Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02891153 2015-05-12
'WO 2012/071040 PCT/U621310/058011
=
=
BRASSICA GAT EVENT DP-073496-4 AND COMPOSITIONS AND METHODS FOR
THE IDENTIFICATION AND/OR DETECTION THEREOF
REFERENCE TO A SEQUENCE USTING SUBMITTED AS A TEXT FILE VIA EFS-
WEB
The official copy of the sequence listing is submitted concurrently with the
specification as a text file via EFS-Web. In compliance with the American
Standard
Code for Information Interchange (ASCII), with a file name of
399080seglist.txt, a
creation date of November 24, 2010, and a size of 40 Kb. The sequence listing
filed
via EFS-Web is part of the specification.
FIELD OF THE INVENTION
This Invention Is in the field of molecular biology. More specifically, this
Invention pertains to expression of a sequence that confers tolerance to
glyphosate.
BACKGROUND OF THE INVENTION
The expression of foreign genes in plants is known to be Influenced by their
location in the plant genome, perhaps due to chromatin structure (e.g.,
heterochromatin) or the proximity of transcriptional regulatory elements
(e.g.,
enhancers) close to the integration site (VVeising, at al., (1988) Ann. Rev.
Genet
22:421-477). At the same time the presence of the transgene at different
locations in
the genome influences the overall phenotype of the plant in different ways.
For this
reason, it Is often necessary to screen a large number of events In order to
Identify an
event characterized by optimal expression of an introduced gene of interest.
For
example, it has been observed in plants and in other organisms that there may
be a
wide variation in levels of expression of an introduced gene among events.
There may
also be differences in spatial or temporal patterns of expression, for
example,
differences In the relative expression ota iransgene in various plant tissues,
that may
not correspond to the patterns expected from transcriptional regulatory
elements
present in the introduced gene construct_ It Is also Observed that the
transgene
Insertion can affect the- .endogenous gene expression.. For these reasons, it
is
common to produce hundreds to thousands of different events and screen those
1
=
CA 02891153 2015-05-12
WO 2012/071040
PCT/US2010/058011
events for a single event that has desired transgene expression levels and
patterns for
commercial purposes. An event that has desired levels or patterns of transgene
expression is useful for introgressing the transgene into other genetic
backgrounds by
sexual outcrossing using conventional breeding methods_ Progeny of such
crosses
maintain the transgene expression characteristics of the original
transformant. This
strategy is used to ensure reliable gene expression in a number of varieties
that are
well adapted to local growing conditions.
It would be advantageous to be able to detect the presence of a particular
event in order to determine whether progeny of a sexual cross contain a
transgene of
interest. In addition, a method for detecting a particular event would be
helpful for
= complying with regulations requiring the pre-market approval and labeling
of foods
derived from recombinant crop plants or for use in environmental monitoring,
monitoring traits In crops in the field or monitoring products derived from a
crop
harvest, as well as for use in ensuring compliance of parties subject to
regulatory or
contractual terms.
In the, commercial production of crops, it is desirable to easily and quickly
eliminate unwanted plants (i.e., "weeds") from a field of crop plants. An
ideal treatment
would be one which could be applied to an entire field but which would
eliminate only
the unwanted plants while leaving the crop plants unharmed. One such treatment
system would involve the use 'of crop plants which are tolerant to an
herbicide so that
when the herbicide was sprayed on a field of herbicide-tolerant crop plants,
the crop
plants would continue to thrive while non-herbicide-tolerant weeds were killed
or
severely damaged.
Due to local and regional variation in dominant weed species as well as
preferred crop species, a continuing need exists for customized systems of
crop
protection and weed management which can be adapted to the needs of a
particular
region, geography, and/or locality. Method and compositions that allow for the
rapid
identification of events in plants that produce such qualities are needed. For
example,
a continuing need exists for methods of crop protection and weed management
which
can reduce the number of herbicide applications necessary to control weeds in
a field,
reduce the amount of herbicide necessary to control weeds in a field, reduce
the
amount of tilling necessary to produce a crop, and/or delay or prevent the
development
and/or appearance of herbicide-resistant weeds. A continuing need exists for
methods
and compositions of crop protection and weed management which allow the
targeted
use of a particular herbicide and for the efficient detection of such an
event.
2
CA 02891153 2015-05-12
BRIEF SUMMARY OF THE INVENTION
Compositions and methods related to transgenic glyphosate-tolerant Brassica
plants are provided. Specifically, the present invention provides Brassica
plants
containing a transgene which imparts tolerance to glyphosate. The event may
be, for
example, DP-073496-4. The Brassica plant harboring the transgene at the
recited
chromosomal location comprises unique genomic/transgene junctions having at
least
the polynucleotide sequence of SEQ ID NO: 2 or at least the polynucleotide
sequence of SEQ ID NO: 12 and/or 13. Further provided are the seeds deposited
as
Patent Deposit Number PTA-11504 and plants, plant cells, plant parts, seed and
plant products derived therefrom. Characterization of the genomic insertion
site of
DP-073496-4 or any other event comprising integration of the glyphosate-
tolerance
transgene provides for an enhanced breeding efficiency and enables the use of
molecular markers to track the transgene insert in the breeding populations
and
progeny thereof. Various methods and compositions for the identification,
detection,
and use of the glyphosate-N-acetyltransferase ("GAT" or "glyat")
transformation event
in Brassica are provided.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows synthesis of plasmid PHP28181. Plasmid PHP28181 was
used to produce the GAT Brassica lines.
Figure 2 provides a schematic map of plasmid PHP28181.
Figure 3 provides a schematic map of insertion DNA, fragment PHP28181A.
Figure 4 provides a schematic representation of fragment A from PHP28181
(PHP28181A), specifically a schematic map of Hind III/Not I fragment
(PHP28181A)
containing the gat4621 gene cassette that was used for plant transformation to
generate DP-073496-4 Brassica. The fragment size is 2112 bp. The construct-
specific primer locations of 09-0-3290/09-0-3288 are indicated on the map.
Figure 5 Southern analysis of Construct Specific PCR of Leaf DNA From DP-
073496-4 Brassica and Non-Genetically Modified Control Brassica. PCR
amplification with primer set 09-0-3290/09-0-3288 targeting the unique
ubiquitin
promoter and gat4621 junction present in DP-073496-4canola. Expected PCR
amplicon size is 675 bp.
Figure 6 Southern analysis of Brassica FatA gene PCR of leaf DNA from DP-
073496-4 Brassica and Non-Genetically Modified Control Brassica. PCR
amplification of endogenous brassica FatA gene with primer set 09-0-2812/09-
02813
as positive control for PCR amplification. Expected PCR amplicon size is 506
bp.
- 3 -
CA 02891153 2015-05-12
WO 2012/071040
PCT/US2010/058011
DETAILED DESCRIPTION OF THE INVENTION
The present inventions now will be described more fully hereinafter with
reference to the accompanying drawings, in which some, but not all embodiments
of
the inventions are shown. Indeed, these inventions may be embodied in many
different forms and should not be construed as limited to the embodiments set
forth
herein; rather, these embodiments are provided so that this disclosure will
satisfy
applicable legal requirements. Like numbers refer to like elements throughout.
Many modifications and other embodiments of the inventions set forth herein
will come to mind to one skilled in the art to which these inventions pertain
having the
benefit of the teachings presented in the foregoing descriptions and the
associated
drawings. Therefore, it is to be understood that the inventions are not to be
limited to
the specific embodiments disclosed and that modifications and other
embodiments are
intended to be included within the scope of the appended claims. Although
specific
terms are employed herein, they are used in a generic and descriptive sense
only and
not for purposes of limitation.
Compositions and methods related to transgenic glyphosate-tolerant Brassica
plants are provided. Specifically, the present invention provides Brass/ca
plants
= having event DP-073496-4 or another event comprising PHP28181A or an
operable
fragment or variant thereof. A Brass/ca plant having' event DP-073496-4, for
example,
has been modified by the insertion of the glyphosate acetyltransferase
(glyat4621)
gene derived from Bacillus licheniformis. The glyat4621 gene was. functionally
improved by a gene shuffling process to optimize the kinetics of glyphosate
acetyltransferase (GLYAT) activity for acetyiating the herbicide glyphosate.
The
Insertion of the glyat4621 gene in the plant confers tolerance to the
herbicidal active
ingredient glyphosate through the conversion of glyphosate to the non-toxic
acetylated
form. Thus, a Brassica plant having the event DP-073496-4 is tolerant to
glyphosate.
The polynucleoticles conferring the glyphosate tolerance are inserted at a
specific position in the Brassica genome and thereby produce, for example, the
DP-
073496-4 event. A Brassica plant harboring the DP-073496-4 event at a specific
chromosomal location comprises genomic/transgene junctions having a unique
polynucleotide sequence exemplified by SEQ ID NO: 2 or at least the
polynucleotide
sequence of SEQ ID NO: 12 and/or 13; SEQ ID NO: 14 and/or 15; or SEQ ID NO: 16
and/or 17. The characterization of the genomic insertion site of either event
provides
for an enhanced breeding efficiency arid enables the use of molecular markers
to track
the transgene insert in the breeding populations and progeny thereof. Various
methods and compositions for the identification, detection, and use of the
Brass/ca
DP-073496-4 event are Provided herein. In one embodiment, a brassica plant
having
4
CA 02891153 2015-05-12
in its genome in the following order: a polynucleotide comprising SEQ ID NO:
12, a
polynucleotide encoding a glyphosate-N-acetyltransferase and a polynucleotide
comprising SEQ ID NO: 13 is provided. The term "event DP-073496-4 specific"
refers to a polynucleotide sequence which is suitable for discriminatively
identifying
event DP-073496-4 in plants, plant material, or in products such as, but not
limited to,
oil produced from the seeds, or food or feed products (fresh or processed)
comprising, or derived from, plant material.
Compositions further include seed deposited as Patent Deposit Numbers
PTA-11504 and plants, plant cells, and seed derived therefrom. Applicant(s)
have
made a deposit of at least 2500 seeds of Brassica event DP-073496-4 with the
American Type Culture Collection (ATCC), Manassas, VA 20110-2209 USA on
November 24, 2010 and the deposit will be maintained under the terms of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms
for the Purposes of Patent Procedure. Deposits are made merely as a
convenience
for those of skill in the art and are not an admission that a deposit is
required under
35 U.S.C. 112. The seeds deposited with the ATCC are taken from the deposit
maintained by Pioneer Hi-Bred International, Inc., 7250 NW 62nd Avenue,
Johnston,
Iowa 50131-1000. Access to this deposit will be available during the pendency
of the
application to the Commissioner of Patents and Trademarks and persons
determined
by the Commissioner to be entitled thereto upon request. Upon allowance of any
claims in the application, the Applicant(s) will make available to the public,
pursuant
to 37 C.F.R. 1.808, sample(s) of the deposit. The deposit of seed comprising
Brassica event DP-073496-4 will be maintained in the ATCC depository, which is
a
public depository, for a period of 30 years or 5 years after the most recent
request or
for the enforceable life of the patent, whichever is longer and will be
replaced if it
becomes nonviable during that period. Additionally, Applicant(s) will have
satisfied
all the requirements of 37 C.F.R. 1.801 - 1.809, including providing an
indication of
the viability of the sample upon deposit. Applicant(s) have no authority to
waive any
restrictions imposed by law on the transfer of biological material or its
transportation
in commerce. Applicant(s) do not waive any infringement of their rights
granted
under this patent or rights applicable to event DP-073496-4 under the Plant
Variety
Protection Act (7 USC 2321, et seq.). Unauthorized seed multiplication
prohibited.
The seed may be regulated.
As used herein, the term "Brassica" means any Brassica plant and includes
all plant varieties that can be bred with Brassica. As used herein, the term
plant
includes plant cells, plant organs, plant protoplasts, plant cell tissue
cultures from
which plants can be regenerated, plant calli, plant clumps and plant cells
that are
- 5..
CA 02891153 2015-05-12
intact in plants or parts of plants such as embryos, pollen, ovules, seeds,
leaves,
flowers, branches, fruit,
- 5A -
1
CA 02891153 2015-05-12
W02012/071040 PCT/US2010/058011
stalks, roots, root tips, anthers, and the like. Mature seed produced may be
used for
food, feed, fuel or other commercial or Industrial purposes or for purposes of
growing
or reproducing the species. Progeny, variants and mutants of the regenerated
plants
are also included within the scope of the invention, provided that these parts
comprise
a DP-073496-4 event.
A transgenic "event" is produced by transformation of plant cells with a
heterologous DNA construct(s) including a nucleic acid expression cassette
that
comprises a transgene of interest, the regeneration of a population of plants
from cells
which each comprise the inserted transgene and selection of a particular plant
characterized by insertion into a particular genome location. An event is
characterized
phenotypically by the expression of the transgene(s). At the genetic level, an
event Is
part of the genetic makeup of a plant. The term "event" also refers to
progeny,
produced by a sexual outcross between the transformant and another variety,
that
include the heterologous DNA. Even after repeated back-crossing to a recurrent
parent, the inserted DNA and flanking DNA from the transformed parent are
present in
the progeny of the cross at the same chromosomal location. The term "event"
also
refers to DNA from the original transformant comprising the inserted DNA and
flanking
sequence immediately adjacent to the inserted DNA that would be expected to be
transferred to a progeny as the result of a sexual cross of one parental line
that
includes the Inserted DNA (e.g., the original transformant and progeny
resulting from
selfing) and a parental line that does not contain the inserted DNA.
As used herein, "insert DNA" refers to the heterologous DNA within the
expression cassettes used to transform the plant material while "flanking DNA"
can
comprise either genomIc DNA naturally present in an organism such as a plant,
or
foreign (heterologous) DNA introduced via the transformation process which is
extraneous to the original insert DNA molecule, e.g. fragments associated with
the
transformation event. A "flanking region" or "flanking sequence' as used
herein refers
to a sequence of at least 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 250001
5000
base pairs or greater which Is located either immediately upstream of and
contiguous
With, or immediately downstream of and contiguous with, the original foreign
insert
DNA molecule. Non-limiting examples of the flanking regions of the DP-073496-4
event comprise polynucleotide sequences that are set forth in SEO ID NO: 2, 8
and/or
9 and variants and fragments thereof.
Transformation procedures leading to random integration of the foreign DNA
will result in transformants containing different flanking regions
characteristic of and
unique for each transformant. When recombinant DNA is introduced into a plant
through traditional crossing, its flanking regions will generally not be
changed.
6
CA 02891153 2015-05-12
W02012/071040 PCT/US2010/058011
Transformants will also contain unique junctions between a piece of
heterologous
insert DNA and genomic DNA or two pieces of genomic DNA or two pieces of
heterologous DNA. A "junction' is a point where two specific DNA fragments
join. For
example, a junction exists where insert DNA joins flanking DNA. A junction
point also
exists in a transformed organism where two DNA fragments join together In a
manner
that is modified from that found in the native organism. As used herein,
"junction DNA"
refers to DNA that comprises a junction point. Non-limiting examples of
junction DNA
from the DP-073496-4 event are forth in SEQ ID NO: 2, 11, 12, 13, 14, 15, 16,
17, 18,
and/or 19 or variants and fragments thereof.
A DP073496-4 plant can be bred by first sexually crossing a first parental
Brassica plant grown from the transgenic DP-073496-4 Brassica plant (or
progeny
thereof derived from transformation with the expression cassettes of the
embodiments
of the present invention that confer herbicide tolerance) and a second
parental
Brassica plant that lacks the herbicide tolerance phenotype, thereby producing
a
plurality of first progeny plants and then selecting a first progeny plant
that displays the
desired herbicide tolerance and selling the first progeny plant, thereby
producing a
plurality of second progeny plants and then selecting from the second progeny
plants
which display the desired herbicide tolerance. These steps can further include
the
back-crossing of the first herbicide tolerant progeny plant or the second
herbicide
tolerant progeny plant to the second parental Brassica plant or a third
parental
Brassica plant, thereby producing a Brassica plant that displays the desired
herbicide
tolerance. It is further recognized that assaying progeny for phenotype is not
required.
Various methods and compositions, as disclosed elsewhere herein, can be used
to
detect and/or identify the DP0734964 or other event,
Two different transgenic plants can also be sexually crossed to produce
offspring that contain two independently-segregating exogenous genes. Selfing
of
appropriate progeny can produce plants that are homozygous for both exogenous
genes. Back-crossing to a parental plant and out-crossing with a non-
transgenic plant
are also contemplated, as is vegetative propagation. Descriptions of other
breeding
methods that are commonly used for different traits and crops can be found in
one of
several references, e.g., Fehr, in Breeding Methods for Cultivar Development,
Moos,
ed., American Society of Agronomy, Madison Wis. (1987).
The term "germplasm" refers to an individual, a group of individuals or a
clone
representing a genotype, variety, species or culture or the genetic material
thereof.
A "line" or "strain" is a group of individuals of identical parentage that are
generally inbred to some degree and that are generally isogenic or near
isogenic.
7
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
Inbred lines tend to be highly homogeneous, homozygous and reproducible.
Many analytical methods are available to determine the homozygosity and
phenotypic
stability of inbred lines,
The phrase "hybrid plants" refers to plants which result from a cross between
genetically different individuals.
The term "crossed" or "cross in the context of this invention means the fusion
of gametes, e.g., via pollination to produce progeny (i.e., cells, seeds, or
plants) in the
case of plants. The term encompasses both sexual crosses (the pollination of
one
plant by another) and, in the case of plants, selfing (self-pollination, i.e.,
when the
pollen and ovule are from the same plant).
The term "introgression refers to the transmission of a desired allele of a
genetic locus from one genetic background to another. In one method, the
desired
alleles can be Introgressed through a sexual cross between two parents,
wherein at
least one of the parents has the desired allele in its genome.
In some embodiments, the polynucleotides conferring the brassica DP-073496-
4 event of the invention are engineered into a molecular stack. In other
embodiments,
the molecular stack further comprises at least one additional polynucleotide
that
confers tolerance to a second herbicide. In one embodiment, the sequence
confers
tolerance to. glufosinate, and in a specific embodiment, the sequence
comprises pat
gene. In another embodiment, the additional polynucleotide provides tolerance
to
ALS-inhibitor herbicides.
In other embodiments, an event of the invention comprises one or more traits
of interest, and in more specific embodiments, the plant is slacked with any
combination of polynucleotide sequences of interest in order to create plants
with a
desired combination of traits. A trait, as used herein, refers to the
phenotype derived
from a particular sequence or groups of sequences. For example, herbicide-
tolerance
polynucleotides may be stacked with any other polynucleotides encoding
polypeptides
having pesticidal and/or insecticidal activity, such as Bacillus thuringiensis
toxic
proteins (described in US Patent Numbers 5,366,892; 5,747,450; 5,737,514;
5,723,756; 5,593,881; Geiser, et al., (1986) Gene 48:109; Lee, et al., (2003)
App!.
Environ. Microbic/. 69:4648-4657 (Vip3A); Galitzky, et at, (2001) Acta
Crystallogr. D.
Biol. Crystallogr. 57:1101-1109 (Cry38b1) and Herman, et aL, (2004) J. Agric.
Food
Chem. 52:2726-2734 (Cry1F)), lectins (Van Demme, of al., (1994) Plant Mot.
Biol.
24:825, pentin (described in US Patent Number 5,981,722), and the like. The
combinations generated can also include multiple copies of any one of the
polynucleotides of interest. .
8
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
In some embodiments, an event of the invention may be stacked with other
herbicide-tolerance traits to create a transgenic plant of the invention with
further
improved properties. Other herbicide-tolerance polynucleotides that could be
used in
such embodiments Include those conferring tolerance to glyphosate by other
modes of
action, such as, for example, a gene that encodes a glyphosate oxido-reductase
enzyme as described more fully in US Patent Numbers 5,776,760 and 5,463,175.
Other traits that could be combined with an event of the invention include
those
derived from polynucleotides that confer on the plant the capacity to produce
a higher
level of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), for example, as
more
fully described in US Patent Numbers 6,248,876 81; 5,627,061; 5,804,425;
5,633,435;
5,145,783; 4,971,908; 5,312,910; 5,188,642; 4,940,835; 5,866,775; 6,225,114
81;
6,130,366; 5,310,667; 4,535,060; 4,789,061; 5,633,448; 5,510,471; Re. 36,449;
RE
37,287 E and 5,491,288 and Intemational Publication Numbers WO 97/04103; WO
00/66746; WO 01/66704 and WO 00/66747. Other traits that could be combined
with
the an event of the invention include those conferring tolerance to
sulfonylurea and/or
imidazolinone, for example, as described more fully in US Patent Numbers
5,605,011;
5,013,659; 5,141,870; 5,767,361; 5,731,180; 5,304,732; 4,761,373; 5,331,107;
5,928,937 and 5,378,824 and International Publication Number WO 96/33270.
In some embodiments, an event of the invention may be stacked with, for
example, hydronrphenylpyruvatedioxygenases which are enzymes that catalyze the
reaction in which para-hydroxyphenylpyruvate (HPP) is transformed into '
homogentisate. Molecules which inhibit this enzyme and which bind to the
enzyme in
order to inhibit transformation of the HPP into homogentisate are useful as
herbicides.
Traits conferring tolerance to such herbicides in plants are described in US
Patent
Numbers 6,245,968 81; 6,268,549 and 6,069,115 and International Publication
Number WO 99/23886. Other examples of suitable herbicide-tolerance traits that
could be stacked with an event of the invention include aryloxyalkanoate
dioxygenase
polynucleotides (which reportedly confer tolerance to 2,4-D and other phenoxy
auxin
herbicides as well as to aryloxyphenoxypropionate herbicides as described, for
example, in International Publication WO 05/107437) and dicarnba-tolerance
polynucleotides as described, for example, in Herman, et al., (2005) J. Biol.
Chem.
280:24759-24767.
Other examples of herbicide-tolerance traits that could be combined with an
event disclosed herein include those conferred by polynucleotides encoding an
exogenous phosphinothricin acetyltransferase, as described in US Patent
Numbers
5,969,213; 5,489,520; 5,550,318; 5,874,265; 5,919,675; 5,561,236; 5,648,477;
5,646,024; 6,177,616 and 5,879,903. Plants containing an exogenous
9
CA 028 91153 2 015- 05-12
WO 2012/071040 PCT/US2010/058011
phosphinothricin acetyitransferase can exhibit Improved tolerance to
gtufosinate
herbicides, which inhibit the enzyme glutamine synthase. Other examples of
herbicide-tolerance trans that could be combined with an event disclosed
herein
Include those conferred by polynucleofides conferring altered
protoporphyrinogen
oxidase (protox) activity, as described in US Patent Numbers 6,288,306 31;
6,282,837
131 and 5,767,373 and International Publication Number WO 01/12825. Plants
containing such polynucleotides can exhibit Improved tolerance to any of a
variety of
herbicides which target the protox enzyme (also referred to as 'protox
inhibitors').
In other embodiments, an ALS inhibitor-tolerant trait is combined with the
event
= 10 disclosed herein. As used herein, an "ALS Inhibitor-tolerant
polypeptide" comprises
any polypeptide which when expressed in a plant confers tolerance to at least
one ALS
inhibitor. A variety of ALS Inhibitors are known and include, for example,
sulfonylure-a,
imidazolinone, triazolopyrimidines, pryimfdinyoxy(thio)benzoates, and/or
sulfonylamlnocarbonyitriazolinone herbicide. Additional ALS inhibitors are
known and
are disclosed elsewhere herein. It is known in the art that ALS mutations fall
into
different classes with regard to tolerance to sulfonylureas, imidazolinones,
trlazolopyrimidines, and pyrimidlnyl(thio)benzoate,s, including mutations
having the
following characteristics: (1) broad tolerance to all four of these groups;
(2) tolerance
to Imidazolinones and pyrImIdinyl(thlo)benzoates; (3) tolerance to
sulfonylureas and
triazolopyrimidines; and (4) tolerance to sulfonytureas and imidazotinones.
Various ALS inhibitor-tolerant polypeptides can be employed. In some
embodiments, the ALS Inhibitor4olerant polynucleolides contain at least one
nucleotide mutation resulting in one amino acid change In the ALS polypeptide.
In
specific embodiments, the change occurs In one of seven substantially
conserved
regions of acetolactate synthase. See, for example, Hattori et al. (1995)
Molecular
Genetics and Genomes 240:419-425; Lee et (1998) EMBO Journal 7:1241-1248;
Mazur etal. (1289) Ann. Rev. Plant Phys, 40:441-470; and U.S. Patent No.
