Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
1
BIRDS FOR PRODUCING FEMALE HATCHLING AND METHODS OF
PRODUCING SAME
FIELD OF THE INVENTION
The present invention relates to compositions and methods for generating a
genetically edited female bird such that, when crossed with a native male
bird, produces
selectively female, but not male, viable hatched offspring.
BACKGROUND OF THE INVENTION
In commercial flocks of avian species, particularly chicken, sex separation is
an
important aspect in the production of broilers (bred and raised for meat
production) and
egg-laying hens. Sex separation allows a better suited management and feeding
according
to the breeding line developed to efficiently maximize the end product (meat
or eggs).
Essentially in all commercial hatcheries billions day-old chicks are culled
every year.
Males of layer breeds are exterminated since they are not useful and females
of broiler
breeds are terminated since growing them for meat is not economical.
In avian species sex determination is via female heredity, as Z-Z allosome
pair will
assign a male and Z-W allosome pair will assign a female (Fridolfsson, A. K.
et al. 1998.
Proc. Natl. Acad. Sci. U. S. A. 95, 8147-8152). Comparing the avian W
chromosome to
the human Y chromosome, the two chromosomes conserved minimal identity to
ancestral
genes, minimizing size and therefore expressed genes. Despite the evolutionary
similarities, it was noted that the chicken W chromosome is remarkably
divergent from
all sequenced Y chromosomes, in that it lacks any genes expressed specifically
in sex-
specific organs or tissues (Bellott, D. W. et al. 2017. Nat. Genet. 49, 387-
394).
Parallel lines of evidence in the chicken lead Bellot et. al (2017, ibid) to
propose
that the avian sex chromosomes possess a critical combination of genes'
expression,
ensuring the survival of females. More specifically, the combination of genes
ensures a
correct embryonic development in early stages.
There is an ongoing search for means and methods for determining the desired
sex
of an embryo while in the egg. For example, International (PCT) Applications
Publication
Nos. WO 2017/094015 and WO 2018/216022 discloses non-invasive methods using
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
2
transgenic avian animals that comprise at least one reporter gene integrated
into at least
one gender chromosome Z or W. The transgenic avian disclosed therein are used
for
gender determination and selection of embryos in unhatched avian eggs by
detecting the
reported gene.
International (PCT) Applications Publication No. WO 2019/092265 discloses a
method and an apparatus for automated noninvasive determining the sex of an
embryo of
a bird's egg, in particular a chicken egg, which allows for a rapid and
reliable
determination of the sex of the embryo at an early stage, at which the embryo
has not
developed a sense of pain yet. The method is based on NMR parameters
associated with
the egg selected from the group consisting of a Ti relaxation time, a T2
relaxation time
and a diffusion coefficient, and a classification module configured for
determining, based
on said one or more NMR parameters or parameters derived therefrom, a
prediction of
the sex of the embryo of the associated egg.
While avoiding the need to cull living hatchlings, sex sorting of eggs still
requires
destroying a vast number of eggs comprising living embryos. Attempts have been
therefor
made to set the offspring sex by manipulating the breeding parents. For
example,
International (PCT) Application Publication No. WO 2018/013759 discloses a
bird or
cells thereof comprising an autosomal repressor cassette integrated on at
least one copy
of an autosome, which can suppress the expression of a protein essential for
early
development. In some aspects, a bird or cells thereof are provided that
comprise an
ectopic rescue cassette and a repressor cassette on the W or Z chromosome,
which can
selectively rescue embryo development in progeny animals. Methods of producing
same
are also disclosed.
International (PCT) Applications Publication Nos. WO 2019/058376 and WO
2020/178822 disclose DNA editing agents for generating chimeric bird cells and
chimeric
birds. The agents can be used to produce conditionally-lethal phenotype in
male bird
embryos. Method for destroying male chick embryos in-ovo are also provided.
US application publication No. 20140359796 discloses genetically modified
livestock animals, and methods of making and using the same, the animals
comprise a
genetic modification to disrupt a target gene selectively involved in
gametogenesis,
wherein the disruption of the target gene prevents formation of functional
gametes of the
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
3
animal.
However, there is a great need for and would be highly advantageous to have a
reproducible and efficient methods for distorting female:male sex ratio in
hatchlings of a
breeding flock.
SUMMARY OF THE INVENTION
The present invention answers the above-described needs, providing in some
embodiments a genetically modified female bird capable of laying viable egg
populations
with a sex ratio biased toward females. Advantageously, the female offspring
are non-
genetically modified. The present invention further provides genetically
modified or
edited male birds that are used for generating the genetically modified female
described
herein, and methods for producing a bird hatchling population characterized by
a sex ratio
biased towards females.
The present invention in based in part on the unexpected discovery that
editing at
least one Z-chromosome gametolog results in male-only ability to inherit the
edited Z-
chromosome, while in females, a gamete bearing the edited chromosome, upon
fertilization, would not develop into a viable embryo.
Without wishing to be bound by any specific theory or mechanism of action, it
is
herein disclosed that the non-modified Z chromosome of the male bird
compensates and
enables the meiosis to produce a gamete having a modified chromosome Z, which
may
fertilize a female gamete to produce a viable embryo. In contrast, in females
having
modified Z chromosome, the chromosome W gametolog is not sufficient to enable
the
generation of a viable male embryo as it requires the product of the Z-
gametolog before
the fertilization. Advantageously, the methods provided herein enable the
production of
males that may produce multiple layer females having distorted female: male
sex ratio in
hatchlings. Methods as described herein utilize a one-step site-directed
mutagenesis for
the production of birds as described herein, that assure minimal genetic
and/or epigenetic
adverse effects. The methods described herein in some embodiments, utilize
systems that
do not integrate any exogenous genes to the genome, and the resulting birds
are
considered non-transgenic birds.
According to one aspect, the present invention provides a bird cell having at
least
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
4
one genetically modified chromosome Z, wherein the genetically modified
chromosome
comprises at least one chromosome Z-gametolog having reduced expression and/or
activity. In another aspect, the present invention provides a male bird cell
having at least
one genetically modified chromosome Z, wherein the genetically modified
chromosome
comprises at least one chromosome Z-gametolog having reduced expression and/or
activity, wherein the bird cell is capable of developing into functional
gametes
According to some embodiments, the cell is genetically edited using at least
one
artificially engineered nuclease.
According to some embodiments, the gametolog is a gene selected from the group
consisting of zfr, smad2, st8sia3, kcrnfl, spin], sub], chdl, nipbk hnmpk,
gfbpl, mier3,
btf3, go1ph3, vcp, txn11, nedd4, ctif, smad7, rp117, znf532, hintz, cl8orf25,
atp5a, zswim6,
rasa], ube2r2, ubap2, and tcf4. Each possibility represents a separate
embodiment of the
invention.
According to some embodiments, the gametolog is genetically modified to reduce
its expression. According to some embodiments, the gametolog is genetically
modified
to reduce its activity.
According to some embodiments, the gametolog is a meiosis-associated gene.
According to some embodiments, the gene is selected from the group consisting
of
zfr, smad2, spin], and nipbl.
According to some embodiments, the gene encodes Zinc Finger RNA Binding
Protein (ZFR). According to certain embodiments, the gene is zfr.
According to some embodiments, the cell is a primordial germ cell (PGC).
According to some embodiments, the PGC is selected from the group consisting
of
gonadal PGC, blood PGC and germinal crescent PGC. In another embodiment, the
cell is
a spermatogonial stem cell (SSC). In other embodiments, the cell is a
spermatogonium or
a spermatocyte. In another embodiment, the cell is a gamete (e.g. sperm cell).
According to some embodiments, when the bird is a male, the cell is
heterozygous
to the genetically edited chromosome Z.
According to some embodiments, the bird is a poultry. According to some
embodiments, the bird is selected from the group consisting of chicken, quail,
turkey,
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
goose, and duck. According to certain embodiments, the bird is a chicken or
quail.
According to additional embodiments, the bird is an ornamental bird.
According to some embodiments, there is provided a cell population comprising
the at least one cell. According to some embodiments, the cell population
comprises
5 gametes.
