Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
1
Mutations in the extracellular domain III of epidermal growth factor receptor
gene
The present invention is directed to new mutations of the human epidermal
growth factor receptor gene, as a marker for determining response to
monoclonal antibody treatment.
BACKGROUND ART
Epidermal growth factor receptor gene (EGFR) is a transmembrane tyrosine-
kinase receptor that belongs to the epidermal growth factor family of
receptors (ErbB family), which includes four closely related receptor tyrosine
kinases: EGFR (ErbB-1), HER2/c-neu (ErbB-2), Her 3 (ErbB-3) and Her 4
(ErbB-4). Upon ligand binding, EGFR activates intracellular signalling
pathways, mainly the RAS-RAF-MEK-ERK cascade and the PI3K-AKT
pathway, that regulate key oncogenic events such as apoptosis, cell growth,
angiogenesis and metastasis. Aberrant activation or overexpression of EGFR
has been reported in several types of cancer (i.e. Mendelsohn J, BaseIga J et
al., "Epidermal growth factor receptor targeting in cancer". Semin Oncol -
2006, Vol. 33, pp.: 369-38). Mutations in EGFR gene have been described in
lung cancer. Examples of such mutations are disclosed for instance in the
document of Lynch TJ et al., "Activating mutations in the epidermal growth
factor receptor underlying responsiveness of non-small-cell lung cancer to
gefitinib", N Engl J Med-2004, Vol. 350, pp:2129-2139.
Metastasic colorectal cancer (mCRC) is the second leading cause of death
from cancer in the Western Countries world.
A therapy based on monoclonal antibodies (moAbs), e.g. cetuximab and
panitumumab, which are directed against the extracellular domain III of EGFR,
provides significant survival benefit to patients with mCRC and are now
standard components of therapy regimens for these patients, i.e. either alone
or in combination with other antineoplastic drug(s).
The moAbs bind to foreign antigens expressed on cancer cells. Once bound,
the cancer cells are marked for destruction by the patient's immune system. In
addition to targeting cancer cells, moAbs can be designed to act on other cell
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
2
types and molecules necessary for tumor growth. For example, antibodies can
neutralize growth factors and thereby inhibit tumor expansion. It is possible
to
create a moAb specific to almost any extracellular/cell surface target (such
as
cancer cells). In summary, moAbs can be used to destroy malignant tumor
cells and prevent tumor growth by blocking specific cell receptors.
Therapeutic
moAbs cetuximab and panitunnumab bind to EGFR and prevent the activation
of intracellular signalling pathways driven by EGFR (i.e., the RAS-RAF-MEK-
ERK cascade and PI3K-AKT pathway).
Not all patients with mCRC respond to a therapy regimen comprising moAbs.
The lack of response of a patient with mCRC to such a treatment could be
primary (i.e. since the beginning of anti-EGFR moAb treatment), known as
primary resistance. Moreover, all mCRC patients that initially respond to anti-
EGFR moAbs invariably develop secondary resistance, i.e. acquired
resistance to anti-EGFR moAb. In both cases, the result is treatment failure.
The mechanisms that contribute to the acquisition of such treatment
resistance in mCRC patients is not fully known yet.
KRAS (also known as V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog)
is an EGFR downstream effector, and a marker of primary resistance to anti-
EGFR moAbs. KRAS has a significant impact on the optimization of treatment
of mCRC patients. Forty per cent of colorectal tumors harbour a mutation in
the KRAS gene and these patients do not benefit from anti-EGFR moAbs. In
current clinical practice all mCRC patients who are being considered for anti-
EGFR moAb therapy should undergo KRAS testing, and patients should be
excluded from cetuxinnab or panitumumab therapy if a KRAS mutation is
detected.
While the use of KRAS mutations and more recently NRAS (Neuroblastonnas
Ras viral oncogene homolog) mutations as markers of primary resistance to
anti-EGFR moAbs has meant a significant step towards optimization of
treatment of mCRC patients, the understanding of molecular changes
underlying acquired resistance to anti-EGFR moAb is currently a crucial
challenge to improve the clinical benefit of these drugs. Recently, mechanisms
of secondary resistance (acquired resistance) have been elucidated in
patients. The most common event is the emergence of KRAS mutations or
gene amplification in approximately 50% of the cases, as deducible from
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
3
M isale et al., "Emergence of KRAS mutations and acquired resistance to anti-
EGFR therapy in colorectal cancer", Nature ¨2012, Vol. No. 486, pp.: 532-
536.
Other mechanisms of secondary resistance include acquisition of a mutation
in the extracellular domain of EGFR abrogating binding of cetuximab to
EGFR, as illustrated by Montagut et al., "Identification of a mutation in the
extracellular domain of the Epidermal Growth Factor Receptor conferring
cetuximab resistance in colorectal cancer", Nature Medicine - 2012, Vol. No.
18, pp.:221-223. The mutation is the polymorphism in the extracellular portion
of the EGFR gene, resulting in the amino acid substitution S492R at domain III
of the codified protein.
With the aim of studying monoclonal antibody interaction with EGFR epitopes,
several reports are directed to the mapping of critical epitopes. These
reports
provide data of mutations obtained by site-directed nnutagenesis at domain III
of EGFR. An example of these reports is the one of Voigt et al., "Functional
Dissection of the Epidermal Growth Factor Receptor Epitopes Targeted by
Panitumumab and Cetuximab'', Neoplasia ¨2012, Vol. No. 14(11), pp.: 1023-
1031. This document discloses mutations in which the wild-type amino acid
has been mostly changed by an alanine, according to the protocols and tools
of site-mutagenesis assays. Voigt concludes that in-vitro data from site-
mutagenesis may not be meaningful in vivo because residues defined as
critical for cetuximab or panitumumab binding by an alanine scanning
approach may well be mutated in vivo to other amino acids without functional
consequences. Therefore, those key positions in a defined epitope identified
by site-mutagenesis do not suggest the in vivo meaningful mutation (the
particular amino acid exchange).
Drug resistance is then a major challenge in colorectal cancer patients
treated
with anti-EGFR drugs, namely cetuximab and panitumumab. Elucidation of the
molecular mechanisms of resistance represents a great goal, but this implies
detection of meaningful mutations or other gene alterations as markers for
predicting a response and, at the same time, for determining if a particular
medical regimen has to be modified due to acquired resistance (secondary
resistance). In summary, the state of the art provides useful tools for
detecting
primary and secondary resistance to anti-EGFR moAb therapies in patients
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
4
with mCRC, but it is necessary to identify additional and alternative
predictive
biomarkers of resistance in order to cover patients with different mutations,
or
with a different evolution of the resistance molecular mechanisms.
SUMMARY OF THE INVENTION
The inventors have identified new mutations in the extracellular domain of
human EGFR (domain III) that correlate with resistance to the treatment with
some moAbs used in the cancer therapy. The mutations lead to the amino
acid substitutions of an arginine by a cysteine at position 451 of the EGFR
protein; of a serine by a leucine at position 464 of the EGFR; of a glycine by
an arginine at position 465 of the EGFR protein; and of a lysine by a
threonine
at position 467 of the EGFR protein.
Wild type human EGFR protein has the amino acid sequence SEQ ID NO: 2,
and the mutations are known herein as R451C, S464L, G465R and K467T.
Mutations may be detected alone or in combination with each of the others in
patients with mCRC after treatment with anti-EGFR moAbs.
All these mutations are located in a particular amino acid sequence fragment
of the cetuximab binding epitope. Namely, they are located in a fragment from
amino acid at position 450 to amino acid at position 470 of SEQ ID NO: 2, this
SEQ ID NO: 2 corresponding to the consensus wild-type amino acid sequence
of human EGFR, This amino acid sequence fragment of the cetuximab
binding epitope is herewith referred also as SEQ ID NO: 12
(LRSLKEISDGDVIISGNKNLC). Interestingly, inventors discovered that this
fragment includes many of the particular amino acid exchanges (mutations)
that lead to a real impairment (i.e not effectivity) of many anti-EGFR moAb
treatments. As above exposed, many amino acid positions have been
determined as key positions by mutagenesis while mapping anti-EGFR-moAb
binding sites, nonetheless, it is also known that mapping assays are not
conclusive for determining resistance to treatments.
Therefore, the inventors provide for the first time a fragment of the
extracellular domain III of EGFR that contains or summarizes many mutation
points with a real effect on therapy. Analysing or determining the sequence
within this fragment (SEQ ID NO: 12) provides the advantage of detecting
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
many of the possibly resistant patients to treatments including anti-EGFR
moAb. Examples of amino acids within this SEQ ID NO: 12
(LRSLKEISDGDVIISGNKNLC) that lead to resistance to the widely employed
anti-EGFR moAb cetuximab are indicated in bold and underwritten.
