Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
1
Improved Methods of Nucleic Acid Sequencing
The present application claims priority to United States Provisional patent
application serial no. 61/607,418 filed March 6, 2012.
BACKGROUND
Sequencing techniques for sequencing nucleic acids including RNA have been
developed. Sequencing techniques include, for example, sequencing-by-
synthesis.
Sequencing-by-synthesis or cycle sequencing can be accomplished by stepwise
addition
of nucleotides containing, for example, a cleavable or photobleachable dye
label as
described, for example, in U.S. Patent No. 7,427,673; U.S. Patent No.
7,414,116; WO
04/018497; WO 91/06678; WO 07/123744; and U.S. Patent No. 7,057,026.
Alternatively, pyrosequencing techniques may be employed. Pyrosequencing
detects the
release of inorganic pyrophosphate (PPi) as particular nucleotides are
incorporated into
the nascent strand (Ronaghi et al., (1996) "Real-time DNA sequencing using
detection of
pyrophosphate release." Analytical Biochemistry 242(1), 84-9; Ronaghi, M.
(2001)
"Pyrosequeneing sheds light on DNA sequencing." Genome Res. 11(1), 3-1 1 ;
Ronaghi,
M., Uhlen, M. and Nyren, P. (1998) "A sequencing method based on real-time
pyrophosphate." Science 281(5375), 363; U.S. Patent No. 6,210,891; U.S. Patent
No.
6,258,568; and U.S. Patent No. 6,274,320). In pyrosequencing, released PPi can
be
detected by being immediately converted to adenosine triphosphate (ATP) by ATP
sulfurylase, and the level of ATP generated is detected via luciferase-
produced photons.
Sequencing techniques also include sequencing by ligation techniques. Such
techniques use DNA ligase to incorporate oligonucleotides and identify the
incorporation
of such oligonucleotides and are described in U.S. Patent No 6,969,488; U.S.
Patent No.
6,172,218; and U.S. Patent No. 6,306,597. Other sequencing techniques include,
for
example,
CA 2864276 2019-04-16
2
fluorescent in situ sequencing (FISSEQ), and Massively Parallel Signature
Sequencing
(MPSS).
Preparation of DNA samples for sequencing can be relatively straightforward
and
include using transposition reactions to fragment and add adaptor sequences to
the DNA
fragments, which simplifies the sample preparation process. See, e.g.,
International
Publication No. WO 2010/048605. By contrast, current protocols for sequencing
RNA
samples employ a sample preparation method that converts the RNA in the sample
into a
double-stranded cDNA format prior to sequencing. Thus, preparation of RNA
samples
for sequencing is more labor intensive. In addition, current protocols arc
less than
optimal in their ability to preserve strand-specific information. More
specifically, most
methods are not able to preserve strand information about the direction of the
original
single-stranded RNA molecule after being converted into double stranded cDNA.
Preserving strand-specific information is important for annotation of new
genes and for
determining gene expression levels. Some methods attempt to preserve strand
specific
information by ligating adaptors to the ends of single-stranded RNA molecules.
The
adaptors can have sequences that provide distinguishable information for both
ends of the
double stranded cDNA generated from the RNA molecules. However, this method
has
disadvantages. For example, if the RNA molecules are fragmented, after
fragmentation
the internal parts of the molecules lose their directional (i.e., strand
specific) information.
SUMMARY
Provided herein is a method of tagging DNA:RNA duplexes. The method
includes the steps of providing a transposase and a transposon composition,
providing
one or more DNA:RNA duplexes immobilized on a support, and contacting the
transposase and transposon composition with the one or more DNA:RNA duplexes
under
conditions wherein the one or more DNA:RNA duplexes and transposon
compositions
undergo a transposition reaction to produce one or more tagged DNA:RNA
duplexes,
wherein the transposon composition comprises a double stranded nucleic acid
molecule
comprising a transferred strand and a non-transferred strand. The method can
also be
performed for tagging DNA:DNA duplexes that are immobilized on a solid
support.
CA 2864276 2019-04-16
2a
Various embodiments provided herein relate to a method of tagging nucleic acid
duplexes comprising the steps of: (a) providing a transposase and a transposon
composition; (b) providing one or more nucleic acid duplexes immobilized on a
support;
and (c) contacting the transposase and transposon composition with the one or
more
nucleic acid duplexes under conditions wherein the one or more nucleic acid
duplexes
and transposon composition undergo a transposition reaction to produce one or
more
tagged nucleic acid duplexes, wherein the transposon composition comprises a
double
stranded nucleic acid molecule comprising a transferred strand and a non-
transferred
strand.
Various embodiments provided herein relate to a method of tagging nucleic acid
duplexes comprising the steps of: (a) providing a transposase and a transposon
composition; (b) providing one or more nucleic acid duplexes immobilized on a
support,
wherein the support comprises a plurality of immobilized primers comprising a
first
subset of primers comprising a polyT sequence and a second subset of primers
comprising a second sequence; and (c) contacting the transposase and
transposon
composition with the one or more nucleic acid duplexes under conditions
wherein the one
or more nucleic acid duplexes and transposon composition undergo a
transposition
reaction to produce one or more tagged nucleic acid duplexes, wherein the
transposon
composition comprises a double stranded nucleic acid molecule comprising a
transferred
strand and a non-transferred strand.
Various embodiments provided herein relate to a method of tagging nucleic acid
duplexes comprising the steps of: (a) providing a transposase and a transposon
composition; (b) providing one or more nucleic acid duplexes immobilized on a
support,
wherein the support comprises a plurality of immobilized primers wherein the
one or
more nucleic acid duplexes comprises one or more DNA:RNA duplexes having an
RNA
strand or one or more DNA:DNA duplexes having a DNA strand, wherein the RNA
strand or the DNA strand comprises a sequence complementary to at least a
portion of
one or more of the immobilized primers and wherein the immobilized primers
comprise a
polyT sequence; and (c) contacting the transposase and transposon composition
with the
one or more nucleic acid duplexes under conditions wherein the one or more
nucleic acid
CA 2864276 2019-04-16
2b
duplexes and transposon composition undergo a transposition reaction to
produce one or
more tagged nucleic acid duplexes, wherein the transposon composition
comprises a
double stranded nucleic acid molecule comprising a transferred strand and a
non-
transferred strand.
Various embodiments provided herein relate to a method of detecting one or
more
target nucleic acids comprising the steps of: (a) capturing one or more target
nucleic acids
on a support; (b) using the one or more captured target nucleic acids as a
template strand
to produce one or more nucleic acid duplexes immobilized on the support; (c)
contacting
a transposase and transposon with the one or more nucleic acid duplexes under
conditions
wherein the one or more nucleic acid duplexes and transposon composition
undergo a
transposition reaction to produce one or more tagged nucleic acid duplexes,
wherein the
transposon composition comprises a double stranded nucleic acid molecule
comprising a
transferred strand and a non-transferred strand; (d) contacting the one or
more tagged
nucleic acid duplexes with a nucleic acid modifying enzyme under conditions to
extend
the 3' end of the immobilized strand to the 5' end of the template strand to
produce one or
more end-extended tagged nucleic acid duplexes; (e) amplifying the one or more
end-
extended tagged nucleic acid duplexes to produce a plurality of tagged nucleic
acid
strands; and (1) detecting the plurality of tagged nucleic acid strands.
Various embodiments provided herein relate to a method of detecting one or
more
target nucleic acids comprising the steps of: (a) capturing the one or more
target nucleic
acids on a support by hybridizing a 3' adaptor of the one or more target
nucleic acids to a
plurality of primers or a subset thereof, wherein the primers are immobilized
on a
support; (b) using the one or more captured target nucleic acids as a template
strand to
produce one or more nucleic acid duplexes immobilized on the support; (c)
contacting a
transposase and transposon with the one or more nucleic acid duplexes under
conditions
wherein the one or more nucleic acid duplexes and transposon composition
undergo a
transposition reaction to produce one or more tagged nucleic acid duplexes,
wherein the
transposon composition comprises a double stranded nucleic acid molecule
comprising a
transferred strand and a non-transferred strand; (d) contacting the one or
more tagged
nucleic acid duplexes with a nucleic acid modifying enzyme under conditions to
extend
CA 2864276 2019-04-16
2c
the 3' end of the immobilized strand to the 5 end of the template strand to
produce one or
more end-extended tagged nucleic acid duplexes; (e) amplifying the one or more
end-
extended tagged nucleic acid duplexes to produce a plurality of tagged nucleic
acid
strands; and (f) detecting the plurality of tagged nucleic acid strands.
Various embodiments provided herein relate to a method of detecting one or
more
target nucleic acids comprising the steps of: (a) providing one or more target
nucleic
acids; (b) capturing the one or more target nucleic acids on a support, the
support
comprising a plurality of immobilized nucleic acids each having a sequence
complementary to at least a portion of the one or more target nucleic acids;
(c) using the
one or more captured target nucleic acids as a template strand to produce one
or more
nucleic acid duplexes immobilized on the support; (d) tagging the one or more
nucleic
acid duplexes via a transposition reaction to produce tagged nucleic acid
duplexes; (e)
amplifying the one or more tagged nucleic acid duplexes to produce a plurality
of tagged
nucleic acid strands; and (f) detecting the plurality of tagged nucleic acid
strands.
CA 2864276 2019-04-16
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
3
The details of one or more embodiments are set forth in the accompanying
drawings and the description below. Other features, objects, and advantages
will be
apparent from the description and drawings, and from the claims.
DESCRIPTION OF DRAWINGS
Figure 1 is a schematic showing an exemplary method provided herein. PolyA
tailed mRNA is captured on a support via hybridization to a polyT DNA capture
probe or
primer coupled to the surface of a support. The polyT strand is next extended
with a
reverse transcriptase polymerase to make a double stranded molecule comprising
a
DNA:RNA duplex. Next, a transposome complex (e.g., Tn5 transposase bound with
a
mosaic end (ME) sequence and sequences complementary to surface amplification
primers) is added to the support, which undergoes a transposition reaction
with and
tagments the duplex, ligating a DNA adaptor oligo to the 5' end of the RNA
strand. A
strand displacing polymerase (e.g., Bst polymerase) can then be used to extend
the 3' end
of the DNA strand, displacing the non-transferred strand of the transposome
complex and
copying the RNA strand to its 5' DNA chimeric end. The double-stranded
molecule can
then be amplified (e.g., cluster amplification) and sequenced with a
sequencing primer.
