Note : Les descriptions sont présentées dans la langue officielle dans laquelle elles ont été soumises.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Method for generating new gene in organism and use thereof
Technical Field
The present invention relates to the technical fields of genetic engineering
and bioinformatics,
and in particular, a method for creating a new gene in an organism in the
absence of an artificial
DNA template, and use thereof
Background Art
Generally speaking, a complete gene expression cassette in an organism
comprises a
promoter, 5' untranslated region (5 UTR), coding region (CDS) or non-coding
RNA region
(Non-coding RNA), 3' untranslated region (3'UTR), a terminator and many other
elements.
Non-coding RNA can perform its biological functions at the RNA level,
including rRNA, tRNA,
snRNA, snoRNA and microRNA. The CDS region contains exons and introns. After
the
transcribed RNA is translated into a protein, the amino acids of different
segments usually form
different domains. The specific domains determine the intracellular
localization and function of
the protein (such as nuclear localization signal, chloroplast leading peptide,
mitochondrial leading
peptide, DNA binding domain, transcription activation domain, enzyme catalytic
center, etc.).
For non-coding RNA, different segments also have different functions. When one
or several
elements of a gene change, a new gene will be formed, which may have new
functions. For
example, an inversion event of a 1.7Mb chromosome fragment occurred upstream
of the PpOFP1
gene of flat peach may result in a new promoter, which will significantly
increase the expression
of PpOFP1 in peach fruit with flat shape in the S2 stage of fruit development
as compared to that
in peach fruit with round shape, thereby inhibit the vertical development of
peach fruit and result
in the flat shape phenotype in flat peach (Zhou et al. 2018. A 1.7-Mb
chromosomal inversion
downstream of a PpOFP1 gene is responsible for flat fruit shape in peach.
Plant Biotechnol. J.
DOT: 10.1111/pbi.13455).
The natural generation of new genes in biological genomes requires a long
evolutionary
process. According to the research work, the molecular mechanisms for the
generation of new
genes include exon rearrangement, gene duplication, retrotransposition, and
integration of
movable elements (transposons, retrotransposons), horizontal gene transfer,
gene fusion splitting,
de novo origination, and many other mechanisms, and new genes may be retained
in species
under the action of natural selection through the derivation and functional
evolution. The
relatively young new genes that have been identified in fruit flies,
Arabidopsis thaliana, and
primates have a history of hundreds of thousands to millions of years
according to a calculation
(Long et al. 2012. The origin and evolution of new genes. Methods Mol Biol.
DOT:
10.1007/978-1-61779-585-57). Therefore, in the field of genetic engineering
and biological
breeding, taking plants as an example, if it is desired to introduce a new
gene into a plant (even if
all the gene elements of the new gene are derived from different genes of the
species itself), it can
only be achieved through the transgenic technology. That is, the elements from
different genes
are assembled together in vitro to form a new gene, which is then transferred
into the plant
through transgenic technology. It is characterized in that the assembly of new
gene needs to be
carried out in vitro, resulting in transgenic crops.
The gene editing tools represented by CRISPR/Cas9 and the like can efficiently
and
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
accurately generate double-strand breaks (DSB) at specific sites in the genome
of an organism,
and then the double-strand breaks (DSB) are repaired through the cell's own
non-homologous
end repair or homologous recombination mechanisms, thereby generating site-
specific mutations.
The current applications of the gene editing technique mainly focus on the
editing of the internal
elements of a single gene, mostly the editing of a CDS exon region. Editing an
exon usually
results in frameshift mutations in the gene, leading to the function loss of
the gene. For this
reason, the gene editing tools such as CRISPR/Cas9 are also known as gene
knockout (i.e., gene
destruction) tools. In addition to the CDS region, the promoter, 5'UTR and
other regions can also
be knocked out to affect the expression level of a gene. These methods all
mutate existing genes
without generating new genes, so it is difficult to meet some needs in
production. For example,
for most genes, the existing gene editing technology is difficult to achieve
the up-regulation of
gene expression, and it is also difficult to change the subcellular
localization of a protein or
change the functional domain of protein. There are also reports in the
literature of inserting a
promoter or enhancer sequence upstream of an existing gene to change the
expression pattern of
the gene so as to produce new traits (Lu et al. 2020. Targeted, efficient
sequence insertion and
replacement in rice. Nat Biotechnol. DOI: 10.1038/s41587-020-0581-5), but this
method requires
the provision of foreign DNA templates, so strict regulatory procedures
similar to genetically
modified crops apply, and the application is restricted.
Summary of the Invention
In order to solve the above-mentioned problems in the prior art, the present
invention
provides a method for creating a new gene in an organism in the absence of an
artificial DNA
template by simultaneously generating two or more DNA double-strand breaks at
a combination
of specific sites in the organism's genome, and use thereof.
In one aspect, the present invention provides a method for creating a new gene
in an
organism, comprising the following steps:
simultaneously generating DNA breaks at two or more different specific sites
in the
organism's genome, wherein the specific sites are genomic sites capable of
separating different
genetic elements or different protein domains, ligating the DNA breaks to each
other by a
non-homologous end joining (NHEJ) or homologous repair, generating a new
combination of the
different gene elements or different protein domains that is different from
the original genome
sequence, thereby creating the new gene.
In another aspect, the present invention provides a method for in vivo
creation of new genes
that can be stably inherited in an organism, characterized by comprising the
following steps:
(1) simultaneously generating double-stranded DNA breaks at two or more
different
specific sites in the organism's genome, wherein the specific sites are
capable of separating
different gene elements or different protein domains, and the DNA breaks are
then ligated to each
other by a non-homologous end joining (NEIEJ) or homologous repair, generating
a new
combination or assemble of the different gene elements or different protein
domains derived
from the original genomic sequence, thereby the new gene is generated;
in a specific embodiment, it also includes (2) designing primer pairs that can
specifically
detect the above-mentioned new combination or assemble, then cells or tissues
containing
the new genes can be screened out by PCR test, and the characteristic
sequences of new
2
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
combinations of gene elements can be determined by sequencing; and
(3) cultivating the above-screened cells or tissues to obtain TO generation
organisms,
and perform PCR tests and sequencing on the organisms for two consecutive
generations
including the TO generation and its bred Ti or at least three consecutive
generations to
select the organisms containing the above-mentioned characteristic sequence of
new
combination of gene elements, namely, a new gene that can be stably inherited
has been
created in the organism;
optionally, it also includes (4) testing the biological traits or phenotypes
related to the
function of the new gene, to determine the genotype that can bring beneficial
traits to the
organism, and to obtain a new functional gene that can be stably inherited.
In a specific embodiment, in the step (1), DNA breaks are simultaneously
generated at
two different specific sites in the genome of the organism, wherein one site
is the genomic
locus between the promoter region and the coding region of a gene, meanwhile,
the other
site is between the promoter region and the coding region of another gene with
different
expression patterns, resulting in a new combination of the promoter of one
gene and the
coding region of the other gene that has a different expression pattern;
preferably, a
combination of the strong promoter and the gene of interest is eventually
produced.
In another specific embodiment, in the step (1), DNA breaks are simultaneously
generated at three different specific sites in the genome of the organism, the
three specific
sites include two genomic sites whose combination capable of cutting off the
promoter
region of a highly expressed gene and the third genomic site between the
coding region and
the promoter region of the gene of interest that has a different expression
pattern; or a
genomic site between the promoter region and the coding region of a highly
expressed gene
and another two genomic sites whose combination capable of cutting off the
coding region
fragment of the gene of interest that has a different expression pattern; then
through gene
editing at the above-mentioned sites, translocation editing events can be
generated, in which
the strong promoter fragment that is inserted upstream of the coding region of
the gene of
interest, or the coding region fragment of the gene of interest is inserted
the downstream of
the promoter of another highly expressed gene, finally, the combination of the
promoter of
one gene and the coding region of the other gene of interest with different
expression
patterns is generated.
In a specific embodiment, the "two or more different specific sites" may be
located on the
same chromosome or on different chromosomes. When they locate on the same
chromosome, the
chromosome fragment resulting from the DNA breaks simultaneously occurring at
two specific
sites may be deleted, inversed or replicating doubled after repair; when they
locate on different
chromosomes, the DNA breaks generated at two specific sites may be ligated to
each other after
repair to produce a crossover event of the chromosome arms. These events can
be identified and
screened by PCR sequencing with specifically designed primers.
In a specific embodiment, the "two or more different specific sites" may be
specific sites on
3
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
at least two different genes, or may be at least two different specific sites
on the same gene.
In a specific embodiment, the transcription directions of the "at least two
different genes"
may be the same or different (opposite or toward each other).
The "gene elements" comprise a promoter, a 5' untranslated region (5'UTR), a
coding region
(CDS) or non-coding RNA region (Non-coding RNA), a 3' untranslated region
(3'UTR) and a
terminator of the gene.
In a specific embodiment, the combination of different gene elements refers to
a
combination of the promoter of one of the two genes with different expression
patterns and the
CDS or non-coding RNA region of the other gene.
In another specific embodiment, the combination of different gene elements
refers to a
combination of a region from the promoter to the 5'UTR of one of two genes
with different
expression patterns and the CDS or non-coding RNA region of the other gene
In a specific embodiment, the "different expression patterns" refer to
different levels of gene
expression
In another specific embodiment, the "different expression patterns" refer to
different
tissue-specific of gene expression.
In another specific embodiment, the "different expression patterns" refer to
different
developmental stage-specificities of gene expression.
In another specific embodiment, the combination of different gene elements is
a
combination of adjacent gene elements within the same gene.
The "protein domains" refer to a DNA fragment corresponding to a specific
functional
domain of a protein; it includes but is not limited to nuclear localization
signal, chloroplast
leading peptide, mitochondrial leading peptide, phosphorylation site,
methylation site,
transmembrane domain, DNA binding domain, transcription activation domain,
receptor
activation domain, enzyme catalytic center, etc.
In a specific embodiment, the combination of different protein domains refers
to a
combination of a localization signal region of one of two protein coding genes
with different
subcellular localizations and a mature protein coding region of the other
gene.
In a specific embodiment, the "different subcellular locations" include, but
are not limited to,
a nuclear location, a cytoplasmic location, a cell membrane location, a
chloroplast location, a
mitochondrial location, or an endoplasmic reticulum membrane location.
In another specific embodiment, the combination of different protein domains
refers to a
combination of two protein domains with different biological functions.
In a specific embodiment, the "different biological functions" include, but
are not limited to,
recognition of specific DNA or RNA conserved sequence, activation of gene
expression, binding
to protein ligand, binding to small molecule signal, ion binding, or specific
enzymatic reaction.
In another specific embodiment, the combination of different protein domains
refers to a
combination of adjacent protein domains in the same gene.
In another specific embodiment, the combination of gene elements and protein
domains
refers to a combination of protein domains and adjacent promoters, 5'UTR,
3'UTR or terminators
in the same gene
Specifically, the exchange of promoters of different genes can be achieved by
inversion of
4
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
chromosome fragments: when two genes located on the same chromosome have
different
directions, DNA breaks can be generated at specific sites between the promoter
and CDS of each
of the two genes, the region between the breaks can be inverted, thereby the
promoters of these
two genes would be exchanged, and two new genes would be generated at both
ends of the
inverted chromosome segment The different directions of the two genes may be
that their 5' ends
are internal, namely both genes are in opposite directions, or their 5' ends
are external, namely
both genes are towards each other. Where the genes are in opposite directions,
the promoters of
the genes would be inverted, as shown in Scheme 1 of Figure 2; where the genes
are towards
each other, the CDS regions of the genes would be inverted, as shown in Scheme
1 of Figure 4.
The inverted region can be as short as less than 10kb in length, with no other
genes therebetween;
or the inverted region can be very long, reaching up to 300kb-3Mb,
andcontaining hundreds of
genes.
It is also possible to create a new gene by doubling a chromosome fragment:
where two
genes located on the same chromosome are in the same direction, DNA breaks can
be generated
in specific sites between the promoter and CDS of each of the two genes, the
region between the
breaks can be doubled by duplication, and a new gene would be created at the
junction of the
doubled segment by fusing the promoter of the downstream gene to the CDS
region of the
upstream gene, as shown in Figure 1 Scheme 1 and Figure 3. The length of the
doubled region
can be in the range of 500bp to 5Mb, which can be very short with no other
genes therebetween,
or can be very long to contain hundreds of genes. Although this method will
induce point
mutations in the regions between the promoters and the CDS region of the
original two genes,
such small-scale point mutations generally have little effect on the
properties of the gene
expression, while the new genes created by promoter replacement will have new
properties of
expression. Or alternatively, DNA breaks can be generated at specific
positions on both sides of a
protein domain of a same gene, and the region between the breaks can be
doubled by duplication,
thereby creating a new gene with doubled specific functional domains.
The present invention also provides a new gene obtainable by the present
method.
Compared with the original genes, the new gene may have different promoter and
therefore
have expression characteristics in terms of tissues or intensities or
developmental stages, or have
new amino acid sequences.
The "new amino acid sequence" can either be a fusion of the whole or partial
coding regions
of two or more gene, or a doubling of a partial protein coding region of the
same gene.
The present invention further provides use of the gene in conferring or
improving a
resistance/tolerance trait or growth advantage trait in an organism.
In a specific embodiment, in the combination of different gene elements, one
element is a
plant endogenous strong promoter or the region from a strong promoter to
5'UTR, and the other
is the HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose
synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein
phosphatase or lycopene
cyclase gene coding region of the same plant.
In a specific embodiment, the present invention also provides a new gene
obtainable by the
present method, the level of the new gene expression is up-regulated relative
to the plant
endogenous wild-type HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST,
SPS,
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein
phosphatase or
lycopene cyclasegenes gene.
In a specific embodiment, the present invention also provides use of the new
gene in the
improvement of the resistance or tolerance to a corresponding inhibition of
HPPD, inhibition of
EPSPS, inhibition of PPO, inhibition of ALS, inhibition of ACCase, inhibition
of GS,
inhibition of PDS, inhibition of DHPS, inhibition of DXPS, inhibition of HST,
inhibition of
SPS, inhibition of cellulose synthesis, inhibition of VLCFAS, inhibition of
fatty acid
thioesterase, inhibition of serine threonine protein phosphatase or inhibition
of lycopene
cyclase herbicide in a plant cell, a plant tissue, a plant part or a plant.
In another specific embodiment, in the combination of different gene elements,
one element
is an endogenous strong promoter or the region from a strong promoter to 5'UTR
of the organism,
and the other is a gene coding region of any one of the P450 family in the
same organism.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the
corresponding endogenous wild-type P450 gene of the organism.
In another specific embodiment, the present invention also provides use of the
new gene in
enhancing biological detoxification capability, stress tolerance or secondary
metabolic
ability.
In another specific embodiment, the said P450 gene is rice OsCYP81A gene or
maize
ZmCYP81A9 gene.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the rice
endogenous OsCYP81A6 gene or corn endogenous ZmCYP81A9 gene, respectively.
In another specific embodiment, the present invention also provides use of the
new gene in
the improvement of the resistance or tolerance of rice or corn to a herbicide.
In another specific embodiment, in the combination of different gene elements,
one element
is a maize endogenous strong promoter or the region from a strong promoter to
5'UTR, and the
other is the coding region of maize gene ZMM28(Zm00001d022088), ZmKNR6 or
ZmBAM1d
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the plant
endogenous wild-type ZM1V128 gene, ZmKNR6 gene or ZmBAM1d gene, respectively.
In another specific embodiment, the present invention also provides use of the
new gene in
the improvement of maize yield.
In another specific embodiment, in the combination of different gene elements,
one element
is a rice endogenous strong promoter or the region from a strong promoter to
5'UTR, and the
other is the coding region of rice gene COLD1 or OsCPK24.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the rice
endogenous wild-type COLD1 gene or OsCPK24, respectively.
In another specific embodiment, the present invention also provides use of the
new gene in
the improvement of cold tolerance in rice.
In another specific embodiment, in the combination of different gene elements,
one element
6
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
is an endogenous strong promoter or the region from a strong promoter to 5'UTR
of the organism,
and the other is a gene coding region of any one of the ATP-binding cassette
(ABC) transporter
family in the same organism.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method,the level of the new gene expression is up-regulated
relative to the
corresponding endogenous wild-type ATP-binding cassette (ABC) transporter gene
of the
organism.
In another specific embodiment, the present invention also provides use of the
new gene in
enhancing biological detoxification capability or stress tolerance
In another specific embodiment, in the combination of different gene elements,
one element
is a plant endogenous strong promoter or the region from a strong promoter to
5'UTR of the plant,
and the other is a gene coding region of any one of the NAC transcription
factor family in the
same plant
In another specific embodiment, the said NAC transcription factor family gene
is
OsNAC045, OsNAC67, ZmSNAC1, OsNAC006, OsNAC42, OsSNAC1 or OsSNAC2.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the
corresponding plant endogenous wild-type NAC transcription factor family gene.
In another specific embodiment, the present invention also provides use of the
new gene in
enhancing plant stress tolerance or plant yield
In another specific embodiment, in the combination of different gene elements,
one element
is a plant endogenous strong promoter or the region from a strong promoter to
5'UTR, and the
other is the gene coding region of any one of MYB, MADS, DREB and bZIP
transcription factor
family in the same plant.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the
corresponding plant endogenous wild-type MYB transcription factor gene, MADS
transcription
factor family gene, DREB transcription factor family gene coding region or
bZIP transcription
factor family gene, respectively.
In another specific embodiment, the present invention also provides the use of
new gene in
enhancing plant stress tolerance or regulating plant growth and development.
In another specific embodiment, in the combination of different gene elements,
one element
is the promoter of any one of overexpression or tissue-specific expression
rice genes listed in
Table A, and the other is the protein coding region or the non-coding RNA
region of another gene
that is different from the selected promoter corresponding to the rice gene
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the expression pattern of the new gene is changed
relative to the selected
protein coding region or the non-coding RNA region of the rice endogenous
gene.
In another specific embodiment, the present invention also provides the use of
new gene in
regulating the growth and development of rice.
7
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
In another specific embodiment, in the combination of different gene elements,
one element
is a protein coding region or non-coding RNA region selected from any one of
the biological
functional genes listed in Table B to K, and the other is the promoter region
of another gene that
is different from the selected functional gene of the biological genome
corresponding to the
selected gene.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the expression pattern of the new gene is changed
relative to the selected
functional gene.
In another specific embodiment, the present invention also provides use of the
new gene in
regulating the growth and development of organism.
In another specific embodiment, in the combination of different gene elements,
one element
is an endogenous strong promoter or the region from a strong promoter to 5'UTR
of the
organism, and the other is a gene coding region of any one of the GST
(glutathione-s-transferases)
family in the same organism.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the
corresponding endogenous GST (glutathione-s-transferases) family gene of the
organism.
In another specific embodiment, the present invention also provides use of the
new
gene in enhancing biological detoxification capability or stress tolerance.
In another specific embodiment, the said GST family gene is wheat GST Cla47
(AY064480.1) gene, wheat GST 19E50 (AY064481.1), wheat GST28E45 (AY479764.1),
maize
ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV,
maize
GST5 or maize GST7 gene.
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the
endogenous wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1),
wheat
GST28E45 (AY479764.1), maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI,
maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene, respectively.
In another specific embodiment, the present invention also provides use of the
new gene in
the improvement of the resistance or tolerance of wheat or maize to a
herbicide.