5
All these mutations are located in exon 12 of the mRNA variant 1 of the
human EGFR gene finally coding for EGFR protein of SEQ ID NO: 2. In
addition, all of them relate to a change of wild-type amino acids to bulky
amino
acids (i.e. those with a side-chain consisting of branched or unbranched C1-
C4 hydrocarbons, optionally with a terminal amino group) and/or polar or
charged amino acids. In particular, most of the mutations relate to a change
of
a polar and/or charged amino acid with a side-chain comprising a terminal
amino (-NH2). More in particular, two of the mutationsrelate to a change of an
amino acid with a side-chain comprising a terminal amino (-NH2). In addition,
mutations R451C and K467T imply the substitution of an amino acid with a
side-chain comprising a terminal amino (-NH2) for a polar amino acid, whose
carbohydrate side-chain comprises radicals with atoms from the oxygen
group, namely ¨OH and ¨SH, and they have a similar chain size as depicted
below:
9
H2N-yH-C-OH 9
91-12 H2N-9H-C-OH
yH2 yH2
cH2 cH2
NH yH2
y=NH 91-12
NH2 NH2
Arg, R Lys, K
9 9
H2N-yH-C-OH H2N-CH-C-OH
yphoH yH2
CH3 SH
Thr, T Cys, C
Thus, inventors provide for the first time the association of mutations in
domain III of human EGFR changing a basic amino acid with a side-chain
comprising a terminal amino (-NH2), with proved resistance to the treatment
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
6
with some moAbs used in the cancer therapy. More particularly, this
association is seen when these basic amino acids change to certain polar
amino acids selected from cysteine and threonine.
Besides, changes of amino acids within the above-mentioned SEQ ID NO: 12
being said amino acids polar or neutral and substituted by bulky amino acids,
being charged or neutral, are also associated with proved resistance to the
treatment with some moAbs used in the cancer therapy. This is the case, for
example, of mutation S464L and of mutation G465R.
Particular mutations R4510 and K467T are detected in a mutated protein
comprising the peptide sequence defined in SEQ ID NO: 1.
Besides, the above-indicated mutations and mutations S464L and G465R are
detected in a mutated protein comprising the peptide sequence defined in
SEQ ID NO: 13.
These markers may then be used to track the evolution of the acquired
resistance mechanisms to anti-EGFR therapies. Detection of acquired
resistance may be a useful tool for proposing another therapeutic approach or
medical regimen along the follow-up of the disease evolution.
Thus, in a first aspect the invention relates to a peptide sequence with a
length from 17 to 100 amino acids and comprising the sequence SEQ ID NO:
13
X1SLKEISDGDVIIX4X5NX2, wherein
X1 is selected from R and C;
X4 is selected from S and L;
X5 is selected from G and R;
X2 is selected from K and T; and wherein at least one of X1, X4, X5
and X2 is, respectively, C, L, R or T.
SEQ ID NO: 13 encompasses any of the above-defined mutations, but at least
one of them: R451C, S464L, G465R or K467T.
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
7
In a particular embodiment, the invention relates to a peptide sequence with a
length from 17 to 100 amino acids and comprising the sequence SEQ ID NO:
1
X1SLKEISDGDVIISGNX2, wherein:
X1 is selected from R and C;
X2 is selected from K and T; and
wherein if X1 is C, then X2 is selected independently from K and T, and
if X1 is R, then X2 is T.
SEQ ID NO: 1 encompasses any of the above-defined mutations, but at least
one of them: R451C or K467T. In other words, X1 and X2 have the indicated
meaning but with the proviso that at least one of X1 or X2 are, respectively,
the
mutated forms C or T; or both X1 and X2 are the mutated forms C and T.
This SEQ ID NO: 1 derives from human EGFR protein of SEQ ID NO: 2. Thus,
it is a fragment of the human protein sequence, said fragment including at
least one of the indicated mutations. Therefore, the resting of the amino
acids
up to 100 are the ones located in the protein sequence of SEQ ID NO: 2,
being either flanking said SEQ ID NO: 1 or a sequence linked to the C-
terminal end of SEQ ID NO: 1 and defined by the amino acid X2.
Advantageously, these mutations (R451C, S464L, G465R or K467T)
represent alternatives that can be tested in a sample of a subject suspected
of
having acquired resistance or a primary resistance to the anti-EGFR moAb
therapies. Thus, besides other mutations that may be present or not in the
sample of a subject, the mutations proposed in SEQ ID NO: 1 (R451C or
K467T) or even in SEQ ID NO: 13 (R451C, S464L, G465R or K467T) serve to
detect possible resistant subjects not detectable by other means. In
particular,
mutations R451C and K467T imply the additional advantage of indicating that
some anti-EGFR moAb therapies are still permissive (or efficient). In
particular, mutations R451C and K467T are permissive to panitumumab. This
means that, if at least one of these two mutations are detected, at least
panitumumab treatment may be recommended.
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
8
In a second aspect, the invention relates to an oligonucleotide comprising a
sequence coding for SEQ ID NO: 1 or SEQ ID NO: 13.
The isolated peptide comprising SEQ ID NO: 1 or SEQ ID NO: 13 is the key
product leading to the detection of mutated forms of EGFR protein of great
interest in the field of cancer therapy. These mutated forms of the protein
are
also detectable in the form of an oligonucleotide comprising a sequence
coding for SEQ ID NO: 1 or for SEQ ID NO: 13.
Oligonucleotides coding for SEQ ID NO: 1 or for SEQ ID NO: 13 are those
including the nucleotide changes that lead to at least one of the above
mentioned amino acid changes taking into account the codon degeneracy
(redundancy of the genetic code) in these mutation positions. These
oligonucleotides may be used then as hybridization probes for detecting the
particular mutations that lead to the amino acid changes.
In addition, all these oligonucleotides are suitable probes allowing detecting
the presence or not of the nucleotide mutations leading to amino acid changes
in a peptide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 13.
In particular, the invention is based on the surprising identification of the
amino acid substitutions of an arginine by a cysteine at position 451 of the
EGFR protein; of a serine by a leucine at position 464 of the EGFR; of a
glycine by an arginine at position 465; and of a lysine by a threonine at
position 467 of the EGFR protein.
The amino acid change K4671 is the result of the nucleotide change A¨>C at
nucleotide 1400 (also known herein as A1400C) of the mRNA variant 1 of the
EGFR gene (Codon AAA is changed to ACA). The amino acid change R451C
is the result of the nucleotide change C¨>T at nucleotide 1351 (also known
herein as C1351T) of the mRNA variant 1 of the EGFR gene (Codon CGC is
changed to TGC). The amino acid change S464L is the result of the
nucleotide change C¨>T at nucleotide 1391 (also known herein as C1391T) of
the mRNA variant 1 of the EGFR gene (Codon TCA is changed to TTA). The
amino acid change G465R is the result of the nucleotide change G¨>A at
nucleotide 1393 (also known herein as G1 393A) of the mRNA variant 1 of the
EGFR gene (Codon GGA is changed to AGA).
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
9
All these amino acid changes may be the result of other mutations in the
codon coding for them. In particular, all those nucleotide changes leading to
a
cysteine at position 451 of SEQ ID NO: 2 (human EGFR protein), to a leucine
at position 464 of SEQ ID NO: 2, to an arginine at position 465 of SEQ ID NO:
2; and to a threonine at position 467 of SEQ ID NO: 2.
As already indicated above, each of the above nucleotide changes refers to
the mRNA, transcript variant 1 sequence of the EGFR gene (also known as
ERBB1, PIG61, proto-oncogene c-ErbB-1, avian erythroblastic leukemia viral
(v-erb-b) oncogene honnolog receptor tyrosine-protein kinase erbB-1, or
HER1). The sequence of the mRNA, transcript variant 1, of the EGFR gene is
that corresponding to SEQ ID NO: 3 (or GenBank accession number
NM 005228.3, version 3 of sequence and database release available on
18.05.2014) as well as any variant thereof, wherein said variant codes for the
EGFR protein. The EGFR protein corresponds to SEQ ID NO: 2 (GenBank
accession number NP_005219.2 version 2 of sequence and database release
of 18.05.2014) or any variant thereof that maintains the basic structure of
the
EGFR protein. SEQ ID NOs: 2 and 3 are from human (Homo sapiens).
Nonetheless, EGFR is highly conserved in most of the mammals and the
herewith mutation points comprise in the wild-type sequences the same amino
acids in most of mammals. Therefore, the invention encompasses the same
mutations but determined in a sequence of EGFR protein or gene of any
mammal.
Another aspect of the invention is a set of primers consisting of SEQ ID Nos:
6
(CAAAGTTTTCAGGGATACATTGTTTTT) and 7
(TTAAATGGGAATAGCCCTTCAATATT).
