VACCIN POLYVALENT CONTRE LES INFECTIONS A ALPHAVIRUS DE SALMONIDE

POLYVALENT VACCINE AGAINST SALMONID ALPHAVIRUS INFECTIONS

Abrégé français

La présente invention concerne une composition comprenant un arbovirus de salmonidé ou un matériau antigénique et/ou immunogénique dérivé combiné avec un ou plusieurs composants sélectionnés dans le groupe contenant les éléments suivants : une bactérie vivante, atténuée ou tuée, un virus autre que larbovirus de salmonidé, ledit virus étant de préférence atténué ou inactif, un champignon, un parasite et un matériau antigénique et/ou immunogénique dérivé de nimporte lequel de ces composants. Linvention concerne également une forme de dosage et un vaccin comprenant ladite composition, de même que lutilisation de la composition en médecine. Linvention concerne aussi une méthode de fabrication dune composition ou dun vaccin décrits ci-dessus et une méthode pour améliorer un vaccin polyvalent en y ajoutant un arbovirus de salmonidé atténué ou inactif. Date reçue / Date Received 2020-08-14

Abrégé anglais

Abstract The present invention relates to a composition comprising salmonid alphavirus or an antigenic and/or immunogenic material derived thereof, combined with one or more components selected from the group consisting of: a live, attenuated or killed bacterium, a virus other than salmonid alphavirus, said virus preferably being attenuated or inactivated, a fungus, a parasite; and an antigenic and/or immunogenic material derived from any of these components. The invention further relates to a dosage form and a vaccine comprising the said composition and the invention provides for use of the composition in medicine. Also, the invention relates to a method of manufacturing a composition or a vaccine as described above, and to a method of improving a polyvalent vaccine, comprising including in the polyvalent vaccine an attenuated or inactivated salmonid alphavirus. = Date Recue/Date Received 2020-08-14

Revendications

76
Claims
1. A pancreatic disease virus vaccine component comprising inactivated
salmonid alphavirus, wherein said salmonid alphavirus is selected from the
group consisting of:
a. the virus strains deposited under the Budapest Treaty at the ECACC
under deposit number V94090731 and with the European Collection
of Cell culture (ECACC), Health Protection Agency, Porton Down,
Salisbury, Wiltshire (UK), SP4 OJG UK on December 12 2007 under
Deposit numbers 07121201, 07121202, and 07121203, and
b. a strain which is a mutant of any one of the strains in a). and which
prior to inactivation has a visible cytopathogenic effect during early
passage in cell culture, and wherein the virus induces mortality of at
least 25% in a laboratory challenge model, said model comprising
smoltifying Atlantic salmon according to standard methods and
challenging of the post-smolts by intraperitoneal injection with a
SAV3 dose of at least 108 TCID5o per fish, within one day after
transfer to seawater at 12 C.
2. The vaccine component according to claim 1, wherein said salmonid
alphavirus has been inactivated by addition of formaldehyde.
3. The vaccine component according to claim 2, wherein said salmonid
alphavirus is inactivated using a procedure comprising addition of 1.5-2.5
g/kg, formaldehyde and subsequent incubation for 12-96 hours at a
temperature from 13-17 C.
4. An isolated salmonid alphavirus of the subtype SAV3, said salmonid
alphavirus being selected from the group consisting of:
a. the virus strains deposited under the Budapest Treaty at the
ECACC
under deposit number V94090731 and with the European Collection
of Cell culture (ECACC), Health Protection Agency, Porton Down,
Salisbury, Wiltshire (UK), 5P4 OJG UK on December 12 2007 under
Deposit numbers 07121201, 07121202, and 07121203, and
Date Recue/Date Received 2022-01-20

77
b. a strain or isolate which is a mutant of, or is a variant
of, any one of
the deposited virus strains in a), wherein the virus has a visible
cytopathogenic effect during early passage in cell culture, and
wherein the virus induces mortality of at least 25% in a laboratory
challenge model, said model comprising smoltifying Atlantic salmon
according to standard methods and challenging of the post-smolts by
intraperitoneal injection with a SAV3 dose of at least 108 TCIDso per
fish, within one day after transfer to seawater at 12 C.
5. The isolated virus according to claim 4, wherein said virus has a
visible
cytopathogenic effect during the first, second, third or fourth passage on a
culture of CHSE cells.
6. The isolated virus according to claim 4, wherein the virus induces
mortality of at least 25% in a laboratory challenge model, said model
comprising smoltifying Atlantic salmon according to standard methods and
challenge of the post-smolts by intraperitoneal injection with a SAV3 dose
of at least 3.5 x 108 TCIDso per fish.
7. The isolated virus according to any one of claims 4-6, wherein the virus
has the ability of growing to a titre, in a supernatant/growth medium, of
at least 1x108 TCIDso/m1 when cultured using host cells which are
selected from the group consisting of CHH-1 cells and CHSE-214 cells.
8. The isolated virus according to claim 7, wherein said titre of at least
1x108
TCIDso/m1 is obtained when:
a. Cells are cultured using host cells which have been seeded at a
density of 0.1-1x105 cells cm2;
b. The host cells are cultured for 4-6 days prior to virus infection;
c. The host cells are grown to a density of from 0.1-1.0 x106 cells cm-2
at the time of infection with said virus isolate;
d. The host cells are cultured in a growth medium comprising EMEM
(EBSS)+ 10% Fetal Bovine Serum (FBS) + 2mM L-Glutamine + 1%
Non Essential Amino Acids (NEAA) + 0.1% gentamicine; and
e. The infected cells are cultured at a temperature of 150C, for a period
of 10-14 days.
Date Recue/Date Received 2022-01-20

78
9. The isolated virus according to any one of claims 4-8, wherein said
virus
comprises a nucleic acid sequence which is at least 95% identical to the
sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3.
10. The isolated virus according to any one of claims 4-9, wherein said
virus
comprises a nucleic acid sequence which is at least 98% identical to the
sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5 and/or SEQ ID NO: 6.
11. The isolated virus according to any one of claims 4-10, wherein when
the
virus is a mutant of any one of the strains in claim 4 a) the virus is
positive in a SAV reverse transcriptase quantitative PCR-identity test using
a primer set corresponding to the primers set forth in SEQ ID NO: 7 and 8
and the conditions 50 C, 30 min - 95 C, 10 min -(95 C, 30 sec - 57 C,
60 sec - 72 C,30 sec)*40.
12. The isolated virus according to any one of claims 4-11, wherein said
virus
is a genetic variant of any one of the virus strains deposited under the
Budapest Treaty at the ECACC under deposit number V94090731 and with
the European Collection of Cell culture (ECACC), Health Protection Agency,
Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on December 12 2007
under Deposit numbers 07121201, 07121202, and 07121203.
13. An inactivated salmonid alphavirus (SAV) for use as a vaccine for
preventing or reducing the incidence of fish pancreatic disease, wherein
said vaccine is compatible with other immunological products and
comprises inactivated salmonid alphavirus in an amount corresponding to
at least 1x109 - 2.5x101 TCID5o/ml, determined by titration on CHH cells
and wherein said salmonid alphavirus is selected from the group
consisting of:
a) the virus strains deposited under the Budapest Treaty at the
ECACC
under deposit number V94090731 and with the European Collection
of Cell culture (ECACC), Health Protection Agency, Porton Down,
Salisbury, Wiltshire (UK), 5P4 OJG UK on December 12 2007 under
Deposit numbers 07121201 and 07121202, and
Date Recue/Date Received 2022-01-20

79
b) a strain which is a mutant of any one of the strains in a)
wherein the
virus is positive in a SAV reverse transcriptase quantitative PCR-
identity test using a primer set corresponding to the primers set
forth in SEQ ID NO: 7 and 8 and the conditions 50 C, 30 min - 95
C, 10 min -(95 C, 30 sec - 57 C, 60 sec - 72 C, 30 sec)*40.
14. The inactivated salmonid alphavirus for use according to claim 13,
wherein
said inactivated salmonid alphavirus is of the SAV1 or SAV3 subtype, or is
a combination thereof.
15. The inactivated salmonid alphavirus for use according to claim 13 or
14,
wherein said inactivated salmonid alphavirus is of the SAV3 subtype.
16. The inactivated salmonid alphavirus for use according to any one of
claims
13-15, wherein said salmonid alphavirus comprises a nucleic acid
sequence which is at least 95% identical to the sequence set forth in SEQ
ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 or at least 98% identical to the
sequence set forth in SEQ ID NO: ID NO: 4, SEQ ID NO: 5 or SEQ ID NO:
6.
17. The inactivated salmonid alphavirus for use according to any one of
claims
13-16, wherein said salmonid alphavirus has been inactivated by addition
of formaldehyde.
18. The inactivated salmonid alphavirus for use according to any one of
claims
13-17, wherein said salmonid alphavirus is inactivated using a procedure
comprising addition of 1.5-2.5 g/kg, formaldehyde and subsequent
incubation for 12-96 hours at a temperature from 13-17 C.
19. The inactivated salmonid alphavirus for use according to any one of
claims
13-18, wherein each dose has a volume of 90-110 pl.
20. The inactivated salmonid alphavirus for use according to any one of
claims
13-18, wherein each dose has a volume of 45-55 pl.
21. The inactivated salmonid alphavirus for use according to claim 20,
wherein
each dose has a volume of 50 pl.
Date Recue/Date Received 2022-01-20

80
22. Pancreatic disease virus vaccine component comprising inactivated
salmonid alphavirus, wherein said salmonid alphavirus is selected from the
group consisting of
a. the virus strains deposited under the Budapest Treaty at the ECACC
under deposit number V94090731 and with the European Collection
of Cell culture (ECACC), Health Protection Agency, Porton Dawn,
Salisbury, Wiltshire (UK), SP4 0JG UK on December 12 2007 under
Deposit numbers 07121201 and 07121202, and
b. a strain which is a mutant of any one of the strains in a). and which
prior to inactivation has a visible cytopathogenic effect during early
passage in cell culture, and wherein the virus induces mortality of at
least 25% in a laboratory challenge model, said model comprising
smoltifying Atlantic salmon according to standard methods and
challenging of the post-smolts by intraperitoneal injection with a
SAV3 dose of at least 10 8 TCID50 per fish, within one day after
transfer to seawater at 12°C.
23. Virus vaccine component according to claim 22, wherein said salmonid
alphavirus has been inactivated by addition of formaldehyde.
24. Virus vaccine component according to claim 22 or 23, wherein said
salmonid alphavirus is inactivated using a procedure comprising addition
of 1.5-2.5 g/kg, formaldehyde and subsequent incubation for 12-96 hours
at a temperature from 13-17 °C.
25. An isolated salmonid alphavirus of the subtype SAV3, said salmonid
alphavirus being selected from the group consisting of
a) the virus strains deposited under the Budapest Treaty at the
ECACC
under deposit number V94090731 and with the European Collection of
Cell culture (ECACC), Health Protection Agency, Porton Dawn, Salisbury,
Wiltshire (UK), 5P4 0JG UK on December 12 2007 under Deposit numbers
07121201 and 07121202, and

81
b) a strain or isolate which is a mutant of, or is a variant
of, any of the
deposited virus strains in a), wherein the virus has a visible
cytopathogenic effect during early passage in cell culture, and wherein
the virus induces mortality of at least 25% in a laboratory challenge
model, said model comprising smoltifying Atlantic salmon according to
standard methods and challenging of the post-smolts by intraperitoneal
injection with a SAV3 dose of at least 108 TCIDso per fish, within one day
after transfer to seawater at 12 C.
26. The isolated virus according to claim 25, wherein said virus has a
visible
cytopathogenic effect during the first, second, third or fourth passage on a
culture of CHSE cells.
27. The isolated virus according to claim 25, wherein the virus induces
mortality of at least 25% in a laboratory challenge model, said model
comprising smoltifying Atlantic salmon according to standard methods and
challenge of the posts-molts by intraperitoneal injection with a SAV3 dose
of at least 3.5 x 108 TCIDso per fish.
28. The isolated virus according to any one of claims 25-27, wherein the
virus
has the ability of growing to a titre, in a supernatant/growth medium, of
at least 1x108 TCIDso/m1 when cultured using host cells which are selected
from the group consisting of CHH-1 cells and CHSE-214 cells.
29. The isolated virus according to claim 28, wherein said titre of at
least
1x108TCIDso/m1 is obtained when:
a. Cells are cultured using host cells which have been seeded at a
density of 0.1-1x105 cells cm2 ;
b. The host cells are cultured for 4-6 days prior to virus infection;
c. The host cells are grown to a density of from 0 .1-1. 0 x 106 cells
cm-2 at the time of infection with said virus isolate;
Date Recue/Date Received 2022-01-20

82
d. The host cells are cultured in a growth medium comprising EMEM
(EBSS)+ 10% Fetal Bovine Serum (FBS) + 2mM L-Glutamine + 1%
Non Essential Ami no Acids (NEAA) + 0.1% gentamicine; and
e. The infected cells are cultured at a temperature of 15 C, for a period
of 10-14 days.
30. The isolated virus according to any one of claims 25-29, wherein said
virus comprises a nucleic acid sequence which is at least 95% identical to
the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO:
3.
31. The isolated virus according to any one of claims 25-30, wherein said
virus comprises a nucleic acid sequence which is at least 98% identical to
the sequence set forth in SEQ ID NO: 4, SEQ ID NO: 5 and/or SEQ ID NO:
6.
32. The isolated virus according to any one of claims 25-31, wherein the
virus
is a mutant of any one of the strains in claim 25 a), wherein the virus is
positive in a SAV reverse transcriptase quantitative PCR-identity test using
a primer set corresponding to the primers set forth in SEQ ID NO: 7 and 8
and the conditions 50 C, 30 min - 95 C, 10 min -(95 C, 30 sec- 57 C,
60 sec- 72 C, 30 sec)*40.
33. The isolated virus according to any one of claims 25-32, wherein said
virus is a genetic variant of any one of the virus strains deposited under
the Budapest Treaty at the ECACC under deposit number V94090731 and
with the European Collection of Cell culture (ECACC), Health Protection
Agency, Porton Dawn, Salisbury, Wiltshire (UK), SP4 OJG UK on December
12 2007 under Deposit numbers 07121201 and 07121202.
Date Recue/Date Received 2022-01-20

Description

1
Polyvalent vaccine against salmonid alphavirus infections
Technical field of the invention
The present invention relates to veterinary immunology and in particular to
means for preventing or controlling infections with salmonid alphaviruses and
outbreaks of fish pancreatic disease or sleeping disease using a polyvalent
vaccine, such as a polyvalent vaccine including both viral and bacterial
antigens.
Background of the invention
Pancreas disease has become a serious disease in farmed salmonids in several
geographical areas. The disease was first reported from Scotland, and has
later
been reported from Ireland, Norway and North America. As of 2007 pancreatic
disease had become endemic in most salmon rearing sites in Ireland and there
have been reports of isolated outbreaks of pancreatic disease in North
America. A
differential diagnosis, sleeping disease, is endemic in parts of France and
has also
been reported in Italy and Spain (McLoughlin & Graham, 2007). Recently, there
have been informal reports that pancreas disease has also been observed in
Chile.
In Norway the disease has spread over the last 10 years with 58 confirmed
infected sites in 2006 and 98 confirmed infected sites in 2007. In 2006, the
disease also spread to the county More og Romsdal, situated north of the
earlier
defined geographical area affected by salmonid pancreas disease. Pancreas
disease is now the major health problem for the aquaculture industry in the
western part of Norway. Pancreas disease (PD) and the related sleeping disease
are both caused by alphaviruses, and can not be treated by any therapeutics.
The first alphavirus was isolated from fish in 1995 (Nelson et al 1995).
Today,
alphaviruses have been isolated from both Atlantic salmon suffering from
pancreas disease, and rainbow trout suffering from sleeping disease
(McLoughlin
and Graham 2007).
The salmonid alphaviruses (SAV) are spherical (approximately 65 nm in
diameter)
enveloped RNA viruses. They contain a single stranded positive-sense RNA
genome of 11-12 kB (McLoughlin and Graham 2007). In EP patent 712,926 it is
Date Recue/Date Received 2020-08-14

2
described as being sensitive to chloroform, rapidly inactivated at pH=3 and at
50 C and with a buoyant density of 1.20 g/ml. Nucleotide sequencing studies
assigns the salmonid alphaviruses to three genetically different subtypes
(Powers
et al 2001, Hodneland et al 2005, Weston et al 2005). Salmonid alphavirus 2
(SAV2) is the causative agent of sleeping disease in rainbow trout, salmonid
alphavirus 1 (SAV1) cause pancreas disease in Atlantic salmon in Ireland and
Scotland, while salmonid alphavirus 3 (SAV3) cause pancreas disease in
Atlantic
salmon and sea reared rainbow trout in Norway. Recently, SAV4, SAV5 and SAV6
have been identified as subtypes related to SAV1.
In Norway, all farmed Atlantic salmon are vaccinated against the most common
bacterial diseases and very often against infectious pancreatic necrosis virus
(IPNV) before transfer to sea. While comprehensive vaccination programs are
certainly desirable in order to avoid economic losses and further dissipation
of
infectious diseases, such programs are also associated with technical
challenges.
Administration of vaccines requires extensive handling of the fish, causing
stress
and mortality since the fish must be pumped into holding tanks, transferred to
a
tank with anesthesia, injected with vaccine and pumped back to holding tanks.
Due to the large scale of modern aquaculture such vaccination programs are
costly and labor-intensive and cause stress to the fish. For these reasons,
vaccines against the various infectious diseases are preferentially
administered in
combined, polyvalent vaccines containing several antigens.
In theory, combination of vaccines should be straightforward. In practice,
however, combining multiple vaccine antigens often leads to reduced efficacy
of
each individual antigen. Such problems associated with polyvalent vaccines are
discussed for instance in Andre, E.F. (1999), which provides a review on
strategies for human pediatric vaccination programs. Similar problems are of
concern in animal vaccination programs, e.g. with respect to vaccines against
ovine footrot as reviewed by O'Meara et al. (1993).
Despite the fact that the salmonid alphavirusses were isolated and
characterized
more than a decade ago, vaccination against pancreatic disease remains a
challenge. In EP patent 712,926, example 11 presents data showing that a
, composition intended for vaccination purposes based on pancreatic disease
virus
SAV1, inactivated by addition of beta-propiolactone and NaOH is ineffective in
Date Recue/Date Received 2020-08-14