5,605011.
The ALS Inhibitor-tolerant
polypeptide can be encoded by, for example, the SuRA or SuRB focus of ALS. In
specific embodiments, the ALS inhibitor-tolerant polypepilde comprises the C3
ALS
mutant, the HRA ALS mutant, the S4 mutant or the S4/HRA mutant or any
combination thereof. Different mutations in ALS are known to confer tolerance
to
different herbicides and groups (and/or subgroups) of herbicides; see, e.g.,
Tranel and
Wright (2002) Weed Science 50:700-712. Sae also, U.S. Patent No. 5,605,011,
5,378,824, 5,141,870, and 5,013,659.
See also, SEQ ID NO:65 comprising a soybean HRA
sequence; SEQ ID NO:66 comprising a maim HRA sequence; SEQ ID NO:67
=
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
comprising an ArabldopsIs HRA sequence; and SEQ ID NO:86 comprising an HRA
sequence used In cotton. The HRA mutation In ALS finds particular use In one
embodiment of the invention. The mutation results in the production of an
acetolactate
synthase polypeptIde which Is resistant to at least one ALS Inhibitor
chemistry in
comparison to the wild-type protein. For example, a plant expressing an ALS
Inhibitor-
tolerant polypeptide may be tolerant of a dose of sulfonylurea, imidazolinone,
triazolopyrimidines, prylmidinyloxy(thio)benzoates, and/or
sulfonylaminocarbonyltriazolinone herbicide that is at least 2, 3, 4, 5, 6, 7,
8, 9, 10, 15,
20, 25, 30, 35, 40, 50, 70, 80, 100, 125, 150, 200, 500, or 1000 times higher
than a
dose of the herbicide that would cause damage to an appropriate control plant.
In
some embodiments, an ALS inhibitor-tolerant polypeptide comprises a number of
mutations. Additionally, plants having an ALS inhibitor polypeptide can be
generated
through the selection of naturally occurring mutations that impart tolerance
to
glyphosate.
In some embodiments, the ALS inhibitor-tolerant polypeptlde confers tolerance
to sulfonylurea and imidazolinone herbicides. Sulfonylurea and imidazolinone
herbicides inhibit growth of higher plants by blocking acetolactate synthase
(ALS), also
known as, acetohydroxy acid synthase (AHAS). For example, plants containing
particular mutations In ALS (e.g., the S4 and/or HRA mutations) are tolerant
to
sulfonylurea herbicides. The production of sutfonylurea-tolarant plants and
=
imidazollnone-tolerant plants is described more fully in U.S. Patent Nos.
5,605,011;.
5,013,659; 5,141,870; 5,767,361; 5,731,180; 5,304,732:4,761,373; 5,331,107;
5,928,937; and 5,378,824; and international publication WO 96133270.
.In specific
embodiments, the ALS inhibitor-tolerant potypeptide comprises a sulfonamide-
tolerant
acetolactate synthase (otherwise known as a sulfonamide-tolerant acetohydroxy
acid
synthase) or an ImIdaiolInone-tolerant acetolactate synthase (otherwise known
as an
Imidazoiinone-tolerant acetohydroxy acid synthase).
Other examples%of herbicide-tolerance traits that could be combined with an
event disclosed herein Include those conferring tolerance to at least one
herbicide in a
plant such as, for example, a brassIca plant or horseweed. Herbicide-tolerant
weeds
are known in the art, as are plants that vary in their tolerance to particular
herbicides.
See, e.g., Green and Williams, (2004) "Correlation of Corn (Zea mays) Inbred
Response to Nicosulfuron and Mesotrione," poster presented at the WSSA Annual
Meeting in Kansas City, Missouri, February 9-12, 2004; Green, (1998) Weed
Technology 12:474-477; Green and Ulrich, (1993) Weed Science 41:508-5143. The
trait(s) responsible for these tolerances can be combined by breeding or via
other
CA 0 2 8 9 1 1 5 3 2 0 1 5-0 5-1 2
=
WO 2012/071040 PC-17111S2010/058011
methods with an event disclosed herein ..to provide a plant of the Invention
as well as
methods of use thereof.
An event disclosed herein can also be combined with at least one other trait
to
produce plants of the present invention that further comprise a variety of
desired trait
combinations Including, but not limited to, traits desirable for animal feed
such as high
oil content (e.g., US Patent Number 6,232,529); balanced amino acid content
(e.g., .
hordothlonIns (US Patent Numbers 5,990,389; 6,885,801; 5,885,802 and
5,703,409;
US Patent Number 5,850,016); barley high lysine (Williamson, et al., (1987)
Eur. J.
Blochem. 165:99-106 and WO 98/20122) and high methlonine proteins (Pedersen,
et
8/., (1986) J. Blot Chem. 261:6279; KInhara, et at, (1988) Gene 71:359 and
Musumura, et at, (1989) Plant MoL Blot 12:123)); increased digestibility
(e.g.,
modified storage proteins (US Patent Application Serial Number 10/053,410,
filed
November 7, 2001) and thioredoxins (US Appkation Serial Number 10/005,429,
filed
December 3, 2001))
Desired trait combinations also include LLNO (low linolenic acid content; see,
e.g.,
Oyer, of al., (2002) AppL Microbiot Biotechnol. 59:224-230) and OLCH (high
oleic acid
content; see, e.g., Fernandez-Moya, et at, (2005) J. Agit. Food Chem. 53:5326.-
5330).
An event disclosed herein may also be combined with other desirable traits
such as, for example, furnonisIn detoxification genes (US Patent Number
5,792,931),
avirulence and disease resistance genes .(Jones, Of at, (1994) Science
266:789;
Martin, et al., (1993) Science 262:1432; Mindrinos, of al., (1994) Cell
78:1089) and
traits desirable for processing or process products such as modified oils
(e.g., fatty
acid desaturase genes (US Patent Number 5,952,544; WO 94111516)); modified
starches (e.g., ADPG pyrophosphoryiases (AGPase), starch syntheses (SS),
starch
. branching enzymes (SSE), and starch debranching enzymes (SDSE)) and polymers
or
bloplastics (e.g., US Patent Number 5,602,321.; beta-ketothiolase,
polyhydroxybutyrate
synthase, and acetoacetyl-CoA reductate (Schubert, of at, (1988) J. Bactenbl.
170:5837-5847) facilitate expression of poiyhydroxyalkanoates (P1iA3)).
One could also combine
herbicide-tolerant polynucleotides with polynucteolides providing agronomic
traits such
as male sterility (e.g., see, US Patent Number 5583,210), stalk strength,
flowering
time or transformation technology traits such as cell cycle regulation or gene
targeting
(e.g., WO 99/61819, WO 00/17364 and WO 99/25821) .
In another embodiment, an event disclosed herein can also be combined with
the Rcg1 sequence or biologically active variant or fragment. thereof. The
Rcgl
12
= =
CA 02891153 2015-05-12
WO 2012/071040 PC1'7082010/058011
sequence is an anthracnose stalk rot resistance gene In corn. See, for
example, US
Patent Application Serial Number 11/397,153, 11/397,275 and 111397,247.
These stacked combinations can be created by any method including, but not
5. limited to, breeding plants by any conventional methodology or
genetic transformation.
If the sequences are stacked by genetically transforming the plants, the
polynucleolide
sequences of interest can be combined at any time and in any order. The traits
can be
introduced simultaneously in a co-transformation protocol with the
polynucleolides of
interest provided by any combination of transformation cassettes. For example,
if two
sequences will be .introduced, the two sequences can be contained In separate
transformation cassettes (trans) or contained on the same transformation
cassette
(cis). Expression of the sequences can be driven by the same promoter or by
different
promoters. In certain cases, It may be desirable to introduce a transformation
cassette
that will suppress the expression of the polynucieotide of Interest. This may
be
combined with any combination of other suppression cassettes or overexpresslon
cassettes to generate the desired combination of traits in the plant. It is
further
recognized that polynucleotide sequences can be stacked at a desired genornic
location using a site-specific recombination system. See, for example,
W099/25821,
W099/25854, W099/25840, W099/25855 and W099/25853.
As used herein, the use of the term mpolynucleoticle" is not intended to limit
the
present invention to polynucleotIdes comprising DNA. Those of ordinary skill
in The art
will recognize that polynucleotides, can comprise ribonucleotides and
combinations of
ribonucleotides and deoxyribonucleotides. Such
deoxyribonucleotides and-
ribonucleotides include both naturally occurring molecules and synthetic
analogues.
The polynucleotides of the invention also encompass all forms of sequences
including,
but not limited to, single-stranded forms, double-stranded forms, hairpins,
stem-and-
loop structures, and the like.
A DP-073496-4 Brassica plant comprises an expression cassette having an
optimized glyphosate acetyltransferase polynucleotide. The cassette can
include 5'
and 3' regulatory sequences operably finked to the g4fat polynucleotides.
*Operably
linked' is Intended to mean a functional linkage between two or more elements.
For
example, an operable linkage between a polynudeptide of interest and a
regulatory
sequence (Le., a promoter) Is functional link that allows for the expression
of the
polynucleotide of Interest. Operably linked elements may be contiguous or non-
contiguous. When used to refer to the joining of two protein coding regions,
by
operably linked it Is intended that the coding regions are In theaame reading
frame.
= 13
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
The cassette may additionally contain at least one additional gene to be
cotransformed
into the organism. Alternatively, the additional gene(s) can be provided on
multiple
expression cassettes. Such an expression cassette. is provided with a
plurality of
restriction sites and/or recombination sites for insertion of the
polynucleotide to be
under the transcriptional regulation of the regulatory regions. The expression
cassette
may additionally contain selectable marker genes.
The expression cassette can include in the 5'-3' direction of transcription, a
transcriptional and translational initiation region (i.e., a promoter), a
coding region and
a transcriptional and translational termination region functional in plants.
"Promoter"
refers to a nucleotide sequence capable of controlling the expression Of a
coding
sequence or functional RNA. In general, a coding sequence is located 3' to a
promoter sequence. The promoter sequence can comprise proximal and more distal
upstream elements, the latter elements are often referred to as enhancers.
Accordingly, an "enhancer" is a nucleotide sequence that can stimulate
promoter
activity and may be an innate element of the promoter or a heterologous
element
= inserted to enhance the level or tissue-specificity of a promoter.
Promoters may be
derived In their entirety from a native gene, or be composed of different
elements
= derived from different promoters found in nature or even comprise
synthetic nucleotide
segments. It is understood by those skilled in the art that different
promoters may
direct the expression of a gene in different tissues or cell types or at
different stages of
development or in response to different environmental conditions. Promoters
that
cause a nucleic acid fragment to be expressed in most cell types at most times
are
commonly referred to as "constitutive promoters". New promoters of various
types
useful in plant cells are constantly being discovered; numerous examples may
be
found in the compilation by Okamuro and Goldberg, (1989) Biochemistry of
Plants
15:1-82. It is further recognized that since in most cases the exact
boundaries of
regulatory sequences have not been completely defined, nucleic acid fragments
of
different lengths may have identical promoter activity.
The expression cassettes may also contain 5' leader sequences. Such leader
sequences can act to enhance translation. The regulatory regions (i.e.,
promoters,
transcriptional regulatory regions, RNA processing or stability regions,
introns,
polyadenylation signals, transcriptional termination regions and translational
termination regions) and/or the coding region may be native/analogous or
heterologous to the host cell or to each other.
The "translation leader sequence" refers to a nucleotide sequence located
between the promoter sequence of a gene and the coding sequence. The
translation
leader sequence is present in the fully processed mRNA upstream of the
translation
14
CA 02891153 2015-05-12
WO 2012/071040 PCT/U52010/058011
start sequence. The translation leader sequence may affect numerous parameters
including, processing of the primary transcript to mRNA, mRNA stability and/or
translation efficiency. Examples of translation leader sequences have been
described
(Turner and Foster, (1995) Mol. Biotechnot 3:225-236). The "3' non-coding
sequences' refer to nucleotide sequences located downstream of a coding
sequence
and include polyadenylation recognition sequences and other sequences encoding
regulatory signals capable of affecting mRNA processing or gene expression.
The
polyadenylation signal is usually characterized by affecting the addition of
polyadenylic
acid tracts to the 3' end of the mRNA precursor. The use of different 3' non-
coding
sequences Is exemplified by Ingelbrecht, etal., (1989) Plant Cell 1:671-680.
As used herein, "heterologous" in reference to a sequence is a sequence that
originates from a foreign species, or, if from the same species, Is
substantially modified
from its native form in composition and/or genomic locus by deliberate human
intervention. For example, a
promoter operably linked to a heterologous
polynucleotide is from a species different from the species from which the
polynucleotide was derived, or, if from the same/analogous species, one or
both are
substantially modified from their original form and/or genomic locus or the
promoter is
not the native promoter for the operably linked polynucleotide.
In preparing the expression cassette, the various DNA fragments may be
manipulated, so as to provide for the DNA sequences in the proper orientation
and, as
appropriate, in the proper reading frame. Toward this end, adapters or linkers
may be
employed to join the DNA fragments or other manipulations may be involved to
provide
for convenient restriction sites, removal of superfluous DNA, removal of
restriction
sites, or the like. For this purpose, in vitro mutagenesis, primer repair,
restriction,
annealing, resubstitutions, e.g., transitions and transversions, may be
involved. The
expression cassette can also comprise a selectable marker gene for the
selection of
transformed cells. Selectable marker genes are utilized for the selection of
transformed
cells or tissues.
Isolated polynucleotides are provided that can be used in various methods for
the detection and/or identification of the brassica DP-073496-4 event. An
"isolated" or
"purified" polynucleotide or biologically active portion thereof, is
substantially or
essentially free from components that normally accompany or interact with the
polynucleotide as found in its naturally occurring environment. Thus, an
isolated or
purified polynucleotide is substantially free of other cellular material or
culture medium
when produced by recombinant techniques or substantially free of chemical
precursors
or other chemicals when chemically synthesized. Optimally, an
'isolated"
polynucleotide Is free of sequences (optimally protein encoding sequences)
that
CA 02891153 2015-05-12
W02012/071040 PCT/11S2010/058011
naturally flank the polynucleotide (i.e., sequences located at the 5' and 3'
ends of the
polynucleolide) in the genomIc DNA of the organism from which the
polynucleotide Is
derived. For example, in various embodiments, the isolated polynucleotide can
contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of
nucleotide
sequence that naturally flank the polynucleotide in genomic DNA of the cell
from which
the polynucleotide is derived.
In specific embodiments, the polynucleotides of the invention comprise the
junction DNA sequence set forth in NO: 2, or variants and/or fragments thereof
or the
junction DNA sequence set forth in SEQ ID NO:12 and/or 13. In other
embodiments,
the polynucleotides of the invention comprise the junction DNA sequences set
forth in
SEQ ID NO: 14,15, 16, 17, 18 and/or 19 or variants and fragments thereof. In
specific
embodiments, methods of detection described herein amplify a polynucleotide
comprising a junction of the specific DP-073496-4 event. Fragments and
variants of
junction DNA sequences are suitable for discriminatively identifying either
event DP-
073496-4. As discussed elsewhere herein, such sequences find use as primers
and/or probes.
In other embodiments, the polynucleotides of the invention comprise
polynucleotides that can detect a DP-073496-4 event or a region specific to DP-
073496-4. Such sequences include any polynucleotide set forth in SEQ ID NO: 2,
4,
5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27 or
variants and fragments thereof. Fragments and variants of polynucleotides that
detect
a DP-073496-4 event or a region specific to DP-073496-4 are suitable for
discriminatively identifying event DP-073496-4, As discussed elsewhere herein,
such
sequences find use as primers and/or probes.
"Variants" is intended to mean substantially similar sequences. For
polynucleotides, a variant comprises a polynucleotide having deletions (I.e.,
truncations) at the 5' and/or 3' end; deletion and/or addition of one or more
nucleotides
at one or more internal sites in the native polynucleotide and/or substitution
of one or
more nucleotides at one or more sites in the native potynucleotide.
As used herein, a "probe is an isolated polynucleotide to which is attached
a
conventional detectable label or reporter molecule, e.g., a radioactive
isotope, ligand,
chemiluminescent agent, enzyme, etc. Such a probe is complementary to a strand
of
a target polynucleotide. In the case of the present invention, the probe is
complementary to a strand of isolated DNA from Brassica event DP-073496-4,
whether from a Brassica plant or from a sample that includes DNA from the
event.
Probes according to the present invention include not only deoxyribonucleic or
16
CA 0 2 8 9115 3 2 0 15 - 0 5 - 12
WO 2012/071040 PCT/US2010/058011
= ribonucleic acids but also polyamideS and other probe materials that can
specifically
detect the presence of the target DNA Sequence,
As used herein, "primers are isolated polynucleotides that are annealed to a
complementary target DNA strand by nucleic acid hybridization to term a hybrid
between the primer and the target DNA strand, then extended along the target
DNA
strand by a polymerase, e.g., a DNA poiymerase. Primer pairs of the invention
refer to
their use for amplification of a target polynucleotide, e.g., by the
polymerase chain
reaction (PCR) or other conventional nucleic-acid amplification methods. "PCR'
or
'polymerase chain reaction" is a technique used for the amplification of
specific DNA
segments (see, US Patent Numbers 4,683,195 and 4,800,159).
Any combination of primers can be used such that the pair allows for the
detection of a DP-073498-4 event or a region specific to DP-073496-4.
Probes and primers are of sufficient nucleotide length to bind to the target
DNA
sequence and specifically detect and/or identify a polynucleotide having a DP-
073406-
4 event. It is recognized that the hybridization conditions or reaction
conditions can be
determined by the operator to achieve this result. this length may be of any
length
that is of sufficient length to be useftil in a detection method of choice.
Generally, 8,
11, 14, 16, 18, 20, 22, 24, 26; 28, 30, 40, 50, 75, 100, 200, 300, 400, 500,
600, 700
nucleotides or more or between about 11-20, 20-30, 30-40, 40-50, 50-100, 100-
200,
200-300, 300-400, 400-500, 500-800, 600-700, 700-800 or more nucleotides In
length
are used. Such probes and primers can hybridize specifically to a target
sequence
under high stringency hybridization conditions. . Probes and primers according
to
embodiments of the present Invention may have complete DNA Sequence identity
of
contiguous nucleotides with the target sequence, although probes differing
from the
target DNA sequence and that retain the ability to specifically detect and/or
identify a
target DNA sequence may be designed by conventional methods. Accordingly,
probes
and primers can share about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% or greater sequence Identity or complementarity to the target
polynucleotide, or can differ from the target sequence by 1, 2, 3, 4, 5, 6 or
more
nucleotides. Probes can be used as primers, but are generally designed to bind
to the
target DNA or RNA and are not used in an amplification process. In one non-
limiting
embodiment, a probe can comprises a polynucleotide encoding the giyat4621
sequence or any variant or fragment thereof.
Specific primers can be used to amri!ify an integration fragment to produce an
empecon that can be used as a "specific probe' or can itself be detected for
identifying
event DP-073496-4 in biological samples. Alternatively, a probe of the
Invention can
be used during the PCR reaction to allow for the detection of the
amplification event
17
=
CA 02891153 2015-05-12
W02012/071040 PCT/US2010/058011
(i.e., a TaqmanTm probe or an MOB probe, so called real-time PCR). When the
probe
is hybridized with the polynucleotides of a biological sample under conditions
which
allow for the binding of the probe to the sample, this binding can be detected
and thus
allow for an indication of the presence of event DP-073496-4 in the biological
sample.
Such identification of a bound probe has been described in the art. In an
embodiment
of the invention, the specific probe is a sequence which, under optimized
conditions,
hybridizes specifically to a region within the 5' or 3' flanking region of the
event and
also comprises a part of the foreign DNA contiguous therewith. The specific
probe
may comprise a sequence of at least 80%, between 80 and 85%, between 85 and
90%, between 90 and 95% and between 95 and 100% identical (or complementary)
to
a specific region of the OP-073496L4 event.
As used herein, "amplified DNA" or "amplicon" refers to the product of
polynucleotide amplification of a target polynucleotide that is part of a
nucleic acid
template. For example, to determine whether a Brassica plant resulting from a
sexual
cross contains the DP-073496-4 event, DNA extracted from the Brassica plant
tissue
sample may be subjected to a polynucleotide amplification method using a DNA
primer
pair that includes a first primer derived from flanking sequence adjacent to
the
insertion site of Inserted heterologous DNA and a second primer derived from
the
inserted heterologous DNA to produce an amplicon that is diagnostic for the
presence
of the DP-073498-4 event DNA. In specific embodiments, the amplicon comprises
a
DP-073496-4 junction polynucleotide (i.e., a portion of SEQ ID NO: 2 which
spans the
junction site, such as, for example, SEQ ID NO: 10, 11, 12, 13, 14, 15, 16,
17, 18
and/or 19 or variants and fragments thereof). By 'diagnostic" for a DP-073496-
4
event, the use of any method or assay which discriminates between the presence
or
the absence of a DP-073496-4 event in a biological sample is intended.
Alternatively,
the second primer may be derived from the flanking sequence. In still other
embodiments, primer pairs can be derived from flanking sequence on both sides
of the
inserted DNA so as to produce an amplicon that includes the entire insert
polynucleotide of the expression construct as well as the sequence flanking
the
transgenic insert. See, Figure 3. The amplIcon is of a length and has a
sequence that
is also diagnostic for the event (i.eõ has a junction DNA from a DP-073490-4
event).
The amplicon may range in length from the combined length of the primer pairs
plus
one nucleotide base pair to any length of amplicon producible by a DNA
amplification
protocol. A member of a primer pair derived from the flanking sequence may be
located a distance from the inserted DNA sequence, this distance can range
from one
nucleotide base pair up to the limits of the amplification reaction or about
twenty
18
CA 02 8 91 15 3 2 0 15-05-12
WO 2012/071540 PCITUS2010/058011
thousand nucleotide base pairs. The use of the term "amplicon" specifically
excludes
primer dimers that may be formed in the DNA thermal amplification reaction.
Methods for preparing and using probes and primers are described, for
example, in Molecular Cloning: A = Laboratory Manual, 2<sup>nd</sup> ed, vol. 1-3,
ed.
. 5 Sambrook, et 8/., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. 1989
(hereinafter, "Sambrook, at al., 19891; Current Protocols in Molecular
Biology, ed.
A.usubel, et ai., Greene Publishing and Wiley-Interscience, New York, 1992
(with
periodic updates) (hereinafter, "Ausubef, et at, 1992') arid Innis, etal., PCR
Protocols:
A Guide to Methods and Applications, Academic Press: San Diego, 1990. PCR
primer
pairs can be derived from a known sequence, for example, by using computer
programs intended for that purpose such as the PCR primer analysis tool in
Vector Nil
version 8 (Informax Inc., Bethesda Md.); PrimerSelect (DNASTAR Inc., Madison,
Wis.); and Primer (Version 0.5©, 1991, Whitehead Institute for
Biomedical
Research, Cambridge, Mass.), Additionally, the sequence can be visually
scanned
and primers manually Identified using guidelines known to one of skill in the
art.
It is to be understood that as used herein the term gtransgenle includes any
cell, cell line, callus, tissue, plant part or plant, the genotype of which
has been altered
by the presence of a heterologous nucleic acid including those transgenics
Initially so
altered as well as those created by sexual crosses or asexual propagation from
the
Initial transgenlc. The term "tranigenic" as used herein does not encompass
the
alteration of the genome (chromosomal or extra-chromosomal) by conventional
plant
breeding methods or by naturally occurring events such as random cross-
fertilization,
non-recombinant viral infection, non-recombinant bacterial transformation, non-
recombinant transposition or spontaneous mutation.
"Transformation" refers to the transfer of a nucleic acid fragment into the
genome of a host organism, resulting In genetically stable inheritance. Host
organisms
containing the transformed nucleic acid fragments are referred to as
"transgenle
organisms. Examples of methods of plant transformation, include Agrobacterium-
mediated transformation (De Blaere, et af., (1987) Meth. Enzyma 143:277) and
=
particle-accelerated or 'gene gun' transformation technology (Klein, of at,
(1987)
Nature (London) 327:70-73: US Patent Number 4,945,050).
Additional transformation methods are disclosed below.