This set of primers allows amplifying the genomic region comprising the
portion of the EGFR coding region wherein the nucleotide changes resulting in
the mutations of the present invention are located. They are thus related with
the novel amino acidic mutations identified by the inventors, and they allow
amplifying the EGFR coding region coding for the fragment herewith named
SEQ ID NO: 12 (LRSLKEISDGDVIISGNKNLC) that has been surprisingly
found as a key region including many mutations leading to resistance
(acquired or primary) to treatment with anti-EGFR moAbs. Particularly, the set
CA 02954952 2017-01-12
WO 2016/015788
PCT/EP2014/079477
of primers consisting of SEQ ID NO: 6 and 7 allow amplification of EGFR
coding region leading to Exon 12 in the variant 1 of mRNA transcript. This set
allows determining if mutations R451C, S464L, G465R and K467T are
present in the final resulting EGFR protein. More in particular if mutations
5 R451C and K467T are present in the final resulting EGFR protein.
Another aspect of the invention is a kit that comprises a set of primers
consisting of: the set of primers of SEQ ID NOs: 6 and 7, and/or an
oligonucleotide as defined in the second aspect of the invention.
This kit is a usable tool to detect the presence of the mutations (R451C,
5464L, G465R and K467T) of SEQ ID NO: 13, and more particularly of
mutations R451C and K467T of SEQ ID NOs: 1, or of any amino acid
sequence comprising it, in an easy and fast way, since it includes the primers
for amplifying regions of EGFR gene that may include the disclosed mutations
correlated with resistance to cetuximab treatment.
Also another aspect of the invention is, therefore, the kit as defined above,
for
use in the prediction of the response of a subject to a therapy regimen
comprising anti-EGFR monoclonal antibodies. Or the use of a kit as defined
above for predicting response of a subject to a therapy regimen comprising
anti-EGFR monoclonal antibodies.
Further, the invention also relates to an in vitro method of predicting the
response of a subject therapy regimen comprising cetuximab and/or
panitumumab, wherein the method comprises:
(i) determining in a sample taken from the subject and by means selected
from the group consisting of genotype methods, and/or protein sequencing
methods if mutations are present or absent in a fragment defined by SEQ ID
NO: 12, which is a fragment from amino acid 450 to amino acid 470 of the
consensus wild-type amino acid sequence of human EGFR of SEQ ID NO: 2;
and ii) correlating the presence of any mutation identified in step i) with
resistance of the subject to the therapy regimen comprising cetuximab, or
correlating the absence of mutations in step i) with response of the subject
to
therapy regimen comprising panitumumab.
Thus, SEQ ID NO: 12 corresponds to the wild-type amino acid fragment (or
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
11
sequence) of the human EGFR, and mutations in relation to this consensus
wild-type amino acid sequence are determined within this SEQ ID NO: 12, that
has been discovered as a meaningful fragment of EGFR regarding prediction
of anti-EGFR moAb treatments. This SEQ ID NO: 12 forms also part of the
invention (LRSLKEISDGDVIISGNKNLC) as an isolated peptide.
The invention also relates to in vitro methods of predicting the response of a
subject therapy regimen comprising cetuximab and/or panitumumab, wherein
the method comprises:
.. i) determining by means selected from the group consisting of genotype
methods, and/or protein sequencing methods, the presence or absence of at
least one of the following amino acids:
a cysteine at position 451 of the amino acid sequence corresponding to SEQ
ID NO: 2, a leucine at position 464 of the amino acid sequence corresponding
SEQ ID NO: 2, an arginine at position 465 of the amino acid sequence
corresponding SEQ ID NO: 2; and a threonine at position 467 of the amino
acid sequence corresponding to SEQ ID NO: 2, in a sample taken from the
subject; and ii) correlating the presence of any of the amino acids identified
in
step i) with resistance of the subject to the therapy regimen comprising
cetuximab, or correlating the absence of all of these amino acids in step i)
with
response of the subject to therapy regimen comprising panitumumab.
Further, the invention also relates, in a particular embodiment, to an in
vitro
method of predicting the response of a subject therapy regimen comprising
cetuximab and/or panitumumab, wherein the method comprises:
i) determining by means selected from the group consisting of genotype
methods, and/or protein sequencing methods, the presence or absence of at
least one of the following amino acids:
a cysteine at position 451 of the amino acid sequence corresponding to SEQ
ID NO: 2, and a threonine at position 467 of the amino acid sequence
corresponding to SEQ ID NO: 2, in a sample taken from the subject; and ii)
correlating the presence of any of the amino acids identified in step i) with
resistance of the subject to the therapy regimen comprising cetuximab, or
correlating the absence of all of these amino acids in step i) with response
of
the subject to therapy regimen comprising panitumumab.
This in vitro method encompasses detecting if in exon 12 of the mRNA variant
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
12
1 of the human EGFR gene finally coding for EGFR protein of SEQ ID NO: 2
there is a nucleotide change leading to a change of an amino acid with a side-
chain comprising a terminal amino (-NH2) in the wild-type gene for a polar
amino acid, whose carbohydrate side-chain comprises radicals with atoms
from the oxygen group.
The put into practice of the in vitro method of predicting the response of a
subject to a therapy regimen comprising cetuximab and/or panitumumab,
implies the advantage of accommodating the more suitable therapy for the
subject, and avoids wrong or not useful enough therapeutically approaches
incurring waste time, which is an essential aspect for the subject and the
success of the treatment, especially if the subject is affected with cancer.
In addition, detection of any of these mutations allows determining if a
secondary resistance to cetuximab treatment has been developed in the
subject, said subject not initially carrying the mutations in the EGFR gene.
Thus, another aspect of the invention is an in vitro method for determining
the
acquired resistance to a therapy regimen comprising cetuximab, the method
comprising:
i) determining by means selected from the group consisting of genotype
methods, and/or protein sequencing methods, the presence or absence of at
least one of the following amino acids:
a cysteine at position 451 of the amino acid sequence corresponding to SEQ
ID NO: 2, a leucine at position 464 of the amino acid sequence corresponding
to SEQ ID NO: 2, an arginine at position 465 of the amino acid sequence
corresponding to SEQ ID NO: 2, and a threonine at position 467 of the amino
acid sequence corresponding to SEQ ID NO: 2, in a sample taken from the
subject; and
ii) correlating the presence of any of the amino acids identified in step i)
with
acquired resistance of the subject to the therapy regimen comprising
cetuximab, or correlating the absence of all of these amino acids in step i)
with
response of the subject to therapy regimen comprising panitumumab.
This in vitro method for determining the acquired resistance in a subject
after
treatment with cetuximab, advantageously allows stopping the treatment and
further to avoid secondary or accompanying cetuximab adverse effects.
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
13
Moreover, other approaches can be taken as fast as possible.
As above, this in vitro method for determining the acquired resistance
encompasses detecting if in exon 12 of the mRNA variant 1 of the human
EGFR gene finally coding for EGFR protein of SEQ ID NO: 2 there is a
nucleotide change leading to a change of an amino acid with a side-chain
comprising a terminal amino (-NH2) in the wild-type gene for a polar amino
acid, whose carbohydrate side-chain comprises radicals with atoms from the
oxygen group. This in vitro method encompasses also detecting if at least in
exon 12 of the mRNA variant 1 of the human EGFR gene finally coding for
EGFR protein fragment of SEQ ID NO: 12, there is a nucleotide change
leading to a change of wild-type amino acids to bulky amino acids (i.e. those
with a side-chain consisting of branched or unbranched C1-C4 hydrocarbons,
optionally with a terminal amino group) and/or to polar or charged amino
acids. Wild-type amino acid refers to the amino acid according to the
consensus amino acid sequence of human EGFR protein (SEQ ID NO: 2).
Another aspect of the invention is an in vitro method of identifying, in a
sample
taken from a subject, the presence or absence of a cysteine at position 451 of
the amino acid sequence corresponding to SEQ ID NO: 2; and/or the
presence or absence of a leucine at position 464 of the amino acid sequence
corresponding to SEQ ID NO: 2; and/or the presence or absence of an
arginine at position 465 of the amino acid sequence corresponding to SEQ ID
NO: 2; and/or the presence or absence of a threonine at position 467 of the
amino acid sequence corresponding to SEQ ID NO: 2, the method comprising
determining the sequence of SEQ ID NO: 2, at least from position 450 to
position 470.