In another specific embodiment, in the combination of different gene elements,
one element
is a rice endogenous strong promoter or the region from a strong promoter to
5'UTR of the
organism, and the other is the coding region of any one of gene protein in
rice GIF1
(0s04g0413500), NOG1 (0s01g075220), LAIR (0s02g0154100), OSA1 (0s03 g0689300),
OsNRT1.1A (0s08g0155400), OsNRT2.3B (0s01g0704100), OsRacl (0s01g0229400),
OsNRT2.1 (0s02g0112100), OsGIF1 (0s03g0733600), OsNAC9 (0s03g0815100),
CPB1/D11/GNS4 (0s04g0469800), miR1432 (0s04g0436100), OsNLP4 (0s09g0549450),
RAG2 (0s07g0214300), LRK1 (0s02g0154200), OsNHX1 (0s07t0666900), GW6
8
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
(0s06g0623700), WG7 (0s07g0669800), D11/0sBZR1 (0s04g0469800, 0s07g0580500),
OsAAP6 (0s07g0134000), OsLSK1 (0s01g0669100), IPA1 (0s08g0509600), SMG11
(0 sOlg0197100), CYP72A31 (0s01g0602200),
SNAC1 (0s03g0815100), ZBED
(0s01g0547200), OsSta2 (0s02g0655200), OsASR5 (0s11g0167800), OsCPK4
(0s02g03410),
OsDjA9 (0s06g0116800), EUI (0s05g0482400), JMJ705 (0s01g67970), WRKY45
(0s05t0322900), OsRSR1 (0s05g0121600), OsRLCK5 (0s01g0114100), APIP4
(0s01g0124200), OsPAL6 (0s04t0518400), OsPAL8 (0s11g0708900), TPS46
(0s08t0168000),
OsERF3 (0s01g58420) and OsYSL15 (0s02g0650300).
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the level of the new gene expression is up-regulated
relative to the
corresponding endogenous gene
In another specific embodiment, the present invention also provides use of the
new gene in
rice breeding.
In another specific embodiment, in the combination of different gene elements,
one element
is a fish endogenous strong promoter, and the other is a gene coding region of
GH1 (growth
hormone 1) in the selected fish.
In another specific embodiment, the present invention also provides a fish
endogenous high
expression GH1 gene obtainable by the method.
In another specific embodiment, the present invention also provides use of the
fish
endogenous high expression GH1 gene in fish breeding.
In another specific embodiment, in the combination of different protein
domains, one
element is a wheat endogenous protein chloroplast localization signal domain,
and the other is a
wheat mature protein coding region of cytoplasmic localization phosphoglucose
isomerase
(PGIc)
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the new gene locates the phosphoglucose isomerase gene
relative to the
coding cytoplasm and its mature protein is located in the chloroplast.
In another specific embodiment, the present invention also provides use of the
new gene in
the improvement of wheat yield.
In another specific embodiment, in the combination of different protein
domains, one
element is a rice protein chloroplast localization signal domain (CTP), and
the other is the
mature protein coding region of OsGL03, 0s0X03 or OsCATC
In another specific embodiment, the present invention also provides a new gene
obtainable
by the present method, the mature protein of the new gene is located in
chloroplast different from
OsGL03, 0s0X03 or OsCATC.
In another specific embodiment, the present invention also provides use of the
new gene in
improving the photosynthetic efficiency of rice.
In another specific embodiment, the present invention also provides a
chloroplast
9
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
localized protein OsCACT, the nucleotide encoding the protein has a sequence
selected
from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 28, or a portion thereof
or a
complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least
90%, at least 95%, at least 98% or at least 99% to any one of the sequences as
defined in (1);
or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
In another specific embodiment, the present invention also provides a
hloroplast
localized protein OsGL03, the nucleotide encoding the protein has a sequence
selected from
the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 29, or a portion thereof
or a
complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least
90%, at least 95%, at least 98% or at least 99% to any one of the sequences as
defined in (1);
or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
In another specific embodiment, the present invention also provides use of the
protein in
improving the photosynthetic efficiency of rice.
The present invention further provides a composition, which comprises:
(a) the promoter of one of two genes with different expression patterns and a
coding region
or non-coding RNA region of the other gene;
(b) a region between the promoter and the 5' untranslated region of one of two
genes with
different expression patterns and a coding region or non-coding RNA region of
the other gene;
(c) a localization signal region of one of the two protein coding genes with
different
subcellular localizations and a mature protein coding region of the other
gene;
(d) gene coding regions of protein domains with different biological functions
derived
from two genes with different functions;
wherein, the composition is non-naturally occurring, and is directly connected
on the
biological chromosome and can be inherited stably.
In a specific embodiment, the "different expression patterns" refers to
different levels of
gene expression.
In another specific embodiment, the "different expression patterns" refers to
different
tissue-specific of gene expression.
In another specific embodiment, the "different expression patterns" refers to
different
developmental stage-specificities of gene expression.
In a specific embodiment, the "different subcellular locations" include, but
are not limited to,
nuclear location, cytoplasmic location, cell membrane location, chloroplast
location,
mitochondrial location, or endoplasmic reticulum membrane location.
In a specific embodiment, the "different biological functions" include, but
are not limited to,
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
recognition of specific DNA or RNA conserved sequence, activation of gene
expression, binding
to protein ligand, binding to small molecule signal, ion binding, or specific
enzymatic reaction.
In a specific embodiment, the composition is fused in vivo.
The present invention also provides an editing method for regulating the gene
expression
level of a target endogenous gene in an organism, which is independent of an
exogenous DNA
donor fragment, which comprises the following steps:
simultaneously generating DNA breaks separately at selected sites between the
promoter and
the coding region of each of the target endogenous gene and an optional
endogenous inducible or
tissue-specific expression gene with a desired expression pattern; ligating
the DNA breaks to each
other by means of non-homologous end joining (NHEJ) or homologous repair,
thereby generating
an in vivo fusion of the coding region of the target endogenous gene and the
optional inducible or
tissue-specific expression promoter to form a new gene with expected
expression patterns.
In a specific embodiment, the target endogenous gene and the optional
endogenous
inducible or tissue-specific expression gene with a desired expression pattern
are located on
the same chromosome or on different chromosomes.
In a specific embodiment, the target endogenous gene is yeast ERG9 gene, the
endogenous
inducible expression gene is HXT1 gene, and the inducible expression promoter
is HXT1 in
response to glucose concentration.
The present invention also provides a yeast endogenous inducible ERG9 gene
obtainable by
the editing method.
The present invention also provides use of the yeast endogenous inducible ERG9
gene in
synthetic biology.
In particular, the present invention also provides an editing method of
increasing the
expression level of a target endogenous gene in an organism independent of an
exogenous DNA
donor fragment, which comprises the following steps: simultaneously generating
DNA breaks at
specific sites between the promoter and the CDS of each of the target
endogenous gene and an
optional endogenous highly-expressing gene; ligating the DNA breaks to each
other via
non-homologous end joining (NHEJ) or homologous repair to form an in vivo
fusion of the
coding region of the target endogenous gene and the optional strong endogenous
promoter,
thereby creating a new highly-expressing endogenous gene. This method is named
as an editing
method for knocking-up an endogenous gene.
In a specific embodiment, the target endogenous gene and the optional highly-
expressing
endogenous gene are located on the same chromosome.
In another specific embodiment, the target endogenous gene and the optional
highly-expressing endogenous gene are located on different chromosomes.
In another aspect, the present invention provides an editing method for
knocking up the
expression of an endogenous HPPD gene in a plant, comprising fusing the coding
region of the
HPPD gene with a strong plant endogenous promoter in vivo to form a new highly-
expressing
11
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
plant endogenous HPPD gene. That is, simultaneously generating DNA breaks at
specific sites
between the promoter and the CDS of each of the HPPD gene and an optional
endogenous
highly-expressing gene, ligating the DNA breaks to each other through an
intracellular repair
pathway to form an in vivo fusion of the coding region of the HPPD gene and
the optional
endogenous strong promoter, thereby creating a new highly-expressing HPPD
gene. In rice, the
strong promoter is preferably a promoter of the ubiquitin2 gene.
The present invention also provides a highly-expressing plant endogenous HPPD
gene
obtainable by the above editing method.
The present invention also provides a highly-expressing rice endogenous HPPD
gene which
has a sequence selected from the group consisting of:
(1) a nucleic acid sequence as shown in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID
NO: 18,
SEQ ID NO: 19 or SEQ ID NO: 27 or a portion thereof or a complementary
sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least 90%, at
least 95%, at least 98% or at least 99% to any one of the sequences as defined
in (1); or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
In another aspect, the present invention provides an editing method for
knocking up the
expression of an endogenous EPSPS gene in a plant, which comprises fusing the
coding region of
an EPSPS gene with a strong plant endogenous promoter in vivo to form a new
highly-expressing
plant endogenous EPSPS gene. That is, simultaneously generating DNA breaks at
specific sites
between the promoter and the CDS of each of the EPSPS gene and an optional
highly-expressing
endogenous gene, ligating the DNA breaks to each other through an
intracellular repair pathway
to form an in vivo fusion of the coding region of the EPSPS gene and the
optional strong
endogenous promoter, thereby creating a new highly-expressing EPSPS gene. In
rice, the strong
promoter is preferably a promoter of the TKT gene.
The present invention also provides a highly-expressing plant endogenous EPSPS
gene
obtainable by the above editing method.
The present invention also provides a highly-expressing rice endogenous EPSPS
gene which
has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID
NO: 13
or SEQ ID NO: 14 or a partial sequence thereof or a complementary sequence
thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least 90%, at
least 95%, at least 98% or at least 99% to any one of the sequences as defined
in (1); or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
In another aspect, the present invention provides an editing method for
knocking up the
expression of an endogenous PPO (PPDX) gene in a plant, which comprises fusing
the coding
region of the PPO gene with a strong plant endogenous promoter in vivo to form
a new
highly-expressing plant endogenous PPO gene. That is, simultaneously
generating DNA breaks at
specific sites between the promoter and the CDS of each of the PPO gene and an
optional
highly-expressing endogenous gene, ligating the DNA breaks to each other
through an
12
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
intracellular repair pathway to form an in vivo fusion of the coding region of
the PPO gene and
the optional strong endogenous promoter, thereby creating a new highly-
expressing PPO gene. In
rice, the strong promoter is preferably a promoter of the CP12 gene. In
Arabidopsis thaliana, the
strong promoter is preferably a promoter of the ubiquitin10 gene.
The present invention also provides a highly-expressing plant endogenous PPO
gene
obtainable by the above editing method.
The present invention also provides a highly-expressing rice endogenous PPO1
gene having
a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID
NO: 17,
SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ
ID
NO: 25, or SEQ ID NO: 26 or a partial sequence thereof or a complementary
sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least 90%, at
least 95%, at least 98% or at least 99% to any one of the sequences as defined
in (1); or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
The present invention also provides a highly-expressing rice endogenous PPO2
gene,
which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID
NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO:
37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO:41, SEQ ID NO: 42,
SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 or SEQ ID NO: 47,
or a
portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least
90%, at least 95%, at least 98% or at least 99% to any one of the sequences as
defined in (1);
or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
The present invention also provides a highly-expressing maize endogenous PPO2
gene,
which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 48 or SEQ ID NO: 49, or a
portion
thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least 90%, at
least 95%, at least 98% or at least 99% to any one of the sequences as defined
in (1); or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
The present invention also provides a highly-expressing wheat endogenous PPO2
gene,
which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID
NO:
52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO: 56, or a portion
thereof or
a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least 90%, at
13
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
least 95%, at least 98% or at least 99% to any one of the sequences as defined
in (1); or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
The present invention also provides a highly-expressing oilseed rape
endogenous PPO2 gene,
which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID
NO: 59,
SEQ ID NO: 60 or SEQ ID NO: 61, or a portion thereof or a complementary
sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least 90%, at
least 95%, at least 98% or at least 99% to any one of the sequences as defined
in (1); or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
The present invention also provides use of the gene in the improvement of the
resistance or
tolerance to a corresponding inhibitory herbicide in a plant cell, a plant
tissue, a plant part or a
plant.
The present invention also provides a plant or a progeny derived therefrom
regenerated from
the plant cell which comprises the gene.
The present invention also provides a method for producing a plant with an
increased
resistance or tolerance to an herbicide, which comprises regenerating the
plant cell which
comprises the gene into a plant or a progeny derived therefrom.
In a specific embodiment, the plant with increased herbicide resistance or
tolerance is a
non-transgenic line obtainable by crossing a plant regenerated from the plant
host cell of the
invention with a wild-type plant to remove the exogenous transgenic component
through genetic
segregation.
The present invention also provides a herbicide-resistant rice, which
comprises one or a
combination of two or more of the rice new gene, highly-expressing rice
endogenous HPPD gene,
highly-expressing rice endogenous EPSPS gene, highly-expressing rice
endogenous PPO1 gene,
and highly-expressing rice endogenous PPO2 gene.
In a specific embodiment, the herbicide-resistant rice is non-transgenic.
The present invention also provides a maize, wheat or oilseed rape resistant
to a herbicide,
which comprises one or a combination of two or more of the maize new gene, the
wheat or maize
new gene, the highly-expressing maize PPO2 gene, the highly-expressing wheat
PPO2 gene, and
the highly-expressing oilseed rape PPO2 gene.
In a specific embodiment,the maize, wheat or oilseed rape is non-transgenic.
The present invention also provides a method for controlling a weed in a
cultivation site of a
plant, wherein the plant is selected from the group consisting of the plant, a
plant prepared by the
method, the rice, or the maize, wheat or oilseed rape, wherein the method
comprises applying to
the cultivation site one or more corresponding inhibitory herbicides in an
amount for effectively
controlling the weed.
The present invention also provides an editing method for knocking up the
expression of
an endogenous WAK gene in a plant, characterized in that it comprises fusing
the coding
region of the WAK gene with a strong endogenous promoter of a plant in vivo to
form a
new highly-expressing plant endogenous WAK gene. That is, simultaneously
generating DNA
14
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
breaks respectively in selected specific sites between the promoter and the
coding region of each
of the WAK gene and an optional endogenous highly-expressing gene, ligating
the DNA breaks
to each other through an intracellular repair pathway, generating in vivo a
fusion of the coding
region of the WAK gene and the optional strong endogenous promoter to form a
new
highly-expressing WAK gene.
The present invention also provides a highly-expressing plant endogenous WAK
gene
obtainable by the editing method.
The present invention also provides a highly-expressing rice WAK gene, which
has a
sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID
NO: 64,
SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67 or SEQ ID NO: 68, or a portion
thereof or a
complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least 90%, at
least 95%, at least 98% or at least 99% to any one of the sequences as defined
in (1); or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
The present invention also provides an editing method for knocking up the
expression of
an endogenous CNGC gene in a plant, characterized in that it comprises fusing
the coding
region of the CNGC gene with a strong endogenous promoter of a plant in vivo
to form a
new highly-expressing plant endogenous CNGC gene. That is, simultaneously
generating
DNA breaks respectively in selected specific sites between the promoter and
the coding region of
each of the CNGC gene and an optional endogenous highly-expressing gene,
ligating the DNA
breaks to each other through an intracellular repair pathway, generating in
vivo a fusion of the
coding region of the CNGC gene and the optional strong endogenous promoter to
form a new
highly-expressing CNGC gene.
The present invention also provides a highly-expressing plant endogenous CNGC
gene
obtainable by the editing method.
The present invention also provides a highly-expressing rice CNGC gene, which
has a
sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown inSEQ ID NO: 69, SEQ ID NO: 70, SEQ ID
NO:
71 or SEQ ID NO: 72, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%,
at least
90%, at least 95%, at least 98% or at least 99% to any one of the sequences as
defined in (1);
or
(3) a nucleic acid sequence capable of hybridizing to the sequence as shown in
(1) or (2)
under a stringent condition.
The present invention also provides use of the gene in conferring or improving
a resistance
to rice blast in rice.
The present invention also provides a rice resistant to rice blast, which
comprises one or a
combination of two or more of the highly-expressing rice WAK gene, and the
highly-expressing
rice CNGC gene.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Preferably the rice is non-transgenic.
The present invention also provides an editing method for knocking up the
expression of an
endogenous GH1 gene in a fish, characterized in that it comprises fusing the
coding region of
the GH1 gene with a strong endogenous promoter of a fish in vivo to form a new
highly-expressing fish endogenous GH1 gene. That is, simultaneously generating
DNA breaks
respectively in selected specific sites between the promoter and the coding
region of each of the
GH1 gene and an optional endogenous highly-expressing gene, ligating the DNA
breaks to each
other through an intracellular repair pathway, generating in vivo a fusion of
the coding region of
the GHlgene and the optional strong endogenous promoter to form a new highly-
expressing GH1
gene; the strong promoter is preferably the corresponding fish ColIAla (
Collagen type I alpha la)
gene promoter, RPS15A (ribosomal protein S15a) gene promoter, Actin promoter
or DDX5
[DEAD (Asp-Glu-Ala-Asp) box helicase 5] gene promoter.
The present invention also provides a highly-expressing fish endogenous GH1
gene
obtainable by the editing method.
The present invention also provides use of the highly-expressing fish
endogenous GH1
gene in fish breeding.
The present invention also providesan editing method for knocking up the
expression of an
endogenous IGF2(Insulin-like growth factor 2) gene in a pig, characterized in
that it
comprises fusing the coding region of the IGF2 gene with a strong endogenous
promoter of a
pig in vivo to form a new highly-expressing pig endogenous IGF2 gene. That is,
simultaneously generating DNA breaks respectively in selected specific sites
between the
promoter and the coding region of each of the IGF2 gene and an optional
endogenous
highly-expressing gene, ligating the DNA breaks to each other through an
intracellular repair
pathway, generating in vivo a fusion of the coding region of the IGF2 gene and
the optional
strong endogenous promoter to form a new highly-expressing IGF2 gene; the
strong promoter is
preferably one of the pig TNNI2 and TNNT3 gene promoter.
The present invention also provides a highly-expressing pig endogenous IGF2
gene
obtainable by the editing method.
The present invention also provides use of the highly-expressing pig
endogenous IGF2
gene in pig breeding
The present invention also provides an editing method for knocking up the
expression
of an endogenous IGF1 (Insulin-like growth factor 1) gene in a chicken embryo
fibroblast,
characterized in that it comprises fusing the coding region of the IGF1 gene
with a strong
endogenous promoter of a chicken in vivo to form a new highly-expressing
chicken
endogenous IGF1 gene That is, simultaneously generating DNA breaks
respectively in
selected specific sites between the promoter and the coding region of each of
the IGF1 gene
and an optional endogenous highly-expressing gene, ligating the DNA breaks to
each other
through an intracellular repair pathway, generating in vivo a fusion of the
coding region of
the IGF1 gene and the optional strong endogenous promoter to form a new
highly-expressing IGF1 gene; the strong promoter is preferably chicken MYBPC1
(myosin
16
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
binding protein C) gene promoter.
The present invention also provides a highly-expressing chicken endogenous
IGF1 gene
obtainable by the editing method.
The present invention also provides use of the highly-expressing chicken
endogenous IGF1
gene in chicken breeding.
The present invention also provides an editing method for knocking up the
expression of an
endogenous EPO (Erythropoietin) gene in an animal cell, characterized in that
it comprises
fusing the coding region of the EPO gene with a strong endogenous promoter of
an animal in
vivo to form a new highly-expressingendogenous EPO gene. That is,
simultaneously
generating DNA breaks respectively in selected specific sites between the
promoter and the
coding region of each of the EPO gene and an optional endogenous highly-
expressing gene,
ligating the DNA breaks to each other through an intracellular repair pathway,
generating in vivo
a fusion of the coding region of the EPO gene and the optional strong
endogenous promoter to
form a new highly-expressing EPO gene.
The present invention also provides a highly-expressing animal endogenous EPO
gene
obtainable by the editing method.
The present invention also provides use of the highly-expressing animal
endogenous EPO
gene in animal breeding.