According to some embodiments, a bird having the at least one cell is
provided.
According to certain embodiments, the bird is a non-transgenic bird.
According to some embodiments, the bird is a chimeric bird. According to
certain
embodiments, the bird is a chimeric male bird having at least one PGC as
described
herein. According to certain embodiments, the at least one PGC is heterozygous
to the
genetically edited chromosome Z.
According to some embodiments, the bird is a female bird. According to some
embodiments, the bird is a female bird having at least one PGC as described
herein.
According to an additional aspect, the present invention provides a site-
directed
mutagenesis system for reducing the expression and/or activity of at least one
chromosome Z-gametolog .
According to some embodiments, the site-directed mutagenesis system is
Clustered
Regularly Interspaced Short Palindromic Repeats (CRISPR). According to other
embodiments, the site directed mutagenesis comprises the use of zinc-finger
nucleases
(ZFNs) or transcription activator-like effector nucleases (TALENs).
According to an additional aspect, the present invention provides a gene-
editing
agent comprising a nucleotide sequence hybridizable with a target nucleic acid
sequence
within a bird chromosome Z- gametolog.
According to some embodiments, the gene-editing agent is a synthetic guide RNA
(sgRNA).
According to some embodiments, the sgRNA comprises a nucleotide sequence
complementary to a target nucleic acid sequence within a bird chromosome Z-
gametolog.
In particular, provided is a sgRNA comprising a targeting sequence (crRNA)
comprising
15-30 contiguous nucleotides that are specifically hybridizable (hybridizes,
or is capable
of hybridizing, in a selective manner) with a target nucleic acid sequence
within a bird
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
6
chromosome Z- gametolog.
According to some embodiments, the targeting sequence (crRNA) is at least 90%,
at least 95% or at least 98% complementary to a target nucleic acid sequence
within a
bird chromosome Z- gametolog.
According to some embodiments, the targeting sequence is fully complementary
to
a target nucleic acid sequence within a bird chromosome Z- gametolog.
According to some embodiments, the target nucleic acid sequence is within the
coding region of the gametolog. In other embodiments, the target nucleic acid
sequence
is within the non-coding region of the gametolog.
According to some embodiments, the Z-gametolog is a gene selected from the
group consisting of zfr, smad2, st8sia3, kcrnfl, spin], sub], chdl, nipbl,
hnmpk, gfbpl,
mier3, btf3, go1ph3, vcp, txn11, nedd4, ctif, smad7, rp117, znf532, hintz,
cl8orf25, atp5a,
zswim6, rasa], ube2r2, ubap2, and tcf4. Each possibility represents a separate
embodiment of the invention.
According to some embodiments, the gametolog is a meiosis-associated gene.
According to some embodiments, the gene is selected from the group consisting
of
zfr, smad2, spin], and nipbl.
According to some embodiments, the gene encodes a zinc finger RNA binding
protein (ZFR).
According to some embodiments, the target nucleic acid sequence is within exon
3
of zfr.
According to some embodiments, the synthetic guide RNA comprises a targeting
sequence selected from the group consisting of GGCTAGCTACACTGTCCACC (SEQ
ID NO: 1) and GCGCACACAGCTACAGATTA (SEQ ID NO: 2).
According to some embodiments, a nucleic acid construct encoding the synthetic
guide RNA is provided.
According to some embodiments, a vector comprising at least one nucleic acid
as
described herein is provided. According to certain embodiments, the vector is
a viral
vector. According to certain embodiments, the viral vector is of a lentivirus
or adenovirus.
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
7
In a particular embodiment said vector is a lentivirus.
According to some embodiments, the bird is poultry. According to certain
embodiments, the bird is a chicken or quail.
According to an aspect, the present invention provides an engineered, non-
naturally
occurring Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)
gene-
editing system comprising: (i) a synthetic guide RNA as described herein; and
(ii) an
RNA-guided DNA endonuclease enzyme.
According to some embodiments, the endonuclease is selected from the group
consisting of caspase 9 (Cas9), Cpfl, zinc-finger nucleases (ZFNs), and
transcription
activator-like effector nucleases (TALENs).
According to some embodiments, the CRISPR editing system comprises a first
nucleic acid sequence encoding the synthetic guide RNA and a second nucleic
acid
sequence encoding the RNA-guided DNA endonuclease enzyme. According to certain
embodiments, the first and the second nucleic acid sequences each form a
separate
molecule. According to additional embodiments, the first and the second
nucleic acid
sequences are comprised in a single molecule.
According to some embodiments, a vector comprising the at least one engineered
non-naturally occurring gene-editing system is provided. According to some
embodiments, the vector is a viral vector. According to certain exemplary
embodiments,
the viral vector is of lentivirus or adenovirus. In a particular embodiment
said vector is a
lentivirus.
According to some embodiments, a cell population comprising the gene-editing
system is provided.
According to some embodiments, the genetically modifying or editing system is
transiently expressed in the cells.
According to some embodiments, a bird (e.g. male) comprising at least one cell
comprising the gene-editing system is provided. According to certain
embodiments, the
at least one cell is a PGC. In another embodiment, the cell is selected from
the group
consisting of gonadal PGC, blood PGC and germinal crescent PGC. In another
embodiment, the cell is a spermatogonial stem cell (SSC). In other
embodiments, the cell
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
8
is a spermatogonium or a spermatocyte. In another embodiment, the cell is a
gamete (e.g.
sperm cell).
According to an additional aspect, the present invention provides a chimeric
male
bird having cells with a genetically modified chromosome Z comprising at least
one
chromosome Z-gametolog having reduced expression and/or activity and an
unmodified
chromosome Z.
According to some embodiments, the cells are genetically edited using at least
one
artificially engineered nuclease.
According to some embodiments, the bird does not comprise any exogenous
polynucleotide sequence stably integrated into its genome. According to
certain
embodiments, the bird does not comprise the genetically modifying or gene
editing
system described herein. According to other embodiments, the bird comprises an
exogenous polynucleotide sequence stably integrated into its genome.
According to an aspect, the present invention provides a method of generating
a
chimeric male bird having cells with a genetically modified chromosome Z
comprising
at least one chromosome Z-gametolog having reduced expression and/or activity
and an
unmodified chromosome Z, the method comprising the step of applying the site-
directed
mutagenesis system or the gene-editing system as described herein to a
population of
male bird cells, thereby generating genome-modified bird cells; and
transferring the
genome-modified bird cells to a recipient male bird embryo, thereby generating
the
chimeric male bird.
According to some embodiments, the method comprises a step of abolishing or
disrupting the endogenous PGCs cells of the recipient bird before transferring
the
genome-modified bird cells to the recipient bird.
According to some embodiments, the method comprises raising the chimeric bird
to sexual maturity, wherein the chimeric bird produces gametes derived from
the donor
PGCs.
According to an aspect, the present invention provides a method of generating
a
chimeric male bird having cells with a genetically modified chromosome Z, the
cells
comprising at least one chromosome Z-gametolog having reduced expression
and/or
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
9
activity and an unmodified chromosome Z, the method comprising the step of
administering the site-directed mutagenesis system or the gene-editing system
as
described herein to a recipient male bird embryo.
According to some embodiments, the site-directed mutagenesis system or the
gene-
editing system are administered via a route selected from the group consisting
of a viral
infection, transposase system, electroporation, chemical transformation, or
any
combination thereof. According to exemplary embodiments, the viral infection
is by a
lentivirus or adenovirus.
According to an additional aspect, the present invention provides a method of
generating a chimeric male bird having cells with a genetically modified
chromosome Z,
the cells comprising at least one chromosome Z-gametolog having reduced
expression
and/or activity and an unmodified chromosome Z, the method comprising the step
of
administering the site-directed mutagenesis system or the gene-editing system
as
described herein in-vivo to a recipient male bird.
According to some embodiments, the bird is a sexually mature male bird.
In various embodiments, the site-directed mutagenesis system or the gene-
editing
system may be administered directly to gametes and/or precursors thereof (e.g.
