza B
lineages.
[0191] Supernatants of cocultured COS7-MDCK cells were titrated six
or seven
days after transfection and the viral titer determined by plaque assays on
MDCK cells.
Table 16:Plasmid set used for the generation of B/Yamanashi/166/98 and 6 + 2
reassortants.
segment
1 pAB251-PB1 pAB251-PB1 pAB251-PB1 pAB251-PB1
2 pAB252-PB 2 pAB 252-PB 2 pAB252-PB 2 pAB 252-PB 2 pAB252-
,PB2
3 pAB253-PA pAB253-PA pAB253-PA pAB253-PA pAB 253-PA
4 pAB 254-HA pAB 254-HA pAB281-11A pAB285-HA pAB287-HA
5 pAB255-NP pAB255-NP pAB255-NP 4 ' pAB255-NP pAB255-NP
6 pAB256-NA pAB256-NA pAB291-NA pAB295-NA pAB297-NA
7 pAB257-M pAB257-M pAB257-M pAB257-M pAB 257-M
8 pAB258-NA pAB 258-NA pAB258-NA pAB258-NA pAB258-NA
Recombinant virus 8 6 + 2 6 + 2 6+ 2
B/Yamanashi/ B/VictoriaJ504/ &Hawaii/10/2001 B/Hong
166/98 2000
Kong/330/2001
pfu/m1 a 0 4 x 106 9 x 106 6 x 106 7 x 106
[0192] Relatively high titers are obtained by replication of wild
type
B/Yamanashi/166/98 in eggs. Experiments were performed to determine whether
this
property was an inherent phenotype of the six "internal" genes of this virus.
To evaluate
this property, the yield of wild type B/Victoria/504/2000, which replicated
only
moderately in eggs, was compared to the yield of the 6+2 reassortant
expressing the
B/Victoria/504/2000 HA and NA. These viruses in addition to wild type and
recombinant
B/Yamanashi/166/98 were each inoculated into 3 or 4 embryonated chicken eggs,
at either
100 or 1000 pfu. Three days following infection, the allantoic fluids were
harvested from
-67-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272B
-
the eggs and the TCID50 titers determined on MDCK cells. The 6+2 reassortants
produced
similar quantities of virus in the allantoic fluid to the wt and recombinant
B/Yamanashi/166/98 strain (Fig. 9). The difference in titer between
BNictoria/504/2000
and the 6+2 recombinant was approximately 1.6 logo Taps (0.7-2.5 log10
TCID50/mL,
95% CI). The difference between B/Victoria/504/2000 and the 6+2 recombinant
were
confirmed on three separate experiments (P <0.001). These results demonstrated
that the
egg growth properties of B/Yamanashi/166/98 could be conferred to HA and NA
antigens
that are normally expressed from strains that replicated poorly in eggs.
EXAMPLE 8: MOLECULAR BASIS FOR ATTENUATION OF CA B/ANN
ARBOR/1/66
[0193] The MDV-B virus (ca B/Ann Arbor/1/66) is attenuated in humans,
shows
an attenuated phenotype in ferrets and shows a cold adapted and temperature
sensitive
phenotype in cell culture. The deduced amino acid sequences of the internal
genes of
MDV-B were compared with sequences in the Los Alamos influenza database (on
the
world wide web at: fludanl.gov) using the BLAST search algorithm. Eight amino
acids
unique to MDV-B, and not present in any other strain were identified (Table
17). Genome
segments encoding PB1, BM2, NS1, and NS2 show no unique substituted residues.
the
PA and M1 proteins each have two, and the NP protein.has four unique
substituted amino
acids (Table 17). One substituted amino acid is found in PB2 at position 630
(an
additional strain B/Harbin/7/94 (AF170572) also has an arginine residue at
position 630).
[0194] These results suggested that the, gene segments PB2, PA, NP
and M1 may
be involved in the attenuated phenotype of MDV-B. In a manner analogous to
that
described above for MDV-A, the eight plasmid system can be utilized to
generate
recombinant and reassortant (single and/or double, i.e., 7:1; 6:2
reassortants) in a helper
independent manner simply by co-transfection of the relevant plasmids into
cultured cells
as described above with respect to MDV-A. For example, the 6 internal genes
from
B/Lee/40 can be used in conjunction with HA and NA segments derived from MDV-B
to
generate 6 + 2 reassortants.
-68-