The primer partially comprises the ME sequence and the upstream adaptor
sequence.
Alternatively, the other end of the molecule (the polyT end) can be sequenced
with a
primer that anneals upstream of the polyT sequence and is extended with
natural dATP
nucleotides before commencing cycles of sequence by synthesis (SBS) chemistry.
Figure 2 is a schematic showing an exemplary method provided herein. RNA is
fragmented and treated with a phosphatase. A single stranded adaptor molecule
is ligated
to the 3'end of each RNA fragment comprising the complement of a surface bound
primer. The fragments are then added to a support and captured via
hybridization. The
hybridized RNA molecules are converted to a DNA:RNA duplex with a reverse
transcriptase polymerase. A transposome complex or composition comprising a
transposase and an adaptor duplex (i.e., transposon) of an ME with P5 is used
to tagment
the duplex. Following extension of the DNA strand to the end with a strand
displacing
polymerase, the molecules can be amplified (e.g., cluster amplification) and
sequenced.
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
4
Figure 3 is a schematic showing an exemplary method provided herein. A
support is used that contains two surface grafted primers: a standard grafting
primer (e.g.,
P5) and a modified grafting primer (e.g., P7) that has a target specific
capture sequence to
its downstream (3') side. An example of a target specific sequence is an oligo
sequence
complementary to a retroviral reverse transcriptase (e.g., HIV polymerase).
Purified viral
RNA is added to the support, captured via hybridization, copied with reverse
transcriptase and tagmented. Sequencing can be achieved with a primer annealed
to the
tagmented adaptor or at the other end to the capture probe.
Figure 4 is a schematic showing an exemplary method provided herein. RNA
transcripts are generated from a plasmid containing green fluorescent protein
(GFP)
transcript sequence and a sequence complementary to a surface bound primer
(e.g., P7'
sequence). The transcripts are hybridized to a support comprising primers
comprising,
for example, a P7 sequence. The hybridized RNA molecules are converted to a
DNA:RNA duplex with a reverse transcriptase polymerase. A transposome complex
is
used to tagment the duplex. Following extension of the DNA strand to the end
with a
strand displacing polymerase and removal of the RNA strand, the molecules can
be
amplified (e.g., cluster amplification) and sequenced.
Figure 5 is a picture of a gel showing RNA transcripts generated from a
plasmid
containing Green Fluorescent Protein (GFP) and, optionally, treated with DNase
to
remove the DNA (i.e., plasmid). No residual DNA (i.e., plasmid) was visible
following
DNase treatment of the RNA transcript.
Figure 6 shows pictures of clusters stained with SYBR green. Lanes 1-4
contained PhiX DNA and Lanes 5-8 contained GFP RNA. Lanes 5 and 6 contained
RNA
that was pre-treated with DNase to remove DNA. Lanes 7 and 8 contained RNA
that was
pre-treated with DNase and treated with RNase as an additional control. First
extension
was carried out using either Avian Myeloblastosis Virus Reverse Transcriptase
(AMV-
RT) (Lanes 2,4, 6 and 8) or Phusion DNA polymerase (Lanes 1, 3, 5, and 7).
Lanes 3-8
were tagmented with P5 adaptor. Isothermal cluster amplification was carried
out as
standard and the clusters stained with SYBR green.
Figures 7A and 7B show graphs of coverage plots of the aligned sequencing data
from sequencing of Lanes 1-8 as described for Figure 6.
RECTIFIED SHEET (RULE 91) ISA/EP
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
Figure 8 is a schematic showing an exemplary method provided herein for
DNA:DNA duplex tagging. Single stranded DNA (ssDNA) is fragmented and the
fragments labeled with polynucleotides by terminal deoxynucleotidyl
transferase. The
fragments are then added to a support and captured via hybridization of the
polyT tail
5 with its complement immobilized on the solid support. The hybridized
ssDNA molecules
are converted to a DNA:DNA duplex with a DNA polymerase. A transposome complex
or composition comprising a transposase and an adaptor duplex (i.e.,
transposon) of a P5-
seq sequence is used to tagment the duplex. Following extension of the DNA
strand to
the end with a strand displacing polymerase, the molecules can be amplified
(e.g., cluster
amplification) and sequenced.
Figure 9 shows pictures of clusters stained with SYBR Green from an experiment
designed to generate data using a whole mRNA transcript sample. Lane 1 is a
PhiX
standard library where there is no tagmentation. Lane 2 is a negative control
where no
tailing was performed and Lane 8 is a dsDNA negative control. Lanes 3 and 4
are the
same experiment, except primers were diluted for Lane 4. Lanes 5 and 6 are the
same
experiment, except primers were diluted for Lane 6. Lane 7 uses random RNA
hexamers
in lieu of random DNA hexamers.
Figure 10 shows a picture of the coverage of aligned sequencing reads for
GAPDH following the method of Figure 1. The top 3' capture demonstrates the
capture,
tagmentation, cluster and sequence alignment from a control polyA tailed mRNA
sample.
The bottom whole transcript demonstrates mRNA alignment from a mRNA sample
that
was enriched from a complex total UHR RNA sample, enzymatically fragmented and
polyadenylated to demonstrate whole mRNA transcript coverage using the methods
of
the present disclosure.
DETAILED DESCRIPTION
Current protocols for sequencing RNA samples all employ a sample preparation
that converts the RNA in the sample into a double-stranded cDNA format prior
to
sequencing. Provided herein are methods for sequencing RNA samples that avoids
a
solution phase preparation of double stranded cDNA intermediate. The provided
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
6
methods also result in the preservation of strandedness information during
sequencing.
However, the methods described herein could also be used for labeling and
sequencing
DNA.
Provided herein is a method of tagging DNA:RNA duplexes. The method
includes the steps of providing a transposase and a transposon composition,
providing
one or more DNA:RNA duplexes immobilized on a support, and contacting the
transposase and transposon composition with the one or more DNA:RNA duplexes
under
conditions wherein the one or more DNA:RNA duplexes and transposon composition
undergo a transposition reaction to produce one or more tagged DNA:RNA
duplexes.
The transposon composition comprises a double stranded nucleic acid molecule
comprising a transferred strand and a non-transferred strand. Although the
following
examples may be exemplified using DNA:RNA duplexes, they could also be
amenable
for DNA:DNA duplexes where appropriate (see Figure 8).
Optionally, the one or more DNA:RNA duplexes are tagged on the 5' end of the
RNA strand. Optionally, the transferred strand comprises a tag to preserve
strand
information. The transposition reaction results in a 5' tagged RNA strand
comprising the
transferred strand of the transposon composition and a gap between the 3' end
of the
DNA strand and the non-transferred strand of the transposon composition.
Optionally,
the method further comprises contacting the one or more tagged DNA:RNA
duplexes
with a nucleic acid modifying enzyme under conditions to extend the 3' end of
the DNA
stands to copy the RNA strands to their 5' end. The nucleic acid modifying
enzyme can
displace the non-transferred strand of the transposon composition.
Figure 1 is a schematic showing an exemplary method provided herein. Briefly,
polyA tailed mRNA is captured on a support (e.g., flowcell) via hybridization
to a polyT
DNA capture probe (or primer) coupled to the surface of the support. The polyT
strand is
next extended with a reverse transcriptase polymerase to make a double
stranded
molecule comprising a DNA:RNA duplex. Next, a transposome complex (e.g., Tn5
bound with a transposon (e.g., mosaic end (ME)) sequence and sequences
complementary
to surface amplification primers) is added to the support, which `tagments'
the duplex,
ligating a DNA adaptor oligo to the 5' end of the RNA strand. A strand
displacing
polymerase (e.g., Bst polymerase) can then be used to extend the 3' end of the
DNA
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
7
strand, displacing the 'non-transferred strand' of the transposome and copying
the RNA
strand to its 5' DNA chimeric end. The double-stranded molecule can then be
amplified
(e.g., clustered) and sequenced with a sequencing primer partially comprising
the ME
sequence and the upstream adaptor sequence. Alternatively, the other end of
the molecule
(the polyT end) can be sequenced with a primer that anneals upstream of the
polyT
sequence and is extended with natural dATP nucleotides before commencing
cycles of
SBS chemistry. Paired end sequencing is also enabled by this method.
When providing ssDNA for sequencing, a similar approach could be utilized. For
example, the 3' end of single stranded DNA polynucleotides could be appended
with
io nucleotides by using terminal deoxynucleotidyl transferase (TdT) and any
dNTP such as
dATP or dTTP. Any method for appending a string of nucleotides to the end of a
ssDNA
molecule could be used. Figure 8 is an example where polyA containing capture
probes
are immobilized on the support surface and ssDNA-polyT tailed molecules are
captured.
Any capture sequence, including that of the ssDNA end, could be utilized as
long as the
complementary sequences are provided by the capture probe on the support and
the
nucleotides on the ssDNA such that hybridization could occur. Extension of the
capture
probe to create dsDNA by a DNA polymerase to create a DNA:DNA duplex,
transpositional ligation of adaptor oligos and strand displacement
amplification as
previously described could be performed to provide double stranded molecules
for cluster
formation. The double-stranded molecule could then be amplified (e.g., cluster
amplification) and sequenced.
By way of another example (Figure 2), RNA (total or polyA enriched) is
fragmented, treated with a phosphatase , then a single stranded adaptor
molecule is
ligated to the 3'end of each fragment comprising the complement of the P7
surface bound
primer. The fragments are then added to a support (e.g., flowcell) and
captured via
hybridization. The hybridized RNA molecules are converted to a DNA:RNA duplex
with
a reverse transcriptase polymerase. A transposome complex comprising a
transposase and
an adaptor duplex (e.g., transposon) of a ME sequence with a P5 primer
sequence can be
used to tagment the duplex. Following extension of the DNA strand to the end
with a
strand displacing polymerase, the molecules can be amplified and sequenced.
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
8
By way of a further example (Figure 3), a special support (e.g., flowcell) is
used
that contains two surface grafted primers: a standard grafting primer (e.g.,
P5) and a
modified grafting primer (e.g., P7) that has a target specific capture probe
to its
downstream (3') side. An example of a target specific probe is an oligo
sequence
complementary to a retroviral reverse transcriptase (e.g., HIV polymerase).