This later aspect can also be formulated as an in vitro method of identifying,
in
a sample taken from a subject, the presence or absence of a cysteine at
position 451 of the amino acid sequence corresponding to SEQ ID NO: 2;
and/or the presence or absence of a leucine at position 464 of the amino acid
sequence corresponding to SEQ ID NO: 2; and/or the presence or absence of
an arginine at position 465 of the amino acid sequence corresponding to SEQ
ID NO: 2; and/or the presence or absence of a threonine at position 467 of the
amino acid sequence corresponding to SEQ ID NO: 2, the method comprising
determining the amino acid at positions 451 and/or 464 and /or 465 and/or
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
14
467 by means selected from the group consisting of genotype methods,
and/or protein sequencing methods.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is the plot of two displays of sequencing results obtained by
conventional Sanger sequencing (plot A) and Next Generation Sequencing
(NGS) in a 454 GS Junior platform (Roche Applied Science, Mannheim,
Germany) (plot B). It shows the acquisition of mutations in the EGFR
ectodomain following treatment with cetuximab in two samples. (A) In patient
#31, the post-treatment tumor sample had acquired an A -> C substitution at
nucleotide 1400 of EGFR gene that was not present in a pre-treatment biopsy,
causing a substitution of a lysine to a threonine at amino acid 467 (K467T).
(B) In patient #35, a C -> T substitution at nucleotide 1351 of the EGFR gene
was detected in the post-treatment sample, leading to a substitution of an
arginine to a cysteine at amino acid 451 (R451C).
FIG. 2 is a Flow cytometry binding analysis of trypsinized NIH3T3
overexpressing wild-type EGFR (wt EGFR) and K467T EGFR mutant
incubated with cetuximab (FIG. 2A) or panitumumab (FIG. 2B) as primary
antibodies and using a secondary antibody conjugated with phycoerythrin
directed against human IgG. C means counts; FL2H denotes the maximal
signal intensity in the second channel of fluorescence detection with a band
pass of 585 21 that is used to detect the phycoerythrin (PE) fluorescence; E
means empty.
FIG. 3 is also a Flow cytometry binding analysis of trypsinized NIH3T3
overexpressing wild-type EGFR (wt EGFR) and S464L EGFR mutant
incubated with cetuximab (FIG. 3A) or panitumumab (FIG. 3B) as primary
antibodies and using a secondary antibody conjugated with phycoerythrin
directed against human IgG. C means counts; FL2H denotes the maximal
signal intensity in the second channel of fluorescence detection with a band
pass of 585 21 that is used to detect the phycoerythrin (PE) fluorescence; E
means empty.
FIG. 4 shows a Flow cytometry binding analysis of trypsinized NIH3T3
overexpressing wild-type EGFR (wt EGFR) and G465R EGFR mutant
,
incubated with cetuximab (FIG. 4A) or panitumumab (FIG. 4B) as primary
antibodies and using a secondary antibody conjugated with phycoerythrin
directed against human IgG. C means counts; FL2H denotes the maximal
signal intensity in the second channel of fluorescence detection with a band
5 pass of 585 21 that is used to detect the phycoerythrin (PE)
fluorescence; E
means empty.
15
DETAILED DESCRIPTION OF THE INVENTION
In general, the following words or phrases have the indicated definition when
used in the description, examples and claims.
The term "therapy regimen" as used in the state of the art and also herein
refers to any therapy intended to prevent, slow, arrest or reverse the growth
of
a precancerous lesion, cancer or a cancer metastasis. It includes
chemotherapy, radiation therapy, immunotherapy, monoclonal antibody
therapy or other methods.
By "response" is to be understood any kind of improvement either clinical or
non-clinical selected from, but not limited to, measurable reduction in tumour
size or evidence of disease or disease progression, stable disease, increase
or elongation of progression of free survival or reduction in toxicity.
"Progression free survival" indicates the length of time during and after
treatment that the cancer does not grow. Progression free survival includes
the amount of time patients have experienced a complete response or partial
response, as well as the amount of time patients have experienced stable
disease.
CA 2954952 2019-12-18
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
16
"A complete response" to a therapy defines patients with valuable but non-
measurable disease, whose tumour and all evidence of disease disappeared.
"A partial response" to a therapy defines patients with anything less than
complete response.
"An anti-EGFR monoclonal antibody (anti-EGFR moAb)" relates to a
monoclonal antibody and to a fragment thereof that are able to recognize
epitopes in the EGFR sequence protein. Approved moAb which recognize
different epitopes of EGFR are cetuxinnab and panitunnunnab, but other moAb
could be used in the therapy regimen for facing cancer disclosed in the
present invention. Suitable antibody fragments include F(ab), F(ab'),Fv and
nanobodies, among others.
The expression "genotype methods" includes all those methodologies and
processes suitable for determining the genotype or, which is the same for
identifying the nucleotide in a given position. Examples of said methodologies
encompass Sanger sequencing, pyrosequencing, allele-specific PCR,
denaturing high pressure liquid chromatography (DHPLC), Allele Specific
Primer Extension (ASPE), DNA biochips/microarrays and dynamic allele-
specific hybridization (DASH).
For "protein sequencing methods" is to be understood any technique allowing
to determine the amino acid sequence of a protein, as well as which
conformation the protein adopts and the extent to which it is complexed with
any non-peptide molecules. The determination of amino acid composition may
be performed by hydrolysis or separation of the amino acids. Known
technologies include the Sanger sequencing, Edman degradation and mass
spectrometry.
If not indicated to the contrary, all sequences relating EGFR gene, mRNA
variant and EGFR protein relate to the human one with the database
accession numbers listed along the description. Also if not indicated to the
contrary, oligonucleotide sequences are shown in the 5'-3' direction, and
peptide sequences are shown starting from the N-terminus amino acid ((also
known as the amino-terminus, NH2-terminus, N-terminal end or amine-
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
17
terminus) of the peptide, according to the convention for writing peptide
sequences.
All the amino acid sequences, as well as of oligonucleotides may be
synthesized following appropriate peptide or oligonucleotide chemical
synthesis. Examples of peptide synthesis include solid-phase synthesis and
liquid-phase synthesis, both processes coupling the carboxyl group or C-
terminus of one amino acid to the amino group or N-terminus of another.
Unintended reactions are avoided in solid-phase synthesis using protecting
groups, such as 9-fluorenylmethyloxycarbonyl (Fmoc) and Tert-
butyloxycarbonyl (t-Boc). Alternatively, the peptides may be obtained by DNA
recombinant technologies. Oligonucleotides may be obtained by solid-phase
synthesis using phosphoramidite method and phosphoramidite building blocks
derived from protected 2'-deoxynucleosides (dA, dC, dG, and T),
ribonucleosides (A, C, G, and U), or chemically modified nucleosides.
Oligonucleotides may also be derived from DNA digestion with appropriate
restriction enzymes.
As already explained above, prior art teachings show that mutations at domain
III of EGFR may help to map critical points for the interaction of moAbs
(cetuximab and/or panitunnunnab). Nonetheless, these data may serve to
detect specific epitopes but they are not concluding in terms of resistance to
treatment, since only specific amino acid exchanges encompass this
information (that of resistance, either primary or secondary resistance).
Particularly, acquired resistance to treatment is of great importance in order
to
modify the therapeutically approaches and avoid wasting time and efforts.
The present invention is based on novel mutations in the coding region of the
EGFR gene. The novel mutations of the present invention are useful to predict
the response to moAb-based therapy of a patient with mCRC. In particular,
they are useful to predict primary resistance and the appearance of a
secondary resistance.
As already indicated above, each of the disclosed nucleotide changes lead to
the substitution to a cysteine at position 451 of SEQ ID NO: 2 (human EGFR
protein), to a leucine at position 464 of SEQ ID NO: 2, to an arginine at
position 465 of SEQ ID NO: 2, and to a threonine at position 467 of SEQ ID
CA 02954952 2017-01-12
WO 2016/015788
PCT/EP2014/079477
18
NO: 2. All these particular mutations are located in a fragment from amino
acid 450 to amino acid 470 of this SEQ ID NO: 2, said fragment hereweith
named SEQ ID NO: 12.
The peptide according to the invention, with a length from 17 to 100 amino
acids and comprising the sequence SEQ ID NO: 1 includes any of the
mutations R451C or K467T.
In a particular embodiment, this peptide is selected from the group consisting
of: a sequence comprising SEQ ID NO: 1 wherein X1 is Rand X2 is T; a
sequence comprising SEQ ID NO: 1 wherein X1 is C and X2 is T; and a
sequence comprising SEQ ID NO: 1 wherein X1 is C and X2 is K.
In a more particular embodiment, the peptide consists in SEQ ID NO: 1 and,
more particularly that SEQ ID NO: 1 selected from the group consisting of
SEQ ID NO: 1 wherein X1 is R and X2 is T; SEQ ID NO: 1 wherein X1 is C and
X2 is T; and SEQ ID NO: 1 wherein X1 is C and X2 is K. These sequences are
represented by SEQ ID NO: 8 (RSLKEISDGDVIISGNT), SEQ ID NO: 9
(CSLKEISDGDVIISGNT) and SEQ ID NO: 10 (CSLKEISDGDVIISGNK).