3
protecting against subsequent infection. In the same experiment, a composition
based on PDV treated with 0.1% formalin (35-38%) appears to elicit a
protective
immune response in experimental settings. However, since treatment with 0.1%
formalin is inadequate to inactivate PDV, one must conclude that the latter
composition is one of live virus. Both compositions contained PD virus of the
SAV1
subtype at a titre of 107.5TCID50m1-1.
As of February 2008 only one PD-vaccine, sold under the name Norvac compact
PD, was commercially available. The vaccine is based on inactivated PD virus
of
the SAV1 subtype: A first generation product contained antigen in amounts of
107'2TCID50/dose at a dosage volume of 100 I. A second generation product has
been developed containing 107=5TCID50/dose. Rodger & Mitchell (2005)
investigated the effect of this vaccine: For 2003 they found that vaccination
did
not reduce the risk of outbreaks of pancreatic disease; for 2004 it appeared
that
vaccinated fish had a somewhat lower risk of infection, however, the result
was
not statistically significant. Further, in mixed populations of vaccinated and
non-
vaccinated fish there was a tendency of lower mortality in the vaccinated
fish.
In the Summary of Product Characteristics, Norvac compact PD is described as
being incompatible with other vaccines and immunological products.
Accordingly,
this monovalent PD-vaccine is recommended only for injection at least 210
- 20 degree days before injection of other multivalent vaccines protecting
against
common bacterial diseases and IPNV in farmed fish (Degree days are calculated
as the product of days and temperature: 10 days with a temperature of 100C
equals 100 degree days). Under normal conditions Norvac compact PD must be
administered 2 -3 weeks prior to administration of a polyvalent vaccine.
According to the Summary of Product Characteristics, no information is
available
on the safety and efficacy from the concurrent use of this vaccine with any
other
immunological product. However, the stated lack of compatibility with other
vaccines is consistent with previous reports of multivalent PD-vaccines
failing to
elicit good protection against pancreas disease (Christie et al 1999 A,
Intervet
newsletter 2002, Christie et al 1999 B). Christie reported induction of
neutralizing
antibodies in 60% of individuals vaccinated with a monovalent PD-vaccine. The
modest efficacy was severely compromised when the vaccine was combined with
Date Recue/Date Received 2020-08-14

4
other immunological products since the resulting polyvalent vaccine induced
neutralizing antibodies in only 20% of vaccinated individuals.
In EP 1 075 523, the inventors are also concerned with the problem of PD-
vaccines being incompatible with other vaccines. Paragraph [0004] states: "A
drawback in the production of inactivated vaccines from the PD virus described
in
EP-A-712926 is the slow growth of the virus, in particular on cell cultures,
which
makes the manufacturing of said vaccines a relatively inefficient process. A
further drawback with the inactivated vaccines is the instability of the
inactivated
virus in the presence of other inactivated pathogens resulting in potency
loss. Fish
vaccines are generally produced as multivalent vaccines, and significantly
higher
amounts of inactivated virus are required in the multivalent vaccines than
would
be necessary in a monovalent vaccine to compensate for the loss of potency."
The
inventors point to recombinant protein vaccines as a solution, but such
recombinant vaccines have never been implemented in the management of
pancreatic disease.
In conclusion, existing vaccination programs against fish pancreatic disease
remain inefficient and have not been able to stop dissipation of the disease.
Also,
according to the general notion in the field, PD vaccines based on inactivated
virus are only available at high production costs and they are incompatible
with
vaccines against other infectious diseases prevailing in farmed fish.
Therefore, there is still an urgent need for effective means for controlling
fish
pancreatic disease, both for ethical and economical reasons.
Summary of the invention
An object of the present invention relates to compositions and vaccines
allowing
combined and simultaneous vaccination against pancreatic disease and one or
more other infectious diseases.
In particular, one aspect of the invention relates to a composition comprising
salmonid alphavirus or an antigenic and/or immunogenic material derived
thereof,
combined with one or more components selected from the group consisting of:
a. a live, attenuated, killed or inactiated bacterium,
Date Recue/Date Received 2020-08-14

5
b. a virus other than salmonid alphavirus, said virus preferably being
attenuated or inactivated,
c. a fungus,
d. a parasite; and
e. an antigenic and/or immunogenic material derived from said bacterium
in a), from said virus in b), from said fungus in c) or from said parasite
in d).
Another aspect of the invention provides a dosage form of a composition
according to the invention.
Yet another aspect of the present invention relates to a vaccine comprising a
composition as defined above.
Further aspects of the present invention provide:
A composition as described above for use in medicine;
A composition as described above for use in preventing, or reducing the
incidence of fish pancreatic disease;
A composition as described above for use in preventing or reducing the -
incidence of infection by salmonid alphavirus;
Use of an inactivated salmonid alphavirus (SAV) in the manufacture of a
vaccine or an immunological composition which is compatible with other
immunological products;
Use of a composition acording to the invention for the manufacture of a
medicament/vaccine for preventing or reducing the incidence of infection by
salmonid alphavirus;
Use of a composition as described above for the manufacture of a
medicament/vaccine for preventing or reducing the incidence of fish
pancreatic disease.
Another aspect of the invention pertains to the use of an inactivated salmonid
alphavirus (SAV) in the manufacture of a vaccine or an immunological
composition
for administration simultaneously or in combination with one or more antigenic
components selected from the group consisting of:
a) a killed bacterium,
Date Recue/Date Received 2020-08-14

6
=
b) an inactivated virus other than a salmonid alphavirus,
c) a fungus,
d) a parasite; and
e) an antigenic and/or immunogenic material derived from said bacterium
in a), from said virus in b), from said fungus in c) or from said parasite
in d).
In a related aspect the invention provides the use of an inactivated salmonid
alphavirus (SAV) in the manufacture of a dosage form for administration
simultaneously or in combination with one or more antigenic components
selected
from the group consisting of:
a) a killed bacterium,
b) a inactivated virus other than a salmonid alphavirus,
c) a fungus,
d) a parasite; and
e) an antigenic and/or immunogenic material derived from said bacterium
in a), from said virus in b), from said fungus in c) or from said parasite
in d).
Still another aspect of the present invention is to provide a method of
manufacturing a composition or a vaccine as described above, said method
comprising combining a preferably inactivated salmonid alphavirus or an
antigenic
and/or immunogenic material derived thereof with one or more components
selected from the group consisting of:
i) a live, attenuated or killed bacterium,
ii) a virus other than salmonid alphavirus, said virus preferably being
attenuated or inactivated,
iii) a fungus,
iv) a parasite; and
v) an antigenic and/or immunogenic material derived from said
bacterium in a), from said virus in b), from said fungus in c) or from
said parasite in d).
Date Recue/Date Received 2020-08-14

7
Still further aspects of the invention provide a method of reducing the
incidence of
and/or treating or preventing infection by Salmonid Alphavirus in a fish
population, said method comprising administering to the fish a composition or
a
dosage form as provided according to the invention.
In a final aspect the invention provides a method of improving a polyvalent
vaccine, said method comprising including in the polyvalent vaccine an
attenuated
or inactivated salmonid alphavirus.
Brief description of the figures
Figure 1 shows SAV3 titres in crude supernatants from CHH-1 cell cultures
inoculated with different SAV3 isolates or passages of isolates.
Figure 2 is a representation of SAV3 titres in crude supernatants from SAV3-
infected CHSE-214 cell cultures.
Figure 3 A and B shows the % accumulated mortality after challenge of Atlantic
salmon smolts with salmonid alphavirus type 3 (SAV3). The figure further shows
the effect of vaccinating the fish in the parr stage against salmonid pancreas
disease using a polyvalent vaccine according to the invention. Two parallel
experiments were conducted in separate challenge tanks (A and B).
The present invention will now be described in more detail in the following.
Detailed description of the invention,
The present invention is based on the observation that despite prior reports
to the
contrary, development of polyvalent vaccines combining inactivated salmonid
alphavirus with vaccines against other fish pathogens is in fact the most
effective
way of protecting reared salmon against pancreatic disease. In particular, the
present inventors made the following observations:
i) Despite testing various different vaccine formulations it was
not
possible to establish any adverse effect other vaccine components on
Date Recue/Date Received 2020-08-14

8
the stability of the pancreatic disease antigen. In other words: PD-
vaccines based on inactivated virus are highly compatible with vaccines
against currently prevailing fish pathogens;
ii) in vaccines based on inactivated virus, a minimum antigen
titre in the
range of 3,75x107 TCID50/dose appears to be desirable in order to
effectively induce protective immunity, indicating that previous
vaccination programs have been based on vaccines containing
= insufficient amounts of antigen;
iii) titres of salmonid alphavirus sufficient for large scale
manufacture of
vaccines with high efficacy can indeed be obtained using conventional
technology for virus propagation and at a reasonable cost;
Microbiological material
In connection with the present invention, isolates of salmonid alphaviruses
have
been deposited under the Budapest Treaty with the European Collection of Cell
Culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire
(UK), SP4 03G UK on the 12 December 2007 under the following accession
numbers: 07121201, corresponding to isolate ALV405 in the examples;
07121202, corresponding to isolate ALV 407 in the examples; and 07121203
corresponding to isolate ALV 409 in the examples.
The present invention pertains to compositions which, in addition to salmonid
alphaviruses or parts thereof, comprise other antigenic components. Polyvalent
vaccines containing antigens from typical fish pathogens other than salmonid
alphaviruses are well known in the art and are already commercially available.
The identification and isolation of suitable antigens to be used in such
vaccines
are described in the literature, thus providing the skilled person with the
capacity
to generate and manufacture such polyvalent vaccines. In addition,
representative isolates of relevant fish pathogens are available with no
restrictions from various sources. For instance, the following bacterial
species are
available from LGCPromochem/American Type Culture Collection ATCC repository
and distribution center (ATCC): A. salmonicida (ATCC 336581m, country of
origin:
not provided), Aeromonas hydrophila, V. salmonicida (ATCC 43839TM, country of
origin: Norway), V. anguillarum serotype 01(ATCC 433051m, country of origin:
Denmark) and 02(ATCC 192641m, country of origin: not provided), and Monte/la
Date Recue/Date Received 2020-08-14

9
viscosa (ATCC BAA1O5TM, country of origin: Norway), Flavobacterium columnaris
(deposited as Cytophaga columnaris) is available under ATCC number 23463TM
(Country of origin: USA).
As for Piscirickettsia salmonis, the present Applicant has deposited several
useful
isolates under the Budapest Treaty with the European Collection of Cell
Culture
(ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4
OJG UK: three isolates are deposited on 9 June 2006 under accession numbers
06050901, 06050902, and 06050903 (isolate AL10005, AL10007 and AL10008).
A single isolate was deposited on 21 March 2007 under accession number
07032110 (country of origin: Chile). In a similar manner representative
isolates of
relevant viral species are available, including infectious pancreatic necrosis
virus
(IPNV, ATCC VR-1318, country of origin: not provided), Viral Hemorrhagic
Septicemia Virus (VHSV, ATCC VR_1389, country of origin: Denmark); Infectious
Hematopoietic Necrosis virus (IHNV, ATCC VR-1392, country of origin: USA));
Pancreatic Necrosis Virus; Spring Viremia of Carp (SVC, ATCC VR-1390, country
of origin: Denmark); Channel Catfish Virus (CCV) (ATCC VR-665, country of
origin: USA); Infectious Salmon Anaemia (ISA) virus (ATCC VR-1554, country of
origin: Canada).
Patent deposits have previously been made by the present applicant of the
following viral species: Heart and Skeletal Muscle Infection Virus (HSMIV,
patent
deposit nr ECACC 04050401, country of origin: Norway); Cardiomyopathic
syndrome virus (CMSV, patent deposit nr ECACC 07032902, country of origin:
Norway).
Definitions
Prior to discussing the present invention in further details, the following
terms and
conventions will be defined:
"An antigenic and/or immunogenic material" in the present context refers to a
material which contains one or more protective epitopes. An epitope is
protective
if it can induce an immune response which is capable of effectively
interfering
= with the extent or progression of infection with salmonid alphavirus,
including
SAV1, SAV2 and, in particular, SAV3. The term comprises polypeptides,
including
Date Recue/Date Received 2020-08-14

10
polypeptides which are prepared using recombinant techniques, and parts of
such
polypeptides.
The term "genotypic characteristics" refers broadly to the composition of one
or
more parts of an individual's genome which contributes to determining a
specific
trait.
In relation to the virus according to the invention, the term "related
genotypic
characteristics" is used in relation to viruses which possess nucleic acid
sequences
with a high degree of sequence identity when compared with known nucleic acid
sequences of previously isolated salmonid alphaviruses. Comparison may be
made with the nucleic acid sequences which encode any one of the nsPl, nsP2,
nsP3 and nsP4 non-structural proteins. Further, comparison may be made with
the nucleic acid sequences which encode the capsid, glycoprotein E2,
glycoprotein
E3 or 6K and gpEl proteins. In particular, the term is used to define viruses
which
have nucleic acid sequences with a high degree of sequence identity when
compared with any such known amino acid sequences of deposited isolates
ALV405, ALV 407 and/or ALV 409. For the purpose of defining the viral isolates
used in relation to the present invention, reference is made in particular to
nucleic
acid sequences of the glycoprotein E2 and the nsP3 non-structural protein as
provided herein and identified by SEQ ID NOs: 1-6. It will therefore be
understood that the virus according to the invention possess nucleic acid
sequences which are at least 80% identical, such as at least 85%,90%, 95%,
96%, 97%, 98%, 99%, 99.5%, 99.8% or 99.9 k identical to the nucleic acid
sequences of glycoprotein E2 and nsP3 non-structural protein as provided
herein
and identified by SEQ ID NOs: 1-6. The term "sequence identity" indicates a
quantitative measure of the degree of homology between two amino acid
sequences or between two nucleic acid sequences of equal length. If the two
sequences to be compared are not of equal length, they must be aligned to give
the best possible fit, allowing the insertion of gaps or, alternatively,
truncation at
the ends of the polypeptide sequences or nucleotide sequences. The sequence
(Nõf-N,,,4/00
identity can be calculated as N-f , wherein Ndif is the total number of
non-
identical residues in the two sequences when aligned and wherein Nref is the
number of residues in one of the sequences. Hence, the DNA sequence
AGTCAGTC will have a sequence identity of 75% with the sequence AATCAATC
Date Recue/Date Received 2020-08-14

11
(Ndif=2 and Nref=8). A gap is counted as non-identity of the specific
residue(s),
i.e. the DNA sequence AGTGTC will have a sequence identity of 75% with the
DNA sequence AGTCAGTC (Ndif=2 and Nref=8).
With respect all embodiments of the invention relating to nucleotide
sequences,
the percentage of sequence identity between one or more sequences may also be
based on alignments using the clustalW software
(http:/www.ebi.ac.uk/clustalW/index.html) with default settings. For
nucleotide
sequence alignments these settings are: Alignment=3Dfull, Gap Open 10.00, Gap
Ext. 0.20, Gap separation Dist. 4, DNA weight matrix: identity (IUB).
Alternatively, nucleotide sequences may be analysed using programme DNASIS
Max and the comparison of the sequences may be done at
http://www.paralign.org/. This service is based on the two comparison
algorithms
called Smith-Waterman (SW) and ParAlign. The first algorithm was published by
Smith and Waterman (1981) and is a well established method that finds the
, 15 optimal local alignment of two sequences. The other algorithm,
ParAlign, is a
heuristic method for sequence alignment; details on the method are published
in
Rognes (2001). Default settings for score matrix and Gap penalties as well as
E-
values were used.
The term "phenotypic characteristics" refers equally broadly to one or more
observable properties of an organism that are produced by interaction of the
inherited genotype of the individual with transmitted epigenetic factors,
and/or
non-hereditary environmental variation. In the context of the present
invention,
the term "related phenotypic characteristics" include any of the following
characteristics: size, shape, pH stability, temperature stability, chloroform
sensitivity and haemaglutination.
"Phenotypic characteristics further include the ability to induce any of the
clinical
signs of pancreatic disease and sleeping disease, including gross pathological
signs and histopathological signs as described in the present application.
"Phenotypic characteristics" also include the ability of the virus to
introduce such
clinical signs in a laboratory challenge experiment as described herein. Still
further, the term refers to the performance of the virus when grown on cell
Date Recue/Date Received 2020-08-14