Purified viral
RNA is added to a support, captured via hybridization, copied with reverse
transcriptase
and tagmented. Sequencing can be achieved with a primer annealed to the
tagmented
adaptor or at the other end to the capture probe. Optionally, the special
support contains
multiple different target specific capture probes to enable simultaneous
capture of many
different RNA targets.
The use of an in vitro transposition reaction to tag the target DNA:DNA or
DNA:RNA duplexes to generate tagged DNA:DNA or DNA:RNA duplexes involves a
transposase, a transposon sequence composition, and suitable reaction
conditions.
As used throughout, the term transposon refers to a double-stranded DNA that
contains the nucleotide sequences that are necessary to form the complex with
the
transposase or integrase enzyme that is functional in an in vitro
transposition reaction. A
transposon forms a complex or a synaptic complex or a transposome complex. The
transposon can also form a transposome composition with a transposase or
integrase that
recognizes and binds to the transposon sequence, and which complex is capable
of
inserting or transposing the transposon into target DNA with which it is
incubated in an
in vitro transposition reaction. A transposon exhibits two complementary
sequences
consisting of a transferred transposon sequence or transferred strand and a
non-
transferred transposon sequence, or non transferred strand. For example, one
transposon
that forms a complex with a hyperactive Tn5 transposase (e.g., EZ-Tn5Tm
Transposase,
EPICENTRE Biotechnologies, Madison, WI, USA) that is active in an in vitro
transposition reaction comprises a transferred strand that exhibits a
transferred transposon
sequence of 5' AGATGTGTATAAGAGACAG 3', (SEQ ID NO: 1) and a non-transferred
strand that exhibits a non-transferred transposon sequence of 5'
CTGTCTCTTATACACATCT 3'. (SEQ ID NO: 2). The 3'-end of a transferred strand is
joined or transferred to target nucleic acid in an in vitro transposition
reaction. The non-
transferred strand, which exhibits a transposon end sequence that is
complementary to the
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
9
transferred transposon end sequence, is not joined or transferred to the
target nucleic acid
in an in vitro transposition reaction. A transposon composition, as used
herein, refers to a
composition comprising a transposon (i.e., the minimum double-stranded DNA
segment
that is capable of acting with a transposase to undergo a transposition
reaction),
optionally including additional sequences. For example, the transposon
composition
comprises two transposon oligonucleotides containing the transferred
transposon
oligonucleotide or transferred strand and the non-transferred strand
oligonucleotide or
non-transferred strand, which, in combination, exhibit the sequences of the
transposon.
One or both strands can comprise additional sequence. The transposon can
include
naturally occurring and/or non-naturally occurring nucleotides and natural or
non-natural
backbone linkages. Optionally, the transposon can also include one or more
moieties
attached to the one or more nucleotides making up the transposon. For example,
one or
both strands of the transposon may be biotinylated or may contain a label, for
example a
fluorescent label.
The terms transferred transposon oligonucleotide and transferred strand are
used
interchangeably and refer to the transferred portion of both transposons and
transposon
compositions, i.e., regardless of whether the transposon end is attached to a
tag or other
sequence or moiety. Similarly, the terms non-transferred transposon
oligonucleotide and
non-transferred strand are used interchangeably and refer to the non-
transferred portion
of both transposons and transposon compositions.
In some embodiments, the transposon composition comprises or consists of at
least one transposon with one or more other nucleotide sequences in addition
to the
transposon sequences. Thus, in some embodiments, the transposon composition
comprises a transferred strand with one or more other nucleotide sequences 5'
of the
transferred transposon sequence, e.g., a tag sequence. In addition to the
transferred
transposon sequence, the tag can have one or more other tag portions or tag
domains.
As used herein, a "tag" refers to a nucleic acid component, generally DNA,
which
provides a means of identifying or addressing a nucleic acid fragment to which
it is
joined. For example, a tag comprises a nucleotide sequence that permits
identification,
recognition, and/or molecular or biochemical manipulation of the DNA to which
the tag
is attached (e.g., by providing a site for annealing an oligonucleotide, such
as a primer for
10
extension by a DNA polymerase, by providing an oligonucleotide for capture or
for a
ligation reaction, or by providing identification of the nucleic acid as
originating from a
particular source, and the like). The process of joining the tag to a nucleic
acid molecule
is sometimes referred to herein as "tagging" and nucleic acids that undergoes
tagging or
that contains a tag is referred to as "tagged" (e.g., "tagged RNA")."
As used throughout, the term strandedness or strand-specific information
refers to
the preservation of the knowledge about the direction of the original single-
stranded
molecule. This is preserved in the provided methods since it is known that the
DNA
strand is complementary to the RNA strand in the DNA:RNA duplexes. Thus, when
sequencing the DNA strand, the sequence will be the sequence of the RNA strand
preserving the strand-specific information and allowing for correct
identification of the
RNA molecule and/or its expression level. Methods for preserving strand
specific
information are also described in WO 2011/003630. However, the method
described in
WO 2011/003630 still requires conversion of the RNA molecules into double-
stranded
cDNA molecules, which, as described herein, is not as efficient as the methods
provided
in the present application. Further, the method described in WO 2011/003630
requires a
tag in order to preserve strand information. In the methods provided herein, a
tag is not
required to preserve strand-specific information or strandedness. In
embodiments
wherein the DNA strand (i.e., first DNA strand) of the DNA:RNA duplexes is
amplified
to produce first and second amplified DNA strands, strandedness is maintained
by the
knowledge that the first DNA strand is complementary to the original RNA
strand and
the second DNA strand is the same sequence as the original RNA strand (with
the
exception of Ts in the sequence instead of Us). Thus, while a tag (e.g., a tag
sequence
can be included in the transferred strand of the transposon) can be used to
preserve
strandedness, it is not required.
As used herein, a tag portion or a tag domain means a portion or domain of a
tag
that exhibits a sequence for a desired intended purpose or application. One
tag portion or
tag domain is the transposon domain, which tag portion or tag domain exhibits
the
transferred transposon sequence. In some embodiments wherein the transferred
strand
also exhibits one or more other nucleotide sequences, the tag also has one or
more other
CA 2864276 2019-04-16
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
11
tag domains, each of which tag domains is provided for any desired purpose.
For
example, a transposon composition can comprise (i) a transferred strand that
exhibits one
or more additional sequences (in addition to the transposon sequence) can
comprise a tag
domain selected from among one or more of a restriction site tag domain, a
capture tag
domain, a sequencing tag domain, an amplification tag domain, a detection tag
domain,
an address tag domain, and a transcription promoter domain; and (ii) a non-
transferred
strand that exhibits the non-transferred transposon sequence.
If a description is used for a tag domain, the names and descriptions of
different
tag domains are for convenience, such as to make it easier to understand and
discuss the
intended purposes and applications of the different portions or domains of the
tag in
different embodiments. However, these names and descriptions are not intended
to limit
the use or applications of the tag or of any of its tag domains in any way.
Thus, any
particular tag or tag domain can be used for any purpose in addition to, or in
place of the
intended or primary purpose or application. Also, one tag domain can comprise
two or
more other tag domains (e.g., a sequencing tag domain can comprise both a
capture tag
domain and an amplification tag domain) or one tag domain can provide the
functions or
purposes or applications of two or more different tag domains (e.g., a capture
tag domain
can also provide the function or purpose of a sequencing tag domain and/or an
amplification tag domain for a particular application). Still further, the tag
need not be
described in terms of one or more different domains in order to be used for
any particular
purpose or application or function.
As used throughout, the term transposase refers to an enzyme that is capable
of
forming a functional complex with a transposon-containing composition (e.g.,
transposons, transposon compositions) and catalyzing insertion or
transposition of the
transposon-containing composition into the double-stranded target nucleic acid
with
which it is incubated in an in vitro transposition reaction. A transposase of
the provided
methods also includes integrases from retrotransposons and retroviruses.
Exemplary
transposases that can be used in the provided methods include wild-type or
mutant forms
of Tn5 transposase and MuA transposase.
A "transposition reaction" is a reaction wherein one or more transposons are
inserted into target nucleic acids at random sites or almost random sites.
Essential
12
components in a transposition reaction are a transposase and DNA
oligonucleotides that
exhibit the nucleotide sequences of a transposon, including the transferred
transposon
sequence and its complement (i.e., the non-transferred transposon end
sequence) as well
as other components needed to form a functional transposition or transposome
complex.
The method of this invention is exemplified by employing a transposition
complex
formed by a hyperactive Tn5 transposase and a Tn5-type transposon end or by a
MuA or
HYPERMu transposase and a Mu transposon end comprising R1 and R2 end sequences
(See e.g., Goryshin, I. and Reznikoff, W. S., J. Biol. Chem., 273: 7367, 1998;
and
Mizuuchi, K., Cell, 35: 785, 1983; Savilahti, H, et al., EMBO J., 14: 4893,
1995).
However, any transposition system that is capable of inserting a transposon
end in a
random or in an almost random manner with sufficient efficiency to tag target
nucleic
acids for its intended purpose can be used in the provided methods. Other
examples of
known transposition systems that could be used in the provided methods include
but are
not limited to Staphylococcus aureus Tn552, Tyl, Transposon Tn7, Tn/O and
IS10,
Mariner transposase, Tcl, P Element, Tn3, bacterial insertion sequences,
retroviruses,
and retrotransposon of yeast (See, e.g., Colegio 0 R et al., J. Bacteriol.,
183: 2384-8,
2001; Kirby C et al., Mol. Microbiol., 43: 173-86, 2002; Devine S E, and Boeke
J D.,
Nucleic Acids Res., 22: 3765-72, 1994; International Patent Application No. WO
95/23875; Craig, N L, Science. 271: 1512, 1996; Craig, N L, Review in: Curr
Top
Microbiol Immunol., 204: 27-48, 1996; Kleckner N, et al., Curr Top Microbiol
Immunol.,
204: 49-82, 1996; Lampe D J, et al., EMBO J., 15: 5470-9, 1996; Plasterk R H,
Curr Top
Microbiol Immunol, 204: 125-43, 1996; Gloor, G B, Methods Mol. Biol., 260: 97-
114,
2004; Ichikawa H, and Ohtsubo E., J Biol. Chem. 265: 18829-32, 1990; Ohtsubo,
F and
Sekine, Y, Curr. Top. Microbiol. Immunol. 204: 1-26, 1996; Brown P 0, et al.,
Proc Natl
Acad Sci USA, 86: 2525-9, 1989; Boeke J D and Corces V G, Annu Rev Microbiol.
