Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
WO 2022/040719
PCT/A112020/050892
ANTIVIRAL SOX INHIBITORS
FIELD
The present disclosure generally relates to antiviral compounds for use in
treatment of
viral associated diseases or conditions. The present disclosure also relates
to processes for
preparing the antiviral compounds, and uses or methods of treatment of viral
associated
diseases or conditions comprising the antiviral compounds. The present
disclosure also
provides antiviral compounds as inhibitors of SOX family transcription
factors, and in particular
SOX18 transcription factor.
BACKGROUND
Kaposi sarcoma (KS) is an angiogenic endothelial tumour caused by KS
herpesvirus
(KSHV). Most cases of KS develop in people infected with HIV, such patients
having a 20,000-
fold increased risk of developing KS compared to people without HIV. KSHV
infection is much
more common in some parts of the world, such as subequatorial Africa, where
over 30% of the
population carries KSHV antibodies. In some areas in Africa, the virus seems
to spread from
mother to child. Seropositivity for the virus ranges from 10% to 25% in the
Mediterranean area.
In other regions of the world where KSHV is not endemic, the seroprevalence is
around 2-5%.
(Horenstein et al., (2008); J. Cutan. Pathol. 35(Suppl. 2): 40-44).
KS cells form purple, brown or red lesions on the skin that are usually
papular (i.e,
palpable or raised). In many cases, these skin lesions do not cause any
symptoms; in other
cases, they may cause painful swelling, especially in the legs, groin area or
skin around the
eyes. KS can cause serious problems, and can even become life-threatening when
the lesions
are in the lungs, liver or digestive tracts. Lesions in the digestive tract
may cause blockage,
resulting in nausea, vomiting, abdominal pain and occasionally bleeding.
Lesions in the lungs
can cause difficulty breathing.
KSHV appears to be transmitted through saliva, as is the case for other human
herpesviruses. Sexual transmission through semen has also been suggested
(Horenstein et
al., (2008); J. Cutan. Pathol. 35(Suppl. 2): 40-44). The virus may also be
transmitted through
organ donation. Some cases of KSHV have been reported in injection drug users
and are
thought to be spread when needles are contaminated with infected blood. The
transmission of
KSHV through blood appears to be rare and occurs much less than HIV
transmission.
The histopathological hallmark of KS is the presence of KSHV-positive spindle
cells
(SC), the tumour cells of KS (Ojala, P. M. & Schulz, T. F. (2014) Semin Cancer
Biol 26:69-77;
Gramolelli, S. & Ojala, P. M. (2017) Curr Opin Virol 26:156-162). The cell of
origin of SC has
been debated for two decades. The prevailing hypothesis suggests lymphatic
endothelial
origin, although blood endothelial cells or mesenchymal cells are also
candidates (Li, Y. et al.
(2018) Cancer Res 78:230-245).
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
2
In vitro, latency is the default replication program in KSHV-infected cells
with
undetectable levels of lytic genes expressed. However, KSHV infection of
lymphatic, but not
blood, endothelial cells (LEC and BEC) leads to a unique infection program
characterized by
high KSHV genome copies, spontaneous lytic gene expression and release of
infectious virus.
During embryonic development, LEC precursors originate from COUPTF2/S0X18
double-positive BECs that physically separate from the cardinal vein to
establish a primary
lymphatic vascular plexus. In this process, COUPTF2 and SOX18 drive the
expression of
PROX1 thereby orchestrating LEC differentiation (Francois, M. et al. (2008)
Nature 822:456);
Srinivasan, R. S. et al. (2010) Genes Dev 24, 696-707).
There is a need for alternatives to anti-viral drug approaches for treating
viruses such
as KSHV.
It will be understood that any prior art publications referred to herein do
not constitute
an admission that any of these documents form part of the common general
knowledge in the
art, in Australia or in any other country.
SUMMARY
The present disclosure is based on a finding that SOX18 binds to viral origins
of
replication and increases viral genome copies. Accordingly, the inventors have
undertaken an
extensive development project to identify SOX inhibitors, and in particular
SOX18 inhibitors, for
an ability to inhibit viral replication, which has involved using Kaposi
sarcoma as an example.
In one aspect, there is provided a method of treating a viral disease or
condition by
administration of an antiviral compound to a subject in need of treatment
thereof, wherein the
antiviral compound is a compound of Formula 1:
OR3 0
R4
X1
R2 L1 X2
X5
X4
Formula 1
wherein
R1 and R2 are each independently selected from hydrogen, halo, OH, Ci_walkyl,
Ci-
ioalkylhalo, OCi-loalkyl, OCi-loalkylhalo,
Cmoalkenylhalo, OCiloalkenyl, OCi_
ioalkenylhalo;
R3 is selected from hydrogen, Ciioalkyl, Ciioalkylhalo, Cr_ioalkenyl,
Ci_walkenylhalo;
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
3
R4 is selected from hydrogen, OH, Ci_ioalkyl, OCiioalkyl, Ci_ioalkylhalo,
OCi_ioalkylhalo,
NH2, NH(Ci-ioalkyl), and N(Ci_loalky1)2;
L1 is selected from Ci_loalkyl, OCHoalkyl, Ci_loalkenyl, OCi_loalkenyl,
OC(=0),
OC(=0)(Ci_malkyl), NHC(=0), N(C-i_loalkyl)C(=0), OS(=0)2, wherein each alkyl
or alkenyl is
uninterrupted or interrupted with one or more groups selected from 0, OC(=0),
NH, N(Ci_
ioalkyl), NHC(=0), S, and S(=0)2, and unsubstituted or substituted with one or
more groups
selected from halo, OH, and C=0; and
X1, X2, X3, X4, and X5, are each independently selected from hydrogen, halo,
OH, Ci_
ioalkyl, Ci_walkenylhalo,
OCi_walkenylhalo, C(=0)H, C(=0)0H, C(=0)0(Ci_walkyl), and NO2, and any two X
groups can
join together to form an aryl group unsubstituted or substituted with one or
more groups
selected from halo, OH, Ci_loalkyl,
OCi-loalkylhalo, Ci-loalkenyl, Ci-
ioalkenylhalo, OCi_loalkenyl, OCi_ioalkenylhalo, C(=0)H, C(=0)0H,
C(=0)0(Ci_ioalkyl), and
NO2.
In another aspect, there is provided a method of treating a viral disease or
condition in
a subject comprising administering an antiviral compound to a subject in need
of treatment
thereof, wherein the antiviral compound is a compound of Formula 1, or
pharmaceutically
acceptable salt, solvate, or stereoisomer thereof.
In another aspect, there is provided a use of a compound of Formula 1 as
defined
according to any aspects, embodiments or examples as described herein, as an
antiviral agent
or for treating a viral disease or condition or a viral associated disease or
condition.
In another aspect, there is provided a use of a compound of Formula 1 as
defined
according to any aspects, embodiments or examples as described herein, in the
manufacture
of a medicament for treating a viral disease or condition or a viral
associated disease or
condition.
In another aspect, there is provided a method for inhibiting replication of a
herpesvirus
and/or treating a viral disease or condition caused by a herpesvirus in a
subject comprising
administering to the subject a compound of Formula 1 as described herein
It will be appreciated that other aspects, embodiments and examples of the
compounds, pharmaceutical compositions, methods, or uses, are further
described herein.
Description of the Drawings
Figure 1 shows (a,b) luciferase reporter assays in HeLa cells transfected as
indicated
with increasing amounts of SOX18. Single values from (b) n=8 and (c) n=4
biological replicates
are shown. Bars represent mean + SEM.
Figure 2 shows HeLa cells transfected for 18 hours with SOX18 and one of two
luciferase reporter constructs: 7XTR and OriA before being treated with GB001
(SM4), GB002
or GB004 for 24 hours. Luciferase signal was quantified and single values from
n=3 technical
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
4
replicates are shown. Data points represent mean + SD. P values were
calculated using a 2-
way and ordinary one way ANOVA followed by Dunnett's multiple comparison test.
Figure 3 shows LECs infected with KSHV and treated with compounds for 6 days
at
the concentrations shown. The relative expression of KSHV from control was
quantified and
single values from n=3 technical replicates are shown. Bars represent mean +
SD. P values
were calculated using a 2-way ANOVA (left) and ordinary one way-ANOVA (right)
followed by
Dunnett's multiple comparison test.
Key to Sequence Listing
SEQ ID NO:1 sequence of the K8.1 forward primer
SEQ ID NO:2 sequence of the K8.1 reverse primer
SEQ ID NO:3 sequence of the genomic forward primer
SEQ ID NO:4 sequence of the genomic reverse primer
Detailed Description
General Definitions
The following definitions apply to the terms as used throughout this
specification, unless
otherwise limited in specific instances. Unless specifically defined
otherwise, all technical and
scientific terms used herein shall be taken to have the same meaning as
commonly understood
by one of ordinary skill in the art.
As used herein, the term "and/or", e.g., "X and/or Y" shall be understood to
mean either
"X and Y" or "X or Y" and shall be taken to provide explicit support for both
meanings or for
either meaning.
As used herein, the term about, unless stated to the contrary, refers to +/-
20%, more
preferably +1-10%, of the designated value.
As used herein, singular forms "a", "an" and "the" include plural aspects,
unless the context
clearly indicates otherwise.
Throughout this specification, the word "comprise", or variations such as
"comprises" or
"comprising", will be understood to imply the inclusion of a stated element,
integer or step, or
group of elements, integers or steps, but not the exclusion of any other
element, integer or
step, or group of elements, integers or steps.