12
cultures, including growth kinetics and the ability to induce a cytopathogenic
effect.
The expressions SAV1, SAV2 and SAV3 defines subtypes of salmonid
alphaviruses: the SAV1 subtype is defined and characterised in Nelson et al.
Diseases of Aquatic Organisms, 22, 25-32, 1995 and a representative isolate
has
been deposited at ECACC under deposit number V94090731. The SAV2 subtype,
on the other hand, is the causative agent of "sleeping disease" and was first
isolated and characterised by Castric et al. Bulletin of the European
Association of
Fish Pathologists 17, 27-30, 1997. The SAV3 subtype was first isolated and
characterized by Hodneland et al. as described in Dis Aquat Organ. 2005 Sep
5;66(2):113-20 (Erratum in: Dis Aquat Organ. 2005 Nov 9;67(1-2):181). The
terms SAV4, SAV5 and SAV6 define novel subtypes of the salmonid alphaviruses
found near Scotland and Ireland.
As the skilled person will understand, "cytopathogenic effect" refers to
visible
morphologic changes in cells infected with viruses. It may in particular
include
shutdown of cellular RNA and protein synthesis, cell fusion, release of
lysosomal
enzymes, changes in cell membrane permeability, diffuse changes in
intracellular
structures, presence of viral inclusion bodies, and chromosomal aberrations.
The term "component or part of said virus" refers to a component or part of
the
nucleic acid core of the virus or of the surrounding protein coat.
"Cell culture" refers to cultures of cells, such as transformed cells,
established in
vitro. Specifically, as used herein, "cell line" refers to a population of
cells capable
of continuous or prolonged growth and division in vitro. Often, cell lines are
clonal
populations derived from a single progenitor cell. It is further known in the
art
that spontaneous or induced changes can occur in karyotype during storage or
transfer of such clonal populations. Therefore, cells derived from the cell
line
referred to may not be precisely identical to the ancestral cells or cultures,
and
the cell line referred to includes such variants. The term "cell lines" also
includes
immortalized cells.
The term "adjuvant" is used within its normal meaning, defining an agent that
may stimulate the immune system and increase the response to a vaccine without
having any specific antigenic effect in itself.
Date Recue/Date Received 2020-08-14

13
Similarly the term "emulsifier" is conventionally used to define a substance
which
stabilizes an emulsion, frequently a surfactant.
The term "detergent" defines another class of surfactant, which chemically
will
interact with both oil and water, thus stabilizing the interface between oil
or water
droplets in suspension.
Emulsions comprising water and oil are generally referred to as either water-
in-oil
emulsions, oil-in-water or water-in-oil-in-water emulsions. Whether an
emulsion
turns into a water-in-oil emulsion or an oil-in-water emulsion depends on the
volume fraction of both phases and on the type of emulsifier. Generally,
emulsifiers and emulsifying particles tend to promote dispersion of the phase
in
which they do not dissolve very well. Proteins, for instance dissolve better
in
water than in oil and so tend to form oil-in-water emulsions (i.e., they
promote
the dispersion of oil droplets throughout a continuous phase of water).
In the present context, a "surfactant", also known as "a tenside", is a
wetting
agents that lowers the surface tension of a liquid, allowing easier spreading,
and
lower the interfacial tension between two liquids.
Finally, in the context of the present invention, a "polyvalent vaccine" (also
known
as multivalent vaccine) is used to define a combination of several antigens in
one
vaccine. Thus, a polyvalent vaccine may protect against more than one disease.
As opposed to a polyvalent vaccine, a "monovalent vaccine" is a vaccine
containing vaccine components directed at only one pathogen. In particular, a
monovalent vaccine may contain only one antigen, protecting against one
particular disease.
Composition
According to a first aspect the present invention provides a composition
comprising a Salmonid Alphavirus or an antigenic andjor immunogenic material
derived thereof, combined with one or more components selected from the group
consisting of:
a. a live, attenuated, killed or inactivated bacterium,
b. a virus other than Salmonid Alphavirus, said virus preferably being
attenuated or inactivated,
=
Date Recue/Date Received 2020-08-14

14
c. a fungus,
d. a parasite; and
e. an antigenic and/or immunogenic material derived from said
bacterium in a), from said virus in b), from said fungus in c) or from
said parasite in d).
Although compositions based on subunits of the virus, e.g. compositions
comprising recombinant antigens may be contemplated, it is preferred that the
compositions according to the invention are prepared on the basis of cultures
of
the virus. For the purpose of the present invention it is desirable that the
composition contains salmonid alphavirus at a titre of at least
7.5x108TCID50/ml.
While naturally occurring non-virulent strains of the salmonid alphaviruses
virus
and strains of the virus that have been attenuated in the laboratory may be
contemplated, the composition according to the invention preferably contains a
salmonid alphavirus which is killed or inactivated.
Similarly, the bacterial, fungal and parasitic components of the vaccine are
preferably killed or by other means made incapable of infecting/infesting the
fish.
Inactivation of the virus may be obtained by chemical or physical means.
Chemical inactivation can be carried out by treatment of the viruses by for
example, but not limited to, treatment with enzymes, with formaldehyde, 13-
propiolactone or ethyleneimine or a derivative thereof, with organic solvent
(e.g.
halogenated hydrocarbon) and/or detergent, e.g. Triton or Tween .
Physiological inactivation can advantageously be carried out by subjecting the
viruses to energy-rich radiation, such as UV light, gamma irradiation or X-
rays. If
necessary, the inactivating agent can be neutralized with thiosulphate. If
25 required, the pH is subsequently returned to about pH 7.
While inactivation with formaldehyde has previously been considered sub-
optimal
as a means for inactivating salmonid alphavirus, the present inventors have
experienced that formaldehyde inactivation is indeed a useful approach. In a
preferred embodiment the virus is inactivated by addition of 1.5-2.5 g/kg of
30 formaldehyde and subsequent incubation for 12-96 hours, such as for 48-84
hours at a temperature from 13-17 C, such as from 14-160C.
Date Recue/Date Received 2020-08-14
=

15
The virus is incubated with formaldehyde for a period of 12-96 hours, such as
from 24-96 hours, from 36-96 hours, from 36-72 hours, from 36-60 hours, or
such as from 48-96 hours, from 48-72 hours or such as from 48-60 hours. The
inventors have found that when using 2,0 g/kg formaldehyde, a 48 hour-
incubation is generally sufficient in order to ensure adequate inactivation of
the
virus. However, in order to meet specific regulatory requirements longer
incubation periods may be preferred, such as an incubation period of at least
72
hours. The virus is preferably incubated with formaldehyde at a temperature of
13-17 C, such as at a temperature of 14-17 C, 15-17 C, 16-17 C, 13-16 C, 13-
15 C, 14-16 C or such as a temperature of 14-15 C.
As for the bacterial components of the composition it is likewise to be
understood
that several applicable methods for inactivation are available to the skilled
person.
In presently preferred embodiments, the bacteria have been inactivated using a
procedure comprising addition of 3.5-4.5 g/kg formaldehyde and subsequent
incubation for 1-2 hours at a temperature of 20 C
While each of the viral, bacterial, fungal and parasitic, components of the
vaccine
may be killed or inactivated prior to being combined with the other
components,
=
they may also me inactivated or killed subsequent to being added to the
vaccine.
In further embodiments the said live attenuated, killed or inactivated
bacterium is
of a species which is a recognised fish pathogen. Accordingly, bacterium is
preferably selected from the group consisting of bacteria of the species
Piscirickettsias spp., Aeromonas spp., Vibrio spp., Listonella spp., Monte/la
viscosa, Photobacterium damsela, Flavobacterium spp., Yersinia spp.,
Pen/bacterium spp., Streptococcus spp., Lactococcus spp., Leuconostoc spp.,
Bifidobacterium spp., Pedlococcus spp., Brevibacterium spp., Edwarsiella spp.,
Francisella spp., Pseudomonas spp., Cytophaga spp., Nocardia spp., Haphnia
spp.
and Mycobacerium spp.
According to more specific embodiments the bacterium is selected from the
group
consisting of Aeromonas spp., Vibrio spp., Flavobacterium spp., Haphnia spp.,
Piscirickettsia spp. and Monte/la viscosa. Even more specifically, the
bacterium is
selected from the group consisting of Aeromonas hydrophila, Aeromonas
Date Recue/Date Received 2020-08-14

16
salmonicida, Vibrio salmonicida, Vibrio anguillarum, Vibrio ordali,
Flavobacterium
columnar's, Haphnia sp., Piscirickettsia salmon's and Monte/la viscosa.
In certain preferred embodiments the composition according to the invention
comprises killed or inactivated bacteria of one or more species selected from
the
group consisting of A. salmonicida, V. salmonicida, V. anguillarum and M.
viscosa.
According to equally preferred embodiments the composition comprises, said
bacteria are of the species Vibrio ordali and/or Piscirickettsia salmon's.
According to other embodiments the composition comprises bacteria of one or
more species selected from the group consisting of Aeromonas hydrophila,
Flavobacterium columnaris and Haphnia sp.
In certain embodiments, the composition according to the invention is
contemplated primarily for use in relation to farming of Atlantic salmon, in
particular in the northern Atlantic. Bacteria of the species Aeromonas sp. in
particular A. salmonicida; Vibrio sp., in particular V. salmonicida and V.
anguillarum serotype 01 and 02; and Monte/la viscosa, provide a challenge to
fish
farming in Norwegian waters and therefore it may be preferred that the live
attenuated killed or inactivated bacterium in the composition according to the
invention is selected from this particular group of bacterial species.
In alternative embodiments, the composition is intended for use in South
America,
including Chile, and in these embodiments the bacterium is selected from the
group of bacterial species consisting of Vibrio sp, in particular Vibrio
ordali, and
Piscirickettsia sp., in particular Piscirickettsia salmon's.
In other alternative embodiments, primarily intended for use in South East
Asia,
the bacterium is selected from ths group consisting of:Aeromonas sp., in
particular Aeromonas hydropnila, Flavobacterium sp., in particular
Flavobacterium
columnar/s1 and Haphnia sp.
In a similar manner, the said virus other than Salmonid Alphavirus is a
recognised
fish pathogen. Accordingly, it is preferably selected from the group
consisting of:
infectious pancreatic necrosis virus (IPNV), Viral Hemorrhagic Septicemia
Virus
(VHSV); Viral Hemorrhagic Septicemia Virus (VHSV); Infectious Hematopoietic
Necrosis virus (IHNV); Pancreatc Necrosis Virus; Spring Viremia of Carp (SVC);
Date Recue/Date Received 2020-08-14

17
Channel Catfish Virus (CCV); Infectious Salmon Anaemia (ISA) virus; nodavirus;
iridovirus, koi herpes virus; Heart and Skeletal Muscle Inflammation Virus
(HSMV)
and Cardiomyopathy Syndrome Virus.
Of these viruses, infectious pancreatic necrosis virus (IPNV) is particularly
relevant
in relation to Norwegian farming of salmon. Therefore, it is preferred in
certain
embodiments that said virus other than salmonid alphavirus is infectious
pancreatic necrosis virus (IPNV).
The fungus is preferably selected from the group consisting of: Saprolegnia
Sp.,
Branchiomyces sanguinis, Branchiomyces demigrans and Icthyophonus hoferi.
Furthermore, the parasite may in particular be selected from the group
consisting
of: Lepeophtheirus Sp., Caligus Sp. and khthyophthirius Sp.
For the sake of convenience it is often preferred that approaches to
controlling
infections in fish populations are aimed at all, or at least most of the
potentially
relevant pathogens. Therefore, it may be preferred that the composition
according
to the invention comprises two or more viral, bacterial, fungus and/or
parasite
components as defined above, such as 3 or more, 4 or more, 5 or more, 6 or
more, 7 or more, 8 or more, 9 or more or 10 or more components as defined
above. In particular, compositions according to the invention may comprise 2,
3,
4, 5, 6, 7, 8 or 10 viral, bacterial, fungus and/or parasite components
selected
amongst those defined above.
It will be understood that the composition according to the invention should
contain antigens in amounts which are sufficient in order to elicit an immune
response, preferably a protective response, after injection of the composition
into
a fish. In general, it is preferred that the composition according to the
invention
has a relatively high content of Salmonid Alphavirus as this is believed to
improve
the protective immune response when the composition is used for vaccination
purposes. The present inventors have observed that, in general, it is possible
to
culture salnnonid alphavirus to reach a satisfactory titre in cell culture,
and that
production costs do not hamper the development of multi-valent vaccines.
Further, the availability of isolates of a particular SAV3 subtype which
exhibit
excellent growth kinetics when grown on cell cultures has allowed the present
Date Recue/Date Received 2020-08-14

18
inventors to develop an extremely cost-effective Pancreatic Disease Virus
vaccine
component.
In particular, the vaccine may comprise an amount of salmonid alphavirus
antigen, such as an amount of SAV3 antigen, which corresponds to 1.5x108-
lx1011 TCID50/m1 vaccine, such as from 1.5x108-5x1010, from 1.5x108-1x1010
,
from 1.5x108-5x109, from 1.5x108-2x109, from 1.5x108-9x108, from 1.5x108-
8x108, from 1.5x108-7x108, 1.5x108-6x108, 2.5x108-1x1011, 5x108-1x1011,
7.5x109-1x1011, 1x101 -1x1011, 2.5x101-9-1x1011, 5x1010-1x1011, 7.5x101 -
1x1011,
2.5x108-7.5x1010, 5x108-5x1010, 5x108-7x109, 5x108-6x109, 5x108-5x109,
5x108-4x109, 5x108-3x109, 5x108-2x109, from 5x108-1x109, 6x108-7x109, 6x108-
6x109, 6x108-5x109, 6x108-4x109, 6x108-3x109, 6x108-2x109, 6x108-1x109,
7x108-7x109, 7x108-6x109, 7x108-5x109, 7x108-4x109, 7x108-3x109, 7x108-
2x109, 7x108-1x109, 8x108-7x109, 7.5x108-1x101 , 8x108-6x109, 8x108-5x109,
8x108-4x109, 8x108-3x109, 8x108-2x109, 8x108-1x109, 9x108-7x109, 9x108-
6x109, 9x108-5x109, 9x108-4x109, 9x108-3x109, or from 9x108-2x109, 1x109-
7.5x10' , 7.5x108-5x1010, 1x109-2.5x101 , 1x109-1x1010, 1x109-8x109, 1x109-
5x109, 1x109-2.5x109, 2.5x109-1x101 or from 5x109-7.5x109 TCID50/m1 vaccine.
As the skilled person will be aware, several methods and means for
administration
of vaccines may be applicable in the aquaculture. It is thus to be understood
that
the vaccine according to the invention may be formulated for administration by
a
route selected from the group consisting of: intraperitoneal injection, bath,
immersion, intramuscular injection and oral administration or combinations
hereof.
When vaccines are to be administered by injection, a fairly small dosage
volume
is generally required. Accordingly, it is desirable to formulate the
composition
according to the invention so that each dose has a volume of 25-20041. More
preferably, each dose has a volume of 40-120 41, such as a volume of 90-11041
or
45-5541. At present a dosage volume of 5041 is preferred.
When formulated for injection, the composition according to the invention may,
in
particular, be formulated for intraperitoneal injection into a teleostei
including, but
not limited to salmonids, basses, breams, cods, snappers, flatfish, catfish,
Date Recue/Date Received 2020-08-14

19
yellowtails and tilapias. Preferably, the vaccine is formulated for injection
into a
salmonid.
In preferred embodiments, when the composition is intended for injection, it
may
be formulated so that an aliquot of 25-2000, preferably an aliquot of 40-120
Ill,
such as an aliquot of 90-110 I or 45-550, and most preferably an aliquot of 50
I,
contains salmonid alphavirus in amounts corresponding to 0.75x107-0.5x101
TCID50, such as from 0.75x107-2.5x109, from 0.75x107-0.5x109, from 0.75x107-
2.5x108, from 0.75x107-1x108, from 0.75x107-4.5x107, from 0.75x107-4x107,
from 0.75x107-3.5x107, 0.75x107-3x107, 1.25x107-0.5x1010, 2.5x107-0.5x101 ,
3.75x108-0.5x1010, 0.5x109-0.5x1010, 1.25x109-0.5x1010, 2.5x109-0.5x1010,
3.75x109-0.5x1010, 1.25x107-3.75x109, 2.5x107-2.5x1019, 2.5x107-3.75x108,
2.5x107-3x108, 2.5x107-2.5x108, 2.5x107-2x108, 2.5x107-1.5x108, 2.5x107-
1x108, from 2.5x107-0.5x108, 3x107-3.5x108, 3x107-3x108, 3x107-2.5x108,
3x107-2x108, 3x107-1.5x108, 3x107-1x108, 3x107-0.5x108, 3.5x107-3.5x108,
3.5x107-3x108, 3,5x107-2.5x108, 3.5x107-2x108, 3.5x107-1.5x108, 3.5x107-
1x108, 3.5x107-0.5x108, 4x107-3.5x108, 3.75x107-0.5x109, 4x107-3x108, 4x107-
2.5x108, 4x107-2x108, 4x107-1.5x108, 4x107-1x108, 4x107-0.5x108, 4.5x107-
3.5x108, 4.5x107-3x108, 4.5x107-2.5x108, 4.5x107-2x108, 4.5x107-1.5x108, or
from 4.5x107-1x108, 0.5x108-3.75x109, 3.73x107-2.5x109, 0.5x108-1.25x109,
0.5x108-0.5x109, 0.5x108-4x108, 0.5x108-2.5x108, 0.5x108-1.25x109,1.25x108-
0.5x109 or to 2.5x108-3.75x108 TCID50.
As mentioned above it is desirable that the composition contains salmonid
alphavirus at a titre of at least 7.5x108TCID50/ml. This preferably yields an
amount of salmonid alphavirus of at least 3,75x107TCID50/dose.
It is to be understood that for the purpose of the present invention the
specified
amounts of salmonid alphavirus are determined by titration on CHH cells as
illustrated in the examples. An alternative approach is titration on CHSE
cells. As
established in example 3, CHH cells are approximately twice as sensitive to
the
salmonid alphavirus as the CHSE cells; therefore when determining virus titres
on
CHH cells the values obtained are approximately twice as high as when
determined by titration on CHSE cells.
In EP patent 712,926, CHSE cells are used for titration. It is therefore
reasonable
to assume that virus titres in the PD-vaccine, which is commercially available
Date Recue/Date Received 2020-08-14