43:
403-34. 1989).
The method for inserting a transposon into a target sequence can be carried
out in
vitro using any suitable transposon system for which a suitable in vitro
transposition
system is available or can be developed based on knowledge in the art. In
general, a
suitable in vitro transposition system for use in the methods of the present
invention
CA 2864276 2019-04-16
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
13
requires, at a minimum, a transposase enzyme of sufficient purity, sufficient
concentration, and sufficient in vitro transposition activity and a transposon
with which
the transposase forms a functional complex with the respective transposase
that is capable
of catalyzing the transposition reaction. Suitable transposase transposon
sequences that
can be used in the invention include but are not limited to wild-type,
derivative or mutant
transposon sequences that form a complex with a transposase chosen from among
a wild-
type, derivative or mutant form of the transposase.
In the provided methods, the DNA:RNA duplexes can be provided in a variety of
ways. By way of example, the support can comprise a plurality of primers and
the
DNA:RNA duplexes are provided by hybridizing one or more RNA molecules to the
immobilized primers on the support and extending the primers hybridized to the
RNA
molecules using the RNA molecules as template to produce the one or more
DNA:RNA
duplexes. Optionally, a plurality of DNA:RNA duplexes are provided by
hybridizing a
plurality of RNA molecules to the immobilized primers on the support and
extending the
primers hybridized to the RNA molecules using the RNA molecules as template to
produce the plurality of DNA:RNA duplexes.
As stated above, the methods can comprise providing a support with a plurality
of
primers; the primers or a subset thereof comprising a sequence capable of
binding to one
or more RNA molecules. For example, the immobilized primers may include a
polyT
sequence and the RNA may include a polyA sequence capable of hybridizing to
the polyT
sequence. Alternatively or additionally, the plurality of immobilized primers
can include
target specific primers capable of hybridizing to one or more of the RNA
molecules in the
plurality of RNA molecules. Thus, the RNA strand of the one or more DNA:RNA
duplexes comprises a sequence complementary to at least a portion of one or
more of the
immobilized primers. Optionally, the plurality of immobilized primers
comprises a first
subset of primers of a first sequence and a second subset of primers of a
second sequence.
The first or second subset of primers may comprise a polyT sequence.
Optionally, a 3' adaptor can be added to the plurality of RNA molecules, the
3'
adaptor comprising a sequence complementary to the plurality of immobilized
primers or
a subset thereof. Such 3'-adaptor ligated RNA molecules can then be hybridized
to the
immobilized primers.
14
Thus, the immobilized primers or a subset thereof can comprise a polyT
sequence,
an RNA target specific sequence or a sequence complementary to an adaptor
ligated to
the RNA molecule. Optionally, the plurality of primers comprises at least two
subsets of
primers, the first subset comprising a polyT sequence, an RNA target specific
sequence or
a sequence complementary to an adaptor ligated to the RNA molecule, and the
second
subset of primers comprising a sequence that is capable of binding to a
sequence on the
DNA strand of the DNA:RNA duplexes. Such a sequence can be, for example, the
same
sequence as a sequence of the transferred strand of the transposon. As
described
throughout, after transposition, there will be a gap between the end of the
DNA strand
and the non-transferred strand of the transposon. The DNA strand can then be
extended
to copy the RNA strand. The copying will include copying the sequences of the
transferred strand of the transposon. The DNA strand will then include
sequences
complementary to the sequences of the transferred strand of the transposon
and, thus, the
primers or subset thereof on the surface of the support. In other words, if
one or more of
the primers comprises a sequence the same as or similar to the transferred
strand of the
transposon, the DNA strand in the DNA:RNA duplexes will then be capable of
hybridizing to the primers since the DNA strand contains a sequence
complementary to
the primer.
Suitable nucleic acid modifying enzymes capable of extending the 3' end of the
DNA strands to copy the RNA strands to their 5' end and displacing the non-
transferred
strand of the transposon are known. Briefly, some DNA polymerases are able to
displace
the strand complementary to the template strand as a new DNA strand is
synthesized by
the polymerase. This process is called strand displacement and the DNA
polymerases
that have this activity are referred to herein as strand-displacing DNA
polymerases. In
general, a DNA-template-specific DNA polymerase used for the provided methods
efficiently synthesizes DNA of a suitable length for the intended purpose
without
disengaging from the template (or terminating synthesis of the DNA), which is
referred to
as the enzyme's processivity. The capability of a DNA polymerase to strand
displace can
be readily determined using the polymerase in a rolling circle replication
assay as
described by Fire and Xu (Proc. Natl. Acad. Sci. USA 92: 4641-4645, 1995).
Strand
displacement and DNA
CA 2864276 2019-04-16
15
polymerase processivity can also be assayed using methods described in Kong et
al. (J.
Biol. Chem. 268: 1965-1975, 1993). Terminal transferase is also defined as a
DNA
polymerase herein, which DNA polymerase is used as a composition in some
embodiments of the provided methods. Terminal transferase can be used because
it
catalyzes template-independent addition of dNTPs to the 3'-hydroxyl termini of
DNA.
In the methods provided herein, the method can further comprise sequencing at
least a portion of the DNA strands and/or amplifying at least a portion of the
DNA
strands. Optionally, the RNA strands from the DNA:RNA duplexes can be removed
prior
to sequencing and/or amplification. By way of example, the method further
comprises
removing the RNA strands from the DNA:RNA duplexes and sequencing at least a
portion of the DNA strands (i.e., the first DNA strands). The method can also
include
copying at least a portion of the DNA strands to produce a second DNA strand
complementary to the DNA strand (i.e., the first DNA strand) of the DNA:RNA
duplexes.
The second complementary DNA strand can then be sequenced, if desired.
Optionally,
the first DNA strand of the DNA:RNA duplexes can be removed prior to
sequencing the
second complementary DNA strand.
In the provided methods, optionally, after removal of the RNA strand from the
DNA:RNA duplexes, the DNA strands may be amplified to produce a plurality of
double
stranded DNA molecules comprising first and second amplified strands.
Optionally, the
amplification produces a cluster, described in more detail below.
In some embodiments, when the DNA strands have been amplified to produce a
plurality of double stranded DNA molecules, either one or both of the strands
can be
sequenced. By way of example, the methods can include removing the first
amplified
strands followed by sequencing at least a portion of the second amplified
strands.
Optionally, the first amplified strands can be regenerated by copying at least
a portion of
the second amplified strands. The second amplified strands can then be removed
in order
to sequence at least a portion of the first amplified strands. Optionally,
sequence reads of
a portion or all of one or both of the first and second amplified strands can
be performed
without removing all or a portion of either strand.
CA 2864276 2019-04-16
16
Various protocols can be used to generate amplified nucleic acids, for
example,
nucleic acids amplified on a support. For example, nucleic acids can be
amplified by
emulsion PCR, or bridge PCR (Mitra & Church Nucleic Acids Res. 27, e34 (1999);
Dressman et al. Proc. Nail. Acad. Sci. USA 100, 8817-8822 (2003); Adessi, C.
et al.
Nucleic Acids Res. 28, e87 (2000); Fedurco et al. Nucleic Acids Res. 34, e22
(2006)).
In embodiments using emulsion PCR, nucleic acids can be PCR amplified in a
water-in-oil emulsion. In one embodiment, a single primer pair is used. One of
the PCR
primers is tethered to the surface (5'-attached) of a support (e.g., micron-
scale beads) and
the other primer is in solution. Optionally, the support comprises primers of
more than
one sequence, the primers being target specific primers capable of hybridizing
to one or
more target RNA molecules and the primer in solution is of the same sequence
(e.g., a
sequence complementary to the sequence added to the DNA strand by copying the
tagged
RNA strand to its 5' end). Generally, a low template concentration results in
most bead-
containing compartments having either zero or one template molecule present.
In
productive emulsion compartments (where both a bead and template molecule is
present),
RNA molecules can be captured and/or the corresponding DNA complement of the
RNA
molecule amplified at the surface of the bead. After breaking the emulsion,
beads bearing
amplification products can be selectively enriched. Each clonally amplified
bead will
bear on its surface PCR products corresponding to amplification of a single
molecule
from the template library. Various embodiments of emulsion PCR methods that
are
useful are set forth in U.S. Pat. App. Publ. Nos. 2005/0042648 Al;
2005/0079510 Al and
2005/0130173 Al, and WO 05/010145.
In embodiments using bridge PCR, also known as cluster formation, nucleic
acids
from a template library can be amplified using primers coated on the surface
of a support.
The primers can be attached at their 5' ends by a flexible linker.
Amplification products
originating from any given member of the template library remain locally
tethered near
the point of origin. At the conclusion of the PCR, each clonal cluster
contains several
copies of a single member of the template library. In the provided methods,
each
DNA:RNA duplex forms the origin of a clonal cluster. Upon removal of the RNA
strand,
CA 2864276 2019-04-16
17
the DNA strand can be copied using the primers attached to the support to
generate
amplified copies of the DNA strand and to produce the clonal cluster. Various
embodiments of bridge PCR methods that are useful are set forth in U.S. Pat.
App. Publ.
No. 2007/0128624 Al, WO 07/010251, U.S. Pat. No. 6,090,592 and U.S. Pat. No.
5,641,658. Methods for carrying out amplification are also described in U.S.
Publication
No. 2009/0226975; WO 98/44151; WO 00/18957; WO 02/46456; WO 06/064199; and
WO 07/010251.
The methods set forth herein can make or use arrays having features at any of
a
variety of densities including, for example, at least about 10 features/cm2,
100
features/cm2, 500 features/cm2, 1,000 features/cm2, 5,000 features/cm2, 10,000
features/cm2, 50,000 features/cm2, 100,000 features/cm2, 1,000,000
features/cm2,
5,000,000 features/cm2, or higher.
