Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
1
Title: Use of a non-structural protein from PRV to protect against heart and
skeletal
muscle inflammation
The present invention relates to the field of protection against heart and
skeletal muscle
inflammation (HSMI) disease in fish. More specifically the present invention
relates to the
protection of HSMI caused by Piscine orthoreovirus (PRV). More specifically
the invention
relates to the use of the non-structural proteins from PRV. In particular the
invention relates to
the use of the non-structural protein from PRV to protect against heart and
skeletal muscle
inflammation caused by an infection of PRV.
Background
Heart and skeletal muscle inflammation (HSMI) is an important disease in
farmed salmonids.
Salmonids includes salmon, trout, chars, freshwater whitefishes and graylings.
HSMI usually
occurs 5-9 months after transfer of the fish to seawater, and is characterized
by epi-, endo- and
myocarditis, myocardial necrosis, myositis and necrosis of the red skeletal
muscle. The
cumulative mortality may reach 20%, but the morbidity is higher as most fish
in an affected sea
cage show histopathological lesions in the heart.
Piscine orthoreovirus (PRV) is the causative agent of heart and skeletal
muscle inflammation
(HSMI) in farmed salmon. HSMI causes significant economic losses to the salmon
aquaculture
industry, and there is currently no vaccine available. PRV is an orthoreovirus
in the family
Reovirus. The PRV genome is predicted to encode at least 12 primary
translation products
where putative functions are assigned (Table 1) based upon sequence homology
to mammalian
reovirus (MRV), avian orthoreovirus (ARV) and grass carp reovirus (GCRV).
Table 1:
Protein Length (aa) Weight (kDa) Putative function
A3 1286 145 RNA-dependent RNA polymerase
A2 1290 144 Guanylyltrasferase, methyhyltransferase
Al 1282 142 Helicase; NTPase, RNA triphosphatase
p2 760 86 NTPase, RNA triphosphatase, RNA
binding
p1 687 74 Outer capsid protein
pNS 752 84 Non-structural protein
a3 330 37 Outer capsid protein
FAST 124 13 Transmembrane protein
a2 420 46 Inner capsid protein
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
2
p8 71 11 Inner capsid protein
aNS 354 39 Non-structural protein
al 315 35 Cell attachment protein
Structural proteins are outer capsid proteins al, a3, A2, plc and inner capsid
proteins Al, a2,
p2, and A3.The non structural proteins aNS and pNS are RNA binding protein
that are thought
to be involved in assembling the viral mRNA for viral genome replication.
W02011/041789 discloses the Piscine reovirus (PRV), and isolated nucleic acids
sequences
and peptides thereof. It describes schematically a method for generating
antibodies against
structural proteins al, a2, a3, p1 and FAST in rabbits. Antiserum from
immunised rabbits
recognised p1, a2, a3, protein in immunohistochemistry of hearts from salmon
with HSMI. It
was said that the serum against the p1 protein worked best and gave a good
signal to noise
ratio in immunohistochemistry. In W02011/041789 the cell attachment protein is
denoted
a2,however function, length and weight are of al.
W02011/041789 describes that the PRV nucleic sequences and the PRV encoded
proteins
may be useful for generation of antibodies and generation of vaccine against
Piscine reovirus
and screening for drugs effective against Piscine reovirus.
Generation of antibodies against certain structural proteins were described,
however no
description of any vaccine comprising any of the PRV non structural proteins
and nucleic acids
encoding these was disclosed, nor any experimental data with such a vaccine
was disclosed in
W02011/041789.
EP 3039128 discloses an ex vivo method for propagating and isolating
orthoreoviruses using
nucleated erythrocytes, such as nucleated piscine erythrocytes. EP 3039128
discloses that
when the orthoreovirus obtained by the method is piscine reovirus (PRV), a
vaccine
composition comprising an inactivated PRV virus may be used for the treatment
and/or
prevention of Heart and Skeletal Muscle Inflammation (HSMI).
None of the above described studies show any effect against HSMI.
Non-structural proteins pNS and aNS have been found to be involved in
disrupting the innate
immune response to infection. Carroll et al (Virology 448(2014)133-145) and
Choudhury et al (J
Virol 91:e01298-17.) found that pNS and aNS prevent Stress Granules (SG)
formation. SGs
are a component of the innate immune response to virus infection, and
modulation of SG
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
3
assembly is a common mechanism employed by viruses to counter this antiviral
response. In
addition, Stanifer et al (Scientific Reports 7, Article number: 10873 (2017))
demonstrated that
pNS is solely responsible for sequestering interferon regulatory factor 3
(IRF3) thereby
impairing the interferon-mediated antiviral immune response. The authors
hypothesize that the
pNS protein actively participates in immune evasion.
Using the non-structural protein in a vaccine composition showed that after
challenge with the
virus, viral RNA was somewhat reduced when compared to control compositions
but the viral
RNA levels were still at a high level. It was therefore surprising that
histopathology data showed
that the vaccines comprising the non-structural proteins had an effect on the
heart muscle
inflammation.
Summary of the Invention
The present invention is directed to PRV non-structural protein as subunit for
use in treatment of
fish against heart and skeletal muscle inflammation (HSMI) disease. Also, the
present invention
is directed to PRV non-structural protein as subunit for use in protecting
fish against heart and
skeletal muscle inflammation (HSMI) disease. The PRV non-structural protein is
in the form of
subunit composition, which means that the use of the whole virus is excluded.
The present invention is further directed to treatment of fish against heart
and skeletal muscle
inflammation (HSMI) disease by using a PRV non-structural protein. The present
invention is
further directed to protecting fish against heart and skeletal muscle
inflammation (HSMI)
disease by using a PRV non-structural protein.
Suitably the PRV non-structural protein is pNS or aNS. The use of a
combination of pNS and
aNS is also contemplated..
In a certain embodiment of the invention and/or embodiments thereof the PRV
non-structural
protein is a polypeptide having a sequence having at least about 70% identity
to any one of
SEQ ID NO: 12 or 13. Suitably the PRV non-structural protein has at least
about 72%, about
75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about
98%, about
99% or about 99.5% identity to any one of SEQ ID NO: 12 or 13. Suitably, the
PRV non-
structural protein is a polypeptide having at least 50 consecutive amino acids
of a polypeptide
having a sequence having at least about 70% identity to any one of SEQ ID NO:
12 or 13.
In a certain embodiment of the invention and/or embodiments thereof the
treatment or
protection treatment comprises administering to a fish a composition
comprising a polypeptide
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
4
of the PRV non-structural protein of the present invention and/or embodiments
thereof. Suitably
the polypeptide has at least 50 consecutive amino acids of polypeptide having
a sequence
having at least about 70% identity to any one of SEQ ID NO: 12 or 13. In a
certain embodiment
of the invention and/or embodiments thereof the treatment comprises
administering to a fish a
composition comprising a polypeptide having a sequence having at least about
72%, about
75%, about 77%, about 78%, about 80%, about 85%, about 90%, about 95%, about
98%, about
99% or about 99.5% identity to any one of SEQ ID NO: 12 or 13.
In another aspect the invention is directed to a polynucleotide encoding the
PRV non-structural
protein as defined herein for use in treatment in fish against heart and
skeletal muscle
inflammation disease. Preferably the polynucleotide encodes for a PRV non-
structural protein
as a subunit protein.
In another embodiment of the invention and/or embodiments thereof the
treatment comprises
administering to fish a composition comprising a polynucleotide encoding a PRV
non-structural
protein as defined herein. Suitably the polynucleotide encoding a PRV non-
structural protein is
a polynucleotide having a sequence having at least about 70% identity to any
one of SEQ ID
NO: 14 or 15.Suitably the polynucleotide encoding the PRV non-structural
protein is a
polynucleotide having a sequence having at least about 72%, about 75%, about
77%, about
78%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or about
99.5%
identity to any one of SEQ ID NO: 14 or 15.
In a certain embodiment of the invention and/or embodiments thereof the
treatment or
protection treatment comprises administering to a fish a composition
comprising a vector
encoding a PRV non-structural protein as defined herein. Suitably the vector
comprises a
polynucleotide encoding a PRV non-structural protein as defined herein.