CA 02827114 2013-09-10
Table 17. Unique substituted amino acids of B/Ann Arbor/1/66
Nr. ca B/Ann Aligned sequences Number of
Arbor/1/66 (wild type viruses) aligned
sequences
pos. amino codon amino codon
acid acid
PB1 0 23
PB2 1 630 Arg630 AGA Ser630 AG C 23
PA 2 431 Met431 ATG Va1431 GTG 23
497 H1s497 CAT Tyr497 TAT
NP 4 55 A1a55 GCC Thr55 ACC 26
114 Ala114 GCG Va1114 GTG
410 His410 CAT Pro410 CCT, CCC
510 Thr510 GAC A1a510 GGC
M1 2 159 G1n159 CAA His159 CAT 24
183 Va1183 GTG M183 ATG
BM2 0 24
NS1 0 80
NS2 0 80
The deduced amino acid sequence of eight proteins of ca B/Ann Arbor was used
in a
BLAST search. Amino acid position which were different between MDV-B and the
aligned sequences are shown. The nucleotides in the codons that are underlined
represent
the substituted positions.
[0195] In order to determine whether the 8 unique amino acid
differences had any
impact on the characteristic MDV-B phenotypes, a recombinant virus was
constructed in
which all eight nucleotide positions encoded the amino acid reflecting the wt
influenza
genetic complement. A set of plasmids was constructed in which the eight
residues of the
PA, NP, and M1 genes were changed by site directed mutagenesis to reflect the
wild type
amino acids (as indicated in Table 17). A recombinant with all eight changes,
designated
rec53-MDV-B, was generated by cotransfection of the constructed plasmids onto
cocultured COS7-MDCK cells. The coculturing of MDCK cells and growth at 33 C
ensured that the supernatant contained high virus titers six to seven days
after transfection.
The supernatants of the transfected cells were titrated and the titer
determined on MDCK
cells by plaque assay and PCK cells at 33 C and 37 C.
[0196] As shown in Fig. 13, in two different independent experiments,
recMDV-B
expressed the ts-phenotype in both MDCK cells and PCK cells. The triple
reassortant
virus rec53-MDV-B designed harboring all eight amino acid changes expressed
the non-
ts-phenotype, the difference in titer between 33 C and 37 C was only 0.7
logio in PCK
-69-

CA 02827114 2013-09-10
WO 03/091401 PCT/IJS03/1272b
-
cells. This titer was less than the required 2 logo difference characteristic
of the ts
definition and significantly lower than the ¨3 logo difference observed with
recMDV-B.
These results show that the alteration of the eight amino acids within PA, NP,
and MI
proteins was sufficient to generate a non-ts, wild type-like virus with both
homologous
and heterologous glycoproteins.
[0197] The contribution of each gene segment to the ts phenotype was
then
determined. Plasmid derived recombinants harboring either the PA, NP, or M
gene
segment with the wild-type amino acid complement were generated by the DNA
cotransfection technique. All single gene recombinants exhibited growth
restriction at 37
C in MDCK cells and in PCK cells (Fig. 14), indicating that changes in no one
gene
segment were capable of reverting the ts phenotype. In addition, recombinant
viruses that
carried both the NP and M or PA and M gene segments together also retained the
ts-
phenotype. In contrast, recombinant viruses that harbored both the PA and NP
gene
segments had a difference in titer between 37 C and 33 C of 2.0 logio or
less, similar to
the rec53-MDV-B. These results show that the NP and PA genes have a major
contribution to the ts-phenotype.
[0198] To determine whether all of the four amino acids in the NP
protein and two
in the PA protein contribute to non-ts, triple gene and dpuble-gene
recombinants with
altered NP and PA genes were generated (Fig. 15). The substitution of two
amino acids
A114 V114 and 11410 P410 resulted in non-ts phenotype. Viruses with single
substitution H410 --> P410 in the nucleoprotein showed non-ts phenotype in
MDCK and
PCK. On the other hand, the single substitution A55 T55 showed a ts-phenotype.
These
results indicate that the P410 in NP is involved in efficient growth at 37 C.
These results
show that from the six amino acids of PA and NP four residues contribute to
the non-ts
phenotype.
[0199] Based on prior evidence, a ts-phenotype and an attenuated
phenotype are
highly correlated. It is well established that ca B/Ann Arbor/I/66 virus is
not detectable in
lung tissue of infected ferrets, whereas non attenuated influenza B viruses
viruses are =
detectable in lungs after intranasal infection. To determine whether identical
mutation
underlie the ts and att phenotypes, the following studies were performed.
-70-