As used herein, the term "nucleic acid" can be used refer to at least two
nucleotide
analog monomers linked together. A nucleic acid can contain phosphodiester
bonds,
however, in some embodiments, a nucleic acid can be an analog having other
types of
backbones, comprising, for example, phosphoramide, phosphorothioate,
phosphorodithioate, peptide nucleic acid backbones and linkages, positive
backbones, or
non-ionic backbones. A nucleic acid can include a pentose moiety such as
ribose
(present in naturally occurring RNA), deoxy-ribose (present in naturally
occurring DNA)
or dideoxy ribose. In some embodiments a nucleic acid can have a non-pentose
moiety
or carbocyclic sugar instead of a ribose or deoxyribose moiety. A nucleic acid
can have
one or more different base moieties including, but not limited to, adenine
(A), guanine
(G), thymine (T), uracil (U), cytosine (C), inosine, xanthanine,
hypoxanthanine,
isocytosine, isoguanine, nitropyrrole (including 3-nitropyrrole) and/or
nitroindole
(including 5-nitroindole). A nucleic acid used herein can include native or
non-native
bases. Thus, a nucleic acid can include naturally occurring and/or non-
naturally
occurring nucleotides and natural or non-natural backbone linkages. Nucleic
acids may
be single stranded or double stranded, as specified, or contain portions of
both double
stranded and single stranded sequence. The nucleic acid may be DNA (e.g.
genomic
DNA or cDNA), RNA or a hybrid.
CA 2864276 2019-04-16
18
As used herein, the term "array" means a population of different molecules
that
are attached to one or more supports such that the different molecules can be
differentiated from each other according to their relative location. An array
can include
different molecules that are each located at a different addressable location
(e.g. a
feature) on a support. Alternatively, an array can include separate supports
each bearing a
different molecule, wherein the different probe molecules can be identified
according to
the locations of the supports on a surface to which the supports are attached
or according
to the locations of the supports in a liquid such as a fluid stream. The
molecules of the
array can be, for example, nucleic acid primers, nucleic acid probes, nucleic
acid
templates or nucleic acid enzymes such as polymerases. For example, in
particular
embodiments target nucleic acids can be attached to a surface of a detector or
to a layer
(e.g. an acrylamide layer) that is present at the surface of the support.
Hydrogels are
particularly useful such as those set forth in US Pat. Pub. No. 2011/0059865
Al.
As used herein the term "array of nucleic acids" means a solid support having
a
plurality of spatially distinguishable nucleic acids disposed thereon or
therein. The
nucleic acids can be disposed in an ordered or random pattern of features. An
individual
feature can be, for example, a spatially isolated nucleic acid molecule, or an
ensemble of
nucleic acid molecules such as a cluster. An array can be a composite array
comprising a
plurality of individual arrays configured to allow processing of multiple
samples. The
individual arrays, referred to herein as "sub-arrays," include groups of
nucleic acid
features. Sub-arrays appear in distinct regions with in a larger array. The
sub-arrays
themselves can be ordered or non-ordered. Such sub-arrays can be optionally
spatially
addressable. Sub-arrays can include clusters of identical nucleic acids. An
example of a
composite array composed of individual sub-arrays is a microtiter plate having
wells in
which the plate as a whole is an array of nucleic acids (or composite array)
while each
individual well represents a sub-array within the larger composite array.
As used herein the term "support" refers to a substrate for immobilizing an
array
of nucleic acids. A "support" is a material having a rigid or semi-rigid
surface to which a
nucleic acid array can be attached or upon which nucleic acids can be
synthesized and/or
modified. Supports can include any resin, microbead, glass, controlled pore
glass (CPG),
CA 2864276 2019-04-16
19
polymer support, membrane, paper, plastic, plastic tube or tablet, plastic
bead, glass bead,
slide, ceramic, silicon chip, multi-well plate, nylon membrane, fiber optic,
and PVDF
membrane.
A support can include any flat wafer-like substrates and flat substrates
having
wells, such as a microtiter plate, including 96-well plates. Exemplary flat
substrates
include chips, slides, etched substrates, microtiter plates, and flow cell
reactors, including
multi-lane flow cell reactors having multiple microfluidic channels, such as
the eight
channel flow cell used in the cBot sequencing workstation (IIlumina, Inc., San
Diego,
CA). Exemplary flow cells that can be used are also described in WO
2007/123744.
A support can also include beads, including magnetic beads, hollow beads, and
solid beads. Beads can be used in conjunction with flat supports, such flat
supports
optionally also containing wells. Beads, or alternatively microspheres, refer
generally to
a small body made of a rigid or semi-rigid material. The body can have a shape
characterized, for example, as a sphere, oval, microsphere, or other
recognized particle
shape whether having regular or irregular dimensions. The sizes of beads, in
particular,
include, without limitation, about 1 um, about 2 1.1m, about 3 um, about 5 um,
about 10
um, about 20 m, about 30 um, about 40 um, about 60 m, about 100 um, about
150 um
or about 200 um in diameter. Other particles can be used in ways similar to
those
described herein for beads and microspheres.
The composition of a support can vary, depending for example, on the format,
chemistry and/or method of attachment and/or on the method of nucleic acid
synthesis.
Support materials that can be used in accordance with the present disclosure
include, but
are not limited to, polypropylene, polyethylene, polybutylene, polyurethanes,
nylon,
metals, and other suitable materials. Exemplary compositions include supports,
and
chemical functionalities imparted thereto, used in polypeptide, polynucleotide
and/or
organic moiety synthesis. Such compositions include, for example, plastics,
ceramics,
glass, polystyrene, melamine, methylstyrene, acrylic polymers, paramagnetic
materials,
thoria sol, carbon graphite, titanium dioxide, latex or cross-linked dextrans
such as
SepharoseTM, cellulose, nylon, cross-linked micelles and TeflonTm, as well as
any other
materials which can be found described in, for example, "Microsphere Detection
Guide"
CA 2864276 2019-04-16
20
from Bangs Laboratories, Fishers IN. A support particle can be made of cross-
linked
starch, dextrans, cellulose, proteins, organic polymers including styrene
polymers
including polystyrene and methylstyrene as well as other styrene co-polymers,
plastics,
glass, ceramics, acrylic polymers, magnetically responsive materials,
colloids, thoriasol,
carbon graphite, titanium dioxide, nylon, latex, or TEFLON . "Microsphere
Detection
Guide" from Bangs Laboratories, Fishers, Inc., hereby incorporated by
reference in its
entirety, is a helpful guide. Further exemplary supports within the scope of
the present
disclosure include, for example, those described in US Application Publication
No.
2002/0102578 and U.S. Pat. No. 6,429,027.
Attachment of a nucleic acid to a support, whether rigid or semi-rigid, can
occur
via covalent or non-covalent linkage(s). Exemplary linkages are set forth in
US Pat. Nos.
6,737,236; 7,259,258; 7,375,234 and 7,427,678; and US Pat. Pub. No.
2011/0059865 Al.
In some embodiments, a nucleic acid or other reaction component can be
attached to a gel
or other semisolid support that is in turn attached or adhered to a solid-
phase support. In
such embodiments, the nucleic acid or other reaction component will be
understood to be
solid-phase.
Optionally, the support is a bead or a plurality of beads. Optionally, the
support is
a planar support. Optionally, a plurality of beads is provided, each bead
comprising one
or more DNA:RNA duplexes. If a bead comprises more than one DNA:RNA duplex,
the
duplexes can be of the same sequence or different sequence. Optionally, a
plurality of
beads is provided each bead comprising a DNA:RNA duplex. The beads in the
plurality
of beads can comprise the same or a different DNA:RNA duplex. For example, a
first
subset of beads in the plurality of beads can comprise a DNA:RNA duplex of a
first
sequence while a second subset of beads in the plurality of beads can comprise
a
DNA:RNA duplex of a second sequence.
Any of a variety of sequencing protocols and respective reagents can be used
in
any method or device set forth herein. Sequencing-by synthesis (SBS)
techniques
generally involve the enzymatic extension of a nascent nucleic acid strand
through the
iterative addition of nucleotides against a template strand. SBS can utilize
nucleotide
monomers that have a terminator moiety or those that lack any terminator
moieties.
CA 2864276 2019-04-16
21
Methods utilizing monomers having terminators include, for example, those
described in
WO 04/018497, US 7,057,026, WO 91/106678, WO 07/123744,U.S. US 2007/0166705,
US 2006/0188901, US 2006/0240439, US 2006/0281109, WO 05/065814, US
2005/0100900, WO 06/064199 or WO 07010251. Also useful are SBS methods that
are
commercially available from Illumina, Inc., San Diego CA.
SBS techniques can utilize nucleotide monomers that have a label moiety or
those
that lack a label moiety. Accordingly, incorporation events can be detected
based on a
characteristic of the label, such as fluorescence of the label; a
characteristic of the
nucleotide monomer such as molecular weight or charge; a byproduct of
incorporation of
the nucleotide, such as release of pyrophosphate or protons; or the like. The
different
nucleotides can be distinguishable from each other, or alternatively, the two
or more
different labels can be indistinguishable under the detection techniques being
used. For
example, the different nucleotides present in a sequencing reagent can have
different
labels and they can be distinguished using appropriate optics as exemplified
by the
sequencing methods developed by Solexa (now Illumina, Inc.). However, it is
also
possible to use the same label for the two or more different nucleotides
present in a
sequencing reagent or to use detection optics that do not necessarily
distinguish the
different labels.
Methods utilizing nucleotide monomers lacking terminators are also useful
including, for example, pyrosequencing. Pyrosequencing detects the release of
inorganic
pyrophosphate (PPi) as particular nucleotides are incorporated into the
nascent strand
(Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlen, M. and Nyren, P. (1996)
"Real-
time DNA sequencing using detection of pyrophosphate release." Analytical
Biochemistry 242(1), 84-9; Ronaghi, M. (2001) "Pyrosequencing sheds light on
DNA
sequencing." Genome Res. 11(1),3-11; Ronaghi, M., Uhlen, M. and Nyren, P.
(1998) "A
sequencing method based on real-time pyrophosphate." Science 281(5375), 363;
US
Patent No. 6,210,891; US Patent No. 6,258,568 and US Patent No. 6,274,320). In
pyrosequencing, released PPi can be detected by being converted to adenosine
CA 2864276 2019-04-16
22
triphosphate (ATP) by ATP sulfurylase, and the level of ATP generated is
detected via
luciferase-produced photons.
Some embodiments can utilize sequencing by ligation techniques. Such
techniques utilize DNA ligase to incorporate oligonucleotides. Exemplary SBS
systems
and methods which can be utilized with the methods and systems described
herein are
described in U.S. Patent No 6,969,488, U.S. Patent No. 6,172,218, and U.S.