The present invention also provides an editing method for knocking up the
expression of an
endogenous p53 gene in an animal cell, characterized in that it comprises
fusing the coding
region of the p53 gene with a strong endogenous promoter of an animal in vivo
to form a new
highly-expressingendogenous p53 gene. That is, simultaneously generating DNA
breaks
respectively in selected specific sites between the promoter and the coding
region of each of the
p53 gene and an optional endogenous highly-expressing gene, ligating the DNA
breaks to each
other through an intracellular repair pathway, generating in vivo a fusion of
the coding region of
the p53 gene and the optional strong endogenous promoter to form a new highly-
expressing p53
gene
The present invention also provides a highly-expressing animal endogenous p53
gene
obtainable by the editing method.
The present invention also provides use of the highly-expressing animal
endogenous p53
gene in animal breeding or cancer prevention.
In a specific embodiment, the "DNA breaks" are produced by delivering a
nuclease with
targeting property into a cell of the organism to contact with the specific
sites of the genomic
DNA. There is no essential difference between this type of DNA breaks and the
DNA breaks
produced by traditional techniques (such as radiation or chemical
mutagenesis).
In a specific embodiment, the "nuclease with targeting property" is selected
from
Meganuclease, Zinc finger nuclease (ZFN), TALEN and the CRISPR/Cas system.
Among them, the CRISPR/Cas system can generate two or more DNA double-strand
breaks
at different sites in the genome through two or more leading RNAs targeting
different sequences;
by separately designing the ZFN protein or TALEN protein in two or more
specific site
17
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
sequences, the Zinc finger nuclease and TALEN systems can simultaneously
generate DNA
double-strand breaks at two or more sites. When two breaks are located on the
same chromosome,
repair results such as deletion, inversion and doubling may occur; and when
two breaks are
located on two different chromosomes, crossover of chromosomal arms may occur.
The deletion,
inversion, doubling and exchange of chromosome segments at two DNA breaks can
recombine
different gene elements or protein domains, thereby creating a new functional
gene.
In a specific embodiment, the said CRISPR/Cas system is Cas9 nuclease system
or
Cas12 nuclease system.
In a specific embodiment, the "nuclease with targeting property" exists in the
form of DNA.
In another specific embodiment, the "nuclease with targeting property" exists
in the form of
mRNA or protein, rather than the form of DNA.
In a specific embodiment, the method for delivering the nucleases with
targeting property
into the cell is selected from a group consisting of: 1) PEG-mediated cell
transfection; 2)
liposome-mediated cell transfection; 3) electric shock transformation; 4)
microinjection; 5) gene
gun bombardment; 6) Agrobacterium-mediated transformation; 7) viral vector-
mediated
transformation method; or 8) nanomagnetic bead mediated transformation method.
The present invention also provides a DNA containing the gene.
The present invention also provides a protein encoded by the gene, or
biologically active
fragment thereof.
The present invention also provides a recombinant expression vector, which
comprises the
gene and a promoter operably linked thereto.
The present invention also provides an expression cassette containing the
gene.
The present invention also provides a host cell, which comprises the
expression cassette.
The present invention further provides an organism regenerated from the host
cell.
In the research work of the inventors, it was found that in cells
simultaneously undergoing
dual-target or multi-target gene editing, a certain proportion of the ends of
DNA double-strand
breaks at different targets were spontaneously ligated to each other,
resulting in events of deletion,
inversion or duplication-doubling of the fragments between the targets on the
same chromosome,
and/or the exchange of chromosome fragments between targets on different
chromosomes. It has
been reported in the literature that this phenomenon commonly exists in plants
and animals
(Puchta et al. 2020. Changing local recombination patterns in Arabidopsis by
CRISPR/Cas
mediated chromosome engineering. Nat Commun. DOT: 10.1038/s41467-020- 18277-z;
Li et al.
2015. Efficient inversions and duplications of mammalian regulatory DNA
elements and gene
clusters by CRISPR/Cas9. J Mol Cell Biol. DOI: 10.1093/jmcb/mjv016).
The present inventors surprisingly discovered that, by inducing DNA double-
strand breaks
in a combination of gene editing targets near specific elements of a gene of
interest, causing
spontaneous repair ligation, directed combination of different gene elements
can be achieved at
the genome level without the need to provide a foreign DNA template, it is
possible to produce
therefrom a new functional gene. This strategy greatly accelerates the
creation of new genes and
has great potential in animal and plant breeding and gene function research.
Detailed description of invention
In the present invention, unless otherwise specified, the scientific and
technical terms used
18
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
herein have the meanings commonly understood by those skilled in the art. In
addition, protein
and nucleic acid chemistry, molecular biology, cell and tissue culture,
microbiology, immunology
related terms and laboratory procedures used herein are all terms and routine
procedures widely
used in the corresponding fields. For example, the standard recombinant DNA
and molecular
cloning techniques used in the present invention are well known to those
skilled in the art and are
fully described in the following documents: Sambrook, J., Fritsch, EF and
Maniatis, T.,
Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press:
Cold Spring
Harbor, 1989. For a better understanding of the present invention, definitions
and explanations of
related terms are provided below.
The term "genome" as used herein refers to all complements of genetic material
(genes and
non-coding sequences) present in each cell or virus or organelle of an
organism, and/or complete
genome inherited from a parent as a unit (haploid).
Table A lists some of the ubiquitously-expressed genes and tissue-specific
expressed
genes in rice. Generally, in production applications, a DNA sequence within 3
kb upstream
of the start codon of ubiquitously-expressed genes or tissue-specific genes is
used as the
promoter region and the 5' non-coding region, where the promoter region of
ubiquitously
expressed genes is used as a representative of strong promoters, and the
promoter region of
tissue-specifically expressed genes is used as a representative of tissue-
specific promoters.
It is known that ubiquitously-expressed genes and tissue-specific genes in
other species
similar to rice can be found in public databases such as NCBI
(https://www.ncbi.nlm.nih.gov), JGI (https://jgi.doe) .gov/).
Table A: The ubiquitously-expressed genes and tissue-specific expressed genes
in rice.
Ubiquitously-expresse
Annotation of gene functions
d genes
LOC_Os02g06640 ubiquitin family protein, putative, expressed
LOC_Os03g51600 tubulin/FtsZ domain containing protein, putative,
expressed
LOC_Os06g46770 ubiquitin family protein, putative, expressed
LOC_Os11g43900 translationally-controlled tumor protein, putative,
expressed
LOC_Os01g67860 fructose-bisphospate aldolase isozyme, putative,
expressed
LOC_0s07g26690 aquaporin protein, putative, expressed
LOC_0s03g27310 histone H3, putative, expressed
LOC_Os05g41060 ADP-ribosylation factor, putative, expressed
LOC_0s08g03290 glyceraldehyde-3-phosphate dehydrogenase, putative,
expressed
LOC_Os05g07700 ribosomal protein, putative, expressed
LOC 0s03g08010 elongation factor Tu, putative, expressed
LOC_Os02g48560 fatty acid desaturase, putative, expressed
LOC 0s01g05490
triosephosphate isomerase, cytosolic, putative, expressed
LOC 0s03g08020 elongation factor Tu, putative, expressed
LOC_Os10g33800 lactate/malate dehydrogenase, putative, expressed
LOC_Os06g04030 histone H3, putative, expressed
LOC_Os04g57220 ubiquitin-conjugating enzyme, putative, expressed
LOC_Os08g09250 glyoxalase family protein, putative, expressed
LOC_Os03g08050 elongation factor Tu, putative, expressed
LOC_Os08g02340 60S acidic ribosomal protein, putative, expressed
LOC_Os03g50885 actin, putative, expressed
19
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC_0s09g26420 AP2 domain containing protein, expressed
LOC_0s03g12670 expressed protein
LOC_0s05g49890 ras-related protein, putative, expressed
LOC_0s05g06770 40S ribosomal protein S27a, putative, expressed
LOC_Os10g08550 enolase, putative, expressed
LOC_Os04g53620 ubiquitin family protein, putative, expressed
LOC_Os05g39960 40S ribosomal protein S26, putative, expressed
LOC_Os02g01560 40S ribosomal protein S4, putative, expressed
LOC_Os08g03640 60S acidic ribosomal protein PO, putative, expressed
LOC_0s06g23440 eukaryotic translation initiation factor 1A, putative,
expressed
LOC_Os10g32920 ribosomal protein, putative, expressed
LOC_Os01g60410 ubiquitin-conjugating enzyme, putative, expressed
LOC_Os01g22490 40S ribosomal protein S27a, putative, expressed
LOC_Os03g13170 ubiquitin fusion protein, putative, expressed
Seed specificity highly
MSU Annotation
expressed genes
LOC 0s07g10580 PROLM26 - Prolamin precursor, expressed
LOC OsOlg55690 glutelin, putative, expressed
LOC_Os10g26060 glutelin, putative, expressed
LOC Os07g11330 RAL2 - Seed allergenic protein RA5/RA14/RA17 precursor,
_
expressed
LOC Os07g11510 RAL6 - Seed allergenic protein RA5/RA14/RA17 precursor,
_
expressed
LOC Os05g41970 SSA1 -
2S albumin seed storage family protein precursor,
_
expressed
LOC Os07g11380 RAL4 - Seed allergenic protein RA5/RA14/RA17 precursor,
_
expressed
LOC_0s07g10570 PROLM25 - Prolamin precursor, expressed
LOC_Os02g16820 glutelin, putative, expressed
LOC_0s02g25640 glutelin, putative, expressed
LOC_Os02g16830 glutelin, putative, expressed
LOC_Os02g15150 glutelin, putative, expressed
LOC_Os03g31360 glutelin, putative, expressed
LOC_Os02g15169 glutelin, putative, expressed
LOC_Os02g15178 glutelin, putative, expressed
LOC_Os06g31070 PROLM24 - Prolamin precursor, expressed
LOC_Os03g46100 cupin domain containing protein, expressed
LOC Os07g11410 RAL5 - Seed allergenic protein RA5/RA14/RA17 precursor,
_
expressed
LOC_Os08g03410 glutelin, putative, expressed
LOC_Os07g11920 PROLM22 - Prolamin precursor, expressed
LOC Os07g11360 RAL3 - Seed allergenic protein RA5/RA14/RA17 precursor,
_
expressed
LOC 0s03g57960 cupin domain containing protein, expressed
LOC Os 1 1g33000 SSA5 -2S
albumin seed storage family protein precursor,
_
expressed
LOC Os07g11650 LTPL164 - Protease inhibitor/seed storage/LTP family
protein
_
precursor, expressed
LOC Os 1 1g37270 AMBP1 - Antimicrobial peptide MBP-1 family protein
precursor,
_
expressed
LOC_Os07g11910 PROLM20 - Prolamin precursor, expressed
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC_Os12g16890 PROLM28 - Prolamin precursor, expressed
LOC_0s07g11900 PROLM19 - Prolamin precursor, putative, expressed
LOC_Os02g15090 glutelin, putative, expressed
LOC_0s08g08960 Cupin domain containing protein, expressed
LOC_Os10g35050 aquaporin protein, putative, expressed
LOC_0s04g46200 oleosin, putative, expressed
GASR6 - Gibberellin-regulated GASA/GAST/Snakin family
LOC_0s05g35690 protein
precursor, expressed
LOC Os07g11630 LTPL163 - Protease inhibitor/seed storage/LTP family
protein
_
precursor, expressed
LOC_Os05g26350 PROLM4 - Prolamin precursor, expressed
LOC_Os06g04200 starch synthase, putative, expressed
LOC_Os05g26770 PROLM18 - Prolamin precursor, expressed
LOC_Os05g26720 PROLM16 - Prolamin precursor, expressed
CAMK CAMK like .8 - CAMK includes calcium/calmodulin
LOC_OslOg39420 _
.
dependent protein kinases, expressed
LOC Os04g33150
desiccation-related protein PCC13-62 precursor, putative,
_
expressed
1,4-alpha-glucan-branching enzyme, chloroplast precursor,
LOC_Os06g51084 putative,
expressed
LOC_0s06g46284 glycosyl hydrolase, family 31, putative, expressed
Stamen specificity
Annotation of gene functions
highly expressed genes
LOC_Os10g40090 expansin precursor, putative, expressed
LOC_Os06g21410
arabinogalactan peptide 23 precursor, putative, expressed
LOC Os05g46530 invertase/pectin methyl esterase inhibitor family
protein, putative,
_
expressed
LOC Os04g32680 POEI20 - Pollen Ole e I allergen and extensin family
protein
_
precursor, expressed
LOC_Os01g27190 C2 domain containing protein, putative, expressed
LOC_Os06g17450 expressed protein
LOC_OsOlg69020
retrotransposon protein, putative, unclassified, expressed
LOC_Os10g32810 beta-amylase, putative, expressed
LOC_Os02g05670 expressed protein
LOC_Os07g15530 expressed protein
LOC_Os04g57280 expressed protein
LOC Os05g20570 invertase/pectin methyl esterase inhibitor family
protein, putative,
_
expressed
LOC_Os03g04770 beta-amylase, putative, expressed
LOC_Os05g40740 monocopper oxidase, putative, expressed
LOC_Os02g02450 transposon protein, putative, unclassified,
expressed
LOC_Os04g33710 expressed protein
LOC 0s10g35930 OsPLIM2c - LIM domain protein, putative actin-binding
protein
and transcription factor, expressed
LOC_Os06g03390 expressed protein
LOC_Os02g03520 THION25 - Plant thionin family protein precursor,
expressed
LOC_Os01g39970 protein kinase domain containing protein, putative,
expressed
LOC_Os12g42650 pollen preferential protein, putative, expressed
LOC_0s08g02880 CXXXC11 - Cysteine-rich protein with paired CXXXC motifs
21
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
precursor, expressed
LOC_0s10g17680 profilin domain containing protein, expressed
LOC_OsOlg21970 protein kinase, putative, expressed
LOC_Os05g13850 TsetseEP precursor, putative, expressed
LOC_Os04g57270 expressed protein
LOC Os02g26290 fasciclin-like arabinogalactan protein 8 precursor,
putative,
_
expressed
LOC Os07g13440 RALFL12 - Rapid ALkalinization Factor RALF family
protein
_
precursor, putative, expressed
LOC_Os10g17660 profilin domain containing protein, expressed
LOC_Os04g25160 pollen allergen, putative, expressed
LOC_Os05g13830 TsetseEP precursor, putative, expressed
LOC_Os04g26220 pollen allergen, putative, expressed
LOC_Os03g01610 expansin precursor, putative, expressed
LOC_Os03g01650 expansin precursor, putative, expressed
LOC_Os04g11130 DEF9 - Defensin and Defensin-like DEFL family,
expressed
LOC_Os06g44470 pollen allergen, putative, expressed
LOC_Os01g23880 expressed protein
LOC_Os08g12520 expressed protein
LOC_Os04g11195 gamma-thionin family domain containing protein,
expressed
Pistil specificity highly
Annotation of gene functions
expressed genes
LOC_Os05g33150 CHIT6 - Chitinase family protein precursor, expressed
LOC_Os07g38130 polygalacturonase inhibitor 1 precursor, putative,
expressed
LOC_Os11g44810 auxin-repressed protein, putative, expressed
LOC_Os09g37910 HMG1/2, putative, expressed
LOC_OsO1g42520 expressed protein
LOC_Os12g38000 60S ribosomal protein L8, putative, expressed
LOC_Os03g08500 AP2 domain containing protein, expressed
LOC_Os04g18090 histone H1, putative, expressed
LOC_Os06g04030 histone H3, putative, expressed
LOC_Os10g40730 expansin precursor, putative, expressed
LOC_Os07g48910
retrotransposon protein, putative, unclassified, expressed
LOC_Os03g22270 auxin-repressed protein, putative, expressed
Leaf specificity highly
Annotation of gene functions
expressed genes
LOC Os12g17600 ribulose bisphosphate carboxylase small chain,
chloroplast
_
precursor, putative, expressed
LOC_Os11g47970 AAA-type ATPase family protein, putative, expressed
LOC Os12g19381 ribulose bisphosphate carboxylase small chain,
chloroplast
_
precursor, putative, expressed
LOC_Os11g07020 fructose-bisphospate aldolase isozyme, putative,
expressed
LOC_OsOlg41710 chlorophyll A-B binding protein, putative, expressed
LOC_Os09g17740 chlorophyll A-B binding protein, putative, expressed
LOC_0s01g45274 carbonic anhydrase, chloroplast precursor, putative,
expressed
LOC_0s01g45914 expressed protein
LOC_Os06g01210 plastocyanin, chloroplast precursor, putative,
expressed
LOC Os08g10020 photosystem II 10 kDa polypeptide, chloroplast
precursor,
_
putative, expressed
LOC_Os03g39610 chlorophyll A-B binding protein, putative, expressed
LOC_OsOlg31690 oxygen-evolving enhancer protein 1, chloroplast
precursor,
22
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
putative, expressed
LOC_0s07g37240 chlorophyll A-B binding protein, putative, expressed
LOC_Os07g37550 chlorophyll A-B binding protein, putative, expressed
LOC_Os04g38600 glyceraldehyde-3-phosphate dehydrogenase, putative,
expressed
LOC_Os08g33820 chlorophyll A-B binding protein, putative, expressed
LOC_Os11g13890 chlorophyll A-B binding protein, putative, expressed
LOC_Os06g21590 chlorophyll A-B binding protein, putative, expressed
LOC_Os02g10390 chlorophyll A-B binding protein, putative, expressed
LOC_0s09g36680 ribonuclease T2 family domain containing protein,
expressed
LOC Os08g44680 photosystem I reaction center subunit II, chloroplast
precursor,
_
putative, expressed
LOC Os12g19470 ribulose
bisphosphate carboxylase small chain, chloroplast
_
precursor, putative, expressed
LOC Os07g05480 photosystem I reaction center subunit, chloroplast
precursor,
_
putative, expressed
LOC_Os07g04840 PsbP, putative, expressed
LOC Os08g01380 2Fe-2S iron-sulfur cluster binding domain containing
protein,
_
expressed
LOC_Os04g33830 membrane protein, putative, expressed
LOC_Os05g48630 expressed protein
LOC_Os01g52240 chlorophyll A-B binding protein, putative, expressed
LOC_Os01g10400 expressed protein
LOC_Os04g38410 chlorophyll A-B binding protein, putative, expressed
LOC 0512g23200 photosystem I reaction center subunit XI, chloroplast
precursor,
putative, expressed
LOC_Os07g38960 chlorophyll A-B binding protein, putative, expressed
LOC_Os01g19740 calvin cycle protein CP12, putative, expressed
LOC_Os01g64960 chlorophyll A-B binding protein, putative, expressed
LOC_Os03g03720 glyceraldehyde-3-phosphate dehydrogenase, putative,
expressed
LOC Os12g08770 photosystem I reaction center subunit N, chloroplast
precursor,
_
putative, expressed
LOC_0s02g02890 peptidyl-prolyl cis-trans isomerase, putative,
expressed
LOC_0s02g47020 phosphoribulokinase/Uridine kinase family protein,
expressed
LOC 0507g25430 photosystem I reaction center subunit IV A, chloroplast
precursor,
_
putative, expressed
LOC OsOlg17170 magnesium-protoporphyrin IX monomethyl ester
_
cyclase,chloroplast precursor, putative, expressed
LOC Os07g36080 oxygen evolving enhancer protein 3 domain containing
protein,
_
expressed
LOC_Os11g06720 abscisic stress-ripening, putative, expressed
LOC_Os03g03910 catalase domain containing protein, expressed
LOC Os03g52840 serine
hydroxymethyltransferase, mitochondrial precursor,
_
putative, expressed
LOC Os carboxyvinyl-carboxyphosphonate phosphorylmutase,
putative,
_
expressed
LOC_Os05g41640 phosphoglycerate kinase protein, putative, expressed
LOC 0509g30340 photosystem I reaction center subunit, chloroplast
precursor,
_
putative, expressed
LOC_Os04g21350 flowering promoting factor-like 1, putative,
expressed
LOC_Os04g16680 fructose-1,6-bisphosphatase, putative, expressed
LOC_Os07g47640 ultraviolet-B-repressible protein, putative,
expressed
23
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC_Os12g08730 thioredoxin, putative, expressed
LOC_0s12g33120 expressed protein
LOC Os03g56670 photosystem I reaction center subunit III, chloroplast
precursor,
_
putative, expressed
LOC_Os03g22370 ultraviolet-B-repressible protein, putative,
expressed
LOC_Os03g57220 hydroxyacid oxidase 1, putative, expressed
LOC OsOlg56680 photosystem II reaction center W protein, chloroplast
precursor,
_
putative, expressed
LOC_Os02g51080 FAD binding domain containing protein, expressed
LOC_Os07g32880 ATP synthase gamma chain, putative, expressed
LOC_Os03g17070 ATP synthase B chain, chloroplast precursor, putative,
expressed
LOC_Os01g13690 ligA, putative,
expressed
LOC Os04g52260 LTPL124 - Protease inhibitor/seed storage/LTP family
protein
_
precursor, expressed
LOC_Os12g43600 RNA recognition motif containing protein, expressed
LOC_Os01g51410 glycine dehydrogenase, putative, expressed
LOC_Os06g40940 glycine dehydrogenase, putative, expressed
LOC_Os06g15400 expressed protein
LOC Os12g02320 LTPL12 - Protease inhibitor/seed storage/LTP family
protein
_
precursor, expressed
LOC 0507g01760 aminotransferase, classes I and II, domain containing
protein,
_
expressed
LOC_Os08g39300 aminotransferase, putative, expressed
LOC_0s06g04270 transketolase, chloroplast precursor, putative,
expressed
LOC_Os08g04500 terpene synthase, putative, expressed
LOC_Os02g44630 aquaporin protein, putative, expressed
LOC Os 3-beta hydroxysteroid dehydrogenase/isomerase family
protein,
_
putative, expressed
LOC_Os06g51220 HMG1/2, putative, expressed
LOC_Os04g41560 B-box zinc finger family protein, putative,
expressed
LOC Os04g56400
glutamine synthetase, catalytic domain containing protein,
_
expressed
Table B lists some functional genes that have been reported to be related to
plant
metabolites. Up-regulated expression of these genes or specific expression in
fruits, leaves
and other organs may enhance the economic value of such plants.