Suitably, the vector
encodes for a PRV non-structural protein according to the invention and/or
embodiments
thereof. Suitably, the vector is an expression vector which encodes the PRV
non-structural
protein, preferably the vector is a DNA vector, replicon vector, a viral
vector, or a plasmid,
preferably a DNA vector or a plasmid.
In yet another embodiment of the invention and/or embodiments thereof, the
treatment or
protection comprises additionally administering to a fish at least one PRV
structural protein
selected from the group comprising Al, A2, A3, p1, p2, al, a2, and a3.
Suitably, at least one of
the outer capsid proteins al, a2, and/or a3 are additionally administered.
Preferably, al, is
additionally administered. . Preferably, p2, is additionally administered.
Suitably the PRV
structural protein is administered as a polypeptide. In another embodiment, at
least one
polynucleotide encoding a PRV structural protein selected from the group
comprising Al, A2, A3,
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
p1, p2, al , a2, and a3 is additionally administered. In another embodiment a
vector encoding at
least one PRV structural protein selected from the group comprising Al, A2,
A3, p1, p2, al, a2,
and a3 is additionally administered.
Suitably, the fish is a salmonid.
Another aspect of the invention relates to a vector, wherein the vector
comprises at least a
promoter sequence and polynucleotide sequence that encodes for a PRV non-
structural protein.
Suitably the polynucleotide sequence encodes for a PRV non-structural protein
as defined
herein.
Another aspect of the invention relates to a vaccine comprising a vector
comprising DNA-
encoding sequence that encodes for a PRV non-structural protein.
Suitably, the vector according to the invention and/or embodiments thereof
further comprises
transcription or translation enhancing sequences. The vector of the invention
and/or
combination thereof may comprise two polynucleotide sequences that each
encodes for a
different PRV non-structural protein. Suitably, the polynucleotide sequence
that encodes for a
PRV non-structural protein encodes for pNS and/or aNS. Suitably the
polynucleotide sequence
that encodes for a PRV non-structural protein comprises a nucleotide sequences
that is at least
70% identical to any of the sequences SEQ ID NO: 14 or 15, or comprises a
nucleotide
sequences that is at least 70% identical to a nucleotide sequence that encodes
for a
polypeptide having any of the sequences SEQ ID NO: 12 or 13. Suitably the DNA-
encoding
sequence that encodes for a PRV non-structural protein encodes for any of the
PRV non-
structural protein, or fragment thereof as defined in the present invention.
In another aspect the invention relates to a vaccine composition comprising a
vector according
to the invention and/or any embodiments thereof.
In another aspect the invention relates to a vaccine composition comprising a
PRV non-
structural protein as defined herein as a subunit.
Suitably a vaccine of the present invention and/or embodiments thereof is used
in a treatment
or protection of fish against heart and skeletal muscle inflammation disease.
Detailed description
Definitions
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
6
As used herein, PRV polypeptide is a polypeptide from a PRV non-structural
protein. It may be
the whole protein or a fragment thereof. PRV polypeptide and PRV non-
structural protein are
used interchangeably.
As used herein, PRV polynucleotide is a polynucleotide that encodes for a PRV
non-structural
protein or a PRV polypeptide.
As used in the specification and the appended claims the term "treatment" is
to be understood
as bringing a body from a pathological state back to its normal, healthy state
or preventing a
pathological state. The latter may be denoted as "prophylactic treatment".
Treatment is meant to
cover protection against a pathological state. Treatment also means to have a
reduction in
pathological changes when compared to individuals that have not been treated.
Suitably, there
is at least a reduction of 10% in pathological changes, more preferably, at
least a reduction of
25%, 20%, 25%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or even a
100% in pathological changes when compared to individuals that have not been
treated.
The term "pharmaceutically acceptable carrier" is intended to include
formulation used to
stabilize, solubilize and otherwise be mixed with active ingredients to be
administered to living
animals, including fish. This includes any and all solvents, dispersion media,
coatings,
antibacterial and antifungal agents, isotonic and absorption delaying agents,
and the like,
compatible with pharmaceutical administration.
The term "disease" as used herein is intended to be generally synonymous, and
is used
interchangeably with, the terms "disorder" and "condition" (as in medical
condition), in that all
reflect an abnormal condition of the body or of one of its parts that impairs
normal functioning
and is typically manifested by distinguishing signs and symptoms.
Heart and skeletal muscle inflammation (HSMI) was first diagnosed in 1999, and
there has
since been a yearly increase in the number of recorded outbreaks. Atlantic
salmon are
commonly affected 5 to 9 month after transfer to sea, but outbreaks have been
recorded as
early as 14 d following seawater transfer. Affected fish are anorexic and
display abnormal
swimming behaviour. Autopsy findings typically include a pale heart, yellow
liver, ascites,
swollen spleen and petechiae in the perivisceral fat. HSMI is diagnosed on the
basis of
histopathology. The major pathological changes occur in the myocardium and red
skeletal
muscle, where extensive inflammation and multifocal necrosis of myocytes are
evident. HSMI is
characterized by epi-, endo- and myocarditis, myocardial necrosis, myositis
and necrosis of the
red skeletal muscle. Most notably the epicarditis and myocarditis characterise
the disease.
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
7
Although field observations have suggested that surviving fish in affected sea
cages may
recover, non-lethal outbreaks are still considered a significant problem in
salmon farming due
to poor growth and general performance of fish following infection
As used herein, subunit protein means an isolated protein of a pathogen such
as a specific
protein. In the present invention subunit protein means an isolated specific
protein from PRV.
More than one subunit protein may be used in the present invention, but always
as an isolated
protein and not in the form of a virus, whole or otherwise. Also combination
of subunit proteins
are contemplated, but not in the form of a virus, whole or otherwise. Usually
a subunit protein is
a recombinant protein. The subunit protein may be used in a subunit vaccine.
A subunit vaccine as used herein presents an antigen to the immune system
without introducing
viral particles, whole or otherwise. One method of production involves
isolation of a specific
protein from a virus and administering this by itself, or a recombinant method
of producing a
specific protein.
By "vector" is meant any genetic element, such as a plasmid, phage,
transposon, cosmid,
chromosome, virus, replicon particle virion, etc., which is capable of
expressing DNA sequences
contained therein, where such sequences are operatively linked to other
sequences capable of
effecting their expression.. Thus, the term includes cloning and expression
vehicles, as well as
viral vectors. The term vector is given here a functional definition, and any
DNA sequence which
is capable of effecting expression of a specified DNA sequence disposed
therein is included in
this term as it is applied to the specified sequence. In general, vectors of
utility in recombinant
DNA techniques are often in the form of "plasmids" referred to as circular
double stranded DNA
loops which, in their vector form, are not bound to the chromosome.
"Replicon" means any nucleotide sequence or molecule which possesses a
replication origin
and which is therefore potentially capable of being replicated in a suitable
cell.
By "recombinant virus" is meant a virus that has been genetically altered,
e.g., by the addition or
insertion of the coding sequence as defined herein into the particle.
The terms DNA "control sequences" and "control elements" refer collectively to
promoter
sequences, polyadenylation signals, transcription termination sequences,
upstream regulatory
domains, origins of replication, internal ribosome entry sites ("IRES"),
enhancers, and the like,
which collectively provide for the replication, transcription and translation
of a coding sequence
in a recipient cell. Not all of these control sequences/elements need always
be present so long
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
8
as the selected coding sequence is capable of being replicated, transcribed
and translated in an
appropriate host cell.
"Operably linked" refers to an arrangement of elements wherein the components
so described
are configured so as to perform their usual function. Thus, control sequences
operably linked to
a coding sequence are capable of effecting the expression of the coding
sequence. The control
sequences need not be contiguous with the coding sequence, so long as they
function to direct
the expression thereof. Thus, for example, intervening untranslated yet
transcribed sequences
can be present between a promoter sequence and the coding sequence and the
promoter
sequence can still be considered "operably linked" to the coding sequence.