SSC or
other spermatogonia) of a male bird in vivo. According to some embodiments,
the site-
directed mutagenesis system or the gene-editing system are administered
directly to the
male bird testicles (e.g. by intra-testicular injection). According to some
embodiments,
the site-directed mutagenesis system or the gene-editing system is
administered via a
route selected from the group consisting of a viral infection, transposase
system,
electroporation, chemical transformation, or any combination thereof.
According to certain embodiments, the site-directed mutagenesis system or the
gene-editing system is administered using lentivirus.
The bird, gametolog gene and the site-directed mutagenesis system or the gene-
editing system are as described hereinabove.
According to another aspect, the present invention provides a method of
generating
a chimeric male bird having cells with a genetically modified chromosome Z,
the cells
comprising at least one chromosome Z-gametolog having reduced expression
and/or
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
activity and an unmodified chromosome Z, the method comprising the step of
administering the genetically modified PGCs as described herein to a recipient
male bird.
According to some embodiments, the bird is sexually mature male bird.
According
to certain embodiments, the method comprises a step of administering the cells
to the bird
5 testicles. According to certain embodiments, the bird was sterilized
before the
administering of the genetically modified PGCs.
According to an additional aspect the present invention provides a genetically
modified male bird comprising at least one cell comprising genetically
modified
chromosome Z comprising at least one chromosome Z-gametolog having reduced
10 expression and/or activity and an unmodified chromosome Z.
According to some embodiments, there is provided a method for generating the
genetically modified male bird comprising the step of mating a chimeric male
bird as
described herein with a female bird having unmodified chromosome Z, and
screening the
resulting offspring for genetically modified males.
According to an additional aspect, the present invention provides a
genetically
modified female bird capable of laying viable egg population with biased sex
ratio, said
bird having a reduced expression and/or activity of at least one chromosome Z-
gametolog.
According to some embodiments, there is provided a method for generating the
genetically modified female bird capable of laying viable egg population with
biased sex
ratio, comprising the step of crossing the genetically modified male bird
described herein
with a female bird and screening the offspring for genetically modified
females.
According to an additional aspect, the present invention provides a method for
producing a bird hatchling population characterized by a sex ratio biased
towards females,
comprising breeding the genetically modified female bird as described herein
with a male
bird having unmodified Z-chromosome, thereby producing an essentially female-
only
hatchling population.
According to an additional aspect, the present invention provides a bird cell
having
at least one genetically modified chromosome Z, wherein the genetically
modified
chromosome comprises at least one chromosome Z-gametolog having reduced
expression
and/or activity.
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
11
According to some embodiments, the bird cell is capable of developing into
functional gametes.
It is to be understood that any combination of each of the aspects and the
embodiments disclosed herein is explicitly encompassed within the disclosure
of the
present invention.
Further embodiments and the full scope of applicability of the present
invention
will become apparent from the detailed description given hereinafter. However,
it should
be understood that the detailed description and specific examples, while
indicating
preferred embodiments of the invention, are given by way of illustration only,
since
various changes and modifications within the spirit and scope of the invention
will
become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 A schematic representation of the breeding steps for generating the
genetically
modified birds according to some embodiments of the invention and the non-
modified
female offspring. A) Generation of a ZZ* chimera male. B) Chimera male ZZ*
from step
A is mated with native females WZ followed by screening for heterozygote male
ZZ*
offspring. C) Heterozygote male ZZ* from step B is mated with native female WZ
followed by screening for heterozygote female WZ* offspring. D) The
heterozygote
.. female WZ* from step C is mated with native male ZZ and produces only WZ
offspring.
FIG. 2. Agarose analysis for in-vitro cleavage using the gRNA/Cas9 system as
described
herein. Control lane contained 250 ng of the non-digested target DNA sequence.
gRNA
lanes were the product of Cas9 endonuclease activity on 250 ng target DNA
sequence
with gRNA 1 (having SEQ ID NO: 1) or 3 (having SEQ ID NO: 2), marked on the
gel,
respectively.
FIG. 3. Iv-vivo cleavage assay. a) A schematic representation of the
experimental
procedure. Genetic construct possessing EGFP gene with a desired genetic
target "break"
in the middle. EGFP has the potential of assembling a functional EGFP gene if
desired
genetic target is cleaved. b) Bright field merged with 488 nm channel of HEK
cells 72
hrs after co-transfection. c) Bright field merged with 488 nm channel of DF-1
cells 72 hrs
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
12
after co-transfection. All cells were co-transfected with the 1st plasmid
harboring
pEGxxFP zfr construct and the 2nd plasmid harboring gRNA (apart from the
control
experiment, without gRNA) and Cas9 endonuclease. gRNA 1 ¨ Guide RNA comprising
SEQ ID NO: 1, gRNA 3 ¨ Guide RNA comprising SEQ ID NO: 2.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides genetically edited birds that produce
selectively
hatched female offspring. The present invention further provides methods for
producing
the genetically edited female birds. The present invention further provides
genetically
edited male birds having cells with a genetically edited chromosome Z
comprising at least
one chromosome Z-gametolog having reduced expression and/or activity and an
unmodified chromosome Z. The genetically edited male birds can be mated with
females
to result with the genetically modified female birds.
Commercial hatcheries use sex separation during the cultivation of broilers
and egg
layers. To produce egg laying hens, male chicks are typically culled at the
hatchery. The
present invention in embodiments thereof provides methods to produce female
birds (e.g.
chickens) that lay essentially only female offspring. This prevents the
inhumane killing
of the male chicks and has the economic advantages of reducing feed and energy
costs,
saving space and manpower.
Methods in accordance of the present invention involve the editing of Z-
chromosome gametolog which results in a male-only ability to inherit the
edited Z-
chromosome. The male gamete having the modified chromosome Z upon
fertilization
with a native female will develop to a viable embryo. The male birds of
embodiments of
the invention, having a gamete with a modified chromosome Z-gametolog, can be
mated
with female birds to produce layer females that can only hatch females.
Advantageously,
a single male edited in its chromosome Z-gametolog, when mated with females,
can
produce multiple females, each laying only females.
The present invention discloses for the first time a chromosome Z gametolog,
which
its function is reduced or abolished at a targeted time after meiosis and
until a few days
after fertilization in females, results in non-viable male embryo. Without
wishing to be
bound by any specific theory or mechanism of action, this phenomenon may be
attributed
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
13
to the fact that in females both chromosomes Z- and W- functional gametologs
are
required for producing a viable embryo. The female gamete requires specific
conditions
and expression profile prior to fertilization, which later are being used for
fertilization
and also post-fertilization for the establishment of the embryo in its first
days. The male
embryo does not survive more than a few days due to lack of the Z-gametolog
product.
Accordingly, the invention in embodiments thereof provides methods and means
for
producing heterozygous male birds capable of mating with female birds to
produce layer
females that can only hatch females.
The present invention provides in some embodiments methods that utilize site-
directed mutagenesis for disrupting the expression or activity of a chromosome
Z-
gametolog in primordial germ cells (PGCs). The genetically modified PGCs are
administered in some embodiments to a male embryo to generate a chimeric male
having
ZZ* (Z* represents a Z chromosome having a genetically modified gametolog).
This
chimeric male bird, when crossed with a native female bird, enables the
generation of a
male bird that is heterozygous to the Z gametolog (ZZ*). The heterologous male
bird is
then breed with a female bird for generating female birds having modified
chromosome
Z-gametolog (WZ* birds) that are capable of laying only viable female
offspring.
In other embodiments, the site-directed mutagenesis is applied directly to
testicles
of a sexually mature male bird to thereby disrupt the expression or activity
of the
chromosome Z-gametolog in sperm cells and/or precursors thereof. In some
embodiments, viral vectors are used to deliver the site-directed mutagenesis
system to the
bird testicles.
In additional embodiments, the genetically modified PGCs may be administered
to
(grafted into) testicles of a sexually mature male bird. In some embodiments,
the bird is
sterilized prior to the PGCs administration.
According to one aspect, the present invention provides a bird cell having at
least
one genetically modified chromosome Z, wherein the genetically modified
chromosome
comprises at least one chromosome Z-gametolog having reduced expression and/or
activity. According to another aspect, the present invention provides a male
bird cell
having at least one genetically modified chromosome Z, wherein the genetically
modified
chromosome comprises at least one chromosome Z-gametolog having reduced
expression
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
14
and/or activity, the bird cell is capable of developing into functional
gametes.