Table B: Genes related to secondary metabolites of plants.
Plant Gene name Utility Reference
Zhang, K., et al. (2021). "CrUGT87A1, a UDP-sugar
Carex Flavonoids, glycosyltransferases (UGTs) gene from Carex
rigesce CrUGT87A1 Salt rigescens, increases salt tolerance by
accumulating
ns tolerance flavonoids for antioxidation in Arabidopsis
thaliana."
Plant Physiol Biochem 159: 28-36.
Solanu Li, Z., et al. (2021). "S1MYB14 promotes
flavonoids
accumulation and confers higher tolerance to
S1MYB14 Flavonoids
lycope 2,4,6-trichlorophenol in tomato." Plant Sci
303:
rsicum 110796.
Zhang, Y., et al. (2020). "Citrus PH4-Noemi regulatory
Citrus CsPH4 Proanthocy complex is involved in proanthocyanidin
biosynthesis
anidin via a positive feedback loop." J Exp Bot
71(4):
1306-1321.
24
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Epigallocat
Ginkg echin, Wu, Y.,
et al. (2020). "Overexpression of the GbF3'Hl
Gene Enhanced the Epigallocatechin, Gallocatechin,
GbF3'Hl Gallocatec
biloba and
Catechin Contents in Transgenic Populus." J Agric
hin, and
L. Food Chem 68(4): 998-1006.
Catechin
Wang, C., et al. (2020). "Comparative transcriptome
L.
analysis of two contrasting wolfberry genotypes during
rutheni LrMYB1
Flavonoids fruit development and ripening and characterization of
cum the LrMYB1 transcription factor that
regulates
flavonoid biosynthesis." BMC Genomics 21(1): 295.
Rao, M. J., et al. (2020). "CsCYT75B1, a Citrus
Flavonoids,
Citrus CYTOCHROME
P450 Gene, Is Involved in
Drought
sinensi CsCYT75B1
Accumulation of Antioxidant Flavonoids and Induces
tolerance
Drought Tolerance in Transgenic Arabidopsis."
Antioxidants (Basel) 9(2).
Premathilake, A. T., et al. (2020). "R2R3-MYB
Pear PpMYB17 Flavonoids transcription factor PpMYB17 positively
regulates
flavonoid biosynthesis in pear fruit." Planta 252(4): 59.
Rapha
Fan, L., et al. (2020). "A genome-wide association
nus Anthocyani
RsPAP2 study uncovers a critical role of the RsPAP2
gene in
sativus ns
red-skinned Raphanus sativus L." Hortic Res 7: 164.
L.
Zhai, R., et al. (2019). "The MYB transcription factor
Pear
PbMYB12b Flavonoids PbMYB12b positively regulates flavonol biosynthesis
in pear fruit." BMC Plant Biol 19(1): 85.
Shen, Y., et al. (2019). "RrMYB5- and
Flavonoids RrMYB10-regulated flavonoid biosynthesis
plays a
Rosa RrMYB5-
rugosa /RrMYB10 proanthocy pivotal role in feedback loop responding to
wounding
anidin and oxidation in Rosa rugosa." Plant
Biotechnol J
17(11): 2078-2095.
Cartha
Liu, X., et al. (2019). "Molecular cloning and
mus
CtCHI
Flavonoids functional characterization of chal cone isomerase from
tinctori
Carthamus tinctorius." AMB Express 9(1): 132.
us
Li, H., et al. (2019). "Overexpression of SmANS
Salvia Enhances Anthocyanin Accumulation and Alters
Anthocyani
miltior SmANS Phenolic Acids Content in Salvia
miltiorrhiza and
rhiza Salvia
miltiorrhiza Bge f. alba Plantlets." Int J Mol Sci
20(9).
Solanu Jian, W., et al. (2019). "S1MYB75, an MYB-type
Anthocyani
transcription factor, promotes anthocyanin
S1MYB75
lycope n
accumulation and enhances volatile aroma production
rsicum in tomato fruits." Hortic Res 6: 22.
Oryza Fang,
C., et al. (2019). "Lsil modulates the antioxidant
Stresstolera
sativa Lsil capacity of rice and protects against
ultraviolet-B
nce
L. radiation." Plant Sci 278: 96-106.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Fraxin Chen, X., et al. (2019). "Molecular cloning and
us functional analysis of 4-Coumarate:CoA ligase
Fm4CL-like
mands Lignin 4(4CL-
like 1)from Fraxinus mandshurica and its role in
1
churic abiotic
stress tolerance and cell wall synthesis." BMC
a Plant Biol 19(1): 231.
Cao, Y., et al. (2019). "PpMYB15 and PpMYBF1
PpMYB15/ Transcription Factors Are Involved in
Regulating
Peach Flavonoids
PpMYBF1
Flavonol Biosynthesis in Peach Fruit." J Agric Food
Chem 67(2): 644-652.
Cartha Ahmad,
N., et al. (2019). "Overexpression of a Novel
mus CtCYP82G2 Flavonoids Cytochrome P450 Promotes
Flavonoid Biosynthesis
tinctori 4 and Osmotic Stress Tolerance in Transgenic
us Arabidopsis." Genes (Basel) 10(10).
Anthocyani
Zhu, Y., et al. (2018). "Molecular Cloning and
Vitis ns,
VbDFR Functional Characterization of a
Dihydroflavonol
bellula Proanthocy
4-Reductase from Vitis bellula." Molecules 23(4).
anidins
Ginkg Zhang, W., et al. (2018). "Characterization and
o
functional analysis of a MYB gene (GbMYBFL) related
GbMYBFL Flavonoids
biloba to flavonoid accumulation in Ginkgo biloba." Genes
L. Genomics 40(1): 49-61.
Malus Wang,
N., et al. (2018). "Transcriptomic Analysis of
MdWRKY1 Red-Fleshed Apples Reveals the Novel Role of
domest Flavonoids
1 MdWRKY11 in Flavonoid and Anthocyanin
ica
Biosynthesis." J Agric Food Chem 66(27): 7076-7086.
Wang, L., et al. (2018). "The GhmiR157a-GhSPL10
Gossy
regulatory module controls initial cellular
pium
GhSPL10 Flavonoids
dedifferentiation and callus proliferation in cotton by
hirsutu
modulating ethylene-mediated flavonoid biosynthesis."
J Exp Bot 69(5): 1081-1093.
Salvia Wang,
B., et al. (2018). "Molecular Characterization
Phenolic and Overexpression of SmJMT Increases the
miltior SmJMT
acids
Production of Phenolic Acids in Salvia miltiorrhiza."
rhiza
Int J Mol Sci 19(12).
Sun, X., et al. (2018). "MdATG18a overexpression
Malus
Anthocyani improves tolerance to nitrogen deficiency and regulates
domest MdATG18a
anthocyanin accumulation through increased autophagy
ica
in transgenic apple." Plant Cell Environ 41(2): 469-480.
Citrus Liu,
X., et al. (2018). "Functional Characterization of a
sinensi UGTs
Flavonoids Flavonoid Glycosyltransferase in Sweet Orange (Citrus
sinensis)." Front Plant Sci 9: 166.
Arabid Li, Q., et al. (2018). "Ectopic expression of
opsis UGT76E11 Flavonoids glycosyltransferase UGT76E11
increases flavonoid
thalian
accumulation and enhances abiotic stress tolerance in
a Arabidopsis." Plant Biol (Stuttg) 20(1): 10-
19.
26
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Arabid Bhatia, C., et al. (2018). "Low Temperature-
Enhanced
opsis Flavonol Synthesis Requires Light-Associated
AtMYB12 Flavonoids
thalian Regulatory Components in Arabidopsis thaliana."
Plant
a Cell Physiol 59(10): 2099-2112.
Wang, F., et al. (2016). "The Antirrhinum AmDEL
Antirr
AmDEL Flavonoids gene enhances flavonoids accumulation and salt
and
hinum drought tolerance in transgenic Arabidopsis."
Planta
244(1): 59-73
Song, X., et al. (2016). "Molecular cloning and
Lyciu
Flavonoids identification of a flavanone 3-hydroxylase
gene from
LcF3H Drought Lycium chinense, and its overexpression enhances
chinen
tolerance drought stress in tobacco." Plant Physiol
Biochem 98:
se
89-100.
Sorghu Phenylprop Scully, E. D., et al. (2016) "Overexpression
of
anoid SbMyb60 impacts phenylpropanoid biosynthesis
and
SbMyb60
bicolor Drought alters secondary cell wall composition in
Sorghum
tolerance bicolor." Plant J 85(3): 378-395.
Malacarne, G., et al. (2016). "The grapevine
Vitis
VvibZIPC22 transcription factor is involved in the
vinifer VvibZIPC22 Flavonoids
regulation of flavonoid biosynthesis." J Exp Bot
a
67(11): 3509-3522.
Eupato
Lijuan, C., et al. (2015). "Chalcone synthase EaCHS1
rium
EaCHS1 Flavonoids from Eupatorium adenophorum functions in salt stress
adenop
tolerance in tobacco." Plant Cell Rep 34(5): 885-894.
horum
Bharti, P., et al. (2015). "AtROS1 overexpression
Arabid
provides evidence for epigenetic regulation of genes
opsis
AtRO S1 Flavonoids encoding enzymes of flavonoid biosynthesis and
thalian
antioxidant pathways during salt stress in transgenic
a
tobacco." J Exp Bot 66(19): 5959-5969.
Malus Anthocyani An, X. H., et al. (2015). "MdMYB9 and MdMYB11
are
MdMYB9/M n, involved in the regulation of the JA-
induced
domest
dMYB11 proanthocy biosynthesis of anthocyanin and proanthocyanidin
in
ica
anidin apples."
Plant Cell Physiol 56(4): 650-662.
Mitsunami, T., et al. (2014). "Overexpression of the
Arabid
PAP1 transcription factor reveals a complex regulation
opsis
PAP1 Flavonoids of flavonoid and phenylpropanoid metabolism
in
thalian
Nicotiana tab acum plants attacked by Spodoptera
a
litura." PLoS One 9(9): e108849.
Camell Mahaj an, M. and S. K. Yadav (2014).
"Overexpression
ia of a tea flavanone 3-hydroxylase gene confers
tolerance
CsF3H Flavonoids
sinensi to salt stress and Alternaria solani in
transgenic
tobacco." Plant Mol Biol 85(6): 551-573.
Arabid Fasano, R., et al. (2014). "Role of
Arabidopsis UV
opsis RESISTANCE LOCUS 8 in plant growth reduction
UVR8 Flavonoids
thalian under osmotic stress and low levels of UV-B."
Mol
a Plant 7(5): 773-791.
27
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Fagop
yrum Bai, Y.
C., et al. (2014). "Characterization of two
tataric FtMYB1/Ft Proanthocy tartary buckwheat R2R3-MYB transcription factors
and
UM MYB2, anidins their
regulation of proanthocyanidin biosynthesis."
Gaertn Physiol Plant 152(3): 431-440.
Ipomo Wang, H., et al. (2013). "Functional
characterization of
Dihydroflavono1-4-reductase in anthocyanin
ea Anthocyani
IbDFR biosynthesis of purple sweet potato underlies
the direct
batatas
evidence of anthocyanins function against abiotic
Lam.
stresses." PLoS One 8(11): e78484.
Liu, Y., et al. (2013). "Proanthocyanidin synthesis in
Theobr
Theobroma cacao: genes encoding anthocyanidin
TcANR/TcL Proanthocy
oma AR anidin synthase, anthocyanidin reductase, and
cacao leucoanthocyanidin reductase." BMC Plant Biol 13:
202.
Solanu Kostyn, K., et al. (2013). "Transgenic potato
plants
Flavonoids with overexpression of dihydroflavonol
reductase can
DFR
tubero vitamin C serve
as efficient nutrition sources." J Agric Food
SUM Chem 61(27): 6743-6753.
Epime Huang, W., et al. (2013). "A R2R3-MYB
transcription
dium Anthocyani factor from Epimedium sagittatum regulates the
EsMYBA1
sagittat n
flavonoid biosynthetic pathway." PLoS One 8(8):
UM e70778.
Nakatsuka, T., et al. (2012). "Isolation and
Gentia characterization of GtMYBP3 and GtMYBP4,
GtMYBP3
na Flavonoids orthologues of R2R3-MYB transcription factors
that
/GtMYBP4
triflora
regulate early flavonoid biosynthesis, in gentian
flowers." J Exp Bot 63(18): 6505-6517.
Ma, Q. H., et al. (2011). "TaMYB4 cloned from wheat
Triticu
regulates lignin biosynthesis through negatively
TaMYB4 Flavonoids controlling the transcripts of both cinnamyl
alcohol
aestivu
dehydrogenase and cinnamoyl-CoA reductase genes."
m L.
Biochimie 93(7): 1179-1186.
Hoffmann, T., et al. (2011). "Metabolic engineering in
Fragari Eugenol,
EGS/IGS
strawberry fruit uncovers a dormant biosynthetic
a vesca Isoeugenol
pathway." Metab Eng 13(5): 527-531.
Mellway, R. D., et al. (2009). "The wound-, pathogen-,
and ultraviolet B-responsive MYB134 gene encodes an
Populu Proanthocy
MYB134 R2R3 MYB transcription factor that regulates
s spp. anidins
proanthocyanidin synthesis in poplar." Plant Physiol
150(2) 924-941.
Li, F. X., et al. (2006). "Overexpression of the
Saussu
Saussurea medusa chalcone isomerase gene in S.
rea
CHI Apigenin involucrata hairy root cultures enhances
their
medus
biosynthesis of apigenin." Phytochemistry 67(6):
a
553-560.
Vitis VvMYB5a Phenolic Deluc, L., et al. (2006).
"Characterization of a
28
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
vinifer compounds
grapevine R2R3-MYB transcription factor that
a
regulates the phenylpropanoid pathway." Plant Physiol
140(2): 499-511.
Medic
Xie, D. Y., et al. (2004). "Molecular and biochemical
ago MtDER1 Flavonoids analysis of two cDNA clones encoding
truncat dihydroflavono1-4-reductase from Medicago
ula truncatula." Plant Physiol 134(3): 979-994.
Solanu
Lukaszewicz, M., et al. (2004). "Antioxidant capacity
Phenolic
m CHS/CHI/D
manipulation in transgenic potato tuber by changes in
acids,Anth
tuberos FR phenolic compounds content." J Agric Food
Chem
ocyanins
um L. 52(6): 1526-1533.
Le Gall, G., et al. (2003). "Characterization and content
Zea
mays LC/ Cl
Flavonoids of flavonoid glycosides in genetically modified tomato
(Lycopersicon esculentum) fruits." J Agric Food Chem
L.
51(9): 2438-2446
Muir, S. R., et al. (2001). "Overexpression of petunia
Petuni .
chalcone isomerase in tomato results in fruit containing
Petunia chi-a Flavonoids a
increased levels of flavonols." Nat Biotechnol 19(5):
470-474.
Taxus
Liao, W., et al. (2019). "Sub-cellular localization and
chinen TcCYP725A Taxol overexpressing analysis of hydroxylase
gene
sis 22
TcCYP725A22 of Taxus chinensis." Sheng Wu Gong
Cheng Xue Bao 35(6): 1109-1116.
Lycope Munir, S., et al. (2020). "Genome-wide
analysis of
rsicon Myo-
inositol oxygenase gene family in tomato reveals
MIOX4 Vitamin C
esculen
their involvement in ascorbic acid accumulation." BMC
tum Genomics 21(1): 284.
Zea
mays
Zhang, H., et al. (2020). "Enhanced Vitamin C
L./Ara
ZmPTPN Vitamin C' Production Mediated by an ABA-Induced PTP-
like
bidops Drought
AtPTPN Nucleotidase Improves Plant Drought Tolerance
in
is tolerance
thalian Arabidopsis and Maize." Mol Plant 13(5): 760-
776.
a
Luo, T., et al. (2020). "Identifying Vitamin E
Elaeis
Biosynthesis Genes in Elaeis guineensis by
guinee EgHGGT Vitamin E
Genome-Wide Association Study." J Agric Food Chem
nsis
68(2): 678-685.
Zhang, L., et al. (2020). "Overexpression of the maize
Zea gamma-
tocopherol methyltransferase gene (ZmTMT)
mays ZmTMT Vitamin E increases
alpha-tocopherol content in transgenic
L.
Arabidopsis and maize seeds." Transgenic Res 29(1):
95-104.
Zhan, W., et al. (2019). "An allele of ZmPORB2
Zea
encoding a protochlorophyllide oxidoreductase
mays ZmPORB2 Vitamin E
L.
promotes tocopherol accumulation in both leaves and
kernels of maize." Plant J 100(1): 114-127.
29
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Liu, Y., et al. (2019). "A WRKY transcription factor
Pyrus
PbrWRKY5 PbrWRKY53 from Pyrus betulaefolia is involved
in
betulae VitaminC
3 drought tolerance and AsA accumulation."
Plant
folia
Biotechnol J 17(9): 1770-1787.
Arabid Bagri, D. S., et al. (2018). "Overexpression of
PDX-II
gene in potato (Solanum tuberosum L.) leads to the
opsis
PDX-II VitaminB6 enhanced accumulation of vitamin B6 in tuber
tissues
thalian
and tolerance to abiotic stresses." Plant Sci 272:
a.