Thus, isolated polynucleotides of the Invention can be incorporated into
recombinant constructs, typically DNA constructs, which are capable of
introduction
Into and replication In a host cell: Such a construct can be a vector that
includes a
replication system and sequences that are capable of transcription and
translation of a
polypeptide-encoding sequence in a given host cell. A number of Vectors
suitable for
19
CA 02891153 2015-05-12
WO 2012/071040 PCT/1JS2010/058011
stable transfection of plant cells or for the establishment of transgenic
plants have
been described in, e.g., Pouwels, at aL, (1985; Supp. 1987) Cloning Vectors: A
Laboratory Manual, Weissbach and Weissbach, (1989) Methods for Plant Molecular
Biology (Academic Press, New York) and Flevin, at aL, (1990) Plant Molecular
Biology
Manual (Kluwer Academic Publishers). Typically, plant expression vectors
include, for
example, one or more cloned plant genes under the transcriptional control of
5' and 3'
regulatory sequences and a dominant selectable marker. Such plant expression
vectors also can contain a promoter regulatory region (e.g., a regulatory
region
controlling inducible or constitutive, environmentally- or developmentally-
regulated or
cell- or tissue-specific expression), a transcription initiation start site, a
ribosome
binding site, an RNA processing signal, a transcription termination site
and/or a
polyadenylation signal.
Various methods and compositions for Identifying event DP-073496-4 are
provided. Such methods find use in identifying and/or detecting a DP-073496-4
event
in any biological material. Such methods include, for example, methods to
confirm
seed purity and methods for screening seeds in a seed lot for a DP-073496-4
event.
In one embodiment, a method for identifying event DP-073496-4 in a biological
sample
is provided and comprises contacting the sample with a first and a second
primer; and,
amplifying a polynucleotide comprising a DP-073496-4 specific region.
A biological sample can comprise any sample in which one desires to
determine if DNA having event DP-073496-4 is present. For example, a
biological
sample can comprise any plant material or material comprising or derived from
a plant
material such as, but not limited to, food or feed products. As used herein,
'plant
material" refers to material which is obtained or derived from a plant or
plant part. In
specific embodiments, the biological sample comprises a brasslca tissue.
Primers and probes based on the flanking DNA and insert sequences disclosed
herein can be used to confirm (and, if necessary, to correct) the disclosed
sequences
by conventional methods, e.g., by re-cloning and sequencing such sequences.
The
polynucleotide probes and primers of the present invention specifically detect
a target
DNA sequence. Any conventional nucleic acid hybridization or amplification
method
can be used to identify the presence of DNA from a transgenic event in a
sample. By
"specifically detect" it is intended that the polynucleotide can be used
either as a
primer to amplify a DP-073496-4 specific region or the polynucleotide can be
used as
a probe that hybridizes under stringent conditions to a polynucleotide from a
DP-
073496-4 event. The level or degree of hybridization which allows for the
specific
detection of a DP-073496-4 event or a specific region of a DP-073496-4 event
is
sufficient to distinguish the polynucleotide with the DP-073496-4 specific
region from a
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
polynucleotide lacking this region and thereby allow for discriminately
identifying a DP-
073496-4 event. By "shares sufficient sequence identity or complentarity to
allow for
the amplification of a DP-073496-4 specific event" is intended the sequence
shares at
least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%
Identity or complementarity to a fragment or across the full length of the
polynucleotide
from the DP-073496-4 specific region.
Regarding the amplification of a target polynucleotide (e.g., by PCR) using a
particular amplification primer pair, "stringent conditions" are conditions
that permit the
primer pair to hybridize to the target polynucleotide to which one primer
having the
corresponding wild-type sequence (or its complement) and another primer having
the
corresponding DP-073496-4 inserted DNA sequence would bind and preferably to
produce an identifiable amplification product (the amplicon) having a DP-
073496-4
specific region In a DNA thermal amplification reaction. In a PCR approach,
oligonucleotide primers can be designed for use in PCR reactions to amplify a
DP-
073496-4 specific region. Methods for designing PCR primers and PCR cloning
are
= generally known in the art and are disclosed in Sambrook, et aL, (1989)
Molecular
Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press,
Plainview, New York). See also, Innis, et al., eds. (1990) PCR Protocols: A
Guide to
Methods and Applications (Academic Press, New York); Innis and Gelfand, eds.
(1995) PCR Strategies (Academic Press, New York) and Innis and Gelfand, eds.
(1999) PCR Methods Manual (Academic Press, New York). Methods of amplification
are further described In US Patent Number 4,683,195, 4,683,202 and Chen, et
aL,
(1994) PNAS 91:5695-5699. These methods as well as other methods known in the
art of DNA amplification may be used in the practice of the embodiments of the
present invention. It is understood that a number of parameters in a specific
PCR
protocol may need to be adjusted to specific laboratory conditions and may be
slightly
modified and yet allow for the collection of similar results. These
adjustments will be
apparent to a person skilled in the art. =
The amplified polynucleotide (amplicon) can be of any length that allows for
the
detection of the DP-073496-4 event or a DP-073496-4 specific region. For
example,
the amplicon can be about 10, 50, 100, 200, 300, 500, 700, 100, 2000, 3000,
4000,
5000 nucleotides in length or longer.
In specific embodiments, the specific region of the DP-073496-4 event is
detected.
Any primer can be employed in the methods of the invention that allows a DP-
0734964 specific region to be amplified and/or detected. For example, in
specific
embodiments, the first primer comprises a fragment of a polynucleotide of SEQ
ID NO:
21
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
2 or 3, wherein the first or the second primer shares sufficient sequence
Identity or
c,omplementarity to the polynucleolide to amplify the DP-073495-4 specific
region.
-The primer pair can comprise a fragment of SEQ ID NO: 2 or 3. In another
embodiment the primer pair comprises a first primer comprising a fragment of
SEQ ID
NO: 8 and a second primer comprising a fragment of SEQ ID NO: 9 or 10; or,
alternatively, the primer pair comprises a first primer comprising a fragment
of SEQ ID
NO: 9 and the second primer comprises a fragment of SEQ ID NO: 8 or 10. The
primers can be of any length sufficient to amplify a DP-073496-4 specific
region
including, for example, at least 8, 7, 8, 9, 10, 15, 20, 15 or 30 or about 7-
10, 10-15, 15-
20, 20-25, 25-30, 30-35, 35-40, 40-45 nucleotides or longer. Additional primer
are
also set forth herein In Table 11:
As discussed elsewhere herein, any method to PCR amplify the DP-073496-4
= event or specific region can be employed, Including for example, real
time PCR. See,
for example, Livak, et at. (1995a). 011gonucleotides with fluorescent dyes at
opposite
ends provide a quenched probe system for detecting PCR product and nucleic add
hybridization. PCR methods and Applications. 4:357-362; US Patent Number
5,538,848; US Patent Number 5,723,591; Applied Blosystema User Bulletin No. 2,
"Relative Quantitation of Gene Expre.sslon," P/N 4303859 and Applied
Biosystems
User Bidletin No. 5, "Multiplex PCR with Taqman VIC probes,* P/N 4308230.
Thus, In specific embodiments, a method of detecting the presence of brassica
event DP-073498-4 or progeny thereof in a biological sample is provided. The
method
comprises (a) extracting a DNA sample from The biological sample; (b)
providing a pair
of DNA primer molecules targeting the insert = and/or junction (c) providing
DNA
amplification reaction conditions; (d) performing the DNA amplification
reaction,
thereby producing a DNA amplicon molecule and (e) detecting the DNA amplicon
molecule, wherein the detection Of said DNA amplicon molecule in the DNA
amplification reaction Indicates the presence of BrassIca event DP-073496-4.
In order
for a nucleic acid molecule to serve as a primer or probe it needs only be
sufficiently
complementary in sequence to be able to form a stable double-stranded
Structure
under the particular solvent and salt concentrations employed.
In hybridization techniques, all or part of a polynucleotide that selectively
hybridizes to a target polynucleotide having a DP-073496-4 specific event Is
employed. By "stringent conditions" or 'stringent hybridization conditions'
when
referring to a polynudeotide probe conditions under which a probe will
hybridize to its
target sequence to a detectably greater degree than to other sequences (e.g.,
at least
2-fold over background) are intended. Regarding the amplification of a =
target
22
=
=
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
polynucleotide (e.g., by PCR) using a particular amplification primer pair,
"stringent
conditions" are conditions that permit the primer pair to hybridize to the
target
polynucleotide to which one primer having the corresponding wild-type sequence
and
another primer having the corresponding DP-073496-4 inserted DNA sequence. =
Stringent conditions are sequence-dependent and will be variable in different
circumstances. By controlling the stringency of the hybridization and/or
washing
conditions, target sequences that are 100% complementary to the probe can be
identified (homologous probing). Alternatively, stringency conditions can be
adjusted
to allow some mismatching in sequences so that lower degrees of identity are
detected
(heterologous probing). Generally, a probe is less than about 1000 nucleotides
in
length or less than 500 nucleotides in length.
As used herein, a substantially identical or complementary sequence is a
polynucleotide that will specifically hybridize to the complement of the
nucleic acid
molecule to which it is being compared under high stringency conditions.
Appropriate
stringency conditions which promote DNA hybridization, for example, 6X sodium
chloride/sodium citrate (SSC) at about 45 C., followed by a wash of 2XSSC at
50 C.,
are known to those skilled in the art or can be found in Current Protocols in
Molecular
Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Typically, stringent
conditions
for hybridization and detection will be those in which the salt concentration
is less than
about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or
other salts)
at pH 7.0 to 8.3 and the temperature is at least about 30 C for short probes
(e.g., 10 to
50 nucleotides) and at least about 60 C for long probes (e.g., greater than 50
nucleotides). Stringent
conditions may also be achieved with the addition of
destabilizing agents such as formamide. Exemplary low stringency conditions
include
hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS
(sodium dodecyl sulphate) at 37 C, and a wash in 1X to 2X SSC (20X SSC = 3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55 C. Exemplary
moderate stringency
conditions include hybridization in 40 to 45% formamide, 1.0 M NaCI, 1% SDS at
37 C, and a wash in 0.5X to lx SSC at 55 to 60 C. Exemplary high stringency
conditions include hybridization in 50% formamide, 1 M NaCI, 1% SDS at 37 C
and a
wash in 0.1X SSC at 60 to 65 C. Optionally, wash buffers may comprise about
0.1%
to about 1% SOS. Duration of hybridization is generally less than about 24
hours,
usually about 4 to about 12 hours. The duration of the wash time will be at
least a
length of time sufficient to reach equilibrium.
In hybridization reactions, specificity is typically the function of post-
hybridization washes, the critical factors being the ionic strength and
temperature of
the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from
the
23
CA 02891153 2015-05-12
W02012/071040 PC171182010/058011
equation of Meinkoth and Wahl, (1984) Anal. Biochem. 138:267-284: Tm= 81.5 C +
16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of
monovalent cations, %GC is the percentage of guanosine and cytosine
nucleotides in
the DNA, % form is the percentage of formamide In the hybridization solution
and L is
the length of the hybrid in base pairs. The Tff, is the temperature (under
defined ionic
strength and pH) at which 50% of a complementary target sequence hybridizes to
a
perfectly matched probe. Tm is reduced by about 1 C for each 1% of
mismatching;
thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize
to
sequences of the desired identity. For example, if sequences with >90%
identity are
sought, the 'I, can be decreased 10 C, Generally, stringent conditions are
selected to
be about 5 C lower than the thermal melting point (Tm) for the specific
sequence and
its complement at a defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3 or 4 C lower
than the
thermal melting point (Tm); moderately stringent conditions can utilize a
hybridization
and/or wash at 6, 7, 8, 9 or 10 C lower than the thermal melting point (Tm);
low
stringency conditions can utilize a hybridization and/or wash at 11, 12, 13,
14, 15 or
C lower than the thermal melting point (Tm). Using the equation, hybridization
and
wash compositions, and desired Tm, those of ordinary skill will understand
that
variations in the stringency of hybridization and/or wash solutions are
inherently
20 described. If the
desired degree of mismatching results in a Tm of less than 45 C
(aqueous solution) or 32 C (formamide solution), it is optimal to increase the
SSC
concentration so that a higher temperature can be used. An extensive guide to
the
hybridization of nucleic acids is found in Tijssen, (1993) Laboratory
Techniques in
Biochemistry and Molecular Biology¨Hybridization with Nucleic Acid Probes,
Part I,
Chapter 2 (Elsevier, New York) and Ausubel, of al., eds. (1995) Current
Protocols in
Molecular Biology, Chapter 2 (Greene Publishing and Wiley-interscience, New
York).
See, Sambrook, of al., (1989) Molecular Cloning: A Laboratory Manual (2d ed.,
Cold
Spring Harbor Laboratory Press, Piainview, New York) and Haymes, of at.,
(1985) In:
Nucleic Acid Hybridization, a Practical Approach, IRL Press, Washington, D.C.
A polynucleotide Is said to be the "complement" of another polynucleotide if
they exhibit complementarity. As used herein, molecules are said to exhibit
complete
complementarity" when every nucleotide of one of the polynucleotide molecules
is
complementary to a nucleotide of the other. Two molecules are said to be
"minimally
complementary' if they can hybridize to one another with sufficient stability
to permit
them to remain annealed to one another under at least conventional "low-
stringency"
conditions. Similarly, the molecules are said to be "complementary" if they
can
24
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
hybridize to one another with sufficient stability to permit them to remain
annealed to
one another under conventional "high-stringency conditions.
Further provided are methods of detecting the presence of DNA corresponding
to the DP-073496-4 event in a sample. In one embodiment, the method comprises
(a)
contacting the biological sample with a polynucteotide probe that hybridizes
under
stringent hybridization conditions with DNA from brassica event DP-073496-4
and
specifically detects the DP-073496-4 event; (b) subjecting the sample and
probe to
stringent hybridization conditions and (c) detecting hybridization of the
probe to the
DNA, wherein detection of hybridization Indicates the presence of the DP-
073496-4
event.
Various methods can be used to detect the DP-073496-4 specific region or
amplicon thereof, including, but not limited to, Genetic Bit Analysis
(Nikiforov, at al.,
(1994) Nucleic Acid Res. 22:4167-4175) where a DNA oligonucleotide is designed
which overlaps both the adjacent flanking DNA sequence and the inserted DNA
sequence. The oligonucleotide is immobilized in wells of a microwell plate.
Following
PCR of the region of Interest (using* one primer in the inserted sequence and
one in
the adjacent flanking sequence) a single-stranded PCR product can be annealed
to
the immobilized oligonucleotide and serve as a template for a single base
extension
reaction using a DNA polymerase and labeled ddNTPs specific for the expected
next
base. Readout may be fluorescent or ELISA-based. A signal indicates presence
of
the insert/flanking sequence due to successful amplification, hybridization
and single
base extension.
Another detection method is the Pyrosequencing technique as described by
Winge, ((2000) Macy. Pharma. Tech. 00:18-24). In this method, an
oligonucleotide is
designed that overlaps the adjacent DNA and insert DNA junction. The
oligonucleotide is annealed to a single-stranded PCR product from the region
of
interest (one primer in the inserted sequence and one in the flanking
sequence) and
incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase,
apyrase,
adenosine 5' phosphosulfate and luciferin. dNIPs are added individually and
the
incorporation results in a light signal which is measured. A light signal
indicates the
presence of the transgene insert/flanking sequence due to successful
amplification,
hybridization and single or multi-base extension.
Fluorescence Polarization as described by Chen, et al., ((1999) Genome Res.
9:492-496) is also a method that can be used to detect an amplicon of the
invention.
Using this method, an oligonucleotide is designed which overlaps the flanking
and
Inserted DNA junction. The oligonucleotide is hybridized to a single-stranded
PCR
product from the region of interest (one primer in the inserted DNA and one in
the
CA 02891153 2015-05-12
WO 2012/071040
PCTIUS2010/058011
flanking DNA sequence) and incubated in the presence of a DNA polymerase and a
fluorescent-labeled ddNTP. Single base extension results in incorporation of
the
ddNTP. Incorporation can be measured as a change in polarization using a
fluorometer. A change in polarization indicates the presence of the transgene
insert/flanking sequence due to successful amplification, hybridization and
single base
extension.
Taqman (PE Applied Biosystems, Foster City, Calif.) is described as= a
method of detecting and quantifying the presence of a DNA sequence and is
fully
understood in the instructions provided by the manufacturer. Briefly, a FRET
ollgonucleotide probe is designed which overlaps the flanking and insert DNA
junction.
The FRET probe and PCR primers (one primer in the insert DNA sequence and one
in
the flanking genomic sequence) are cycled in the presence of a thermostable
polymerase and dNIPs. Hybridization of the FRET probe results in cleavage and
release of the fluorescent moiety away from the quenching moiety on the FRET
probe.
A fluorescent signal indicates the presence of the flanking/transgene insert
sequence
due to successful amplification and hybridization.
Molecular Beacons have been described for use in sequence detection as
described in Tyangi, et al., ((1996) Nature Biotech. 14:303-308). Briefly, a
FRET
oligonucleotide probe is designed that overlaps the flanking and insert DNA
junction.
The unique structure of the FRET probe results in it containing secondary
structure
that keeps the fluorescent and quenching moieties in close proximity. The FRET
probe and PCR primers (one primer in the insert DNA sequence and one in the
= flanking sequence) are cycled in the presence of a thermostable
polymerase and
dNTPs. Following successful PCR amplification, hybridization of the FRET probe
to
the target sequence results in the removal of the probe secondary structure
and spatial
separation of the fluorescent and quenching moieties. A fluorescent signal
results. A
fluorescent signal indicates the presence of the flanking/transgene insert
sequence
due to successful amplification and hybridization.
A hybridization reaction using a probe specific to a sequence found within the
amplicon is yet another method used to detect the amplicon produced by a PCR
reaction.
As used herein, "kit" refers to a set of reagents for the purpose of
performing
the method embodiments of the invention, more particularly, the identification
and/or
the detection of the DP-073496-4 event in biological samples. The kit of the
invention
can be used and its components can be specifically adjusted, for purposes of
quality
control (e.g. purity of seed lots), detection of event DP-073496-4 in plant
material or
26
CA 02891153 2015-05-12
W02012/071040
PCT/US2010/058011
material comprising or derived from plant material, such as but not limited to
food or
feed products.
In specific embodiments, a kit for identifying event DP-073496-4 in a
biological
sample is provided. The kit comprises a first and a second primer, wherein the
first
and second primer amplify a polynucleotide comprising a DP-073496-4 specific
region.
In further embodiments, the kit also comprises a polynucleotide for the
detection of the
DP-073496-4 specific region. The kit can comprise, for example, a first primer
comprising a fragment of a polynucleotide of SEQ ID NO: 2, 3, 8, 9, or 10,
wherein the
first or the second primer shares sufficient sequence homology or
complementarily
and specificity to the polynucleotide to amplify said DP-073496-4 specific
region. For
example, in specific embodiments, the first primer comprises a fragment of a
polynucleotide of SEQ ID NO: 2 or 3, wherein the first or the second primer
shares
sufficient sequence homology or complementarity to the polynucleotide to
amplify the
DP-073496-4 specific region. In other embodiments, the first primer comprises
a
fragment of a polynucleotide of SEQ ID NO: 8 and the second primer comprises a
fragment of SEQ ID NO: 9 or 10, wherein the first or the second primer shares
sufficient sequence homology or complementarity to the polynucleotide to
amplify the
DP061061-7 specific region. Alternatively, the first primer pair comprises SEQ
ID
NO:9 or a variant or fragment thereof and the second primer comprises SEQ ID
NO: 8
or 10 or a variant or fragment thereof. In other embodiments, the primer pair
can
= comprise a fragment of SEQ ID NO: 2 and a fragment of SEQ ID NO: 3. The
primers
can be of any length sufficient to amplify the DP-073496-4 region including,
for
= example, at least 6, 7, 8, 9, 10, 15, 20, 15 or 30 or about 7-10, 10-15,
15-20, 20-25,
25-30, 30-35, 35-40, 40-45 nucleotides or longer. Further provided are DNA
detection
kits comprising at least one polynucleotide that can specifically detect a DP-
073496-4
specific region or insert DNA, wherein said polynucleotide comprises at least
one DNA
molecule of a sufficient length of contiguous nucleotides homologous or
complementary to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18
19, 20, 21, 22, 23, 24, 25, 26, or 27.
In one embodiment, a kit for identifying event DP-073496-4 in a biological
sample is provided. The kit comprises a first and a second primer, wherein
said first
and said second primer amplify a polynucleotide comprising a DP-073496-4
specific
region. In further embodiments, the kit further comprises a polynucleotide for
the
defection of the DP-073496-4 specific region. Thus, in one non-limiting
embodiment,
the first primer comprises a first fragment of SEQ ID NO: 11 and the second
primer
comprises a second fragment of SEQ ID NO:11, wherein the first and the second
primer flank the DP-073496-4 specific region and share sufficient sequence
homology
27
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
or compiementarity to the polynucleotlde to amplify said DP-073496-4 specific
region.
As such, a kit can therefore include a first primer comprising a fragment of
SEQ ID
NO:8 and a second primer comprising a fragment of SEQ ID NO:9; or a first or a
second primer comprising at least 8 consecutive polynucleotides of SEQ ID NO:
11; or
a first or a second primer comprising at least 8 consecutive polynucleotides
of SEQ ID
NO:8 or 9.
In further embodiments, methods are provided for detecting a glyphosate-N-
acetyltranferase polypeptide comprising analysing brassica plant tissues using
an
immunoassay comprising a glyphosate-N-acetyltranferase polypeptide-specific
antibody or antibodies. In other embodiments, methods for detecting the
presence of
a polynucleotide that encodes a glyphosate-N-acetyltranferase polypeptide are
provide
and comprise assaying brassica plant tissue using PCR amplification. Kits for
employing such methods are further provided.
Any of the polynucleotides and fragments and variants thereof employed in the
methods and compositions of the invention can share sequence identity to a
region of
the transgene insert of the DP-073496-4 event, a junction sequence of the DP-
073496-4 event, or a region of the insert in combination with a region of the
flanking
sequence of the DP-073496-4 event. Methods to determine the relationship of
various
sequences are known. As used herein, "reference sequence" is a defined
sequence
used as a basis for sequence comparison, A reference sequence may be a subset
or
the entirety of a specified sequence; for example, as a segment of a full-
length cDNA
or gene sequence, or the complete cDNA or gene sequence. As used herein,
"comparison window" makes reference to a contiguous and specified segment of a
polynucleotide sequence, wherein the polynucleotide sequence in the comparison
window may comprise additions or deletions (i.e., gaps) compared to the
reference
sequence (which does not comprise additions or deletions) for optimal
alignment of the
two polynucleotides. Generally, the comparison window is at least 20
contiguous
nucleotides in length and optionally can be 30, 40, 50, 100 Or longer. Those
of skill in
the art understand that to avoid a high similarity to a reference sequence due
to
inclusion of gaps in the polynucleotide sequence a gap penalty is typically
introduced
and is subtracted from the number of matches.
Methods of alignment of sequences for comparison are well known in the art.
Thus, the determination of percent sequence identity between any two sequences
can
be accomplished using a mathematical algorithm. Non-limiting examples of such
mathematical algorithms are the algorithm of Myers and Miller, (1988) CABIOS
4:11-
17; the local alignment algorithm of Smith, et al., (1981) Adv. App!. Math.
2:482; the
global alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol.
48:443-
28
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
453; the search-for-local alignment method of Pearson and Lipman, (1988) Proc.
Natl.
Acad. Sci. 85:2414-2448; the algorithm of Karlin and Altschul, (1990) Proc.
Natl. Acad.
Sci. USA 872264, modified as in Karlin and Altschul, (1993) Proc. Natl. Acad.
Sci. USA
90:5873-5877.
Computer implementations of these mathematical algorithms can be utilized for
comparison of sequences to determine sequence identity. Such implementations
Include, but are not limited *to: CLUSTAL in the PC/Gene program (available
from
intelligenetics, Mountain View, California); the AUGN program (Version 2.0)
and GAP,
BESTFIT, BLAST, FASTA and TFASTA in the GCG Wisconsin Genetics Software
Package, Version 10 (available from Accelrys Inc., 9685 Scranton Road, San
Diego,
California, USA). Alignments using these programs can be performed using the
default parameters. The CLUSTAL program is well described by Higgins, etal.,
(1988)
Gene 73:237-244 (1988); Higgins, of al., (1989) CABlOS 5:151-153; Corpet, at
aL,
(1988) Nucleic Acids Res. 16:10881-90; Huang, et al., (1992) CAB/OS 8:155-65
and
Pearson, at al., (1994) Meth. Mot Biol. 24:307-331. The ALIGN program is based
on
the algorithm of Myers and Miller, (1988) supra. A PAM120 weight residue
table, a
gap length penalty of 12 and a gap penalty of 4 can be used with the ALIGN
program
when comparing amino acid sequences. The BLAST programs of Altschul, et al.,
(1990) J. Mol. Biol. 215:403 are based on the algorithm of Karlin and
Altschul, (1990)
supra. BLAST nucleotide searches can be performed with the BLASTN program,
score = 100, wordiength = 12, to obtain nucleotide sequences homologous to a
nucleotide sequence encoding a protein of the invention. BLAST protein
searches can
be performed with the BLASTX program, score = 50, wordlength = 3, to obtain
amino
acid sequences homologous to a protein or polypeptide of the invention. To
obtain
gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be
utilized as described in Altschul, et at., (1997) Nucleic Acids Res. 25:3389.
Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated
search
that detects distant relationships between molecules. See, Altschul, of at,
(1997)
supra, When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters
of
the respective programs (e.g., BLASTN for nucleotide sequences, EILASTX for
proteins) can be used. See www.ncbi.nlm.nih.gov. Alignment may also be
performed
manually by inspection.
Unless otherwise stated, sequence identity/similarity values provided herein
refer to the value obtained using GAP Version 10 using the following
parameters: %
identity and % similarity for a nucleotide sequence using GAP Weight of 50 and
Length
Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity
for an
amino acid sequence using GAP Weight of 8 and Length Weight of 2 and the
29
CA 02891153 2015-05-12
W02012/071040 PCT/US2010/058011
BLOSUM62 scoring matrix or any equivalent program thereof. By "equivalent
program" any sequence comparison program that, for any two sequences in
question,
generates an alignment having Identical nucleotide or amino acid residue
matches and
an identical percent sequence identity when compared to the corresponding
alignment
generated by GAP Version 10 is intended.
GAP uses the algorithm of Needleman and Wunsch, (1970) J. Mol. Biol.
48:443-453, to find the alignment of two complete sequences that maximizes the
number of matches and minimizes the number of gaps. GAP considers all possible
alignments and gap positions and creates the alignment with the largest number
of
matched bases and the fewest gaps. It allows for the provision of a gap
creation
penalty and a gap extension penalty in units of matched bases. GAP must make a
profit of gap creation penalty number of matches for each gap it inserts. If a
gap
extension penalty greater than zero is chosen, GAP must, in addition, make a
profit for
each gap inserted of the length of the gap times the gap extension penalty.
Default
gap creation penalty values and gap extension penalty values in Version 10 of
the
GCG Wisconsin Genetics Software Package for protein sequences are 8 and 2,
respectively. For nucleotide seqUences the default gap creation penalty is 50
while the
default gap extension penalty is 3. The gap creation and gap extension
penalties can
be expressed as an integer selected from the group of integers consisting of
from 0 to
200. Thus, for example, the gap creation and gap extension penalties can be 0,
1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 15, 20,25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.
GAP presents one member of the family of best alignments. There may be
many members of this family, but no other member has a better quality. GAP
displays
four figures of merit for alignments: Quality, Ratio, Identity and Similarity.
The Quality
is the metric maximized in order to align the sequences. Ratio is the Quality
divided by
the number of bases In the shorter segment, Percent Identity is the percent of
the
symbols that actually match. Percent Similarity is the percent of the symbols
that are
similar. Symbols that are across from gaps are ignored. A similarity is scored
when
the scoring matrix value for a pair of symbols is greater than or equal to
0.50, the
similarity threshold. The scoring matrix used in Version 10 of the GCG
Wisconsin
Genetics Software Package is BLOSUM62 (see, Henikoff and Henikoff, (1989)
Proc.
Natl. Acad. Sci. USA 89:10915).
As used herein, "sequence Identity' or "identity" in the context of two
polynucleotides or polypeptide sequences makes reference to the residues in
the two
sequences that are the same when aligned for maximum correspondence over a
specified comparison window. When percentage of sequence identity is used in
reference to proteins it is reco-gnized that residue positions which are not
identical
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
often differ by conservative amino acid substitutions, where amino acid
residues are
substituted for other amino acid residues with similar chemical properties
(e.g., charge
or hydrophobicity) and therefore do not change the functional properties of
the
molecule. When sequences differ In conservative substitutions, the percent
sequence
identity may be adjusted upwards to correct for the conservative nature of the
substitution. Sequences that differ by such conservative substitutions are
said to have
"sequence similarity" or "similarity". Means for making this adjustment are
well known
to those of skill In the art Typically this involves scoring a conservative
substitution as
a partial rather than a full mismatch, thereby increasing the percentage
sequence
identity. Thus, for example, where an identical amino acid is given a score of
1 and a
non-conservative substitution is given a score of zero, a conservative
substitution Is
given a score between zero and 1. The scoring of conservative substitutions is
calculated, e.g., as implemented in the program PC/GENE (1ntelligenetics,
Mountain
View, California).
As used herein, "percentage of sequence Identity" means the value determined
by comparing two optimally aligned sequences over a comparison window, wherein
the portion of the polynucleotide sequence in the comparison window may
comprise
additions or deletions (I.e., gaps) as compared to the reference sequence
(which does
not comprise additions or deletions) for optimal alignment of the two
sequences, The
percentage is calculated by determining the number of positions at which the
identical
nucleic acid base or amino acid residue occurs in both sequences to yield the
number
of matched positions, dividing the number of matched positions by the total
number of
positions in the window of comparison and multiplying the result by 100 to
yield the
percentage of sequence identity.
The present invention provides methods for controlling weeds in an area of
cultivation, preventing the development or the appearance of herbicide
resistant weeds
in an area of cultivation, producing a crop and increasing .crop safety. The
term
"controlling," and derivations thereof, for example, as in "controlling weeds
refers to
one or more of inhibiting the growth, germination, reproduction and/or
proliferation of
and/or killing, removing, destroying Or otherwise diminishing the occurrence
and/or
activity of a weed.
As used herein, an "area of cultivation" comprises any region in which one
desires to grow a plant. Such areas of cultivations include, but are not
limited to, a
field in which a plant is cultivated (such as a crop field, a sod field, a
tree field, a
managed forest, a field for culturing fruits and vegetables, etc), a
greenhouse, a
growth chamber, eta
31
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
The methods of the invention comprise planting the area of cultivation with
the
Brass/ca DP-073496-4 seeds or plants, and In specific embodiments, applying to
the
crop, seed, weed or area of cultivation thereof an effective amount of a
herbicide of
interest. It is recognized that the herbicide can be applied before or after
the crop is
planted in the area of cultivation. Such herbicide applications can include an
application of glyphosate.
In one embodiment, the method of controlling weeds comprises planting the
area with the DP-073496-4 Brass/ca seeds or plants and applying to the crop,
crop
part, seed of said crop or the area under cultivation, an effective amount of
a herbicide,
wherein said effective amount comprises an amount that is not tolerated by a
second
control crop when applied to the second crop, crop part, seed or the area of
cultivation,
wherein said second control crop does not express the GLYAT polynucleotIde.
In another embodiment, the method of controlling weeds comprises planting
the area with a DP-073496-4 Brass/ca crop seed or plant and applying to the
crop,
crop part, seed of said crop or the area under cultivation, an effective
amount of a
glyphosate herbicide, wherein said effective amount comprises a level that Is
above
the recommended label use rate for the crop, wherein said effective amount is
tolerated when applied to the DP-073496-4 Brass/ca crop, crop part, seed or
the area
of cultivation thereof.
A "control" or "control plant" or "control plant cell" provides a reference
point for
measuring changes in phenotype of the subject plant or plant cell, and may be
any
suitable plant or plant cell. A control plant or plant cell may comprise, for
example: (a)
a wild-type plant or cell, i.e., of the same genotype as the starting material
for the
genetic alteration which resulted in the subject plant or cell; (b) a plant or
plant cell of
the same genotype as the starting material but which has been transformed with
a null
construct (i.e., with a construct which has no known effect on the trait of
interest, such
as a construct comprising a marker gene); (c) a plant or plant cell which is a
non-
transformed segregant among progeny of a subject plant or plant cell; (d) a
plant or
plant cell which is genetically identical to the subject plant or plant cell
but which is not
exposed to the same treatment (e.g., herbicide treatment) as the subject plant
or plant
cell; (e) the subject plant or plant cell itself, under conditions in which
the gene of
interest is not expressed or (0 the subject plant or plant cell itself, under
conditions in
which it has not been exposed to a particular treatment such as, for example,
a
herbicide or combination of herbicides and/or other chemicals. In some
instances, an
appropriate control plant or control plant cell may have a different genotype
from the
subject plant or plant cell but may share the herbicide-sensitive
characteristics of the
starting material for the genetic alteration(s) which resulted in the subject
plant or cell
32
CA 02891153 2015-05-12
W02012/071040 PCT/US2010/058011
(see, e.g., Green, (1998) Weed Technology 12:474-477; Green and Ulrich, (1993)
Weed Science 41:508-516. In other embodiments, the null segregant can be used
as
a control, as they are genetically identical to DP-073496-4 with the exception
of the
transgenic insert DNA.
Classification of herbicides (i.e., the grouping of herbicides into classes
and
subclasses) Is well-known in the art and includes classifications by HRAC
(Herbicide
Resistance Action Committee) and WSSA (the Weed Science Society of America)
(see also, Retzinger and Mallory-Smith, (1997) Weed Technology 11:384-393). An
abbreviated version of the HRAC classification (with notes regarding the
corresponding WSSA group) is set forth below in Table 1.
Herbicides can be classified by their mode of action and/or site of action and
can also be classified by the time at which they are applied (e.g.,
preemergent or
postemergent), by the method of application (e.g., foliar application or soil
application)
or by how they are taken up by or affect the plant. For example,
thifensutfuron-methyl
and tribenuron-methyl are applied to the foliage of a crop and are generally
metabolized there, while rimsulfuron and chlorimuron-ethyl are generally taken
up
through both the roots and foliage of a plant. "Mode of action" generally
refers to the
metabolic or physiological process within the plant that the herbicide
inhibits or
otherwise Impairs, whereas "site of action" generally refers to the physical
location or
biochemical site within the plant where the herbicide acts or directly
Interacts.
Herbicides can be classified in various ways, including by mode of action
and/or site of
action (see, e.g., Table 1).
Often, a herbicide-tolerance gene that confers tolerance to a particular
herbicide or other chemical on a plant expressing It will also confer
tolerance to other
herbicides or chemicals In the same class or subclass, for example, a class or
subclass set forth in Table 1. Thus, in some embodiments of the invention, a
transgenic plant of the invention is tolerant to more than one herbicide or
chemical in
the same class or subclass, such as, for example, an inhibitor of FPO, a
sulfonylurea
or a synthetic auxin.
Typically, the plants of the present Invention can tolerate treatment with
different types of herbicides (i.e., herbicides having different modes of
action and/or
different sites of action) as well as with higher amounts of herbicides than
previously
known plants, thereby permitting improved weed management strategies that are
recommended in order to reduce the incidence and prevalence of herbicide-
tolerant
weeds. Specific herbicide combinations can be employed to effectively control
weeds.
The invention thereby provides a transgenic brassica plant which can be
selected for use in crop production based on the prevalence of herbicide-
tolerant weed
33
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
species in the area where the transgenic crop Is to be grown. Methods are
known in
the art for assessing the herbicide tolerance of various weed species. Weed
management techniques are also known in the art, such as for example, crop
rotation
using a crop that is tolerant to a herbicide to which the local weed species
are not
tolerant. A number of entities monitor = and publicly report the incidence and
characteristics of herbicide-tolerant weeds, including the Herbicide
Resistance Action
Committee (HRAC), the Weed Science Society of America and various state
agencies
(see, for example, herbicide tolerance scores for various broadleaf weeds from
the
2004 Illinois Agricultural Pest Management Handbook) and one of skill in the
art would
be able to use this information to determine which crop and herbicide
combinations
should be used in a particular location.
These entities also publish advice and guidelines for preventing the
development and/or appearance of and controlling the spread of herbicide
tolerant
weeds (see, e.g., Owen and Hartzler, (2004), 2005 Herbicide Manual for
Agricultural
Professionals, Pub. WC 92 Revised (Iowa State University Extension, Iowa State
University of Science and Technology, Ames, Iowa); Weed Control for Corn,
Brassicas, and Sorghum, Chapter 2 of "2004 Illinois Agricultural Pest
Management
Handbook" (University of Illinois Extension, University of Illinois at Urbana-
Champaign,
Illinois); Weed Control Guide for Field Crops, MSU Extension Bulletin E434
(Michigan
State University, East Lansing, Michigan)).
Table 1: Abbreviated version of HRAC Herbicide Classification
I. ALS Inhibitors (WSSA Group 2)
A. Sulfonylureas
1. Azimsulfuron
2. Chlorimuron-ethyl
3. Metsulfuron-methyl
4. Nicosulfuron
5. Rimsulfuron
6. Sulfometuron-methyl
7. Thrfensulfuron-methyl
8. Tribenuron-methyl
9. Amidosulfuron
10. Bensulfuron-methyl
= 11. Chlorsulfuron
12. Cinosulfuron
13. Cyclosulfamuron
14. Ethametsulfuron-methyl
15. Ethoxysulfuron
16. Flazasulfuron
17. Flupyrsulfuron- methyl
34
CA 02891153 2015-05-12
W02012/071040 PCT/US2010/058011
18. Foramsulfuron
19. Imazosulfuron
20. lodosulfuron-methyl
21. Mesosulfuron-methyl
22. Oxasulfuron
23. Prirnisulfuron-methyl
24. Prosulfuron
25. Pyrazosulfuron-ethyl
26. Sulfosulfuron
27. Triasulfuron
28. Trifloxysulfuron
29. Triflusulfuron-methyl
30. Tritosulfuron
31. Halosulfuron-methyl
32, Flucetosulfuron
B. Sulfonylaminocarbonyltriazolinones
1. Flucarbazone
2. Procarbazone
C. Triazolopyrimidines
1. Cloransu lam-methyl
2. Flumetsulam
3. Diclosulam
4. Florasulam
5. Metosulam .
6. Penoxsulam
7. Pyroxsulam
D. Pyrimicilnyloxy(thio)benzoates
1. Bispyribac
2. PyrIftaild
= 3. Pyribenzoxim
4. Pyrithiobac
5. Pyriminobac-methyl
=
E. Imidazanones
1. Imezapyr
2. Imazethapyr
3. Imazaquin
4. lmazapic
5. Imazamethabenz-methyl
6. Imazamox
II. Other Herbicides-Active Ingredients/
Additional Modes of Action
A. Inhibitors of Acetyl CoA carboxylase
(ACCase) (WSSA Group 1)
1. Aryloxyphenoxyproplonates
('FOPs')
a. Quizalofop-P-ethyl
CA 02891153 2015-05-12
WO 2012/071040 PCM1S2010/058011
b. Diclofop-methyl
c. Clodinafop-propargyl
Fenoxaprop-P-ethyl
e. FluazIfop-P-butyl
f. Propaquizafop
g. Haloxyfop-P-methyl
Ii. Cyhalofop-butyl
I Quizalofop-P-ethyl
2. Cyclohexanediones (DIMs')
a, Alloxydim
b. Butroxydim
C. ClethodIm
d. Cycloxydim
e. Sethoxydim
f. Tepraloxydim
g. Tralkoxydim
B. Inhibitors of Photosystem II¨HRAC
Group C1/ WSSA Group 5
1. Triazines
a. Ametryne
b. Atrazine
C. CyanazIne
d. Desmettyne
e. Dimethametryne
1. Prometon
g. Prometryne
h. Propazlne
1. Simazine
J. Stmetryne
k. Terbumeton
I. Terbuthylazine
m. Terbutryne
n. TrietazIne
2. TrIazinones
a. Hexazlnone
b. MetrIbuzin
c. Metamitron
3. Triazolinone
a. Amicarbazone
4. Uracils
a. Bromacil
b. Lenacil
c. Terbacll
5. Pyridazinones
a. Pyrazon
36
CA 02891153 2015-05-12
WO 2012/071040 PCMS2010/058011
6. Phenyl carbamates
a. Desmedipham
b. Phenmedipham
C. Inhibitors of Photosystem
Group C2/WSSA Group 7
1. Ureas
a. Fluometuron
b. Linuron
c. Chlorobromuron
d. Chlorotoluron
e. Chloroxuron
f. Dimefuron
g. Diuron
h. Ethidimuron
I. Fenuron
J. Isoproturon
K. Isouron
I. Methabenzthiazuron
m. Metobromuron
n. Metoxuron
0. Monollnuron
p. Neburon
q. Siduron
r. Tebuthiuron
2. Amides
a. Propanil
b. Pentanochlor
D. Inhibitors of Photosystem II-HRAC
Group C3/ WSSA Group 6
1. Nitrites
a. Bromofenoxlm
b. Bromoxynil
C. loxynli
2. Benzothiadiazinone (Bentazon)
a. Bentazon
3. PhenylpyridazInes
a. Pyridate
b. Pyridafol
E. Photosystem-l-electron diversion
(Bipyridyliums) (WSSA Group 22)
1. Diquat
2. Paraquat
F. Inhibitors of PPO
(protoporphyrinogen oxidase) (VVSSA
Group 14)
37
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
1. Diphenyiethers
a. Acifiuorfen-Na
b. Bifenox
c. Chlomethoxyfen
d. Fluoroglycofen-ethyl
=
= e. Fomesafen
f. Halosafen
g. Lactofen
h. Oxyfluorfen
2. Phenylpyrazoies
a. Fluazolate
b. Pyraflufen-ethyl
N-phenylphthalimides
a. Cinidon-ethyl
b. Flumioxazin
C. Flumiciorac-pentyl
4. Thiadiazoles
=
a. Fluthlacet-methyl
b. Thidiazimin
5. Oxadiazoles
a. Oxadiazon
b. Oxadiargyl
6. Trlazolinones
a. Carfentrazone-ethyl
b. Stlifentrazone
7. Oxazolldinediones
a. Pentoxazone
8. Pyrimldindiones
a. Benzfendizone
b. Butafenicil
9. Others
a. Pyrazogyl
b. Profluazol
=
=
G. Bleaching: Inhibition of carotenoid
biosynthesis at the phytoene desaturase
step (PDS) (VVSSA Group 12)
1. Pyridazinones
a. Norflurazon
2. Pyridinecarboxamides
a. Diflufenican
38
CA 02891153 2015-05-12
W02012/071040 PCT/US2010/058011
b. Ploolirtafen
3. Others
a. Beflubutamid
b. Fluridone
c. Flurochloridone
d. Flurtamone
H. Bleaching: Inhibition of 4-
hydroxyphenyl-pyruvate-dioxygenase (4-
HPPD) (WSSA Group 28)
1. Triketones
a. Mesotrlone
b. Sulcotrione
C. topremezone
d. temtorlone
2. Isoxazoles
a. Isoxachlortole
b. Isoxaflutole
3. Pyrazoles
a Benzofenap
=
b. Pyrazoxyferi
o. Pyrazolynate
4. Others
a. Benzobicyclon
I. Bleaching: Inhibition of carotenoid
biosynthesis (unknown target) (WSSA
Group 11 and 13)
1. Triazoles (WSSA Group 11)
a. Amitrole
2. Isoxazolidinones (WSSA Group
13)
a. Clomazone
3. Ureas
a. Fluometuron
3. Dlphenylether
a. Aclonifen =
J. Inhibition of EPSP Synthase
1. Glycines (WSSA Group 9)
a. Glyphosate
b. Sulfosate
K. Inhibition of glutamine synthetase
1. Phosphinic Acids
a. Glufosinate-ammonium
b. Bialaphos
39
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
L. Inhibition of DHP (dihydropteroate)
synthase (WSSA Group 18)
1 Carbamates
a. Asulam
M. Microtubule Assembly Inhibition
(WSSA Group 3)
1. Dinitroanilines
a. Benfluralin
b. Butralin
C. Dinitramine
d. Ethalfluralin
e. Oryzalin
f. Pendlmethalin
g. Trifluralin
2. Phosphoroamidates
a. Amlprophos-methyl
b. Butarniphos
3. Pyridines
a. Dithiopyr
b. Thiazopyr
4. Benzamides
a. Pronamide
b. Tebutam
5. Benzenedicarboxylic acids
a. Chlorthal-dimethyl =
N. Inhibition of mitosis/microtubule
organization WSSA Group 23) =
1. Carbamates
a. Chlorpropham
b. Propham
C. Carbetamide
0. Inhibition of cell division (Inhibition
of very long chain fatty acids as proposed
mechanism; WSSA Group 15)
I. Chloroacetamides
a. Acetochlor
b. Alachlor
c. Butachlor
d. Dimethachlor
e. Dimethanamid
f. Metazachlor
g. Metolachlor
h. Pethoxamid
I. Pretilachlor
j. Propachlor
CA 02891153 2015-05-12
WO 2012/071040 PCMS2010/058011
k. Proplsochlor
I. Thenylchlor
2. Acetamides
a. Diphenamid
b. Napropamide
C. Naproanilide
3. Oxyacetamides
a. Flufenacet
b. Mefenacet
4. Tetrazolinones
a. Fentrazamide
5. Others
a. Anilofos
b. Cafenstrole
c. indanotan
d. Piperophos
P. inhibition of cell wall (cellulose)
synthesis
1. Nitriles (VVSSA Group 20)
a. Dichlobenil
b. Chlorthiamid
2. Benzamides (isoxaben
(WSSA Group 21))
a. Isoxaben
3. Trlazolocarboxamides
(flupoxam)
a. Flupoxam
Q. Uncoupling (membrane
disruption): (VVSSA Group 24)
1. Dinitrophenols
a. I:NOG
b. Dinoseb
c. Dinoterb
R. Inhibition of Lipid Synthesis by
=
other than ACC inhibition
1. Thiocarba mates (WSSA
Group 8)
a. Butylate
b. Cyctoate
c. Dimepiperate
d. EPTC
e. Esprocarb
f. Molinate
g. Orbencarb
h. Pebulate
41
CA 02891153 2015-05-12
WO 2012/071040 PCT/IJS2010/058011
1. Prosulfocarb
J, Benthlocarb
k. Tiocarbazil
I. Triallate
m. Vemolate
2. Phosphorodithioates
a. Bensulide
3. Benzofurans
a. Benfuresate
b. Ethofumesate
4. Halogenated alkanoic acids
(VVSSA Group 26)
a. TCA
b, Dalapon
c. Flupropanate
S. Synthetic auxins (1AA-like) (WSSA
Group 4)
1. Phenoxycarboxylic acids
a. Clomeprop
b. 2A-D
c. Mecoprop
2, Benzoic acids
a. Dicamba
b. Chloramben
c. TBA
3. Pyridine carboxylic acids
a. Clopyralid
b. Fluroxypyr
c. Picloram
d. Tricyclopyr
4. Quin line carboxylic acids
a. Quinclorac
b. Quinmerac
5. Others (benazolin-ethyl)
a. Benazolin-ethyl
T. Inhibition of Auxin Transport
1. Phthalamates;
semicarbazones (WSSA Group 19)
a. Naptalam
b. Diflufenzopyr-Na
U. Other Mechanism of Action
1. Arylaminopropionic acids
a. Flamprop-M-methyl /-
42
CA 02891153 2015-05-12
WO 2012/071040 PCT/1152010/058011
isopropyl
2. Pyrazolium
a. Difenzoquat
3. Organoarsenicals
a. DSMA
b. MSMA
4. Others
a. Bromobutide
b. Cinmethylln
c. Cumyluron
d. Dazomet
e. Daimuron-methyl
f. Dimuron
g. Etobenzanid
h. Fosamine
I. Metam
j. Oxaziciomefone
k. Oleic acid
I. Pelargonic acid
m. Pyributicarb
In certain methods, glyphosate, alone or in combination with another herbicide
of interest, can be applied to the DP-073496-4 Brassica plants or their area
of
cultivation. Non-limiting examples of glyphosate formations are set forth in
Table 2. In
specific embodiments, the glyphosate is in the form of a salt, such as,
ammonium,
isopropylammonlum, potassium, sodium (including sesquisodium) or trimesium
(alternatively named suffosate).
43
CA 0 2 8 9115 3 2 015 - 0 5 - 12
WO 2012/071040 PCIYITS2010/058011
Table Z. Gly-phosate formulations comparisons.
Active Acid Acid
Herbicide by ingredi- eguiva- Apply:
equiva.