As used herein, the term "genetically modified" with reference to a cell or an
organism refers to a cell genetically altered by man or an organism comprising
same. The
genetic modification includes a modification of an endogenous DNA molecule(s)
or
gene(s) for example by introducing insertion, alteration, deletion
transposable element
and the like into an endogenous nucleic acid sequences or gene of interest.
Additionally,
or alternatively, genetic modification includes transforming the cell with
heterologous
polynucleotide that incorporate to the cell genome, thereby producing a
transgenic cell or
a transgenic organism comprising same.
The term "native bird" as used herein refers to a bird that is non-edited or
modified
in its sex chromosome according to the invention.
The term "chimeric bird" as used herein refers to a bird having both non-
edited or
modified cells, and modified or edited cells as described herein (i.e. having
a genetically
modified chromosome Z in which at least one gametolog has reduced expression
and/or
activity).
According to an aspect the present invention provides a genetically modified
male
bird comprising at least one cell comprising genetically modified chromosome Z
comprising at least one chromosome Z-gametolog having reduced expression
and/or
activity and an unmodified chromosome Z.
In another embodiment, the present invention provides a genetically modified
bird
(e.g. male bird) bird comprising, in substantially all its cells, a
genetically modified
chromosome Z comprising at least one chromosome Z-gametolog having reduced
expression and/or activity and an unmodified chromosome Z.
In another embodiment, the present invention provides a genetically modified
bird
(e.g. male bird) in which the germline cells comprise a genetically modified
chromosome
Z comprising at least one chromosome Z-gametolog having reduced expression
and/or
activity and an unmodified chromosome Z.
As used herein a "genetically modified bird" generally refers to a bird in
which its
cells comprising genetically modified chromosome Z. This term includes a bird
in which
substantially portion of its cells are modified as described herein. In other
embodiments,
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
all of the bird's cells are modified as described herein.
The terms "reduced expression" or "inhibited expression" of a gametolog as
described herein are used interchangeably and include, but are not limited to,
deleting or
disrupting the gene that encodes for the protein to result in a significantly
downregulated
5 expression.
The terms "reduced activity" or "inhibited activity" of a gametolog as
described
herein includes without limitation mutations or posttranslational
modifications resulting
in a significantly reduced or abolished activity of the protein.
According to some embodiments, the expression or the activity of the gametolog
is
10 reduced by at least 50%, 60%, 80%, 80%, 90%, 95%, or 99% compared to the
expression
or activity of a non-edited or non-modified gametolog. According to some
embodiments,
the expression of the gametolog is completely abolished. According to
additional
embodiments, the activity of the gametolog is completely abolished.
The term "functional gamete" as used herein refers to a gamete that is
capable, when
15 .. combined with another male or female gamete, to produce a viable embryo.
A "viable embryo" refers to an embryo that is capable to develop to a bird.
According to some embodiments, an endogenous gene of a cell is modified by
gene
edited techniques using at least one artificially engineered nuclease.
RNA-directed DNA nucleases are used herein to introduce a mutation(s) in a
.. chromosome Z-gametolog to disrupt its activity and/or expression.
As used herein the term "genetically edited" refers to the insertion, deletion
or
replacement of one or more nucleotides in endogenous genomic DNA. The
insertion,
deletion, or replacement are used herein to disrupt the expression and/or
activity of a gene
product.
The term "gametolog" as used herein is as known in the art and refers to the
homologous genes shared between the sex chromosomes, specifically chromosome Z
and
chromosome W of birds.
According to some embodiments, the gametolog is a gene selected from the group
consisting of zfr, srnad2, st8sia3, kcrnfl, spin], sub], chdl, nipbk hnmpk,
gfbpl, rnier3,
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
16
btf3, go1ph3, vcp, txn11, nedd4, ctif, srnad7, rp117, znf532, hintz, cl8orf25,
atp5a, zswirn6,
rasa], ube2r2, ubap2, and tcf4. Each possibility represents a separate
embodiment of the
invention.
According to some embodiments, the gametolog is a gene selected from the group
consisting of zfr, srnad2, st8sia3, kcrnfl, spin], sub], chdl, and nipbl.
According to some
embodiments, the gametolog is a gene selected from the group consisting of
hnmpk,
gfbpl, rnier3, btf3, go1ph3, vcp, txn11, nedd4, ctif, srnad7, rp117, znf532,
hintz, cl8orf25,
atp5a, zswirn6, rasa], ube2r2, ubap2, and tcf4. Each possibility represents a
separate
embodiment of the invention.
According to some embodiments, the at least one gametolog is genetically
modified
to reduce its expression. According to some embodiments, the at least one
gametolog is
genetically modified to reduce its activity. The modification can be done, for
example,
by the insertion of a missense or nonsense mutation to the coding region.
According to some embodiments, the gametolog is a meiosis-associated gene.
According to some embodiments, the gene is selected from the group consisting
of
zfr, srnad2, spin], and nipbl. According to some embodiments, the gene is
selected from
the group consisting of zfr, srnad2, and spin]. According to some embodiments,
the gene
is selected from the group consisting of zfr and srnad2. According to some
embodiments,
the gene is selected from the group consisting of srnad2 and spin]. According
to some
embodiments, the gene is selected from the group consisting of srnad2, spin],
and nipbl.
According to some embodiments, the gene encodes Zinc Finger RNA Binding
Protein (ZFR).
The zfr gene (Gene ID 427424, synonym: zfr2) is conserved in a variety of
animals
including human, chimpanzee, dog, cow, mouse, and chicken. This gene encodes
an
RNA-binding protein characterized by its DZF (domain associated with zinc
fingers)
domain.
According to other embodiments, the gametolog is selected from the group
consisting of srnad2, st8sia3, kcrnfl, spin], sub], chdl, nipbl, hnmpk, gfbpl,
rnier3, btf3,
go1ph3, vcp, txn11, nedd4, ctif, srnad7, rp117, znf532, hintz, cl8orf25,
atp5a, zswirn6,
rasa], ube2r2, ubap2, and tcf4.
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
17
The gene srnad2 encodes to the protein SMAD2 (e.g. Gene ID: 395247 in Gallus
gallus (chicken)), also named SMAD family member 2 (Mothers against
decapentaplegic
homolog 2) SMAD2 protein mediates the signal of the transforming growth factor
(TGF)-
beta.
The gene st8sia3 encodes for st8sia3 protein (ST8 alpha-N-acetyl-neuraminide
alpha-2,8-sialyltransferase 3; e.g. Gene ID: 414796 (Gallus gallus)).
The gene kcrnfl encodes for potassium channel modulatory factor 1 (e.g. Gene
ID:
770239 (Gallus gallus)).
The gene spin] encodes for SPIN1, a spindlin 1 protein (e.g. Gene ID: 395344
(Gallus gallus)).
The gene sub] encodes for SUB1, regulator of transcription (e.g. Gene ID:
427425
(Gallus gallus)).
The gene chdl encodes for CHD1 protein, a chromodomain helicase DNA binding
protein 1Z (e.g. Gene ID: 395783 (Gallus gallus)).
The gene nipbl or L0C427439 encodes for Nipped-B homolog-like protein (e.g.
Gene ID: 427439 (Gallus gallus)).
The gene hnmpk encodes for HNRNPK, a heterogeneous nuclear ribonucleoprotein
K (e.g. Gene ID: 427458 (Gallus gallus)).
The gene rnier3 encodes for MIER3 or MIER family member 3 (e.g. Gene ID:
427146 (Gallus gallus)).
The gene go1ph3 encodes GOLPH3, golgi phosphoprotein 3 (e.g. Gene ID: 427422
(Gallus gallus)).
The gene vcp encodes VCP, a valosin containing protein (e.g. Gene ID: 427410
(Gallus gallus)).
The gene txnll encodes TXNL1, a thioredoxin like 1 protein (e.g. Gene ID:
426854
(Gallus gallus)).