20
from the proprietor of EP 712,926 are also determined by titration on CHSE
cells.
Therefore, the declared antigen content of 107=2TCID50/dose in the first
generation
monovalent vaccine from the patent proprietor would correspond to
3.2x107TCID50/dose if determined using CHH cells for titration. Likewise, the
declared antigen content of 107.5TCID50/dose in the second generation vaccine
would correspond to 6.4x107TCID50/dose when titrated on CHH cells.
According to presently preferred embodiments of the invention, the composition
comprises inactivated salmonid alphavirus (SAV) at a titre of 5x108 - 5x101
TCID50/ml. (providing an antigen content of 2,5x107 - 2,5x109TCID50/dose at a
dosage volume of 50 I.11)
Further it is preferred that the said live attenuated or killed bacterium is
present in
amounts corresponding to 0.2 x108-2.5x109ce11s/m1 (0.1 x107-
1.25x108ce115/dose), such as 0.5 x108-2.5x109ce11s/m1(0.25 x107-
1.25x108ce11s/dose), 0.5 x108-1x109cells/m1 (0.25 x107-0.5x108cells/dose), 0.5
x108-0,5x109ce11s/m1 (0.25 x107-0.25x108ce11s/dose), 1x108-5x109ce11s/m1
(0.5x107-0.25x108ce115/dose), 2.5x108-5x109cells/m1 (1.25x107-
2.5x108ce115/dose), 5 x108-5x109cells/m1 (2.5 x107-2.5x108cells/dose), 7.5
x108-
5x109cells/m1(3.75 x107-2.5x108cells/dose), 1-5x109cells/m1 (0.5-
2.5x108ce11s/m1), 2-5x109ce11s/m1(1-2.5x108ce11s/dose), 3-5x109ce11s/m1 (1.5-
2.5x108cells/dose), or 4-5x109ce11s/m1(2-2.5x108cells/dose). It is further
preferred that the bacterial antigen is added in amounts, which elicit a
protection
resulting in a relative percent survival (RPS) above 70 for the relevant
disease
using a challenge model for the disease using intraperitoneal injection for
challenge.
According to more specific embodiments the said bacterium is present in
amounts
corresponding to 1 x 108-8 x 109cells/ml. At a dosage volume of 50 pi this
corresponds to 5x106 - 4x108 cells/dose. Preferably, the bacterium is present
in
amounts corresponding to 0.9- 5 x109cells/ml, corresponding to 0.45- 2.5x108
cells/dose at a dosage volume of 50111.
In a particular embodiment primarily aimed at the Norwegian market, the said
live
attenuated or killed bacterium is present in amounts corresponding to 22.9x108
cells/ml (2.1.45x107 cells/dose) of Aeromonas salmonicida, 7.4x107ce1ls/m1
(23.7x106cells/dose) of Vibrio salmonicida, 4.3x108ce1ls/m1 (>
=
Date Recue/Date Received 2020-08-14

21
1.65x107cells/dose) of V. anguillarum serovar 02a, ?:3.2x108cells/m1(.1.6x107
cells/dose) of V. anguillarum serovar 01 and 2.7x107cells/m1 1.35x106
cells/dose) of Moritella viscose. In further preferred embodiments intended
for the
same purpose, the composition comprises inactivated Aeromonas salmonicida,
inactivated Vibrio. Salmonicida, inactivated Vibrio anguillarum, and
inactivated
Monte/la viscose, each bacterial antigen being present in an amount
corresponding
to 0.9 -5x109cells/ml.
In preferred embodiment, presently intended for the Chilean market the
composition comprises: inactivated Vibrio ordali and inactivated
Piscirickettsia
salmonis, both in an amount corresponding to 0.9 -5x109cells/ml.
In preferred embodiment, presently intended for East Asia, the composition
comprises: inactivated Aeromonas hydrophila, inactivated Flavobacterium
columnaris and inactivated Haphnia sp., each in an amount corresponding to 0.9
-
5x109ce1ls/ml.
The virus other than salmonid alphavirus may preferably be present in amounts
corresponding to .5x106 PFU/ml. In particular these amounts are relevant when
the virus is infectious pancreatic necrosis virus (IPNV). According to
specific
embodiments, the virus is present in amounts corresponding to 1.0 -5 x109
PFU/ml or 2-8 antigenicity units (AU)/m1 when infectious pancreatic necrosis
virus
(IPNV). At a dosage size of 50 ptl, this corresponds to 0.5 ¨ 2.5x108PFU/dose
and
0.2-0.8 antigen icity units/dose, respectively.
As the skilled person will realize it is possible to include one or more
recombinantly produced antigens in the vaccines according to the invention. In
particular, the antigenic and/or immunogenic material derived from the
salmonid
alphavirus may be a material which is produced using recombinant techniques.
In
addition, the antigenic and/or immunogenic material derived from said
bacterium
in item a), from said virus in item b), from said fungus in item c) or from
said
parasite in item d) as defined above may be produced using recombinant
techniques.
Such techniques, including techniques for the cloning, expression, synthesis
and
purification of peptides and polypeptides, are of course available and well
known
to the skilled person.
Date Recue/Date Received 2020-08-14

22
Suitable recombinant antigens may be polypeptides cloned from fish pathogens
or
immunogenic portions of such polypeptides. An immunogenic portion of a
polypeptide may comprise a T-cell and/or a B-cell epitope. 1-cell epitopes,
which
are linear, may be identified by investigating the effect of deletion
mutantions
introduced systematically into the polypeptide sequence. B-cell epitopes may
be
identified by analysing the B-cell responses to overlapping peptides covering
the
polypeptide sequence of interest. The skilled person will be aware that, in
general,
immunogenic amino acid sequences will have a minimum length of 6 amino acids
in a consecutive sequence. Longer amino acids sequences may of course be
preferred, including amino acid sequences of at least 7, 8, 9, 10, 12, 15, 20,
30,
50, 100, 150 or 200 amino acids in a consecutive sequence.
The skilled person will acknowledge that, when contemplated for the purpose of
eliciting a protective immune response, the composition according to the
invention
may further comprise an organic adjuvant and/or an inorganic adjuvant.
The organic adjuvant is preferably selected from the group consisting of:
mineral
oil, squalene (2,6,10,15,19,23-hexamethy1-2,6,10,14,18,22-tetracosahexaene),
virosomes, Montanide and CpG oligodeoxynucieotides. Other examples of
adjuvants frequently used in fish and shellfish farming are muramyldipeptides,
lipopolysaccharides, several glucans and glycans, mineral oil and Carbopol .
Also
adjuvants such as interleukin and glycoproteins may be used. An extensive
overview of adjuvants suitable for fish and shellfish vaccines is given in the
review
paper by Jan Raa (1996).
Useful inorganic adjuvants will be known to the skilled artisan and are
described
JC Aguilar and EG Rodriguez, 2007, Vaccine 25, 3752 - 3762.
In particular, the inorganic adjuvant which is optionally included in the
composition according to the invention is selected from the group consisting
of
Al(OH)3 (Aluminium hydroxide), Ca3(PO4)2 (Calcium phosphate), and water un-
soluble salts of aluminium, calcium, iron or zirconium.
The composition of the invention may further comprise a suitable
pharmaceutical
carrier. In a currently preferred embodiment, the vaccine is formulated as an
Date Recue/Date Received 2020-08-14

23
emulsion of water in oil. The vaccine may also comprise a so-called "vehicle".
A
vehicle is a device to which the antigen adheres, without being covalently
bound
to it. Such vehicles are La. biodegradable nano/micro-particles or ¨capsules
of
PLGA (poly-lactide-co-glycolic acid), alginate or chitosan, liposomes,
niosomes,
micelles, multiple emulsions and macrosols, all known in the art. A special
form of
such a vehicle, in which the antigen is partially embedded in the vehicle, is
the
so-called ISCOM (European patents EP 109.942, EP 180.564 and EP 242.380).
In addition, the composition may comprise one or more suitable surface-active
compounds, detergents and/or emulsifiers.
In particular, the detergent is selected from the group consisting of non-
ionic
detergents, cationic detergents and anionic detergents.
As the skilled person will realize esters of non-PEG-ylated or PEG-ylated
sorbitan
with fatty acids are examples of useful emulsifiers. As illustrated in the
examples
the emulsifier may in particular be polysorbate or sorbitan oleate. More
specifically, the said detergent and/or emulsifier may be selected from the
group
consisting of polyoxyethylene (20) sorbitan monooleate (Tween 80), Sorbitane
monooleate (Span 80), Cremophore, Tween and Span .
In certain embodiments, the composition according to the invention is selected
from the group consisting of a water-in-oil emulsion, a water-in-oil-in-water
emulsion and an oil-in-water emulsion. As presently preferred the composition
according to the invention is a water-in-oil emulsion.
In specific embodiments, the composition comprises a mineral oil.
Particular embodiments of the invention pertain to a vaccine comprising an oil
phase and a water phase, each phase constituting from 20-80% (v/v) of the
total
volume of said vaccine.
In further preferred embodiments the vaccine comprises an oil phase
constituting
from 50-80% (v/v) of the total volume of said vaccine, such as from 55-75%
(v/v), from 45-62% (v/v), from 45-60% (v/v), from 50-70% (v/v), from 55-70%
(v/v), from 50-65% (v/v), from 50-60% (v/v) from 55-60% (v/v) or from 57-
60% (v/v) the total volume of said vaccine.
Date Recue/Date Received 2020-08-14

24
In still further preferred embodiments, the vaccine comprises a water phase
constituting from 20-55% (v/v) of the total volume of said vaccine, such as
from
20-50% (v/v) from 20-45% (v/v), from 20-40% (v/v), from 30-55% (v/v), from
30-52% (v/v), from 30-50% (v/v), from 37-55% (v/v), from 37-500/0 (v/v),or
such as from 37-45% (v/v) of the total volume of said vaccine.
In further preferred embodiments, the composition comprises an oil phase and a
water phase, each phase constituting from 30-70% (v/v) of the total volume of
said vaccine.
In yet further preferred embodiments, the composition comprises an oil phase
constituting from 45-70% (v/v) of the total volume of said vaccine, such as
from
45-65% (v/v), from 45-62% (v/v), from 45-60% (v/v), from 50-70% (v/v), from
55-70% (v/v), from 50-65% (v/v), from 50-60% (v/v) from 55-60% (v/v) or
from 57-60% (v/v) the total volume of said vaccine.
In still further preferred embodiments the composition comprises a water phase
constituting from 30-55% (v/v) of the total volume of said vaccine, such as
from
30-50% (v/v) from 30-45% (v/v), from 30-40% (v/v), from 35-55% (v/v), from
35-52% (v/v), from 35-50% (v/v), from 37-55% (v/v), from 37-50% (v/v),or
such as from 37-45% (v/v) of the total volume of said vaccine.
In further preferred embodiments the composition comprises an oil phase
constituting from 50-80% (v/v) of the total volume of said vaccine, such as
from
55-75% (v/v), from 45-62% (v/v), from 45-60% (v/v), from 50-70% (v/v), from
55-70% (v/v), from 50-65% (v/v), from 50-60% (v/v) from 55-60% (v/v) or
from 57-60% (v/v) the total volume of said vaccine.
In still further preferred embodiments, the composition comprises a water
phase
constituting from 20-55% (v/v) of the total volume of said vaccine, such as
from
20-50% (v/v) from 30-45% (v/v), from 20-40% (v/v), from 30-55% (v/v), from
30-52% (v/v), from 30-50% (v/v), from 37-55% (v/v), from 37-50% (v/v),or
such as from 37-45% (v/v) of the total volume of said vaccine.
It is to be understood that the Salmonid Alphavirus in the composition
according
to the invention may be a virus of any of the presently know SAV subtypes,
Date Recue/Date Received 2020-08-14

25
SAV1, SAV 2, SAV 3, SAV4 SAV5 and SAV6 as defined above. The present
inventors have observed that previously described strains of salmonid
alphaviruses are indeed effective when used as antigenic component in
polyvalent
vaccines and provide good protection against subsequent infection.
Representative isolates of the SAV1 and SAV 2 subtypes are described in the
art:
A patent deposit of SAV1 has previously been made under the Budapest Treaty at
the ECACC under deposit number V94090731. The deposited SAV1 isolate
corresponds to the isolate described in Nelson et al. 1995 and the isolate
provided in EP 712,926.
Preferably the Salmonid Alphavirus in the composition according to the
invention
is a salmonid alphavirus subtype 3 (SAV3) virus. In the presently most
preferred
embodiments, the Salmonid Alphavirus of the composition is selected from the
group consisting of the virus strains deposited under the Budapest Treaty with
the
European Collection of Cell culture (ECACC), Health Protection Agency, Porton
Down, Salisbury, Wiltshire (UK), SP4 OJG UK on December 12 2007 under Deposit
numbers 07121201, 07121202 and 07121203.
=
Related genotypic characteristics:
In further embodiments, the virus is a strain or isolate with genotypic
characteristics which are related or similar to those of the deposited strains
specified above, in particular any of the deposited SAV3 strains.
While the genomic organizations of all characterized SAVs are equal, the
nucleotide sequence similarity between SAV3 and SAV1 is only 91.6%, and
between SAV3 and SAV2 92.9% (Hodneland et al 2005). If the comparison is
limited to certain genes, e.g. the non-structural protein nsP3, the similarity
between subtypes is as low as 81.5 % (Weston et al 2005).
In particular embodiments, the salmonid alphavirus used in relation to the
present invention comprises a nucleic acid sequence which is at least 90%,
such
as 95%, 97% or 99% identical to any one of the sequences set forth in SEQ ID
NO: 1-3.
SEQ ID NO: 1
aagaagtgca ccagattttc caccaccccg aagaagtccg ccccctacct cgttgacgtg
tacgacgctc tgccgatttc tgtagagatt agcaccgttg taacatgcaa cgacaatcag
Date Recue/Date Received 2020-08-14 .

l=-80-0Z0Z panpoe ee/enóej ele0
66633533m 6633322333 6352363516 3622623364 66636362m 6336662544
1124351333 3635245236 3362323346 3623665326 346342326D 6633646446
:9 :ON ClI OAS St
:4 3436663232 6623326326
4334632233 6232p6216 2336332362 6666166465 4363436633 1163344362
3366233623 664236266o D266626644 6262433266 6236333656 2436262245 0.17
3363663445 2322666323 22p666262 4DDE060D50 DO6D236264 6362362pm
6336661623 3362326264 6634166336 346362446D 3512612526 2323666332
2113663316 2334616235 3546362262 336256232D 6233633666 2643442336
133336362o 6354645212 D352323316 3623666366 1423123663 6233636346
:S :ON CII b3S Sc
D34366532 325623426o 2643116322 D362321365
4624363323 5262664661 2643634366 3344633443 6243262346 2366123625
2342566256 4362621132 6652363336 6621362626 1533636634 1623326663 OC
2322436662 6243364366 5636234366 3363463623 D634632643 2262123666
3362311663 D162334516 2363616362 2623364662 323623363o 6562612336
1333363623 6321616242 D366323346 D6eD666o6ö 1123423563 5233632415
17. :ON CII bgs
sz
*9-i7 :ON
CII b3S Jo auo Au e u! qpo as aDuonbas au4 (34 123!luaPI %66 JO %86 '%S6 '%06
'%58 sP LIDI1S '%08 Is2a! 42 s! 1.13!qm 1e3uanbes ppe Dialanu e sesuclwoo
uopuanu!
luasaJd aq1 04 uonelw pasn sn.qn2qc112 puowies at41 quaw!poqwe Jetwni UI
OZ
.4326361 D252623363 3344633341 2331126626 3622264662 6222366266
3623336446 4223163125 244332363D 622366523D D231236233 6336632213
D466336256 2636163211 4632623331 326362332o 1133231533 2626222336
n6Dee6eep 6462262212 6341222616 2323321.663 D323361666 2616232361
623262226o 2236423264 6616332362 D4262624613411263361 D436126121 ST
6461264463 4312134363 6334622622 6333323323 31111.66233 2361222622
C :ON aI b3S
43223613222663363 3311633311 6333126622 D622261622 6622366266
4624336446 1223663426 eDiDD23200 622366623D 323121623D 64366322p OT
3466336266 2636153244 4632623334 3263623323 444323463D 2636634336
4363626223 6422222232 6344222616 232332366o 3323364666 2616232361
6233624263 2236423224 6316332362 1426262163 3111263361 3136326321
6464264463 4.332121323 6331622222 2DD4DPiDeD 3111426233 2161222622
:Z :ON ClI b3S
1.3326363 3262623363 OD11600044 2DOOle66e6 3662261622 6522366266
3623336446 4243423426 21433236m 6223666233 323121623D 633663261D
1166336266 2616163211 1632623331 3263623324 1133211633 2636223336
1363626223 6462262212 6314222616 2323324563 D323364662 2615232351
9Z