Registered eat per lent per fl oz/
lent per
Tradenntric Matusfactuer Salt gallon gallon acre acre
Roundup Original Monsanto Isopropylamine 4 3 32 0.750
Roundup Original II Monsanto Isopropylamine 4 3 32 0.750
Roundup Original MAX Monsanto Potassium 5.5 4.5 22 0.773
Roundup trItraMax Monsanto Lsopropylamine 5 3.68 26 0.748
Roundup UltraMax II Monsanto Potassium 5.5 4.5 22 0.773
Roundup Weather's= Monsanto Potassium 5.5 4.5 22 0.773
Touchdown Syngenta Diacrunoniwn 3.7 3 32 0.750
Touchdown HiTech Syngenta Potassium 6.16 5 29 0.781
Touchdown Total Syngenta Potassium 5.1.4 4.17 24 0.782
Durango Dow AgroSciences Isopropylamine 5.4 4 24
0.750
Glyphomax Dow AgroSciences Isopropylamine 4 3 32
0.750
C.dyphomax Plus DOW AgrOSCialC85 Isopropylamine 4 3 32
0.750
C.713phomax .7CRT Dow AgroSciences Isopropylamine 4 3 32
0,750
Gly Star Plus Albaughthgri star Isopropylatnine 4 3 32
0.750
Gly Star $ Albirugh/Agri Star Isopropylamine 5.4 4 24
0.750
GI), Star Original Albaugh/Agri Star Isopropylamine 4 3 32
0.750
Gly-Flo Micro Flo Isopropylambie 4 3 32 0.750
Credit Nufenn Isopropylamine 4 3 32 0.750
Credit Extra Nufann Isopropylamine 4 3 32 0.750
Credit Duo Nufartn Isopro. + 4 3 32 0.750
1310110aL11111.
Credit Duo Extra Nufann Isopro. + 4 3 32 0.750
. M0110a1M11.
Extra Credit 5 Nufarm Isopropylamine 5 3.68 26 0.748
Cornerstone Agriliance Isopropylamine 4 3 32 0.750
Cornerstone Plus Agrilianc-e Isopropylarnine 4 3 32 0.750
Glyfos Chenainova Isopropylamine 4 3 32 0.750
Glyfos X-TRA Cheminova Isopropylaraine 4 3 32 0.750
Rattler Helena Isopropylanaine 4 3 32 0.750
Rattler Plus Helena Isopropylamine 4 3 32 0.750
Mirage UAP Isopropylarren. e 4 3 37 0.750
Mirage Plus LIAP Isopropylamine 4 3 37 0.750
Glyphosate 41% Helm Agro USA IsopropyLarnine 4 3 32
0.750
Buccaneer Tenkoz Isopropylamine 4 3 32 0.750
BUCCaneer Plus Terikoz Isopropylatnine 4 3 32 0.750
Honcho Monsanto Isoproylamine 4 3 32 0.750
Honcho Plus Monsanto Isopropylrunisse 4 3 32 9.750
city-4 Univ, Crop Prot. Alit Isopropylamine 4 3 32
0.750
Oly-4 Plus Univ. Corp Not. Alit Isopropylamine 4 3 32
0.750
ClearOut 41 Chemical Products Isopropylamine 4 3 32
0.750
Tech.
ClearOur 41 Plus Chemical Products Isopropylamine 4 3 32
0.750
Tech.
Spitfire Control Solutions Isopropylamine 4 3 32
0.750
Spitfire Plus Control Solutions Isopropylamine 4 3 32
0.750
Glyphosate 4 ParmerSavencom Lsopropylamine .4 3 32
0.750
ES Glyphosate Plus Growmark Isopropylamine 4 3 32 0.750
Glyphosate Original Griffin. T.LC Isopropylareine 4 3 32
0.750
Thus, in some embodiments, a transgenic plant of the invention Is used in a
method of growing a DP-073496-4 brassica crop by the application of herbicides
to
which the plant is tolerant. In this manner, treatment with a combination of
one of
more herbicides which include, but are not limited to: acetochior, acifluorfen
and its
sodium salt, aclonifen, acrolefn (2-propenal), alachlor, alloxydim, ametryn,
amicarbazone, amidosulfuron, aminopyralid, amitrole, ammonium sulfamate,
anilofos,
asulam, atrazine, azimsulfuron, beflubutamld, benazolin, benazolin-ethyl,
'44
CA 02891153 2015-05-12
WO 2012)071040 PCT/US2010/058011
bencarbazone, benfluralin, benfuresate, bensutfuron-methyl, bensulide,
bentazone,
.benzoblcyclon, benzofenap, bifenox, bilanafos, bispyribac and its sodium
salt,
bromacil, bromobutide, bromofenoxim, bromoxynil, bromoxynil octanoate,
butachlor,
butafenacil, butamifos, butralin, butroxydim, butylate, cafenstrole,
carbetamide,
carfentrazone-ethyl, catechin, chlomethoxyfen, chloramben, chlorbromuron,
chlorflurenol-methyl, chloridazon, chlorimuron-ethyl, chlorotoluron,
chlorpropham,
chlorsulfuron, chlorthal-dimethyl, chlorthlamid, cinidon-ethyl, cinmethylin,
cinosulfuron,
clethodim, clodinafop-propargyl, clomazone, clomeprop, clopyralid, clopyralid-
olamine,
cloransulam-methyl, CUH-35 (2-methoxyethyl 2-[[(4-chloro-2-fluoro-5-[(1-methyl-
2-
propynyl) oxy]phenylK3-fluorobenzoyl)aminojcarbonyli-1 -cyclohexene-1-
carboxylate),
cumyluron, cyanazine, cycloate, cyclosulfamuron, cycloxydim, cyhalofop-butyl,
2,4-D
and its butotyl, butyl, isoctyl and isopropyl esters and its dimethylammonium,
diolamlne
and trolamine salts, daimuron, dalapon, dalapon-sodium, dazomet, 2,4-DB and
its
dimethylammonium, potassium and sodium salts, desmedipham, desmetryn, dicamba
and its diglycolammonium, dimethylammonium, potassium and sodium salts,
dichlobenil, dichlorprop, diclofop-methyl, diclosulam, difenzoquat
metilsulfate,
diflufenican, diflufenzopyr, dimefuron, =dimepiperate, dimethachlor,
dimethametryn,
dimethenamid, dimethenamld-P, dimethipin, dimethylarsinic acid and its sodium
salt,
dinitramine, dinotert, diphenamld, dlquat dibromide, dithiopyr, diuron, DNOC,
endothal, EPTC, esprocarb, ethalfluralin, ethametsulfuron-methyl,
ethofumesate,
ethoxyfen, ethoxysulfuron, etobenzanid, fenoxaprop-ethyl, fenoxaprop-P-ethyl,
fentrazamide, fenuron, fenuron-TCA, flamprop-methyl, flamprop-M-isopropyl,
flamprop-M-methyl, flazasulfuron, florasulam, fluazifop-butyl, fluazlfop-P-
butyl,
flucarbazone, flucetosulfuron, fluchloralln, flufenacet, flufenpyr, flufenpyr-
ethyl,
flumetsulam, flumiclorac-pentyl, flumioxazin, fluometuron, fluoroglycofen-
ethyl,
flupyrsulfuron-methyl and its sodium salt, flurenol, flurenol-butyl,
fluridone,
flurochloridone, fluroxypyr, flurtamone, fluthiacet-methyl, fomesafen,
foramsulfuron,
fosamine-ammonium, glufosinate, glufosinate-ammonium, glyphosate and its salts
such as ammonium, isopropylammonium, potassium, sodium (including
sesquisodium)
and trimesium (alternatively named suifosate), halosulfuron-methyl, hatoxyfop-
etotyl,
haloxyfop-methyl, hexazinone, HOK-201 (N-(2,4-clifluorophenyI)-1,5-dihydro-
N-(1-methylethyl)-5-oxo-1-[(tetrahydro-2H-pyran-2-yl)methyl]-41-1-1,2,4-
triazole-
4-carboxamide), imazamethabenz-methyl, imazamox, imazapic, imazapyr,
imazaquin,
imazaquin-ammonium, imazethapyr, imazethapyr-ammonium, lmazosulfuron,
indanofan, iodosulfuron-methyl, loxynil, roxynit octanoate, ioxynil-sodium,
isoproturon,
isouron, isoxaben, isoxaflutole, isoxachlortole, lactofen, !enact!, linuron,
maleic =
hycirazide, MCPA and its salts (e.g., MCPA-dimethylammonium, MCPA-potassium
and
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
MCPA-sodlum, esters (e.g., MCPA-2-ethylhexyl, MCPA-butotyl) and thioesters
(e.g.,
MCPA-thioethyl), MCPB and Its salts (e.g., MCPB-sodium) and esters (e.g., MCPB-
ethyl), mecoprop, mecoprop-P, mefenacet, mefluidicie, mesosulfuron-methyl,
mesotrione, metam-sodium, metamifop, meta m itron ,
metazachlor,
methabenzthiazuron, methylarsonic acid and its calcium, monoammonium,
monosodium and disodium salts, methyldymron, metobenzuron, metobromuron,
metolachlor, S-metholachlor, rnetosulam, metoxuron, metribuzin, metsulfuron-
methyl,
molinate, mondinuron, naproanilide, napropamide, naptalam, neburon,
nicosulfuron,
norflurazon, orbencarb, oryzalin, oxadiargyl, oxadiazon, oxasulfuron,
oxaziclomefone,
oxyfluorfen, paraquat dichloride, pebulate, pelargonic acid, pendimethalin,
penoxsulam, pentanochlor, pentoxazone, perfluidone, pethoxyamid, phenmedipham,
picloram, picloram-potassium, picolinafen, pinoxaden, piperofos, pretilachlor,
primisulfuron-methyl, prodiamine, profoxydim, prometon, prometryn, propachlor,
propanil, propaquizafop, propazine, propham, propisochlor, propoxycarbazone,
propyzamide, prosulfocarb, prosulfuron, pyradonil, pyraflufen-ethyl,
pyrasulfotole,
pyrazogyl, pyrazolynate, pyrazoxyfen, pyrazosuffuron-ethyl, pyribenzoxim,
pyributicarb, pyridate, pyriftalid, pyriminobac-methyl, pyrimisulfan,
pyrithiobac,
pyrithiobac-sodium, pyroxsulam, quinclorac, quinmerac,
quinoclamine,
quizalofop-ethyl, quizalofop-P-ethyl, quizalofop-P-tefuryl, rimsulfuron,
sethoxydirn,
siduron, simazine, simetryn, sulcotrione, sulfentrazone, sulfometuron-methyl,
sulfosulfuron, 2,3,6-TBA, TCA, ICA-sodium, tebutam, tebuthiuron,
tefuryitrione,
tembotrione, tepraloxydim, terbacil, tertumeton, terbuthylazine, terbutryn,
thenylchlor,
thiazopyr, thiencarbazone, thifensulfuron-methyl, th io be n
carb, tiocarbazil,
topramezone, traikoxydim, tri-allate, triasulfuron, triaziflam, tribenuron-
methyl, triclopyr,
triclopyr-butotyl, triclopyr-triethylammonium, tridiphane, trietazine,
trifloxysulfuron,
trifluralin, triflusulfuron-methyl, tritosulfuron and vernolate is disclosed.
Other suitable herbicides and agricultural chemicals are known in the art,
such
as, for example, those described in WO 2005/041654. Other herbicides also
include
bioherbicides such as Altemana destruens Simmons, Colletotrichum
gloeosporiodes
(Penz.) Penz, and Saco., Orechsiera monoceras (MT13-851), Myrothecium
verrucaria
(Albertini & Schweinitz) Ditmar: Fries, Phytophthora palmivora (Butt.) Butt.
and
Puccinia thlaspeos Schub.. Combinations of various herbicides can result in a
greater-
than-additive (i.e., synergistic) effect on weeds and/or a less-than-additive
effect (i.e.,
safening) on crops or other desirable plants. In certain instances,
combinations of
glyphosate with other herbicides having a similar spectrum of control but a
different
mode of action will be particularly advantageous for preventing the
development of
46
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
resistant weeds. Herbicidally effective amounts of any particular herbicide
can be
easily determined by one skilled in the art through simple experimentation.
Herbicides may be classified into groups and/or subgroups as described herein
above with reference to their mode of action, or they may be classified Into
groups
and/or subgroups in accordance with their chemical structure.
Sulfonamide herbicides have as an essential molecular structure feature a
sulfonamide moiety (¨S(0)2NH¨). As referred to herein, sulfonamide herbicides
particularly comprise sulfonylurea herbicides,
sulfonylaminocarbonyltriazolinone
herbicides and triazolopyrimidine herbicides. In sulfonylurea
herbicides the
sulfonamide moiety is a component in a sulfonylurea bridge
(¨S(0)2NHC(0)NH(R)¨).
In sulfonylurea herbicides the suffonyl end of the sulfonyfurea bridge is
connected
either directly or by way of an oxygen atom or an optionally substituted amino
or
methylene group to a typically substituted cyclic or acyclic group. At the
opposite end
of the sulfonylurea bridge, the amino group, which may have a substituent such
as
methyl (R being CH3) instead of hydrogen, is connected to a heterocyclic
group,
typically a symmetric pyrimidine or triazine ring, having one or two
substituents such
as methyl, ethyl, trifluoromethyl, methoxy, ethoxy, methylamino,
dimethylamino,
ethylamino and the halogens. In sulfonylaminocarbanyltriazolinone herbicides,
the
sulfonamide moiety is a component of a sulfonylaminocarbonyl bridge (-
S(0)2NHC(0)¨). In sulfonylaminocarbonyltriazolinone herbicides the sulfonyl
end of
the sulfonylaminocarbonyl bridge is typically connected to substituted phenyl
ring. At
the opposite end of the sulfonylaminocarbonyl bridge, the carbonyl is
connected to the
1-position of a triazolinone ring, which is typically substituted with groups
such as alkyl
and alkoxy. In triazolopyrimidine herbicides the sulfonyl end of the
sulfonamide moiety
is connected to the 2-position of a substituted [1,2,4]triazolopyrimidine ring
system and
the amino end of the sulfonamide moiety is connected to a substituted aryl,
typically
phenyl, group or alternatively the amino end of the sulfonamide moiety is
connected to
the 2-position of a substituted [1,2,4]triazolopyrImicline ring system and the
sulfonyl
end of the sulfonamide moiety is connected to .a substituted aryl, typically
pyridinyl,
group.
The methods further comprise applying to the crop and the weeds in a field a
sufficient amount of at least one herbicide to which the crop seeds or plants
are
tolerant, such as, for example, glyphosate, a hydroxyphenylpyruvatedioxygenase
inhibitor (e.g., mesotrione or sulcotrione), a phytoene desaturase inhibitor
(e.g.,
diflufenican), a pigment synthesis inhibitor, sulfonamide, imidazolinone,
bialaphos,
phosphinothrlcin, azafenidin, butafenacil, sulfosate, glufosinate,
triazolopyrimidine,
pyrimidinyloxy(thio)benzoate or sulonylaminocarbonyltriazolinone, an acetyl Co-
A
47
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
carboxylase inhibitor such as quizalofop-P-ethyl, a synthetic auxin such as
quinclorac,
Kif-1-485 or a protox inhibitor to control the weeds without significantly
damaging the
crop plants.
Generally, the effective amount of herbicide applied to the field is
sufficient to
selectively control the weeds without significantly affecting the crop. "Weed"
as used
herein refers to a plant which is not desirable in a particular area.
Conversely, a "crop
plant' as used herein refers to a plant'which is desired in a particular area,
such as, for
example, a Brassica plant. Thus, in some embodiments, a weed is a non-crop
plant or
a non-crop species, while in some embodiments, a weed is a crop species which
is
sought to be eliminated from a particular area, such as, for example, an
inferior and/or
non-transgenic Brassica plant in a field planted with Brassica event DP-073496-
4 or a
non-Brassica crop plant in a field planted with DP-073496-4. Weeds can be
classified
into two major groups: monocots and dicots.
Many plant species can be controlled (i.e., killed or damaged) by the
herbicides
described herein. Accordingly, the methods of the invention are useful in
controlling
these plant species where they are undesirable .(i.e., where they are weeds).
These
plant species Include crop plants as well as species commonly considered
weeds,
including but not limited to species such as: blackgrass (Alopecurus
myosuroides),
giant foxtail (Setaria faben), large crabgrass (Digitaria sanguinalis),
Surinam grass
(Brachiaria decumbens), wild oat (Avena .fatua), common cocklebur (Xanthium
pensylvanicum), common lambsquarters (Chenopodium album), morning glory
(ipomoea coccinaa), pigweed (Amaranthus spp,), velvetieaf (Abut/lion
theophrastr),
common barnyardgrass (Echinochloa bermudagrass
(Cynodon dactylon),
downy brome (Bromus tectorum), goosegrass (Eleusine indica), green foxtall
(Setaria
viridis), Italian ryegrass (Lolium multiflorum), Johnsongrass (Sorghum
halepense),
lesser canarygrass (Phalaris minor), windgrass (Apera spice-vent;), wooly
cupgrass
(ErIchroa villosa), yellow nutsedge (Cyperus esculentus), common chickweed
(Stellaria
media), common ragweed (Ambrosia artemiefolia), Kochia scopatia, horseweed
(Conyza canadens(s), rigid ryegrass (Lolium rigidum), goosegrass (Eleucine
indica),
hairy fleabane (Conga bonariensis), buckhom plantain (Plantago lanceolata),
tropical
spiderwort (Commelina benghalensis), field bindweed (Convolvulus amens's),
purple
nutsedge (Cyperus rotundus), redvine (Brunnichia ovate), hemp sesbania
(Sesbanla
exa/tafa), sicklepod (Senna obtusifolia), Texas blueweed (Helianthus cillaris)
and
Devil's claws (Proboscidea louisianica). In other embodiments, the weed
comprises a
herbicide-resistant ryegrass, for example, a glyphosate resistant ryegrass, a
paraquat
resistant ryegrass, a ACCase-inhibitor resistant ryegrass and a non-selective
herbicide
48
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
resistant ryegrass. In some embodiments, the undesired plants are proximate
the crop
plants,
As used herein, by "selectively controlled" it is intended that the majority
of
weeds in an area of cultivation are significantly damaged or killed, while if
crop plants
are also present in the field, the majority of the crop plants are not
significantly
damaged. Thus, a method is considered to selectively control weeds when at
least
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the weeds are
significantly damaged or killed, while If crop plants are also present in the
field, less
than 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or 1% of the crop plants are
significantly damaged or killed.
In some embodiments, a Brass/ca DP-073496-4 plant of the invention is not
significantly damaged by treatment with a particular herbicide applied to that
plant at a
dose equivalent to a rate of at least 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15,
20, 25, 30, 35, 40, 45, 60, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120,
150, 170,
200, 300, 400, 500, 600, 700, 800, 800, 1000, 2000, 3000, 4000, 5000 or more
grams
or ounces (1 ounce = 29.57m1) of active ingredient or commercial product or
herbicide
formulation per acre or per hectare, whereas an appropriate control plant is
significantly damaged by the same treatment.
In specific embodiments, an effective amount of an ALS inhibitor herbicide
comprises at least about 0.1, 1, 5, 10, 25,50, 75, 100, 150, 200, 250, 300,
350, 400,
450, 500, 600, 700, 750, 800, 850, 900, 950,1000, 2000, 3000, 4000, 5000 or
more
grams or ounces (1 ounce = 29.57m1) of active ingredient per hectare. In other
embodiments, an effective amount of an ALS inhibitor comprises at least about
0.1-50,
about 25-75, about 50-100, about 100-110, about 110-120, about 120-130, about
130-
140, about 140-150, about 150-200, about 200-500, about 500-600, about 600-
800,
about 800-1000 or greater grams or ounces (1 ounce = 29.57m1) of active
ingredient
per hectare. Any ALS inhibitor, for example, those listed in Table 1 can be
applied at
these levels.
in other embodiments, an effective amount of a suffonylurea comprises at least
0,1, 1, 5, 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600,
700, 800,
900, 1000, 5000 or more grams or ounces (1 ounce = 29.57m1) of active
ingredient per
hectare. In other embodiments, an effective amount of a sulfonyiurea comprises
at
least about 0.1-50, about 25-75, about 50-100, about 100-110, about 110-120,
about
120-130, about 130-140, about 140-150, about 150-160, about 160-170, about 170-
180, about 190-200, about 200-250, about 250-300, about 300-350, about 350-
400,
about 400-450, about 450-500, about 500-550, about 550-600, about 600-650,
about
650-700, about 700-800, about 800-900, about 900-1000, about 1000-2000 or more
49
CA 0 2 8 9 1 1 5 3 2 0 1 5-0 5-1 2
WO 2012/071040 PCUUS2010/058011
grams-or ounces (1 ounce = 29.57mf) of active Ingredient per hectare..
Representative
suffonylureas that can be applied at this level are set forth in Table 1.
In other embodiments, an effective amount of a
sulfonylaminocarbonyltriazollnones, triazolopyrimidines,
pyrimidinyloxy(thlo)benzoates,
and lmidazolinones can comprise at least about 0.1, 1, 5, 10, 25, 50, 75, 100,
150,
200, 250, 300, 350, 400, 450, 500, 650, 600, 650, .700, 750, 800, 850, 900,
950, 1000,
1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1500, 1550, 1600, 1650, 1700,
1800, 1850, 1900, 1950, 2000, 2500, 3500, 4000, 4500, 5000 or greater grams or
ounces (1 ounce = 29.57MI) active ingredient per hectare. In other
embodiments, an
effective amount of a suffonyluminocarbonyttriazolines, triazolopyrimidlnes,
pyrimIdinyloxy(thio)benzoates or imidazolinones comprises at least about 0.1-
50,
about 25-75, about 50-100, about 100-110, about 110-120, about 120-130, about
130-
140, about 140-150, about 150-160, about 160-170, about 170-180, about 190-
200,
about 200-250, about 250-300, about 300-350, about 350-400, about 400-450,
about
450-500, about 600-550, about 550-600, about 600-650, about 650-700, about 700-
800, about 800-900, about 900-1000, about 1000-2000 or more grams or ounces (1
ounce =I 29.57 ml) active ingredient per hectare.
Additional ranges of the effective amounts of herbicides can be found, for
example, in various publications from University Extension services. See, for
example,
Bemards, at al,, (2006) Guide for Weed Management in Nebraska
(www.ianrpubs,urteclu/sendit/ec130); Regher, et al., (2005) Chemical Weed
Control
for Fields Crops, Pastures, Rangeland, and Noncropland, Kansas State
University
Agricultural Extension Station and Corporate Extension Service; Zollinger, et
aL,
(2006) North Dakota Weed Control Guide, North Dakota Extension Service and the
Iowa State University Extension at wWw.weeds.iastate.edu
In some embodiments of the invention, glyphosate is applied to an area of
cultivation and/or to at least one plant in an area of cultivation at rates
between 8 and
32 ounces of acid equivalent per acre, or at rates between 10, 12, 14, 16, 18,
20, 22,
24, 26, 28 and 30 ounces of acid equivalent per acre at the lower end of the
range of
application and between 12, 14, 18, 18, 20, 22, 24, 28, 28, 30 and 32 ounces
of acid
equivalent per acre at the higher end of the range of application (1 ounce
29.57 m1).
In other embodiments, glyphosate is applied at least at 1, 5,10, 20, 30,40,
50, 60, 70,
80, 90 or greater ounce of active ingredient per hectare (1 ounce = 29.57 m1).
In some
embodiments of the Invention, a surfonylurea herbicide Is applied to a fold
and/or to at
least one plant in a field at rates between 0.04 and 1.0 ounces of active
ingredient per
acre, or at rates between 0.1, 0.2, 0.4, 0.6 and 0.8 ounces of active
ingredient per acre
50 =
=
CA 02891153 2015-05-12
WO 2012/071040 PC171182010/058011
at the lower end of the range of application and between 0.2, 0.4, 0.6, 0.8
and 1,0
ounces of active ingredient per acre at the higher end of the range of
application. (1
= ounce 29.57 m1).
As is known in the art, glyphosate herbicides as a class contain the same
active ingredient, but the active Ingredient is present as one of a number of
different
salts and/or formulations. However, herbicides known to inhibit ALS vary in
their
active ingredient as well as their chemical formulations. One of skill in the
art is
familiar with the determination of the amount of active ingredient and/or acid
equivalent
=
present in a particular volume and/or weight of herbicide preparation.