In a particular embodiment, the peptide with a length from 17 to 100 amino
acids and comprising the sequence SEQ ID NO: 1, further comprises SEQ ID
NO: 4
NLCYANTINWKKLFGTSGGKTKIIX3, wherein
X3 is selected from S and R.
The peptide comprising both SEQ ID NO: 1 and SEQ ID NO: 4 corresponds,
in a particular embodiment, to a continuous amino acid sequence starting with
SEQ ID NO: 1. This sequence has 42 amino acids and corresponds to a
fragment of EGFR protein coded partially by exon 12 of the EGFR gene. It is
represented by, or consists in SEQ ID NO: 5
(X1SLKEISDGDVIISGNX2NLCYANTINWKKLFGTSGGKTKIIX3)
In another particular embodiment, the peptide with a length from 17 to 100
amino acids and comprising the sequence SEQ ID NO: 13, further comprises
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
19
SEQ ID NO: 4. This peptide comprising both SEQ ID NO: 13 and SEQ ID NO:
4 corresponds, in a particular embodiment, to a continuous amino acid
sequence starting with SEQ ID NO: 13. It has 42 amino acids and
corresponds to a fragment of EGFR protein coded partially by exon 12 of the
EGFR gene. It is represented by, or consists in SEQ ID NO: 14
(X1SLKEISDGDVIIX4X5NX2NLCYANTINWKKLFGTSGGKTKIIX3)
Indeed, this SEQ ID NO: 5 includes any or all of the mutations R451C and
K467T, and further it encompasses the option of including mutation S492R.
Thus, X1, X2and X3 have the same meaning as indicated above; and if X1 is
C, then X2 is selected independently from K and T, and if X1 is R, then X2 is
T.
Mutation 5492R was firstly disclosed by the inventors in Montagut et al.,
(supra) as a key mutation for determining also resistance to moAb in cancers,
including nnetastasic colorectal cancer.
Besides, SEQ ID NO: 14 includes any or all of the mutations R451C, 5464L,
G465R and K467T, and further it encompasses the option of including
mutation 5492R. Thus, X1, X2, X3, X4and X5 have the same meaning as
indicated above, but at least one of X1, X2, X4or X5 is, respectively, C, L, R
or
T.
In another particular embodiment, the peptide sequence comprising SEQ ID
NO: 1 or SEQ ID NO: 13 has a length from 17 to 50 amino acids. In another
particular embodiment it has a length from 17 to 25 amino acids (that is 17,
18, 19, 20, 21, 22, 23, 24 or 25). In another most particular embodiment the
peptide sequence has a length of 17 amino acids. In another particular
embodiment it has a length of 21 amino acids, being any of SEQ ID NO: 1 or
SEQ ID NO: 13 flanked in the N-terminal end by a leucine (L) and in the C-
terminal end by the tripeptide N-Asparagine-Leucine-Cysteine-C (abbreviated
NLC)
In addition, and as will be depicted in the examples below, the inventors also
detected a new mutation leading to resistance to moAb in cancers, including
metastasic colorectal cancer, namely a change of an isoleucine by a
methionine at position 491 of SEQ ID NO: 2 (human EGFR protein). This
mutation is herewith named I491M. The amino acid change I491M is the result
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
of the nucleotide change AG at nucleotide 1473 (also known herein as
A1473G) of the mRNA variant 1 of the EGFR gene (Codon ATA is changed to
ATG)
5 New mutations identified in the present invention are alternatives, but
may
also be used in combination to assure a proper therapy selection.
The invention encompasses oligonucleotides coding for SEQ ID NO: 1 or SEQ
ID NO: 13. In the particular embodiment of an oligonucleotide coding for SEQ
10 ID NO: 1 or SEQ ID NO: 13, optionally in combination with any embodiment
above or below, said oligonucleotide further codes for SEQ ID NO: 4 and thus
in another particular embodiment the oligonucleotide codes for SEQ ID NO: 5
or for SEQ ID NO: 14. Particular oligonucleotides are those consisting in
nucleotide sequences coding for any of sequences SEQ ID NO: 8 to 10.
15 These oligonucleotides, as above exposed, may be used as hybridization
probes for detecting the mutations.
The kit according to the invention comprises, besides the set of primers
disclosed above, oligonucleotide probes for detecting wild-type or mutated
20 forms of EGFR gene coding for any of the mutations R451C and K467T.
Examples of these probes for detecting mutated forms of EGFR gene,
consists in oligonucleotides selected from those coding for any of SEQ ID NO:
1, 5, 8, 9 and 10.
The probes consisting in the oligonucleotides selected from those coding for
any of SEQ ID NO: 1, 5, 8, 9 and 10 are nucleotide sequences comprising the
several options of codon degeneracy in the corresponding mutation points.
Particular probes for the detection of the mutation R451C are those
complementary to the mutated region of the EGFR, wherein the nucleotide
changes resulting in the mutation R451C of the present invention is located,
being either the coding or complementary region of the gene. Thus, they
hybridize with a fragment of the nucleotide sequence carrying the mutation,
and allows detecting the nucleotide change C¨>T at position 1351 disclosed
above.
Particular probes for the detection of the mutation K467T are those
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
21
complementary to the mutated region of the EGFR wherein the nucleotide
changes resulting in the mutation K467T of the present invention is located,
being either the coding or complementary region of the gene. Thus, it
hybridizes with a fragment of the nucleotide sequence carrying the mutation,
and allows detecting the nucleotide change A¨>C at position 1400 disclosed
above.
Other particular oligonucleotide probes in the kit are for detecting wild-type
or
mutated forms of EGFR gene coding for any of the mutations S464L and
G465R.
Particular probes for the detection of the mutation S464L are those
complementary to the mutated region of the EGFR, wherein the nucleotide
changes resulting in the mutation S464L of the present invention is located,
being either the coding or complementary region of the gene. Thus, they
hybridize with a fragment of the nucleotide sequence carrying the mutation,
and allows detecting the nucleotide change C¨>T at position 1391 disclosed
above.
Other particular probes for the detection of the mutation G465R are those
complementary to the mutated region of the EGFR, wherein the nucleotide
changes resulting in the mutation G465R of the present invention is located,
being either the coding or complementary region of the gene. Thus, they
hybridize with a fragment of the nucleotide sequence carrying the mutation,
and allows detecting the nucleotide change G¨>A at position 1393 disclosed
above.
For "nucleotide sequence carrying the mutation" is to be understood any of the
coding or complementary DNA chains in the DNA genomic structure, as well
as an mRNA chain which is going to be translated.
The kits of the invention may, optionally in combination with any embodiment
above or below, further comprise additional reagents for detecting mutations
in the KRAS and/or PIK3CA, and/or BRAF genes, and/or additional mutations
in EGFR gene. These reagents include specific primers for detecting particular
mutations in all these genes, and particularly mutations associated with
resistance to a therapy regimen comprising cetuximab and/or panitumumab.
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
22
Other reagents included in the kit relate to oligonucleotide probes that can
hybridize either with the wild-type or mutated forms of all these genes.
Thus, in a particular embodiment, optionally in combination with any of the
embodiments above or below, the kit comprises tools and means (reagents) to
detect the mutations in KRAS selected from the group consisting of GI 2A;
G12C; G12D; G12R; G12S; G12V; G13A; G13C, G13D; G13V as defined by
Karapetis et al., "K-ras Mutations and Benefit from Cetuximab in Advanced
Colorectal Cancer", The New England Journal of Medicine - 2008, Vol. 359,
.. pp.: 1757-1765. All these mutations are placed on codons 12 and 13 of the
protein sequence of K-ras identified with the GenBank accession number
NP_004976.2 from 24.07.2011 (named GTPase KRas isoform b precursor)
and NP 203524.1 from 24.07.2011 (named GTPase KRas isoform a
precursor. In another preferred embodiment the kit comprises reagents to
detect mutations in exons 9 and 20 of the PIK3CA gene that codifies for the
PIK3CA protein with the GenBank accession number NP_006209.2 from
17.07.2011; and/or the V600E mutation placed on codon 600 of the protein
sequence of BRAF identified with the GenBank accession number
NP 004324.2 from 24.07.2011. In another preferred embodiment the kit
comprises means (reagents) to detect mutation S492R in EGFR protein of
SEQ ID NO: 2. In another preferred embodiment the kit comprises means
(reagents) to detect mutation I491M in EGFR protein of SEQ ID NO: 2.
The kits of the invention are in particular for use in the prediction of the
.. response of a subject to a therapy regimen comprising anti-EGFR monoclonal
antibodies, in particular cetuximab and/or panitumumab. More particularly, the
subject is affected with cancer, and the cancer is metastatic colorectal
cancer.