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272
[0200] Recombinant viruses obtained after transfection were
passaged in
embryonated chicken eggs to produce a virus stock. Nine week old ferrets were
inoculated
intranasaly with 0.5 ml per nostril of viruses with titers of 5.5, 6.0 or 7.0
loglo pfu/ml.
Three days after infection ferrets were sacrificed and their lungs and
turbinates were
examined as described previously.
[0201] Ferrets (four animals in each group) were infected
intranasaly with
reclVIDV-B or rec53-MDV-B. Three days after infection virus nasal turbinates
and lung
tissue were harvested and the existence of virus was tested. No virus was
detected in lung
tissues of ferrets infected with 7.0 logo pfu recMDV-B. From the four animals
infected
with rec53-MDV-B virus with 7.0 logo pfu in three animals virus was detected
in lung
tissue (one animal in this group for unknown reasons). In two out of four lung
tissues of
= .
= -ferrets infected with rec53-:MDV-B at a jower dose (5.5 log pfu/ml)
virus could be isolated
= - -
from lung tissue. Thus, the change of the eight unique amino acids in PA, NP,
and M1
protein into wild type residues were sufficient to convert a att phenotype
into a non-att
phenotype.
[0202] Since the data in cell culture showed that PA and NP are
main contributors
to the ts-phenotype, in a second experiment, ferrets were infected with rec53-
MDV-B.
(PA,NP,M), rec62-IVIDV-B (PA), NP rec71-MDV-B (NP) with 6 log pfu. Two out of
four
animals infected with rec53-MDV-B had virus in the king. None of the lung
tissues of
ferrets infected with single and double reassortant viruses had detectable
levels of virus.
Thus, in addition to the amino acids in the PA and NP proteins, the M1 protein
is
important for the att phenotype. Virus with wt PA and NP did not replicate in
ferret lung,
indicating that a subset of the mutations involved in attenuation are involved
in the ts
phenotype.
[0203] Thus, the ts-phenotype of B/Ann Arbor/1/66 is determined by at
most three
genes. The conversion of eight amino acids in the PA, NP, and M1 protein into
wild type
residues resulted in a recombinant virus that replicated efficiently at 37 C.
Similarly, a
6+2 recombinant virus representing the six internal genes of MDV-B with the HA
and NA
segments from B/HongKong/330/01 showed a ts-phenotype and the triple
recombinant
was non-ts.
-71-
=