The term "identical" or "identity" means that two nucleic acid sequences or
two amino acid
sequences are identical (i.e., on a nucleotide-by-nucleotide basis or amino
acid-by-amino acid
basis) over the window of comparison. The term "percentage of sequence
identity" is calculated
by comparing two optimally aligned sequences over the window of comparison,
determining the
number of positions at which the identical nucleic acid base or amino acid
occurs in both
sequences to yield the number of matched positions, dividing the number of
matched positions
by the total number of positions in the window of comparison (i.e., the window
size), and
multiplying the result by 100 to yield the percentage of sequence identity.
The terms "substantial
identity" as used herein denotes a characteristic of a polynucleotide sequence
or polypeptide
sequence, wherein the polynucleotide comprises a sequence that has at least 70
percent
sequence identity, preferably at least 80 percent identity and often 90 to 95
percent sequence
identity, more usually at least 99 percent sequence identity as compared to a
reference
sequence over a comparison window of at least 20 nucleotide positions or amino
acid positions.
Alignment tools to determine the sequence identity are well known to a skilled
person, such as
BLAST (Altschul et al , Nucleic Acids Res. 1997;25:3389-3402) and FASTA
(Pearson and
Lipman. Natl. Acad. Sci. USA. 1988;85:2444-2448).
Conservative amino acid substitutions refer to the interchangeability of
residues having similar
side chains. For example, a group of amino acids having aliphatic side chains
is glycine,
alanine, valine, leucine, and isoleucine; a group of amino acids having
aliphatic-hydroxyl side
chains is serine and threonine; a group of amino acids having amide-containing
side chains is
asparagine and glutamine; a group of amino acids having aromatic side chains
is
phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic
side chains is
lysine, arginine, and histidine; and a group of amino acids having sulfur-
containing side chains
is cysteine and methionine. Preferred conservative amino acids substitution
groups are: valine-
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
9
leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine,
and asparagine-
glutamine.
As used herein, the terms "protecting" or "providing protection to" and "aids
in the protection" do
not require complete protection from any indication of infection. For example,
"aids in the
protection" can mean that the protection is sufficient such that, after
challenge, symptoms of the
underlying infection are at least reduced, and/or that one or more of the
underlying cellular,
physiological, or biochemical causes or mechanisms causing the symptoms are
reduced and/or
eliminated. It is understood that "reduced," as used in this context, means
relative to the state
of the infection, including the molecular state of the infection, not just the
physiological state of
the infection. Protecting against HSMI means that there is a reduction in
heart lesions.
Preferably there is at least a 10% reduction in heart lesions. More
preferably, there is at least
20%, 25,% 30%, 40%, 50%, 60%, 70% 75%, 80%, 85%, 90%, or even at 95% reduction
in
heart lesions compared to a fish that has been infected with PRV and not
treated with the non-
structural PRV proteins of the present invention. Preferably the heart lesion
is scored
histopathological changes. Preferably the histopathological changes are scored
from 0 to 4
using criteria described in Table 4A and 4B. Suitably, heart lesions in
consistence with HSMI,
are scored for epicardial and myocardial changes. Suitably protection means
that there is a
reduction in epicardial changes of at least 10% when compared to fish that are
infected with
PRV and have not been treated with the non-structural PRV proteins of the
present invention.
More preferably, there is at least 20%, 25,% 30%, 40%, 50%, 60%, 70% 75%, 80%,
85%, 90%,
or even at 95% reduction in epicardial changes when compared to fish that are
infected with
PRV and have not been treated with the non-structural PRV proteins of the
present invention.
Suitably there is a reduction in epicardial changes of between 100% and 20%,
more preferably
there is a reduction in epicardial changes of between 30% and 90%, more
preferably there is a
reduction in epicardial changes of between 35% and 85%, more preferably there
is a reduction
in epicardial changes of between 40% and 80%, more preferably there is a
reduction in
epicardial changes of between 45% and 75%, more preferably there is a
reduction in epicardial
changes of between 50% and 70%, more preferably there is a reduction in
epicardial changes
of between 55% and 65%.
Suitably protection means that there is a reduction in myocardial changes of
at least 10% when
compared to fish that are infected with PRV and have not been treated with the
non-structural
PRV proteins of the present invention. More preferably, there is at least 20%,
25,% 30%, 40%,
50%, 60%, 70% 75%, 80%, 85%, 90%, or even at 95% reduction in myocardial
changes when
compared to fish that are infected with PRV and have not been treated with the
non-structural
PRV proteins of the present invention. Suitably there is a reduction in
myocardial changes of
between 100% and 20%, more preferably there is a reduction in myocardial
changes of
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
between 30% and 90%, more preferably there is a reduction in myocardial
changes of between
35% and 85%, more preferably there is a reduction in myocardial changes of
between 40% and
80%, more preferably there is a reduction in myocardial changes of between 45%
and 75%,
more preferably there is a reduction in myocardial changes of between 50% and
70%, more
preferably there is a reduction in myocardial changes of between 55% and 65%.
The grade of changes was scored from 0 to 4 using criteria described in Table
4A and 4B
The present invention is directed to a treatment or protection of fish against
heart and skeletal
muscle inflammation (HSMI). HSMI may be caused by Piscine orthoreovirus (PRV).
It was surprisingly found that fish that were vaccinated with one or two PRV
non-structural
proteins were protected from heart muscle inflammation. The PRV non-structural
proteins
appear to have only a modest effect on viral load, but are very effective in
preventing HSMI after
infection with PRV.
The PRV non-structural protein of the present invention and/or embodiments is
a subunit
protein. The protein may be recombinantly produced with systems that are well
known to a
skilled person, such as with expression vectors in suitable cells, bacterial
expression systems,
eukaryotic expression system, such as yeast expression systems, baculovirus
system,
Filamentous fungi system, leishmania expression system, mammalian systems,
such as
Chinese Hamster ovary (CHO) or Human Embryonic Kidney (HEK) systems.
The present invention does not relate to the use of the whole virus.
The PRV non-structural protein may be pNS or aNS and also the use of a
combination of pNS
and aNS is contemplated. The amino acid sequence of pNS is SEQ ID NO: 12 and
the amino
acid sequence of aNS is SEQ ID NO: 13 (figure 1 and 2). In one embodiment of
the invention
and/or embodiments thereof, the PRV non-structural protein may be a
polypeptide fragment
comprising about 50 consecutive amino acids of a PRV non-structural protein
described herein.
In another embodiment, the PRV non-structural protein fragment may be a
polypeptide
comprising about 60 consecutive amino acids of a PRV non-structural
polypeptide described
herein. In another embodiment, the PRV non-structural protein fragment may be
a PRV non-
structural polypeptide comprising about 75 consecutive amino acids of a PRV
non-structural
protein described herein. In another embodiment, the PRV non-structural
protein fragment may
be a PRV non-structural polypeptide comprising about 90 consecutive amino
acids of a PRV
non-structural protein described herein. In another embodiment, the PRV non-
structural protein
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
11
fragment may be a polypeptide comprising about 100 consecutive amino acids of
a PRV non-
structural protein described herein. In another embodiment, the PRV non-
structural protein
fragment may be a polypeptide comprising about 120 consecutive amino acids of
a PRV non-
structural protein described herein. In another embodiment, the PRV non-
structural protein
fragment may be a polypeptide comprising about 150 or more consecutive amino
acids of a
PRV non-structural protein described herein.
In yet another embodiment of the invention and/or embodiments thereof, the PRV
non-structural
protein fragment may be a polypeptide comprising from about 50 to about 750,
about 60 to
about 700, about 70 to about 650, about 75 to about 600, about 80 to about
550, about 90 to
about 500, about 100 to about 450, about 120 to about 400, about 140 to about
350, about 150
to about 300, about 160 to about 250, about 170 to about 220, about 180 to
about 200 or more
consecutive amino acids of a PRV non-structural protein described herein.