In some embodiments, an ALS inhibitor herbicide is employed. Rates at which
the ALS inhibitor herbicide is applied to the crop, crop part, seed or area of
cultivation
can be any of the rates disclosed herein. In specific embodiments, the rate
for the
ALS inhibitor herbicide is about 0.1 to about 5000 g al/hectare, about 0.5 to
about 300
g ai/hectare or about 1 to about 150 g ai/hectare.
Generally, a particular herbicide is applied to a particular field (and any
plants
growing in it) no more than 1, 2, 3, 4, 5, 6, 7 or 8 times a year, or no more
than 1, 2, 3,
4 or 5 times per growing season.
By 'treated with a combination or or "applying a combination of' herbicides to
a
crop, area of cultivation or field" it is intended that a particular fleld,
crop or weed is
treated with each of the herbicides and/or chemicals indicated to be part of
the
combination so that a desired effect is achieved, i.e., so that weeds are
selectively
controlled while the crop is not significantly damaged. In some embodiments,
weeds
which are susceptible to each of the herbicides exhibit damage from treatment
with
each of the herbicides which is additive or synergistic. The application of
each
herbicide and/or chemical may be simultaneous or the applications may be at
different
times, so long as the desired effect is achieved. Furthermore, the application
can
occur prior to the planting of the crop.
The proportions of herbicides used in the methods of the invention with other
herbicidal active ingredients in herbicidal compositions are generally in the
ratio of
5000:1 to 1:5000, 1000:1 to 1:1000, 100:1 to 1:100, 10:1 to 1:10 or 5:1 to 1:5
by
weight. The optimum ratios can be easily determined by those skilled in the
art based
on the weed control spectrum desired. Moreover, any combinations of ranges of
the
various herbicides disclosed in Table 1 can also be applied in the methods of
the
invention.
Thus, in some embodiments, the invention provides improved methods for
selectively controlling weeds in a field wherein the total herbicide
application may be
less than 90%, 85%, 80%, 76%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%,
51
CA 02891153 2015-05-12
WO 20121071040 PCUUS2010/058011
25%, 20%, 15%, 10%, 5% or 1% of that used in other methods. Similarly, in some
embodiments, the amount of a particular herbicide used for selectively
controlling
weeds in a field may be less than 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%,
45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% or 1% of the amount of that
particular herbicide that would be used in other methods, i.e., methods not
utilizing a
plant of the invention.
In some embodiMents, a DP-073496-4 Brassica plant of the invention benefits
from a synergistic effect, wherein the herbicide tolerance conferred by the
GLYAT
polypeptide and that conferred by a polypeptide providing tolerance to another
herbicide is. greater than expected from simply combining the herbicide
tolerance
conferred by each gene separately. See, e.g., McCutchen, at al., (1997) J.
Econ.
Entomol. 90:1170-1180; Priesler, et at, (1999) J. Econ. Entomol. 92:598-603.
As used
herein, the terms "synergy,' synergistic," "synergistically" and derivations
thereof,
.such as in a "synergistic effect" or a "synergistic herbicide combination" or
a
'synergistic herbicide composition" refer to circumstances under which the
biological
activity of a combination of herbicides, such as at least a first herbicide
and a second
herbicide, is greater than the sum of the biological activities of the
individual
herbicides. Synergy, expressed in terms of a "Synergy Index (SI)," generally
can be
determined by the method described by Kull, at al., (1961) Applied
Microbiology 9:538.
See also, Colby, (1967) Weeds 15:20-22.
In other instances, the herbicide tolerance conferred on a DP-073496-4 plant
of
the invention is additive; that is, the herbicide tolerance profile conferred
by the
herbicide tolerance genes is what would be expected from simply combining the
herbicide tolerance conferred by each gene separately to a transgenic plant
containing
them individually. Additive and/or synergistic activity for two or more
herbicides
against key weed species will increase the overall effectiveness and/or reduce
the
actual amount of active ingredient(s) needed to control said weeds. Where such
synergy is observed, the plant of the invention may display tolerance to a
higher dose
or rate of herbicide and/or the plant may display tolerance to additional
herbicides or
other chemicals beyond those to which it would be expected to display
tolerance. For
example, a DP-073496-4 Brass/ca plant may show tolerance to organophosphate
compounds such as insecticides and/or Inhibitors of 4-hydroxyphenylpyruvate
dioxygenase.
Thus, for example, the DP-073496-4 Brassica plants of the invention, when
further comprising genes conferring tolerance to other herbicides, can exhibit
greater
than expected tolerance to various herbicides, including but not limited to
glyphosate,
ALS inhibitor chemistries and sulfonylurea herbicides. The DP-073496-4
Brassica
52
CA 02891153 2015-05-12
WO 2012/071040 PCMS2010/058011 -
plant plants of the invention may show tolerance to a particular herbicide or
herbicide
combination that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%,
15%,
17%, 20%, 22%, 25%, 27%, 30%, 35%, 40%, 45%, 60%, 55%, 60%, 65%, 70%, 80%,
90%, 100%, 125%, 150%, 175%, 200%, 300%, 400% or 500% or more higher than
the tolerance of an appropriate control plant that contains only a single
herbicide
tolerance gene which confers tolerance to the same herbicide or herbicide
combination. Thus, DP-073498-4 Brassica plants may show decreased damage from
the same dose of herbicide in comparison to an appropriate control plant, or
they may
show the same degree of damage in response to a much higher dose of herbicide
than
the control plant. Accordingly, in specific embodiments, a particular
herbicide used for
selectively containing weeds in a field is more than 1%, 5%, 10%, 15%, 20%,
25%,
30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100% or greater than the amount
of that particular herbicide that would be used in other methods, i.e.,
methods not
utilizing a plant of the invention.
In the same manner, in some embodiments, a DP-073496-4 Brasslea plant of
the invention shows improved tolerance to a particular formulation of a
herbicide active
Ingredient in comparison to an appropriate control plant. Herbicides are sold
commercially as formulations which typically include other ingredients in
addition to the
herbicide active ingredient; these ingredients are often intended to enhance
the
efficacy of the active Ingredient. Such other ingredients can include, for
example,
safeners and adjuvants (see, e.g., Green and Foy, (2003) "Adjuvants: Tools for
Enhancing Herbicide Performance," In Weed Biology and Management, ed. Inderjit
(Kluwer Academic Publishers, The Netherlands)). Thus, a DP-073496-4 Brassica
plant of the invention can show tolerance to a particular formulation of a
herbicide
(e.g., a particular commercially available herbicide product) that is at least
1%, 2%,
3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 17%, 20%, 22%, 25%, 27%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100%, 125%, 150%, 175%,
200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1100%, 1200%,
1300%, 1400%, 1500%, 1500%, 1700%, 1800%, 1900% or 2000% or more higher
than the tolerance of an appropriate control plant that contains only a single
herbicide
tolerance gene which confers tolerance to the same herbicide formulation.
In some embodiments, a DP-073496,4 Brass/ca plant of the invention shows
improved tolerance to a herbicide or herbicide class to which at least one
other
herbicide tolerance gene confers tolerance as well as Improved tolerance to at
least
one other herbicide or chemical which has a different mechanism or basis of
action
than either glyphosate or the herbicide corresponding to said at least one
other
herbicide tolerance gene. This surprising benefit of the invention finds use
in methods
53
CA 02891153 2015-05-12
W02012/071040 PCT/US2010/038011
of growing crops that comprise treatment with various combinations of
chemicals,
including, for example, other chemicals used for growing crops. Thus, for
example, a
DP-073496-4 Brassica plant may also show improved tolerance to chlorpyrifos, a
systemic organophosphate insecticide. Thus, the invention also provides a DP-
073496-4 Brassica plant that confers tolerance to glyphosate (i.e., a GLYAT
gene)
which shows improved tolerance to chemicals which affect the cytochrome P450
gene,
and methods of use thereof. In some embodiments, the DP-073496-4 Brassica
plants
also show improved tolerance to dicamba. In these embodiments, the improved
tolerance to dicamba may be evident in the presence of glyphosate and a
sulfonylurea
herbicide.
In other methods, a herbicide combination is applied over a DP-073496-4
Brassica plant, where the herbicide combination produces either an additive or
a
synergistic effect for controlling weeds. Such combinations of herbicides can
allow the
application rate to be reduced, a broader spectrum of undesired vegetation to
be
controlled, improved control of the undesired vegetation with fewer
applications, more
rapid onset of the herbicidal activity or more prolonged herbicidal activity.
An 'additive herbicidal composition' has a herbicidal activity that is about
equal
to the observed activities of the Individual components. A "synergistic
herbicidal
combination" has a herbicidal activity higher than what can be expected based
on the
observed activities of the individual components when used alone. Accordingly,
the
presently disclosed subject matter provides a synergistic herbicide
combination,
wherein the degree of weed control of the mixture exceeds the sum of control
of the
Individual herbicides. In some embodiments, the degree of weed control of the
mixture
exceeds the sum of control of the individual herbicides by any statistically
significant
amount including, for example, about 1% to 5%, about 5% to about 10%, about
10% to
about 20%, about 20% to about 30%, about 30% to 40%, about 40% to about 50%,
about 50% to about 60%, about 60% to about 70%, about 70% to about 80%, about
80% to about 90%, about 90% to about 100%, about 100% to 120% or greater.
Further, a "synergistically effective amount' of a herbicide refers to the
amount of one
herbicide necessary to elicit a synergistic effect in another herbicide
present in the
herbicide composition. Thus, the term ¶synergist," and derivations thereof,
refer to a
substance that enhances the activity of an active ingredient (ai), i.e., a
substance in a
formulation from which a biological effect is obtained, for example, a
herbicide.
Accordingly, in some embodiments, the presently disclosed subject matter
provides a method for controlling weeds in an area of cultivation. In some
embodiments, the method comprises: (a) planting the area with a DP-073496-4
crop
seeds or crop plants which also comprise polynucleotides conferring ALS-
inhibitor
54
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
tolerance; and (b) applying to the weed, the crop plants, a crop part, the
area of
cultivation or a combination thereof, an effective amount of a herbicide
composition
comprising at least one of a synergistically effective amount of glyphosate
and a
synergistically effective amount of an ALS inhibitor (for example, but not
limited to, a
sulfonylurea herbicide) or agriculturally suitable salts thereof, wherein at
least one of:
(i) the synergistically effective amount of the glyphosate is lower than an
amount of
glyphosate required to control the weeds in the absence of the sulfonylurea
herbicide;
(ii) the synergistically effective amount of the ALS inhibitor herbicide is
lower than an
amount of the ALS inhibitor required to control the weeds in the absence of
glyphosale
and (iii) combinations thereof and wherein the effective amount of the
herbicide
composition is tolerated by the crop seeds or crop plants and controls the
weeds in the
area of cultivation.
In some embodiments, the herbicide composition used in the presently
disclosed method for controlling weeds comprises a synergistically effective
amount of
glyphosate and a sulfonylurea herbicide, In further embodiments, the presently
disclosed synergistic herbicide composition comprises glyphosate and a
sulfonylurea
herbicide selected from the group consisting of metsulfuron-methyl,
chlorsuffuron and
triasulfuron.
In particular embodiments, the synergistic herbicide combination further
comprises an adjuvant such as, for example, an ammonium Sulfate-based
adjuvant,
e.g., ADD-UP (Wenkem., Halfway House, Midrand, South Africa). In additional
embodiments, the presently disclosed synergistic herbicide compositions
comprise an
additional herbicide, for example, an effective amount of a
pyrimiclinyloxy(thio)benzoate herbicide. In some embodiments, the
pyrimidinyloxy(thio)benzoate herbicide comprises bispyribac, e.g., (VELOCITY ,
Valent U.S.A. Corp., Walnut Creek, California, United States of America) or an
agriculturally suitable salt thereof.
In some embodiments of the presently disclosed method for controlling
undesired plants, the glyphosate is applied pre-emergence, post-emergence or
pre-
and post-emergence to the undesired plants or plant crops and/or the ALS
inhibitor
herbicide (i.e., the sulfonylurea herbicide) is applied pre-emergence, post-
emergence
or pre- and post-emergence to the undesired plants or plant crops. In other
embodiments, the glyphosate and/or the ALS inhibitor herbicide (i.e., the
sulfonylurea
herbicide) are applied together or are applied separately. In yet other
embodiments,
the synergistic herbicide composition is applied, e.g., step (b) above, at
least once
prior to planting the crop(s) of Interest, e.g., step (a) above.
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
Weeds that can be difficult to control with glyphosate alone In fields where a
crop is grown (such as, for example, a brassica crop) include but are not
limited to the
following: horseweed (e.g., Conyza canadensis); rigid ryegrass (e.g., Lolium
rigidum);
goosegrass (e.g., Eleusine indica); Italian ryegrass (e.g., Lolium
multiflorum); hairy
fleabane (e.g., Conyza bonariensis); buckhorn plantain (e.g., Plantago
lanceolate);
common ragweed (e.g., Ambrosia artemisifolia); morning glory (e.g., lpomoea
spp.);
waterhemp (e.g., Amaranthus spp.); field bindweed (e.g., Convolvulus
arvensis);
yellow nutsedge (e.g., Cyperus esculentus); common larnbsquarters (e.g.,
Chenopodium album); wild buckwheat (e.g., Polygonium convolvulus); velvetleaf
Abut/Ion theophrasti); kochia (e.g., Kochla scoparia) and Asiatic dayflower
(e.g.,
Commelina spp.). In areas where such weeds are found, Brassica plants
comprising
the DP-073496-4 event and tolerance to another herbicide are particularly
useful in
allowing the treatment of a field (and therefore any crop growing in the
field) with
combinations of herbicides that would cause unacceptable damage to crop plants
that
= 15 did not contain both of these polynucleotides. Plants of the
invention that are tolerant
to glyphosate and other herbicides such as, for example, sulfonylurea,
imidazolinone,
triazolopyrimidine, pyrimidinyl(thio)benzoate and/or
sulfonylaminocarbonyltriazolinone
herbicides in addition to being tolerant to at least one other herbicide with
a different
mode of action or site of action are particularly useful in situations where
weeds are
tolerant to at least two of the same herbicides to which the plants are
tolerant. In this
manner, plants of the invention make possible Improved control of weeds that
are
tolerant to more than one herbicide.
For example, some commonly used treatments for weed control in fields where
current commercial crops (including, for example, Brassicas) are grown include
glyphosate and, optionally, 2,4-D; this combination, however, has some
disadvantages. Particularly, there are weed species that it does not control
well and it =
also does not work well for weed control in cold weather. Another commonly
used
treatment for weed control in brassica fields is the sulfonylurea herbicide
chlorimuron-
ethyl, which has significant residual activity in the soil and thus maintains
selective
pressure on all later-emerging weed species, creating a favorable environment
for the
growth and spread of sulfonylurea-resistant weeds. Fields may be be treated
with
sulfonylurea, imidazolinone, triazolopyrimidines, pyrimidiny(thio)benzoates
and/or
sulfonylaminocarbonyltriazonlinone such as the sulfonylurea chlorimuron-ethyl,
either
alone or in combination with other herbicides, such as a combination of
glyphosate
and tribenuron-methyl (available commercially as Express ). This combination
has
several advantages for weed control under some circumstances, including the
use of
herbicides with different modes of action and the use of herbicides having a
relatively
56
CA 02891153 2015-05-12
WO 2012/071040 PCTfUS2010/058011
short period of residual activity in the soil. A herbicide having a relatively
short period
of residual activity is desirable, for example, in situations where it is
important to
reduce selective pressure that would favor the growth of herbicide-tolerant
weeds. Of
course, in any particular situation where weed control is required, other
considerations
may be more important, such as, for example, the need to prevent the
development of
and/or appearance of weeds in a field prior to planting a crop by using a
herbicide with
a relatively long period of residual activity. Treatments that include both
tribenuron-
methyl and thifensuifuron-methyl may be particularly useful.
Other commonly used treatments for weed control in fields where current
commercial varieties of crops (including, for example, Brassicas) are grown
include the
sulfonylurea herbicide thifensulfuron-methyl (available commercially as
Harmony
GTO). However, one disadvantage of thifensulfuron-methyl is that the higher
application rates required for consistent weed control often cause injury to a
crop
growing in the same field. DP-073496-4 Brass/se plants comprising additional
tolerance can be treated with a combination of glyphosate and thifensulfuron-
methyl,
which has the advantage of using herbicides with different modes of action.
Thus,
weeds that are resistant to either herbicide alone are controlled by the
combination of
the two herbicides, and the improved DP-073496-4 Brassica plants would not be
significantly damaged by the treatment.
. Other herbicides which are used for weed control in fields where current
commercial varieties of crops (including, for example, Brassicas) are grown
are the
triazolopyrimidine herbicide cloransulam-methyl (available commercially as
FirstRate0) and the imIdazolinone herbicide imazaquin (available commercially
as
Sceptor0). When these herbicides are used Individually they may provide only
marginal control of weeds. However, may be treated, for example, with a
combination
of glyphosate (e.g., Roundup (glyphosate isopropyramine salt)), imazapyr
(currently
available commercially as Arsenal ), chloiimuron-ethyl (currently available
commercially as Classic ), quizalofop-P-ethyl (currently available
commercially as
Assure 110) and fomesafen (currently available commercially as Flexstaret).
This
combination has the advantage of using herbicides with different modes of
action.
Thus, weeds that are tolerant to just one or several of these herbicides are
controlled
by the combination of the five herbicides. This combination provides an
extremely
broad spectrum of protection against the type of herbicide-tolerant weeds that
might be
expected to arise and spread under current weed control practices.
Fields containing the DP-073496-4 Brass/ca plants with additional herbicide
tolerance may also be treated, for example, with a combination of herbicides
including
glyphosate, rimsutfuron, and dicamba or mesotrione. This combination may be
57 =
CA 02891153 2015-05-12
WO 2012/071040 PCT/U52010/058011
particularly useful in controlling weeds which have developed some tolerance
to
herbicides which inhibit ALS. Another combination of herbicides which may be
particularly useful for weed control includes glyphosate and at least one of
the
following: metsulfuron-methyl (commercially available as Ally ), imazapyr
(commercially available as Arsenalill), imazethapyr, imazaquin and
suffentrazone. It is
understood that any of the combinations discussed above or elsewhere herein
may
also be used to treat areas in combination with any other herbicide or
agricultural
chemical.
Some commonly-used treatments for weed control in fields where current
commercial crops (including, for example, Brass/ca) are grown include
glyphosate
(currently available commercially as Roundup ), rimsulfuron (currently
available
commercially as Resolve or Matrix ), dicamba (commercially available as
Clarity ),
atrazine and mesotrione (commercially available as Callisto0). These
herbicides are
sometimes used individually due to poor crop tolerance to multiple herbicides.
Unfortunately, when used individually, each of these herbicides has
significant
disadvantages. Particularly, the incidence of weeds that are tolerant to
individual
herbicides continues to increase, rendering glyphosate less effective than
desired in
some situations. Rimsulfuron provides better weed control at high doses which
can
cause injury to a crop, and alternatives such as dicamba are often more
expensive
than other commonly-used herbicides
Some commonly-used treatments for weed control in fields where current
commercial crops are grown include glyphosate (currently available
commercially as
Roundup ), chlorimuron-ethyl, tribenuron-methyl, rimsuifuron (currently
available
commercially as Resolve or Matrix ), Imazethapyr, imazapyr and imazaquin.
Unfortunately, when used individually, each of these herbicides has
significant
disadvantages. Particularly, the incidence of weeds that are tolerant to
individual
herbicides continues to increase, rendering each individual herbicide less
effective
than desired in some situations. However, DP-073496-4 Brassica with an
additional -
herbicide tolerance trait can be treated with a combination of herbicides that
would
cause Unacceptable damage to standard plant varieties, including combinations
of
herbicides that include at least one of those mentioned above.
In the methods of the invention, a herbicide may be formulated and applied to
an area of interest such as, for example, a field or area of cultivation, in
any suitable
manner. A herbicide may be applied to a field in any form, such as, for
example, in a
liquid spray or as solid powder or granules. In specific embodiments, the
herbicide or
combination of herbicides that are employed in the methods comprise a tankmix
or a
premix. A herbicide may also be formulated, for example, as a "homogenous
granule
58
CA 02891153 2015-05-12
WO 2012/071040 PC=82010/058011
blend" produced using blends technology (see, e.g., US Patent Number
6,022,552,
entitled "Uniform Mixtures of Pesticide Granules"). The blends technology of
US
Patent Number 6,022,552 produces a nonsegregating blend (i.e., a 'homogenous
granule blend") of formulated crop protection chemicals in a dry granule form
that
enables delivery of customized mixtures designed to solve specific problems. A
homogenous granule blend can be shipped, handled, subsampled and applied in
the
same manner as traditional premix products where multiple active ingredients
are
formulated into the same granule.
Briefly, a 'homogenous granule blend" is prepared by mixing together at least
two extruded formulated granule products. In some embodiments, each granule
product comprises a registered formulation containing a single active
ingredient which
is, for example, a herbicide, a fungicide and/or an insecticide. The
uniformity
(homogeneity) of a 'homogenous granule blend" can be optimized by controlling
the
relative sizes and size distributions of the granules used in the blend. The
diameter of
extruded granules is controlled by the size of the holes in the extruder die
and a
centrifugal sifting process may be used to obtain a population of extruded
granules
with a desired length distribution (see, e.g., US Patent Number 6,270,025).
A homogenous granule blend is considered to be "homogenous" when it can
be subsampled into appropriately sized aliquots and the composition of each
aliquot
will meet the required assay specifications. To demonstrate homogeneity, a
large
sample of the homogenous granule blend is prepared and is then subsampled into
aliquots of greater than the minimum statistical sample size.Blends also
afford the
ability to add other agrochemicals at normal, labeled use rates such as
additional
herbicides (a 3rd14th mechanism of action), fungicides, insecticides, plant
growth
regulators and the like thereby saving costs associated with additional
applications.
Any herbicide formulation applied over the DP-073496-4 Brass/ca plant can be
prepared as a lank-mix" composition. In such embodiments, each ingredient or a
combination of ingredients can be stored separately from one another. The
Ingredients can then be mixed with one another prior to application.
Typically, such
mixing occurs shortly before application. In a tank-mix process, each
ingredient,
before mixing, typically is present In water or a suitable organic solvent.
For additional
guidance regarding the art of formulation, see, Woods, "The Formulator's
Toolbox¨
Product Forms for Modern Agriculture" Pesticide Chemistry and Bioscience, The
Few/-
Environment Challenge, Brooks and Roberts, Eds., Proceedings of the 9th
International Congress on Pesticide Chemistry, The Royal Society of Chemistry,
Cambridge, 1999, pp, 120-133. See also, US Patent Number 3,235,361, Column 6,
line 16 through Column 7, line 19 and Examples 10-41; US Patent Number
3,309,192,
59
CA 0 2 8 9 1 1 5 3 2 0 1 5-0 5-1 2
Nve= 2012/071040 PC171152010/058011
Column 5, line 43 through Column 7, line 62 and Examples 8, 12, 15, 39, 41,
52, 53,
58, 132, 138-140, 162-164, 166, 167 and 169-182; US Patent Number 2,891,855,
Column 3, line 66 through Column 5, line 17 and Examples 1-4; KlIngman, Weed
Control as a Science, John Wiley and Sons, Inc., New York, 1951, pp 81-98 and
Hance, of al., Weed Control Handbook, 8th Ed., Blackwell Scientific
Publications,
Oxford, 1989 .
The methods of the invention further allow for the development of herbicide
combinations to be used with the DP-07349.6-4 &Basica plants. In such methods,
the
environmental conditions in an area of cultivation are evaluated.
Environmental
conditions that can be evaluated Include, but are not limited to, ground and
surface
water pollution concerns, Intended use of the crop, crop tolerance, soil
residuals,
weeds present in area of cultivation, soil texture, pH of soil, amount of
organic matter
in soil, application equipment and tillage practices. Upon the evaluation of
the
environmental conditions, an effective amount of a combination of herbicides
can be
applied to the crop, crop part, seed of the crop or area of cultivation.
In some embodiments, the herbicide applied to the DP-073496-4 Brass/ca
plants of the invention serves to prevent the initiation of growth of
susceptible weeds
and/or serve to cause damage to weeds that are growing in the area of
interest. In
some embodiments, the herbicide or herbicide mixture exert these effects on
weeds
affecting crops that are subsequently planted in the area of interest (i.e.,
field or area
of cultivation). In the methods of the Invention, the application of the
herbicide
combination need not occur at the same time. So long as the field in which the
crop is
planted contains detectable amounts of the first herbicide and the second
herbicide is
applied at some time during the period in which the crop is in the area of
cultivation,
the crop is considered to have been treated with a mixture of herbicides
according to
" the invention. Thus,
methods of the invention encompass applications of herbicide
which are 'preemergent,"postemergent,"preplant incorporation" and/or which
Involve seed treatment prior to planting.