267-275.
Liao, P., et al. (2018). "Improved fruit
alpha-tocopherol, carotenoid, squalene and phytosterol
Brassi
contents through manipulation of Brassica juncea
ca BjHMGS1 VitaminE
3-HYDROXY-3-METHYLGLUTARYL-COA
juncea
SYNTHASE1 in transgenic tomato." Plant Biotechnol J
16(3): 784-796.
Hordeu
Chen, J., et al. (2017). "Overexpression of HvHGGT
HvHGGT VitaminE Enhances Tocotrienol Levels and Antioxidant
Activity
vulgare
in Barley." J Agric Food Chem 65(25): 5181-5187.
L.
Medic Jiang, J., et al. (2017).
"P-HYDROXYPHENYLPYRUVATE
ago
MsHPPD VitaminE DIOXYGENASE from Medicago sativa is involved in
sativa
vitamin E biosynthesis and abscisic acid-mediated seed
L.
germination." Sci Rep 7: 40625.
Arabid Bu, Y., et al. (2016). "Overexpression of AtOxR
gene
opsis improves abiotic stresses tolerance and
vitamin C
AtOxR VitaminC
thalian content in Arabidopsis thaliana." BMC
Biotechnol
a 16(1): 69.
Medic Jiang, J., et al. (2016). "Overexpression of
Medicago
ago sativa TMT elevates the alpha-tocopherol
content in
MsTMT VitaminE
sativa Arabidopsis seeds, alfalfa leaves, and
delays
L. dark-induced leaf senescence." Plant Sci 249:
93-104.
Arabid Ramirez Rivera, N. G., et al. (2016).
"Metabolic
opsis engineering of folate and its precursors in
Mexican
AtGCHI Vitamin B9
thalian common bean (Phaseolus vulgaris L.)." Plant
a Biotechnol J 14(10): 2021-2032.
Tang, Y., et al. (2016). "Roles of MPBQ-MT in
Lactuc
Promoting alpha/gamma-Tocopherol Production and
a LsMT VitaminE
Photosynthesis under High Light in Lettuce." PLoS
sativa
One 11(2): e0148490.
Arabid Vom Dorp, K., et al. (2015). "Remobilization of
Phytol
opsis from Chlorophyll Degradation Is Essential
for
VTE6 VitaminE
thalian Tocopherol Synthesis and Growth of
Arabidopsis."
a Plant Cell 27(10): 2846-2859.
Triticu Zeng, J., et al. (2015). "Metabolic
Engineering of
Beta-carote Wheat Provitamin A by Simultaneously Overexpressing
CrtB
aestivu ne CrtB and Silencing Carotenoid Hydroxylase
(TaHYD)."
m L. J Agric Food Chem 63(41): 9083-9092.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
S olanu Drought Yu, Z. B., et al. (2016). "A homologue of vitamin K
tolerance epoxide reductase in Solanum lycopersicum is
involved
SlVKOR
lycope Salt in resistance to osmotic stress." Physiol Plant
156(3):
rsicum tolerance 311-322.
Dong, W., et al. (2014). "Overexpression of folate
Oryza GTPCHI/AD VitaminB9/ biosynthesis genes in rice (Oryza sativa L.)
and
sativa CS/DHFS/F
folate evaluation of their impact on seed folate
content." Plant
L. PGS
Foods Hum Nutr 69(4): 379-385.
Amaya, I., et al. (2015). "Increased antioxidant capacity
Strawb in tomato by ectopic expression of the strawberry
FaGalUR VitaminC
erry D-galacturonate reductase gene." Biotechnol J
10(3):
490-500.
myo-inositol Lisko, K. A., et al. (2013). "Elevating vitamin C
Arabid
oxygenase/ content via overexpression of myo-inositol oxygenase
opsis
¨ua lono-1,4 VitaminC and 1-gulono-1,4-lactone oxidase in
Arabidopsis leads
thalian
-lactone to enhanced biomass and tolerance to abiotic
stresses."
a
oxidase In Vitro Cell Dev Biol Plant 49(6): 643-
655.
Arun, M., et al. (2014). "Transfer and targeted
overexpression of gamma-tocopherol methyltransferase
Perilla
frutesc TMT VitaminE (gamma-TMT) gene using seed-specific
promoter
improves tocopherol composition in Indian soybean
ens
cultivars." Appl Biochem Biotechnol 172(4):
1763-1776.
Arabid Zhang, G. Y., et al. (2013). "Increased
opsis alpha-tocotrienol content in seeds of transgenic
rice
AtTMT VitaminE
thalian overexpressing Arabidopsis gamma-tocopherol
a methyltransferase." Transgenic Res 22(1): 89-
99.
Johnson, A. A., et al. (2011). "Constitutive
Oryza overexpression of the OsNAS gene family reveals
Increase Zn
sativa NAS single-gene strategies for effective iron-
and
Fe
L. zinc-biofortification of rice endosperm." PLoS
One
6(9): e24476.
Zea Aluru, M., et al. (2008). "Generation of
transgenic
mays crtB /crtI
VitaminA maize with enhanced provitamin A content." J Exp Bot
L. 59(13): 3551-3562.
Arabid Lee, K., et al. (2007). "Overexpression of
Arabidopsis
homogenti sate phytyltransferase or tocopherol cyclase
opsis PT/V-TE2&
VitaminE elevates vitamin E content by increasing
thalian TC/VTE1
gamma-tocopherol level in lettuce (Lactuca sativa L.)."
a
Mol Cells 24(2): 301-306.
Kanwischer, M., et al. (2005). "Alterations in
Arabid
tocopherol cyclase activity in transgenic and mutant
opsis
VTE1 VitaminE plants of Arabidopsis affect tocopherol
content,
thalian
tocopherol composition, and oxidative stress." Plant
a
Physiol 137(2): 713-723.
31
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Hordeu
Falk, J., et al. (2003). "Constitutive overexpression of
4-hydroxyph
barley 4-hydroxyphenylpyruvate dioxygenase in
enylpyruvate VitaminE
vulgare tobacco results in elevation of the vitamin E content in
dioxygenase
L. seeds but not in leaves." FEBS Lett 540(1-3):
35-40.
Triticu
Chen, Z., et al. (2003). "Increasing vitamin C content of
DHAR VitaminC plants through enhanced ascorbate
recycling." Proc
aestivu
Natl Acad Sci U S A 100(6): 3525-3530.
m L.
Agius, F., et al. (2003). "Engineering increased vitamin
Strawb GalUR VitaminC C levels in plants by overexpression
of a
erry D-
galacturonic acid reductase." Nat Biotechnol 21(2):
177-181.
Arabid gamma-toco
Shintani, D. and D. DellaPenna (1998). "Elevating the
opsis pherol
thalian methyltransf VitaminE vitamin E content of plants through
metabolic
engineering." Science 282(5396): 2098-2100.
a erase
Table C lists the important functional genes in oilseed rape. The combination
of such
genes with those endogenous promoters of oilseed rape can be used to create
non-transgenic
endogenous high-expression new genes or tissue-specific expression genes by
applying the
method in the present invention to bring about more application scenarios for
breeding.
There are also a large number of genes with reported functions in rice, corn,
wheat,
soybeans and other species. For those functional genes or non-coding RNAs that
need to be
up-regulated to realize competitive advantages for crops, their combinations
with known
strong expression promoters are available for creating customized new genes
with new
expression patterns as per needed by using the method in the present
invention.
Table C: Important functional genes in oilseed rape
Gene name Application Reference
Metallothione Pan, Y., et al. (2018). "Genome-Wide
in Family Characterization and Analysis of
Metallothionein
To improve tolerance to
Genes (MT) - Family Genes That Function in Metal Stress
heavy metal toxicity
metallothione Tolerance in Brassica napus L." Int J Mol
Sci
in 19(8).
Yang, H., et al. (2019). "Overexpression of
Alternative To confer tolerance to
BnaA0X1b Confers Tolerance to Osmotic and Salt
oxidases osmotic and salt stress
Stress in Rapeseed." G3 (Bethesda) 9(10):
(A0Xs) in oilseed rape
3501-3511.
CBF/DREB1-
To improve freezing
tolerance and regulate Savitch, L. V., et al. (2005). "The
effect of
like
chloroplast overexpression of two Brassica CBF/DREB1-
like
transcription
development, thus to
transcription factors on photosynthetic capacity and
factors
improve photochemical freezing tolerance in Brassica napus."
Plant Cell
(BnCBF5 and
efficiency and Physiol 46(9): 1525-1539.
17)
photosynthetic capacity
32
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Mitogen-activ
To indicate the
ated protein
transcriptional level of
kinase Wang, Z., et al. (2021). "Genome-Wide
BnaMKK and
(MAPK),Mito Identification and Analysis of MKK and MAPK
BnaMAPK is usually
gen-activated Gene Families in Brassica Species and Response to
regulated by growth,
protein kinase Stress in Brassica napus." Int j Mol Sci
22(2).
(MAPK) development and stress
signal.
Family Genes
pyrabactin
resistance Di, F., et al. (2018). "Genome-Wide Analysis
of the
1-like PYL Gene Family and Identification of PYL Genes
Abiotic stress response
(PYR/PYL) That Respond to Abiotic Stress in Brassica
napus."
protein gene Genes (Basel) 9(3).
family
Ding, Y., et al. (2018). "Screening of candidate
BnPCS1; Key factors in cadmium gene responses to cadmium stress by RNA
BnHMAs stress response sequencing in oilseed rape (Brassica napus
L.)."
Environ Sci Pollut Res Int 25(32): 32433-32446.
APETALA2/e
thylene
Du, C., et al. (2016). "Dynamic transcriptome
response
analysis reveals AP2/ERF transcription factors
factor
Cold stress response responsible for cold stress in rapeseed
(Brassica
(AP2/ERF)
napus L.)." Mol Genet Genomics 291(3):
transcription
1053-1067.
factor (TF)
superfamily
Edrisi Maryan, K., et al. (2019). "Analysis of
dehydrin, Cold stress response Brassica napus dehydrins and their Co-
Expression
DHNs regulatory networks in relation to cold
stress."
Gene Expr Patterns 31: 7-17.
WRKY Feng, Y., et al. (2020). "Transcription
factor
transcription BnaA9.WRKY47 contributes to the adaptation of
To adapt to low boron
factor Brassica napus to low boron stress by up-regulating
environmental stress
families; the boric acid channel gene BnaA3.NIP5;1."
Plant
NIP5.1 Biotechnol J 18(5): 1241-1254.
Georges, F., et al. (2009). "Over-expression of
Brassica napus phosphatidylinositol-phospholipase
phosphatidyli Drought resistance, C2 in canola induces significant
changes in gene
nositol-phosp early flowering and expression and phytohormone
distribution patterns,
holipase C2 maturation enhances drought tolerance and promotes
early
flowering and maturation." Plant Cell Environ
32(12): 1664-1681.
Guo, P., et al. (2019). "Genome-wide survey and
GRAS gene expression analyses of the GRAS gene
family in
Root stress response
Brassica napus reveals their roles in root
family
development and stress response." Planta 250(4):
1051-1072.
33
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
He, X., et al. (2020). "Comprehensive analyses of
Annexins
the annexin (ANN) gene family in Brassica rapa,
(ANN) Cold stress response
Brassica oleracea and Brassica napus reveals their
genes
roles in stress response." Sci Rep 10(1): 4295.
CaM
(Calmodulin) He, X., et
al. (2020). "Genome-wide identification
Abiotic stress response and expression analysis of CaM/CML genes in
/ CML
(calmodulin-li genes
Brassica napus under abiotic stress." J Plant Physiol
255: 153251.
ke) genes
Huang, R., et al. (2019). "Heat Stress Suppresses
WRINKLED1 Brassica napus Seed Oil Accumulation by
Heat tolerance
,BnWRI1 Inhibition of Photosynthesis and BnWRI1
Pathway." Plant Cell Physiol 60(7) 1457-1470.
WAX Liu, N., et al. (2019). "Overexpression of
WAX
INDUCER1/S To promote growth and INDUCER1/SHINE1 Gene Enhances Wax
HINE' increase oil content Accumulation under Osmotic Stress and
Oil
(WINO
Synthesis in Brassica napus." Int J Mol Sci 20(18).
Liu, P., et al. (2018). "Genome-Wide Identification
Cytokinin and Expression Profiling of Cytokinin
oxidase/dehyd Oxidase/Dehydrogenase (CKX) Genes Reveal
Relates to pod length
rogenases Likely Roles in Pod Development and
Stress
(CKXs) Responses in Oilseed Rape (Brassica napus
L.)."
Genes (Basel) 9(3).
mitogen-activ Wang, Z., et al. (2009). "Overexpression of
ated protein Brassica napus MPK4 enhances resistance to
Disease resistance
kinases
Sclerotinia sclerotiorum in oilseed rape." Mol Plant
4,MAPK4 Microbe Interact 22(3): 235-244.
ABSCISIC Xu, P. and W. Cai (2019). "Function of
Brassica
ACID napus BnABI3 in Arabidopsis gsl, an Allele of
Stress response
INSENSITIV AtABI3, in Seed Development and Stress
E3 Response." Front Plant Sci 10: 67.
Alternative Yang, H., et al. (2019). "Overexpression
of
BnaA0X1b Confers Tolerance to Osmotic and Salt
oxidases Tolerance to salt stress
Stress in Rapeseed." G3 (Bethesda) 9(10):
(A0Xs)
3501-3511.
Zhang, Y., et al. (2015). "Overexpression of Three
Resistance to Glucosinolate Biosynthesis Genes in
Brassica
Glucosinol ate
Sclerotinia sclerotiorum napus Identifies Enhanced Resistance to Sclerotinia
Biosynthesis
and Botrytis cinerea sclerotiorum and Botrytis cinerea." PLoS
One
10(10): e0140491.
Huang, Y., et al. (2020). "A Brassica napus
tropinone Reductase Gene Dissected by Associative
Cold resistance
reductase Transcriptomics Enhances Plant Adaption
to
Freezing Stress." Front Plant Sci 11: 971.
34
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Qi, Q., et al. (2003). "Molecular and biochemical
characterization of an
aminoalcohol aminoalcoholphosphotransferase (AAPT1) from
phosphotransf Brassica napus: effects of low temperature and
Cold resistance
erase(AAPT1 abscisic acid treatments on AAPT expression in
Arabidopsis plants and effects of over-expression
of BnAAPT1 in transgenic Arabidopsis." Planta
217(4): 547-558.
BnSIP1-1 Luo, J., et
al. (2017). "BnSIP1-1, a Trihelix Family
Tolerance to osmotic
Trihelix Gene,
Mediates Abiotic Stress Tolerance and ABA
stress and salt stress
Family Gene Signaling in
Brassica napus." Front Plant Sci 8: 44.
Ding, L. N., et al. (2020). "Arabidopsis GDSL1
Resistance to overexpression enhances rapeseed
Sclerotinia
BnGLIP1 sclerotiorum
resistance and the functional
Sclerotinia sclerotiorum
identification of its homolog in Brassica napus."
Plant Biotechnol J 18(5): 1255-1270.
BnLEA (B.
napus group 3 Park, B. J.,
et al. (2005). Genetic improvement of
late Resistance to drought Chinese cabbage for salt anddrought
tolerance by
embryogenesi and salt stress constitutive expressionof a B.
napusLEA gene.
s abundant Plant Science 169: 553-558.
gene
Yu, Q., et al. (2005). Sense and antisense
BnPIP1 (B.
napus plasma expression
of plasma membrane aquaporin BnPIP1
Drought resistance from Brassica napus in tobacco and its
effects on
membrane
plant drought resistance. Plant Science 169:
aquaporin
647-656.
Dalal, M., et al. (2019). Abiotic stress and
ABA-inducible Group 4 LEA from Brassica napus
BnLEA 4-1 Drought resistance
plays a key role in salt and drought tolerance.
Journal of Biotechnology 139: 137-145.
BnCIPK6
(CBL-interact
Chen, L., et al. (2012) The Brassica napus
ing protein
Calcineurin B-Like 1/CBL-interacting protein
kinase 6) Salt resistance, low
kinase 6 (CBL1/CIPK6) component is involved in
BnCIPK6M phosphorous tolerance
(CIPK6 the plant response to abiotic stress and
ABA.
Journal of Experimental Botany 63: 6211-6222.
phosphomimi
c form)
Kuluev, B. R., et al. (2013). "[Morphological
AINTEGUM features of
transgenic tobacco plants expressing the
ENTA (ANT) High yield AINTEGUMENTA gene of rape under
control of
gene the Dahlia mosaic virus promoter]."
Ontogenez
44(2): 110-114.
Chen, L., et al. (2011). "A novel cold-regulated
gene, C0R25, of Brassica napus is involved in
BnCOR25 Cold resistance
plant response and tolerance to cold stress." Plant
Cell Rep 30(4): 463-471.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Zou, Z., et al. (2020). "Genome-Wide Identification
and Analysis of VQ Motif-containing Gene Family
BnVQ7(BnM
Disease resistance in Brassica napus and Functional
Characterization
KS1)
of BnMKS1 in Response to Leptosphaeria
maculans." Phytopathology.
b-ketoacyl-A Gupta, M., et al. (2012). "Transcriptional
activation
of Brassica napus beta-ketoacyl-ACP synthase II
CP synthase To improve quality
with an engineered zinc finger protein transcription
II(KASII)
factor." Plant Biotechnol J 10(7) 783-791.
Liang, Y., et al. (2019). "Drought-responsive genes,
late embryogenesis abundant group3 (LEA3) and
vicinal oxygen chelate, function in lipid
BnLEA3,
Drought resistance
accumulation in Brassica napus and Arabidopsis
BnVOC
mainly via enhancing photosynthetic efficiency and
reducing ROS." Plant Biotechnol J 17(11):
2123-2142.
Liu, S., et al. (2020). "Dissection of genetic
architecture for glucosinolate accumulations in
BnaA3.MYB2
To improve quality leaves and seeds of Brassica napus by genome-
wide
8
association study." Plant Biotechnol J 18(6):
1472-1484.
Shi, L., et al. (2019). "A CACTA-like transposable
BnaA9.CYP7
element in the upstream region of
8A9 P450
To increase yield BnaA9.CYP78A9 acts as an enhancer to
increase
monooxygena
silique length and seed weight in rapeseed." Plant J
se
98(3): 524-539.
Shen, Q., et al. (2011). "Expression of a Brassica
Tolerance to Hg napus heme oxygenase confers plant
tolerance to
BnH0-1
pollution mercury toxicity." Plant Cell Environ
34(5):
752-763.
Ligaba, A., et al. (2006). "The BnALMT1 and
Al-activated BnALMT2 genes from rape encode
Tolerance to aluminum
malate aluminum-activated malate transporters that
toxicity
transporter)
enhance the aluminum resistance of plant cells."
Plant Physiol 142(3): 1294-1303.
SUPPRESSO
R WITH Li, S., et al. (2015). "BnaC9.SMG7b
Functions as a
MORPHOGE
Positive Regulator of the Number of Seeds per
To increase pod seed
NETIC number Silique in Brassica napus by Regulating
the
EFFECTS ON
Formation of Functional Female Gametophytes."
GENITALIA Plant Physiol 169(4): 2744-2760.