As used herein, the term "subject" refers to any organism susceptible to a
disease or
condition. For example, the subject can be a mammal, primate, livestock (e.g.,
sheep, cow,
horse, pig), companion animal (e.g., dog, cat), or laboratory animal (e.g.,
mouse, rabbit, rat,
guinea pig, hamster). In one example, the subject is a mammal. In one
embodiment, the
subject is human. In one embodiment, the disease or condition is associated
with a virus.
As used herein, the term "treating" includes alleviation or reducing symptoms
associated with a specific disorder or condition.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
As used herein, the term "prevention" includes prophylaxis of the specific
disorder or
condition. For example, as used herein, the term "preventing" refers to
preventing the onset or
duration of the symptoms associated with a virus.
The present disclosure relates to compounds of Formula 1 and salts thereof.
Salts may
5 be formed in the case of embodiments of the compound of Formula 1 which
contain a suitable
acidic or basic group. Suitable salts of the compound of Formula 1 include
those formed with
organic or inorganic acids or bases.
As used herein, the phrase "pharmaceutically acceptable salt" or like term
refers to
pharmaceutically acceptable organic or inorganic salts. It will be appreciated
that any reference
to "salt" herein can include "pharmaceutically acceptable salts". Exemplary
acid addition salts
include, but are not limited to, sulfate, citrate, acetate, oxalate, chloride,
bromide, iodide,
nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate,
salicylate, acid citrate,
tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate,
maleate, gentisinate,
funnarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate,
methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and
pamoate (i.e.,
1,1'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Exemplary base addition
salts include, but
are not limited to, ammonium salts, alkali metal salts, for example those of
potassium and
sodium, alkaline earth metal salts, for example those of calcium and
magnesium, and salts with
organic bases, for example dicyclohexylamine, N-methyl-D-glucomine,
morpholine,
thiomorpholine, piperidine, pyrrolidine, a mono-, di- or tri-lower alkylamine,
for example ethyl-,
tert-butyl-, diethyl-, diisopropyl-, triethyl-, tributyl- or dimethyl -
propylamine, or a mono-, di- or
trihydroxy lower alkylamine, for example mono-, di- or triethanolamine. A
pharmaceutically
acceptable salt may involve the inclusion of another molecule such as an
acetate ion, a
succinate ion or other counterion. The counterion may be any organic or
inorganic moiety that
stabilizes the charge on the parent compound. Furthermore, a pharmaceutically
acceptable salt
may have more than one charged atom in its structure. Instances where multiple
charged
atoms are part of the pharmaceutically acceptable salt can have multiple
counter ions. Hence,
a pharmaceutically acceptable salt can have one or more charged atoms and/or
one or more
counterion. It will also be appreciated that non-pharmaceutically acceptable
salts also fall within
the scope of the present disclosure since these may be useful as intermediates
in the
preparation of pharmaceutically acceptable salts or may be useful during
storage or transport.
Those skilled in the art of organic and/or medicinal chemistry will appreciate
that many
organic compounds can form complexes with solvents in which they are reacted
or from which
they are precipitated or crystallized. These complexes are known as
"solvates". For example, a
complex with water is known as a "hydrate". As used herein, the phrase
"pharmaceutically
acceptable solvate" or "solvate" refer to an association of one or more
solvent molecules and a
compound of the present disclosure. Examples of solvents that form
pharmaceutically
acceptable solvates include, but are not limited to, water, isopropanol,
ethanol, methanol,
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
6
DMSO, ethyl acetate, acetic acid, and ethanolamine. It will be understood that
the present
disclosure encompasses solvated forms, including hydrates, of the compounds of
formula (I)
and salts thereof.
The compounds of the present disclosure may contain chiral (asymmetric)
centers or
the molecule as a whole may be chiral. The individual stereoisomers
(enantiomers and
diastereoisomers) and mixtures of these are within the scope of the present
disclosure.
As used herein, the term "stereoisomer" refers to compounds having the same
molecular formula and sequence of bonded atoms (i.e., atom connectivity),
though differ in the
three-dimensional orientations of their atoms in space. As used herein, the
term "enantiomers"
refers to two compounds that are stereoisomers in that they are non-
superimposable mirror
images of one another. Relevant stereocenters may be donated with (R)- or (S)-
configuration.
Those skilled in the art of organic and/or medicinal chemistry will appreciate
that the
compounds of Formula 1 and salts thereof may be present in amorphous form, or
in a
crystalline form. It will be understood that the present disclosure
encompasses all forms and
polymorphs of the compounds of Formula 1 and salts thereof.
As would be understood by the person skilled in the art, a compound of Formula
1, or
any salt, solvate or stereoisomer thereof would be administered in a
therapeutically effective
amount. The term "therapeutically effective amount", as used herein, refers to
a compound
being administered in an amount sufficient to alleviate or prevent to some
extent one or more of
the symptoms of the disorder or condition being treated. The result can be the
reduction and/or
alleviation of the signs, symptoms, or causes of a disease or condition, or
any other desired
alteration of a biological system. In one embodiment, the term
"therapeutically effective
amount" refers to a compound of Formula 1, or any salt thereof, being
administered in an
amount sufficient to inhibit or modulate a SOX transcription factor (e.g.
SOX18) to provide a
therapeutic outcome.
As used herein, the term "halogen" or "halo" means fluorine, chorine, bromine,
or
iodine.
As used herein, the term "alkyl" encompasses both straight chain (i.e. linear)
and
branched chain hydrocarbon groups. Examples of alkyl groups include methyl,
ethyl, n-propyl,
iso-propyl, n-butyl, t-butyl, 1-butyl, sec-butyl, pentyl, and hexyl groups. In
one example, the alkyl
group is of 1 to 20 carbon atoms (i.e. C1_20a1ky1). In another example, the
alkyl group is of 1 to
10 carbon atoms (i.e. Ci_ioalkyl). In another example, the alkyl group is 2 to
10 carbon atoms
(i.e. C2_10alkyl). In another example, the alkyl group is 1 to 6 carbon atoms
(i.e. Ci_ealkyl) or 2 to
6 carbon atoms (i.e. C2.8alkyl). In another example, the alkyl group is 1 to 4
carbon atoms (i.e.
Ci_aalkyl) or 2 to 4 carbon atoms (i.e. C2_4alkyl).
As used herein, the term "alkenyl" refers to both straight and branched chain
unsaturated hydrocarbon groups with at least one carbon-carbon double bond.
Examples of
alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, and hexenyl
groups. In one
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
7
example, the alkenyl group is of 1 to 20 carbon atoms (i.e. C1_20alkeny1). In
another example,
the alkenyl group is of 1 to 10 carbon atoms (i.e. Ci_loalkeny1). In another
example, the alkenyl
group is 2 to 10 carbon atoms (i.e. Ci_loalkeny1). In another example, the
alkenyl group is 1 to 6
carbon atoms (i.e. Ci_ealkenyl) or 2 to 6 carbon atoms (i.e. C2_6alkeny1). In
another example, the
alkenyl group is 1 to 4 carbon atoms (i.e. Ci_aalkenyl) or 2 to 4 carbon atoms
(i.e. C2_4alkeny1).
As used herein, the term "alkynyl" refers to both straight and branched chain
unsatu-
rated hydrocarbon groups with at least one carbon-carbon triple bond. Examples
of alkynyl
groups include ethynyl, propynyl, butynyl, pentynyl, and hexynyl groups. In
one example, the
alkynyl group is of 1 to 20 carbon atoms (i.e. Ci_20alkyny1). In another
example, the alkynyl
group is of 1 to 10 carbon atoms (i.e. Ci_loalkyny1). In another example, the
alkynyl group is 2 to
10 carbon atoms (i.e. Cmoalkynyl). In another example, the alkynyl group is 1
to 6 carbon
atoms (i.e. Ci_aalkynyl) or 2 to 6 carbon atoms (i.e. C2_6alkyny1). In another
example, the alkynyl
group is 1 to 4 carbon atoms (i.e. Ci_aalkynyl) or 2 to 4 carbon atoms (i.e.
C2_4a1kyny1).
As used herein, the term "alkylhalo" refers to an alkyl group having at least
one halogen
substituent, where "alkyl" and "halogen" are as described above. Examples of
alkylhalo groups
include fluoromethyl, chloromethyl, bromomethyl, iodomethyl, fluoropropyl, and
fluorobutyl
groups. Examples include difluoromethyl and difluoroethyl groups, and
trifluoromethyl and
trifluoroethyl groups.
As used herein, the term "alkenylhalo" refers to an alkenyl group having at
least one
halogen substituent, where "alkenyl" and "halogen" are as described above.
As used herein, the term "alkynylhalo" refers to an alkynyl group having at
least one
halogen substituent, where "alkynyl" and "halogen" are as described above.
"Aryl" whether used alone, or in compound words, such as arylalkyl,
represents: (i) an
optionally substituted mono- or polycyclic aromatic carbocyclic moiety, e.g.,
of about 6 to about
20 carbon atoms, such as phenyl, naphthyl or fluorenyl; or, (ii) an optionally
substituted partially
saturated polycyclic carbocyclic aromatic ring system in which an aryl and a
cycloalkyl or
cycloalkenyl group are fused together to form a cyclic structure such as a
tetrahydronaphthyl,
indenyl, indanyl or fluorene ring. It will be appreciated that the polycyclic
ring system includes
bicyclic and tricyclic ring systems. In further examples the term "aryl"
denotes single,
polynuclear, conjugated and fused residues of aromatic hydrocarbons, such as
unsubstituted
or substituted: phenyl, biphenyl, terphenyl, quaterphenyl, phenoxyphenyl,
naphthyl,
tetrahydronaphthyl, anthracenyl, dihydroanthracenyl, benzanthracenyl,
dibenzanthracenyl and
phenanthrenyl groups.
As used herein, the term "alkylaryl" refers to an alkyl group interrupted
and/or
substituted with at least one aryl group, where "alkyl" and "aryl" are as
described above.