Patent No.
6,306,597.
Some embodiments can utilize methods involving the real-time monitoring of
DNA polymerase activity. Nucleotide incorporations can be detected through
fluorescence resonance energy transfer (FRET) interactions between a
fluorophore-
bearing polymerase and y-phosphate-Labeled nucleotides as described, for
example, in
U.S. Patent No. 7,329,492 and U.S. Patent No. 7,211,414 or nucleotide
incorporations
can be detected with zero-mode vvaveguides as described, for example, in U.S.
Patent No.
7,315,019 and using fluorescent nucleotide analogs and engineered polymerases
as
described, for example, in U.S. Patent No. 7,405,281 and U.S. Patent
Application
Publication No. 2008/0108082. The illumination can be restricted to a
zeploliter-scale
volume around a surface-tethered polymerase such that incorporation of
fluorescently
labeled nucleotides can be observed with low background (Levene, M.1. et al.
"Zero-
mode waveguides for single-molecule analysis at high concentrations." Science
299, 682-
686 (2003); Lundquist, P.M. et al. "Parallel confocal detection of single
molecules in real
time." Opt. Lett. 33, 1026-1028 (2008); Korlach, J. et al. "Selective aluminum
passivation for targeted immobilization of single DNA polymerase molecules in
zero-
mode waveguide nanostructures." Proc. Nat'l. Acad. Sci. USA 105, 1176-
1181(2008).
Disclosed are materials, compositions, and components that can be used for,
can
be used in conjunction with, can be used in preparation for, or are products
of the
disclosed methods and compositions. These and other materials are disclosed
herein, and
it is understood that when combinations, subsets, interactions, groups, etc.
of these
CA 2864276 2019-04-16
23
materials are disclosed that while specific reference of each various
individual and
collective combinations and permutation may not be explicitly disclosed, each
is
specifically contemplated and described herein. For example, if a method is
disclosed and
discussed and a number of modifications that can be made to the method steps
are
discussed, each and every combination and permutation of the method steps, and
the
modifications that are possible arc specifically contemplated unless
specifically indicated
to the contrary. Likewise, any subset or combination of these is also
specifically
contemplated and disclosed. This concept applies to all aspects of this
disclosure. Thus, if
there are a variety of additional steps that can be performed it is understood
that each of
these additional steps can be performed with any specific method steps or
combination of
method steps of the disclosed methods, and that each such combination or
subset of
combinations is specifically contemplated and should be considered disclosed.
A number of embodiments have been described. Nevertheless, it will be
understood that various modifications may be made. Accordingly, other
embodiments
are within the scope of the following claims.
EXAMPLES
Example 1. RNA sequencing employing a tagmentation reaction of a DNA:RNA
duplex
An exemplary experiment with a P7' adapted RNA transcript was performed, the
schematic of which is outlined in Figure 4. RNA transcripts were generated
from a
plasmid containing Green Fluorescent Protein (GFP) using the Riboprobe In
vitro
Transcription System kit from Promega (Madison, WI) following manufacturer's
protocol.
The sequence of the GFP expression cassette is shown below (SEQ ID NO:3).
aatgatacggcgaccaccgagatctacactcMccetacacgacgctettccgatcttaatacgacteactataggcaat
tttaa
ctttactaaggagaattcaccatgaaacatcaccatcaccacacGACTACAAAGACGATGACGACAAGg
cgatcgtgagcaagggcgaggagctgttcaccggggtggtgcccatectggtcgagctggacggcgacgtaaacggcca
ca
CA 2864276 2019-04-16
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
24
agttcagcgtgtccggeggggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaag
ctg
cccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgettcagccgctacccgaccacatgaagca
gcac
gacttatcaagtecgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagac
ccg
cgccgaggtgaagttcgagggcgaaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaaca
tc
ctggggcacaagctggagtacaactacaacagccacaacgtetatatcatggccgacaagcagaagaacgcatcaaggt
gaa
cttcaagatccgccacaacatcgaggacggcagegtgcagetcgccgaccactaccagcagaacacceccateggcgac
gg
ccccgtgctgctgcccgacaaccactacctgagccccagtccgccctgagcaaagaccccaacgagaagcgcgatcaca
tgg
tectgctggagttcgtgaccgccgccgggatcactcteggcatggacgagctgtacaagta a
ctgctgccaccgctgagaataa
clakcataaccectiggggcctctaaacgggtcttRaggggittfttgagatcggaagagcggttcagcaggaatgccg
agac
cgatcTCGTATGCCGTCTTCTGCTTG (SEQ ID NO:3)
The pMA-T based plasmid contains P5 (underlined), a T7 polymerase promoter
(in bold font), a start codon (in bold font and italics), a His tag (in
italics and underlined),
a FLAG tag (in capital letters), the GFP sequence, a TAA stop codon
(underlined and in
bold font), a T7 terminator (in bold font, italics and underlined) and P7' (in
capital letters
and bold font).
The RNA transcript should extend from the promoter sequence to the T7
termination sequence. However, the T7 terminator does not stop transcription
completely
and so some of the resulting RNA transcripts are His_FLAG_GFP_P7'. The RNA
transcript was treated with DNase to remove DNA that would otherwise form
clusters. In
order to check that the DNase treatment was effective, a reaction was
performed and
analyzed on a gel to prove that the DNase treatment was effective at removing
the DNA.
No residual DNA (i.e., plasmid) was visible following DNase treatment of the
RNA
transcript (Figure 5).
A PhiX DNA library and the DNase treated GFP-P7' RNA transcripts were
hybridized onto different lanes of a flowcell following the standard cluster
protocol for
template hybridization. Lanes 1-4 contained the PhiX DNA and lanes 5-8
contained the
GFP RNA. Lanes 5 and 6 contained RNA that was pre-treated with DNase to remove
DNA. Lanes 7 and 8 contained RNA that was pre-treated with DNase and treated
with
RNase on the flowcell as an additional control. The PhiX DNA library can
hybridize via
P5 or P7 as both sequences and their complements are present in the template.
In
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
contrast, the GFP-P7' RNA templates hybridize to the P7 surface primers only
because of
their `strandedness' and the lack of a P5 sequence.
First extension was carried out using either Avian Myeloblastosis Virus
Reverse
Transcriptase (AMV-RT) (Lanes 2, 4, 6 and 8) or Phusion DNA polymerase (Lanes
1, 3,
5 5, and 7). AMV-RT can generate a cDNA strand from either an RNA or DNA
template,
whereas Phusion can only generate a DNA strand from a DNA template.
Some lanes were transposed using a transposome complex containing the
transposon sequence P5 adaptor sequence (Lanes 3-8). Gaps in the DNA sequence
left
after the transposition event were filled in using a strand displacement
extension reaction
10 containing Bst DNA polymerase. The transposition event is required in
the lanes
containing GFP_P7' RNA to add the P5 adapter to generate a template that can
make
clusters. Isothermal cluster amplification was carried out as standard and the
clusters
stained with SYBR Green. Pictures of the clusters are shown in Figure 6.
Lane 1 was a control for cluster generation as it contains a standard format
DNA
15 sample extended with PHUSION DNA Polymerase. Successful cluster
generation
resulted as shown in Figure 6.
Lane 2 demonstrated that DNA templates can be successfully extended by a
reverse transcriptase (generating a DNA:DNA duplex) and make clusters under
standard
conditions (Figure 6).
20 Lanes 3 and 4 demonstrated that the DNA :DNA duplexes (extended with
either
PHU SION DNA Polymerase or AMV-RT) can be tagmented with a Tn5 adaptor and
generate clusters (Figure 6).
Lane 5 would not be expected to generate clusters because PHUSION DNA
Polymerase has been previously reported not to extend opposite an RNA strand.
The
25 small number of clusters observed may be due to residual DNA template
used to generate
the RNA despite DNase treatment, or some degree of extension by PHUSION DNA
Polymerase of DNA opposite RNA (Figure 6).
Lanes 7 and 8 would not be expected to exhibit any cluster formation because
the
templates have been RNase and DNase treated. As was seen in lane 5, the small
number
of clusters observed may be due to residual DNA template used to generate the
RNA
despite DNase treatment (Figure 6).
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
26
Lane 6 of Figure 6 demonstrates extension of a DNA strand against an RNA
template as expected. These extended templates were not expected to form
clusters since
they do not possess a P5 sequence. However, following tagmentation with a P5
adaptor
(q.e.d lane 6), they form clusters. The small number of clusters in lanes 5, 7
and 8
suggests there is a low level of DNA contamination in the RNA sample, but
shows that
the majority of clusters in lane 6 are generated from RNA.
The clusters on the flowcell were then sequenced. Table 1 shows the results of
sequencing.
Table 1. Sequencing Summary
Lane Lane Clusters Clusters l' Cycle %intensity %PF
%Align Alignment %Error Rate
0
Yield (raw) (PF) Int(PF) after 20 Clusters (PF)
Score (PF) (PF) k..)
cycles (PF)
c,.)
PhiX 1 116 177455+/- 161186+/- 289+/-9 86.80+/- 90388+/-
98.28+/- 166.43+/- 0.04+/-0.00 1--,
c,
11971 10237 0.97 1.64 0.22 0.00
l,1
-
PhiX 2 78 116338+1- 108649+/- 282+/-8 86.4+/-0.75 93.39+/-0.37 98.11+/-
166.03+/-0.11 0.05+/-0.01
3547 3484 0.07
PhiX+ 3 40 63725+/- 55752+/- 289+/-4 87.78+/- 87.49+/-0.34 58.26+/-
96.55+0.39 0.28+/-0.00
Tn 1557 1477 1.13 0.25
PhiX+ 4 23 42441+/- 32075+/- 267+/-16 88.48+/- 75.56+/-0.76 35.54+/-
57.81+/-0.99 0.49+/-0.02
0
Tn 1497 1307 1.77 0.63
2
0
RNA+ 5 3 13608+/- 4332+/- 295+/-54 121.18+/- 32.00+/-4.62 55.95+/-
49.00+/- 2.76+/-0.37
..
,,,
IV
..]
Tn 731 510 17.78 15.91 24.03
--.1 0,
N.