27
catagagcgg gcgccttcag cgtcgctggc tcggtgagac agcccagcgg gccgcctagt
agcgtgagca cgcccgccgc gaccagaggg ctgacacggg accagtttga cgtcgtgaga
gctagggccc gtaggaactt ggaaccggag gggtcggagc atggcagcca agccagcttc
cgctccggct cgctgacggt ggggagctct gctagtagct acagccaacg ttccgacgat
caggacacgg gcacc
Sequence identifier Source
SEQ ID NO: 1 (Norwegian salmonid alphavirus isolate F04-
170(7) E2 (E2) gene, partial cds., Fringuelli,
E., J. Fish Dis. 31 (11), 811-823 (2008)
Genbank accession No: EF675594):
SEQ ID NO: 2 (Salmon pancreas disease virus isolate F05-
124(5) E2 (E2) gene, partial cds. Fringuelli,
E., J. Fish Dis. 31 (11), 811-823 (2008)
Genbank accession No: EF675577):
SEQ ID NO: 3 (Sleeping disease virus isolate F04-198(22)
E2 (E2) gene, partial cds. Fringuelli, E., J.
Fish Dis. 31 (11), 811-823 (2008) Genbank
accession No: EF675590):
SEQ ID NO: 4 Norwegian salmonid alphavirus isolate F04-
170(3) non-structural protein P3 (nsP3) gene,
partial cds. Fringuelli, E., J. Fish Dis. 31 (11),
811-823 (2008) Genbank accession No:
EF675545
SEQ ID NO: 5 Sleeping disease virus isolate F04-198(22)
nonstructural protein P3 (nsP3) gene, partial
cds. Fringuelli, E., J. Fish Dis. 31 (11), 811-
823 (2008) Genbank accession No: EF675542
SEQ ID NO: 6 Salmon pancreas disease virus isolate F05-
124(5) nonstructural protein P3 (nsP3) gene,
partial cds. Fringuelli, E., J. Fish Dis. 31 (11),
811-823 (2008) Genbank accession No:
EF675529
In preferred embodiments of the present invention relating to virus of the
SAV3
variant, it will be understood that the virus comprises a nucleic acid
sequence
Date Recue/Date Received 2020-08-14

28
which is at least 98%, 99%, or 99.5%, identical to the sequence set forth in
SEQ
ID NO: 1.
For the purpose of the present invention, a suitable test for determining
whether
a virus isolate has genotypic characteristics, which are related or similar to
those
of the deposited strains specified above is provided in exmple 2: the skilled
person will realize that in preferred embodiments, the salmonid alphavirus
according to the invention is a virus, which is positive in the SAV reverse
transcriptase quantitative PCR (RT-QPCR) identity test as described in example
2,
in particular when using a set of primers designed to amplify part of a
salmonid
alphavirus glycoprotein E2 nucleotide sequence, such as the primers set forth
in
SEQ ID NOs: 7 and 8.
Related phenotypic characteristics:
In still further embodiments the virus is a strain or isolate with phenotypic
characteristics, which are related or similar to those of the deposited
strains, in
particular any of the deposited SAV3 strains.
Phenotypic differences do exist between isolates within the three SAV groups,
as
well as between groups (Christie et al. Dis. Aquat. Org. 75: 13-22, 2007,
Hodneland et al, 2005, Taksdal et al.): In a study by Taksdal et al. all
Atlantic
salmon and 76% of the Rainbow trout infected with virus of the SAV3 subtype
had severe pancreatic lesions in the late/regenerative stage. This was in
contrast
with reports from Irish and Scottish cases where fish infected with SAV1
usually
had normal, probably recovered, exocrine pancreatic tissue. A further
characteristic feature of pancreatic disease caused by the SAV3 subtype is the
presence of numerous cells in the kidney containing cytoplasmic eosinophilic
granules (EG). In Taksdal's studies, EG-containing cells were found in 40% of
the
rainbow trout and in 64% of the Atlantic trout. In addition, it is
characteristic that
rainbow trout and Atlantic salmon are equally susceptible to infections with
SAV3
while rainbow trout appear to be somewhat resistant to infection with SAV1.
Finally the heart seems to recover earlier from infections with SAV3 as
compared
to infections with SAV1.
Date Recue/Date Received 2020-08-14

29
According to further embodiments, the virus which is included in the
composition
according to the invention is capable of inducing mortality of at least 25%,
such
as at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at
least
55%, or preferably at least 60% in a laboratory challenge model, said model
comprising smoltifying Atlantic salmon according to standard methods and
challenge the post-smolts by intraperitoneal injection with a SAV3 dose of at
least
108TCID50 per fish, such as at least 109TCID50, at least 101 TCID50 or
preferably at
least 3.5 x 108 TCID50 per fish, within one day after transfer to seawater
(25%o)
at 12 C.
The new variant of the Salmonid Alphavirus subtype SAV3, is characterised by
having the ability of growing to high titres in vitro in cultures of host
cells.
Accordingly, this virus may be capable of growing to a titre, in the
supernatant/growth medium, of at least 1x108, 5x108, 1x109, 5x109, lx101 , and
5x101 or such as at least 1x1011 TCID50/ml. when cultured using host cells
which
are selected from the group consisting of CHH-1 cells or CHSE-214 cells.
In particular, such high titres of virus may be obtained when:
i) Cells are cultured using host cells which have been seeded at
a density
of 0.1-1x105 cells cm2;
ii) The host cells are cultured for 4-6 days prior to virus infection;
iii) The host cells are grown to a density of from 0.1-1.0 x106 cells cm-2 at
the time of infection with said virus isolate;
iv) The host cells are cultured in a growth medium comprising EMEM
(EBSS)+ 10% Fetal Bovine Serum (FBS) + 2mM L-Glutamine + 1% Non
Essential Amino Acids (NEAA) + 0.1% gentamicine; and
v) The infected cells are cultured at a temperature of 15 C, for a period
of
10-14 days.
It will further be understood that the SAV 1, SAV3, SAV4, SAV5 or SAV6 virus,
which is included in the composition according to the invention is a virus
which,
unless attenuated or inactivated, is capable of causing the symptoms
associated
with fish pancreatic disease. General symptoms of fish pancreatic disease have
been reviewed in McLoughlin and Graham, Journal of Fish Disease 2007, 30, 511-
Date Recue/Date Received 2020-08-14

30
531. The symptoms include:
i) Death/mortality
ii) Inappetance
iii) Impaired swimming behaviour
iv) Lethargy
v) Pancreatic necrosis
vi) Cardiomyopathy and skeletal myopathy, including oesophageal
muscle lesions
vii) Kidney lesions, affected kidneys containing numerous interstitial
cells filled with eosinophilic material
viii) Focal gliosis in the brain.
Generally, the course of disease following from infections with fish
pancreatic
disease virus can be characterised as comprising an acute stage and a
late/chronic stage, each stage being associated with various histopathological
symptoms. The virus provided according to the present invention may in
particular be capable of causing at least one of the following
histopathological
symptoms in the acute stage:
1) destruction of the majority of pancreatic acinar tissue and a variable
inflammatory response ranging from no inflammation to moderate
inflammation;
ii) fibrosis of periacinar tissue.
Also, the virus provided according to the present invention may be capable of
causing at least one of the following histopathological symptoms in the late/
chronic stage:
i) significant loss of pancreatic acinar tissue with or without
fibroplasia of
periacinar tissue;
ii) multifocal cardiomyocytic necrosis, affected cells having a
shrunken,deeply eosinophilic cytoplasm and pyknotic nuclei.
As opposed to infections with SAV1 and 3, infections with SAV2 in rainbow
trout is
reported to cause lower mortality, but a mortality up to 220/0 has been
reported
(Boucher and Baudin 1994,). Sleeping disease, however, may cause the fish to
Date Recue/Date Received 2020-08-14

31
rest on their side on the bottom of tanks or raceways. If disturbed, the fish
swim
for some time and then return to the bottom. This sign is primarily due to
extensive necrosis of skeletal red muscle.
Macroscopic lesions do not occur, but occasionally, secondary ulcerations of
the
skin or petechiae on the pyloric organ. Necrosis of the skeletal red muscle
may be
present and histopathological examination may reveal inflammation of exocrine
pancreas and heart. In the individual fish, these lesions may be present with
or
without any behavioural alterations.
It will be understood that the SAV 2 virus, which may be included in the
composition according to the invention is a virus which, unless attenuated or
inactivated, is capable of causing the symptoms associated sleeping disease in
fish.
It is further to be understood that the virus according to the invention may
have .a
visible cytopathogenic effect during early passage in cell culture, such as
during
the first, second, third or fourth passage on a culture of CHSE cells. As
mentioned, the present inventors have identified a new variant of the Salmonid
Alphavirus subtype SAV3. This variant of the virus showed visible
cytopathogenic
effect during first passage in cell culture. While previous isolates of
salmonid
alphaviruses have not had visible cytopathogenic effect before becoming
adapted
to the in vitro culture conditions, the ability of causing a cytopathogenic
effect
without having been passed on a cell line may therefore apply as a further
characteristic of the virus according to the present invention.
It is to be understood that the deposited viruses may mutate or otherwise
change
characteristics, for instance when being passed on host cells in vitro (JD
Watson
et al.(1987). As the skilled person will realize, replication of RNA virus
genomes is
accompanied by very high mutation rates (Watson et al. 1987). This is due to
the
lack of proofreading activity of RNA virus polymerases, which leads to a
constant
generation of new genetic variants e.g. during virus propagation (Elena and
Sanjthin (2005). Also, Domingo and Holland (1997) concludes that different
constellations of mutations may be associated with a similar biological
behaviour.
Therefore, the salmonid alphavirus used for the purpose of the present
invention
may be a strain which is obtainable by introducing one or more substitutions,
deletions and/or additions of nucleotides into the genome of any one of the
Date Recue/Date Received 2020-08-14

32
deposited strains mentioned above. In other words, the salmonid alphavirus
used
for the purpose of the present invention may be a genetic variant of any one
of
the above-mentioned deposited strains.
In the course of screening new SAV 3 isolates from outbreaks in Norwegian
salmon farms, the present inventors have discovered a variant of the virus
with
properties diverging significantly from those previously described. Thus, the
finding that this variant of the SAV3 subtype showed visible cytopathogenic
effect
during their first passage in cell culture, and produced mortality when
injected into
Atlantic salmon was highly surprising. In addition, it is greatly encouraging
that
vaccines based on antigenic material from this variant of the virus gives an
excellent protection against subsequent infection with salmonid alphavirus,
also
when the vaccine is provided as a polyvalent vaccine comprising additional
antigens. In addition, this newly discovered variant of the virus has fine
growth
properties when grown in vitro on cultures of host cells.
It will be understood that the cultures of salmonid alphavirus which are used
in
relation to the invention, are substantially free of other viral or microbial
material.
In particular, contamination of virus isolates according to the invention by
IPNV is
a concern since, often, fish infected with salmonid alphavirus are also
infected
with IPNV. In the course of isolating the virus according to the invention it
may
therefore be necessary to add an antibody directed against IPNV in order to
eliminate the IPNV virus from isolates or cultures of the virus according to
the
invention. In cultures of virus on host cells this antibody will inhibit
infection of
the host cells with IPNV.
In a specific and currently preferred embodiment, presently intended for use
in
Northern Europe, including Norway, the composition of the invention comprises:
i) inactivated Salmonid Alphavirus, such as subtype SAV3 in an amount
corresponding to 7.5x108 - 5x108 TCID50/m1 (in order to preferably
provide 3.75x107 - 2.5x108 TCID50/dose at a dosage volume of 50 I),
preferably 1x109 - 5x109 TCID50/m1 (in order to preferably provide
0.5x108 - 2.5x108 TCID50/dose at a dosage volume of 50 IA),
ii) inactivated Aeromonas salmonicida in an amount corresponding to 0.9 -
5x109cells/m1 (in order to preferably provide 0.45- 2.5x108cells/dose),
Date Recue/Date Received 2020-08-14

33
iii) inactivated Vibrio. salmonicida in an amount corresponding to 0.9 -
5x109cells/m1 (in order to preferably provide 0.45 - 2.5x108cells/dose at
a dosage volume of 50 I),
iv) inactivated Vibrio anguillarum in an amount corresponding to 0.9 -
5x109ce11s/m1 (in order to preferably provide 0.45 - 2.5x108cells/dose at
a dosage volume of 50 I),
v) inactivated Monte/la viscosa in an amount corresponding to 0.5 -
5x109cells/m1 (in order to preferably provide 0.45 - 2.5x108cells/dose at
a dosage volume of 50 I),
vi) inactivated infectious pancreatic necrosis virus (IPNV) in an amount
corresponding to 1.0-5.0x109 PFU/ml live virus (in order to preferably
provide 0.5 - 2.5x108PFU/dose at a dosage volume of 50 I) or 2-8
antigenicity units (AU)/m1 (in order to preferably provide 0.2-0.8
antigenicity units/dose at a dosage volume of 50 I),
vii) an adjuvant, preferably mineral oil; and
viii) a detergent and/or emulsifier.
In alternative embodiments, presently intended primarily for use in South
America, including Chile, the composition according to the invention
comprises:
i) inactivated Salmonid Alphavirus, such as subtype SAV3 in an amount
corresponding to 7.5x108 - 5x109TCID50/m1 (in order to preferably
provide 3.75x107 - 2.5x108 TCID50/dose at a dosage volume of 50 I),
preferably 1x109 - 5x109 TCID50/m1 (in order to preferably provide
0.5x108 - 2.5x108 TCID50/dose at a dosage volume of 50 1),
ii) inactivated Vibrio ordali in an amount corresponding to 0.9 -
5x109cells/m1 (in order to preferably provide 0.45- 2.5x108cells/dose at
a dosage volume of 50 1),
iii) inactivated Piscirickettsia salmonis in an amount corresponding to 0.9 -
5x109cells/m1 (in order to preferably provide 0.45- 2.5x108cells/dose at
a dosage volume of 50 I),
iv) inactivated infectious pancreatic necrosis virus (IPNV) in an amount
corresponding to 1.0-5.0x109 PFU/nril live virus (in order to preferably
provide 0.5 - 2.5x108PFU/dose at a dosage volume of 50 I) or 2-8
antigenicity units (AU)/m1 (in order to preferably provide 0.2-0.8
antigenicity units/dose at a dosage volume of 50 Ml),
Date Recue/Date Received 2020-08-14

34
v) an adjuvant, preferably mineral oil; and
vi) a detergent and/or emulsifier.
In other alternative embodiments, presently intended primarily for use in
South
East Asia, the composition according to the invention comprises:
i) inactivated Salmonid Alphavirus, such as subtype SAV3 in an amount
corresponding to 7.5x108 - 5x109 TCID50/m1 (in order to preferably
provide 2.5x107 - 2.5x108 TCID50/dose at a dosage volume of 50 I),
preferably 1x109 - 5x109 TCID50/m1 (in order to preferably provide
0.5x108 - 2.5x108 TCID50/dose at a dosage volume of 50 1),
ii) inactivated Aeromonas hydrophila in an amount corresponding to 0.9 -
5x109cells/m1 (in order to preferably provide 0.45- 2.5x108cells/dose at
a dosage volume of 50 I),
iii) inactivated Flavobacterium columnaris in an amount corresponding to
0.9 -5x109ce11s/m1 (in order to preferably provide 0.45 - 2.5x108
cells/dose at a dosage volume of 50 I),
iv) inactivated Haphnia sp. in an amount corresponding to 0.9 -5x109cells/m1
(in order to preferably provide 0.45- 2.5x108cells/dose at
a dosage volume of 50 I),
v) inactivated infectidus pancreatic necrosis virus (IPNV) in an amount
corresponding to 1.0-5.0x109 PFU/ml (in order to preferably provide 0.5
- 2.5x108PFU/dose at a dosage volume of 50 I) or 2-8 antigenicity units
(AU)/m1 (in order to preferably provide 0.2-0.8 antigenicity units/dose at
a dosage volume of 50 pi),
vi) an adjuvant, preferably mineral oil; and
vii) a detergent and/or emulsifier.
Dosage form
Yet another aspect of the invention provides a dosage form of a composition
according to the invention.
While other dosage forms may be contemplated, including solid dosage forms
based on a fish feed, the dosage form according to the invention is preferably
a
liquid dosage form, more preferably a liquid dosage form for injection, such
as
Date Recue/Date Received 2020-08-14