As used herein, the term "saturated" refers to a group where all available
valence
bonds of the backbone atoms are attached to other atoms Representative
examples of
saturated groups include, but are not limited to, butyl, cyclohexyl,
piperidine, and the like.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
8
As used herein, the term "unsaturated" refers to a group where at least one
valence
bond of two adjacent backbone atoms is not attached to other atoms.
Representative examples
include, but are not limited to, alkenes (e.g., -CH2-CH=CH-), phenyl, pyrrole,
and the like.
As used herein, the term "substituted" refers to a group having one or more
hydrogens
or other atoms removed from a carbon or suitable heteroatom and replaced with
a further group
(i.e., substituent).
As used herein, the term "unsubstituted" refers to a group that does not have
any
further groups attached thereto or substituted therefore.
All documents cited or referenced herein, and all documents cited or
referenced in
herein cited documents, together with any manufacturer's instructions,
descriptions, product
specifications, and product sheets for any products mentioned herein or in any
document
incorporated by reference herein, are hereby incorporated herein by reference
in their entirety.
Compounds of Formula 1
The present disclosure is directed to providing antiviral compounds. The
antiviral
compounds can be effective inhibitors of one or more SOX family transcription
factors, and in
particular SOX18. It will be appreciated that the SOX family transcription
factors are sex
determining region Y proteins (SRY-related HMG-box proteins). The antiviral
compounds are
based on a benzoic acid scaffold or derivative, and in particular a biaryl
benzoic acid scaffold.
The antiviral compounds of the present disclosure can be provided by a
compound of Formula
1 as described herein.
In one aspect, compounds of Formula 1 can be provided as follows:
OR3 0
R4
15`_ xl
R2 L1 x2
R1 B
x5 x3
x4
Formula I.
In one example of the above Formula 1:
R1 and R2 are each independently selected from hydrogen, halo, OH, Cmoalkyl,
Ci-
ioalkylhalo, 0Cmoalkyl, 0Cmoalkylhalo, Ciioalkenyl, Cmoalkenylhalo,
0Cmoalkenyl, OCi_
ioalkenylhalo;
R3 is selected from hydrogen, Ci_loalkyl, Cmoalkylhalo, Cmoalkenyl,
Cmoalkenylhalo;
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
9
R4 is selected from hydrogen, OH, Ci_ioalkyl, OCi ioalkyl, Ci_ioalkylhalo,
OCi_ioalkylhalo,
NH2, NH(Ci-ioalkyl), and N(Ci_loalky1)2;
L1 is selected from Ci_loalkyl, OCHoalkyl, Ci_loalkenyl, OCi_loalkenyl,
OC(=0),
OC(=0)(Ci_ioalkyl), NHC(=0), N(Ci_ioalkyl)C(=0), OS(=0)2, wherein each alkyl
or alkenyl is
uninterrupted or interrupted with one or more groups selected from 0, OC(=0),
NH, N(Ci_
ioalkyl), NHC(=0), S, and S(=0)2, and unsubstituted or substituted with one or
more groups
selected from halo, OH, and C=0; and
X1, X2, X3, X4, and X5, are each independently selected from hydrogen, halo,
OH, Ci_
ioalkyl, Ciioalkylhalo, OCi_malkyl, OCi_ioalkylhalo, Ci_ioalkenyl,
Ci_walkenylhalo,
OCi_walkenylhalo, C(=0)H, C(=0)0H, C(=0)0(Ci_walkyl), and NO2, and any two X
groups can
join together to form an aryl group unsubstituted or substituted with one or
more groups
selected from halo, OH, Ci_loalkyl,
OCi_ioalkyl, OCi-loalkylhalo, Ci-loalkenyl, Ci-
ioalkenylhalo, OCi_loalkenyl, OCi_ioalkenylhalo, C(=0)H, C(=0)0H,
C(=0)0(Ci_ioalkyl), and
NO2.
In another example of the above Formula 1:
R1 and R2 are each independently selected from hydrogen, halo, OH, Ci_ioalkyl,
Ci-
ioalkylhalo, OCi_ioalkyl, and OCi_ioalkylhalo;
R3 is selected from hydrogen, Ci_ioalkyl and Ci_ioalkylhalo;
R4 is selected from OH, OCi ioalkyl, and OCi ioalkylhalo;
L1 is selected from Ci_ioalkyl, OCiioalkyl, Ci_ioalkenyl, and OCi_loalkenyl,
wherein each
alkyl or alkenyl is uninterrupted or interrupted with one or more groups
selected from 0,
OC(=0), NH, N(Ci_ioalkyl), NHC(=0), S, and S(=0)2, and unsubstituted or
substituted with one
or more groups selected from halo, OH, and C=0; and
Xl, X2, X3, X4, and X5, are each independently selected from hydrogen, halo,
OH, Ci_
ioalkyl, Ciioalkylhalo, OCHoalkyl, OCi_walkylhalo, and any two X groups can
join together to
form an aryl group unsubstituted or substituted with one or more groups
selected from halo,
OH, Ci_ioalkyl, OCi_ioalkyl, OCi_ioalkylhalo.
In another example of the above Formula 1:
R1 and R2 are each independently selected from hydrogen, halo, OH, Ci_ioalkyl,
Ci-
ioalkylhalo, OCi_loalkyl, and OCi_loalkylhalo;
R3 is selected from hydrogen, Ci_icalkyl and Ci_ioalkylhalo;
R4 is selected from OH, OCi_ioalkyl, and OCi_ioalkylhalo;
L1 is selected from C2.4alkyl, 0C2_4alkyl, C2_4alkenyl, and 0C2_4alkenyl,
wherein each
alkyl or alkenyl is uninterrupted or interrupted with one or more groups
selected from 0,
OC(=0), NH, N(Ci_ioalkyl), NHC(=0), S, and S(=0)2, and unsubstituted or
substituted with one
or more groups selected from halo, OH, and C=0; and
X1, X2, X3, X4, and X5, are each independently selected from hydrogen, halo,
OH, Ci_
ioalkyl, Ci-ioalkylhalo, OCHoalkyl, OCi_walkylhalo, and any two X groups can
join together to
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
form an aryl group unsubstituted or substituted with one or more groups
selected from halo,
OH, Ci-ioalkyl, OCi_ioalkyl, OCi-ioalkylhalo.
In another example of the above Formula 1:
R1 and R2 are each independently selected from hydrogen, halo, OH, Ci_ioalkyl,
Ci-
5 ioalkylhalo, OCi ioalkyl, and OCi_ioalkylhalo;
R3 is selected from hydrogen, Ci_ioalkyl and Ci_ioalkylhalo;
R4 is selected from OH, OCi_ioalkyl, and OCi_ioalkylhalo;
L1 is selected from C2_4alkyl, 0C2_4alkyl, C2_4alkenyl, and 0C2_4alkenyl,
wherein each
alkyl or alkenyl is uninterrupted or interrupted with one or more groups
selected from 0,
10 OC(=0), NH, N(Ci_ioalkyl), NHC(=0), S, and S(=0)2, and unsubstituted or
substituted with one
or more groups selected from halo, OH, and C=0; and
Xl, X2, X3, X4, and X5, are each independently selected from hydrogen, halo,
OH, Ci_
ioalkyl, OCi_ioalkylhalo, and any two X groups
can join together to
form a monocyclic or bicyclic aryl group unsubstituted or substituted with one
or more groups
selected from halo, OH, Ci_ioalkyl, Ci_ioalkylhalo, OCi_ioalkylhalo.
In another example of the above Formula 1:
R1 and R2 are each independently selected from hydrogen and halo;
R3 is selected from hydrogen, Ci_ioalkyl and Ci_ioalkylhalo;
R4 is selected from OH, OCi ioalkyl, and OCi ioalkylhalo;
Ll is selected from C2_4alkyl, 0C2_4alkyl, C2_4alkenyl, and 0C2_4alkenyl,
wherein each
alkyl or alkenyl is uninterrupted or interrupted with one or more groups
selected from 0,
OC(=0), NH, N(Ci_ioalkyl), NHC(=0), S, and S(=0)2, and unsubstituted or
substituted with one
or more groups selected from halo, OH, and C=0; and
Xl, X2, X3, X4, and X5, are each independently selected from hydrogen, halo,
OH, Ci_
ioalkyl, Ciioalkylhalo, OCHoalkyl, OCi_loalkylhalo, and any two X groups can
join together to
form a phenyl or naphthyl group unsubstituted or substituted with one or more
groups selected
from halo, OH, Ci_walkyl, Ci_ioalkylhalo,
In another example of the above Formula 1:
R1 and R2 are hydrogen;
R3 is hydrogen;
R4 is selected from OH and OCi_ioalkyl;
Ll is selected from C2_4alkyl and C2_4alkenyl, wherein each is uninterrupted
or
interrupted with one or more groups selected from 0, OC(=0), NH,
N(Ci_ioalkyl), NHC(=0), S,
and S(=0)2, and unsubstituted or substituted with one or more groups selected
from halo, OH,
and CO; and
X1, X2, X3, X4, and X5, are each independently selected from hydrogen, halo,
OH, Ci_
ioalkyl, Ciioalkylhalo, OCiioalkyl, OCi_ioalkylhalo, and any two X groups can
join together to
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
11
form a phenyl group unsubstituted or substituted with one or more groups
selected from halo,
OH, Ci-ioalkyl, OCi_ioalkyl, OCi-loalkylhalo.
A-Ring Groups
The above structure of Formula 1 comprises an aryl "A" ring on the left hand
side that is
linked via an L1 group to an aryl "B" ring on the right hand side. A compound
of Formula 1 can
be provided by a linked biaryl benzoic acid scaffold. In the above formula 1,
the A ring groups
comprise R1, R2, R3 and R4.