7
BnaA03 .MPK
Wang, Z., et al. (2020). "BnaMPK6 is a
6,
Resistance to determinant of quantitative disease
resistance
mitogen-activ
Sclerotinia sclerotiorum
against Sclerotinia sclerotiorum in oilseed rape."
ated protein
Plant Sci 291: 110362.
kinases
36
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Ren, F., et al. (2014). "A Brassica napus PHT1
PHT1
phosphate transporter, BnPht1;4, promotes
phosphate To improve phosphate
phosphate uptake and affects roots architecture of
transporter, uptake
BnPht1;4 transgenic Arabidopsis." Plant Mol Biol 86(6):
595-607.
proline-rich,
Haffani, Y. Z., et al. (2006). "Altered Expression of
extensin-like
PERK Receptor Kinases in Arabidopsis Leads to
receptor To increase yield
Changes in Growth and Floral Organ Formation."
kinase
Plant Signal Behav 1(5): 251-260.
(PERK)
Tolerance to osmotic Luo, J., et al. (2017). "BnSIP1-1, a
Trihelix Family
BnSIP 1- I and salt stress in Gene, Mediates Abiotic Stress
Tolerance and ABA
germination stage Signaling in Brassica napus." Front Plant
Sci 8: 44.
Peng, D., et al. (2018). "Enhancing freezing
To increase trichome
tolerance of Brassica napus L by overexpression of
density, change
LTP2 a stearoyl-acyl carrier protein desaturase
gene
secondary metabolite
(SAD) from Sapium sebiferum (L.) Roxb." Plant
concentration
Sci 272: 32-41.
Wang, Z., et al. (2018). "Overexpression of
OsPGIP2 confers Sclerotinia sclerotiorum
Resistance to
BnPGIP2 resistance in Brassica napus through increased
Sclerotinia sclerotiorum
activation of defense mechanisms." J Exp Bot
69(12): 3141-3155.
Yang, M., et al. (2011). "Overexpression of the
To increase plant Brassica napus BnLAS gene in Arabidopsis
affects
BnLAS
drought tolerance plant
development and increases drought
tolerance." Plant Cell Rep 30(3): 373-388.
Savitch, L. V., et al. (2005). "The effect of
CBF/
To improve overexpression of two Brassica CBF/DREB1-
like
drebltype
photosynthetic capacity transcription factors on photosynthetic capacity and
transcription
and freezing tolerance freezing tolerance in Brassica napus." Plant
Cell
factor
Physiol 46(9): 1525-1539.
To enhance resistance Wang, Z., et al. (2014). "Overexpression
of
BnWRKY33 in oilseed rape enhances resistance to
BnWRKY33 to Sclerotinia
Sclerotinia sclerotiorum." Mol Plant Pathol 15(7)
sclerotiorum
677-689.
Clauss, K., et al. (2011). "Overexpression of
To inhibit sinapine sinapine esterase BnSCE3 in oilseed rape
seeds
BnSCE3
accumulation triggers global changes in seed metabolism."
Plant
Physiol 155(3): 1127-1145
Positively regulates
vascular lignification, Jiang, J., et al. (2020). "MYB43 in Oilseed
Rape
plant morphology and (Brassica napus) Positively Regulates
Vascular
MYB43 Yield potential but Lignification, Plant Morphology and Yield
negatively affects Potential but Negatively Affects
Resistance to
resistance to Sclerotinia Sclerotinia sclerotiorum." Genes (Basel)
11(5).
sclerotiorum
37
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Peng, D., et al. (2018). "Increasing branch and seed
To increase branch and yield through heterologous expression of the novel
PAT15
seed yield rice S-acyl transferase gene OsPAT15 in Brassica
napus L." Breed Sci 68(3): 326-335.
Faure-Rabasse, S., et al. (2002). "Effects of nitrate
pulses on BnNRT1 and BnNRT2 genes: mRNA
To increase nitrate
BnNRT2.2 influx rates
levels and nitrate influx rates in relation to the
duration of N deprivation in Brassica napus L." J
Exp Bot 53(375): 1711-1721
Table D lists important functional genes in some horticulture crops. Methods
in the
present invention can be used to edit such genes and create new genes by
designing new
combinations of different gene elements or different protein domain.
Table D: Important functional genes in horticulture crops
Crop Gene name Application Reference
Huo, L., et al. (2020). "MdATG18a
overexpression improves basal
Apple MdATG18a Thermo tolerance
thermotolerance in transgenic apple by
decreasing damage to chloroplasts." Hortic
Res 7:21.
Ma, Y., et al. (2021). "The miR156/SPL
module regulates apple salt stress tolerance
Apple MdSPL13 Salt stressresistance
by activating MdWRKY100 expression."
Plant Biotechnol J 19(2): 311-323.
Sharma, V., et al. (2019). "An apple
transcription factor, MdDREB76, confers salt
Drought tolerance and drought tolerance in transgenic
tobacco
Apple MdDREB76
and salt resistance by activating the expression of
stress-responsive genes." Plant Cell Rep
38(2): 221-241.
Zhang, F. J., et al. (2021). "The ankyrin
Salt tolerance and repeat-containing protein MdANK2B
Apple MdANK2B regulates salt tolerance and ABA
sensitivity
ABA sensitivity
in Malus domestica." Plant Cell Rep 40(2):
405-419.
Quality Yu, J. Q., et al. (2021). "The apple
bHLH
,
transcription factor MdbHLH3 functions in
Apple MdbHLH3 carbohydrate and
determining the fruit carbohydrates and
malic acid
malate." Plant Biotechnol J 19(2): 285-299.
Huang, D., et al. (2021). "Overexpression of
MdIAA24 improves apple drought resistance
Apple MdIAA24 Drought tolerance by
positively regulating strigolactone
biosynthesis and mycorrhization." Tree
Physiol 41(1): 134-146.
Zhang, S., et al. (2020). "A novel NAC
transcription factor, MdNAC42, regulates
Apple MdNAC42 Anthocyanin anthocyanin accumulation in red-
fleshed
apple by interacting with MdMYB10." Tree
Physiol 40(3): 413-423.
38
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Yang, S., et al. (2020). "MdHAL3, a
4'-phosphopantothenoylcysteine
Apple MdHAL3 Salt tolerance decarboxylase, is involved
in the salt
tolerance of autotetraploid apple." Plant Cell
Rep 39(11): 1479-1491.
Shi, K., et al. (2020). "MdWRKY11 improves
MdWRKY11-
copper tolerance by directly promoting the
Apple Copper tolerance
MdHMA5
expression of the copper transporter gene
MdHMA5." Hortic Res 7: 105.
Huo, L., et al. (2020). "The Apple
Autophagy-Related Gene MdATG9 Confers
Apple MdATG9 Nitrogen stress
Tolerance to Low Nitrogen in Transgenic
Apple Callus." Front Plant Sci 11:423.
Huo, L., et al. (2020). "Increased autophagic
activity in roots caused by overexpression of
Apple MdATG10 Salt tolerance the autophagy-related gene
MdATG10 in
apple enhances salt tolerance." Plant Sci 294:
110444.
Gao, T., et al. (2020). "Exogenous dopamine
alleviate replant and overexpression of the dopamine
synthase
Apple MdTYDC
disease gene MdTYDC alleviated apple replant
disease." Tree Physiol.
Dong, Q., et al. (2020). "MdWRKY30, a
MdWRKY26/ Salt tolerance and group Ha WRKY gene from apple, confers
Apple
tolerance to salinity and osmotic stresses in
28/30 osmotic stress
transgenic apple callus and Arabidopsis
seedlings." Plant Sci 299: 110611.
Chen, Q., et al. (2020). "Overexpression of an
apple LysM-containing protein gene,
resistance to MdCERK1-2, confers improved
resistance to
Apple MdCERK1-2
pathogenic fungus the pathogenic fungus, Alternaria alternata, in
Nicotiana benthamiana." BMC Plant Biol
20(1): 146.
Zheng, L., et al. (2019). "Transcriptome
Analysis Reveals New Insights into
Growth and
Apple MdBAK1
MdBAK1-Mediated Plant Growth in Malus
development
domestica." J Agric Food Chem 67(35):
9757-9771.
Zhang, F., et al. (2019). "MdWRKY100
Resistance to
encodes a group I WRKY transcription factor
Colletotrichum
Apple MdWRKY100 in
Malus domestica that positively regulates
gloeosporioides
resistance to Colletotrichum gloeosporioides
infection
infection." Plant Sci 286: 68-77.
Ma, B., et al. (2019). "A Mal0 gene encoding
P-type ATPase is involved in fruit organic
Apple Mal0 Acidity
acid accumulation in apple." Plant Biotechnol
J 17(3): 674-686.
39
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Jia, D., et al. (2019). "An apple (Malus
domestica) NAC transcription factor enhances
Apple MdNAC1 Drought resistance
drought tolerance in transgenic apple plants."
Plant Physiol Biochem 139: 504-512.
Huang, D., et al. (2019). "Overexpression of
Apple MdIAA9 Osmotic stress
MdIAA9 confers high tolerance to osmotic
stress in transgenic tobacco." Peed 7: e7935.
Feng, Y., et al. (2019). "Genome-Wide
Identification and Characterization of ABC
Transporters in Nine Rosaceae Species
Apple MdABCG28 Stem growth
Identifying MdABCG28 as a Possible
Cytokinin Transporter linked to Dwarfing."
Int J Mol Sci 20(22).
Zheng, X., et al. (2018). "MdWRKY9
overexpression confers intensive dwarfing in
the M26 rootstock of apple by directly
Apple MdWRKY9 Dwarfing
inhibiting brassinosteroid synthetase
MdDWF4 expression." New Phytol 217(3):
1086-1098.
Zhang, J., et al. (2018). "The ethylene
response factor MdERF1B regulates
Apple MdERF1B Anthocyanin anthocyanin and proanthocyanidin
biosynthesis in apple." Plant Mol Biol 98(3):
205-218.
Sun, X., et al. (2018). "Improvement of
drought tolerance by overexpressing
MdATG18a is mediated by modified
Apple MdATG18a Drought tolerance
antioxidant system and activated autophagy in
transgenic apple." Plant Biotechnol J 16(2):
545-557.
Meng, D., et al. (2018). "Sorbitol Modulates
Resistance to Alternaria alternata by
MdWRKY79-
Apple MdNLR16 Fungus resistance Regulating the
Expression of an NLR
Resistance Gene in Apple." Plant Cell 30(7):
1562-1581.
Dong, Q., et al. (2018). "Genome-Wide
Analysis and Cloning of the Apple
Stress-Associated Protein Gene Family
Apple MdSAP15 Drought tolerance
Reveals MdSAP15, Which Confers Tolerance
to Drought and Osmotic Stresses in
Transgenic Arabidopsis." Int J Mol Sci 19(9).
Ma, J., et al. (2021). "The NAC-type
transcription factor CaNAC46 regulates the
Salt and drought
Pepper CaNAC46 salt and drought tolerance of
transgenic
tolerance
Arabidopsis thaliana." BMC Plant Biol 21(1):
11.
Zhang, H. X., et al. (2020). "Identification of
Phytophthora
Pepper CaSBP08 Gene in Defense Response
Pepper CaSBP08
capsici resistance Against Phytophthora capsici Infection."
Front Plant Sci 11: 183.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Yang, S., et al. (2020). "Pepper CaML06
Negatively Regulates Ralstonia solanacearum
Pepper CaML06 Thermo resistance Resistance and Positively Regulates
High
Temperature and High Humidity Responses."
Plant Cell Physiol 61(7): 1223-1238.
Shen, L., et al. (2020). "CaCBL1 Acts as a
Ralstonia
Positive Regulator in Pepper Response to
Pepper CaCBL1 solanacearum
Ralstonia solanacearum." Mol Plant Microbe
resistance
Interact 33(7): 945-957.
Liu, C., et al. (2020). "Genome-wide analysis
of NDR1/HIN1-like genes in pepper
Pathogenic bacteria
Pepper CaNHL4 resistance
(Capsicum annuum L.) and functional
characterization of CaNHL4 under biotic and
abiotic stresses." Hortic Res 7: 93.
Foong, S. L. et al. (2020). "Capsicum annum
Hsp26.5 promotes defense responses against
Pepper CaHsp26.5 Virus defense RNA
viruses via ATAF2 but is hijacked as a
chaperone for tobamovirus movement
protein." J Exp Bot 71(19): 6142-6158.
Ali, M., et al. (2020). "The CaChiVI2 Gene of
Thermo tolerance Capsicum annuum L. Confers Resistance
Pepper CaChiVI2 and disease
Against Heat Stress and Infection of
resistance Phytophthora capsici." Front Plant Sci
11:
219.
Mou, S., et al. (2019). "CaLRR-RLK1, a
novel RD receptor-like kinase from Capsicum
Ralstonia
annuum and transcriptionally activated by
Pepper CaLRR-RLK1 solanacearum
CaHDZ27, act as positive regulator in
resistance
Ralstonia solanacearum resistance." BMC
Plant Biol 19(1): 28.
Huang, L. J., et al. (2019). "CaHSP16.4, a
Thermo and small heat shock protein gene in
pepper, is
Pepper CaHSP16.4
drought tolerance involved in heat and drought
tolerance."
Protoplasma 256(1): 39-51.
Dang, F., et al. (2019). "A feedback loop
Ralstonia
between CaWRKY41 and H202 coordinates
Pepper CaWRKY41 solanacearum the
response to Ralstonia solanacearum and
resistance
excess cadmium in pepper." J Exp Bot 70(5):
1581-1595.
Qiu, A., et al. (2018). "CaC3H14 encoding a
tandem CCCH zinc finger protein is directly
Ralstonia
targeted by CaWRKY40 and positively
Pepper CaC3H14 solanacearum
regulates the response of pepper to
resistance
inoculation by Ralstonia solanacearum." Mol
Plant Pathol 19(10): 2221-2235.
Hussain, A., et al. (2018). "CaWRKY22 Acts
as a Positive Regulator in Pepper Response to
Ralstonia
RalstoniaSolanacearum by Constituting
Pepper CaWRKY22 solanacearum
Networks with CaWRKY6, CaWRKY27,
resistance
CaWRKY40, and CaWRKY58." Int J Mol Sci
19(5).
41
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Guan, D., et al. (2018). "CaHSL1 Acts as a
Positive Regulator of Pepper
Pepper CaHSL1
Thermo tolerance Thermotolerance Under High Humidity and Is
Transcriptionally Modulated by
CaWRKY40." Front Plant Sci 9: 1802.
Ashraf, M. F., et al. (2018). "Capsicum
annuum HsfB2a Positively Regulates the
Thermo tolerance
and Ralstonia Response to Ralstonia solanacearum
Infection
Pepper HsfB2a solanacearum or High Temperature and High
Humidity
Forming Transcriptional Cascade with
resistance
CaWRKY6 and CaWRKY40." Plant Cell
Physiol 59(12): 2608-2623.
Tanpure, R. S., et al. (2017). "Improved
tolerance against Helicoverpa armigera in
transgenic tomato over-expressing
Pepper CanPI7 Insect resistance
multi-domain proteinase inhibitor gene from
Capsicum annuum." Physiol Mol Biol Plants
23(3): 597-604.
Qin, L., et al. (2017). "CaRDR1, an
Resistance to RNA-Dependent RNA Polymerase Plays a
Pepper CaRDR1
TMV Positive Role in Pepper Resistance
against
TMV." Front Plant Sci 8: 1068.
Cheng, W., et al. (2017). "A novel
Ralstonia
leucine-rich repeat protein, CaLRR51, acts as
Pepper CaLRR51 solanacearum a
positive regulator in the response of pepper
resistance to Ralstonia solanacearum infection."
Mol
Plant Pathol 18(8): 1089-1100.
Shen, L., et al. (2016). "Pepper CabZIP63
acts as a positive regulator during Ralstonia
High temperature solanacearum or high temperature-
high
Pepper CabZIP63
tolerance humidity challenge in a positive
feedback
loop with CaWRKY40." J Exp Bot 67(8):
2439-2451.
Cai, H., et al. (2015). "CaWRKY6
transcriptionally activates CaWRKY40,
Ralstonia
Pepper CaWRKY6 solanacearum
regulates Ralstonia solanacearum resistance,
and confers high-temperature and
resistance
high-humidity tolerance in pepper." J Exp Bot
66(11): 3163-3174.
Kim, E. Y., et al. (2014). "Overexpression of
Drought and salt CaDSR6 increases tolerance to drought
and
Pepper CaDSR6
tolerance
salt stresses in transgenic Arabidopsis plants."
Gene 552(1): 146-154.
Dang, F., et al. (2014). "Overexpression of
CaWRKY27, a subgroup IIe WRKY
Ralstonia
transcription factor of Capsicum annuum,
Pepper CaWRKY27 solanacearum
resistance positively regulates tobacco
resistance to
Ralstonia solanacearum infection." Physiol
Plant 150(3): 397-411.
42
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Lee, S. C., et al. (2008). "Involvement of the
pepper antimicrobial protein CaAMP1 gene in
Pepper CaAMP1 Fungus resistance
broad spectrum disease resistance." Plant
Physiol 148(2): 1004-1020.
An, S. H., et al. (2008). "Pepper pectin
methylesterase inhibitor protein CaPMEI1 is
Pepper CaPMEI1 Fungus
resistance required for antifungal activity, basal disease
resistance and abiotic stress tolerance." Planta
228(1): 61-78.
VvChi5,
Zheng, T., et al. (2020). "Chitinase family
VvChi17,
genes in grape differentially expressed in a
Fungus resistance,
Grape VvChi22, fruit
storage manner specific to fruit species in response to
VvChi26VvC Botrytis cinerea." Mol
Biol Rep 47(10):
hi31 7349-7363.
Fan, R., et al. (2021). "Characterization of
Albizia
diacylglycerol acyltransferase 2 from Idesia
julibris IpDGAT2 Lipid content
polycarpa and function analysis." Chem Phys
sin
Lipids 234: 105023.
Ye, Q., et al. (2020). "VvBAP1, a Grape C2
Thermo stress
Domain Protein, Plays a Positive Regulatory
Grape VvBAP1
tolerance
Role Under Heat Stress." Front Plant Sci 11:
544374.
Yang, Z., et al. (2020). "Overexpression of
beta-Ketoacyl-CoA Synthase From Vitis
Grape VvKCS Salt
tolerance vinifera L. Improves Salt Tolerance in
Arabidopsis thaliana." Front Plant Sci 11:
564385.
Moriyama, A., et al. (2020). "Crosstalk
To reduce the
Pathway between Trehalose Metabolism and
number of flower
Grape VvCKX5 buds per
Cytokinin Degradation for the Determination
of the Number of Berries per Bunch in
inflorescence
Grapes." Cells 9(11).
Lim, S. D., et al. (2020). "Plant tissue
succulence engineering improves water-use
Grape VvCEBlopt Drought
tolerance efficiency, water-deficit stress attenuation and
salinity tolerance in Arabidopsis." Plant J
103(3): 1049-1072.
Dong, T., et al. (2020). "The Effect of
Botrytis cinerea
Ethylene on the Color Change and Resistance
Grape VvERF1
resistance to
Botrytis cinerea Infection in 'Kyoho' Grape
Fruits." Foods 9(7).
Cai, Y., et al. (2020). "Expression of Sucrose
Grape VvSUC11,Vv To enhance drought Transporters from Vitis vinifera Confer
High
SUC27 resistance
Yield and Enhances Drought Resistance in
Arabidopsis." Int J Mol Sci 21(7).
Zhu, D., et al. (2019). "VvWRKY30, a grape
improve salt stress
WRKY transcription factor, plays a positive
Grape VvWRKY30
tolerance
regulatory role under salinity stress." Plant
Sci 280: 132-142.
43
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Zhang, Z., et al. (2019). "VvSWEET10
increase sugar
Grape VvSWEET10 Mediates Sugar Accumulation in
Grapes."
accumulation
Genes (Basel) 10(4).