35
intraperitoneal injection. When intended for injection the dosage form
preferably
has a volume of 25-200p1, more preferably a volume of 40-120 111, such as a
volume of 90-1100 or 45-5541. At present a dosage volume of 500 is the most
preferred for convenience reasons.
In relation to the dosage form the same preferences with respect to dosage
volume and antigen content apply as described in relation to the composition
according to the invention.
In particular, the dosage form according to the invention preferably comprises
salmonid alphavirus in amounts corresponding to 0.75x107-0.5x1019TCID50/dose,
such as from 0.75x107-2.5x109, from 0.75x107-0.5x109, from 0.75x107-2.5x108,
from 0.75x107-1x108, from 0.75x107-4.5x107, from 0.75x107-4x107, from
0.75x107-3.5x107, 0.75x107-3x107, 1.25x107-0.5x101 , 2.5x107-0.5x1010,
=
3.75x108-0.5x1010, 0.5x109-0.5x1019, 1.25x109-0.5x1019, 2.5x109-0.5x1019,
3.75x109-0.5x1019, 1.25x107-3.75x109, 2.5x107-2.5x1019, 2.5x107-3.75x108,
2.5x107-3x108, 2.5x107-2.5x108, 2.5x107-2x108, 2.5x107-1.5x108, 2.5x107-
1x108, from 2.5x107-0.5x108, 3x107-3.5x108, 3x107-3x108, 3x107-2.5x108,
3x107-2x108, 3x107-1.5x108, 3x107-1x108, 3x107-0.5x108, 3.5x107-3.5x108,
3.5x107-3x108, 3,5x107-2.5x108, 3.5x107-2x108, 3.5x107-1.5x108, 3.5x107-
1x108, 3.5x107-0.5x108, 4x107-3.5x108, 3.75x107-0.5x109, 4x107-3x108, 4x107-
2.5x108, 4x107-2x108, 4x107-1.5x108, 4x107-1x108, 4x107-0.5x108, 4.5x107-
3.5x108, 4.5x107-3x108, 4.5x107-2.5x108, 4.5x107-2x108, 4.5x107-1.5x108, or
from 4.5x107-1x108, 0.5x108-3.75x109, 3.73x107-2.5x109, 0.5x108-0.5x109,
0.5x108-4x108, 0.5x108-2.5x108, 0.5x108-1.25x109, 1.25x108-0.5x109 or from
2.5x108-3.75x108TCID50/dose.
=
Vaccine
A further aspect of the invention provides a vaccine comprising a composition
or a
dosage form as defined above. It is to be understood that all embodiments and
features as described above will also apply to the vaccine according to the
invention.
As the skilled person will be aware several methods and means for
administration
of vaccines may be applicable in the aquaculture. It is thus to be understood
that
Date Recue/Date Received 2020-08-14

36
the vaccine according to the invention may be formulated for administration by
a
route selected from the group consisting of: intraperitoneal injection, bath,
immersion, intramuscular injection and oral administration or combinations
hereof.
For the sake of convenience it is preferred that the vaccine is administered
to
salmon parr, preferably parr of 10 - 60 grams. As the skilled person will
realize
however, the vaccine according to the invention may also be administered to
salmon in other stages, including any of the salt water stages.
As demonstrated in the examples the compositions according to the inventions
provide extremely effective protection against infection with salmonide
alphavirus
when tested in laboratory challenge experiments, in which the vaccinated fish
are
challenged with high titres of highly virulent SAV3 isolates. In the field,
where the
fish are exposed to much lower titres of the virus it is to be expected that
protective efficacy of the vaccines provided according to the invention is
even
higher than what is shown in the present examples.
Medical use/method of prophylaxis
Other aspects of the present invention provide the use of inactivated salmonid
alphavirus in the manufacture of a medicament, e.g. as an immunological
-composition such as a vaccine, and/or dosage form for administration
simultaneously or in combination with one or more antigenic components
selected
from the group consisting of:
a) a killed bacterium,
b) a inactivated virus other than a salmonid alphavirus,
c) a fungus,
d) a parasite; and
e) an antigenic and/or immunogenic material derived from said bacterium
in a), from said virus in b), from said fungus in c) or from said parasite
in d);
It will be understood that in accordance with the invention, the said dosage
form
preferably contains inactivated salmonid alphavirus in an amount corresponding
to
at least 3.75x107TCID50/dose. Likewise, it is preferred that said
Date Recue/Date Received 2020-08-14

37
vaccine/immunological composition contains inactivated salmonid alphavirus in
an
amount corresponding to at least 7.5x108 TCID50/ml.
Another aspect pertains to the use of an inactivated salmonid alphavirus in
the
manufacture of a vaccine or an immunological composition, which is compatible
with other immunological products, wherein said vaccine comprises inactivated
salmonid alphavirus in an amount corresponding to at least 7.5x108TCID50/m1
(corresponding to 3.75x107TCID50/dose at a dosage volume of 50 I).
In still another aspect, the invention provides a composition as described
above
for use in medicine. In particular, the composition may be for use in
preventing,
or reducing the incidence of fish pancreatic disease or, alternatively
phrased, for
use in preventing or reducing the incidence of infection by salmonid
alphavirus. A
related aspect provides a vaccine according to any of the embodiments
described
above for use in preventing, or reducing the incidence of fish pancreatic
disease.
Other aspects of the invention provide a vaccine as described above for use in
preventing or reducing the incidence of infection by salmonid alphavirus. It
is
contemplated that a polyvalent vaccine based on a composition comprising a
combination of viral, bacterial, fungal and/or parasitic antigens as described
above
can provide a successful approach to controlling infections with any of the
currently known groups of salmonid alphavirus, SAV1, SAV2, SAV3, SAV4, SAV5
and SAV6.
Further aspects of the invention relates to the use of a composition as
described
above for the manufacture of a medicament/vaccine for preventing or reducing
the incidence of infection by salmonid alphavirus.
Still further aspects pertain to the use of a composition as described above
for the
manufacture of a medicament/vaccine for preventing or reducing the incidence
of
fish pancreatic disease and/or sleeping disease. In yet another aspect the
invention provides a method of reducing the incidence of and/or treating or
preventing infection by Salnnonid Alphavirus in a fish population, said method
comprising administering to the fish a composition, vaccine or dosage form as
defined above.
Method of making a vacccine
Date Recue/Date Received 2020-08-14

38
The invention also provides a method of manufacturing a composition and/or
vaccine and/or a dosage form as defined above. The method comprises combining
a, preferably attenuated or inactivated, Salmonid Alphavirus or an antigenic
and/or immunogenic material derived thereof with one or more components
selected from the group consisting of:
a. a live, attenuated, killed or inactivated bacterium,
b. a virus other than Salmonid Alphavirus, said virus preferably being
attenuated or inactivated,
c. a fungus,
d. a parasite; and
e. an antigenic and/or immunogenic material derived from said
bacterium in a), from said virus in b), from said fungus in c) or from
said parasite in d).
Preferably, the amount of salmonid alphavirus is adjusted to provide a
composition or vaccine comprising at least 7.5x108 TCID50/m1 inactivated
salmonid
alphavirus or a dosage form comprising at least 2.5x107TCID50/dose.
In this context, the viral, bacterial, fungal and parasitic antigen components
are
preferably as specified above, depending on the fish pathogens which prevail
in
the area in which the vaccine is to be used.
As the salmonid alphavirus must be grown on cultures of host cells, the method
according to this aspect of the invention may further comprise
a. establishing a culture of host cells;
b. infecting said host cells with an isolate of a virus of the Salmonid -
Alphavirus, and
c. culturing the infected cells under conditions allowing said virus to reach,
in
the supernatant/growth medium, a titre of at least 7.5x108TCID50/ml,
such as at least 1x109, 5x109, lx101 or at least 5x101 TCID50/ml.
In the method according to the invention the said host cells are either
cultured on
a solid support or as suspension cultures.
In order to provide optimal growth conditions the host cells are preferably
cultured at a pH between 6.5 and 8.5, such as between 7.0 and 8.0, between 7.2
and 8.0, between 7 and 7.5 or between 7.2 and 7.5.
=
Date Recue/Date Received 2020-08-14

39
The method according to the invention is developed with the particular purpose
of
producing the salmonid alphavirus vaccine component in large amounts.
Therefore, in presently preferred embodiments the process is adapted for
producing Salmonid Alphavirus material in batches of 25-2000 litres, such as
of
25-1000 litres, of 50-2000 litres, of 50-1000 litres or of 50 - 500 litres.
In particular embodiment it is a further-characteristic of the method
according to
the invention that the said host cells, when grown on a solid support, are
seeded
at a density of 0.1-1.5x105 cells cm2, 0.2.-1.5x105 cells cm2, 0.2-1.25x105
cells
cm2 0.2-1x105 cells cm2 or 0.2-1x105 cells cm2.
According to further embodiments, the said host cells are cultured for 3-8
days
prior to virus infection, such as from 4-8 days, 4-7 days or for 4-6 days.
In still further embodiments the said host cells are grown to a density of
8x105
cells cm-2 at the time of infection with said virus isolate.
In particular, the host cells may be grown to a density of from 5x105 cells cm-
2 to
5x106 cells cm-2 at the time of infection with said virus isolate.
As for the growth medium, it may be preferred that the host cells are cultured
in
a growth medium selected from the group consisting of EMEM (EBSS)+ 10% Fetal
Bovine Serum (FBS) + 2mM L-Glutamine + 1% Non Essential Amino Acids (NEAA)
+ 0.1% gentamicine.
After infection of the cells, the infected cells are preferably cultured at a
temperature from 12-16 0C, such as at a temperature of 13-160C, 13-150C, 14.-
160C, or 14-150C, and for a period of 6-20 days, such as a period of 8-20
days,
8-18 days, 8-16 days, 9-20 days, 9-18 days, 9-16 days, 10-20 days, 10-18 days,
10-16 days or 10-14 days.
Also, it may be preferred that the infected cells are cultured until 30% of
the host
cells are lysed or have detached, such as until 40%, 50%, 60%, 70%, 80% or
90% of the host cells are lysed or have a cytopathogen effect consisting of
rounded cells.
As explained above it may be preferred that said Salmonid Alphavirus is a
virus of
the SAV3 subtype.
Date Recue/Date Received 2020-08-14

40
As for the host cells, these are preferably selected from the group consisting
of
cells derived from heart tissue of juvenile chum salmon (Onchorhynchus keta),
cells derived from Chinook salmon (Oncorhynchus tshawytscha) embryo.
More specifically it is preferred to use host cells which are selected from
the group
consisting of CHH-1 cells and CHSE-214 cells. CHH-1 cells are available from
ATCC
under deposit number CRL-1680, CHSE-214 cells are available from ATCC, deposit
number CRL 1681 and from ECACC under deposit number 91041114.
Bacterial antigens for use in the polyvalent vaccine according to the
invention can
be prepared using conventional techniques, for instance by growing the
bacteria
in tryptic soy broth with 2% NaCI at 12-15 C, or in brain heart infusion broth
with
3% NaCI at 12-15 C (Atlas, RM,2004, Handbook of Microbiological Media, Third
edition, CRC press, page 1820 and 246).
As for the infectious pancreatic necrosis virus (IPNV), this virus can be can
be
propagated for the purpose of the preparation of a vaccine in CHSE-214 cells
according to Dobos P and Roberts TE, 1982, Canadian Journal of Microbiology,
29,
377 - 384.
The cultivation of these representative pathogens are also described at
http://www.lgcpromochem-atcc.com/.
A related aspect of the invention provides a method of improving a polyvalent
vaccine. The method comprises including in the polyvalent vaccine (an
immunogenic amount of) an attenuated or inactivated Salmonid Alphavirus. In a
preferred embodiment the said polyvalent vaccine comprises one or more
components selected from the group consisting of:
a. a live, attenuated, inactivated or killed bacterium,
b. a virus other than Salmonid Alphavirus, said virus preferably being
attenuated or inactivated,
c. a fungus,
d. a parasite; and
Date Recue/Date Received 2020-08-14

41
e. an antigenic and/or immunogenic material derived from said bacterium
in a), from said virus in b), from said fungus in c) or from said parasite
in d).
In relation to this method the same preferences with respect to dosage volume
and antigen content apply as described in relation to the composition
according to
the invention.
An example of such a polyvalent vaccine which could advantageously be improved
by including an antigen preparation of Salmonid Alphavirus is A..1 6-2 already
marketed by the present applicant.
It should be noted that embodiments and features described in the context of
one
of the aspects of the present invention also apply to the other aspects of the
invention.
The invention will now be described in further details in the following non-
limiting
examples.
Examples
Example 1: Isolation of PD virus from fish with clinical PD infection (ALV-
405, ALV 406 and ALV-407)
Materials
Oman material
Hearts were sampled from fish with clinical symptoms of pancreas disease in
commercial fish farms. The hearts were kept cold at 4 C.
Cell cultures
= CHH-1, 145th passage.
= CHSE-214, 36th passage
= GF-1, 4th passage
Date Recue/Date Received 2020-08-14

42
Cells were seeded two - three days before use.
Growth media
= CHH-1 growth medium: EMEM (Sigma M7278), 10% FBS (Sigma F-3885),
1% L-glutamine (Sigma G-7513), 1% NEAA (Sigma M-7145), 0.1%
gentamicine (Sigma G1397).
= CHSE-214 growth medium: EMEM (Sigma M7278), 10% FBS (Sigma F-
3885), 1% L-glutamine (Sigma G-7513), 0.1% gentamicine (Sigma
G1397).
= GF-1 growth medium: L-15 (Sigma L-5520 lot), 10% FBS (Sigma F-3885),
1% L-glutamine (Sigma G-7513), 0.1% gentamicine (Sigma G1397).
Filter: TM
Minisaii plus (Sartorius #17829)
Anti IPNV antibodies: Rabbit anti IPNV antiserum (CP54/1996)
Hearts from Atlantic salmon were homogenised using a porcelain mortar and
quarts sand with some added medium (ca 8-20m1). The homogenate was
centrifuged at 2000 x g for 10 minutes at 4 C, before 0.45 1.1m filtration
through a
syringe filter. The homogenates were dispatched in cryo vials and frozen at -
80
C.
Samples of some of the organ homogenates were mixed 1:100 with anti IPNV
antiserum and incubated for two hours at 15 C. Subsequently 50-200111 of
homogenate with or without added anti-IPNV antiserum was inoculated into the
different cell cultures (50-90% confluency) in 75/175 cm2 Nunc cell flasks
with
15/50 ml of the appropriate medium according to table 1.
When passaging the virus into new cell cultures, 1 ml of supernatant was
transferred into new cell culture flasks.
Table 1
Identity Anti- Cell Passage Passage Passage Passage Passage
IPNV line 1 2 3 4 5
ALV 405 + GF-1 + ++ +++ +++ +++
20 dpi 12 dpi 14 dpi 21 dpi 12 dpi
Date Recue/Date Received 2020-08-14

43
6.8 x108
TCID50
ALV 406 + CHSE ++ ++ +++ +++ +++
20 dpi 8 dpi 14 dpi 21 dpi 12
dpi
ALV 407 - GF-1 ++ +++ +++
22 dpi 28 dpi 14 dpi
4.2x108
TCID50
- CHH- +++
1 10 dpi
= 3.7x107
TCID50
- CHSE +++
10dpi
1,3x108
TCID50
+,++,+++ designates the degree of cytopathogen effect observed in the cells
XX dpi; xx days post infection when cytopathogen effect was observed in the
cells
X:X x 10x TCID50 Titration result of supernatant from the specific flask
Conclusions
= SAV3 was isolated from hearts collected from Atlantic salmon with
pancreas disease.
= Cytopathogen effect was visible in the cell cultures from passage 1
= The passage 1 SAV3 isolates had a titer of up to 1,3x108 TCID50
= SAV3 can be isolated in passage 1 on several different cell lines
Example 2: Identity test for SAV3, and test for absence of IPNV in SAV3
isolates
To confirm the identity of different isolates of SAV3 and to test them for the
absence of Infectious Pancreatic Necrosis Virus (IPNV), a Reverse
Transcription-
Date Recue/Date Received 2020-08-14

44
Quantitative PCR (RT-QPCR) procedure using primers specific for SAV and IPNV
was applied.
Materials
Virus isolates: ALV-405 p5 and p6, ALV 407 p1, ALV 408 p1, ALV 409 1pA and
1pB (two separate isolations). Positive control: IPNV ALV 103.
TM
RNA isolation: QIAamp Viral RNA Mini Spin Protocol
Reverse transcription and QPCR: Brilliant II QPCR and QRT-PCR Reagents from
Stratagene.
Table 2: Primers
Viru Forward primer Reverse primer
SAV CGTCAC I I CACCAGCGACTCCCAGA GGATCCATTCGGATGTGGCGTTGCTAT
CG (SEQ ID NO: 7) GG (SEQ ID NO: 8)
IPN GTCCGGTGTAGACATCAAAG (SEQ TGCAGTTCCTCGTCCATCC (SEQ ID
V ID NO: 9) NO: 10)
RT-PCR conditions:
IPNV test: 50 C,30 min - 95 C,10 min -(95 C,30 sec - 57 C,60 sec - 72 C,30
sec)*40
SAV3 test: 50 C,30 min - 95 C,10 min -(95 C,30 sec - 57 C,60 sec - 72 C,30
sec)*40
Results: All SAV3 isolates were positive in the SAV RT-QPCR and negative in
the
IPNV RT-QPCR. These tests show that all the SAV3 isolates are indeed SAV and
not contaminated by IPNV.
Date Recue/Date Received 2020-08-14

45
Example 3: Titration of salmon pancreas disease virus using different cell
lines.
SAV3 was titrated on two different cell lines; CHH and CHSE as described in
examples 4 and 5, respectively. The TCID50 values obtained with the two cell
lines
are presented in table 3. The CHH cell line is approximately twice as
sensitive to
the virus as the CHSE cell line.
Table 3:
Experiment CHH CHSE
1 6,49x109 TCID50 3,32x109 TCID50
2 2,87x109 TCID50 2,14x109 1C1D50
3 5,62x109 TCID50 2,37x109TC1D50
4 4,22x109TC1D50 9,09X108 TCID50
Example 4: Cultivation of SAV3 in CHH-1 cell culture flasks with high cell
density.
Intention
The aim was to evaluate the potential PD yields of different virus isolates in
CHH-
1 cell culture flasks with high cell density.
Materials and methods
Cell cultures and growth media
3 x 175cm2 flasks, CHH-1, 160th passage with 100 x 106 cells per flask (5.7 x
105
C/cm2)
CHH-1 growth medium: EMEM (Sigma M7278), 10% FBS (Invitrogen), 1% L-
glutamine (Sigma G-7513), 1% NEAA (Sigma M-7145), 0.1% gentamicine (Sigma
G1397).
. 25
Virus/infection material
Date Recue/Date Received 2020-08-14