R1 and R2 can each be independently selected from hydrogen, halo, OH,
Ci_thalkyl, Ci_
ioalkylhalo, OCiioalkyl, OCi_ioalkylhalo, Ci_ioalkenyl, Ci_ioalkenylhalo,
OCi_walkenyl, and OCi_
ioalkenylhalo. In other examples, R1 and R2 can each be independently selected
from
hydrogen, halo, OH, Ci_loalkyl, Ci_ioalkylhalo, OCHoalkyl, and OCHoalkylhalo.
In other
examples of Formula 1, R1 and R2 can each be independently selected from
hydrogen, OH, or
OCi_walkyl. In other examples of Formula 1, R1 is hydrogen. In other examples
of Formula 1,
R1 and R2 are hydrogen.
R3 can be selected from hydrogen, Ci_loalkyl, Ci_ioalkylhalo, Ci-ioalkenyl,
and Ci-
ioalkenylhalo. In other examples of Formula 1, R3 is hydrogen or C-i_salkyl.
In other examples of
Formula 1, R3 is hydrogen.
R4 can be selected from hydrogen, OH, Ci ioalkyl, OC, ioalkyl, NH2, NH(Ci
ioalkyl), and
N(Ci_loalky1)2. In other examples of Formula 1, R4 is OH or Ci_salkyl. In
other examples of
Formula 1, R4 is OH.
It will be appreciated that the above various definitions and examples of R1,
R2, R3 and
R4 may be combined in any way. For example, in some examples of Formula 1 R1
is hydrogen,
R2 is hydrogen, R3 is hydrogen or C-i_salkyl, and R4 is OH or OCi_Balkyl.
Linker Group L1
The linker group L1 connects the aryl ring A to the aryl ring B.
L1 may be selected from Ci_walkyl, OCtioalkyl, Ciioalkenyl, OCi_walkenyl,
OC(=0),
OC(=0)(Ci_walkyl), NHC(=0), N(Ci_loalkyl)C(=0), OS(=0)2. Each alkyl or alkenyl
can be
uninterrupted or interrupted with one or more groups and/or unsubstituted or
substituted with
one or more groups. For example, each alkyl or alkenyl is uninterrupted or
interrupted with one
or more groups selected from 0, OC(=0), NH, N(Ci_walkyl), NHC(=0), S, and
S(=0)2, and/or
unsubstituted or substituted with one or more groups selected from halo, OH,
and C=0.
In one example, L1 may be selected from Ci_loalkyl or Ci_loalkenyl. In another
example,
each alkyl or alkenyl may be uninterrupted or interrupted with one or more
groups selected
from 0, OC(=0), NH, N(Ci_walkyl), NHC(=0), S, and S(=0)2, and/or unsubstituted
or
substituted with one or more groups selected from halo, OH, and C=0.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
12
In another example, L1 is selected from C1_6a1ky1 or C1_6alkenyl. In another
example,
each alkyl or alkenyl is uninterrupted or interrupted with one or more groups
selected from 0,
NH, NHC(=0), S, and S(=0)2.
In another example, L1 is selected from C2_6alkyl or C2_6a1keny1. In another
example,
each alkyl or alkenyl is uninterrupted or interrupted with one or more groups
selected from 0,
NH, NHC(=0), S, and S(=0)2.
In another example, L1 is selected from C2_421ky1 or C2_4a1keny1. In another
example,
each alkyl or alkenyl is uninterrupted or interrupted with one or more groups
selected from 0,
NH, NHC(=0), S, and S(=0)2.
In other examples, L1 can be selected from any one of the following linker
groups, in
which it will be appreciated that either end of the linker group can be joined
to either the A ring
or B ring:
Czalkylialkenyl C3alkyl/alkenyl Caalkyl/alkenyl
-CH2-CH2- -CH2-CH2-CH2- -CH2-CH2-CH2-
CH2-
-CH=CH- (E/Z) -CH=CH-CH2- (E/Z) -CH=CH-CH2-CH2-
(E/Z)
-0-CH2- -0-CH2-CH2- -CH2-CH=CH-CH2-
(E/Z)
-S-CH2- -CH2-0-CH2- -CH=CH-CH=CH-
(E/Z)
-NH-CH2- -0-CH2-0- -0-CH2-CH2-CH2-
-NH-C(=0)- -S-CH2-CH2- -CH2-0-CH2-0-
-N(CH3)-CH2- -CH2-S-CH2- -S-CH2-CH2-CH2-
-N(Et)-CH2- -S-CH2-0- -NH-C(=0)-CH2-
CH2-
-0-C(=0)- -NH-CH2-CH2- -CH2-NH-C(=0)-
CH2-
-C(=0)-CH2- -NH-C(=0)-CH2- -CH2-CH2-CH2-
CH2-
In other examples, each of the L1 groups described above may be further
substituted
with one or more groups selected from halo and OH.
The "one or more" groups as described herein for optional substitution may be
1 to 6
groups, 1 to 5 groups, 1 to 4 groups, Ito 3 groups, 1 or 2 groups, or 1 group.
The "one or more" groups as described herein for optional interruption may be
1 to 6
groups, 1 to 5 groups, 1 to 4 groups, 1 to 3 groups, 1 or 2 groups, or 1
group.
6-Ring Groups
In Formula 1, the B ring groups can comprise X1, X2, X3, X4, and X5.
In one example, X1, X2, X3, X4, and X5, can each be independently selected
from
hydrogen, halo, OH, Ci_6alkyl, Ci_6alkylhalo, OCi_Balkyl, OCi_salkylhalo,
C(0)OH, C(=0)0(Ci_
ioalkyl), and NO2. Any two X groups can also join together to form an aryl
group, for example X2
and X3 can join together to form an aryl group (e.g. phenyl or naphthyl), such
that the B ring is a
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
13
substituted or unsubstituted naphthyl or anthracenyl group. In another
example, X1 and X2 join
together to form an aryl group and X4 and X5 join together to form an aryl
group (e.g. phenyl
group), such that the B ring is a substituted or unsubstituted anthracenyl
group. The aryl group
can be unsubstituted or substituted, for example substituted with one or more
groups selected
from halo, OH, C1_6alkyl, Ci_6alkylhalo, OCi_Balkyl, OCi_ealkylhalo, C(0)OH,
C(=0)0(C1_
ioalkyl), and NO2. The aryl group can be a monocyclic (e.g. phenyl) or
bicyclic group (e.g.
naphthyl or linked biphenyl group).
In another example, X1, X2, X3, X4, and X5, can each be independently selected
from
hydrogen, halo, OH, Ci_6alkyl, C1_6a1ky1ha10, OCi_Balkyl, OC1_681ky1ha10, and
X2 and X3 can join
together to form a phenyl group.
The phenyl group can be unsubstituted or substituted, for example substituted
with one
or more groups selected from halo, OH, Ci_6alkyl, Cialkyltialo, OCi_6alkyl,
OCi_oalkylhalo,
C(0)OH, C(=0)0(Ci_ioalkyl), and NO2.
In another example, X1, X2, X3, X4, and X5, can each be independently selected
from
hydrogen, halo, OH, Ci_6alkyl, Ci_salkylhalo, OCi_6alkyl, 0C1_6alkylhalo.
In another example, X1, X4, and X5, can each be independently selected from
hydrogen,
halo, OH, Cl_salkyl, Ci_salkylhalo, OCi_salkyl, OCi_salkylhalo, and X2 and X3
are joined together
to form a phenyl group. The phenyl group can be unsubstituted or substituted,
for example
substituted with one or more groups selected from halo, OH, C1 ealkyl, Ci
6alkylhalo, OCi 6a1ky1,
OCi_ealkylhalo, C(0)OH, C(=0)0(Ci_ioalkyl), and NO2.
In another example, a compound of Formula 1 can be provided by a compound of
Formula la as follows:
OR3 0
R4
A x6 x7
R2 L1 X8
R1 B
x12 X9
x11 x10
Formula la.
For Formula la, X , X7, X8, X9, X19, X11, and X12, can each be independently
selected
from hydrogen, halo, OH, Ci_6alkyl, Ci_6alkylhalo, OCi_6alkyl, OCi_6alkylhalo,
C(0)OH,
C(=0)0(Ci_ioalkyl), and NO2.
Each of the above various embodiments or examples of R1, R2, R3, R4, and
may
also apply to provide various independently selected further embodiments or
examples of
compounds of Formula 2.
CA 03190768 2023- 2- 23
WO 2022/040719 PCT/AU2020/050892
14
Example Compounds of Formula 1
Example compounds of Formula 1 can be selected from any one of the compounds
in
the following Table 1.
Table 1: Example Compounds
Chemical Structure Chemical Name Ref.