Yu, Y. H., et al. (2019). "Grape (Vitis
enhance powdery vinifera) VvD0F3 functions as a transcription
Grape VvD0F3 activator and enhances powdery mildew
mildew resistance
resistance." Plant Physiol Biochem 143:
183-189.
Closely relates to Yu, Y.,
et al. (2019) "Functional
sa-mediated Characterization of Resistance to Powdery
Grape VvTIFY9
powdery mildew
Mildew of VvTIFY9 from Vitis vinifera." Int
resistance in grapes J Mol Sci 20(17).
Yu, Y., et al. (2019). "The grapevine
Positively regulates
defensive response R2R3-
type MYB transcription factor
VdMYB1 positively regulates defense
Grape VdMYB1 and increases
resveratrol content
responses by activating the stilbene synthase
gene 2 (VdSTS2) " BMC Plant Biol 19(1)
in leaves
478.
Sun, X., et al. (2019). "The ethylene response
factor VaERF092 from Amur grape regulates
VaERF092 improve cold
Grape the
transcription factor VaWRKY33,
VaWRKY33 tolerance
improving cold tolerance." Plant J 99(5):
988-1002.
enhance ethylene
Liu, M., et al. (2019). "Expression of stilbene
compounds synthase VqSTS6 from wild Chinese Vitis
Grape VqSTS6 accumulation and quinquangularis in grapevine
enhances
improve disease resveratrol production and powdery
mildew
resistance
resistance." Planta 250(6): 1997-2007.
To increase Zhu, Y., et al. (2018). "Molecular Cloning
anthocyanin and Functional Characterization of a
Grape VbDFR
production in Dihydroflavonol 4-Reductase from Vitis
flowers bellula." Molecules 23(4).
To show larger Lim, S. D., et al. (2018). "A Vitis vinifera
cells, organ size basic helix-loop-helix transcription
factor
Grape VvCEBlopt
and vegetative enhances plant cell size, vegetative
biomass
biomass and reproductive yield." Plant
Biotechnol J.
Hou, H., et al. (2018). "Overexpression of a
To improve SBP-Box Gene (VpSBP16) from Chinese
Grape VpSBP16 tolerance to salt and Wild Vitis Species in Arabidopsis
Improves
drought stress Salinity and Drought Stress
Tolerance." Int J
Mol Sci 19(4).
Wen, Z., et al. (2017). "Constitutive
heterologous overexpression of a
Resistance to strong TIR-NB-ARC-LRR gene encoding a putative
pathogenic bacteria disease resistance protein from wild Chinese
Grape VpTNL1
pseudomonas Vitis pseudoreticulata in Arabidopsis and
syringae tobacco enhances resistance to
phytopathogenic fungi and bacteria." Plant
Physiol Biochem 112: 346-361.
44
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Wang, L., et al. (2017). "RING-H2-type E3
gene VpRH2 from Vitis pseudoreticulata
Resistance to
Grape VpRH2 powdery mildew improves
resistance to powdery mildew by
interacting with VpGRP2A." J Exp Bot 68(7):
1669-1687.
Sun, T., et al. (2017). "VvVHP1; 2 Is
To improve
Transcriptionally Activated by VvMYBA1
Grape VvVHP1;2
anthocyaninaccumu and Promotes Anthocyanin Accumulation of
lation
Grape Berry Skins via Glucose Signal." Front
Plant Sci 8: 1811.
Be able to have
quick response to
Jiao, L., et al. (2017). "Overexpression of a
biotic and abiotic
stress-responsive U-box protein gene VaPUB
stress and
affects the accumulation of resistance related
Grape VaPUB
obviously affect proteins in Vitis vinifera 'Thompson
accumulation of Seedless'." Plant Physiol Biochem
112:
disease resistance 53-63.
related proteins
Huang, W., et al. (2017). "Functional
Characterization of a Novel R2R3-MYB
To increase
Epime EsMYB9 anthocyanin and Transcription Factor
Modulating the
chumFlavonoid Biosynthetic Pathway from
flavonol content
Epimedium sagittatum." Front Plant Sci 8:
1274.
To play an
Cai, Y., et al. (2017). "Overexpression of a
important role in
biotic and abiotic
Grapevine Sucrose Transporter (VvSUC27) in
Grape VvSUC27
Tobacco Improves Plant Growth Rate in the
stress response,
Presence of Sucrose In vitro." Front Plant Sci
especially in the
8: 1069.
presence of sucrose
To promote plant
growth, reduce
Xie, X. and Y. Wang (2016). "VqDUF642, a
botrytis cinerea
gene isolated from the Chinese grape Vitis
sensibility and
Grape VqDUF642 enhance resistance quinquangularis, is
involved in berry
development and pathogen resistance." Planta
to erysipelas and
244(5): 1075-1094.
Metarhizium
anisopliae
To make stress
Dubrovina, A. S., et al (2015). "VaCPK20, a
response in
calcium-dependent protein kinase gene of
non-stress
Grape VaCPK20 conditions, wild grapevine Vitis
amurensis Rupr.,
mediates cold and drought stress tolerance." J
post-freezing and
Plant Physiol 185: 1-12.
drought stress
Aleynova, 0. A., et al. (2015). "Regulation of
Positively regulates
resveratrol production in Vitis amurensis cell
VaCPK29 factors take part in
Grape cultures by calcium-dependent protein
VaCPK20 the biosynthesis of
resveratrol
kinases." Appl Biochem Biotechnol 175(3):
1460-1476.
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
The overexpression
Nicolas, P., et al. (2014). The basic leucine
strongly enhances
the accumulation of zipper transcription factor ABSCISIC ACID
RESPONSE ELEMENT-BINDING
diphenylethene
Grape VvABF2 FACTOR2 is an important
transcriptional
(resveratrol) which
regulator of abscisic acid-dependent grape
is beneficial to
berry ripening processes." Plant Physiol
plant defense and
164(1): 365-383.
human healthy
To obtain
adaptability,
Fujimori, N., et al. (2014). "Plant
tolerance and DNA DNA-damage repair/toleration 100
protein
Grape VvDRT100-L
repairation to
repairs UV-B-induced DNA damage." DNA
ultraviolet light Repair (Amst) 21: 171-176.
stress
Marchive, C., et al. (2013). "Over-expression
To enhance of VvWRKY1 in grapevines induces
Grape VvWRKY1
resistance to downy expression of j asmonic acid pathway-related
mildew in grapes genes and confers higher tolerance to
the
downy mildew." PLoS One 8(1): e54185.
To hasten growth
Kohno, M., et al. (2012).
speed, including
"Auxin-nonresponsive grape Aux/IAA19 is a
Grape VvIAA19 root elongation and
positive regulator of plant growth." Mol Biol
flower
transformation Rep 39(2): 911-917.
Kobayashi, M., et al. (2012).
Tolerance to cold,
"Characterization of grape C-repeat-binding
VvCBF2
Grape drought and salt
factor 2 and B-box-type zinc finger protein in
VvZFPL
stress transgenic Arabidopsis plants under
stress
conditions." Mol Biol Rep 39(8): 7933-7939.
Deluc, L., et al. (2008) "The transcription
Anthocyanin and
factor VvMYB5b contributes to the regulation
procyani dine
Grape VvMYB5b of anthocyanin and proanthocyanidin
derivate
biosynthesis in developing grape berries."
accumulation
Plant Physiol 147(4): 2041-2053.
Mzid, R., et al. (2007). "Overexpression of
Resistance to VvWRKY2 in tobacco enhances broad
Grape VvWRKY2
fungal pathogens
resistance to necrotrophic fungal pathogens."
Physiol Plant 131(3): 434-447.
Marchive, C., et al. (2007). "Isolation and
characterization of a Vitis vinifera
Resistance to transcription factor, VvWRKY1, and
its
Grape VvWRKY1
fungal pathogens effect on responses to fungal
pathogens in
transgenic tobacco plants." J Exp Bot 58(8):
1999-2010.
46
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
To increase the
Deluc, L., etal. (2006). "Characterization of a
biosynthesis of
grapevine R2R3-MYB transcription factor
Grape VvMYB5a condensed tannins
that regulates the phenylpropanoid pathway."
and change xylogen
Plant Physiol 140(2): 499-511.
metabolism
Qiu, Z., et al. (2019). "The eggplant
Ralstonia transcription factor myb44 enhances
Eggpla
SmMYB44 solanacearum
resistance to bacterial wilt by activating the
nt
resistance expression of spermidine synthase".
Journal
of Experimental Botany(19), 19.
Zhang, Y., et al. (2014). "Anthocyanin
accumulation and molecular analysis of
Eggpla Anthocyanin
anthocyanin biosynthesis-associated genes in
SmMYB1
nt accumulation
eggplant (Solanum melongena L.)." Journal
of Agricultural & Food Chemistry 62(13):
2906.
Zhou, L., et al. (2019). "CBFs Function in
Eggpla SmCBFs Anthocyanin
Anthocyanin Biosynthesis by Interacting with
nt SmMYB113 accumulation
MYB113 in Eggplant (Solanum melongena
L.)." Plant and Cell Physiology(2): 2.
Bracuto, V., et al. (2017). "Functional
characterization of the powdery mildew
Eggpla Powdery mildew
SmML01
susceptibility gene SmML01 in eggplant
nt susceptibility genes
(Solanum melongena L.)." Transgenic
Research 26(3): 1-8.
Chines
Ding, Q., etal. (2018). "Ectopic expression of
To regulate organ a
Brassica rapa AINTEGUMENTA gene
BrANT-1 size of Chinese
(BrANT-1) increases organ size and stomatal
cabbag
cabbage density in Arabidopsis." Sci Rep 8(1):
10528.8(1):10528-.
Wang, N., et al. (2020). "Defect in Brnyml, a
Chines
To keep green
magnesium-dechelatase protein, causes a
Brnyml
stay-green phenotype in an EMS-mutagenized
cabbag phenotype of leaves
Chinese cabbage (Brassica campestris L. ssp.
pekinensis) line." Hortic Res 7(1): 8.
Chines
Wang, B., et al. (2010). "Ectopic expression
To regulate organ
of a Chinese cabbage BrARGOS gene in
BrARGOS size of Chinese
cabbag
Arabidopsis increases organ size." Transgenic
cabbage
Res 19(3): 461-472.
Chines
Peng, S., etal. (2019). "Mutation of ACX1, a
Relates to petal
Jasmonic Acid Biosynthetic Enzyme, Leads
Bra040093 development in to
Petal Degeneration in Chinese Cabbage
cabbag
Chinese cabbage
(Brassica campestris ssp. pekinensis)." Int J
Mol Sci 20(9).
Chines
Wang, Y., et al. (2014). "BrpSPL9 (Brassica
Early-maturing rapa ssp. pekinensis SPL9) controls
the
BrpSPL9-2
cabbag improvement earliness of heading time in Chinese
cabbage." Plant Biotechnol J 12(3): 312-321.
47
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Kim, H. S., et al. (2014). "Overexpression of
Chines the Brassica rapa transcription
factor
Resistance to carrot WRKY12 results in reduced soft rot
BrWRKY12
cabbag bacterial blight symptoms caused by Pectobacterium
carotovorum in Arabidopsis and Chinese
cabbage." Plant Biol (Stuttg) 16(5): 973-981.
Fan, L., et al. (2020). "A genome-wide
Anthocyanin association study uncovers a critical
role of
Radish RsPAP2
accumulation the RsPAP2 gene in red-skinned
Raphanus
sativus L." Hortic Res 7: 164.
Wang, Y., et al. (2020). "Genome-Wide
Identification and Functional Characterization
RsCPA31
Radish Salt stress tolerance of the Cation Proton Antiporter
(CPA) Family
(RsNHX1)
Related to Salt Stress Response in Radish
(Raphanus sativus L.)." Int J Mol Sci 21(21).
Wang, Y., et al. (2020). "Characterization of
Radish RsOFP2.3 To regulate the OFP Gene Family and its
Putative
tuberous root shape Involvement of Tuberous Root Shape in
Radish." Int j Mol Sci 21(4).
Huang, J., et al. (2020). "CaASR1 promotes
salicylic acid- but represses jasmonic
Ralstonia
acid-dependent signaling to enhance the
Pepper CaASR1 solanacearum
resistance of Capsicum annuum to bacterial
resistance
wilt by modulating CabZIP63." J Exp Bot
71(20): 6538-6554.
Ali, M., et al. (2020). "The CaChiVI2 Gene of
Capsicum annuum L. Confers Resistance
Thermo and
Pepper CaChiVI2 Against Heat Stress and Infection of
drought tolerance
Phytophthora capsici." Front Plant Sci 11:
219.
Zhang, H., et al. (2020). "Molecular and
Functional Characterization of CaNAC035,
Tolerance to abiotic
Pepper CaNAC035 an
NAC Transcription Factor From Pepper
stresses
(Capsicum annuum L.)." Front Plant Sci 11:
14.
Table E lists the representative functional genes in soybean. Methods in the
present
invention can be used to edit such genes and create new genes by designing new
combinations of different gene elements or different protein domain, and can
be utilized in
soybean breeding program.
Table E: Important functional genes in soybean
Gene
Gene number Application Reference
name
Ma, X., et al. (2021). "Functional
characterization of soybean (Glycine max)
GmDIR27 Glyma.05g213400 Resistance toD RIGENT genes reveals an important role
of
pod cracking
GmDIR27 in the regulation of pod
dehiscence." Genomics 113(1 Pt 2): 979-990
48
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Zhao, Y., et al. (2020). "Genome-Wide
Analysis of the Glucose-6-Phosphate
GmG6PD Dehydrogenase Family in Soybean and
Glyma.19G082300 Salt tolerance
H2 Functional Identification of GmG6PDH2
Involvement in Salt Stress." Front Plant Sci
11:214.
Zhang, G., et al. (2020). "Phospholipase D-
and phosphatidic acid-mediated phospholipid
GmPLDal Root nodule
Glyma.01G215100
development
interaction
and signaling modulate symbiotic
phal
and nodulation in soybean (Glycine
max)." Plant J.
Wei, Z., et al. (2020). "GmGPA3 is involved in
Growth
post-Golgi trafficking of storage proteins and
GmGPA3 Glyma.20G32900
development cell growth in soybean cotyledons." Plant Sci
294: 110423.
Wang, W., et al. (2020). "GmNMHC5, A
GmNMHC Glyma.13G255200 Development Neoteric Positive Transcription Factor
of
stage Flowering and Maturity in
Soybean." Plants
(Basel) 9(6).
Wang, L., et al. (2020). "Natural variation and
CRISPR/Cas9-mediated mutation in
Development
GmPRR37 Glyma.12G073900
GmPRR37 affect photoperiodic flowering and
stage
contribute to regional adaptation of soybean."
Plant Biotechnol J 18(9): 1869-1881.
Shi, Y., et al. (2020). "RNA
Sequencing-Associated Study Identifies
Glyma.11G150400. Root nodule
GmDRR1 GmDRR1 as Positively Regulating the
1 development
Establishment of Symbiosis in Soybean." Mol
Plant Microbe Interact 33(6): 798-807.
Jahan, M. A., et al. (2020). "Glyceollin
Resistance to
GmMYB2 Transcription Factor GmMYB29A2 Regulates
Glyma.02G005600 phytophthora
9A2
Soybean Resistance to Phytophthora sojae."
sojae
Plant Physiol 183(2): 530-546.
He, Y., et al. (2020). "Functional activation of
GmMYB6 Glyma.04G042300. Salt alkali a novel R2R3-MYB protein gene, GmMYB68,
8 1 tolerance confers salt-alkali resistance in
soybean
(Glycine max L.)." Genome 63(1): 13-26.
Zhang, W., et al. (2019). "A cation diffusion
facilitator, GmCDF1, negatively regulates salt
GmCDF1 Glyma.08G102000 Salt tolerance
tolerance in soybean." PLoS Genet 15(1)
e1007798.
Zhang, C., et al. (2019). "GmBTB/POZ, a
Resistance to novel BTB/POZ domain-containing nuclear
GmBTB /
Glyma.04G244900 phytophthora protein, positively regulates the response of
POZ
sojae
soybean to Phytophthora sojae infection." Mol
Plant Pathol 20(1): 78-91.
49
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Wang, L., etal. (2019). "GmSnRK1.1, a
Resistance to Sucrose Non-fermenting-1(SNF1)-Related
GmSnRK1
Glyma.08G240300 phytophthora Protein Kinase, Promotes Soybean Resistance
.1
soj ae to
Phytophthora sojae." Front Plant Sci 10:
996.
Li, S., et al. (2019). "A
GmSIN1/GmNCED3s/GmRbohBs
Glyma.12G221500. Feed-Forward Loop Acts as a
Signal Amplifier
GmSIN1 Salt tolerance
1 That Regulates Root Growth in Soybean
Exposed to Salt Stress." Plant Cell 31(9):
2107-2130.
GmHsp90 Thermo
Huang, Y., et al. (2019). "GmHsp90A2 is
Glyma.16G178800 involved in soybean heat
stress as a positive
A2 tolerance
regulator." Plant Sci 285: 26-33.
Chen, X., etal. (2019). "Overexpression of a
Resistance to soybean 4-coumaric acid: coenzyme A ligase
GmPI4L NM.001256363.1 phytophthora (GmPI4L) enhances resistance to
Phytophthora
soj ae
sojae in soybean." Funct Plant Biol 46(4):
304-313.
Chen, L., et al. (2019). "A nodule-localized
Root nodule phosphate transporter GmPT7 plays an
GmPT7 Glyma.14G188000 development; important role in enhancing symbiotic N2
increase yield fixation and yield in soybean." New Phytol
221(4): 2013-2025.
Xu, S., et al. (2021). "GmbZIP1 negatively
Root nodule regulates ABA-induced inhibition of
GmbZIP1 Glyma.02G131700
development nodulation by targeting GmENOD40-1 in
soybean." BMC Plant Biol 21(1): 35.
Lyu, X., et al. (2021). "GmCRYls modulate
GmCRY1
Tolerance to gibberellin metabolism to regulate soybean
Glyma.06G103200
close planting shade avoidance in response to reduced blue
light." Mol Plant 14(2): 298-314.
Li, M., et al. (2021). "GmNAC06, a NAC
GmNACO domain transcription factor enhances salt stress
Glyma.06g21020.1 Salt tolerance
6
tolerance in soybean." Plant Mol Biol 105(3):
333-345.
Salt and Yang, Y., et al. (2020). "The Soybean
bZIP
GmbZIP2 Glyma.14G002300 drought
Transcription Factor Gene GmbZIP2 Confers
tolerance Drought and Salt Resistances in
Transgenic
Plants." Int .1- Mol Sci 21(2).
Yang, C., et al. (2020). "GmNAC8 acts as a
Glyma.16G151500. Drought
GmNAC8
1 tolerance
positive regulator in soybean drought stress."
Plant Sci 293: 110442.
Wang, Y., et al. (2020). "GmPAP12 Is
Root nodule Required for Nodule Development and
GmPAP12 Glyma.06G028200 Nitrogen Fixation Under Phosphorus
development
Starvation in Soybean." Front Plant Sci 11:
450.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Ma, X. J., et al. (2020). "GmNFYA13
Salt and
GmNFYA Glyma.13G202300 drought Improves Salt and Drought
Tolerance in
13
Transgenic Soybean Plants." Front Plant Sci
tolerance
11: 587244.
Liu, S., et al. (2020). "Overexpression of
GmAAP6a enhances tolerance to low nitrogen
Tolerance to
and improves seed nitrogen status by
GmAAP6a Glyma.17g192000 nitrogen
optimizing amino acid partitioning in
deficiency
soybean." Plant Biotechnol J 18(8):
1749-1762.
Li, C., et al. (2020). "A
To regulate
Glyma.12G073900.