,
RNA+ 6 4 20916+/- 5701+/- 179+/-35 219.02+/- 26.98+/-6.47 25.45+/-
19.48+/- 2.77+1-0.70 ..
i
Tn 1519 1642 82.12 8.27 13.01
.
RNA+ ' 7 1 ' 22597+/- 1627+/- 190+1-65 104.24+/-
7.43+/-1.99 12.12+/- 3.69+/-2.40 ' 3.45+/-0.83 '
Tn+R 4274 317 35.64 6.14
NAse
RNA+ 8 1 45904+/- 1033+/- 178+/-22 ' 108.42+/-
2.26+/-0.35 41.32+/- 46.18+/- 1.47+/-0.72
Tn+R 10022 156 12.14 9.19 19.94
od
n
NAse
m
Lanes 1, 3, 5 and 7 were amplified with Phusion, not assumed to amplify RNA.
od
L.,
Lanes 2, 4, 6, and 8 were amplified with AMV-RT, which amplifies DNA and RNA.
-a-
uL
Sequencing for non-transposed lanes I and 2 with SBS3+T, for transposed lanes
3-8 with Nx RI primer. .L.,
LA
--4
Matrix and phasing adjusted, lanes 5-8 aligned to GFP
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
28
As expected, over 90% of clusters passed chastity filters for lane 1 and 2 and
of
these over 98% aligned to PhiX as expected (Table 1). Lanes 3 and 4 which
contained
tagmented DNA:DNA duplexes exhibited a 10-20% reduction in clusters passing
filter,
of which between 75-87% of clusters aligned to PhiX. Given that tagmentation
can
reduce the length of a template, in some cases to a length too short to align
effectively, a
reduction in cluster passing filters and aligning is not unexpected. The
clusters in lanes 7
and 8 should not sequence well since there should not be any template present
(with the
exception of contaminating DNA templates or undigested RNA stumps). As
expected
very few clusters passed filters: less than 7% of clusters passed filters of
which only 12%
aligned for the PHUSION DNA Polymerase extended templates and 41% aligned for
the
AMV-RT extended templates. Where no RNase treatment was done, only DNase, and
the RNA extended with Phusion 32% of clusters passed filters of which 56+1-16%
aligned (Lane 5, Table 1). This may be due to a combination of residual DNA
templates
and some extension of DNA opposite RNA by PHUSION DNA Polymerase . In
contrast, approximately 50% more clusters were observed in lane 6, where DNase
treated
RNA template was extended with AMV-RT and of which a similar % passed filter
(-27%) to lane 6 with 25% aligning.
The aligned data was used to generate coverage plots (Figure 7). Lanes 1-4
gave
complete genome coverage of PhiX as expected. The lanes containing tagmented
DNA
(lanes 3 and 4) gave more uneven coverage. Lanes 5-8, containing tagmented RNA
samples all showed partial coverage of the GFP, indicating that tagmentation
of template
has generated clusters. Given that some of this may derive from residual DNA
template,
lane 6 shows the widest coverage of the GFP template, indicating that AMV-RT
extended
RNA molecules have been tagmented successfully.
Example 2. RNA sequencing employing a tagmentation reaction of human samples.
A flosvcell with eight lanes was prepared comprising primers capable of
hybridizing to RNA molecules comprising a polyA tail as follows. Lane 1 was
grafted
with a standard oligo mix only comprising P5 and P7 oligos and lanes 2-8 were
grafted
with standard mix (P5 and P7 oligos) plus the capture oligo (i.e., the primer
comprising a
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
29
polyT sequence for binding to RNA molecules comprising a polyA tail). After
primer
grafting, the flowcell was stored in 4 C until it was used.
For lanes I and 2, 5 pM of PhiX control library samples were prepared and
added
to the flowcell for hybridization. For each lane 3-8, 400ng of RNA sample was
prepared
and added to the flowcell for hybridization. Lanes 3 and 4 contained human RNA
from
Clontech (Mountain View, CA). Lanes 5 and 6 contained human RNA from brain.
Lanes
7 and 8 contained universal human reference (UFIR) RNA. After template
hybridization,
wash buffer was administered through the flowcell for removal of un-hybridized
template. Hybridized templates were extended using AMV-RT (NEB, Ipswich, MA)
in
all lanes, which produced DNA:RNA duplexes in lanes 3-8.
While lanes 3-8 were contacted with a transposome complex, lanes I and 2 were
contacted with equivalent volume of wash buffer. Transposome complex mixes of
two
different concentrations were prepared. The mix for lanes 3, 5 and 7 was
prepared with
1.25 1 of transposome complex, 100 1 of buffer and 400p.1 of water. The mix
for lanes 4,
6 and 8 was prepared with 0.625p1 of transposome complex, 100111 of buffer and
400111 of
water. 95p.I of transposome complex mixes were added to lanes 3-8 of the
flowcell for
tagmentation. To remove the transposase after tagmentation, chaotropic buffer
was
added to lanes 3-8 of the flowcell and incubated for 2 minutes. The lanes of
the flowcell
were then washed twice. After washing, Bst enzyme was used for strand
displacement
extension of tagmented DNA:RNA duplexes to remove the non-transferred strand
of the
transposon and make the DNA strand of the DNA:RNA duplexes full length for
clustering. The RNA strands were removed and clusters were then generated
using
isothermal amplification. The clusters were then sequenced. Table 2 shows the
results of
sequencing.
Table 2. Sequencing Summary
0
111
Lane Sample Clusters Clusters l Cycle Int % int after
%PF % Align % Error
,..)
(raw) (PF) (PF) 20 cyc (PF) Clusters
(PF) Rate (PF) .
,...)
\ 0
1 PhiX DNA 73569+7- 68422 +/- 284+1-13 87.51+1-2.89
92.94+1-0.77 97.99+/-0.23 0.06+/-0.00 C1
l'4
2 primer 8007 7981
2 Ph iX DNA 18553+/- 11200+/- 206+/-10 99.83+1-6.39
60.00+1-4.34 1.55+1-1.36 8.78+1-1.60
3 primer 2932 2451
3 Clontech Ix 187046+/- 164971+/- 209+7-13 85.35+1-2.94
88.23+/-1.30 73.27+7-0.46 0.30+/-0.00
Tn5 29545 26054
p
2
4 Clontech 109889+7- 99558+/- 211+7-10 87.58+7-4.32 90.49+1-
1.19 73.91+1-0.56 0.27+/-0.02
.'
0.5x Tn5 13109 13108
0"
Brain lx 226164+/- 198031+/- 218+1-6 84.55+1-2.36 87.55+1-0.97
75.27+7-0.36 0.36+/-0.20
oi
Tn5 31941 28192
r
6 Brain 0.5x 125939+/- 113273+/- 212+7-12 86.85+7-
3.09 90.06+7-1.20 75.91+/-0.13 0.24+/-0.00
Tn5 21818 18279
7 UHR lx 310276+/- 269047+/- 195+1-7 86.77+7-2.14
86.75+7-1.68 67.70+7-0.38 0.27+/-0.04
Tn5 21976 17778
r)
8 UHR 0.5x 195323+/- 172838+/- 211+/-16 86.70+7-1.77
86.47+/-0.67 68.14+/-0.52 0.36+/-0.30
Tn5 16530 15327
,...)
-a-
uri
.6.
rJ1
I--,
=-=1
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
31
The sequencing results were compared to results obtained for standard RNA
sequencing of human brain RNA and universal human reference RNA, which was
carried
out according to standard Illumina sequencing methods using standard Illumina
sequencing reagents. Such methods are described in TruSeq RNA Sample
Preparation
Guide and HiSeq2000 User Guide. The guides and reagents are available from
Illumina,
Inc. (San Diego. CA). The results are shown in Table 3.
Table 3. Comparison of Tagmentation Method with Standard RNA Sequencing Method
Clontech RNA UHR RNA Brain RNA
Standard RNA Sequencing
c,4
Read 1 Read2 Readl Read2 Readl Read2
UHR UHR Brain Brain
c,
Total Clusters 16,000,000 16,000,000 16,000,000
PFC lusters 14,113,235 100% 100% 14,008,505 100%
100% 13,957,990 100% 100% 78,895,928 100%
80,670,795 100%
usableClusters 9,005,973 63.8% 62.6% 8,756,482 62.5% 60.9% 8,956,350 64.2%
61.1% 59,010,700 74.8% 59,821,123 74.2%
noMatch 622,294 4.4% 2.2% 600,138 4.3% 2.7% 484,158 3.5% 3.1 1,352,439
1.7% 1,503,346 1.9%
repeatMasked 4,484,041 31.8% 35.1% 4,651,421 33.2% 36.4% 4,517,061 32.4%
35.7% 18,525,758 23.5% 19,342,556 24%
spliceUsable 9,058 0.1% 4.9% 6,427 0% 3.3% 22,719
0.2% 7.0% 9,357,715 11.9% 6,959,693 8.6%
genomeUsable 8,996,915 63.7% 57.8% 8,750,055 62.5% 57.6% 8,933,631 64%
54.1% 49,652,985 62.9% 52,861,430 65.5%
chrM.fa 2,045,187 14.5% 14.1% 2,570,314 18.3% 17.9% 737,706
5.3% 5.3% 5,710,330 7.2% 10,414,460 12.9%
tol.)
Cs)
h umRi bosom al.fa 9,409 0.1% 0.1% 7,248 0.1% 0.1% 8,839
0.1% 0.1% 1,789,882 2.3% 2,349,250 2.9%
33
The results show normal alignment distribution for the RNA samples sequenced
using the tagmentation method provided herein. The results show higher repeat
masked
clusters likely due to higher numbers of polyA sequences and more repeats in
the 3' UTR
regions of the RNA samples analyzed by the tagmentation method. The usable
reads
were about 10% lower than for the standard RNA sequencing protocol again
likely due to
more repeats in the RNA that was analyzed. The amount of ribosomal RNA is low
as
would be expected since mRNA was isolated and sequenced in the tagmentation
method
provided herein. The mitochondrial RNA is within normal limits.
Example 3. RNA sequencing employing a tagmentation reaction and a cell lysate
This example demonstrates that nucleic acid templates can be captured,
tagmented and sequenced on a solid support using a crude cell lysate. Briefly,
mouse
cells were lysed using a Triton-XTm and Proteinasc K solution. The lysate was
applied to
a flowed, mRNA was captured and tagmented, and clusters were created and
sequenced.