OH
COON 2-hydroxy-6-(2-(naphthalen-2-
GB001 (SM4)
yl)ethyl)benzoic acid
COON (E)-2-methoxy-6-(2-(naphthalen-2-
GB002
yl)vinyl)benzoic acid
OH
COOH 2-hydroxy-6-phenethylbenzoic acid
GB003
OH
COOH 2-(2,4-dichlorophenethyl)-6-
GB004
hydroxybenzoic acid
CI CI
COOH 2-methoxy-6-(4- GB005
methoxyphenethyl)benzoic acid
ocH3
COOH 2-methoxy-6-((naphthalen-2-
GB006
ylmethoxy)methyl)benzoic acid
0
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
OH
COOH (E)-2-hydroxy-6-styrylbenzoic
acid GB007
OH
COON (E)-2-hydroxy-6-(2-(naphthalen-2-
GB008
yl)vinyl)benzoic acid
OH
COOH (E)-4-chloro-2-hydroxy-6-(2-
GB009
(naphthalen-2-yl)vinyl)benzoic acid
CI
COOH (E)-2-methoxy-4-methyl-6-(2-
GB010
(naphthalen-2-yl)vinyl)benzoic acid
OH
COOH (E)-2-hydroxy-4-methyl-6-(2-
GB011
(naphthalen-2-yl)vinyl)benzoic acid
OH
COOH 2-hydroxy-4-methyl-6-(2- GB012
(naphthalen-2-yl)ethyl)benzoic acid
o o
(E)-N,N-diethyl-2-methoxy-6-(2- GB013
NEt (naphthalen-2-yl)vinyl)benzamide
CA 03190768 2023- 2- 23
WO 2022/040719 PCT/AU2020/050892
16
OH 0
N,N-diethy1-2-hydroxy-6-(2- GB014
NEt
(naphthalen-2-yl)ethyl)benzamide
OH 0
methyl 2-(2-(anthracen-9-yl)ethyl)-6- GB015
hydroxybenzoate
OH 0
methyl 2-(2-([1,1'-bipheny1]-4- GB016
O
yl)ethyl)-6-hydroxybenzoate
óácJ
2-methoxy-6-((naphtha len-2- GB017
OH ylmethoxy)methyl)benzoic acid
0
OH 0
2,4-dihydroxy-6-(2-(naphthalen-2- GB018
OH
yl)ethyl)benzoic acid
HO
011 0
4-chloro-2-hydroxy-6-(2- GB019
OH
(naphthalen-2-yl)ethyl)benzoic acid
CI
CA 03190768 2023- 2- 23
WO 2022/040719 PCT/AU2020/050892
17
OH 0
methyl
3-bromo-6-hydroxy-2-(4- GB020
hydroxyphenethyl)benzoate
Br
OH
OH 0
o/../ methyl 2-(4-bromophenethyl)-6-
GB021
hydroxybenzoate
Br
OH 0
2-hydroxy-6-
GB022
OH
((phenylthio)methyl)benzoic acid
s
OH 0
2-hydroxy-6-
GB023
OH
(phenethoxymethyDbenzoic acid
0
OH
COOH (E)-2-hydroxy-6-(2-(naphthalen-2-
GB024
yl)vinyl)benzoic acid
OH
C001-1 2-hydroxy-4-methoxy-6-(2-
GB025
(naphthalen-2-yl)ethyl)benzoic acid
iI
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
18
OH 0
methyl
(E)-2-hydroxy-6- GB026
0
styrylbenzoate
0
2-methoxy-6-(2-(naphthalen-1-
GB027
OH yl)ethyl)benzoic acid
O
OH
methyl
2-(4-chlorophenethyl)-6- GB028
0
hydroxybenzoate
The compounds of the present invention also include stereoisomers of the
compounds
described herein and compositions comprising more than one compound of the
invention may,
where applicable, include such stereoisomers, for example E/Z isomers, either
individually or
admixed in any proportions. Stereoisomers may include, but are not limited to,
enantiomers,
diastereomers, racemic mixtures, and combinations thereof. Such stereoisomers
can be
prepared and separated using conventional techniques, either by reacting
enantiomeric starting
materials, or by separating isomers of compounds and prodrugs of the present
invention.
Isomers may include geometric isomers. Examples of geometric isomers include,
but are not
limited to, trans isomers or cis isomers (E/Z) across a double bond. Other
isomers are
contemplated among the compounds of the present invention. The isomers may be
used either
in pure form or in admixture with other isomers of the compounds described
herein.
The compounds may optionally be provided in a composition that is
enantiomerically or
diastereomercially enriched, such as a mixture of enantiomers or diastereomers
in which one
enantiomer or diastereomer is present in excess, in particular, to the extent
of 95% or more,
96% or more, 97% or more, 98% or more, or 99% or more, including 100%.
The compounds may be utilized per se or in the form of a pharmaceutically
acceptable
ester, amide, salt, solvate, prodrug, or isomer, as appropriate. For example,
the compound may
be provided as a pharmaceutically acceptable salt. If used, a salt of the drug
compound should
CA 03190768 2023- 2- 23
WO 2022/040719 PCT/AU2020/050892
19
be both pharmacologically and pharmaceutically acceptable, but non-
pharmaceutically
acceptable salts may be used in the preparation of the compounds. Such
pharmacologically
and pharmaceutically acceptable salts can be prepared by reaction of the drug
with an organic
or inorganic acid, using standard methods detailed in the literature. Examples
of
pharmaceutically acceptable salts or solvates have been previously described.
Preparation of Compounds of Formula 1
0
OH 0 )*L 0 0 0 0
SOCl2 Tf20, Pyr
R1 PI¨
ON DMAP OH
OTf
1 2 3
Cul, Pd(PPh3)Cl2
I
2
MeCN, Diethylannine
OHO 0 0 0 0
(j'''="").L.OH NaOH
_nor_ Pd/C, H2
N., 0
R1 r I R1 I
I -I R2 I ¨R2
6 5 4
¨Rz
Scheme 1
The compounds of Formula 1 may be prepared generally according to Scheme 1
above. For example, a salicylic acid derivative compound 1 can provide an A
ring scaffold and
be protected to form a cyclic lactam compound 2. A solution of compound 1,
acetone and
DMAP in DME (30 mL) can be provided and SOCl2 added at about 0 C). The
mixture can be
stirred at 0 C for about an hour and then stirred at room temperature. The
resulting mixture
can be quenched with water and purified to afford compound 2.
The free hydroxyl group of compound 2 can be activated by forming a triflate.
A solution
of compound 2 and pyridine in DCM (50 mL) along with Tf20 can be stirred at
about 0 C for
about an hour. The mixture can be purified to provide compound 3.
The activated compound 3 can then be reacted with a linker-B ring scaffold.
For
example, a mixture of compound 3, 2-ethynylnaphthalene, Pd(PPh3)2C12,
diethylaminein and
Cul in MeCN can be heated to reflux for about 2 hours under an atmosphere of
Nz. The
reaction mixture can be purified to provide a compound 4, which is a protected
lactam
derivative compound of Formula 1 comprising an unsaturated linker group.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
Compound 4 can be modified to reduce the unsaturated linker group to a fully
saturated
alkyl linker group. For example, a mixture of compound 4 and Pd/C (10% on
activated carbon,
500 mg) in Me0H can be stirred at room temperature for about 2 hours under an
atmosphere
of H2 (1 atm). The mixture can be worked up and purified to provide a compound
5.
5 Compound 5 can then be deprotected to provide a compound of Formula 1.
A mixture
of compound 5, NaOH in THF and H20 can be heated at 80 C for about 16 hours.
The mixture
can be acidified with 1N HCI to pH 2-3 and extracted with Et0Ac. The combined
organic
phases can be concentrated and purified to provide a compound 6.
It will be appreciated that the compounds may be prepared according to other
synthetic
10 approaches, and the above scheme provides one example of a synthetic
approach.
Pharmaceutical Compositions
In another aspect, there is provided a pharmaceutical composition comprising a
compound of Formula 1, or any salt, stereoisonner, or solvate thereof
according to any aspect,
15 embodiment or example thereof as described herein, and a
pharmaceutically acceptable
carrier, diluent and/or excipient.
Suitably, the pharmaceutically acceptable carrier, diluent and/or excipient
may be or
include one or more of diluents, solvents, pH buffers, binders, fillers,
emulsifiers, disintegrants,
polymers, lubricants, oils, fats, waxes, coatings, viscosity-modifying agents,
glidants and the
20 like.
Diluents may include one or more of microcrystalline cellulose, lactose,
mannitol,
calcium phosphate, calcium sulfate, kaolin, dry starch, powdered sugar, and
the like. Binders
may include one or more of povidone, starch, stearic acid, gums,
hydroxypropylmethyl cellulose
and the like. Disintegrants may include one or more of starch, croscarmellose
sodium,
crospovidone, sodium starch glycolate and the like. Solvents may include one
or more of
ethanol, methanol, isopropanol, chloroform, acetone, methylethyl ketone,
methylene chloride,
water and the like. Lubricants may include one or more of magnesium stearate,
zinc stearate,
calcium stearate, stearic acid, sodium stearyl fumarate, hydrogenated
vegetable oil, glyceryl
behenate and the like. A glidant may be one or more of colloidal silicon
dioxide, talc or
cornstarch and the like. Buffers may include phosphate buffers, borate buffers
and carbonate
buffers, although without limitation thereto. Fillers may include one or more
gels inclusive of
gelatin, starch and synthetic polymer gels, although without limitation
thereto. Coatings may
comprise one or more of film formers, solvents, plasticizers and the like.
Suitable film formers
may be one or more of hydroxypropyl methyl cellulose, methyl hydroxyethyl
cellulose, ethyl
cellulose, hydroxypropyl cellulose, povidone, sodium carboxymethyl cellulose,
polyethylene
glycol, acrylates and the like. Suitable solvents may be one or more of water,
ethanol,
methanol, isopropanol, chloroform, acetone, methylethyl ketone, methylene
chloride and the
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
21
like. Plasticizers may be one or more of propylene glycol, castor oil,
glycerin, polyethylene
glycol, polysorbates, and the like.
Reference is made to the Handbook of Excipients 6th Edition, Eds. Rowe,
Sheskey &
Quinn (Pharmaceutical Press), which provides non-limiting examples of
excipients which may
be useful according to the present disclosure. Other pharmaceutical excipients
and/or additives
suitable for use in the compositions according to the present disclosure are
listed in
"Remington: The Science & Practice of Pharmacy", 19<sup>th</sup> ed., VVilliams &
VVilliams, (1995),
and in the "Physician's Desk Reference", 52<sup>nd</sup> ed., Medical Economics,
Montvale, N.J.