In another embodiment of the invention and/or embodiments thereof the PRV non-
structural
protein is a polypeptide having a sequence having at least about 70% identity
to any one of
SEQ ID NO: 12 or 13. Suitably the PRV non-structural protein is a polypeptide
having a
sequence having at least about 72%, about 74%, about 75%, about 76%, about
78%, about
80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%, about
91%, about
92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about
99%,
identity to any one of SEQ ID NO: 12 or 13. More suitably the PRV non-
structural protein is a
polypeptide having a sequence having at least about 95.5%, about 96%, about
96.5%, about
97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about
99.9% identity
to any one of SEQ ID NO: 12 or 13.
In another embodiment of the invention and/or embodiments thereof the PRV non-
structural
polypeptide is encoded by a nucleic acid having a sequence having at least
about 70% identity
to any one of SEQ ID NOs: 14 or 15, or a fragment thereof.
In another embodiment of the invention and/or embodiments thereof the PRV
polypeptide is
encoded by a polynucleotide having a sequence having at least about 72%, about
74%, about
75%, about 76%, about 78%, about 80%, about 82%, about 84%, about 85%, about
87%, about
88%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about
96%, about
97%, about 98%, about 99%, identity to any one of SEQ ID NO: 14 or 15, or a
fragment thereof.
In one embodiment, the PRV polypeptide is encoded by a polynucleotide having a
sequence
having at least about 90%, about 95.5%, about 96%, about 96.5%, about 97%,
about 97.5%,
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
12
about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity to that
of any one of
SEQ ID NOs: 14 or 15, or a fragment thereof.
In a certain embodiment of the invention and/or embodiments thereof the
treatment or
protection comprises administering to a fish a composition comprising a
polypeptide of the PRV
non-structural protein as described herein. Suitably the PRV polypeptide has
at least 50
consecutive amino acids of a polypeptide having a sequence having at least 70%
identity to any
of SEQ ID NO: 12 or 13. Suitably the PRV polypeptide has an amino acids
sequence of any of
SEQ ID NO: 12 or 13.
In another embodiment of the invention and/or embodiments thereof the PRV
polypeptide or
PRV non-structural protein is encoded by a nucleic acid complementary to a PRV
polynucleotide sequence having a sequence having at least 70% identity to any
of SEQ ID NOs:
14 or 15, or a fragment thereof.
In another embodiment of the invention and/or embodiments thereof, the PRV
polynucleotide
has a length from about 150 to about 2200, about 200 to about 2000, about 250
to about 1800,
about 300 to about 1600, about 350 to about 1400, about 300 to about 1200,
about 400 to
about 1000, about 500 to about 900, about 600 to about 800, about 650 to about
750, or more
nucleotides.
In another embodiment of the invention and/or embodiments thereof the
treatment or protection
comprises administering to fish a composition comprising a polynucleotide
encoding the PRV
non-structural protein as defined herein. Suitably the polynucleotide encoding
the PRV non-
structural protein is a polynucleotide having a sequence having at least 70%
identity to any of
SEQ ID NO: 14 or 15. Suitably the polynucleotide encoding the PRV non-
structural protein is
polynucleotide having a sequence having at least about 72%, about 74%, about
75%, about
76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about
88%, about
90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about
98%, about 99%, identity to any one of any one of SEQ ID NO: 14 or 15.Suitably
the PRV
polynucleotide having a sequence having at least about 90%, about 95.5%, about
96%, about
96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%
or about
99.9% identity to any one of SEQ ID NO: 14 or 15.
In a certain embodiment of the invention and/or embodiments thereof the
treatment comprises
administering to fish a composition comprising a vector encoding the PRV non-
structural protein
as defined herein. Suitably the vector comprises a polynucleotide encoding the
PRV non-
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
13
structural protein as defined herein. Suitably, the vector encodes for a PRV
non-structural
protein according to the invention and/or embodiments thereof. Suitably, the
vector is an
expression vector. Suitable vectors are DNA vector, replicon vector, plasmid,
phage, or a viral
vector, preferably a DNA vector or plasmid. Suitably the vector is non-viral.
Suitably the vector is
an expression vector.
Suitably the treatment comprises the production of the PRV non-structural
protein in the cell of
the target animal. This may be accomplished by e.g. DNA vaccines. The internal
production of
proteins is often accomplished by using a suitable expression vector
comprising a suitable
promoter. A skilled person is well aware of suitable promoters, such as e.g.
the CMV promoter.
Suitably the vector of the present invention and/or embodiments thereof
comprises sequences
that optimise the expression in eukaryotic cells. The vectors may include
eukaryotic sequences
for performing transcription (sequences upstream of 5', promoters, intron-
processing signals)
and translation (polyadenylation signals) in eukaryotic cells.
In preferred embodiments, the PRV polynucleotide is administered as naked DNA.
The PRV non-structural protein of the invention can be administered by any
appropriate route of
administration that results in a protection against HSMI, for which the PRV
non-structural
protein will be formulated in a manner that is suitable for the chosen route
of administration. The
administration in the methods described herein may be oral administration,
immersion
administration or injection administration. Preferably the administration is
injection
administration. More preferably the administration is intramuscular injection.
In preferred embodiments the PRV polypeptide of the present invention may be
administered in
the presence of agents which enhance uptake of the PRV polypeptide by target
cells, such as
phospholipid formulation, e.g, a liposome.
In preferred embodiments the PRV polynucleotide or the vector of the present
invention is also
administered in the presence of agents which enhance uptake of the
polynucleotide or vector by
target cells, such as phospholipid formulation, e.g, a liposome, lipid
nanoparticles, polymeric
nanocarriers, or cationic dendrimers.
Suitable administration method for polynucleotides and/or vectors include
electroporation of.
polynucleotides and/or vectors.
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
14
In a suitable embodiment, the treatment of the invention and/or any
embodiments thereof is
useful to vaccinate a fish against heart muscle inflammation pathology caused
by infection of
PRV.
In a suitable embodiment, the treatment of the invention and/or any
embodiments thereof is
useful to protect a fish against heart muscle inflammation pathology caused by
infection of PRV.
In a suitable embodiment, the treatment or protection of the invention and/or
any embodiments
thereof does not comprise PRV as a whole virus, live, killed or otherwise.
In yet another embodiment of the invention and/or embodiments thereof, the
treatment
comprises additionally administering to a fish a PRV structural protein
selected from the group
comprising Al, A2, A3, p1, p2, al, a2, and a3. Suitably, the outer capsid
proteins al , a2, and/or
a3 are additionally administered. Preferably, al, is additionally
administered. Preferably, p2, is
additionally administered
Also contemplated is the administration of a polynucleotide encoding at least
one of the PRV
structural protein selected from the group comprising Al, A2, A3, p1, p2, G1,
a2, and a3.
Suitably an expression vector encoding the PRV structural protein selected
from the group
comprising Al, A2, A3, p1, p2, G1, a2, and a3 is used.
In preferred embodiment the PRV structural protein may be p2 or al and also
the use of a
combination of p2 and al is contemplated. The amino acid sequence of p2 is SEQ
ID NO: 18
and the amino acid sequence of al is SEQ ID NO: 16. In one embodiment of the
invention
and/or embodiments thereof, the PRV structural protein may be a polypeptide
fragment
comprising about 50 consecutive amino acids of a PRV structural protein
described herein. In
another embodiment, the PRV structural protein fragment may be a polypeptide
comprising
about 60 consecutive amino acids of a PRV structural polypeptide described
herein. In another
embodiment, the PRV structural protein fragment may be a PRV structural
polypeptide
comprising about 75 consecutive amino acids of a PRV structural protein
described herein. In
another embodiment, the PRV structural protein fragment may be a PRV
structural polypeptide
comprising about 90 consecutive amino acids of a PRV structural protein
described herein. In
another embodiment, the PRV structural protein fragment may be a polypeptide
comprising
about 100 consecutive amino acids of a PRV structural protein described
herein. In another
embodiment, the PRV structural protein fragment may be a polypeptide
comprising about 120
consecutive amino acids of a PRV structural protein described herein. In
another embodiment,
the PRV structural protein fragment may be a polypeptide comprising about 150
or more
consecutive amino acids of a PRV structural protein described herein.