As a control and for comparison, Universal Human Reference total RNA (UHR) was
also
captured, tagmented, clustered and sequenced. Table 4 synopsis the results of
duplicate
reads for each sample type.
Table 4. Sequencing data comparison between UHR and lysate mRNA
UHR mouse cell lysate
R1 R2 R1 R2
total reads 4,726,081 1,905,434
%PF 86.89% 84.59% 83.94% 84.79%
aligned (of %PF reads) 61.14% 73.97% 49.17% 68.16%
unaligned 28.42% 12.00% 34.01% 8.45%
(of %PF reads)
abundant
(of %PF reads) 10.44% 14.03% 16.82% 23.39%
spliced alignments (% of aligned bases) 0.80% 11.14% 0.62%
10.73%
spliced alignments 0.4893 8.2435 0.3054 7.3138
(of % PF reads)
human Ribosomal 0.21% 0.04% 3.98% 4.88%
human 5Sr 0.01% 0.01% 0.02% 0.17%
median insert 135 129
SD insert 67.99 66.97
duplicates 41.66% 45.54%
CA 2864276 2019-04-16
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
34
Table 4 demonstrates that sequence was obtained directly from mRNA captured
from a crude mouse cell lysate. The percentage of aligned reads dropped only
about 10%
when mRNA was captured directly from crude cell lysates compared to the UHR
RNA
sample (aligned of % PF reads). Further sequencing data comparing the UHR
control
with mouse lysate derived mRNA reported that the correct strand was captured
and
aligned at >97% for both the UHR and the mRNA from the mouse lysate. Further,
coverage was comparable between the UHR control and the mRNA from lysate;
roughly
65% untranslated region (UTR), roughly 16% coding region, roughly 13%
intergenic
region, and small percentage intronic reads. As such, the present methods can
be used to
capture, tagment, cluster and sequence mRNA from crude lysates.
Example 4: RNA sequencing employing a tagmentation reaction from whole mRNA
transcript
This experiment was performed to demonstrate that a mRNA sample representing
a whole transcript could be captured and tagmented on a solid support to
provide
sequence information following methods disclosed herein. Briefly,
polyA RNA enrichment was performed from 50ug of UHR total RNA (Agilent) using
the
PolyA Purist Kit (Ambion). RNA fragmentation of the enriched polyA mRNA was
done
in 25 ul of 1X T4 PNK Buffer (Epicentre) with 10Ong of polyA RNA, wherein the
sample
was heated to 95 C for 5 min and chilled on ice. The fragmented RNA was
phosphorylated with T4 PNK and the fragments were polyA tailed using 4 units
of E. coli
PolyA polymerase in 50u1 of 2X PolyA polymerase buffer containing 2 mM ATP
(Epicentre). The polyadenylated fragmented mRNA was purified using the RNA
Clean
and Concentration kit (Zymo Research). Controls included a PhiX control to
validate the
sequencing chemistry performance and a non-total mRNA derived polyadenylated
sample that was captured and tagmented to compare with the mRNA whole
transcript
captured from the complex total RNA UHR pool.
Sequencing data from replicate I (R1) of 2 is reported in Table 5 for the PhiX
control (ctrl) control mRNA sample (3' capture) and mRNA derived from the
total RNA
sample (whole transcript).
Table 5. Replicate sequence summary for whole mRNA transcript
0
Sample 1st intensity
Alignment Mean
Clusters Clusters Cycle % PF
>=Q30 Quality
R1 Yield after 20 Clusters
bases SCore
Align Score Mismatch r.)
(raw) (PF) Int
(Mb) cycles (PF)
(PF) Rate (PF)
(PF) (PF) (PF)
(PF)
ctrl
317 7,079,810 6,343,692 268 86.78 89.6 97.89 251.82 0.15 98.35 39.12
3' capture 1,077 28,753,789 21,543,617 290
85.17 74.92 57.15 75.08 0.74 92.34 36.58
whole
752 19,474,750 15,040,807 323 83.03 77.23 49.85
70.27 1.63 91.89 36.51
transcript
1-q
ur.
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
36
Table 5 reports that the percentage of aligned reads was comparable regardless
of
the mRNA source (% align (PF)) with high cluster generation. Additionally,
sequence
data showed that transcript coverage of the control mRNA (3' capture) was
approximately 70% UTR, 19% coding region followed by intergenic and intronic
region
coverage. Transcript coverage of the mRNA derived from complex total RNA was
approximately 43% UTR, 37% coding and relatively similar for intergenic and
intronic
regions. Figure 10 demonstrates aligned transcript coverage for a
representative gene,
GAPDH; the control mRNA (3' capture) shows coverage mainly in the 3' region of
the
gene as expected, whereas coverage from the total RNA derived mRNA (whole
transcript) shows more complete coverage of both the exonic and the UTR
regions. As
such, while the control mRNA sequences aligned to those regions associated
with the 3'
end of a transcript (the polyA tail region), the coverage from the mRNA
derived from the
total RNA demonstrated more complete, whole transcript reads, thereby
demonstrating
the utility of the methods for obtaining whole transcript information from a
sample.
An alternative workflow was also performed to enrich the mRNA from a UHR
total RNA sample for whole transcript sequencing. Double stranded cDNA was
prepared
from 500ng of UHR total RNA and 50 ng random DNA hexamers. Excess primers were
degraded by adding 20 units of Exonuclease I (Epicentre), incubating at 37 C
for 30 min
followed by enzyme heat inactivation. RNA was removed by an enzyme mix of 1U
RNase I/10 U Hybridase (RNAse H, Epicentre) at 55 C for 10 min. The reaction
was
purified using equal volumes of AMPure beads (Agencourt) and DNA was eluted in
a
10mM Tris HCl (pH8.0) buffer. The cDNA was polyA tailed using 20 U Terminal
Transferase (New England Biolabs), 1mM ATP and IX Transferase buffer,
incubating
37 C for 10 min. followed by heat inactivation. For some of the samples, a
1:10 dilution
of the random DNA hexamers was utilized. Further, for some of the samples the
Exonuclease I step was omitted. The samples were then applied to a flowcell,
captured,
tagmented, clustered and sequenced. Controls included PhiX control (ctrl), non
tailed
cDNA (non tailed ctrl), a dsDNA negative control, and a purified mRNA sample
that
followed the same method as described above, except using random RNA hexamers
and
omitting the Exonuclease I step.
Table 6 summarizes the first of two replicate sequencing runs.
Table 6. Replicate sequence summary for alternative whole mRNA transcript
0
No
=
c..) _
Mean
1st
c..)
1st intensity %
% >=Q30 ,--.
Yield Clusters Clusters % PF %Align
Alignment Quality
c,
R1 Cycle Int
after 20 Mismatch bases r.)
(Mb) (raw) (PF) Clusters (PF)
Score (PF) SCore
(PF) cycles
Rate (PF) (PF)
(PF)
(PF)
Lane 1-
227 7,040,939 6,480,317 317 89.58 92.04 98.16
165.52 0.08 98.25 38.88
PhiX ctrl
Lane 2-
3 773,384 76,281 246 84.82 9.86 0.15 0.05 5.04
42.11 20.13
No tail ctrl ,
Lane 3-
RNAse, 62 3,504,536 1,783,482 420 75.32 50.89
20.14 13.65 1.29 85.96 34.57
P
AMP, tail
2
Lane 4-
00
cn
15 1,353,520 429,352 339 91.53 31.72 8.37 6.38
1 62.02 27.88 .
1:10
.
Lane 5-
Exo,
.
'
97 4,922,187 2,774,812 373 83.4 56.37 40.74 27.62 1.47 86.68 34.8 .
RNAse,
00
H
AMP, tail
Lane 6-
7 844,731 198,052 317 79.07 23.45 13.09 6.81 1.38
42.76 21.15
1:10
Lane7-
RNA 29 2,164,633 840,373 377 92.34 38.82
17.28 13.89 0.7 79.14 32.88
primers
Lane 8-
8 852,450 219,356 311 97.61 25.73 1.3 0.32 2.61
48.15 23.6
ds cDNA
od
(")
1-3
od
t.0
0
1--,
Ce4
CA
.6.
fli
1--,
--I
CA 02864276 2014-08-11
WO 2013/131962
PCT/EP2013/054517
38
Table 6 demonstrates that the method of preparation of treating a sample with
nucleases, Exo I and RNases H and I, following by bead purification and polyA
tailing
(Exo, RNAse, AMP, tail) can be used to provide a whole mRNA transcript sample
for
sequencing. Figure 9 shows pictures of clustering on the flowcell with respect
to the
different conditions identified in Table 6. Lanes 1-8 in Table 1 correspond to
the Lanes
1-8 in Figure 9. The PhiX positive control shows a large number of clusters
which
corresponds to the highest yield and cluster count in the sequencing data. The
negative
control lanes 2 and 8, which show low number of clusters also correspond to
two of three
the lowest yield and cluster counts in the sequencing data. Diluting the
random DNA
hexamer primers 1:10, regardless of exonuclease digestion in the preparation
method,
was not optimal for sequencing, showing low cluster count in Table 6 supported
by fewer
clusters seen on Figure 9. The method using RNAse H and I with Exonuclease I
during
sample preparation of whole mRNA transcripts resulted in the greatest numbers
of
clusters generated as well as % alignment after the PhiX positive control,
followed by the
preparation method where Exonuclease I digestion was not practiced. Further,
the
percentage of aligned reads (% align (PF)) are highest for Lane 5 and Lane 3,
respectively, among the test Lanes. The results demonstrate that the
alternative method
described in this example for generating cDNA can be used to provide whole
mRNA
transcript information by sequencing using the capture and tagmentation
methods
described in this application.
Additional options for sample preparation include, but are not limited to,
utilizing
the disclosed methods for sequencing RNA from species that do not have
polyadenylated
RNA, such as bacterial mRNA. In this case, ribosomal RNA could first be
removed and
the remaining mRNA could be fragmented and polyA tailed as previously
described. The
mRNA could then be captured, tagmented, cluster amplified and sequenced as
described
above.
These results show that a variety of different types of RNA samples and DNA
samples derived from RNA samples can be sequenced using the methods provided
herein
and that the methods provided herein provide approximately equivalent sequence
results
to current standard RNA sequencing protocols.