(1998), and in "Handbook of Pharmaceutical Excipients", Third Ed., Ed. A. H.
Kibbe,
Pharmaceutical Press, 2000.
It will be appreciated that the choice of pharmaceutically acceptable
carriers, diluents
and/or excipients will, at least in part, be dependent upon the mode of
administration of the
formulation. By way of example only, the composition may be in the form of a
tablet, capsule,
caplet, powder, an injectable liquid, a suppository, a slow release
formulation, an osmotic pump
formulation or any other form that is effective and safe for administration.
Dosages
The amount of active ingredient that is required to achieve a therapeutic
effect will, of
course, vary with the particular compound, the route of administration, the
subject under
treatment, including the type, species, age, weight, sex, and medical
condition of the subject
being treated, and the renal and hepatic function of the subject, and the
particular condition,
disorder or disease being treated, as well as its severity. An ordinary
skilled physician or
clinician can readily determine and prescribe the effective amount of the drug
required to
prevent or treat the condition, disorder or disease.
Dosages of a compound of Formula 1, or salt, solvate or stereoisomer thereof,
when
used for the indicated effects, may range between, for example, about 0.01 mg
per kg of body
weight per day (mg/kg/day) to about 1000 mg/kg/day. In one example, the dosage
of a
compound of Formula 1, or salt, solvate or stereoisomer thereof, is between
about 0.01 and
1000, 0.1 and 500, 0.1 and 100, 1 and 50 mg/kg/day. In one example, the dosage
of a
compound of Formula 1, or salt, solvate or stereoisomer thereof, is between
about 0.01 and
1000 mg/kg/day. In one example, the dosage of a compound of Formula 1, or
salt, solvate or
stereoisomer thereof, is between about 0.1 and 100 mg/kg/day. In one example,
the dosage of
a compound of Formula 1, or salt, solvate or stereoisomer thereof, is greater
than about 0.01,
0.1, 1, 10, 20, 50, 75, 100, 500, 1000 mg/kg/day. In one example, the dosage
of a compound of
Formula 1, or salt, solvate or stereoisomer thereof, is less than about 5000,
1000, 75, 50, 20,
10, 1, 0.1 mg/kg/day.
A compound of Formula 1, or salt, solvate or stereoisomer thereof, may for
example be
administered as a single daily dose, or otherwise the total daily dosage may
be administered in
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
22
divided doses of two, three, or four times daily. In one example, the compound
of Formula 1, or
salt, solvate or stereoisomer thereof, may be dosed less frequently than once
per day, for
example once per two days, three days, four days, five days, six days, or once
per week.
Indications/Applications
The disclosure also provides a use of a compound of Formula 1 as defined
according to
any aspects, embodiments or examples as described herein, as an antiviral
agent or for
treating a viral disease or condition or a viral associated disease or
condition.
Accordingly, the present disclosure provides a method of treating a viral
disease or
condition by administration of an antiviral compound to a subject in need of
treatment thereof,
wherein the antiviral compound is a compound of Formula 1, or pharmaceutically
acceptable
salt, solvate, or stereoisomer thereof, according to any aspects, embodiments
or examples
thereof as described herein.
In one example, the compounds described herein are particularly useful for
treating or
preventing a 80X18-dependent viral disease or condition. A "SOX18-dependent
viral disease
or condition" is referred to herein as one which involves SOX18 activity. In
one example, the
SOX18 activity includes contacting and/or binding of SOX18 to a DNA sequence
and/or a
protein. In a further example, the protein is selected form the group
consisting of SOX7, RBPJ,
XRCC5, SOX18, ILF3, DDX17 and any combination of thereof.
In one example, the compound of Formula 1 described herein inhibit, prevent or
reduce
the SOX18 activity in a subject. In another example, the compound of Formula 1
demonstrates
one or more of the following activities as determined in cell culture such as
KLEC or luciferase
assay as described herein. In one example, the compound of Formula 1 described
herein
selectively inhibit SOX18 activity.
The SOX18-dependent viral disease or condition may be selected from the group
consisting of Kaposi sarcoma, AIDS-related lymphoproliferative disorder, angio-
immunoblastic
T-cell lymphoma, Burkitt's lymphoma, Hodgkin's lymphoma, Non-Hodgkin's
lymphoma,
Leiomyosarcoma, breast cancer, Gastric carcinoma, Nasal T/NK cell lymphoma,
T/NK cell
lymphoma, nasopharyngeal carcinoma, CMV retinitis of the eyes, pneumonia,
gastrointestinal
ulcer, oral herpes, genital herpes and joint inflammation.
An anti-viral compound of the disclosure can be combined with a further agent
such as
an antiretroviral, retinoid or chemotherapeutic agent. The anti-viral agent
may also be
combined with a treatment such as radiation therapy, photodynamic treatment or
cryosurgery.
Examples of agents that may be used in combination with a compound of the
disclosure include antivirals such as ganciclovir or forcarnet; retinoids such
as alitretinoin and
chemotherapy agents such asdoxorubicin, daunorubicin, paditaxel, vinorelbine,
bleomycin, and
etoposide.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
23
The disclosure also provides use of a compound of Formula 1 as defined herein
in the
manufacture of a medicament for treating a viral disease or condition or a
viral associated
disease or condition.
In another example, the antiviral compound of Formula 1 inhibits SOX18-S0X18
homodimerisation. In another example, the antiviral compound of Formula 1
inhibits SOX18-
RBPJ heterodimersation.
The present disclosure also provides a method for inhibiting replication of a
herpesvirus
and/or treating a viral disease or condition caused by a herpesvirus in a
subject comprising
administering to the subject a compound of Formula 1 as described herein. In
one example, the
viral disease or condition is SOX18 ¨dependent.
The herpesvirus may be selected from the group consisting of Alpha
Herpesviruses,
Beta Herpesviruses, Gammai Herpesviruses and Gamnria2 Herpesviruses. In one
example, the
herpesevirus is selected from the group consisting of Kaposi sarcoma
herpesvirus (KSHV),
Epstein-Barr virus (EBV), cytonnegalovirus (CMV), Vesicular stomatitis virus
(VSV), rhesus
lymocryptovirus (rLCV), Herpes simplex virus 1 (HSV-1), Herpes simplex virus
(HSV-2) and
Ross river virus (RRV).
In another example, the viral disease or condition is selected from any one of
the
following or from the group consisting of:
(i) Kaposi sarcoma caused by KSHV;
(ii) AIDS-related lymphoproliferative disorder caused by KSHV;
(iii) Angio-immunoblastic 1-cell lymphoma caused by EBV;
(iv) Burkitt's lymphoma caused by EBV;
(v) Hodgkin's lymphoma caused by EBV;
(vi) Non-Hodgkin's lymphoma caused by EBV;
(vii) Leiomyosarcoma caused by EBV;
(viii) Breast cancer caused by EBV;
(ix) Gastric carcinoma caused by EBV
(x) Nasal T/NK cell lymphoma caused by EBV;
(xi) T/NK cell lymphoma caused by EBV;
(xii) Nasopharyngeal carcinoma caused by EBV
(xiii) CMV retinitis of the eyes caused by CMV;
(xiv) pneumonia caused by CMV;
(xv) gastrointestinal ulcers caused by CMV;
(xvi) a condition or symptom caused by VSV;
(xvii) Oral herpes caused by HSV-1;
(xviii) Genital herpes caused by HSV-2; and
(xix) joint inflammation or rash caused by RRV.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
24
In another example, Kaposi sarcoma is selected from any one of or the group
consisting of classic Kaposi sarcoma, endemic Kaposi sarcoma, AIDS-related
Kaposi sarcoma,
and iatrogenic Kaposi sarcoma.
Kaposi Sarcoma
Kaposi sarcoma herpesvirus (KSHV) is one of nine species in the genus
Rhadinovirus
of the subfamily Gammaherpesvirus in the family Herpesviridae. KSHV, like
other
herpesviruses establishes lifelong infection in the infected hosts and
maintains the viral
genome as extra-chromosomal episomes in a latent state. The virus encodes a
limited number
of genes for persistence without being recognized by the host immune
surveillance. Latency
Associated Nuclear Antigen (LANA) is one of the proteins expressed in all
latently infected cells
(Rainbow L, et al. (1997) J Virol 71: 5915-5921; Renne R, et al., (1998) J
Virol 72: 5182-
5188).
LANA is considered an oncogenic protein because of its role in modulating
cellular
pathways required to induce/promote tumorigenesis (Moore PS, Chang Y (1998) J
Natl Cancer
Inst Monogr. pp 65-71). Along with its role in modulation of various cellular
and viral pathways,
LANA is critical for maintaining the viral genome in infected cells (Cotter
MA, 2nd, Robertson
ES (1999) Virology 264: 254-264; Ye FC, et al. (2004) J Virol 78: 11121-
11129).
LANA docks onto the host chromatin through the amino terminal chromatin-
binding
domain (CBD) and tethers the viral genome to the host chromosome by binding to
the DNA
binding domain of the carboxyl terminus within the terminal repeats (Barbera
AJ, et al. (2006)
Science 311: 856-861; Cotter MA, 2nd, Subramanian C, Robertson ES (2001)
Virology 291:
241-259).
The KSHV genome has multiple reiterated copies of the terminal repeats (TR),
which
are proposed to be the region required for circularisation of the genome. Each
terminal repeat
unit is a 801bp long high GC content DNA element and was shown to contain the
latent origin,
or replication initiation site similar to EBV. Each TR unit has two LANA
binding sites (a high
affinity site LBS1 and a lower affinity site LBS2). A 31 bp long sequence
upstream of the LANA
binding sequence is mapped as a replicator element (RE) important for
replication initiation.