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/12726
[0204] As described above with respect to influenza A strains,
substitution of the
residues indicated above, e.g., PB263 (S630R); PA431 (V431M); PA497 (Y497H);
NP55
(T55A); NP114 (V114A); NP410 (P410H);
NP51 (A510T); M1159 (H159Q) and M1183
(M183V), confers the ts and att phenotypes. Accordingly, artificially
engineered variants
of influenza B strain virus having one or more of these amino acid
substitutions exhibit the
ts and att phenotypes and are suitable for use, e.g., as master donor strain
viruses, in the
production of attenuated live influenza virus vaccines.
EXAMPLE 9: RESCUE OF INFLUENZA FROM EIGHT PLASMIDS BY
ELECTROPORATION OF VERO CELLS
[0205] Previously it has been suggested that recombinant influenza A can be
rescued from Vero cells (Fodor et al. (1999) Rescue of influenza A virus from
recombinant
DNA J. Virol. 73:9679-82; Hoffmann et al. (2002) Eight -plasmid system for
rapid
generation of influenza virus vaccine Vaccine 20:3165-3170). The reported
method
requires the use of lipid reagents and has only been documented for a single
strain of a
highly replication competent laboratory strains of influenza A (A/WSN/33 and
A/PR/8/34), making it of limited application in the production of live
attenuated virus
suitable for vaccine production. The present invention provides a novel method
for
recovering recombinant influenza virus from Vero cells using electroporation.
These
methods are suitable for the production of both influenza A and influenza B
strain viruses,
and permit the recovery of, e.g., cold adapted, temperature sensitive,
attenuated virus from
Vero cells grown under serum free conditions facilitating the preparation of
live attenuated
vaccine suitable for administration in, e.g., intranasal vaccine formulations.
In addition to
its broad applicability across virus strains, electroporation requires no
additional reagents
other than growth medium for the cell substrate and thus has less potential
for undesired
contaminants. In particular, this method is effective for generating
recombinant and
reassortant virus using Vero cells adapted to growth under serum free
condition, such as
Vero cell isolates qualified as pathogen free and suitable for vaccine
production. This
characteristic supports the choice of electroporation as an appropriate method
for
commercial introduction of DNA into cell substrates.
[0206] Electroporation was compared to a variety of methods for
introduction of
DNA into Vero cells, including transfection using numerous lipid based
reagents, calcium
-72-

CA 02827114 2013-09-10
phosphate precipitation and cell microinjection. Although some success was
obtained
using lipid based reagents for the rescue of influenza A, only electroporation
was
demonstrated to rescue influenza B as well as influenza A from Vero cells.
[0207]
One day prior to electroporation, 90 - 100% confluent Vero cells were split,
and seeded at a density of 9 x 106 cells per T225 flask in MEM supplemented
with
pen/strep, L-glutamine, nonessential amino acids and 10% FBS (MEM, 10% FBS).
The
following day, the cells were trypsinized and resuspend in 50 ml phosphate
buffered saline
(PBS) per T225 flask. The cells are then pelleted and resuspend in 0.5 ml
OptiMEM I'm per
T225 flask. Optionally, customized OptiMEMTm medium containing no human or
animal-
derived components can be employed. Following determination of cell density,
e.g., by
counting a 1:40 dilution in a hemocytometer, 5 x 106 cells were added to a 0.4
cm
electroporation cuvette in a final volume of 400 pl OptiMEM I. Twenty g DNA
consisting of an equimolar mixture of eight plasmids incorporating either the
MDV-A or
MDV-B genome in a volume of no more than 25 I was then added to the cells in
the
cuvette. The cells were mixed gently by tapping and electroporated at 300
volts, 950
microFarads in a BioRad Gene Pulser J1TM with Capacitance Extender PlusTM
connected
(BioRad, Hercules, CA). The time constant should be in the range of 28 ¨ 33
msec.
[0208]
The contents of the cuvette were mixed gently by tapping and 1-2 min after
= electroporation, 0.7m1 MEM, 10% FBS was added with a 1 ml pipet. The
cells were again
mixed gently by pipetting up and down a few times and then split between two
wells of a
6 well dish containing 2 ml per well MEM, 10% FBS. The cuvette was then washed
with I
ml MEM, 10% FBS and split between the two wells for a final volume of
approximately
3.5 ml per well.
[0209] In alternative experiments, Vero cells adapted to serum
free growth
conditions, e.g., in OptiproTM (SFM)(Invitrogen, Carlsbad, CA) were
electroporated as
described above except that following electroporation iiOptIMEM I, the cells
were
diluted in OptiPro (SFM) in which they were subsequently cultured for rescue
of virus.
[0210]
The electroporated cells were then grown under conditions appropriate for
replication and recovery of the introduced virus,
at 33 C for the cold adapted Master
Donor Strains. The following day (e.g., approximately 19 hours after
electroporation), the
medium was removed, and the cells were washed with 3 ml per well OptiMEM I or
-73-.