46
=
ALV-405, p6, titre: 5.01 x 108 TCID50/m1
ALV-407, pl, titre: 3.41 x 107 TCID50/m1
ALV-407, p4, titre: 4.14 x 107 TCID50/m1
Table 4. Cell cultures and experimental data.
Flask no Infection material Cell number per
MOI Medium
Virus stock Volume flask volume
1 ALV-405, p6 30p1 100 x 106 0.15
50m1
2 ALV-407, pl 500p1 100 x 106 0.18
50m1
3 ALV-407, p4 500p1 100 x 106 0.21
50m1
Immediately before infection was the growth medium of the flasks replaced with
50m1 fresh growth medium, and then were the respective infection materials
added (table 1). All flasks were incubated at 15 C with tightly closed caps.
Sampling, titration and microscopic observations
Microscopic observations and titration of samples were performed 7, 10, 13 and
18 days pi on CHH-1.
Results/discussion
Microscopic observations
Detachment and rounding of cells appeared about one week pi in all flasks. At
the
end of the observation period (18 days pi) flask 2 had the most prominent CPE
with 80% of the cells detached, whereas flask 1 and 3 had 20% and 40%
detached cells, respectively.
Titration results
The three isolates/passages had all titres at 109 TCID50/m1 or higher.
Surprisingly
was the yields highest in the flask infected with the 1st passage of ALV-407
(figure
1, ALV-407 p2), but this flask had also had the most prominent CPE. The
results
confirm that CHH-1 cells produce high SAV3 yields, also from low passage virus
stocks. Results are shown in figure 1.
Date Recue/Date Received 2020-08-14

47
Conclusions
= The highest yields were 1.78 x 109 TCID.50/m1 in a sample obtained 13
days
after inoculation with ALV-407 pl at MOI 0.2.
= Production of low passage SAV3 in CHH-1 cells gives a good yield of SAV3.
Example 5: Cultivation of SAV3 in CHSE cells.
Intention
The aim was to evaluate the potential SAV3 yields of different virus stocks in
CHSE-214 cell cultures.
Materials and methods
Cell culture and growth medium
= CHSE-214: 19th passage with ca 80% confluence.
= CHSE-214 growth medium: EMEM (Sigma M7278), 10% FBS (Invitrogen),
1% L-glutamine (Sigma G-7513), 0.1% gentamicine (Sigma G1397).
Virus stock
= ALV-404, 8p.
Table 5. Cell cultures and experimental data. All flasks were 75cm2, had 20m1
growth medium and were inoculated with 100p1 of the virus stock.
Flask no Cell Days after Cell Virus stock MOI
line seeding density
1-2 CHSE 2 80% ALV-404, 8p >1.2
(CHSE)
The flasks were cooled down to 15 C before they were infected without medium
change. All flasks were incubated at 15 C with tight caps.
Date Recue/Date Received 2020-08-14

48
Sample of the virus seed materials were titrated on 96 wells plates.
Microscopic observation and titration of samples from all flasks were
performed 6,
12, 15, 20 and 27 days pi.
Results/discussion
Microscopic observations
The infection (lysis and detachment of cells) developed quickly in the CHSE
cultures, with more than 90% lysis 12 days pi. Samples from the two flasks
were
collected and titrated on 96 well plates on day 6, 12, 15, 20 and 27 days post
infection. The average values from the two parallel flasks are shown in figure
2.
This experiment shows that CHSE-214 is a suitable cell line for production of
SAV3 since high virus titers are produced from a low passage stock of SAV3.
Example 6: Vaccination of salmon parr using a polyvalent vaccine
comprising SAV3
The present example presents a multivalent pancreas disease vaccine based on
salmonid alphavirus subtype 3 antigenic material, showing excellent protection
in
an experimental challenge model with high mortality in the unvaccinated
control
group.
Table 6: Outline of experiment
Task Activity Environmental parameters Experimental
week
Acclimatisation 12h/12h light, fresh water, flow 0
of fish 0.8 litre/kg biomass
Start of Vaccination and 1
experiment marking
Smoltification Start of 24 hour light, fresh water, 1-4
smoltification 12 C flow 0.8 litre/kg biomass
Date Recue/Date Received 2020-08-14

49
Smoltification Smoltification 24 hour
light, Fresh water 4-6
15 C, flow 0.8 litre/kg biomass
Transfer to sea Transfer of the 12h/12h
light, 25%0 sea water, 6
water fish to seawater flow 0.8 litre/kg biomass
(25%0 sea
water).
Challenge The SAV 12h/12h light, 25%0 sea water, 6
challenge is flow 0.8 litre/kg biomass
performed the
day after
transfer to sea
water by i.p.
injection.
Disease Dead and 12h/12h light, 25%0 sea water, 6-11
development moribound fish .. flow 0.8 litre/kg biomass
are recorded
and removed
daily
Termination of 11
the experiment
Atlantic salmon parr with an average weight of 25.7 grams were vaccinated with
0.1 ml of a polyvalent water-in-oil vaccine. The vaccine contained inactivated
antigen from the following pathogens:
Table 7: Vaccine components
Components Amount
Inactivated SAV3 2 x 109 TCID50/ml
Inactivated Aeromonas salmonicida 3 x 109 cells/ml
Inactivated Vibrio salmonicida 3 x 109 cells/ml
Inactivated Vibrio anguillarum 01 3 x 109 cells/ml
Inactivated Vibrio anguillarum 02 3 x 108 cells/n.11
Inactivated Moritella viscosa 3 x 109 cells/ml
Date Recue/Date Received 2020-08-14

50
Inactivated IPN virus 3 x 109 PFU/ml
Paraffin light liquid
Polysorbate
Sorbitan oleate
All components were inactivated by addition of 2.0 g/kg formaldehyde and
subsequent incubation for 72 hours at a temperature of 15 C.
Table 8: Tagging and vaccination
Group Vaccine Content Number of fish Tagging
Control fish PBS PBS 100 unmarked
vaccinated fish Polyvalent 4.28 x 109 100 left
maxillae
4.28 x 109 TCID50 /ml SAV3 TCID50/m1
After smoltification, the fish were distributed in two tanks containing
seawater
(25%0) and challenged by injection of 2nd passage, freshly prepared ALV-407.
The
challenge dose was 5.36 x 108 TCID50 per fish. In the challenge tanks,
mortality
reached 86% in the control group in tank 1 and 66% in tank 2, whereas no
mortality was recorded in the groups vaccinated with the polyvalent vaccine
protecting against salmonid pancreas disease. Results are shown in figure 3.
This
experiment shows that a polyvalent vaccine can indeed protect against salmonid
pancreas disease.
Example 7: Dosis/response - vaccination with monovalent and
polyvalent SAV3 vaccine.
The present example presents a dose-response experiment with monovalent and
multivalent pancreas disease vaccine.
Table 9: Outline of experiment
Date Recue/Date Received 2020-08-14

51
Task Activity Environmental
Experimental
parameters week
Acclimatisation 12h/12h light, fresh water, 0
of fish flow 0.8 litre/kg biomass
Start of Vaccination 1
experiment and marking
Smoltification Start of 24 hour light, fresh water, 1-4
smoltification 12 C, flow 0.8 litre/kg
biomass
Smoltification Smoltification 24 hour
light, Fresh water 4-6
15 C, flow 0.8 litre/kg
biomass
Transfer to sea Transfer of the 12h/12h light, 25%o sea 6
water fish to water, flow 0.8 litre/kg
seawater biomass
(25%o sea
=
water).
Challenge The SAV 12h/12h light, 25%o sea 6
challenge is water, flow 0.8 litre/kg
performed the biomass
day after
transfer to sea
water by i.p.
injection.
Disease Dead and 12h/12h light, 25%0 sea 6-11
development moribound fish water, flow 0.8 litre/kg
are recorded biomass
and removed
daily
Termination of 11
the experiment
Date Recue/Date Received 2020-08-14

52
Atlantic salmon parr with an average weight of 25.7 grams were vaccinated with
0.1 ml of a polyvalent water-in-oil vaccine. The vaccine contained inactivated
antigen from the following pathogens:
Table 10: Vaccine components, multivalent vaccines.
Components Amount
Vaccine Vaccine Vaccine Vaccine
A
Inactivated SAV3 2 x 107 1 x 109 2 x 109 4 x
109
-robs /ml Tops /ml
Tcib50/mi -rcup50 /ml
Inactivated Aeromonas salmonicida 3 x 109 cells/ml
Inactivated Vibrio salmonicida 3 x 109 cells/ml
Inactivated Vibrio anguillarum 01 3 x 109 cells/ml
Inactivated Vibrio anguillarum 02 3 x 108 cells/ml
Inactivated Moritella viscosa 3 x 109 cells/m1
= Inactivated IPN virus 3 x
109 PFU/ml
Paraffin light liquid
Polysorbate
Sorbitan oleate
Table 11: Vaccine components, monovalent vaccines.
Components Amount
Inactivated SAV3 Vaccine Vaccine
Vaccine Vaccine
2 x 107 1 x 109 2 x 109 4 x
109
Taos. /ml mow /ml -rcio50 /ml
/ml
Paraffin light liquid
Polysorbate
Sorbitan oleate
Date Recue/Date Received 2020-08-14

53
All components were inactivated by addition of 2.0 g/kg formaldehyde and
subsequent incubation for 72 hours at a temperature of 15 C.
Tagging and vaccination
For each group, 40 fish were tagged by fin clipping and vaccinated with 0.05
ml
vaccine or 0.05 ml PBS and left for immunisation and smoltification. After
smoltification, the fish were distributed in two tanks containing seawater
(25%o)
and challenged by injection of 2nd passage, freshly prepared ALV-407. The
challenge dose was 6,5 x 108TCID50per fish.
Results:
Table 12:
Date Recue/Date Received 2020-08-14

54
. Polyvalent Control A
(PBS)
(PD= 2 x 107 (PD= 1 x 109
Tabs /ml)
ToD50/ml)
Mortality 72.5% 26.3% 2.6% 7.7% 2.4%
Relative A) 63.7 96.5 89.4 96.6
survival
Monovalent Control E
(PBS)
(PD= 2 x 107 (PD= 1 x 109 (PD= 2 x 109 (PD= 4 x 109
Tops /ml) TCID50 /ml) iciD50 /ml) TCID5,
/ml)
Mortality 50 43.6% 12.8% 4.9% 5.0%
Relative % 12.8 74.4 90.2 90.0
survival
In the challenge, the polyvalent vaccine gave better protection than the
monovalent vaccine at the lowest antigen doses. This experiment shows that a
polyvalent vaccine with a PD antigen content of 1 x 109 1CID50 /MI, when given
in
doses of 0.5 x 108 TCID50 /dose can effectively protect against salmonid
pancreas
disease. Since the vaccine provides some protection against subsequent
infection
even when given in doses of 106 TCID50, it is reasonable to conclude that a
reasonable level of protection can also be provided when the vaccine is
administered is doses containing somewhat less than 0.5 x 108 TCID50 /dose.
Example 8: Vaccination of salmon parr using a polyvalent vaccine
comprising SAV1
Date Recue/Date Received 2020-08-14

55
The present example presents a multivalent pancreas disease vaccine containing
SAV1 antigenic material. The vaccine shows good protection in an experimental
challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 1 is isolated from outbreaks of
pancreatic disease in Atlantic salmon in Scotland.SAV1 antigenic material is
prepared from a culture of this virus, grown on CHSE cells according to a
similar
procedure as described in the preceding examples.
A vaccine containing the following components is prepared:
Table 13: Vaccine components
Components Amount
Inactivated SAV1 2 x 109 TCID50 /m1
Inactivated Aeromonas 3 x 109 cells/ml
salmonicida
Inactivated Vibrio salmonicida 3 x 109 cells/ml
Inactivated Vibrio anguillarum 01 3 x 109 cells/ml
Inactivated Vibrio anguillarum 02 3 x 108 cells/ml
Inactivated Monte/la viscose 3 x 109 cells/ml
Inactivated IPN virus 3 x 109 PFU/ml
Paraffin light liquid
= Polysorbate
Sorbitan oleate
The SAV1 virus was inactivated by addition of 2.0 g/kg formaldehyde and
subsequent incubation for 72 hours at a temperature of 15 C.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated
and
tagged, and vaccinated fish and control fish are subsequently smoltified as
described in the preceding example.
=
=
Date Recue/Date Received 2020-08-14

56
After smoltification, the fish are distributed in tanks containing seawater
(25%0)
and challenged by injection of 2nd passage, freshly prepared SAV3. The
challenge
dose i53-6 x 108 TCID50 per fish. This experiment shows that a polyvalent
vaccine
comprising salmonid alphavirus typel antigenic material can indeed protect
against salmonid pancreas disease SAV3.
Example 9: Vaccination of salmon parr using a vaccine comprising SAV1
The present example presents a multivalent pancreas disease vaccine containing
SAV1 antigenic material. The vaccine shows good protection in an experimental
challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 1 is isolated from outbreaks of
pancreatic disease in Atlantic salmon in Scotland. SAV1 antigenic material was
prepared from a culture of this virus, according to a similar procedure as
described in the preceding examples.
A vaccine containing the following components was prepared:
Table 14: Vaccine components
Vaccine A:
Components Amount
Inactivated SAV1 2 x 109 TCID50 /ml
Inactivated Aeromonas 3 x 109 cells/ml
salmon icida
Inactivated Vibrio salmonicida 3 x 109 cells/m1
Inactivated Vibrio anguillarum 01 3 x 109 cells/m1
Inactivated Vibrio anguillarum 02 3 x 108 cells/ml
Inactivated Monte/la viscosa 3 x 109 cells/nil
Inactivated IPN virus 3 x 109 PFU/ml
Paraffin light liquid
Polysorbate
Sorbitan oleate
Date Recue/Date Received 2020-08-14

57
Vaccine B and C:
Components Vaccine content
Vaccine B Vaccine C
Inactivated SAV1 5 x 108 TCID50 /m1 1 x 109 TCID50 /m1
Paraffin light liquid
Polysorbate
Sorbitan oleate
=
The SAV1 virus was inactivated by addition of 2.0 g/kg formaldehyde and
subsequent incubation for 72 hours at a temperature of 15 C. Vaccines were
formulated as water-in-oil emulsions using standard methods.
60 fish were tagged by fin clipping and vaccinated with 0.05 ml vaccine or
0.05
ml PBS and left for immunisation and smoltification as described in the
preceding
example.
After smoltification, the fish were distributed in a tank containing seawater
(25%o) and challenged by injection of 2nd passage, freshly prepared SAV3. The
challenge dose was 3.01 x 108 TCID50 per fish.
Table 15: Results.
Date Recue/Date Received 2020-08-14

58
Vaccine % mortality RPS (%mortality
vaccinated
group/% mortality control
group)*100
PBS 70
Polyvalent A 3.3 95.2
Monovalent B 16.7 76.2
Monovalent C 6.1 87.9
Mortality in the control group reached 70%, while mortality in the group
vaccinated with a polyvalent vaccine comprising 2 x 109 TCID50 /m1 inactivated
SAV1 reached 3.3% giving a relative % survival of 95.2. This experiment shows
that a polyvalent vaccine comprising salmonid alphavirus type1 antigenic
material
can indeed protect against salmonid pancreas disease. In this experiment, the
SAV1 antigen dose is doubled compared to the monovalent SAV1 vaccine C, and
there is an increase in the RPS observed. This suggests that the same antigen
dose can be used in polyvalent PD vaccines eliciting the same protection as
monovalent PD vaccines. This is in contrast to the conventional wisdom in the
field of fish vaccinology.
Example 10: Vaccination of salmon parr using a polyvalent vaccine
comprising SAV2
The present example presents a multivalent pancreas disease vaccine containing
SAV2 antigenic material. The vaccine shows good protection in an experimental
= challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 2 is isolated from outbreaks of
sleeping
disease in rainbow trout reared in fresh water in France. SAV2 antigenic
material
Date Recue/Date Received 2020-08-14

59
is prepared from a culture of this virus, grown on CHSE cells according to a
similar procedure as described in the preceding examples.
A vaccine containing the following components is prepared:
Table 16: Vaccine components
Components Amount
Inactivated SAV2 2 x 109 TCID50 /m1
=
Inactivated Aeromonas 3 x 109 cells/ml
salmonicida
Inactivated Vibrio salmonicida 3 x 109 cells/ml
Inactivated Vibrio anguillarum 01 3 x 109 cells/ml
Inactivated Vibrio anguillarum 02 3 x 108 cells/ml
= Inactivated Monte/la viscosa
3 x 109 cells/ml
Inactivated IPN virus 3 x 109 PFU/ml
Paraffin light liquid
Polysorbate
Sorbitan oleate
The SAV2 virus is inactivated by addition of 2.0 g/kg formaldehyde and
subsequent incubation for 72 hours at a temperature of 15 C.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated
and
tagged, and vaccinated fish and control fish are subsequently smoltified as
described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater
(25%0)
and challenged by injection of 2nd passage, freshly prepared SAV3. The
challenge
dose is 3-6 x 108 TCID50 per fish. This experiment shows that a polyvalent
vaccine
comprising salmonid alphavirus type2 antigenic material can indeed protect
against subsequent infection with salmonid alphavirus SAV3.
Date Recue/Date Received 2020-08-14