Each TR unit has a replicator element.
Work has demonstrated the presence of an additional replication site at the
left end of
the KSHV genome (Verma SC, et al., (2007) Cell Host Microbe 2:106-118). This
replication
site does not require expression of LANA in trans, and is referred to as an
autonomous
replication origin (oriA, as referred to herein). Accordingly, replication
initiation events can occur
throughout the KSHV genome, which is distinctly different from earlier
conclusions that
replication initiates from a specific site within the terminal repeats.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
Types of Kaposi Sarcoma
There are a number of different types of KS which are defined by the different
populations in which the disease develops. Classic (or Mediterranean) KS
occurs in elderly
people of Mediterranean, Eastern European, and Middle Eastern heritage and
occurs more
5 commonly in men than in women. Patients typically have one or more
lesions on the legs,
ankles, or the soles of the feet. In comparison with other types of KS, the
lesions in this type do
not grow as quickly, and new lesions do not develop as often. People who get
classic KS come
from areas where KSHV infection is more common than in the US or Northern
Europe. The
immune system of people with classic KS is not as weakened as those who have
epidemic KS
10 (see below); however, old age may naturally weaken the immune system,
thus making people
more likely to develop KS if they already have a KSHV infection.
Endemic KS occurs in people living in Equatorial Africa and is sometimes
called African
KS. KSHV infection is much more common in Africa than in other parts of the
world, increasing
the chance of developing KS. There appear to be other factors in Africa that
contribute to the
15 development of KS since the disease affects a broader group of people
that includes children
and women. Endemic KS tends to occur in younger people (usually under age 40).
In some
parts of Africa, KS is currently considered the most common cancer (Horenstein
et al., (2008);
J. Cutan. Pathol. 35(Suppl. 2): 40-44).
The most common type of KS in the United States is epidemic or AIDS-related
KS. This
20 type of KS develops in individuals who are infected with HIV, the virus
that causes AIDS. The
severe immunosuppression caused by AIDS increases the likelihood of the
development of KS
in individuals already infected with KSHV. This more aggressive form of KS was
first noted in
young homosexual men in the 1970s. In addition to departing from the usual
ethnic
predisposition, the disease manifested with lesions that occurred at any site
and that tended to
25 spread more rapidly to the lymph nodes and visceral organs, such as the
gastrointestinal and
respiratory tracts. Gastrointestinal (GI) involvement is generally
asymptomatic and does not
affect prognosis, while lung involvement frequently is symptomatic and
adversely affects
prognosis. The disease progressed very rapidly and many patients died within
one year,
despite drug chemotherapy regimens. Treatment of HIV infection with highly
active
antiretroviral therapy (HAART) has decreased the incidence of epidemic KS and
can often
keep advanced KS from developing. The clinical course of AIDS-KS is variable,
ranging from a
very indolent process requiring little, if any therapy, to a rapidly
progressive and fatal disease
When KS develops in people whose immune systems have been suppressed after an
organ transplant it is called iatrogenic, or transplant-associated KS or
immunosuppression-
associated KS. Most transplant patients take immunosuppressant drugs, such as
rapannycin, to
prevent organ rejection. The immunosuppression caused by these drugs increases
the
likelihood that individuals infected with KSHV will develop KS. Stopping the
immune
suppressing drugs or lowering their dose often makes KS lesions disappear or
get smaller.
CA 03190768 2023- 2- 23
WO 2022/040719 PCT/AU2020/050892
26
EXAMPLES
Compound Preparations
Compound GB001 (SM4) was synthesised by the following process as shown in
Scheme 2:
0
OH 0 0 0 0 0
OH SOCl2 0 Tf20, Pyr
0
OH DMAP OH OTf
la 2a 3a
Cul, Pd(PPh3)Cl2
MeCN, Diethylamine
OH 0 0 0 0 0
Pd/C,
NaOH H2
OH 0 0
4a
GBM-0009 5a
Scheme 2
To a solution of compound la (51.9 mmol), acetone (67.53 mmol) and DMAP (2.59
mmol) in DME (30 mL) was added SOCl2 dropwise at 0 C. The mixture was stirred
at 0 C for
1 hour then stirred at room temperature for 16 hours. The resulting mixture
was quenched with
water and purification by flash column chromatography on silica gel (0 to 100%
Et0Ac in PE) to
afford compound 2a (62.6 %) as a yellow solid.
To a solution of compound 2a (25.8 mmol) and pyridine (92.7 mmol) in DCM (50
mL)
was added Tf20 (30.9 mmol) at 0 C. The mixture was stirred at room
temperature for 1 hour.
Solvent was removed under vacuum and the crude was purified by flash column
chromatography on silica gel (eluting with 0 to 50% Et0Ac in PE) to give
compound 3a (65.1%)
as a yellow solid.
A mixture of compound 3a (3.06 mmol), 2-ethynylnaphthalene (3.36 mmol),
Pd(PPh3)2Cl2 (0.055 Mmol), diethylaminein (6.12 mmol) and Cul (0.3 mmol) in
MeCN (15 mL)
was heated reflux for 2 hours under an atmosphere of N2. The reaction mixture
was filtered
through celite. The filtrate was concentrated under vacuum and purified by
flash column
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
27
chromatography on silica gel (0 to 50% Et0Ac in PE) to give compound 4a
(75.22%) as white
solid.
A mixture of compound 4a (2.29 mmol) and Pd/C (10% on activated carbon, 500
mg) in
Me0H (20 mL) was stirred at room temperature for 2 hours under an atmosphere
of H2 (1 atm).
Then mixture was filtered through celite. The filtrate was concentrated and
purified by flash
column chromatography (0 to 50% Et0Ac in PE) to give compound 5a (59.2%) as a
white solid.
A mixture of compound 5a (1.36 mmol), NaOH (6.8 mmol) in THE (10 mL) and H20
(10
mL) was heated at 80 C for 16 hours. The mixture was acidified with IN HCI to
pH 2-3 and
extracted with Et0Ac. The combined organic phases was concentrated and
purified on a
Biotage lsolera One (C18 column, eluting with 30% to 100% MeCN/H20 containing
0.1%
HCOOH) to afford Compound 1 (GBM-0009, SM4) (88.16%) as a white solid.
Purity of Compound 1 has been assessed by HPLC-UV/MS, reporting a purity of
99.5%
(by UV254), and a correct [M-H] mass of 290.95, and 1H-NMR with correct
assignment and peak
area for each proton.
The synthesis of GB003 was similar to that of GB001by using a 3-
ethynylphenylene
instead of a 3-ethynylnaphthalene. The synthesis of GB002 and GB003 has been
described
previously generally above and in W02018/112545, which its entire contents are
herein
incorporated by reference.
Compounds GB004, GB005 and GB006 were purchased from ABCr (Germany) and
analyzed for purity by HPLC/MS.
Inhibitor Treatments
The following inhibitors were used: GB001, GB002, GB003, GB004, GB005 and
GB006.
KSHV-infected cells were incubated with the indicated inhibitor at the
concentrations
stated in the Figure panels for six days prior to analysis. HeLa cells were
incubated with the
indicated inhibitor at the concentrations stated in the Figure panels for 24
hours prior to
analysis.
KLEC genome copy number Assay
Primary human dermal lymphatic (C-12216) endothelial cells (LECs) were
purchased
from Promocell and grown in Lonza EBM-2 (00190860) supplemented with EGMTM-2
MV
Microvascular Endothelial SingleQuotsTM(CC-4147). Cell from passage 1-3 were
used.
rKSHV.219 was produced from iSLK.219 cells reactivated using 0.2 pg/ml
doxycycline
and 1.35mM NaB for 72h. Supernatant was harvested, spun down (2000 rpm 5min)
and sterile
filtered using 45 pm pore-size filters. Subsequently the supernatant was
ultracentrifuged at
22000 rpm for 2h. The concentrated virus was then aliquoted and stored at -80
C.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
28
Virus titres were determined by infecting U2OS cells with serial dilutions of
the
concentrated virus preparation and assessing the amount of GFP+ or LANA+ cells
24h post-
infection by automated high-content microscopy.
Equal number of LECs were seeded into 6-well assay-plates and incubated at 37
C &
5% CO2 until 80% confluency. After reaching confluency, LECs were infected
with rKSHV.219
and incubated at 37 C & 5% CO2 for 3 days, making sure that the cell density
remained
similar. Cell were subsequently mixed at a 2:3 ratio with uninfected LECs for
2 days. Once GFP
expression and cell spindling was observed the culture medium was replaced
with medium
containing the experimental compounds with 0.25% DMSO (v/v) at concentrations
from 0.1uM
to 50uM. After 3 days of incubation, the cells were replenished with new
medium containing
experimental compounds and incubated for 3 more days.
After compound incubation, cells were collected and genomic and viral DNA was
extracted using the NucleoSpin Tissue Kit (Macherey-Nagel, 740952) following
the kit's
standard protocol. qPCR was subsequently completed (SYBR Green, ThermoFisher
K0222) in
triplicates using primers for viral K8.1 and Human genomic actin. K8.1 forward
primer:
AAAGCGTCCAGGCCACCACAGA (SEQ ID NO:1); reverse
primer:
GGCAGAAAATGGCACACGGTTAC (SEQ ID NO:2). Genomic acid forward primer:
AGAAAATCTGGCACCACACC (SEQ ID NO:3); reverse
primer:
AACGGCAGAAGAGAGAACCA (SEQ ID NO:4).
SOX18 Luciferase Reporter Assay
HeLa cells were cultured in DMEM containing 10% FCS, 1% L-glutamine and 1%
pen/strep at 37 C & 5% CO2. Cells were seeded at a density of 7000 cells per
well in 125 1..d_ of
the maintenance medium in a 96-well format for 24 hours.