The invention relates according to one aspect of the invention to an in vitro
.. method of predicting the response of a subject therapy regimen comprising
cetuximab and/or panitumumab, wherein the method comprises:
(i) determining in a sample taken from the subject and by means selected
from the group consisting of genotype methods, and/or protein sequencing
methods if mutations are present or absent in a fragment defined by SEQ ID
.. NO: 12, which is a fragment from amino acid 450 to amino acid 470 of the
consensus wild-type amino acid sequence of human EGFR of SEQ ID NO: 2;
and ii) correlating the presence of any mutation identified in step i) with
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
23
resistance of the subject to the therapy regimen comprising cetuximab, or
correlating the absence of mutations in step i) with response of the subject
to
therapy regimen comprising panitumumab.
In a particular embodiment of the in vitro method in step (i) there are
determined within the SEQ ID NO: 12 if at least one of the following mutations
are present or absent: a change of an arginine by a cysteine at corresponding
position 451 of the SEQ ID NO:2; a serine by a leucine at corresponding
position 464 of the SEQ ID NO: 2; a glycine by an arginine at the
corresponding position 465 of the SEQ ID NO: 2; and of a lysine by a
threonine at the corresponding position 467 of the SEQ ID NO: 2.
In another particular embodiment, the in vitro method of predicting the
response of a subject therapy regimen comprising cetuximab and/or
panitumumab comprises:
i) determining by means selected from the group consisting of genotype
methods, and/or protein sequencing methods the presence or absence of at
least one of the following amino acids:
a cysteine at position 451 of the amino acid sequence corresponding to SEQ
ID NO: 2, and a threonine at position 467 of the amino acid sequence
corresponding to SEQ ID NO: 2, in a sample taken from the subject; and ii)
correlating the presence of any of the amino acids identified in step i) with
resistance of the subject to the therapy regimen comprising cetuximab, or
correlating the absence of all of these amino acids in step i) with response
of
the subject to therapy regimen comprising panitumumab.
This particular embodiment encompasses determining if SEQ ID NO: 1 is
present in the sample of the subject, and further correlating in step ii) the
presence of any of the mutations R451C and/or K467T with resistance of the
subject to the therapy regimen comprising cetuximab, or correlating the
absence of all of these amino acids in step i) with response of the subject to
therapy regimen comprising panitumumab.
In a more particular embodiment of the method, optionally in combination with
any embodiments above or below step i) encompasses determining if
additionally SEQ ID NO: 4 is present in the sample of the subject. Thus, after
determining if any of the mutations R451C and/or 5464L and/or G465R and/or
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
24
K467T is present, the method includes also determining if mutation S492R is
present in EGFR protein.
Detection of mutation S492R relates to the particular embodiment of the in
vitro method, optionally in combination with any of the embodiments below or
above, wherein step i) further comprises determining the presence or absence
of an arginine at position 492 of the amino acid sequence corresponding to
SEQ ID NO: 2, and wherein in step ii) the additional presence of the arginine
identified in step i) is correlated with resistance of the subject to the
therapy
regimen comprising cetuximab.
In another particular embodiment, optionally in combination with any
embodiments above or below, the in vitro method of predicting the response
of a subject therapy regimen comprising cetuximab and/or panitumumab,
further comprises determining in step (i) the presence or absence of a
methionine at position 491 of the amino acid sequence corresponding to SEQ
ID NO: 2, and wherein in step ii) the additional presence of the methionine
identified in step i) is correlated with resistance of the subject to the
therapy
regimen comprising cetuximab.
In another particular embodiment, optionally in combination with any of the
embodiments above or below, step i) is performed with a set of primers
consisting of SEQ ID NOs: 6 and 7.
Further to the amplification with the above mentioned primers, in a particular
embodiment step i) is performed by genotype methods. In another most
particular embodiment, optionally in combination with any embodiment above
or below, said genotype method is selected from Sanger sequencing,
pyrosequencing, droplet digital PCR (ddPCR), allele-specific PCR, denaturing
high pressure liquid chromatography (DHPLC), Allele Specific Primer
Extension (ASPE), DNA biochips/microarrays and dynamic allele-specific
hybridization (DASH). In even a most particular embodiment, the genotype
method is pyrosequencing.
Examples of pyrosequencing genotype methods include, among others, the
next generation sequencing (NGS) methods known as 454 High though output
pyrosequencing, sequencing by synthesis (Illumina), and Chain termination
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
sequencing (Sanger sequencing).
Alternatively, step i) includes specific probes to detect wild-type or mutated
points as genotyping method of the amplified regions. Particular probes are
5 those oligonucleotides coding for SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO:
8, SEQ ID NO: 9, and SEQ ID NO: 10. All these oligonucleotides are
complementary to nucleotide sequences of mutated EGFR gene.
The in vitro method for predicting the response of a subject to a therapy
10 regimen comprising cetuximab and/or panitumumab, is carried out in a
sample
comprising the tumour, in which the nucleotide changes in the EGFR gene of
the present invention can be detected. In cases of mCRC, the sample can be
used directly as obtained from the source or following a pre-treatment of the
sample. The sample may additionally comprise normal tissue adjacent to said
15 tumour. Accordingly, in case of mCRC the sample is selected from a
primary
colorectal cancer biopsy or a biopsy of a metastasis thereof. In other words,
the sample may be a biopsy from colorectal cancer samples, including primary
tumors and metastases. In a preferred embodiment, the metastasis is in the
liver tissue.
Patients comprising any of the new identified mutations are likely to show
response to a therapy regimen not comprising cetuximab as measured by any
suitable clinical or sub-clinical increase or elongation in progression free
survival.
In a preferred embodiment the therapy regimen is cetuximab alone or in
combination with a chemotherapy regimen based on irinotecan, oxaliplatin
and/or 5-fluorouracil (5-FU or 5FU). In a preferred embodiment the therapy
regimen is pan itumumab alone or in combination with a chemotherapy
regimen based on irinotecan, oxaliplatin and/or 5-fluorouracil.
The invention further provides also methods for deciding and/or
recommending a therapy regimen for subjects affected with cancer, preferably
mCRC, comprising: i) determining by means selected from the group
consisting of genotype methods, and/or protein sequencing methods the
presence or absence of at least one of the following amino acids:
a cysteine at position 451 of the amino acid sequence corresponding to SEQ
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
26
ID NO: 2, and a threonine at position 467 of the amino acid sequence
corresponding to SEQ ID NO: 2, in a sample taken from the subject; and ii)
recommending the administration to said subject of an effective amount of
cetuximab, or a composition thereof, if all the mutations are absent, or
panitumumab, or a composition thereof, if at least one of the mutations is
present.
The invention encompasses also an in vitro method for determining the
acquired resistance to a therapy regimen comprising cetuximab, the method
comprising, in a particular embodiment of this aspect:
i) determining by means selected from the group consisting of genotype
methods, and/or protein sequencing methods, the presence or absence of at
least one of the following amino acids:
a cysteine at position 451 of the amino acid sequence corresponding to SEQ
ID NO: 2, and a threonine at position 467 of the amino acid sequence
corresponding to SEQ ID NO: 2, in a sample taken from the subject; and
ii) correlating the presence of any of the amino acids identified in step i)
with
acquired resistance of the subject to the therapy regimen comprising
cetuximab, or correlating the absence of all of these amino acids in step i)
with
response of the subject to therapy regimen comprising panitumumab.
As above exposed, the invention provides also an in vitro method of
identifying, in a sample taken from a subject, the presence or absence of a
cysteine at position 451 of the amino acid sequence corresponding to SEQ ID
NO: 2; and/or the presence or absence of a threonine at position 467 of the
amino acid sequence corresponding to SEQ ID NO: 2 by means selected from
the group consisting of genotype methods, and/or protein sequencing
methods. In a preferred embodiment the in vitro method of identifying the
presence or absence of one or both of these mutations in SEQ ID NO: 2,
further comprises identifying the presence or absence of an arginine at
position 492 of SEQ ID NO: 2 by means selected from the group consisting of
genotype methods, and/or protein sequencing methods.
In a particular embodiment, optionally in combination with any embodiment
above or below, the method of identifying the presence or absence of a
cysteine at position 451 of the amino acid sequence corresponding to SEQ ID
NO: 2; and/or the presence or absence of a leucine at position 464 of the
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
27
amino acid sequence corresponding to SEQ ID NO: 2; and/or the presence or
absence of an arginine at position 465 of the amino acid sequence
corresponding to SEQ ID NO: 2; and/or the presence or absence of a
threonine at position 467 of the amino acid sequence corresponding to SEQ
ID NO: 2, is carried out by determining the sequence of SEQ ID NO: 2 up to
position 467 by means selected from the group consisting of genotype
methods, and/or protein sequencing methods. In a preferred embodiment, the
method is carried out by determining the sequence of SEQ ID NO: 2 from
position 450 to 470 (SEQ ID NO: 12), and more preferably from 451 to
position 467. For "determining a sequence up to a position" is to be
understood that the sequencing is performed from oligonucleotide or amino
acid from position 1 of said sequence to the position (nucleotide or amino
acid) of interest (in this particular case, to amino acid 467 or to the
nucleotide
leading to this amino acid).