The gene ctif encodes CTIF, a CBP80/20-dependent translation initiation factor
(e.g. Gene ID: 770140 (Gallus gallus)).
The gene srnad7 encodes SMAD7 or SMAD family member 7 protein (Gene ID:
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
18
429683 (e.g. Gallus gallus)).
The gene rp117 encodes ribosomal protein L17 (e.g. Gene ID: 426845 (Gallus
gallus)).
The gene znf532 encodes for zinc finger protein 532 (e.g. Gene ID: 100857356
(Gallus gallus)).
The gene cl8orf25 or LOC100858742 encodes chromosome Z open reading frame,
human C18orf25 pseudogene (e.g. Gene ID: 100858742 (Gallus gallus)).
The gene zswin16 encodes a zinc finger SWIM-type containing 6 (e.g. Gene ID:
770670 (Gallus gallus)).
The gene rasa] encodes for RASA1, a RAS p21 protein activator 1 (e.g. Gene ID:
427327 (Gallus gallus)).
The gene ube2r2 encodes a ubiquitin conjugating enzyme E2 R2 (e.g. Gene ID:
427021 (Gallus gallus)).
The gene ubap2 encodes for UBAP2, a ubiquitin associated protein 2 (e.g. Gene
ID: 407092 (Gallus gallus)).
The gene tcf4 encodes for TCF4, a transcription factor 4 (e.g. Gene ID: 768612
(Gallus gallus)).
It is to be understood that the above gametologs of Gallus gallus (chicken)
are given
as non-limiting examples of gametologs, which includes their homologues in
chickens,
quails and other bird species as disclosed herein.
The term "meiosis-associated gene" as used herein refers to a gene encoding a
product that is involved in the meiosis process.
According to some embodiments, the cell is a primordial germ cell (PGC).
According to some embodiments, the PGC is selected from the group consisting
of
gonadal PGC, blood PGC and germinal crescent PGC. According to additional
embodiments, the cell is selected from the group consisting of gonadal PGC,
blood PGC
and germinal crescent PGC. In another embodiment, the cell is a spermatogonial
stem
cell (SSC). In other embodiments, the cell is a spermatogonium or a
spermatocyte. In
another embodiment, the cell is a gamete (e.g. sperm cell).
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
19
Primordial germ cells are diploid cells that are precursors of gametes, and
which
still have to reach the gonads and there, following meiosis, are developed as
haploid
sperm and eggs. These cells can be obtained from embryos and be propagated as
a cell
culture without losing the ability to contribute to the germline when
reintroduced into a
host bird animal. PGCs can be genetically modified in culture using
traditional
transfection and selection techniques, including gene targeting and site-
specific nuclease
approaches.
According to some embodiments, a bird having the at least one cell is
provided.
According to some embodiments, the bird is a chimeric bird. According to
certain
embodiments, the bird is a chimeric male bird having at least one PGC as
described
herein. According to certain embodiments, the at least one PGC is heterozygous
to the
genetically edited chromosome Z.
According to some embodiments, the bird is a female bird. According to some
embodiments, the bird is a female bird having at least one PGC as described
herein.
As used herein, the term "bird" refers to any avian species, including but not
limited
to chicken, quail, turkey, and duck. Preferably, the bird is a poultry.
According to some embodiments, the bird is a chicken. According to certain
embodiments, the bird is a quail.
According to some embodiments, there is provided a cell population comprising
the at least one cell. According to certain embodiments, the cell population
comprises
gametes.
According to some embodiments of the invention, the cell population are
derived
from the same avian species as the recipient bird. According to some
embodiments of the
invention, the cell population is derived from the same breed as the recipient
bird.
According to other embodiments, the cell population is derived from a
different avian
species or breed as the recipient bird.
According to an additional aspect, the present invention provides a site-
directed
mutagenesis system for reducing the expression and/or activity of at least one
chromosome Z-gametolog .
Any genetically modification, editing or mutagenesis method known in the art
that
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
will result in the disruption of chromosome Z-gametolog expression or activity
may be
used according to the present invention.
According to some embodiments, the site-directed mutagenesis system is
Clustered
Regularly Interspaced Short Palindromic Repeats (CRISPR).
5
According to some embodiments, the CRISPR system comprises, or encodes: (i) a
gRNA as described herein and (ii) an RNA-guided DNA endonuclease enzyme.
According to an additional aspect, the present invention provides a synthetic
guide
RNA comprising a nucleotide sequence (also referred to herein as a targeting
nucleotide
sequence) complementary to a target nucleic acid sequence within a bird
chromosome Z-
10 gametolog .
As used herein, "gRNA" means guide RNA and is a short synthetic RNA composed
of a "scaffold" sequence necessary for endonuclease-binding and a user-defined
nucleotide "spacer" or "targeting" sequence of approximately 20 nucleotides in
length
that defines the genomic target.
15 The
gRNA molecule can be stabilized using modifications. According to some
embodiments, the gRNA is a synthetic RNA molecule. According to some
embodiments,
the gRNA molecule is modified. According to certain embodiments, the gRNA is
modified at the 5' end.
In some embodiments, the modifications are selected from the group consisting
of
20 2' -0-Methyl (2'-0-Me), 2' -0-methoxyethyl (2'-M0E), and combinations
thereof.
The gRNA sequence includes a combination of a targeting homologous sequence
(crRNA) and an endogenous bacterial RNA that links the crRNA to the Cas9
nuclease
(tracrRNA) in a single chimeric transcript. The gRNA/Cas9 complex is recruited
to the
target sequence by the base-pairing between the crRNA sequence and the
complement
genomic DNA. For successful binding of Cas9, the genomic target sequence must
also
contain the correct Protospacer Adjacent Motif (PAM) sequence immediately
following
the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9
to the
genomic target sequence so that the Cas9 can cut both strands of the DNA
causing a
double-strand break.
According to some embodiments, the target nucleic acid sequence of the gRNA is
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
21
within the coding region of the gametolog.
According to some embodiments, a nucleic acid construct encoding the guide RNA
is provided.
According to some embodiments, a vector comprising at least one nucleic acid
as
described herein is provided. According to certain embodiments, the vector is
a viral
vector. According to certain embodiments, the viral vector is of a lentivirus
or adenovirus.
The vectors typically comprise regulatory elements for the expression of the
desired
nucleic acids in the cells. The vector may comprise a promoter(s) which is
operatively
linked to drive the expression of the gRNA and the endonuclease. The promoter
can be
constitutive or inducible. According to some embodiments the promoter(s)
operatively
linked to drive the expression of the gRNA and the endonuclease are
constitutive
promoters. The promoter can be, but are not limited to, of a viral origin,
such as the CMV,
E 1A, CAG or RSV promoter, or alternatively, a housekeeping promoter of the
bird.
According to certain exemplary embodiments, the gRNA promoter is 7SK promoter
of
quails. According to some embodiment, the gRNA promoter is human U6 promoter.
The CAG promoter is a strong synthetic promoter comprising CMV promoter and
chicken beta-actin promoter frequently used to drive high levels of gene
expression in
birds.
According to some embodiments, the vectors further comprise functional element
such as origin of replication, a multicloning site, and a selectable marker.
Preferably, the codons encoding the endonuclease of the DNA editing system are
"optimized" codons, i.e., the codons are those that appear frequently in
expressed genes
in the bird species.
The present invention further provides an engineered, non-naturally occurring
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) gene-
editing
system comprising: (i) a synthetic guide RNA as described herein; and (ii) an
RNA-
guided DNA endonuclease enzyme.
According to some embodiments, the endonuclease is selected from the group
consisting of caspase 9 (Cas9), Cpfl, zinc-finger nucleases (ZFNs), and
transcription
activator-like effector nucleases (TALENs).
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
22
As used herein, "Cas9" means non-specific CRISPR-associated endonuclease. The
Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a
different DNA
strand. When both of these domains are active, the Cas9 causes double strand
breaks in
the genomic DNA.
Cpfl (CRISPR-Cas12a) is an endonuclease that uses a small guide RNA devoid of
trans-activating CRISPR RNA, targets T-rich regions of the genome, and is able
to
generate double strand breaks (DSB) with staggered ends.