Plasmids were transfected using FuGENE HD Transfection Reagent (Promega E2311)
(1:4 DNA to reagent ratio) and Opti-MEM (ThermoFisher 31985062). OriA-luc
negative control
and experimental wells contained 25ng OriA-luc plasmid and1Ong SOX18 plasmid
per well,
positive control contained 25ng OriA-luc plasmid and long mCherry plasmid per
well. 7XTR-luc
negative control and experimental wells contained 50ng 7XTR-luc plasmid and
20ng SOX18
plasmid per well, positive control contained 50 ng 7XTR-luc plasmid and 20ng
mCherry plasmid
per well. Cell were incubated for 18 hours before cells were replenished with
new medium
containing experimental compounds and incubated for 24 hours.
Luminescence was measured by adding an equal volume of Steady-Glo reagent to
cells at room temperature and luminescence was quantified using the FLUOstar
plate reader
(BMG Labtech, FLUOstar Omega; 4 sec intervals per well).
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
29
Preparation of Compounds
A library of n-butanol fractions generated from a marine library collected
across
Australia and Antarctica was used for screening. Active fractions were
fractionated into pure
compounds re-assayed in the same way as original fractions.
A library of 2688 samples of marine invertebrate and alga collected across
southern
Australia and Antarctica was processed to generate an extract library suitable
for high
throughput bioassay. Et0H extracts were decanted, concentrated and partitioned
into n-BuOH
and H20 phases, then transferred to deep 96-well plates, resulting in a >10-
fold concentration
of small molecules, while removing salts. The n-BuOH fraction (25 mg/mL w/v of
dried residue)
was used for screening, following 10- and 100-fold dilution (2.5 and 0.25
mg/mL). Active
fractions were triturated with hexane, CH2Cl2 and Me0H, and fractionated into
pure compounds
by HPLC. All compounds were assayed in the same way as fractions.
Compound 1 (GB001, SM4) was purchased from EndoTherm GmbH (Germany) and
analysed for purity by HP-LC/MS.
The synthesis of GB002 and GB004 has been described previously generally above
and in W02018/112545.
Sox18 activity of compounds
Monkey kidney fibroblast-like cells (COS-7) were cultured at 37 C and 5% CO2
in
DMEM (Life Technologies, 11995) with fetal bovine serum (FBS), sodium
pyruvate, L-
glutamine, penicillin, streptomycin, non-essential amino acids, and HEPES.
Cells were grown in
96-well plates to 80% confluence and transfected with mouse plasmids pGL2 Vcam-
1 promoter
construct (VC1889) and pReceiver M49 SOX18, using X-tremeGENE HP DNA
transfection
reagent (Roche, 6366236001). After 4 hr of transfection, cells were incubated
with compounds
in 0.5% FBS medium for another 24 hr, before lysis and luciferase assay
(Perkin Elmer,
6016711). Results are presented as %inhibition of the maximal signal observed
in cells
transfected with VCAM-1 and SOX18 without compound incubation.
Statistical Analysis
Data was presented as the mean +/- SD of at least 3 independent experiments.
An
ordinary one-way ANOVA or two-way ANOVA was performed as appropriate followed
by
Dunnett's post-hoc test for multiple comparisons.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
Example 1: Compounds and their activity on SOX18 protein interactions
The compounds examined in this study are described in Table 2 below.
Table 2 GBM compounds and functional activity
Chemical Structure Chemical Name Ref.
%inhibition
of Sox18
OH
COOH 2-hydroxy-6-[2-(naphtha len-
GB001 99_10
2-yDethyl]benzoic acid
0
COON 2-methoxy-6-[(1E)-2- GB002
30/8
(naphthalen-2-
ypethenyl]benzoic acid
OH
cooH 2-hydroxy-6-(2- GB003
49.18
phenylethyl)benzoic acid
OH
cooH 2-(2,4-dichlorophenethyl)-6-
GB004 48.26
hydroxybenzoic acid
CI CI
====_o
COOH 2-methoxy-6-(4- GB005
25.32
methoxyphenethyDbenzoic
acid
OCH3
COON 2-methoxy-6-((naphthalen-2- GB006
19.33
ylmethoxy)methyl)benzoic
0 acid
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
31
OH
COOH 2-hydroxy-4-methyl-6-(2- GB012
96.7
(naphthalen-2-
yl)ethyl)benzoic acid
OH 0
4-chloro-2-hydroxy-6-(2- GB019
54.02
OH
(naphthalen-2-
yl)ethyl)benzoic acid
OH 0
2-hydroxy-6- GB023
78.07
OH
(phenethoxymethyl)benzoic
0
acid
OH
COOH (E)-2-hydroxy-6-(2- GB024
100.21
(naphthalen-2-
yl)vinyl)benzoic acid
OH
COOH 2-hydroxy-4-methoxy-6-(2-
GB025 67.19
(naphthalen-2-
yl)ethyl)benzoic acid
OH 0
methyl (E)-2-hydroxy-6- GB026
49.66
styrylbenzoate
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
32
0
2-methoxy-6-(2-(naphthalen- GB027 47.43
OH 1-yl)ethyl)benzoic acid
OH 0
48.31
methyl 2-(4-chlorophenethyl)- GB028
0
6-hydroxybenzoate
Example 2: Involvement of 7XTR and OriA in Kaposi Sarcoma
Replication of latent Kaposi Sarcoma (KS) herpesevirus (KSHV), the virus
responsible
for Kaposi Sarcoma involves the terminal repeat region (TR) and to a minor
extent, the OriA
region of the KSHV genome.
Accordingly, the inventors used a luciferase assay to assess the role of SOX18
in the
expression of the TR and OriA regions of the virus.
Activation of these genes was measured using HeLa cells that were transfected
with
luciferase-reporters harbouring either seven copies of the TR (7XTR) or the
OriA promoter
fused to OriLyt upstream of an SV40 promoter and a firefly luciferase
reporter. ORF, that binds
to the OriLyt and is a potent activator of this reporter (Chen J et al.,
(2009) Virology 386:290-
302) was used as a positive control. In the presence of LANA, SOX18 expression
increased
the activity of the 7XTR reporter in a dose-dependent manner. SOX18 expression
also
increased the activity of the OriA+OriLyt reporter in an ORF50-independent
manner. SOX18
did not change the activity of a reporter plasmid harbouring the ORF50
promoter (data not
shown) supporting the specificity of the activation observed in the 7XTR and
OriA+OriLyt
reporters.
Figure 1 shows that HeLa cells co-transfected with SOX18 demonstrate increased
activity of 7XTR and OriA. This indicates that the activation of 7XTR and OriA
are under control
of SOX18. Data obtained from Gramolelli et al. 2020 Cancer Res.
Accordingly, the luciferase assay can be used as a read-out as to whether the
compounds described herein are capable of interfering with SOX18 and hence
replication of
Kaposi Sarcoma.
CA 03190768 2023- 2- 23
WO 2022/040719
PCT/AU2020/050892
33
Example 3 SOX18 activation of gene expression
The ability of the compounds to interference with SOX18 activation of gene
expression
was measured by two different assays.
The first assay examined the ability of compound GB001 to inhibit SOX18
activity of
the TR and OriA regions of the Kaposi sarcoma virus. Figure 2 shows the
results of the
luciferase assay treatment of compounds GB001, GB002 and GB004 on HeLa cells
transfected
with 7xTR and OriA.
These results demonstrate that GB001, GB002 and GB004 interferes with SOX18-
mediates gene transcription in Kaposi sarcoma.
The second assay measured the interaction between SOX18 and the VCAM-1
promoter (Hosking et al., (2004) J Biol. Chem. 297:5314-5322). Inhibition of
this interaction
demonstrates cell-based efficacy of the ability of a compound to modulate
SOX18-mediated
gene transcription. Without wishing to be bound by theory, it is understood
that viral infection
can induce an inflammatory response of endothelial cells, the latter being a
result of VCAM-1
gene expression which is regulated by SOX18 activity (Huber J. (1994) J Virol.
68(6):3453-8).
Put another way, the expression of VCAM-1 is driven by SOX18 so upon virus
infection,
SOX18 binds to the VCAM promoter and induces expression of VCAM.
The compounds described in Table 2 were tested by the VCAM-1 luciferase
reporter
assay. The results are shown in Table 2 under the column %inhibition of SOX18.
The compounds that showed the greatest level of inhibition were GB001 (99.10%
inhibition), GB024 (100% inhibition), GB023 (78% inhibition) and GB012 (96.7%
inhibition). As
discussed above, the VCAM-1 assay may be suggestive of viral infection (Ou R
et al., (2008) J
Virol. 82(6):2952-2965; Pati S et al., (2001) 75(10):8660-73). Thus, the
compounds were
examined for their ability to inhibit VCAM-1 expression as a surrogate for
their potential activity
as viral inhibitors.
Example 4 Effect of the compounds on viral cienome copy
number
A KLEC assay was used to examine the ability of the compounds to inhibit viral
copy
number in virus infected primary human dermal lymphatic endothelial cells
(LECs).
Figure 3 shows the results for LECs infected with Kaposi sarcoma herpesvirus
(KSHV).
The results for three representative compounds (GB001, GB002 and GB004) is
shown.
Significant reduction in genome copy number as demonstrated by fold change was
seen for
GB001 at lOpM and 50pM; GB002 at 50pM and GB004 at 5pM.
It will be appreciated by persons skilled in the art that numerous variations
and/or
modifications may be made to the above-described embodiments, without
departing from the
broad general scope of the present disclosure. The present embodiments are,
therefore, to be
considered in all respects as illustrative and not restrictive.
CA 03190768 2023- 2- 23