In one embodiment, methods are provided for coating seeds. The methods
comprise coating a seed with an effective amount of a herbicide or a
combination. of
herbicides (as disclosed elsewhere herein). The seeds can then be planted in
an area
of cultivation. Further provided are seeds having a coating comprising an
effective
amount of a herbicide or a combination of herbicides (as disclosed elsewhere
herein).
"Preemergent refers to a herbicide which is applied to an area of interest
(e.g.,
=35 a field or area of cultivation) before a plant emerges visibly from
the soil.
"Postemergent" refers to a herbicide which Is applied to an area after a plant
emerges
visibly from the soil. In some instances, the terms 'preemergenr and
'posternergenr
eo
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
are used with reference to a weed in an area of interest, and in some
instances these
terms are used with reference to a crop plant in an area of interest. When
used with
reference to a weed, these terms may apply to only a particular type of weed
or
species of weed that is present or believed to be present in the area of
interest. While
any herbicide may be applied in a preemergent and/or postemergent treatment,
some
herbicides are known to be more effective in controlling a weed or weeds when
applied
either preemergence or postemergence. For example,
rimsutfuron has both
preemergence and postemergence activity, while other herbicides have
predominately
preemergence (metolachlor) or postemergence (glyphosate) activity. These
properties
of particular herbicides are known in the art and are readily determined by
one of skill
in the art. Further, one of skill in the art would readily be able to select
appropriate
herbicides and application times for use with the transgenic plants of the
invention
and/or on areas in which transgenic plants of the invention are to be planted.
"Preplant incorporation" Involves the incorporation of compounds into the soil
prior to
planting.
Thus, the invention provides Improved methods of growing a crop and/or
controlling weeds such as, for example, "pre-planting burn down," wherein an
area is
treated with herbicides prior to planting the crop of Interest in order to
better control
weeds. The invention also provides methods of growing a crop and/or
controlling
weeds which are "no-till" or "low-till" (also referred to as "reduced
tillage"). In such
methods, the soil is not cultivated or is cultivated less frequently during
the growing
cycle in comparison to traditional methods; these methods can save costs that
would
otherwise be incurred due to additional Cultivation, including labor and fuel
costs.
The methods of the invention encompass the use of simultaneous and/or
sequential applications of multiple classes of herbicides. In some
embodiments, the
methods of the invention involve treating a plant of the invention and/or an
area of
interest (e.g., a field or area of cultivation) and/or weed with just one
herbicide or other
chemical such as, for example, a sulfonylurea herbicide.
The time at which a herbicide is applied to an area of interest (and any
plants
therein) may be important In optimizing weed control. The time at which a
herbicide is
applied may be determined with reference to the size of plants and/or the
stage of
growth and/or development of plants in the area of interest, e.g., crop plants
or weeds
growing In the area. The stages of growth and/or development of plants are
known in
the art. Thus, for example, the time at which a herbicide or other chemical Is
applied
to an area of interest in which plants are growing may be the time at which
some or all
of the plants in a particular area have reached at least a particular size
and/or stage of
growth and/or development, or the time at which some or all of the plants in a
61
CA 02891153 2015-05-12
WO 2012/071040 PCIN52010/058011
- particular area have not yet reached a particular size and/or stage of
growth and/or
development.
In some embodiments, the DP-073496-4 Brass/ca plants of the invention show
improved tolerance to postemergence herbicide treatments. For example, plants
of
the invention may be tolerant to higher doses of herbicide, tolerant to a
broader range
of herbicides, and/or may be tolerant to doses of herbicide applied at earlier
or later
times of development in comparison to an appropriate control plant. For
example, in
some embodiments, the DP-0734964 Brassica plants of the invention show an
increased resistance to morphological defects that are known to result from
treatment
at particular stages of development. Thus, the glyphosate-tolerant plants of
the
invention find use in methods involving herbicide treatments at later stages
of
development than were previously feasible. Thus, plants of the invention may
be
treated with a particular herbicide that causes morphological defects in a
control plant
treated at the same stage of development, but the glyphosate-tolerant plants
of the
invention will not be significantly damaged by the same treatment.
Different chemicals such as herbicides have different "residual' effects,
i.e.,
different amounts of time for which treatment with the chemical or herbicide
continues
to have an effect on plants growing in the treated area. Such effects may be
desirable
or undesirable, 'depending on the desired future purpose of the treated area
(e.g., field
or area of cultivation). Thus, a crop rotation scheme may be chosen based on
residual
effects from treatments that will be used for each crop and their. effect on
the crop that
will subsequently be grown in the same area. One of skill in the art is
familiar with
techniques that can be used to evaluate the residual effect of a herbicide;
for example,
generally, glyphosate has very little or no soil residual activity, while
herbicides that act
to inhibit ALS vary in their residual activity levels. Residual activities for
various
herbicides are known in the art, and are also known to vary with various
environmental
factors such as, for example, soil moisture levels, temperature, pH and soil
composition (texture and organic matter).
Moreover, the transgenic plants of the invention provide improved tolerance to
treatment with additional chemicals commonly used on crops in conjunction with
herbicide treatments, such as safeners, adjuvants such as ammonium sulfonate
and
crop oil concentrate, and the like. The term "safener" refers to a substance
that when
added to a herbicide formulation eliminates or reduces the phytotoxic effects
of the
herbicide to certain crops. One of ordinary skill in the art would appreciate
that the
choice of safener depends, in part, on the crop plant of Interest and the
particular
herbicide or combination of herbicides included in the synergistic herbicide
composition. Exemplary safeners suitable for use with the presently disclosed
62
CA 02891153 2015-05-12
=
WO 2012/071040 PCT/US2010/058011
herbicide compositions Include, but are not limited to, those disclosed in US
Patent
Numbers 4,808,208; 5,502,025; 6,124,240 and US Patent Application Publication
Numbers 2008/0148647; 2006/0030485; 2005/0233904; 2005/0049145;
2004/0224849; 2004/0224848; 2004/0224844; 200.4/0157737; 2004/0018940;
2003/0171220; 2003/0130120; 20031007B157.
The methods of the invention can
Involve the (155 of herbicides in combination with herbicide safeners such as
benoxacor, BCS (1-bromo-4-[(chloromethyl) sulfony]benzene), cloquintocet-
mexyl,
cyometrinli, dichlorMid, 24dichloromethy1)-2-methyl-1,3-dioxolane {MG 191.),
fenchlorezole-ethyl, fenclorim, flurazole, fiuxofenlm, furilazole, isoxadifen-
ethyl,
mefenpyr-diethyl, meth oxyphenone ((4-methoxy-3-methylphenyl)(3-methylpheny1)-
methanone), naphthalic anhydride (1,8-naphthalic anhydride) and oxabeeinil to
increase crop safety. Antidotally effective amounts of the herbicide safeners
can be
applied at the same time as the compounds of this invention, or applied as
seed
treatments. Therefore an aspect of the present invention relates to the use of
a
= mixture comprising glyphosate, at least one other herbicide and an
antidotally effective
amount of a herbicide safener.
Seed h-eatment Is particularly useful for selective weed control, because it
physically restricts antidoting to the crop plants. Therefore a particularly
useful
embodiment of the present invention Is a methOd for selectively controlling
the growth
of weeds in a field comprising treating the seed from which the crop Is grown
with an
antidotally effective amount of safe ner and treating the field with an
effective amount of
herbicide to control weeds. Antidotally effective amounts of safeners can be
easily
determined by one skilled in the art through simple experimentation. An
antidotally
effective. amount of a serener is present where a desired plant Is treated
with the
serener so that the effect of a herbicide on the plant is decreased in
comparison to the
effect of the herbicide on a plant that was not treated with the safener-,
generally, an
antidotally effective amount of serener prevents damage or severe damage to
the plant
treated with the safener. One of skill in the art Is capable of determining
whether the
use of a safaner is appropriate and determining the dose at which a safener
should be
administered to a crop.
In specific embodiments, the herbicide or herbicide combination applied to the
plant of the Invention acts as a safener. In this embodiment, a first
herbicide or a
herbicide mixture is applied at an antidotally effect amount to the plant
Accordingly, a
method for controlling weeds In an area of cultivation is provided. The method
comprises planting the area with crop seeds or plants which comprise a first
polynudeotide encoding a polypeptide that can confer tolerance to glyphosate
63
=
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
operably linked to a promoter active in a plant; and, a second polynucleotide
encoding
an ALS inhibitor-tolerant polypeptide operably linked to a promoter active in
a plant. A
combination of herbicides comprising at least an effective amount of a first
and a
second herbicide is applied to the crop, crop part, weed or area of
cultivation thereof.
The effective amount of the herbicide combination controls weeds; and, the
effective
amount of the first herbicide is not tolerated by the crop when applied alone
when
compared to a control crop that has not been exposed to the first herbicide;
and, the
effective amount of the second herbicide is sufficient to produce a safening
effect,
wherein the safening effect provides an increase in crop tolerance upon the
application
of the first and the second herbicide when compared to the crop tolerance when
the
first herbicide is applied alone.
In specific embodiments, the combination of safening herbicides comprises a
first ALS inhibitor and a second ALS inhibitor. In other embodiments, the
safening
effect is achieved by applying an effective amount of a combination of
glyphosate and
at least one ALS inhibitor chemistry. Such mixtures provides increased crop
tolerance
(i.e., a decrease In herbicidal injury). This method allows for increased
application
rates of the chemistries post or pre-treatment. Such methods find use for
increased
control of unwanted or undesired vegetation. In still other embodiments, a
safening
affect is achieved when the DP-073496-4 brassica crops, crop part, crop seed,
weed
or area of cultivation is treated with at least one herbicide from the
sulfonyiurea family
' of chemistry in combination with at least one herbicide from the
imidazolinone family.
This method provides increased crop tolerance (i.e., a decrease in herbicidal
injury).
In specific embodiments, the sulfonylurea comprises rimsulfuron and the
Imidazolinone
comprises imazethapyr. In other embodiments, glyphosate is also applied to the
crop,
crop part or area of cultivation.
As used herein, an "adjuvant" Is any material added to a spray solution or
formulation to modify the action of an agricultural chemical or the physical
properties of
the spray solution. See, for example, Green and Foy, .(2003) "Adjuvants: Tools
for
Enhancing Herbicide Performance," in Weed Biology and Management, ed. inderjit
(Kluwer Academic Publishers, The Netherlands). Adjuvants can be categorized or
subclassified as activators, acidifiers, buffers, additives, adherents,
antiflocculants,
antifoamers, defoamers, antifreezes, attractants, basic blends, chelating
agents,
cleaners, colorants or dyes, compatibility agents, cosolvents, couplers, crop
oil
concentrates, deposition agents, detergents, dispersants, drift control
agents,
emulsifiers, evaporation reducers, extenders, fertilizers, foam markers,
formulants,
inerts, humectants, methylated seed oils, high load COCs, polymers, modified
vegetable oils, penetrators, repellants, petroleum oil concentrates,
preservatives,
64
CA 02891153 2015-05-12
WO 2012/071040 PCT/lUS20101058011
rainfast agents, retention aids, solubilizers, surfactants, spreaders,
stickers, spreader
stickers, synergists, thickeners, translocation aids, uv protectants,
vegetable oils, water
conditioners and wetting agents.
In addition, methods of the invention can comprise the use of a herbicide or a
mixture of herbicides, as well as, one or more other insecticides, fungicides,
nematocides, bactericides, acaricides, growth regulators, chemosterllants,
semiochemicals, repellents, attractants, pheromones, feeding stimulants or
other
biologically active compounds or entomopathogenic bacteria, virus or fungi to
form a
multi-component mixture giving an even broader spectrum of agricultural
protection.
Examples of such agricultural protectants which can be used in methods of the
Invention include: Insecticides such as abamectln, acephate, acetamlprid,
amidoflumet
(8-1955), avermectin, azadirachtin, azinphos-methyl, bifenthrin, bifenazate,
buprofezin, carbofuran, cartap, chlorfenapyr, chlorfluazuron, chiorpyrifos,
chlorpyrifos-
methyl, chromafenozide, clothianidin, cyflumetofen, cyfluthrin, beta-
cyfiuthrin,
cyhaiothrin, lambda-cyhalothrin, cypermethrin, cyromazine, deltamethrin,
diafenthiuron, dlazinon, dieldrin, diflubenzuron, dimefluthrin, dimethoate,
dinotefuran,
diofenoian, emamectin, endosulfan, esfenvalerate, ethiprole, fenothiocarb,
fenoxycarb,
fenpropathrin, fenvalerate, fipronil, flonicamid, flubendiamide,
flucythrinate,
tau-fluvalinate, flufenerim (UR-50701), fiufenoxuron, fonophos, halofenozide,
hexaflumuron, hydramethylnon, imidacloprid, indoxacarb, isofenphos, lufenuron,
maiathion, metaflurnizone, metaldehyde, methamidophos, methidathion, methomyl,
methoprene, methoxychlor, metofluthrin, monocrotophos, methoxyfenozide,
nitenpyram, nithiazine, novaluron, novIflumuron (XDE-007), oxamyl, parathion,
parathion-methyl, permethrin, phorate, phosalone, phosmet, phosphamidon,
pirimicarb, profenofos, profluthrin, pymetrozine, pyrafluprole, pyrethrin,
pyridalyi,
pyriprole, pyriproxyfen, rotenone, ryanodine, spinosad, spirodiclofen,
spiromesifen
(BSN 2060), splrotetramat, suiprofos, tebufenozide, teflubenzuron, tefluthrin,
terbufos,
tetrachlorvinphos, thiacloprid, thiamethoxam, thiodicarb, thiosultap-sodium,
tralomethrin, triazamate, trichlorfon and triflumuron; fungicides such as
acibenzolar,
aldimorph, amisulbrom, azaconazole, azoxystrobin, benalaxyl, benomyl,
benthiavalicarb, banthiavalicarb-isopropyl, binomial, biphenyl, bitertanol,
blastIcidin-S,
Bordeaux mixture (Tribasic copper sulfate), boscalidinic,obifen,
bromuconazole,
bupirimate, buthiobate, carboxin, carpropamid, captafol, captan, carbendazim,
chloroneb, chlorothalonil, chlozolinate, clotrimazole, copper oxychloride,
copper salts
such as copper sulfate and copper hydroxide, cyazofamid, cyflunamid,
cymoxanll,
cyproconazole, cyprodinil, dichlofluanid, diclocymet, didomezine, dicloran,
diethofencarb, difenoconazole, dim ethomo rp h,
di moxystrobin, diniconazole,
65 =
CA 02891153 2015-05-12
WO 2012/071640 PCMIS2010/058011
cilnlconazole-M, dinocap, discostrobin, dithianon, ciodemorph, dodine,
econazole,
etaconazole, edifenphos, epoxiconazoie, ethaboxam, ethirimol,
ethridiazole,
famoxadone, fenamidone, fenarimol, fenbuconazole, fencaramid, fenfuram,
fenhexamide, fenoxanil, fenpiclonil, fenpropidin, fenpropimorph, fentin
acetate, fentin
hydroxide, ferbam, ferfurazoate, fenrnzone, fluazinam, fludioxonil,
flumetover,
fluopicollde, fluoxastrobin, fluquinconazole, fluquInconazole, flusilazole,
flusulfamide,
flutolanil, flutriafol, folpet, fosetyl-aluminum, fuberldazole, furalaxyl,
furametapyr,
hexaconazole, hymexazole, guazatine, imazalil, imibenconazole, iminoctadine,
iodicarb, ipconazole, iprobenfos, iprodione, iprovalicarb, isoconazole,
isoprothiolane,
kasugamycin, kresoxim-methyl, mancozeb, mandipropamid, maneb, mapanipyrin,
mefenoxam, mepronil, metalaxyl, metconazole, methasulfocarb, metiram,
metominostrobintfenominostrobin, mepanipyrim, metrafenone, miconazole,
myclobutanil, nee-asozin (ferric methanearsonate), nuarimol, octhilinone,
ofurace,
orysastrobin, oxadixyl, oxolinic acid, oxpoconazole, ogcarboxin,
paclobutrazol,
penconazole, pencycuron, penthiopyrad, perfurazoate, phoSphonlc acid,
phthalide,
picobenzamid, picoxystrobin, polyoxin, probenazole, Orochloraz, procymidone,
propamocarb, propamocarb-hydrochloride, propiconazole, propineb, proquinazid,
prothioconazole, pyraclostrobln, pryazophos, pyrifenox, pyrimethanil,
pyrifenox,
pyrolnitrine, pyroquilon, quinconazole, quinoxyfen, quintozene, silthlofam,
simeconazole, spiroxamine, streptomycin, sulfur, tebuconazole, techrazene,
tecloftalam, tecnazene, tetraconazole, thiabendazole, thifluzamide,
thiophanate,
thiophanate-methyl, thlrarp, tiadinil, toiclofos-methyl, tolyfluanid,
triadimefon,
triadimenol, trlarimol, triazoxide, tridemorph, trimoprhamide tricyclazole,
trifloxystrobin,
triforine, triticonazole, uniconazole, validamycin, vindozolin, zineb, ziram,
and
zoxamide; nematocides such as aldicarb, oxamyl and fenamiphos; bactericides
such
as streptomycin; acaricides such as amitraz, chinomethionat, chlorobenzilate,
cyhexatin, dicofol, dienochlor, etoxazole, fenazaquin, fenbutatin oxide,
fenpropathrin,
fenpyroximate, hexythiazox, propargite, pyridaben and tebufenpyrad and
biological
agents including entomopathogenic bacteria, such as Bacillus thuringiensis
subsp.
Aizawai, Bacillus thuringlansis subsp. Kurstaki, arid the encapsulated delta-
endotoxins
of Bacillus thuringlensis (e.g., Cellcap, MPV, MPVII); entomopathogenic fungi,
such as
green muscardine fungus; and entomopathogenic virus including baculovirus,
nucleopolyhedro virus (NPV) such as HzNPV, AfNPV; and granulosis virus (GV)
such
as CpGV. The weight ratios of these various mixing partners to other
compositions
(e.g., herbicides) used in the methods of the invention typically are between
100:1 and
1:100, or between 30:1 and 1:30, between 10:1 and 1:10, or between 4:1 and
1:4.
66
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
The present invention also pertains to a composition comprising a biologically
effective amount of a herbicide of interest or a mixture of herbicides, and an
effective
amount of at least one additional biologically active compound or agent and
can further
comprise at least one of a surfactant, a solid diluent or a liquid diluent.
Examples of
such biologically active compounds or agents are: insecticides such as
abamectin,
acephate, acetamiprid, amidoflumet (S-1955), avermectin, azadirachtin,
azinphos-
methyl, bifenthrin, binfenazate, buprofezin, carbofuran, chlorferiapyr,
chlorfluazuron,
chlorpyrifos, chlorpyrifos-methyl, chromafenozide, clothianidin, cyfluthrin,
beta-
cyfluthrin, cyhalothrin, lambda-cyhalothrin, cypermethrin, cyromazine,
deltamethrin,
diafenthluron, diazinon, diflubenzuron, dimethoate, cliofenolan, emamectin,
endosulfan, esfenvalerate, ethiprole, fenothicarb, fen oxycarb, fenpropathrin,
fenvalerate, fipronil, flonicamid, flucythrinate, tau-fluvalinate, flufenerim
(UR-50701),
flufenoxuron, fonophos, halofenozide, hexaflumuron, imidacloprid, indoxacarb,
Isofenphos, lufenuron, malathion, metaldehyde, methamidophos, methidathion,
methomyl, methoprene, methoxychlor, monocrotophos, methoxyfenozide, =
nithiazin,
novaluron, noviflumuron (XDE-007), oxamyl, parathion, parathion-methyl,
permethrin,
phorate, phosalone, phosmet, phosphamidon, pirimicarb, profenofos,
pymetrozine,
pyridalyl, pyriproxyfen, rotenone, spinosad, spiromesifin (BSN 2060),
sulprofos,
tebufenozide, teflubenzuron, tefluthrin, terbufos, tetrachlorvinphos,
thiacloprid,
thiamethoxam, thiodicarb, thiosultap-sodium, tralomethrin, trichlorfon and
triflumuron;
fungicides such as acibenzolar, azoxystrobin, benomyl, biasticidin-S, Bordeaux
mixture (tribasic copper sulfate), bromuconazole, carpropamid, captafol,
captan,
carbendazim, chloroneb, chlorothalonii, copper oxychloride, copper salts,
cyflufenamid, cymoxanil, cyproconazole, cyprodinil, (S)-3,5-dichloro-N-(3-
chloro-1-
ethyl-1-methyl-2-oxopropyI)-4-methylbenzamide (RH 7281), diclocymet (S-2900),
diclomezine, dicloran, difenoconazole, (S)-3,5-dihydro-5-methy1-2-(methylthio)-
5-
phenyl-3-(phenyl-amino)-4H-imidazol-4-one (RP 407213),
dimethomorph,
dimoxystrobin, dinlconazole, diniconazole-M, dodine, edifenphos,
epoxiconazole,
famoxadone, fenamidone, fenarimol, fenbuconazole, fencaramid (SZX0722),
fenpiclonil, fenpropidin, fenpropimorph, fentin acetate, fentin hydroxide,
fluazinam,
fludioxonil, flumetover (RPA 403397), flumorf/flumorlin (SYP-L190),
fluoxastrobin (HEC
5725), fluquinconazole, flusilazole, flutolanil, flutriafol, folpet, fosetyl-
aluminum,
furalaxyl, furametapyr (3-82658), hexaconazole, ipconazole, iprobenfos,
iprodione,
isoprothiolane, kasugamycin, kresoxim-methyl, mancozeb, maneb, mefenoxam,
mepronil, metalaxyl, metconazole, metornino-strobinffenominostrobin (SSF-126),
metrafenone (AC375839), myclobutanil, neo-asozin (ferric methane-arsonate),
nicobifen (BAS 510), orysastrobin, oxadixyl, penconazote, pencycuron,
probenazole,
67
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
prochloraz, propamocarb, propiconazole, proquInazid (DPX-KQ926),
prothioconazole
(JAU 6476), pyrifenox, pyraclostrobin,. pyrimethanil, pyroquilon, quinoxyfen,
spiroxamine, sulfur, tebuconazole, tetraconazole, thiabendazole, thifluzamide,
thiophanate-methyl, thiram, tiadinil, triadimefon, triadimenol, tricyclazole,
trifloxystrobin,
triticonazole, validamycin and vinclozolin; nematocides such as aldicarb,
oxamyl and
fenamiphos; bactericides such as streptomycin; acaricides such .as amitraz,
chinomethionat, chlorobenzilate, cyhexatin, dicofol, dienochlor, etoxazole,
fenazaquin,
fenbutatin oxide, fenpropathrin, fenpyroximate, hexythlazox, propargite,
pyridaben and
tebufenpyrad; and biological agents including entomopathogenic bacteria, such
as
Bacillus thuringiensis subsp. Aizawai, Bacillus thuringiensis subsp. Kurstaki,
and the
encapsulated delta-endotoxins of Bacillus thuringiensis (e.g., Cellcap, MPV,
MPVII);
entomopathogenic fungi, such as green muscardine fungus; and entomopathogenic
virus including baculovirus, nucleopolyhedro virus (NPV) such as HzNPV, AfNPV
and
granulosis virus (GV) such as CpGV. Methods of the invention may also comprise
the
use of plants genetically transformed to express proteins toxic to
invertebrate pests
(such as Bacillus thuringiensis delta-endotoxins). In such embodiments, the
effect of
exogenously applied invertebrate pest control compounds may be synergistic
with the
expressed toxin proteins.
General references for these agricultural protectants .Include The Pesticide
Manual, 13th Edition, Tomlin, Ed_, British Crop Protection Council, Farnham,
Surrey,
U.K., 2003 and The BioPesticide Manual, 2nd Edition, Copping, Ed., British
Crop
Protection Council, Farnham, Surrey, U.K., 2001.
In certain instances, combinations with other invertebrate pest control
compounds or agents having a similar spectrum of control but a different mode
of
action will be particularly advantageous for resistance management. Thus,
compositions of the present Invention can further comprise a biologically
effective
amount of at least one additional invertebrate pest control compound or agent
having a
similar spectrum of control but a different mode of action. Contacting a plant
genetically modified to express a plant protection compound (e.g., protein) or
the locus
of the plant with a biologically effective amount of a compound of this
invention can
also provide a broader spectrum of plant protection and be advantageous for
resistance management.