Zinc-finger nucleases (ZFNs) are artificial restriction enzymes generated by
fusing
a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains
can
be engineered to target specific desired DNA sequences and this enables zinc-
finger
nucleases to target unique sequences within complex genomes.
Transcription activator-like effector nucleases (TALEN) are restriction
enzymes
that can be engineered to cut specific sequences of DNA. They are made by
fusing a TAL
effector DNA-binding domain to a DNA cleavage domain (a nuclease which cuts
DNA
strands). They contain DNA binding proteins called TALEs. The TALE is 33-35
amino
acids in length and recognizes a single base pair of DNA.
According to some embodiments, the CRISPR editing system comprises a first
nucleic acid sequence encoding the synthetic guide RNA and a second nucleic
acid
sequence encoding the RNA-guided DNA endonuclease enzyme. According to certain
embodiments, the first and the second nucleic acid sequences each form a
separate
molecule. According to additional embodiments, the first and the second
nucleic acid
sequences are comprised in a single molecule.
According to some embodiments, a vector comprising the at least one engineered
non-naturally occurring gene-editing system is provided. According to some
embodiments, the vector is a viral vector. According to certain exemplary
embodiments,
the viral vector is lentivirus.
According to some embodiments, the invention relates to a nucleic acid
molecule,
construct, system or vector as disclosed herein, which modulates the
expression of at least
one Z-gametolog.
According to some embodiments, a cell population comprising the gene-editing
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
23
system is provided.
According to some embodiments, a bird comprising at least one cell comprising
the
gene-editing system is provided. According to certain embodiments, the at
least one cell
is PGC. According to additional embodiments, the cell is selected from the
group
consisting of gonadal PGC, blood PGC and germinal crescent PGC. In another
embodiment, the cell is a spermatogonial stem cell (SSC). In other
embodiments, the cell
is a spermatogonium or a spermatocyte. In another embodiment, the cell is a
gamete (e.g.
sperm cell).
In some embodiments, the cells are extracted form a bird embryo and the site-
directed mutagenesis system is administered to the cells in vitro. In other
embodiments,
the site-directed mutagenesis system is administered to the bird or the
embryo. In certain
exemplary embodiments, the site-directed mutagenesis system is administered to
the
testicles of a sexually mature male bird. In other embodiments, the site-
directed
mutagenesis system is administered to a hatched chick before sexual
maturation.
Any method as known in the art can be applied for administering the site-
directed
mutagenesis system, e.g. CRISPR, to the cells.
According to some embodiments, the site-directed mutagenesis system is
administered to the cells using a viral vector. According to some embodiments,
the viral
vector is adenovirus. According to certain embodiments, the viral vector is
lentivirus.
According to some embodiments, the site-directed mutagenesis system is
administered to the cells using electroporation, a chemical agent, or nano
particles.
According to some embodiments the chromosome Z-gametolog is mutated using
the transposase system.
The transposase system comprises the transposase enzyme and a DNA element
defined by its inverted terminal repeats (ITR) or other elements with the same
ITRs. An
example of transposase system is the To12 transposon. The transposase system
enables
the insertion of a DNA segment into a pre-defined location within the genome,
thus the
disruption of a desired gene.
Any site-directed mutagenesis can be used for generating the genetically
modified
birds described herein. An exemplary system is the Clustered Regularly
Interspaced Short
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
24
Palindromic Repeats (CRISPR) gene-editing system. The CRISPR system enables
the
cutting of strands of DNA in a precise location within the genome.
The CRISPR system uses a guide RNA (gRNA) to target the endonuclease to cut
and create specific double-stranded breaks at a desired location(s) in the
genome. The
cleavage in the chromosome is then repaired by the error-prone non-homologous
end
joining (NHEJ) pathway. This pathway frequently causes small nucleotide
insertions or
deletions, which likely account for genetic disruption and gene knockout. This
system is
used herein to reduce the expression and/or activity of at least one
chromosome Z-
g ametolog .
The targeting sequences are selected such that they will specifically
hybridized to
the gametolog sequences and not to any other chromosome of the cell.
Determining a suitable gRNA target sequence can be done using a variety of
publicly available bioinformatic tools including the CHOPCHOP algorithm, Broad
Institute GPP, CasOFFinder, CRISPOR, Deskgen, etc.
According to certain exemplary embodiments, the synthetic guide RNA comprises
a targeting sequence selected from the group consisting of
GGCTAGCTACACTGTCCACC (SEQ ID NO: 1) and
GCGCACACAGCTACAGATTA (SEQ ID NO: 2).
It is to be understood, that when the nucleic acid sequence of a nucleic acid
molecule of the invention is presented herein, both DNA and RNA sequences are
included. For example, the sequence of a nucleic acid molecule having the
nucleic acid
sequence as set forth in SEQ ID NO: 1 may be either GGCTAGCTACACTGTCCACC
or GGCUAGCUACACUGUCCACC, depending on the context.
Methods for qualifying the efficacy and detecting the correct genetically
modifications as described herein are well known in the art and include, but
not limited
to, DNA sequencing, PCR, RT-PCR, RNase protection, in-situ hybridization,
primer
extension, Southern blot, Northern Blot and dot blot analysis.
The genetically editing or modifying systems of the invention may be used for
the
generation of male birds (e.g. roosters) having chromosome Z-gametolog with
reduced
activity and/or expression. The genetically edited male birds may be mated
with females
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
to generate female chickens that are capable of producing only viable female
offspring.
As a first step, the DNA editing system is introduced into either primordial
germ
cells of the bird or directly into sperm cells (and/or precursors thereof as
disclosed herein)
of the bird. Any method know in the art can be used for introducing the DNA
editing
5 system including but not limited to, lipofection, transfection,
microinjection, and
electroporation, as well as transduction via viral vectors.
The cells are then screened in embodiments of the invention for those having
chromosome Z-gametolog with reduced activity and/or expression.
To produce chimeric birds from PGCs edited in vitro, the exogenous edited
cells
10 are injected intravenously into surrogate host embryos, at a stage when
their endogenous
PGCs are migrating to the genital ridge.
Administration of the primordial germ cells to the recipient animal in-ovo can
be
carried out at any suitable time at which the PGCs can still migrate to the
developing
gonads. In one embodiment, administration is carried out from about stage IX
according
15 to the Eyal-Giladi & Kochav (EG&K) staging system to about stage 30
according to the
Hamburger & Hamilton staging system of embryonic development, and in another
embodiment, at stage 15. For chickens, the time of administration is thus
during days 1,
2, 3, or 4 of embryonic development: in one embodiment day 2 to day 2.5.
Administration
is typically by injection into any suitable target site, such as the region
defined by the
20 amnion (including the embryo), the yolk sac, etc. According to some
embodiments, the
injection is into the embryo itself (including the embryo body wall), and in
alternative
embodiments, intravascular or intracoelomic injection into the embryo can be
employed.
In other embodiments, the injection is performed into the heart. The methods
of the
presently disclosed subject matter can be carried out with prior sterilization
of the
25 recipient bird in ovo (e.g. by chemical treatment using Busulfan of by
gamma or X-ray
irradiation). As used herein, the term "sterilization" refers to render
partially or
completely incapable of producing gametes derived from endogenous PGCs. When
donor
gametes are collected from such a recipient, they can be collected as a
mixture with
gametes of the donor and the recipient. This mixture can be used directly, or
the mixture
.. can be further processed to enrich the proportion of donor gametes therein.
The in-ovo administration of the primordial germ cells can be carried out by
any
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
26
suitable technique, either manually or in an automated manner. According to
some
embodiments, the in-ovo administration is performed by injection. The
mechanism of in-
ovo administration is not critical, but it is understood that the mechanism
should not
unduly damage the tissues and organs of the embryo or the extraembryonic
membranes
surrounding it so that the treatment will not unduly decrease hatch rate. A
hypodermic
syringe fitted with a needle of about 18 to 26 gauge is suitable for the
purpose. A
sharpened pulled glass pipette with an opening of about 20-50 microns diameter
may be
used. Depending on the precise stage of development and position of the
embryo, a one-
inch needle will terminate either in the fluid above the chick or in the chick
itself. If
desired, the egg can be sealed with a substantially bacteria-impermeable
sealing material
such as wax or the like to prevent subsequent entry of undesirable bacteria.