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
In yet another embodiment of the invention and/or embodiments thereof, the PRV
structural
protein fragment may be a polypeptide comprising from about 50 to about 750,
about 60 to
about 700, about 70 to about 650, about 75 to about 600, about 80 to about
550, about 90 to
about 500, about 100 to about 450, about 120 to about 400, about 140 to about
350, about 150
to about 300, about 160 to about 250, about 170 to about 220, about 180 to
about 200 or more
consecutive amino acids of a PRV structural protein described herein.
In another embodiment of the invention and/or embodiments thereof the PRV
structural protein
is a polypeptide having a sequence having at least about 70% identity to any
one of SEQ ID
NO: 16 or 18. Suitably the PRV structural protein is a polypeptide having a
sequence having at
least about 72%, about 74%, about 75%, about 76%, about 78%, about 80%, about
82%, about
84%, about 85%, about 87%, about 88%, about 90%, about 91%, about 92%, about
93%, about
94%, about 95%, about 96%, about 97%, about 98%, about 99%, identity to any
one of SEQ ID
NO: 16 or 18. More suitably the PRV structural protein is a polypeptide having
a sequence
having at least about 95.5%, about 96%, about 96.5%, about 97%, about 97.5%,
about 98%,
about 98.5%, about 99%, about 99.5% or about 99.9% identity to any one of SEQ
ID NO: 16 or
18.
In another embodiment of the invention and/or embodiments thereof the PRV
structural
polypeptide is encoded by a nucleic acid having a sequence having at least
about 70% identity
to any one of SEQ ID NOs: 17 or 19, or a fragment thereof.
In another embodiment of the invention and/or embodiments thereof the PRV
structural
polypeptide is encoded by a polynucleotide having a sequence having at least
about 72%,
about 74%, about 75%, about 76%, about 78%, about 80%, about 82%, about 84%,
about 85%,
about 87%, about 88%, about 90%, about 91%, about 92%, about 93%, about 94%,
about 95%,
about 96%, about 97%, about 98%, about 99%, identity to any one of SEQ ID NO:
17 or 19, or
a fragment thereof. In one embodiment, the PRV structural polypeptide is
encoded by a
polynucleotide having a sequence having at least about 90%, about 95.5%, about
96%, about
96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%
or about
99.9% identity to that of any one of SEQ ID NOs: 17 or 19, or a fragment
thereof.
In a certain embodiment of the invention and/or embodiments thereof the
treatment or
protection additionally comprises administering to a fish a composition
comprising a polypeptide
of the PRV structural protein as described herein. Suitably the PRV structural
polypeptide has at
least 50 consecutive amino acids of a polypeptide having a sequence having at
least 70%
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
16
identity to any of SEQ ID NO: 16 or 18. Suitably the PRV structural
polypeptide has an amino
acids sequence of any of SEQ ID NO: 16 or 18.
In another embodiment of the invention and/or embodiments thereof the PRV
polypeptide or
PRV structural protein is encoded by a nucleic acid complementary to a PRV
polynucleotide
sequence having a sequence having at least 70% identity to any of SEQ ID NOs:
17 or 19, or a
fragment thereof.
In another embodiment of the invention and/or embodiments thereof, the PRV
polynucleotide
has a length from about 150 to about 2200, about 200 to about 2000, about 250
to about 1800,
about 300 to about 1600, about 350 to about 1400, about 300 to about 1200,
about 400 to
about 1000, about 500 to about 900, about 600 to about 800, about 650 to about
750, or more
nucleotides.
In another embodiment of the invention and/or embodiments thereof the
treatment or protection
comprises administering to fish a composition comprising a polynucleotide
encoding the PRV
structural protein as defined herein. Suitably the polynucleotide encoding the
PRV structural
protein is a polynucleotide having a sequence having at least 70% identity to
any of SEQ ID
NO: 17 or 19. Suitably the polynucleotide encoding the PRV structural protein
is polynucleotide
having a sequence having at least about 72%, about 74%, about 75%, about 76%,
about 78%,
about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about 90%,
about 91%,
about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%,
about 99%,
identity to any one of any one of SEQ ID NO: 17 or 19.Suitably the PRV
polynucleotide having a
sequence having at least about 90%, about 95.5%, about 96%, about 96.5%, about
97%, about
97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about 99.9% identity
to any one of
SEQ ID NO: 17 or 19.
Suitably, the fish is a salmonid. Salmonids include salmon, trout, chars,
freshwater whitefishes,
and graylings.
In another aspect the invention is directed to a vaccine comprising a vector
comprising
polynucleotide sequence that encodes for a PRV non-structural protein.
Suitably the vaccine
comprises a vector of the invention and/or embodiments thereof.
In another aspect the invention is directed to a vaccine composition
comprising a PRV non-
structural protein as defined herein as a subunit.
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
17
Suitably the vaccine is used in a treatment or protection of fish against HSMI
disease. Suitably
the vaccine is used to protect fish against HSMI disease. Suitably the vaccine
does not
comprise PRV particles, live, killed, attenuated or otherwise.
Suitable the vector comprises a promoter. Classic promoters include the human
CMV/immediate early or CMV-chicken-I3 actin (CAGG) promoters. CMV promoters
are used for
most DNA vectors since they drive high constitutive expression levels in a
wide range of
mammalian tissues and do not suppress downstream read-through. Improvement of
expression
and immunogenicity have been observed by modifying CMV promoters (i.e.,
incorporation of
HTLV-1R-U5 downstream of the CMV promoter) or by using chimeric 5V40-CMV
promoter.
Alternatives to CMV promoters include host tissue-specific promoters, which
avoid constitutive
expression of antigens in inappropriate tissues. The presence of an intron in
the vector
backbone downstream of the promoter can enhance the stability of mRNA and
increase gene
expression. A kozak sequence immediately prior to the ATG start codon may
further enhance
protein expression. The use of species-specific codons increases protein
expression. Gene
expression can be manipulated by altering the polyA sequence, which is
required for proper
termination of transcription and export of mRNA from the nucleus. Many current
DNA vectors
use the bovine hormone terminator sequence. Alteration of the polyA sequence
may enhance
gene expression of DNA vectors.
Therefore an embodiment of the present invention and/or embodiments thereof,
is directed to a
vector comprising a promoter sequence and a polynucleotide sequence that
encodes for a PRV
non-structural protein. Suitably the vector further comprises an enhancing 5'
sequence.
Examples of such enhancing 5'sequences may be found i.a. in EP1818406.
Suitably the
promoter is a CMV promoter. Many commercially available vectors comprise the
CMV promoter,
such as e.g. the pcDNA3 plasmid (lnvitrogen). The promoter is preferably
operately joined to
the polynucleotide sequence that encodes for a PRV non-structural protein. As
used herein, the
expression "operatively joined" means that the PRV non-structural protein is
expressed in the
correct reading frame under the control of the promoter.
Therefore, another aspect of the invention relates to a vector, hereinafter
the vector of the
invention, which comprises at least a promoter sequence and polynucleotide
sequence that
encodes for a PRV non-structural protein. Said vector can be a viral vector or
a non-viral vector.
In general, the choice of vector will depend on the host cell in which it is
subsequently to be
introduced. The vector of the invention can be obtained using conventional
methods known to a
person skilled in the art (Sambrook et al., 1989). Suitably, the vector
encodes the PRV non
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
18
structural protein as a subunit protein. Preferably, the expression of PRV non
structural protein
is such that a PRV viral particle cannot be assembled.
In a particular embodiment, the vector of the invention is a non-viral vector,
such as a plasmid
or an expression vector that can be expressed in eukaryotic cells, e.g. in
animals cells, which
comprises at least a promoter sequence and polynucleotide sequence that
encodes for a PRV
non-structural protein, which, when introduced into a host cell, is either
integrated into the
genome of said cell or not.
The vector of the invention and/or embodiments thereof may also contain the
necessary
elements for expression of the PRV non-structural protein and the elements
that regulate its
transcription and/or translation. The vector of the invention and/or
embodiments thereof may
also contain RNA-processing sequences such as intron sequences for transcript
splicing,
transcription termination sequences, sequences for peptide secretion, etc. If
desired, the vector
of the invention may contain an origin of replication and a selectable marker,
such as an
antibiotic-resistant gene.