Thus, methods of the invention employ a herbicide or herbicide combination
and may further comprise the use of insecticides and/or fungicides, and/or
other
agricultural chemicals such as fertilizers. The use of such combined
treatments of the
Invention can broaden the spectrum of activity against additional weed species
and
suppress the proliferation of any resistant biotypes.
68
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
Methods of the invention can further comprise the use of plant growth
regulators such as aviglyclne, N-(phenylmethyl)-1H-purin-6-amine, ethephon,
epocholeone, gibberellic acid, gibberellin A4 and A7, harpin protein, mepiquat
chloride,
prohexadione calcium, prohydrojasmon, sodium nitrophenolate and trinexapac-
methyl
and plant growth modifying organisms such as Bacillus cereus strain BP01.
Embodiments of the present invention are further defined in the following
Examples. It should be understood that these Examples are given by way of
illustration
only. From the above discussion and these Examples, one skilled in the art can
ascertain the essential characteristics of this invention, and without
departing from the
spirit and scope thereof, can make various changes and modifications of the
embodiments of the invention to adapt it to various usages and conditions.
Thus,
various modifications of the embodiments of the invention, in addition to
those shown
and described herein, will be apparent to those skilled in the art from the
foregoing
description. Such modifications are also intended to fall within the scope of
the
appended claims.
EXPERIMENTAL
The following abbreviations are used in describing the present invention.
ALS acetolactate synthase protein
bp base pair
glyat4621 glyphosate acetyltransferase gene
GLYAT4621 glyphosate acetyltransferase protein
zm-als wild type acetolactate synthase gene from
brassica
zm-hra modified version of acetolactate synthase gene
from brasslca
kb kilobase
PCR polymerase chain reaction
UTR untranslated region
Exam_ple 1. Insert and Flanking Border Sequence Characterization of
Brassica
Event DP0-73496-4
Brassica (Brassica napus L.) has been modified by the insertion of the
glyphosate acetyltransferase gene (glyat4621) derived from Bacillus
licheniformis and
optimized by gene shuffling, Plasmid PHP28181 contains an expression cassette
as
further described hereafter.
69
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/05B011
DNA construct PHP28181 was made by cloning the GAT4621:PINII TERM
fragment excised from DNA construct pZSL149 with BamHI and Mfel double
digestion
downstream to the AT-UBQ10 promoter of DNA construct QC272 in the same BamHI
and Mfel sites using T4 DNA ligase (New England Lab). The resulting PHP28181
DNA contains the expression cassette: AT-UBQ10 (DUPONT) PRO:GA'T4621:PINII
TERM. See, Figure 1 and Figure 2.
The 2112 bp PHP28181A DNA fragment was prepared from plasmid
P11P28181 with HindlIl and Not! restriction enzyme double digestion. The
digested
plasmid DNA was resolved in a 1% agarose gel by electrophoresis. The DNA band
of
the correct size was excised and DNA fragment was extracted using a Qiagen DNA
fragment extraction kit (Qiagen). DNA fragment purity was checked by PCR with
a
series of dilutions of amp+ positive control DNA since the PHP28181 plasmid
contains
an amp+ gene in its backbone. DNA fragment concentration was measured
spectrophotometrically and confirmed by comparing to DNA low mass markers
(InVitrogen) in an agarose gel.
Transformation was accomplished essentially as described in Chen and
Tulsieram, US Patent Application Publication Number 2007/0107077. Buds were
collected from donor line NS1822BC and sterilized. Buds were then homogenized,
filtered, and washed to collect the microspores. The resultant microspore
suspension
was adjusted to a specified density and cultured for 2 days. Embryogenic
microspores
were then isolated via gradient centrifugation and cultured.
Gold particles coated with the PHP28181A DNA fragment were used for
transformation. Biolistic transformation was carried out using the PDS-1000/He
Particle Delivery System (Bio-Rad, Hercules, CA) as described by Klein, et
al., (1987)
Nature 327:70-73. Transformed embryogenic microspores were cultured in fresh
medium In dark conditions for 10-12 days, then under dim light for 1-3 weeks.
Green
embryos were transferred to fresh medium and cultured for two weeks to select
for
giyphosate tolerance. Germinated shoots and/or plants were transferred to
growth
medium supplemented with glyphosate.
The glyat4621 gene was derived from the soil bacterium Bacillus lichenifomys
and was synthesized by a gene shuffling process to optimize the
acetyltransferase
activity of the GLYAT4621 enzyme (Castle, et af., (2004) Science 304:1151-
1164).
The inserted fragment (Figure 3) from this plasmid contains the glyat4621 gene
cassette. The expression of the glyat4621 gene is controlled by the UBQ10
regulatory
region from Arabldopsis and the John terminator (see, Table 4). A summary of
the
transformation fragment of plasmid PHP28181 is shown in Table 4. The genetic
=
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
elements of plasmid PHP28181 used in the creation of DP-073496-4 are shown in
Table 3.
Table 3: Description of Genetic Elements in Plasmid P1-1P28181
.
:-.iia4.4,f-I.,...cr t.',41Mg-ii,:z:Zi..;,=;*itilifiLkil ' '. i-t ,-
W.tilg.6::*:;e4ji?;.,:l..g.-=,,..4.:40.24 PliFizitii.'..-- : -_-T..---::,--13t
,'" ;
t
-if: g,tp, 4, =,õQr. I. -õ,,, : .õ--.!..L.,õ: : õ õd,,s,, -,.,,,,,,-
,..),....A#----1-,-.1-: ',,.....:,--A-,-.LaTAtzr.,...aa:4,4TriTi-.....ver ::-
Tn...N.w., --,-,, T =E
Tif.1,;_---.:::?-"-.5.44447W5.7i,411104A. '1706-
01tAirivwfAirg:~POW.100g4ii74,M.I.:4-".
Tran.y-ormatian
lAggW:b 10
;,!1;',:-,,,:7,-..-..,--:---.4--.:4- See Table 4 for information on
Fragment 1 to 2112 iMF;Arc:P4,õ,:g! 2112
.....,, .57:17.C.--- the elements in this region
PHP28181.A ttPa4.71RYTP"
-""lirri.1-.,-,=,:k
..-.,?-34:10.1-:tiai
;:4-73;:,,1NsTIIV ,
includes DNA from various sources for
Plasmid
2113 to 4770 elements 2658 plasmid construction and
Construct
below plasnaid replication
13-lactamase gene coding for
" .!!!;::fi!-.= ....;,-;:',7:;=-.2.1;'::.F.;:;_,?
ampicillin resistance from a 402i
2736 to 3596 bla (ApR) 861
(Sutcliffe, 1978) (Yanisch-Perron, et
:: .49.D]i'tgarTZ:ifiere:40
:.i.C1,11::!.',If?" !=:::'2-#4µ),NIA'sti:F at, 1984)
'rri:vii'.igV11,V51.11e:5Wit, Hat II fragment containing bacterial
4170 to 4539 colE1 or! 370 origin of replication region
(colE1
=,,,..,::4= 4P,..v4r4tt,:..7,,z-k.:::,F
= derived) (romizawa et al., 1977)
71
CA 02891153 2015-05-12
WO 2012/071040PCT/US2010/058011
Table 4: Description of Genetic Elements in the Transformation Fragment
PHP2818IA
M16Ø014.40 Z.,,WW$-;::.:',if!;-'37nUM::,',00.04M0.400,41g-1.00441WPOIA
igm
proot54:.t-*k;,:;,,:r::2,1an:T;mg:xr4,sTe.,lin"_E-,;tm:vw.,.m:i:.-,1
.lisio,,Iiioa,/,:xvow,4-6;ii;!:,!,At#304.3,4-0644,04p.rfimm;,n5m,,,:4,,.,?:;1,
aiiactamiii,gastorogrovutmatizvmmy..-z,cv.T.:;..,.-,
Polylinker
1 to 7 Region 7 Region required for cloning genetic elements
Version of the promoter region from Ambidopsis
8 to 1312 1305
U-13,21 0 thaliana U130 0 poiyubiquitin gene (Norris et
ed,
Promoter 1993) developed by the E. I. duPont de Nemours
and
Company
... _
1313 to 1335 ' .-7--er 23 Region required for cloning genetic
elements
Region
1336 to 1779 gat4621 Gene
Synthetic glyphosate N-acetyltransferase gene (Castle
, 444
et al., 2004; Siehl et al., 2007)
Polylinker
1780 to 1796 Region 17 Region required for clotting genetic elements
,
1797 to 2106 310 pitill Terminator region from Solanum
tetberosum proteinase
Terminator inhibitor II gene (Keil et al, 1986; An el al,
1989)
-
linker
2107 to 2112 Poly 6 Region required for cloning genetic elements
Region
The nucleotide sequence of the inserted DNA in the DP-073496-4 event has
been determined. PCR amplification of the unique junctions spanning the
introduced
genetic elements can distinguish DP-073496-4 plants from their non-genetically-
modified counterparts and can be used to screen for the presence of the
inserted
DNA, even at very low concentrations. Described below is a construct-specific
poiymerase chain reaction (PCR) assay on genomic DNA from DP-073496-4
Brass/ca.
Specifically, genomic DNA from the test substance (plant material of event DP-
073496-4) and the control substance (plant material of a non-genetically
modified
Brassica with a genetic background representative of the event background) is
Isolated
and subjected to qualitative PCR amplification using a construct-specific
primer pair.
The PCR products are separated on 1.5% or 2% agarose gels to confirm the
presence
of the inserted construct in the genomic DNA generated from the test
substance, and
absence in the genomic DNA generated from the control substance. A reference
standard (100 base pair DNA Ladder; Invitrogen Corporation Catalog # 10380-
012) is
used to determine the PCR product size.
Test and control samples are harvested from plant's. Genomic DNA extraction
from the test and control tissues is performed using a standard urea
extraction
protocol, if leaf tissue. Genomic DNA from the test and control samples is
isolated
using Wizard e Magnetic 96 DNA Plant System (Promega Corporation Catalog #
FF3760), if seed tissue. Genomic DNA Is quantified on a spectrofluorometer
using
72
CA 02891153 2015-05-12
WO 2(112/071040 PCT/US2010/058011
PicoGreen(11) reagent (Molecular Probes, Inc., Eugene, OR) and/or visualized
on an
agarose gel to confirm quantitation values and to deterrnine the DNA quality.
Genomic DNA isolated from plant material of event DP-073496-4 and control
samples is subjected to PCR amplification (PCR Master Mix Catalog #7505 from
Promega Corporation) utilizing a construct-specific primer pair which spans at
least a
portion of the glyat4621 coding region, and allows for the unique
identification of maize
event DP-073490-4. A second primer set is used to amplify an endogenous gene
as a
positive control for PCR amplification. The PCR target site and size of the
expected
PCR product for each primer set are compared to the observed results.
Example 2. Characterization of Event DP-073496-4 by Southern Blot
Southern blot analyses (Southern, 1975) are performed to investigate the
number of sites of insertion of the transforming DNA, the copy number and
functional
integrity of the genetic elements and the absence of plasmid backbone
sequences.
The method used is described generally as follows. Genomic DNA is extracted
from lyophilized tissue sampled from DP-073496-4 Brassica and non-genetically-
modified control plants. Genomic DNA is digested with restriction endonuclease
enzymes and size-separated on an agarose gel. A molecular weight marker is run
alongside samples for size estimation purposes. DNA fragments separated on
agarose gel are depurinated, denatured and neutralized in situ and transferred
to a
nylon membrane. Following, transfer to the membrane, the DNA is bound to the
membrane by UV crosslinking. Fragments homologous to the glyst4621 gene are
generated by PCR from plasmid PHP28181, separated on an agarose gel by size,
exsized and purified using a gel extraction kit. Labeled probe is hybridized
to the
target DNA on the nylon membranes for detection of the specific fragments.
Washes
after hybridization are carried out at high stringency. Blots are exposed to X-
ray film
for one or more time points to detect hybridizing fragments and visualize
molecular
weight markers.
Example 3. Expression of the Insert
Expression of the GLYAT4621 protein is evaluated using leaf tissue collected
from transgenic plants. For example, four fresh leaf punches may be collected
and
ground in sample extraction buffer using a GenoGrinder (Spex Certiprep). Total
Extractable Protein (TEP) can be determined using the Bio-Rad Protein assay,
which
is based on the Bradford dye-binding procedure. Sample extracts may be diluted
in
sample extraction buffer for ELISA analysis.
73
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
The levels of expression of the GAT4621 protein in DP-073496-4 Brassica can
be determined by quantitative enzyme linked immunosorbent assay (ELISA) of
samples obtained from multiple field trial locations. Replicate seed samples
(three
replicates) may be obtained from DP-073496-4 plants treated with the maximum
recommended label rate of Touchdown Total glyphosate herbicide (500 g/1
glyphosate as potassium salt; 0.60-1.35 I/ha), applied at the cotyledon to 5-
leaf stage,
as this represents a likely commercial cultivation scenario.
Another way to verify the expression of the insert in DP-073496-4 Brass/ca
plants is to evaluate the transformed plants' tolerance to glyphosate.
Multigenerational
stability and Within-generation segregation of the herbicide tolerant trait
conferred by
expression of the GAT4621 enzyme will be confirmed using a functional assay
for
herbicide tolerance. Tests are conducted on at least three generations of
plant
material. Herbicide injury may be scored as described in Table 5.
15Table 5: The 0 to 100 crop response rating system for herbicide injury
711."Lrfi 11:WV;;--= LAT. LqiiA:¨ge r114:.4),;;AVAANqIiri 1.1,ST40
_
,14
0 No Effect No crop reduction or injury
10 Slight crop discoloration or stunting
Slight Effect Some crop discoloration, stunting, or stmt loss
Crop injury more pronounced, but not lasting
Moderate injury, crop usually recovers
Moderate Effect Crop injury more lasting, recovery doubtful
Lasting crop injury, no recovery
Heavy crop injury and stand loss
Severe Effect Crop nearly destroyed - A few surviving plants
Only occasional live crop plants left
100 Complete Effect Complete crop destruction
Example 4. Construct Specific PCR Analysis of Brass/ca Event DP-073496-4
Genomic DNA isolated from leaf of DP-073496-4 canola (T2F2 generation) and
20 control canola (non-genetically modified) was subjected to PCR
amplification (Roche
High Fidelity PCR Master Kit, Roche Catalog # 12140314001) utilizing the
construct-
specific primer pair (09-0-3290/09-0-3288) which spans the ubiquitin promoter
and the
gat4621 gene cassette (Figure 4). A second primer set (09-0-2812/09-0-2813)
was
used to amplify the endogenous canola FatA gene as a positive control for PCR
25 amplification. The PCR target site and size of the expected PCR product
for each
primer sets are shown in Table 8. PCR reagents and reaction conditions are
shown In
Table 9. The primer sequences used in this study are listed in Table 10. In
this study,
100 ng of leaf genomic DNA was used in all PCR reactions.
74
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
A PCR product of approximately 800 bp in size amplified by the construct-
specific primer set 09-0-3290/09-0-3288 was observed in PCR reactions using
plasmid
PHP28181 (10 ng) as a template and three DP-073496-4 canola plants, but absent
in
three control canola plants and the no-template control (Figure 5). Samples
were
loaded as shown in Table 6.
Table 6
Lane Sample
1 Low Mass Molecular Weight Marker
2 Blank
3 Non-Genetically Modified canola Cl
4 Non-Genetically Modified canola C2
5 Non-Genetically Modified canola C3
6 DP-073496-4 canola T1
7 DP-073496-4 canola T2
8 DP-073496-4 canola T3
9 NT Control
________________ Plasmid PHP28181
11 Blank
12 Low Mass Molecular Weight Marker
These results correspond with the expected PCR product size (675 bp) for
samples containing DP-073496-4 canola genomic DNA. A PCR product
10 approximately 450 bp in size was observed for both DP-073496-4 canola
and control
canola plants following PCR reaction with the primer set 09-0-2812/09-0-2813
for
detection of the endogenous FatA gene (Figure 6). Samples were loaded as shown
in
Table 7.
Table 7
Lane Sample
1 Low Mass Molecular Weight Marker
2 Blank
3 Non-Genetically Modified canola Cl
4 Non-Genetically Modified canola C2
5 Non-Genetically Modified canola C3
6 DP-073496-4 canola Ti
7 DP-673496-4 canola 12
8 DP-073496-4 canola T3
9 NT Control
10 Plasmid PHP28181
11 Blank
12 Low Mass Molecular Weight Marker
These results correspond with the expected PCR product size (506 bp) for
genomic DNA samples containing, the canola endogenous FatA gene. The
endogenous target band was not observed in the no-template control.
75
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
Table 8: PCR Genomic DNA
Tatciet Site and Expected Size of PCR Products
Primer Set Target Site Expected Size of
PCR Product (bp)
Construct-Specific ubiquitin
09-0-3290/09-0-3288 675
promoter and gat4621
Endogenous canola FatA
09-0-2812/09-0-2813 506
gene'
PCR: POLYMERASE CHAIN REACTION =
BP: BASE PAIRS
1. Genbank accession number for FatA gene is X87842.1. This sequence was used
to
design PCR primers.
Table 9: PCR Reagents and Reaction
Conditions
PCR Reagents PCR Reaction Conditions
Volume Cycle Temp Time
Reagent # Cycles
(pL) Element ( C) (sec)
Template DNA Initial
1 94 120 1
(100 ng/111) Denaturation
Primer 1 (10 pM) 0.75 Denaturation 94 10
Primer 2 (10 pM) 0.75 Annealing 65 20 35
PCR Master Mix* 12.5 Elongation 72 45
ddH20 10 Final Elongation 72 180 1
Until
Hold Cycle 4
analysis
PCR: POLYMERASE CHAIN REACTION
DDH20: DOUBLE-DISTILLED WATER
*Roche High Fidelity Master Mix
Table 10: List of Primer Sequences Used in PCR Reactions
Primer Sequence 57 ¨ 3' Target Sequence
Name
SEQ ID NO 47
09-0-3290 Ubiquitin Promoter
AGCTATTGCTTCACCGCCTTAGC
SEQ ID NO: 5
09-0-3288 gat4621
GCTCAGCTTGGTGGAATGAAGCCAC
SEQ ID NO: 6 Canola Endogenous
09-0-2812
GACACAAGGCGGCTTCAAAGAGTTACAGATO _______________________ FatA
SEQ IC NO 7: Canola Endogenous
09-0-2813
ACAATGTGATCTTGCTGOCATTCTCTTCTG FatA
Example 5. Further Insert and
Flanking Border Sequence Characterization of
Brassica Event DP-073496-4
To characterize the integrity of the inserted DNA and the genomic insertion
site, the flanking genomic DNA border regions of the DP-0734964 event were
=
76 =
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
determined. Flanking genomic sequence of DP-073496-4 is included within SEQ ID
NO: 2. PCR amplification from the insert and border sequences confirms that
the
border regions are of Brass/ca origin and that the junction regions can be
used for
identification of DP-073495-4 Brass/ca. Overall, characterization of the
insert and
genomic border sequences, along with Southern blot data, indicate a single
insertion
of the DNA fragment present in the Brassica genome. Various molecular
techniques
are then used to specifically characterize the integration site.
In the initial characterization, the flanking genomic border regions are
cloned
and sequenced using the GenomeWalker and inverse PCR methods. Using
information from the flanking border sequence, PCR is performed on DP-073496-4
genomic DNA and unmodified control genomic DNA. Those skilled in the art will
also
include a control PCR using an endogenous gene to verify that the isolated
genomic
DNA is suitable for PCR amplification.
77
=
=
Table 11.
aa
KR-based
event-
specific
detection
methods
PCR Primer 1 Primer 2 Probe
______________ Assay
event type Name Sequence Name Sequence Name
Sequence 5 label Quencher
10-0-
10-0-3514 GGTCCGTGGGC 3515 TTATCr-G6TCCTAG
0P473496= Gel- SEQI0 NO: CTTCCTAAACGT SEQ ID ATCATCAGTTCATA
4 based 20 GCCG 1,10:23
CAAACCTCC = CO
09-0-
09-0-2824 GTTc..i OTC 2825 CAAACCTCCATAG TTAGTTAGATC
Ln
DP-073496- Real- SEQ ID ATAGCTCATTAC SEQ tri AGTTCAACATMA
09-QP83 AGGATATTCTT
co 4 time 140:21 AG I N0:24 A SEQ ID N0:26
0 FAM MOB
09-0-
n.)
09-0-3249 ACAGATGAAGT 3251
fatA A- Real- SEQ10 TC000ACGAG7 552 10
CAGGTTGAGATCC 09-0P87 AAGAAGAATCA
Ln
specific time 52:22 AC 140:25 ACATGCTTAAATAT
5E0 ID NO:27 TCATGCTTC FAM MOB
Ln
n.)
0.3
vs
ce)
cc
CA 02891153 2015-05-12
WO 2012/071040 PCT/US2010/058011
Table 12. Summary Table of SEQ ID NOS
SEQ ID NO Description
1 GAT4621 protein
2 DP-073496-4 Insert and flanking sequence
3 PHP28181A
4 Primer 09-0-3290 (SEQ ID NO: 4
AGCTATTGCTTCACCGCCTTAGC) Target ¨ Ubiquitin Promoter
Primer 09-0-3288 (SEQ ID NO: 5
GCTCAGCTTGGTGGAATGAAGCCAC) Target gat4621
Primer 09-0-2812 (SEQ ID NO: 6
6 GACACAAGGCGGCTTCAAAGAGTTACAGATG) Target Canola
Endogenous FatA
Primer 09-0-2813 (SEQ ID NO:
7 ACAATOTCATCTTOCTGGCATTCTCTICTG ) Canela
Endogenous FatA
Right border genomic sequence
9 Left border genomic sequence
Complete internal transgene _
11 Complete flanking and internal transgene
12 Right flanking genornic/right border transgene (10 nt/10nt)
13 Left flanking genomic/left border transgene (10 nt/10nt)
14 Right flanking genomic/right border transgene (20 nt/20nt)
Left flanking genomic/left border transgene (20 nt/20nt)
16 Right flanking genomic/right border transgene (30 nt/30nt)
17 Left flanking genomic/left border transgene (30 nt/30nt)
18 Right flanking genomic/complete transgene
19 Left flanking genomicieomplete transgene
Primer 10-0-3514
21 Primer 09-0-2824
22 Primer 09-0-3249
23 Primer 10-0-3515
24 Primer 09-0-2825
Primer 09-0-3251
26 Primer 09-QP83
79
CA 02891153 2015-05-12
WO 2012/071040 PCTAIS2010/058011
SEQ ID NO Description
27 Primer 09-QP87
The article a and 'an" are used herein to refer to one or more than one (I.e.,
to at
least one) of the grammatical object of the article. By way of example, an
element'
means one or more element
All publications and patent applications mentioned in the specification are
indicative of the level of those skilled in the art to .which this invention
pertains.
The scope of the claims should not be limited by the preferred
embodiments set forth in the examples, but should be given the broadest
interpretation consistent with the description as a whole.
=
=
=
=
CA 0 2 8 9 1 15 3 2 0 15 - 0 5 - 1 2
WO 2012/071040 PCTTUS2010/058011
Applicants or agents International application No,
file reference 35718/39908 PCT/U52010/
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule 13bis)
A. The
indications made below relate to the deposited microorganism or other
biological material referred to in the description on page 40, line 5
B. IDENTIFICATION
OF DEPOSIT Further deposits are Identified on an additional sheet 0
Name of depository Institution
American Type Culture Collection
Address of depositary institution (Including postal code and country)
10801 University Blvd.
Manassas, Virginia 20110-2209 USA
Date of deposit Acce-s-ila Number
24 November 2010 PTA-
C. ADDITIONAL
INDICATIONS (leave blank If not applicable) This information is continued
on an additional sheet ID
page 3, line 9; page 5, line 8; page 82, line 8; page 82, line 19; page 84,
line 33; page 85, line 15 and page 85,
line 21
=
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the Indicators are
not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau
later (specify the general nature of the indications e.g., 'Accession
Number of Deposit,
For receiving Office use only For International Bureau use only
0 This sheet was recewea wan me international application This sheet
11/b. ibuberbu u !Inc. ICRIVI rat utabod on:
Authorized officer Authorized officer
= =
Form PCT/R0/134 (July 1998)
81