It is
envisioned that a high-speed injection system for avian embryos will be
particularly
suitable for practicing the presently disclosed subject matter. All such
devices, as adapted
for practicing the methods disclosed herein, comprise an injector containing a
formulation
of the primordial germ cells as described herein, with the injector positioned
to inject an
egg carried by the apparatus in the appropriate location within the egg. In
addition, a
sealing apparatus operatively connected to the injection apparatus can be
provided for
sealing the hole in the egg after injection thereof. According to other
embodiments, a
pulled glass micropipette can be used to introduce the PGCs into the
appropriate location
within the egg - for example directly into the blood stream, either to a vein
or an artery or
directly into the heart.
The injected embryo may be allowed to grow to maturity. In some embodiments,
the injected embryo is transferred to a surrogate egg.
Once the eggs have been injected with the modified PGCs, the chimeric embryo
is
incubated to hatch. It is raised to sexual maturity, wherein the chimeric bird
produces
gametes derived from the donor PGCs.
The gametes, (either eggs or sperm) from the chimeras are then used to raise
founder birds (e.g. chickens). Molecular biology techniques known in the art
(e.g. PCR,
Southern blot and/or T7 endonuclease assay) may be used to confirm germ-line
.. transmission.
According to other embodiments, a genetic manipulation, in which site directed
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
27
mutagenesis is applied, is performed directly on spermatogonial stem cells
(SSCs) or
differentiated sperm cells of a sexually mature male bird. This can be done by
injecting
or otherwise applying the site directed mutagenesis system described herein
directly into
its testicles.
According to additional embodiments, the site directed mutagenesis system
described herein is injected or otherwise applied to testicles of non-mature
birds, or
chicks.
According to some embodiments, the genetically modified PGC cells described
herein are administered to a male bird. In some embodiments, the PGC cells are
administered to the testicles of the bird. In some embodiments, the birds are
sexually
mature. According to other embodiments, the birds are non-sexually mature, or
chicks.
According to some embodiments, birds are sterilized before the administration.
In some embodiments, the mutagenesis system is administered using a viral
vector,
such as of lentivirus. In additional embodiments, the mutagenesis system is
administered
using transposases.
According to some embodiments, a lentivirus vector is used for delivering the
site
directed mutagenesis. In some embodiments, the site-directed mutagenesis is
CRISPR.
According to some embodiments, the lentivirus comprises both gRNA comprising
targeting sequence to a Z-gametolog and a sequence encoding an endonuclease.
According to some embodiments, the endonuclease is CAS9. According to certain
embodiments, the lentivirus vector comprises a CAG promoter operably linked to
the
sequence encoding the endonuclease and/or the gRNA. According to certain
embodiments, the endonuclease comprises a nuclear localization signal.
According to an additional aspect, there is provided a chimeric male bird
having
cells comprising at least one chromosome Z-gametolog having reduced expression
and/or
activity and an unmodified chromosome Z.
According to some embodiments, the bird does not comprise any exogenous
polynucleotide sequence stably integrated into its genome.
The present invention provides methods of generating a chimeric male bird
having
cells comprising at least one chromosome Z-gametolog having reduced expression
and/or
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
28
activity and an unmodified chromosome Z, the method comprising the step of
applying
the site-directed mutagenesis system or the gene-editing system as described
herein to a
population of male bird cells, thereby generating genome-edited bird cells;
and
transferring the genome-edited bird cells to a recipient male bird embryo,
thereby
generating the chimeric male bird.
According to some embodiments, the method comprises raising the chimeric bird
to sexual maturity, wherein the chimeric bird produces gametes derived from
the donor's
genetically modified PGCs.
The present invention further provides a method of generating a chimeric male
bird
having cells comprising at least one chromosome Z-gametolog having reduced
expression
and/or activity and an unmodified chromosome Z, the method comprising the step
of
administering the site-directed mutagenesis system or the gene-editing system
as
described herein to a recipient male bird embryo.
The chimeric bird is then mated with a female bird to generate heterozygous
ZZ*
offspring.
According to some embodiments, there is provided a method for generating the
genetically edited male bird comprising the step of breeding a chimeric male
bird as
described herein with a female bird having unmodified chromosome Z. According
to
certain embodiments, the method comprises screening the resulting offspring
for
heterozygous ZZ* birds.
According to an additional aspect the present invention provides a genetically
edited female bird capable of laying viable egg population with biased sex
ratio, said bird
having a reduced expression and/or activity of at least one chromosome Z-
gametolog.
According to some embodiments, there is provided a method for generating the
genetically edited female bird capable of laying viable egg population with
biased sex
ratio, comprising the step of crossing the genetically edited male bird
described herein
with a female bird and screening the offspring for genetically edited females.
According to an additional aspect, the present invention provides a method for
producing a bird hatchling population characterized by a sex ratio biased
towards females,
comprising breeding the genetically edited female bird as described herein
with a male
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
29
bird having unmodified Z-chromosome, thereby producing an essentially female-
only
hatchling population.
According to an additional aspect, the present invention provides a veterinary
composition comprising the PGCs cells or the site-directed mutagenesis system
as
described herein and an acceptable carrier.
According to some embodiments, the veterinary composition is formulated for
injection to birds.
According to some embodiments, the site directed mutagenesis system is CRISPR.
According to some embodiments, the composition comprises a viral vector or
transposase comprising the site directed mutagenesis system described herein.
According to some embodiments, the composition further comprises antibiotics.
The following examples are presented in order to more fully illustrate some
embodiments of the invention. They should, in no way be construed, however, as
limiting
the broad scope of the invention. One skilled in the art can readily devise
many variations
and modifications of the principles disclosed herein without departing from
the scope of
the invention.
EXAMPLES
Example 1: Editing zfr gene using CRISPR system
Bioinformatics analysis for guide RNAs (gRNAs) selection:
Focusing on the 3rd exon of the zfr gene from Gallus gallus's Z chromosome, 3
gRNA were selected. The selected targeting sequences were further analyzed
using
CHOPCHOP algorithm (Labun, K. et al. Nucleic Acids Res. 47, W171¨W174 (2019))
before testing their efficiency in vitro. DNA sequence of ¨1000 bp upstream to
the exon,
the 283 bp of the exon itself and ¨1000 bp downstream to the exon were
inserted as a
single target sequence to the CHOPCHOP analysis with the following parameters:
comparison genome of Gallus gallus 6 (galGa16), using CRISPR/Cas9, for knock-
out.
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
The 2 gRNA targeting sequences described below and their information were
located
within the analysis report.
Cas9 in-vitro cleavage assay (Anders, C. & Jinek, M. Methods in Enzymology
546, 1-20
(Elsevier Inc., 2014)):
5 gRNAs
were chosen for targeting of zfr gene from the Z chromosome of Gallus
gallus. The 2 gRNAs comprising the targeting sequences SEQ ID NO: 1 and SEQ ID
NO:
2 were synthesized in-vitro, and underwent cleavage assessment using a PCR
product of
the zfr DNA target sequence and purified Cas9 endonuclease protein. DNA
product
cleavage was analyzed on an agarose gel.
10 In-vivo cleavage assay:
In-vivo assay was done utilizing Mashiko et. al. pEGxxFP construct (RNA. Sci.
Rep. 3, 3355 (2013)). The target sequence comprised of partial zfr gene from
the Z
chromosome of Gallus gallus that was cloned in between overlapping segments of
EGFP
gene. The construct was transfected into chicken Fibroblast (DF-1) or human
embryonic
15 kidney 293 cells (HEK) and observed for green fluorescence after ¨72
hrs.