Throughout the description and claims the word "comprise" and variations of
the word, are not intended to exclude other technical features, additives,
components, or steps. Furthermore, the word "comprise" encompasses the
case of "consisting of". Additional objects, advantages and features of the
invention will become apparent to those skilled in the art upon examination of
the description or may be learned by practice of the invention. The following
examples are provided by way of illustration, and they are not intended to be
limiting of the present invention. Furthermore, the present invention covers
all
possible combinations of particular and preferred embodiments described
herein.
EXAMPLES
Example 1.Tumor samples and patients
There was performed a proof-of-concept approach to study and characterize
the presence of heterogeneous mutations emerging after cetuximab-based
therapy in routine clinical practice. All mCRC consenting patients treated
with
anti-EGFR moAb at Parc de Salut Mar Biobank (MARBiobanc, Barcelona,
Spain) Hospital del Mar institution between January 2010 and June 2013 were
included in this study. In 34 patients the specimens were prospectively
collected for this study and in 3 patients there were analyzed sequential
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
28
biopsies taken in the past in the context of their routine clinical
management.
In the analysis, there were only included patients that had good quality
paired
pre- and post- treatment biopsies and that had acquired resistance to anti-
EGFR based-therapy defined as progression disease following a) complete
response or partial response orb) stable disease for more than 16 weeks (7-
9). Response was evaluated according to the Response Evaluation Criteria in
Solid Tumors (RECIST)(Eisenhauer et al., "New response evaluation criteria
in solid tumours: revised RECIST guideline (version 1.1)", Eur J Cancer 2009,
Vol. 45(2):228-247). Tumoral biopsy obtained during the regular diagnosis
procedure was used as the pre-treatment (initial) sample. In most cases this
sample was obtained from the primary tumor during routine colonoscopy. A
second initial biopsy from a metastatic site is not routine and was not
performed unless necessary for pathologic diagnosis. The study included re-
biopsy following treatment failure in patients that consented to this extra
procedure. Re-biopsies at the time of progression were obtained from the
most accessible lesion with less potential risk of related complications for
the
patient according to ethical considerations. Serum samples were collected
before starting the cetuximab- based therapy and at the time of progression.
When a mutation was detected in the post-treatment biopsy sample, the
serum sample from that same patient was analyzed for that specific mutation.
In this study, there are included nine cases (patients #21 to #28 and patient
#36) that had been previously assessed for EGFR S492R, KRAS exon 2,
BRAF V600E and PIK3CA mutations by direct sequencing and that in the
current work were analyzed for the mutations reported above (R451C and
K467T) using deep-sequencing technology. Biological samples were obtained
from Parc de Salut Mar Biobank (MARBiobanc). This study was approved by
the local Ethics Board (CEIC-2012/4741/I). All participating patients signed
written informed consent.
For the KRAS, BRAF, NRAS, PIK3CA and EGFR sequencing, DNA extraction
from tumoral samples was performed as previously described by Diaz et al.
"The molecular evolution of acquired resistance to targeted EGFR blockade in
colorectal cancers", Nature-2012, Vol No. 486, pp.:537-40. Mutational analysis
of KRAS (exons 2, 3 and 4), BRAF (exon15), NRAS (exons 2 and 3), PIK3CA
(exons 9 and 20) and EGFR (exon 12, 13) was performed by Sanger
sequencing using BigDye v3.1 (Applied Biosystems, Foster City, CA) following
the manufacturer's instructions and analyzed on a 35000x Genetic Analyzer
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
29
(Applied Biosystems). All cases were also screened by pyrosequencing using
a Next Generation Sequencing (NGS) 454 GS Junior platform (Roche Applied
Science, Mannheim, Germany). Moreover, processed and quality-filtered
reads were analyzed using the GS Amplicon Variant Analyzer software
version 2.5p1 (Roche). Mutations detected by NGS were confirmed by
competitive allele-specific TaqMan PCR (CAST-PCR, Applied Biosystems)
when specific assays were available.
Primers for EGFR sequences were those disclosed above and defined by the
set of primers consisting in SEQ ID NOs: 6 and 7. The pair of SEQ ID NO: 6
and SEQ ID NO: 7 served for amplifying entirely exon 12 that could contain
mutations R451C and K467T, and some intron flanking regions. This
sequence is represented by SEQ ID NO: 11:
caaagifitcagqg ata cattgtttttatattttca ccacatg
atttttcttctctccaatgtagTGGTCAGTTT
TCTCTTGCAGTCGTCAGCCTGAACATAACATCCTTGGGATTACGCTCCCT
CAAGGAGATAAGTGATGGAGATGTGATAATTTCAGGAAACAAAAATTTGT
GCTATGCAAATACAATAAACTGGAAAAAACTGITTGGGACCTCCGGTCAG
AAAACCAAAATTATAAGCAACAGAGGTGAAAACAGCTGCAgtaagtcaccgcttt
ctgtttagtttatggagttgglictaatgggtcctttatttgtatttagaatattgaagggctattcccatttaa;
wherein underwritten nucleotides correspond to the sequences identical (for
SEQ ID NO: 6) or complementary (for SEQ ID NO: 7) to the primers of the set,
capital letters relate to exon 12 and non-capital are intron fragments.
Amplification was performed under the following conditions: 95 C for 10
minutes ; 40 cycles of 95 C, 1 minute, 60 C, 1' 30" and 72 C 1 minute; and a
final extension of 10 minutes at 72 C.
Besides, it was performed a Fluorescence in situ Hybridization (FISH). FISH
was performed whenever there was sufficient remaining material following
analysis of mutations. Amplification of EGFR was assessed by fluorescent in
situ hybridization (FISH) using the LSI EGFR/CEP7 probe (Abbott Molecular
Inc., DesPlaines, IL), as previously described (for example in document such
as Salido et al., "Increased ALK gene copy number and amplification are
frequent in non-small cell lung cancer", J Thorac Oncol - 2011, Vol. No. 6,
pp.:21-7). KRAS amplification was analyzed using a dual colour FISH assay
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
with KRAS/CEP12 probe (Abnova). Samples with a ratio KRAS/CEP12
greater than 3, in at least 10% 01 50 analysed nuclei were scored. When the
average number of chromosome 12 exceeded 2.5 or 4 per cell, the case was
considered polysomic or high-polysonnic respectively.
5
Example 2. Presence of R451C and K467T EGFR mutations and acquired
resistance to cetuximab
As depicted in FIG 1, which is a plot of two different displays of a Next
10 Generation Sequencing (NGS) 454 GS Junior platform (Roche Applied
Science, Mannheim, Germany), shows that some patients acquired mutations
in EGFR ectodomain following treatment with cetuximab. FIG. 1 (A) shows a
patient #31, in which the post-treatment tumor sample had acquired an A -> C
substitution at nucleotide 1400 of EGFR gene that was not present in the pre-
15 treatment biopsy, causing a substitution of a lysine to a threonine at
amino
acid 467 (K467T). The substitution is detected by the genotyping method and
visualized (arrow) by means of a double pick (band or curve) in this position.
Lower pick corresponded to the C nucleotide.
20 On the other side, in FIG. 1(B) it is shown the display of the
sequencing
process (Read minus the Reference) from patient #35, in which a C -> T
substitution at nucleotide 1351 of the EGFR gene was detected in the post-
treatment sample, leading to a substitution of a arginine to a cysteine at
amino
acid 451 (R451C). Substitution is also marked with an arrow and in this case
25 the change is visualized by a negative value.
Example 3. Mutations in SEQ ID NO: 12 (fragment from amino acid 450 to
amino acid 470 of SEQ ID NO: 2) involve resistance to cetuximab
30 treatment.
3A: EGFR ectodomain mutations and acquired resistance to cetuximab
in CRC cell models
It was previously reported that acquisition of resistance in CRC cells is
associated with emergence of KRAS, BRAF and NRAS activating mutation..