CA 02827114 2013-09-10
WO 03/091401 PCT/US03/1272h
-
OptiPro (SFM). One ml per well OptiMEM I or OptiPro (SFM) containing pen/strep
was
added to each well, and the supemdtants were collected daily by replacing the
media.
Supernatants were stored at - 80 C in SPG. Peak virus production was
typically
observed between 2 and 3 days following electroporation.
Table 18: Results of 8 Plasmid Rescue of MDV strains on Different Cell Types
and by
Different Transfection Methods
Substrate Method No of Test
Result (Infectious Virus Recovered)
MDV-B
COS-7/MDCK Lipo 3 positive
COS-7/MDCK CaPO4 2 positive
MRC-5 Lipo 5 negative
MRC-5 CaPO4 3 negative
MRC-5 Electroporation 2 negative
W1-38 Lipo 2 negative
W1-38 Electroporation 4 negative
W1-38 Microinjection 1 negative
LF1043 Lipo 1 negative
LF1043 CaPO4 2 negative
Vero Lipo 7 negative
Vero CaPO4 2 negative
Vero/MDCK Lipo 1 negative
Vero (serum) Electroporation 5 positive (5/5)
Vero (serum free) Electroporation 4 positive (4/4)
MDV-A
Vero (serum) Electroporation 3 4õ' positive (3/3)
Vero (serum Free) Electroporation 3 positive (3/3)
EXAMPLE 10: INFLUENZA VIRUS VECTOR SYSTEM FOR GENE DELIVERY
[0211] The vectors
of the present invention can also be used as gene delivery
systems and for gene therapy. For such applications, it is desirable to
generate
recombinant influenza virus, e.g., recombinant influenza A or B virus
expressing a foreign
protein. For example, because segment 7 of the influenza B virus is not
spliced, it
provides a convenient genetic element for the insertion of heterologous
nucleic acid
sequences. The mRNA contains two cistrons with two open reading frames
encoding the
M1 and BM2 proteins. The open reading frame of BM2 or M1 is substituted by the
heterologous sequence of interest, e.g., a gene encoding the enhanced green
fluorescent
protein (EGFP). Using the plasmid based vector system of the present
invention, the
cDNA encoding the open reading frame of Ml-EGFP and BM2 are cloned on two
different plasmids. The open reading frame is flanked by the non coding region
of
segment 7, which contains the signals required for replication and
transcription.
-74-

CA 02827114 2013-09-10
Alternatively, two plasmids are constructed: one containing M1 ORF and the
other
containing EGFP-BM2. Co-transfection of the resultant nine plasmids results in
the
generation of a recombinant influenza B virus containing the heterologous gene
sequence.
Similarly, EGFP can be expressed from the NS1 segment of influenza A.
[0212] The exemplary "green" influenza B virus can be used for
standardization in
virus assays, such as micro neutralization assays. The combination of the
plasmid based
technology and the simple detection of protein expression (fluorescence
derived from
EGFP can be monitored by microscopy, as illustrated in Figure 2), permits the
optimization of protein expression.
[0213] While the foregoing invention has been described in some detail for
purposes of clarity and understanding, it will be clear to one skilled in the
art from a
reading of this disclosure that various changes in form and detail can be made
without
departing from the true scope of the invention. For example, all the
techniques and
apparatus described above may be used in various combinations.
4.`
-75-

CA 02827114 2013-09-10
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEM,AND E OU CE BREVETS
CONIPREND PLUS D'UN TOLVIE.
CECI EST LE TOME _____________________ DE ____
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME I OF
NOTE: For additional volumes please contact the Canadian Patent Office.

Dessin représentatif