In one particular embodiment, the vector of the invention and/or embodiments
thereof contains
a single polynucleotide sequence that encodes for a PRV non-structural
protein. However, in
another particular embodiment, the vector of the invention contains two or
more polynucleotide
sequences that encodes for a PRV non-structural protein. In this case, the
vector of the
invention can encode two or more different PRV non-structural protein.
Alternatively, the vector
of the invention can encode one PRV non-structural and one or more PRV
structural proteins.
Alternatively, the vector of the invention can encode two PRV non-structural
and one or more
PRV structural proteins. Also contemplated is that the vector of the invention
encodes for further
proteins from a fish pathogen other than PRV, thereby producing a multi-
purpose vaccine. For
example, polynucleotide of pG of VHSV, the VP2 of IPNV or the E2 protein of
PDV may be
included in the same vector. Suitably the vector of the invention encodes at
least pNS and at
least one PRV structural protein. Suitably the vector of the invention encodes
at least aNS and
at least one PRV structural protein. Suitably the vector of the invention
encodes pNS and pNS
and at least one PRV structural protein. Suitably the vector of the invention
encodes at least
pNS and al. Suitably the vector of the invention encodes at least pNS and p2.
Suitably the
vector of the invention encodes at least aNS and G1. Suitably the vector of
the invention
encodes at least aNS and p2. . Suitably the vector of the invention encodes
pNS and pNS and
al .. Suitably the vector of the invention encodes pNS and pNS and p2..
Suitably the vector of
the invention encodes pNS and pNS and al and p2.
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
19
When the vector of the invention comprises two or more gene constructs
encoding for proteins,
the transcription of each nucleic acid sequence encoding each protein can be
directed from its
own expression control sequence to which it is operatively joined or it can be
two or more
proteins in the same reading frame.
When the vector of the invention is introduced into cells of an appropriate
fish, the cells into
which said vector of the invention has been introduced express the PRV non-
structural protein
and optionally the PRV structural protein in the vector of the invention,
resulting in the protection
or treatment of the fish against HSMI pathology or disease.
The vector of the invention and/or embodiments thereof, can include CpG
dinucleotides, as they
have immunostimulatory effects, thus enabling the DNA to act as an adjuvant.
The vector of the invention and/or embodiments thereof may comprise two
polynucleotide
sequence that each encodes for a different PRV non-structural protein.
Suitably, the
polynucleotide sequence that encodes for a PRV non-structural protein encodes
for pNS and/or
aNS. Preferably, the polynucleotide sequence that encodes for a PRV non-
structural protein
encodes for at least pNS. It is contemplated that the vector may code for pNS
and aNS. The
pNS and aNS may be under a single promoter or they may each be linked to a
separate
promoter. It is also contemplated that two or more vectors are used in the
method of the
invention and/or embodiments thereof wherein each vector comprises a
polynucleotide
sequence that encodes for a different PRV non-structural protein or PRV
structural protein such
as p2 or al .
Suitably the polynucleotide sequence that encodes for a PRV non-structural
protein comprises
any of the sequences SEQ ID NO: 14 or 15, or comprises a nucleotide sequences
that encodes
for a polypeptide havingy any of the sequences SEQ ID NO: 12 or 13.
Furthermore, the DNA-
encoding sequence that encodes for a PRV non-structural protein may comprise a
nucleotide
sequences that is at least 70% identical to any of the sequences SEQ ID NO: 14
or 15, or
comprises a nucleotide sequences that is at least 70% identical to a
nucleotide sequence that
encodes fora polypeptide having any of the sequences SEQ ID NO: 12 or 13.
Suitably, the polynucleotide sequence that encodes for a PRV non-structural
protein may
comprise a nucleotide sequences that is at least about 72%, about 74%, about
75%, about
76%, about 78%, about 80%, about 82%, about 84%, about 85%, about 87%, about
88%, about
90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about
97%, about
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
98%, about 99%, identical to any one of SEQ ID NO: 14 or 15 or to a nucleotide
sequence that
encodes for a polypeptide having a sequence of any of the sequences SEQ ID NO:
12 or 13.
Suitably, the polynucleotide sequence that encodes for a PRV non-structural
protein may
comprise a nucleotide sequences that is at least about 90%, about 95.5%, about
96%, about
96.5%, about 97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5%
or about
99.9% identical to any one of SEQ ID NOs 14 or 15 or to a nucleotide sequence
that encodes
fora polypeptide having any of the sequences SEQ ID NO: 12 or 13.
It is also possible that the polynucleotide sequence that encodes for a PRV
non-structural
protein comprises a nucleotide sequence that is complementary to a sequence
having at least
70% identity to any one of SEQ ID NOs 14 or 15 or to a nucleotide sequence
that encodes for a
polypeptide having any of the sequences SEQ ID NO: 12 or 13.
Suitably the polynucleotide sequence that encodes for a PRV structural protein
comprises any
of the sequences SEQ ID NO: 17 or 19, or comprises a nucleotide sequences that
encodes for
a polypeptide havingy any of the sequences SEQ ID NO: 16 or 18. Furthermore,
the DNA-
encoding sequence that encodes for a PRV structural protein may comprise a
nucleotide
sequences that is at least 70% identical to any of the sequences SEQ ID NO: 17
or 19, or
comprises a nucleotide sequences that is at least 70% identical to a
nucleotide sequence that
encodes fora polypeptide having any of the sequences SEQ ID NO: 16 or 18.
Suitably, the polynucleotide sequence that encodes for a PRV structural
protein may comprise a
nucleotide sequences that is at least about 72%, about 74%, about 75%, about
76%, about
78%, about 80%, about 82%, about 84%, about 85%, about 87%, about 88%, about
90%, about
91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
98%, about
99%, identical to any one of SEQ ID NO: 17 or 19 or to a nucleotide sequence
that encodes for
a polypeptide having a sequence of any of the sequences SEQ ID NO: 16 or 18.
Suitably, the polynucleotide sequence that encodes for a PRV structural
protein may comprise a
nucleotide sequences that is at least about 90%, about 95.5%, about 96%, about
96.5%, about
97%, about 97.5%, about 98%, about 98.5%, about 99%, about 99.5% or about
99.9% identical
to any one of SEQ ID NOs 17 or 19 or to a nucleotide sequence that encodes for
a polypeptide
having any of the sequences SEQ ID NO: 16 or 18.
It is also possible that the polynucleotide sequence that encodes for a PRV
structural protein
comprises a nucleotide sequence that is complementary to a sequence having at
least 70%
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
21
identity to any one of SEQ ID NOs 17 or 17 or to a nucleotide sequence that
encodes for a
polypeptide having any of the sequences SEQ ID NO: 16 or 18.
Further the vector of the present invention and/or embodiments thereof may
also code for
fragments of the PRV non-structural protein as defined herein.
Suitably, the vector of the present invention and/or embodiments thereof
encodes a fragment of
the PRV non-structural protein comprising from about 50 to about 750, about 60
to about 700,
about 70 to about 650, about 75 to about 600, about 80 to about 550, about 90
to about 500,
about 100 to about 450, about 120 to about 400, about 140 to about 350, about
150 to about
300, about 160 to about 250, about 170 to about 220, about 180 to about 200 or
more
consecutive amino acids of a PRV non-structural protein as described herein.
Further the vector of the present invention and/or embodiments thereof may
also code for
fragments of the PRV structural protein as defined herein.
Suitably, the vector of the present invention and/or embodiments thereof
encodes a fragment of
the PRV structural protein comprising from about 50 to about 750, about 60 to
about 700, about
70 to about 650, about 75 to about 600, about 80 to about 550, about 90 to
about 500, about
100 to about 450, about 120 to about 400, about 140 to about 350, about 150 to
about 300,
about 160 to about 250, about 170 to about 220, about 180 to about 200 or more
consecutive
amino acids of a PRV structural protein as described herein.
Suitably the polynucleotide sequence encodes for a PRV structural protein,
and/or fragment
thereof as defined in the present invention.
In another aspect of the invention, the vaccine comprises a vector according
to the invention
and/or any embodiments thereof.