To discover additional mechanisms of resistance to EGFR blockade 5 CRC
CA 02954952 2017-01-12
WO 2016/015788 PCT/EP2014/079477
31
cell lines were exploited (DiFi, LIM1215, HCA-46, NCIH508, OXCO-2 and
CCK81), which are highly sensitive to cetuximab. All these cell lines are wild
type for KRAS, NRAS, BRAF and PIK3CA with the exception of NCIH508,
which displays the p.E545K PIK3CA mutation. Altogether, these cell models
recapitulate the molecular features of tumors from CRC patients likely to
respond to anti EGFR therapies. For each line, at least five million cells
were
exposed continuously to cetuximab until resistant populations emerged. To
define molecular mechanisms underlying acquisition of resistance, it was
initially performed Sanger sequencing of genes involved in regulation of the
EGFR signalling pathway (EGFR, KRAS, BRAF, NRAS, and PIK3CA). In
accordance with previous reports, resistant populations often displayed KRAS,
BRAF and NRAS mutations (See Misale et al. "Blockade of egfr and mek
intercepts heterogeneous mechanisms of acquired resistance to anti-egfr
therapies in colorectal cancer", Sci Transl Med- 2014;6:224ra226). All of
these alleles were detected in the resistant cells but not in the
corresponding
parental population from which they originated. Importantly, in several
occasions multiple genetic alterations were concomitantly present in the
resistant cell population indicating their polyclonal status. To assess the
molecular features of individual clones it was therefore performed limited
cell
dilutions of LIM1215 and CCK81 as these cell lines are amenable to this
procedure. Single clones were then subjected to Sanger sequencing for
candidate genes (EGFR, KRAS, BRAF, NRAS, and PIK3CA). Notably,
mutation profiling of clones identified three novel EGFR variants: S464L,
G465R and I491M. Mutations S464L, G465R, together with mutations of
Example 2 (R541C and K4671) are located in SEQ ID NO: 12 (a fragment
defining part of the cetuximab binding epitope). Considering that the
resistant
derivatives are polyclonal, and in light of the limited sensitivity of the
Sanger
sequencing method, it was postulated that variants present in less than 20%
of the cell populations might have remained undetected. To identify mutations
present at low frequency it was employed droplet digital PCR (ddPCR) which
is known to have a mutant/wild type sensitivity of 1:20000. ddPCR probes
were designed and individually validated using control mutant DNA to detect
EGFR variants previously identified in tumor biopsy or cell lines. This
analysis
unveiled the presence 3 new EGFR variants (5464L, G465R, and I491M) that
were not detected by Sanger sequencing in resistant cell populations. ddPCR
could not be performed in tissue samples because there was no sufficient
material left. Overall, the mutational landscape of cell lines with acquired
32
resistance to cetuximab, recapitulate the molecular profiles of tumors that
relapsed upon cetuximab treatment.
ddPCRTM Supermix for Probes (Bio-RadTM) using KRAS, NRAS, BRAF and
EGFR assay (PrimePCRTM ddPCRTM Mutation Assay, Bio-Rad and custom
designed). ddPCR was performed according to manufacturer's protocol and
the results reported as percentage or fractional abundance of mutant DNA
alleles to total (mutant plus wild type) DNA alleles. 8 to 10 pl of DNA
template
was added to 10 pl of ddPCRTM Supermix for Probes (Bio-Rad) and 2 pl of the
primer/probe mixture. This 20 pl sample was added to 70 pl of Droplet
Generation Oil for Probes (Bio-Rad) and used for droplet generation. Droplets
were then thermal cycled with the following conditions: 5 minutes at 95 C, 40
cycles of 94 C for 30s, 55 C for 1 minute followed by 98 C for 10 minutes
(Ramp Rate 2 C/sec). Samples were then transferred to a QX200TM Droplet
Reader (Bio-Rad) for fluorescent measurement of FAM and HEX probes.
Gating was performed based on positive and negative controls, and mutant
populations were identified. Fractional Abundances of the mutant DNA in the
wild-type DNA background were calculated for each sample using QuantaSoft
software (Bio-Rad). Multiple replicates (minimum of four) were performed for
each sample. ddPCR analysis of normal control gDNA from cell lines and no
DNA template (water) controls were performed in parallel with all the samples,
including again multiple replicates as a contamination-free control.
EGFR probes and primers sequences are available upon request.
Cell culture and generation of resistant cells utilized herein has already
been
previously described (see Misale S et al. Emergence of KRAS mutations and
acquired resistance to anti-EGFR therapy in colorectal cancer. Nature.
2012;486:532-6; Misale S, Arena S et al Blockade of EGFR and MEK
intercepts heterogeneous mechanisms of acquired resistance to anti-EGFR
therapies in colorectal cancer. Sci Transl Med. 2014;6:224ra26). CCK81 cells
were cultured in MEM medium (Invitrogen) supplemented with 5 % FBS, 2mM
L-glutamine, antibiotics (100U/mL penicillin and 100 mg/mL streptomycin) and
grown in a 37 C and 5% CO2 air incubator. CCK81 cetuximab-resistant
derivatives were obtained by increasing the cetuximab dosage stepwise from
680 nM to 1.4 pM during the course of six months.
Date Recue/Date Received 2021-03-03
33
3B: Presence of S464L, G465R and K467T EGFR mutation and resistance
to cetuximab
To establish whether the S464L, G465R and K467T EGFR mutations of the
invention were responsible for the observed resistance to cetuximab, full-
length wild-type EGFR and any of the S464L, G465R or K467T EGFR
mutations were ectopically expressed in cultured NIH3T3 mouse embryonic
fibroblast cell line that lack detectable endogenous EGFR expression.
EGFR was stimulated with its natural ligand EGF in the presence of cetuximab
or panitumumab in transfected cells. Antibody binding was analyzed by flow
cytornetry using a secondary antibody to human IgG conjugated with
phycoerythrin (PE). NIH 3T3 cells expressing the empty vector were used as a
negative control (EMPTY). The percentage of cells binding to the antibody are
shown in the two-dimensional dot plots of FIGs. 2-4. In this FIGs. 2-4, cell
counts (C of "counts",Y-axis) in the FL2H channel of the fluorescence
detection are plotted for the assay with cetuximab (FIG. 2 A, 3A and 4A) and
for the assay with panitumumab (FIG. 2B, 3B and 4B).
In wild-type EGFR cells (EGFRWT in FIGs. 2-4 NB), both cetuximab and
panitumumab inhibited EGFR activation, whereas in cells carrying the K467T
mutation (EGFR K467T in FIG. 2 A/B), S464L (EGFR S464L in FIG. 3 NB)
and G465R (EGFR_G465R in FIG. 4 NB) panitumumab, but not cetuximab,
effectively blocked EGF-induced EGFR activation. EMPTY is the negative
control (EGFR non-expressing cells)
For the DNA constructs, the pLX301-EGFR WT construct, a generous gift
from Dr. C. Sun and Prof R. Bernards (NKI, Amsterdam), was constructed
from pLX301 (Addgene0). EGFR mutants containing the 4 point mutations
(R451C, S464L, G465R, and K467T) were constructed using the
QuikChange0 II site-directed nnutagenesis kits from AgilentTM Technologies
with
pLX301-EGFR WT plasmid as the template DNA. The presence of mutations
was confirmed by DNA sequencing.
REFERENCES CITED IN THE APPLICATION
- Mendelsohn J, Baselga J et al., "Epidermal growth factor receptor
targeting in cancer". Semin Oncol - 2006, Vol. 33, pp.: 369-38.
Date Recue/Date Received 2021-03-03
CA 02954952 2017-01-12
WO 2016/015788
PCT/EP2014/079477
34
- Lynch TJ et al., "Activating mutations in the epidermal growth factor
receptor underlying responsiveness of non-small-cell lung cancer to
gefitinib", N Engl J Med-2004, Vol. 350, pp:2129-2139.
- Misale et al., "Emergence of KRAS mutations and acquired resistance
to anti-EGFR therapy in colorectal cancer", Nature ¨2012, Vol. No.
486, pp.: 532-536.
- Montagut et al., "Identification of a mutation in the extracellular
domain
of the Epidermal Growth Factor Receptor conferring cetuximab
resistance in colorectal cancer", Nature medicine -2012, Vol. No. 18,
pp.:221-223.
- Voigt et al., "Functional Dissection of the Epidermal Growth Factor
Receptor Epitopes Targeted by Panitunnunnab and Cetuxinnab",
Neoplasia ¨2012, Vol. No. 14(11), pp.: 1023-1031.
- Karapetis et al., "K-ras Mutations and Benefit from Cetuximab in
Advanced Colorectal Cancer", The New England Journal of Medicine -
2008, Vol. 359, pp.: 1757-1765.
- Eisenhauer et al., "New response evaluation criteria in solid tumours:
revised RECIST guideline (version 1.1)", Eur J Cancer 2009, Vol.
45(2):228-247.
- Salido et al., "Increased ALK gene copy number and amplification are
frequent in non-small cell lung cancer", J Thorac Oncol - 2011, Vol. No.
6, pp.:21-7.
- Diaz et al. "The molecular evolution of acquired resistance to targeted
EGFR blockade in colorectal cancers", Nature-2012, Vol No. 486,
pp.:537-40.
- Misale et al. "Blockade of egfr and mek intercepts heterogeneous
mechanisms of acquired resistance to anti-egfr therapies in colorectal
cancer", Sci Transl Med- 2014;6:224ra226.