Results:
CHOPCHOP analysis report for the target area inside the zfr gene at the Z
chromosome, resulted in 192 possible gRNAs sorted from best to worse. The 3
chosen
gRNAs were located in the report as follows: gRNA 1 (having targeting sequence
SEQ
20 ID NO: 1) ranked 17th, gRNA 2 ranked 113th and gRNA 3 (having targeting
sequence
SEQ ID NO: 2) ranked 7th (Table 1). Apart from the gRNAs rank, the number of
off-
target sites that exist in the Gallus gallus genome was also a significant
consideration.
The higher the number of off-targets, the less optimal the gRNA. gRNA 2 has
considerably more off-targets than gRNAs 1 and 3 (Table 1). Moreover, one of
the off-
25 targets has 0 mismatches and matches the target sequence on 100%
(confirmed as an off-
target located at the W chromosome zfr gene). Thus, gRNA 2 is considered as a
poor
choice for actual usage. Regarding gRNAs 1 (having targeting sequence SEQ ID
NO: 1)
and 3 (having targeting sequence SEQ ID NO: 2) off-targets (Table 2), each
gRNA has
an off-target sequence with 1 mismatch at the W chromosome ZFR gene.
Additionally,
30 gRNA 1 has a second off-target site at the 1st chromosome with 3
sequence mismatches.
Overall gRNAs 1 and 3 mismatches are considered as a reasonable result,
especially when
taking into account the homology between the zfr genes from the W or Z
chromosomes.
CA 03217797 2023-10-23
WO 2022/224244 PCT/IL2022/050389
31
Hence, gRNAs 1 and 3 (having targeting sequences as set forth in SEQ ID NOs: 1
and 2,
respectively) were used for further analysis.
Table 1. CHOPCHOP ranking result for the 3 chosen gRNAs. MMX meaning the
number of Gallus gallus genomic off-targets with X mismatches from the target
sequence.
CHOPCHOP rank
Chosen gRNA MMO MM1 MM2 MM3 Efficiency
(out of 192)
1 17 0 1 0 1 58.45
2 113 1 0 0 185 40.52
3 7 0 1 0 0 43.71
Table 2. Detailed off-targets for gRNAs 1 and 3 according to CHOPCHOP.
gRNA 1 off-targets
Number of Targeting sequence (including
Location
mismatches mismatches)
Chr 1:
3 CCTGGTGaAAGGTAGCTAGCC
31573888
Chr W:
1 CCTGGTGGACAGTGTAGCTAGC;
5189123
gRNA 3 off-targets
Number of Targeting sequence (including
Location
mismatches mismatches)
Chr W:
1 CCATAATCTGTAGCTG:GTGCGC
5188972
Initial gRNAs targeting and cleavage testing were performed using a Cas9 in-
vitro
cleavage assay (Anders ibid). Figure 2 presents digestion patterns of the
target DNA
sequence using gRNA 1 or gRNA 3 compared to non-digested target DNA of 768 bp.
The cleavage pattern for gRNA 1 shows that while some of the target DNA
remained
uncut, two smaller bands at ¨300 bp and ¨450 bp were apparent and matched the
cleavage
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
32
prediction of gRNA 1 on the target sequence. The gRNA 3 cleavage pattern
suggest that
it also contained some uncut target DNA and two smaller bands corresponding to
¨280
bp and ¨480 bp that matched the cleavage prediction of gRNA 3. Hence in-vitro
assay
for both gRNA 1 and gRNA 3 demonstrated positive cleavage.
An in-vivo assay was also performed to examine the activity of the selected
gRNA
molecules. The in-vivo assay, despite not testing cleavage ability on the
chromosome
itself, provided a more reliable representation on the gRNAs cleavage
potential in a
complex cellular environment. Using a pEGxxFP construct (Mashiko, ibid),
containing
the target sequence of zfr in between overlapping areas from EGFP reporter,
the pEGxxFP
zfr plasmid was co-transfected with a second plasmid containing gRNA (apart
from the
control experiment) and Cas9 endonuclease (Fig. 3a). The assay was carried out
in HEK
293 cells (Fig. 3b) and chicken Fibroblast cells (DF-1) (Fig. 3c), where a
positive cleavage
was aimed to result in a green fluorescence signal within the cell.
The in-vivo assay results clearly demonstrate the correct activity of the
designed
gRNA molecules (Fig. 3b, Fig 3c). Control experiments, in the absence of a
gRNA, did
not develop green fluorescence. Thus, the pEGxxFP zfr construct is stable and
does not
cleave and self-repair spontaneously. A clear green signal was observed for
cells co-
transfected with the pEGxxFP zfr construct together with gRNA 1 or gRNA 3. As
the
control did not result in any background fluorescence, it is concluded that
all fluorescence
signals originated from gRNAs cleavage activity on the pEGxxFP zfr construct
and EGFP
repair. In terms of efficiency, gRNA 1 appeared to result in better
fluorescence as green
cells were more abundant than for gRNA 3, corresponding well to the predicted
efficiency
by the CHOPCHOP algorithm (Table 1). These results served as further
indication for the
two selected gRNAs ability to cleave the target sequence within the ZFR gene
from a
Gallus gallus's Z chromosome and demonstrate favoring gRNA 1 over gRNA 3.
Example 2: Producing a genetically edited female bird that is capable of
producing
only female offspring
The DNA editing system described in Example 1 is used to knockout the
expression
of zfr in primordial germ cells (PGCs). The modified cells having ZZ* are then
administered to a male chicken embryo. The administration is performed under
conditions
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
33
sufficient to allow the PGC cells to colonize a gonad of the recipient bird
embryo. The
embryo is raised to maturity. The chimeric bird is then mated with regular
(native)
females and the progeny are screened for heterozygote ZZ* birds. The
identified
heterozygous ZZ* are mated with native females ( 'Grandmothers' WZ), and their
offspring are screened for female WZ* (`Mothers'). The genetically modified
WZ* are
the layer bird females that are capable of producing only female offspring.
The resulting
offspring are non-genetically modified birds.
Example 3: Injection of the site-directed mutagenesis system into sexually
mature
male testes for producing chimeric heterozygote ZZ* birds
Lentiviral vectors comprising the DNA editing system as described in Example 1
were designed, suitable to be used to knock-out the expression of zfr in
quails or roosters.
The designed lentiviral vector comprised gRNA scaffold having promoter 7SK of
quails,
and Cas9 endonuclease having CAG promoter.
A surgical procedure was performed on hatched male quails as follows. Male
quails
at an age between 1-6 weeks were used. Under anesthesia, the first testis was
exposed
within the bird's body. Using a syringe, a suspension comprising Lentiviral
vectors were
injected into the testis at several locations. The surgical opening was
sutured and closed.
The same procedure was executed on the second testis from the other side of
the bird.
Following Lentivirus injection to both testes, the male was given 1-2 weeks of
recovery.
In other experiments, the procedure is repeated on 1-26 week-old roosters.
After recovery, the male (considered as GO) is put together with females to
mate.
Eggs are hatched for scanning transgenic offspring (G1) having *ZZ.
In an additional experiment a transposase system is used for delivering the
site-
mutagenesis system to the bird testicles. In this case the injected liquid
contains a
transfection reagent (such as lipofectamine), plasmid for expression of
transposase and
plasmid for desired genomic integration (i.e. disruption of the Z-gametolog).
In additional experiment, injection of primordial germ cells into male testes
is
performed. In this case the injected liquid contains modified PGCs (ZZ*). The
PGCs are
injected into a native male or to a male that was sterilized prior to the
procedure (by e.g.
CA 03217797 2023-10-23
WO 2022/224244
PCT/IL2022/050389
34
utilizing radiation (UV/Gamma) or specific chemicals (like Busulfan)). Once
sterilized,
the surgical procedure to implant the new PGCs is performed as described
above.
The foregoing description of the specific embodiments will so fully reveal the
general nature of the invention that others can, by applying current
knowledge, readily
modify and/or adapt for various applications such specific embodiments without
undue
experimentation and without departing from the generic concept, and,
therefore, such
adaptations and modifications should and are intended to be comprehended
within the
meaning and range of equivalents of the disclosed embodiments. It is to be
understood
that the phraseology or terminology employed herein is for the purpose of
description and
not of limitation. The means, materials, and steps for carrying out various
disclosed
functions may take a variety of alternative forms without departing from the
invention.