The vaccine may comprise optionally one of more adjuvants and/or
pharmaceutically
acceptable ingredients. The vaccine of the invention and/or embodiments
thereof can be
prepared in the form of an aqueous solution or suspension, in a
pharmaceutically acceptable
vehicle, such as saline solution, phosphate buffered saline (PBS), or any
other pharmaceutically
acceptable vehicle. The adjuvants may comprise plasmid-encoded signalling
molecules
including cytokines, chemokines, immune costimulatory molecules, toll-like
receptor agonists or
inhibitors of immune suppressive pathways. Also traditional adjuvants
including killed bacteria,
bacterial components, such LPS, aluminium salts, oil emulsions, polysaccharide
particles,
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
22
liposomes and biopolymers may be used. Suitable systems use nanoparticles
based on
biodegradable polymers. Synthetic polymers such as poly(vinylpyridine),
polylactide-co-
glycolides (PLG) and polylactide-co-glycolide acid (PLGA) may be used.
Encapsulation of DNA
helps protect the plasmid from nuclease degradation and provides prolonged
release.
The vaccine of the invention and/or embodiments thereof may be prepared using
conventional
methods known by a person skilled in the art. In a particular embodiment, said
vaccine is
prepared using the PRV polypeptide, PRV polynucleotides, or a vector of the
invention,
optionally having one or more adjuvants and/or pharmaceutically acceptable
vehicles.
The vector of the invention and/or embodiments thereof, can be incorporated
into conventional
transfection reagents, such as liposomes, e.g. cationic liposomes,
fluorocarbon emulsions,
cochleates, tubules, gold particles, biodegradable microspheres, cationic
polymers, etc. A
review of said transfection reagents can be found in US 5780448. Suitably the
vector of the
invention and/or embodiments thereof is administered by electroporation.
Preferably the PRV non-structural protein, polynucleotide encoding the PRV non-
structural
protein, PRV structural protein, polynucleotide encoding the PRV structural
protein vectors of
the present invention and/or embodiments thereof are administered in an
effective amount. In
the meaning used herein, the expression "effective amount" refers to an
effective amount to
provide protection against HSMI caused by an infection by PRV.
The pharmaceutically acceptable vehicles that may be used in the formulation
of a vaccine of
the invention must be sterile and physiologically compatible, e.g. sterile
water, saline solution,
aqueous buffers such as PBS, alcohols, polyols and suchlike. Said vaccine may
also contain
other additives, such as adjuvants, stabilisers, antioxidants, preservatives
and suchlike. The
available adjuvants include, but are not limited to, aluminium salts or gels,
carbomers, nonionic
block copolymers, tocopherols, muramyl dipeptide, oil emulsions, cytokines,
etc. The amount of
adjuvant that may be added depends on the nature of the adjuvant. The
stabilisers available for
use in vaccines according to the invention are, e.g. carbohydrates, including
sorbitol, mannitol,
dextrin, glucose and proteins such as albumin and casein, and buffers such as
alkaline
phosphatase. The available preservatives include, among others, thimerosal,
merthiolate and
gentamicin.
Examples:
The invention will now be further described by the following, non-limiting,
examples.
Materials and methods
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
23
Plasmid constructs
The full-length open reading frames (ORFs) of PRV genes encoding pNS, al, a3,
p2, and aNS,
were amplified using Pfu Ultra ll Fusion HS DNA polymerase (Agilent, Santa
Clara, CA, USA)
and cDNA prepared like in an earlier study (Miller CL, et al.Localization of
mammalian
orthoreovirus proteins to cytoplasmic factory-like structures via
nonoverlapping regions of
microNS. J Virol 2010, 84(2):867-882). Expression vector pcDNA3.1 (+)
(Invitrogen) expressing
PRV pNS, aNS, al, a3, p2, or enhanced Green fluorescent protein (EGFP)
(control), was
constructed. In short, the PCR amplicons of the ORFs were cloned into the Xbal
restriction site
of pcDNA3.1.
Primer sequences are listed in Table 2.
Table 2: Primer sequences
Vector Primer Nucleotide sequence (5'4 3') SEQ
ID
NO:
pcDNA3. Forward GCCGCTCGAGTCTAGAGCCACCATGGCTGAATCAATTACT 1
1 pNS TTTGG
Reverse AAACGGGCCCTCTAGATCAGCCACGTAGCACATTATTCAC 2
pcDNA3. Forward GCCGCTCGAGTCTAGAGCCACCATGTCGAACTTTGATCTT 3
1 aNS GG
Reverse AAACGGGCCCTCTAGACTAACAAAACATGGCCATGA 4
pcDNA3. Forward GTTTAAACTTAAGCTTATGCATAGATTTACCCAAGAAGAC 5
1 al Reverse CTGGACTAGTGGATCCCTAGATGATGATCACGAAGTCTCC 6
pcDNA3. Forward GTTTAAACTTAAGCTTATGGCGAACCATAGGACGGCGACA 7
1 a3 Reverse GATATCTGCAGAATTCTCACGCCGATGACCATTTGAGCAA 8
Transfections of fish cells
CHSE-214 cells (ATCC CRL-1681, Chinook salmon embryo) were cultivated in
Leibovitz L-15
medium (L15, Life Technologies, Carlsbad, USA) supplemented with 10 % heat
inactivated fetal
bovine serum (FBS, Life technologies), 2 mM L-glutamine, 0.04 mM
mercaptoethanol and 0.05
mg/ml gentamycin-sulphate (Life Technologies). A total of 3 million CHSE cells
were pelleted by
centrifugation, resuspended in 100 pL lngenio Electroporation Solution (Mirus,
Madison, WI,
USA) and separately transfected with 3 pg of each the plasmids using the Amaxa
T-20
program. The transfected cells were diluted in 1 mL pre-equilibrated L-15
growth medium and
100 pL of the diluted cells was seeded onto gelatin embedded cover slips (12
mm) in a 24-well
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
24
plate for expression analysis by immunofluorescence microscopy. Transfections
with
pcDNA3.1/EGFP construct was used as positive expression controls.
Immunofluorescence microscopy
Transfected CHSE-214 cells were fixed and stained using an intracellular
Fixation and
Permabilization Buffer (eBioscience, San Diego, CA, USA). The cells were
washed in
Dulbecco's PBS (DPBS) with sodium azide. Intracellular fixation buffer was
added before
incubation with primary antibodies, anti-pNS (1:1000) (Haatveit et al. Viral
Protein Kinetics of
Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells. Viruses 2017,
9(3)), anti-a1
(1:1000) (Finstad et al: lmmunohistochemical detection of piscine reovirus
(PRV) in hearts of
Atlantic salmon coincides with the course of heart and skeletal muscle
inflammation (HSMI). Vet
Res 2012, 43:2715). Secondary antibodies were anti-rabbit immunoglobulin G
(IgG) conjugated
with Alexa Fluor 488 (Life Technologies, 1:400) or anti-goat IgG conjugated
with Alexa Fluor
594 (Life Technologies, 1:400). Nuclear staining was performed with Hoechst
trihydrochloride
trihydrate stain solution (Life Technologies). The cover slips were mounted
onto glass slides
using Fluoroshield (Sigma-Aldrich) and images were captured on an inverted
fluorescence
microscope (Olympus IX81).
Vaccine preparations
The concentration of plasmid constructs were measured using a NanoDrop ND-1000
spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and diluted
in PBS to 1000
ng/pL. Samples for vaccination were prepared to contain 10 pg of each plasmid
construct in a
total volume 50 pL.
Vaccination trials
Cohabitant challenge experiment was performed following vaccination of a
pcDNA3.1-based
expression vaccines. The trials were performed using previously unvaccinated
Atlantic salmon
pre-smolts with an average weight of 30-40 g, confirmed free of common salmon
pathogens.
The fish were kept in a freshwater flow-through system (temperature: 12 C;
oxygen: > 70%; pH
6.6-6.9), acclimatized for 1 week and starved 48 hours prior to vaccination.