60
Example 11: Vaccination of salmon parr using a polyvalent vaccine
comprising SAV3
The present example presents a multivalent pancreas disease vaccine containing
SAV3 antigenic material. The vaccine shows good protection in an experimental
challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 3 is isolated from outbreaks of
pancreatic disease in Atlantic salmon in Scotland. SAV3 antigenic material is
prepared from a culture of this virus, grown on CHSE cells according to a
similar
procedure as described in the preceding examples.
A vaccine containing the following components is prepared:
Table 17: Vaccine components
Components Amount
Inactivated Aeromonas 3 x 109 cells/ml
hydrophila
Inactivated Flavobacterium 3 x 109 cells/ml
columnaris
Inactivated Haphnia sp 3 x 109 cells/ml
Inactivated SAV3 2 x 109 TCID50 /ml
Inactivated IPN virus 3 x 109 PFU/ml
Paraffin light liquid
Polysorbate
Sorbitan oleate
The SAV3 virus was inactivated by addition of 2.0 g/kg formaldehyde and
subsequent incubation for 72 hours at a temperature of 15 C. Bacterial
antigens
were inactivated by addition of 4 g/kg formaldehyde and subsequent incubation
for 1.5 hours at a temperature of 20 C
A water-in-oil emulsion is made according to standard methods.
Date Recue/Date Received 2020-08-14

61
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated
and
tagged, and vaccinated fish and control fish are subsequently smoltified as
described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater
(25%o)
and challenged by injection of 2nd passage, freshly prepared SAV3. The
challenge
dose is3-6 x 108 TCID50 per fish . This experiment shows that a polyvalent
vaccine
comprising salmonid alphavirus antigenic material and several bacterial
antigens
can indeed protect against salmonid pancreas disease.
Example 12: Vaccination of salmon parr using a polyvalent vaccine
comprising SAV3
The present example presents a multivalent pancreas disease vaccine containing
SAV3 antigenic material. The vaccine shows good protection in an experimental
challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 3 is isolated from outbreaks of
pancreatic disease in Atlantic salmon in Scotland. SAV3 antigenic material is
prepared from a culture of this virus, grown on CHSE cells according to a
similar
procedure as described in the preceding examples.
A vaccine containing the following components is prepared:
Table 18: Vaccine components
Components 1 Amount
Inactivated SAV3 2 x 109 TCID50 /m1
Inactivated Vibrio ordali 3 x 109 cells/nil
Inactivated Piscirickettsia 3 x 109 cells/ml
salmonis
Inactivated IPN virus 3 x 109 PFU/m1
Paraffin light liquid
Polysorbate
Date Recue/Date Received 2020-08-14

62
Sorbitan oleate
The SAV3 virus was inactivated by addition of 2.0 g/kg formaldehyde and
subsequent incubation for 72 hours at a temperature of 15 C. Bacterial
antigens
were inactivated by addition of 4 g/kg formaldehyde and subsequent incubation
for 1.5 hours at a temperature of 20 C
A water in oil emulsion is made according to standard methods.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated
and
tagged, and vaccinated fish and control fish are subsequently smoltified as
described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater
(25%0)
and challenged by injection of 2nd passage, freshly prepared SAV3. The
challenge
dose is 3-6 x 108 TCID50per fish. This experiment shows that a polyvalent
vaccine
comprising salmonid alphavirus antigenic material and several bacterial
antigens
can indeed protect against salmonid pancreas disease.
Example 13: Vaccination of salmon parr using a polyvalent vaccine
comprising SAV3
The present example presents a multivalent pancreas disease vaccine containing
SAV3 antigenic material. The vaccine shows good protection in an experimental
challenge model with high mortality in the unvaccinated control group.
An isolate of salmonid alphavirus subtype 3 is isolated from outbreaks of
pancreatic disease in Atlantic salmon in Scotland. SAV3 antigenic material is
prepared from a culture of this virus, grown on CHSE cells according to a
similar
procedure as described in the preceding examples.
A vaccine containing the following components is prepared:
Table 19: Vaccine components
Date Recue/Date Received 2020-08-14

63
Components I Amount
Inactivated SAV3 2 x 109 TCID50 /m1
Inactivated Aeromonas 3 x 109 cells/ml
salmonicida
Inactivated Vibrio salmonicida 3 x 109 cells/n-11
Inactivated Vibrio anguillarum 01 3 x 109 cells/ml
Inactivated Vibrio anguillarum 02 3 x 108 cells/ml
Inactivated Monte/la viscosa 3 x 109 cells/ml
=
Inactivated IPN virus 3 x 109 PFU/ml
Montanide ISA 736 B 70% v/v
The SAV3 virus is inactivated by addition of 2.0 g/kg formaldehyde and
subsequent incubation for 72 hours at a temperature of 15 C. Bacterial
antigens
were inactivated by addition of 4 g/kg formaldehyde and subsequent incubation
for 1.5 hours at a temperature of 20 C
A water-in-oil emulsion is made according to standard methods.
The vaccine is administered to Atlantic salmon parr. The fish is vaccinated
and
tagged, and vaccinated fish and control fish are subsequently smoltified as
described in the preceding example.
After smoltification, the fish are distributed in tanks containing seawater
(25%0)
and challenged by injection of 2nd passage, freshly prepared SAV3. The
challenge
dose is 3-6 x 108 TCID50 per fish. This experiment shows that a polyvalent
vaccine
comprising salmonid alphavirus antigenic material and Montanide ISA 736B can
indeed protect against salmonid pancreas disease.
Date Recue/Date Received 2020-08-14

64
Receipts for deposits of microorganisms:
Health Protection Agency, Porton Down
and
European Collection of Cell Cultures
This document certifies that
Virus Salmon Alphavirus 3 ALV-405
Deposit Reference 07121201
has been accepted as a patent deposit, in accordance with
The Budapest Treaty of 1977,
with the European Collection of Cell Cultures on
12 December 2007
- .
ECACC Patent Supervisor
=
European Collection of Cell Cultures, Health Protection Agency, Centre For
Emergency Preparedness and Response. Porton Down, Salisbury. Wiltshire. 6P4
DM. UK.
Tel: 49 101 12801312512 Fax: 44 (0) 1980 611315 Email: ecacc@hpa.arg.uk Web
Site: vaarraeacc,org.uk
Date Recue/Date Received 2020-08-14

65
=
Health Protection Agency Porton Down
and
European Collection of Cell Cultures
This document certifies that
Virus Salmon Alphavirus 3 ALV-407
Deposit Reference 07121202
has been accepted as a patent deposit, in accordance with
The Budapest Treaty of 1977,
with the European Collection of Cell Cultures on
12 December 2007
ECACC Patent Supervisor
European Collection of Cell Cultures, Health Protection Agency, Centre For
Emergency Preparedness end Response, Porton Om, Salisbury. Wiltshire, 5P4 OA
UK.
Tel: 44 101 1980 812512 Fax: 44 (0) 1980 611315 Email: eeecceDhpa.org.uk Web
Site: www.ecece.org.uk
=
Date Recue/Date Received 2020-08-14

66
Health Protection Agency, Porton Down
and.
European Collection of Cell Cultures
This document certifies that
Virus Salmon alphavirus 3 ALV-409
Deposit Reference 07121203
has been accepted as a patent deposit, in accordance with
The Budapest Treaty of 1977,
with the European Collection of Cell Cultures on
12 December 2007
CSCL,
ECACC Patent Supervisor
European Collection of Cell Cultures, Health Protection Agency, Centre For
Emergency Preparedness end Response, Porten Down, Salisbury, Wiltshire, 5P4
OE, LK.
Tel: 44 (01 1880 612512 Fax: 44 WI 1980 611315 Email: ecacc@hpa.urtuk Wet
Site: wmecacc.org.uk
Date Recue/Date Received 2020-08-14

67
Health Protection Agency Porton Down
and.
European Collection of Cell Cultures
This document certifies that
Virus HEART &
SKELETAL MUSCLE
INFLAMMATION VIRUS (HSMI)
Deposit Reference 04050401
has been accepted as a patent deposit, in accordance with
The Budapest Treaty of 1977,
with the European Collection of Cell Cultures on
04 May 2004
Dr D H Lew
General Manager
ECACC
European Collection of Cell Cultures, Health Protection Agency, Porten Down.
Salisbury, SP4 OJG UK,
Tel: 44 (0) 1980 612512 Fax: 44(0) 1980 611315 Email: ecacc@hpa.org.uk Web
Site: ecacc.org.uk
Date Recue/Date Received 2020-08-14

,
68
Health Protection Agency, Porton Down
and
European Collection of Cell Cultures
This doou rent certifies that
Virus
Cardiomyopathy syndrome virus (CMS)
Deposit Reference 07032902
has been accepted as a patent deposit, in accordance with
The Buda,..iest Treaty of 1977,
with the European Collection of Cell Cultures on
29 March 2007
=
õ
ECACC Patent Supervisor
. = = . . , = = =
, 44 ail 138L, li1512 =
Date Recue/Date Received 2020-08-14

69
Health Protection Agency, Porton Down
and
European Collection of Cell Cultures
This document certifies that
Bacteria AL10005
Deposit Reference 06050901
has been accepted as a patent deposit, in accordance with
The Budapest Treaty of 1977,
with the European Collection of Cell Cultures on
09 May 2006
Yr
di.19% (n/4-6714
Dr D H Lewis
General Manager
ECACC
European Collection of Cell Cultures, Health Protection Agency, Centre For
Emergency Preparedness and Response, Porton Down, Salisbury, Wiltshire, SP4
OJG, UK.
Tel: 44 Ill) 11140 612512 Fax: 44 101 1980 611315 Email: ececc@hpe.org.uk Web
Site: twmecace.orb.uk
Date Recue/Date Received 2020-08-14

70
Health Protection Agency, Porton Down
and
European Collection of Cell Cultures
This document certifies that
Bacteria AL10007
=
Deposit Reference 06050902
has been accepted as a patent deposit, in accordance with
The Budapest Treaty of 1977,
with the European Collection of Cell Cultures on
09 May 2006
fp
Dr D H Lewis
General Manager
ECACC
iuropeon Collection of Cell Cultures, Health Protection Agency, Centre Foe
Emergency Preparedness and Response, Porton Down, Salisbury, lAfiltshire. 6P4
OJG, UK.
Tel: 44(0) 1910 612512 Fax: 44 RD 1980 611315 Email: eeacc@hpa.org.uk Web
Site: vemecacc.org uk
=
Date Recue/Date Received 2020-08-14

71
Health Protection Agency, Porton Down
and=
European Collection of Cell Cultures
= This document certifies that
Bacteria AL10008
Deposit Reference 06050903
= has been accepted as a patent deposit, in accordance with
The Budapest Treaty of 1977,
with the European Collection of Cell Cultures on
09 May 2006
= (6: )3/ Gi-Or/)
et
= Dr D H Lewis
General Manager
ECACC
European Collection of Cell Cultures, Health Protection Agency, Centre For
Emergency Preparedness and Response, Porton Down, Salisbury, Wiltshire, SP4 OA
UK.
Tel: 44 10)10130 1312512 Fax: 44 101 1980 611315 Email: ecacc@hpa.org.uk Web
Site: rumecacc.org.uk
=
Date Recue/Date Received 2020-08-14

72
Health Protection Agency, Porton Down
and
European Collection of Cell Cultures
This document certifies that
Bacteria Piscirickettsia salmonis
Deposit Reference 07032110
has been accepted as a patent deposit, in accordance with
The Budapest Treaty of 1977,
with the European Collection of Cell Cultures on
21 March 2007
ECACC Patent Supervisor
European Collection of CeN Cultures, Health Protection Agency, Centre For
Emergency Preparedness and Response, Porton Down, Salisbury, Wiltshire, SP4 OA
UK,
Tel: 44(0) 1980 612512 Fee: 44 (0) 1980 611315 &net ecacc@hpa.org.uk Web Sta:
wmetecacc.org.uk
Date Recue/Date Received 2020-08-14
=

73
References
=
Aguilar JC and Rodriguez EG (2007), Vaccine adjuvants revisited, Vaccine 2007,
25, 3752 - 3762, 2007.
Alderborn G and AuIton M (2002) Pharmaceutics; The Science of Dosage Form
Design, 2002, Elsevier Science
Castric J, baudin Laurencin F, Bremont M, jeffroy 3, Le Ven A and Bearzotti M
(1997) Bulletin of the European Association of Fish Pathologists 17, 27-30,
1997.
Boucher P and Baudin Laurencin F (1994) Sleeping disease (SD) of salmon ids,
Bull of the European Association of Fish Pathologists, 14, 179-180
Castric), baudin Laurencin F, Bremont M, jeffroy 3, Le Ven A and Bearzotti M
(1997) Bulletin of the European Association of Fish Pathologists 17, 27-30,
1997.
Christie KE, Koumans JTM, Fyrand K, Goovaerts D and Rodseth OM (1999A)
Vaccination against pancreas disease in Atlantic salmon (Salmo salar L). IXth
International Conference of the European Association of Fish Pathologists,
Rohdes, September 1999, oral presentation with abstract
Christie KE, Fyrand K and Rodseth OM (1999B) Vaksine mot pancreas disease hos
laks og orret, meeting Frisk Fisk, Tromso January 1999, oral presentation with
abstract.
Hodneland K, Bratland A, Christie KE, Endresen C, Nylund A. (2005), New
subtype of salmonid alphavirus (SAV), Togaviridae, from Atlantic salmon Salmo
salar and rainbow trout Oncorhynchus mykiss in Norway, Dis Aquat Organ. 2005
Sep 5;66(2):113-20, Erratum in: Dis Aquat Organ. 2005 Nov 9;67(1-2):181.
Intervet Newsletter, March 2002.
Lonez-Doriga MV, Smail DA, Smith RJ, Domenech A, Castric 3, Smith PD, Ellis
AE.
Isolation of salmon pancreas disease virus (SPDV) in cell culture and its
ability to
protect against infection by the 'wild-type' agent. Fish Shellfish Immunol.
2001
Aug;11(6):505-22.
McLoughlin MF and Graham DA (2007), Alphavirus infections in salmonids ¨ a
review, Journal of Fish Diseases 2007, 30, 511-531.
Date Recue/Date Received 2020-08-14

74
Nelson RT, McLoughlin MF, Rowley HM, Platten MA and McCormick 31 (1995)
Isolation of a toga-like virus from Atlantic salmon Salmo salar with pancreas
disease (1995) Diseases of Aquatic Organisms, 22, 25-32, 1995.
Powers AM, Brault AC, Shirako Y, Strauss EG, kang W, Strauss JH and Weaver SC
(2001) Evolutionary relationships and systematics of the alphaviruses,
Virology
75, 10118-10131 2001.
Raa (1996), Reviews in Fisheries Science 4(3):229-228 1996.
Rognes T ( 2001), ParAlign: a parallel sequence alignment algorithm for rapid
and
sensitive database searches, Nucleic Acids Research, 29, 1647-1652 2001.
Smith TF and Waterman MS (1981) Identification of common molecular sub-
sequences.Journal of Molecular Biology, 147, 195-197.
Taksdal T, Olsen, A B, Bjerkgs I, Hjortaas M J, Dannevig B H, Graham D A,
McLoughlin M F (2007), Pancreas disease in farmed Atlantic salmon, Salmo salar
L., and rainbow trout, Oncorhynchus mykiss (Walbaum), in Norway, Journal of
Fish Disease 2007, 30, 545-558.
Watson JD, Hopkins NH, Roberts JW, Steitz JA, Weiner AM (1987)
Molecular biology of the gene, Chapter 24 The extraordinary diversity of
eucaryotic viruses (898-961)
Rodger, H & Mitchell, S. Pancreas disease in Ireland: Epidemiological survey
results for2003 and 2004 in Ruane N, Rodger H, Graham D, Foyle L, Norris A,
Ratcliff J, Murphy K, Mitchell S, Staples C, Jewherst H, Todd D, Geoghegan F
and
Cinneide MO: Marine Environment and health service No 22 2005 Research on
Pancreas disease in Irish farmed Salmon 2004/2005 - Current and Future in
initiatives. 2005.
Andre, E F: Development and clinical application of new polyvalent combined
paediatric vaccines, Vaccine 17(1999), 1620-1627
0,Meara et al.: Recombinant vaccines against ovine footrot, Immunology and
Cell
Biology (1993) 71, 473-488.
Date Recue/Date Received 2020-08-14

75
Elena, SF and Sanjuan, R et al. Adaptive Value of High Mutation Rates of RNA
viruses: Separating Causes from Consequences (2005), Journal of Virology, 79,
11555-11558.
Domingo, E and Holland, JJ et al. RNA virus mutations and fitness for survival
(1997), Annu. Rev. Microbiol., 51, 151-78.
Watson JD, Hopkins NH, Roberts JW, Steitz JA, Weiner AM (1987), Molecular
biology of the gene, Chapter 24 The extraordinary diversity of eucaryotic
viruses
= 10 (898-961)
Date Recue/Date Received 2020-08-14