The fish were
randomly selected for vaccination, anesthetized by bath immersion (2-5 min) in
benzocaine
chloride (0.5 g/10 L water, Apotekproduksjon AS, Oslo, Norway), labelled with
passive
integrated transponder (PIT) tags (two weeks prior to vaccination) and
intramuscularly (i.m.)
injected with the vaccines or control substances. The challenges were
performed in connection
with transfer to seawater six weeks after vaccination and after photoperiod
manipulation. The
shedders were i.p. injected with 0.1 mL of pooled heparinized blood samples
from a previous
PRV challenge experiment (Finstad et al. Piscine orthoreovirus (PRV) infects
Atlantic salmon
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
erythrocytes. Vet Res 2014, 45:35). The inoculum was confirmed negative for
the salmon
viruses including infectious pancreatic necrosis virus (IPNV), infectious
salmon anemia virus
(ISAV), salmonid alphavirus (SAV) and piscine myocarditis virus (PMCV) by RT-
qPCR. The fish
were starved for 24 hours prior to challenge. Fish were divided into six
groups, each containing
26 fish, and vaccinated by i.m. injection of 10 pg/50 pL per pcDNA3.1
construct, control
construct (pcDNA3.1/EGFP) or PBS (Table 3).
CA 03083873 2020-05-27
WO 2019/110664
PCT/EP2018/083656
26
Table 3: Vaccination groups
Grou Administratio Dos
No.
Vaccine Marking
n route fish
(mL)
PIT
1 pcDNA 3.1 al + pcDNA 3.1 pNS + tagging i.m. 0.05 24 +
2
pcDNA3.1 aNS
PIT
2 pcDNA 3.1 pNS + pcDNA3.1 aNS tagging i.m. 0.05 24 +
2
+ pcDNA3.1 a3
PIT
3 tagging i.m. 0.05 24 +
2
pcDNA 3.1 pNS + pcDNA3.1 aNS
PIT
4 tagging i.m. 0.05 24 +
2
pcDNA3.1 pNS
PIT
tagging i.m. 0.05 24 + 2
Control (pcDNA3.1 EGFP)
PIT
6 tagging i.m. 0.05 24 +
2
Saline
At 4 wpc, six fish from the PBS control group were sampled and analyzed for
viral RNA loads in
blood to determine suitable time points for the following two samplings, set
to 6 and 8 wpc.
Further, 12 fish per group were sampled at these two time-points before
termination of the
experiment. Heparinized blood, plasma and heart (stored in 4% formalin or
RNAlater) were
sampled from both challenge experiments.
RNA isolation and RT-qPCR
Total RNA was isolated from 20 pL heparinized blood homogenized in 650 pL
QIAzol Lysis
Reagent (Qiagen, Hilden, Germany) using 5 mm steel beads, TissueLyser II
(Qiagen) and
RNeasy Mini spin column (Qiagen) as recommended by the manufacturer. RNA
quantification
was performed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher
Scientific,
Wilmington, DE, USA). For the plasma samples, a 10 pL volume was diluted in
PBS to 140 pL
and used in the Mini spin column (Qiagen), as recommended by the manufacturer.
The Qiagen
OneStep kit (Qiagen) was used for RT-qPCR with a standard input of 100 ng (5
pL of 20 ng/pL)
of the isolated total RNA per reaction. From the cell free plasma samples, 5
pL input of total
eluted RNA was used. The template RNA was denatured at 95 C for 5 min prior to
RT-qPCR
targeting PRV gene segment S1 (S1Fwd: 5'TGCGTCCTGCGTATGGCACC'3 (SEQ ID NO: 9)
S1 Rev: 5'GGCTGGCATGCCCGAATAGCA'3 (SEQ ID NO: 10) and Slprobe: 5'-FAM-
ATCACAACGCCTACCT'3- MGBNFQ (SEQ ID NO: 11) using the following conditions: 400
nM
primer, 300 nM probe, 400 nM dNTPs, 1.26 mM MgCl2, 1:100 RNase Out
(Invitrogen) and 1 x
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
27
ROX reference dye. The cycling conditions were 50 C for 30 min and 94 C for 15
min, followed
by 35 cycles of 94 C/15 sec, 54 C/30 sec and 72 C/15 sec in an AriaMx
(Agilent, Santa Clara,
CA, USA). All samples were run in duplicates, and a sample was defined as
positive if both
parallels produced a Ct value below 35.
Histopathological scoring
Sections for histopathology were processed and stained with hematoxylin and
eosin following
standard procedures. Individual fish from both vaccination trials were
examined for heart lesions
in consistence with HSMI, discriminating between epicardial and myocardial
changes. The
grade of changes was scored from 0 to 4 using criteria described in Table 4A
and 4B. The
individual histopathological scores were used to calculate the mean score SD
at each time
point of sampling (n = 6 or n = 12) for both epicardial and myocardial
changes.
Table 4A:
Score Description Epicard
0 Normal appearance
1 Focal/multifocal (2-4 foci) of inflammatory cells lifting the
epicardial layer from the
surface of the heart, typically 2-3 layers thick
2 Diffuse infiltration of inflammatory cells (mononuclear)>5 cell layers
thick in most of
the epicard present. The infiltration of cells is multifocal to diffuse and
can involve
parts or the entire epicardium available for assessment.
3 Diffuse infiltration of inflammatory cells (mononuclear)>10 cell layers
thick in most of
the epicard present.Moderate pathological changes consisting of moderate
number
of inflammatory cells in the epicardium
4 Diffuse infiltration of inflammatory cells (mononuclear)>15 cell layers
thick in most of
the epicard present. Severe pathological changes characterised by intense
infiltration
of inflammatory cells in the epicardium.
Table 4B:
Score Description Ventricle
0 Normal appearance
1 Vascular changes in small vessels of the compart layer characterised by
enlarged
endothelial cells, typically stretching out. Minor inflammatory changes in the
compact
layer without significant involvement of the spongious layer.
2 Focal to multifocal inflammatory foci (2-5 foci) of the compact layer
and/or the
spongious part (2-5 foci). Extensions typically seen along small vessels and
perivascular infiltration.
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
28
3 The changes in the compact layer are multifocal or diffuse in areas and
typically
concentrated along small blood vessels. Combines with multifocal to diffuse
changes
in the spongious layer.
4 Widespread to diffuse infiltration of inflammatory cells in the compact
layer in a
multifocal pattern. Degeneration and/or necrosis of muscle fibres may be/are
seen.
Atrium can also be involved with inflammatory changes.
Statistical analyses
The PRV RT-qPCR results and the histopathology scores were analyzed
statistically using the
Mann Whitney compare ranks test. All statistical analysis described were
performed with
Graph Pad Prism (Graph Pad Software inc., USA) and p-values of p 0.05 were
considered as
significant.
Results
RT-qPCR analysis indicated high PRV loads at the two sampling points 6 and 8
wpc for both
control. All four vaccinated groups remain a high viral load although viral
RNA loads in blood
cells was reduced when compared to the controls at 6 wpc (table 5). Group 1
showed
significantly lower viral RNA load 6 wpc compared to control groups 5 and 6.
Group 4 showed
the highest viral load of all vaccination groups at both 6 and 8 wpc. In
addition, group 4 showed
higher PRV RNA levels than the control groups at 8 wpc.
Table 5:
Group Vaccine 6wpc 8wpc
Histo-score Histo-score
Ct- Epicard Myocard Ct-value Epicard Myocard
value
1 pNS + aNS + 24,2 0,3 0,3 18,7 1,0 2,5
al
2 pNS + aNS + 20,6 1,3 1,3 20,5 1,7 2,2
a3
3 pNS + aNS 21,2 0,6 0,7 19,1 1,6 2,0
4 pNS 19,7 0,7 0,8 15,5 1,4 1,9
Control (EGFP) 16,1 0,7 0,3 17,4 2,5 4,0
6 Saline 18,1 0,0 0,0 17,1 2,1 4,0
CA 03083873 2020-05-27
WO 2019/110664 PCT/EP2018/083656
29
At 8 wpc when the control groups showed sever epicard and myocard pathology,
all the
vaccination groups showed a significant less pathology. Group 4 showed the
least pathology. It
is interesting to note that group 4 showed the highest viral load at 8wpc,
even higher than the
control groups.