Domestication-Associated Gene GmPRR3b
GmPRR3b development
1
Regulates the Circadian Clock and Flowering
stage
Time in Soybean." Mol Plant 13(5): 745-759.
Chen, L., et al. (2020). "Overexpression of
Tolerance to GmMYB14 improves high-density yield and
GmMYB1
Glyma.15G259400 close planting drought tolerance of soybean through
4
and drought regulating plant architecture mediated by the
brassinosteroid pathway." Plant Biotechnol J.
Chen, L., et al. (2020). "Soybean AP1
To increase
GmAP1 Glyma.16G091300
homologs control flowering time and plant
yield
height." J Integr Plant Biol 62(12): 1868-1879.
Chen, K., et al. (2020). "Overexpression of
Drought GmUBC9 Gene Enhances Plant Drought
GmUBC9 Glyma.03G199900 tolerance; late Resistance and Affects Flowering Time
via
maturing Histone H2B Monoubiquitination." Front Plant
Sci 11 555794.
Zhang, D., et al. (2019). "Artificial selection
GmOLE0 High seed oil on GmOLE01 contributes to the increase in
Glyma.20G196600
1 content .. seed oil during soybean
domestication." PLoS
Genet 15(7): e1008267.
Xun, H., et al. (2019). "Over-expression of
Resistance to GmKR3, a TIR-NBS-LRR type R gene,
GmKR3 Glyma.06G267300
viral diseases confers resistance to multiple viruses
in
soybean." Plant Mol Biol 99(1-2): 95-111.
Wang, Y., et al. (2019). "GmYUC2a mediates
GmYUC2 Root nodule auxin biosynthesis during root development
Glyma.08G038600
a development and nodulation in soybean." J Exp Bot
70(12):
3165-3176.
Indrasumunar, A., et al. (2011). "Nodulation
GmNFRla Root nodule factor receptor kinase lalpha controls nodule
Glyma.02G270800
1pha development organ number in soybean (Glycine max
L.
Merr)." Plant J 65(1): 39-50.
Zhu, B., et al. (2006). "Identification and
characterization of a novel heat shock
Glyma.16G091800. Thermo
GmHsfAl
1 tolerance transcription factor gene,
GmHsfAl, in
soybeans (Glycine max)." J Plant Res 119(3):
247-256.
51
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
To enhance
resistance to Wu, D., et al. (2020). "Identification
of a
phytophthora candidate gene associated with
isoflavone
GmMPK1 Glyma.08G309500 sojae; to
content in soybean seeds using genome-wide
increase association and linkage mapping."
Plant J
isoflavone 104(4): 950-963.
content
Resistance to Cheng, Q., et al. (2015). "Overexpression of
phytophthora Soybean Isoflavone Reductase (GmIFR)
GmIFR NM 001254100
sojae in
Enhances Resistance to Phytophthora sojae in
soybean Soybean." Front Plant Sci 6: 1024.
Zhou, Z., et al. (2015). "Overexpression of a
Resistance to GmCnx1 gene enhanced activity of nitrate
GmCnx1 NM 001255600 mosaic virus reductase and aldehyde oxidase, and boosted
SMV
mosaic virus resistance in soybean." PLoS One
10(4): e0124273.
Resistance to Jiang, L., et al. (2015). "Isolation
and
phytophthora Characterization of a Novel
sojae No.1 Pathogenesis-Related Protein Gene (GmPRP)
GmPRP KM506762
physiological with Induced Expression in Soybean (Glycine
race in max) during Infection with
Phytophthora
soybean sojae."
PLoS One 10(6): e0129932.
Resistance to Cheng, Q., et al. (2015). "Overexpression of
phytophthora Soybean Isoflavone Reductase (GmIFR)
GmIFR NM 001254100,
sojae in
Enhances Resistance to Phytophthora sojae in
soybean Soybean." Front Plant Sci 6: 1024.
Hao, Q., et al. (2016). "Identification and
Comparative Analysis of CBS
Nitrogen use Domain-Containing Proteins in Soybean
GmCBS21 Glyma.06G032200
efficiency (Glycine max) and the Primary Function of
GmCBS21 in Enhanced Tolerance to Low
Nitrogen Stress." Int J Mol Sci 17(5).
Lu, X., et al. (2016). "The transcriptomic
Seed weight and seed oil
GA200X, G1yma07g08950,
signature of developing soybean seeds reveals
NFYA Glyma02g47380
the genetic basis of seed trait adaptation during
content
domestication." Plant J 86(6): 530-544.
Li, N., et al. (2017). "A Novel Soybean
Resistance to
Dirigent Gene GmDIR22 Contributes to
GmDIR22 HQ 993047 phytophthora
Promotion of Lignan Biosynthesis and
sojae in
Enhances Resistance to Phytophthora sojae."
soybean
Front Plant Sci 8: 1185.
To increase Li, Q. T., et al. (2017). "Selection
for a
seed oil
Zinc-Finger Protein Contributes to Seed Oil
GmZF351 Glyma06g44440
content in Increase during Soybean Domestication." Plant
soybean Physiol 173(4): 2208-2224.
52
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Xu, Z., et al. (2017). "The Soybean Basic
Helix-Loop-Helix Transcription Factor
Resistance to
ORG3-Like Enhances Cadmium Tolerance via
GmORG3 Glyma03g28630 chromium
Increased Iron and Reduced Cadmium Uptake
stress
and Transport from Roots to Shoots." Front
Plant Sci 8: 1098.
To promote Zhang, C., et al. (2017). "Functional analysis
GmESR1 JN590243.1 seed of
the GmESR1 gene associated with soybean
germination
regeneration." PLoS One 12(4): e0175656.
To promote
plant
Zeng, X., et al. (2018). "Soybean MADS-box
maturation for gene GmAGL1 promotes flowering via the
GmAGL1 AW433203
early
photoperiod pathway." BMC Genomics 19(1):
flowering and 51.
early maturing
Zhou, L., et al. (2014). "Constitutive
GmPIP1;6 Gm08g01860.1
Salt tolerance overexpression of soybean plasma membrane
intrinsic protein GmPIP1;6 confers salt
tolerance." BMC Plant Biol 14: 181.
Zhou, L., et al. (2014). "Overexpression of
GmAKT2 potassium channel enhances
GmAKT2 Glym08g20030.1 SMV tolerance
resistance to soybean mosaic virus." BMC
Plant Biol 14: 154.
Table F lists the representative functional genes in corn. Methods in the
present
invention can be used to edit such genes and create new genes by designing new
combinations of different gene elements or different protein domain, and can
be utilized in
corn breeding program.
Table F: Important functional genes in corn
Gene name Application Reference
Cai, G., et al. (2014). "A maize mitogen-activated protein
Drought and salt kinase kinase, ZmMKK1, positively regulated the
salt and
ZmMKK1
tolerance drought tolerance in transgenic Arabidopsis." J
Plant Physiol
171(12): 1003-1016.
To increase de Castro, M., et al. (2014). "Early cell-wall
modifications of
ZmCesA7 cellulose content in maize cell cultures during habituation to
dichlobenil." J Plant
cells Physiol 171(2): 127-135.
To increase de Castro, M., et al. (2014). "Early cell-wall
modifications of
ZmCesA8 cellulose content in maize cell cultures during habituation to
dichlobenil " J Plant
cells Physiol 171(2): 127-135.
To increase grain Guo, M., et al. (2014). "Maize ARGOS1 (ZAR1) transgenic
ZmARGOS1 yield and improve
alleles increase hybrid maize yield." J Exp Bot 65(1):
drought tolerance 249-260.
Li, C., et al. (2014). "Ectopic expression of a maize hybrid
To control corn leaf down-regulated gene ZmARF25 decreases organ size by
ZmARF25
size affecting cellular proliferation in Arabidopsis."
PLoS One
9(4): e94830.
53
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Liu, Y., et al. (2014). "Group 5 LEA protein, ZmLEA5C,
enhance tolerance to osmotic and low temperature stresses in
ZmLEA5C Stress resistance
transgenic tobacco and yeast." Plant Physiol Biochem 84:
22-31.
Suzuki, M., et al. (2014). "Distinct functions of COAR and
B3 domains of maize VP1 in induction of ectopic gene
ZmVP1 Seed development
expression and plant developmental phenotypes in
Arabidopsis." Plant Mol Biol 85(1-2): 179-191.
Wang, B., et al. (2014). "Maize ZmRACK1 is involved in the
ZmRACK1 Disease resistance plant response to fungal phytopathogens." Int J
Mol Sci
15(6): 9343-9359.
Wu, L., et al. (2014). "Overexpression of the maize GRF10,
To affect leaf size an endogenous truncated growth-regulating factor protein,
ZmGRF 10
and plant height leads to reduction in leaf size and plant height." J Integr
Plant
Biol 56(11): 1053-1063.
Zm
Zanin, L., et al. (2014). "Isolation and functional
urea-proton To increase urea
characterization of a high affinity urea transporter from roots
symporter uptake
of Zea mays." BMC Plant Biol 14: 222.
DUR3
To participate in
signal transduction Zhang, D., et al. (2014). "The overexpression of
a maize
pathway of salt mitogen-activated protein kinase gene (ZmMPK5)
confers
ZmMPK5
stress, oxidative salt stress tolerance and induces defence
responses in
stress and pathogen
tobacco." Plant Biol (Stuttg) 16(3): 558-570.
defense
Zhao, S., et al. (2014). "ZmS0C1, a MADS-box transcription
ZmS0C1 Early flowering factor from Zea mays, promotes flowering in
Arabidopsis."
Int J Mol Sci 15(11): 19987-20003.
Zhao, Y., et al. (2014). "A novel maize homeodomain-leucine
Drought and salt zipper (HD-Zip) I gene, Zmhdz10, positively
regulates
Zmhdz10
tolerance drought and salt tolerance in both rice and
Arabidopsis."
Plant Cell Physiol 55(6): 1142-1156.
Gao, Y., et al. (2015). "A maize phytochrome-interacting
Drought and salt
ZmPIF3 factor 3 improves drought and salt stress
tolerance in rice."
tolerance
Plant Mol Biol 87(4-5): 413-428.
Huo, Y., et al. (2015). "Overexpression of the Maize psbA
Gene Enhances Drought Tolerance Through Regulating
ZmpsbA Drought tolerance Antioxidant System, Photosynthetic Capability,
and Stress
Defense Gene Expression in Tobacco." Front Plant Sci 6:
1223.
Li, S., et al. (2015). "Overexpression of ZmIRT1 and
ZmIRT1 Iron uptake ZmZIP3 Enhances Iron and Zinc Accumulation in
Transgenic
Arabidopsis." PLoS One 10(8): e0136647.
Li, S., et al. (2015). "Overexpression of ZmIRT1 and
ZmZIP3 Zinc uptake ZmZIP3 Enhances Iron and Zinc Accumulation in
Transgenic
Arabidopsis." PLoS One 10(8): e0136647.
Liu, Y., et al. (2015). "Characterization and functional
Drought and salt
ZmBDF analysis of a B3 domain factor from Zea mays." J
App! Genet
tolerance
56(4): 427-438.
54
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Shi, J., et al. (2015). "Overexpression of ARGOS Genes
ZmARGOS8 Drought tolerance, Modifies Plant Sensitivity to Ethylene, Leading to
Improved
yield increase Drought Tolerance in Both Arabidopsis and Maize."
Plant
Physiol 169(1): 266-282.
Weckwerth, P., et al. (2015). "ZmCPK1, a
calcium-independent kinase member of the Zea mays CDPK
ZmCPK1 Cold stress
gene family, functions as a negative regulator in cold stress
signalling." Plant Cell Environ 38(3): 544-558.
Wu, L., et al (2015). "Overexpression of ZmMAPK1
Drought tolerance
ZmMAPK1 enhances drought and heat stress in transgenic
Arabidopsis
and thermos stress
thaliana." Plant Mol Biol 88(4-5): 429-443.
To promote plant
flowering, stem Xu, M., et al. (2015). "ZmGRF, a GA regulatory factor from
ZmGRF elongation and cell maize, promotes flowering and plant growth in
Arabidopsis."
expansion, GA Plant Mol Biol 87(1-2): 157-167.
singal
Yan, J., et al. (2015). "Calcium and ZmCCaMK are involved
ZmCCaMK Antioxidant defense in brassinosteroid-induced antioxidant defense in
maize
leaves." Plant Cell Physiol 56(5) 883-896.
Drought tolerance Zhou, X., et al. (2015). "A maize jasmonate Zim-
domain
ZmJAZ14 and growth protein, ZmJAZ14, associates with the JA, ABA,
and GA
promotion signaling pathways in transgenic Arabidopsis."
PLoS One
regulation 10(3): e0121824.
Alter, P., et al. (2016). "Flowering Time-Regulated Genes in
ZmMADS1 Early flowering Maize Include the Transcription Factor
ZmMADS1." Plant
Physiol 172(1): 389-404.
To adjust contents
of stearic acid, oil
acid and long chain Du, H., et al. (2016). "Modification of the
fatty acid
ZmSAD1 saturated acid and composition in Arabidopsis and maize seeds
using a
the proportion of stearoyl-acyl carrier protein desaturase-1 (ZmSAD1) gene."
saturated fatty acid BMC Plant Biol 16(1): 137.
and unsaturated
fatty acid
Gu, L., et al. (2016). "ZmGOLS2, a target of transcription
ZmGOLS2 Stress resistance factor ZmDREB2A, offers similar protection
against abiotic
stress as ZmDREB2A." Plant Mol Biol 90(1-2): 157-170.
He, L., et al. (2016). "Maize OXIDATIVE STRESS2
Homologs Enhance Cadmium Tolerance in Arabidopsis
ZmOXS2b Stress resistance
through Activation of a Putative SAM-Dependent
Methyltransferase Gene." Plant Physiol 171(3): 1675-1685.
He, L., et al. (2016). "Maize OXIDATIVE STRESS2
Homologs Enhance Cadmium Tolerance in Arabidopsis
ZmO2L1 Stress resistance
through Activation of a Putative SAM-Dependent
Methyltransferase Gene." Plant Physiol 171(3): 1675-1685.
Huang, H., et al. (2016). "Sucrose and ABA regulate starch
ZmEREB156 Starch synthesis biosynthesis in maize through a novel
transcription factor,
ZmEREB156." Sci Rep 6: 27590.
To stimulate
Li, S., et al. (2016). "Constitutive expression of the ZmZIP7
ZmZIP7 endogenous iron and in Arabidopsis alters metal homeostasis and
increases Fe and
zinc uptake Zn content." Plant Physiol Biochem 106: 1-
10.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
To enhance Liu, Y., et al. (2016). "Group 3 LEA Protein,
ZmLEA3, Is
ZmLEA3 tolerance to cold Involved in Protection from Low Temperature
Stress." Front
stress Plant Sci 7: 1011.
To improve Lowe, K., et al. (2016). "Morphogenic Regulators
Baby
Baby boom
transformation boom and Wuschel Improve Monocot Transformation." Plant
(BBM)
efficiency Cell 28(9): 1998-
2015.
To improve Lowe, K., et al. (2016). "Morphogenic Regulators
Baby
Wuschel2
transformation boom and Wuschel Improve Monocot Transformation." Plant
efficiency Cell 28(9): 1998-
2015.
Ma, F., et al. (2016). "ZmABA2, an interacting protein of
Drought and salt
ZmABA2 ZmMPK5, is involved in abscisic acid
biosynthesis and
tolerance
functions." Plant Biotechnol J 14(2): 771-782.
Mao, H., et al. (2016). "ZmNAC55, a maize stress-responsive
ZmNAC55 Drought tolerance NAC transcription factor, confers drought
resistance in
transgenic Arabidopsis." Plant Physiol Biochem 105: 55-66.
Sun, X., et al. (2016). "Maize ZmVPP5 is a truncated
To enhance salt
ZmVPP5 Vacuole H(+) -PPase that confers hypersensitivity
to salt
sensitivity
stress." J Integr Plant Biol 58(6): 518-528.
Active GTP
Wang, Q., et al. (2016). "A maize ADP-ribosylation factor
combination,
ZmArf2 ZmArf2 increases organ and seed size by promoting cell
endosperm
development expansion in Arabidopsis." Physiol Plant 156(1):
97-107.
Wang, X., et al. (2016). "Isolation and functional
Cold stress characterization of a cold responsive
phosphatidylinositol
Zm SEC14p
resistance transfer-associated protein, ZmSEC14p, from maize
(Zea
may L.)." Plant Cell Rep 35(8): 1671-1686.
Zhang, F., et al. (2016). "Characterization of the calcineurin
B-Like (CBL) gene family in maize and functional analysis
ZmCBL9 Stress resistance
of ZmCBL9 under abscisic acid and abiotic stress
treatments." Plant Sci 253: 118-129.
Brugiere, N., et al. (2017). "Overexpression of RING Domain
ZmXericol Drought tolerance E3 Ligase ZmXericol Confers Drought Tolerance
through
Regulation of ABA Homeostasis." Plant Physiol 175(3):
1350-1369.
Brugiere, N., et al. (2017). "Overexpression of RING Domain
ZmXerico2 Drought tolerance E3 Ligase ZmXericol Confers Drought Tolerance
through
Regulation of ABA Homeostasis." Plant Physiol 175(3):
1350-1369.
Cai, H., et al. (2017). "A novel GRAS transcription factor,
ZmGRAS20 Starch synthesis ZmGRAS20, regulates starch biosynthesis in
rice
endosperm." Physiol Mol Biol Plants 23(1): 143-154.
Cai, R., et al. (2017). "The maize WRKY transcription factor
ZmWRKY17 Salt stress response ZmWRKY17 negatively regulates salt stress
tolerance in
transgenic Arabidopsis plants." Planta 246(6): 1215-1231.
Cao, H., et al. (2017). "Overexpression of the Maize
m Z NLP6 and ZmNLP8 Can Complement the Arabidopsis
ZmNLP6 Nitrogen utilization
Nitrate Regulatory Mutant n1p7 by Restoring Nitrate
Signaling and Assimilation." Front Plant Sci 8: 1703.
56
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Cao, H., et al. (2017). "Overexpression of the Maize
ZmNLP6 and ZmNLP8 Can Complement the Arabidopsis
ZmNLP8 Nitrogen utilization
Nitrate Regulatory Mutant n1p7 by Restoring Nitrate
Signaling and Assimilation." Front Plant Sci 8: 1703.
Dong, Z., et al. (2017). "Ideal crop plant architecture is
To improve plant mediated by tassels replace upper earsl, a BTB/POZ ankyrin
TRU1
morphology
repeat gene directly targeted by TEOSINTE BRANCHED1."
Proc Natl Acad Sci U S A 114(41) E8656-E8664
To regulate
Du, Y., et al. (2017). "UNBRANCHED3 regulates branching
UNBRANCH vegetative and
by modulating cytokinin biosynthesis and signaling in maize
ED3 /UB3 reproductive
and rice." New Phytol 214(2): 721-733.
branching
Hong, C., et al. (2017). "The role of ZmWRKY4 in
ZmWRKY4 Oxidation resistance regulating maize antioxidant defense under
cadmium stress."
Biochem Biophys Res Commun 482(4): 1504-1510.
Li, H., et al. (2017). "The maize CorA/MRS2/MGT-type Mg
To enhance
ZmMGT10 tolerance
to Mg transporter, ZmMGT10, responses to magnesium deficiency
and confers low magnesium tolerance in transgenic
deficiency in corn
Arabidopsis." Plant Mol Biol 95(3): 269-278
Li, T., et al. (2017). "Regulation of Seed Vigor by
To increase seed
ZmGOLS2
Manipulation of Raffinose Family Oligosaccharides in Maize
vigor
and Arabidopsis thaliana." Mol Plant 10(12): 1540-1555.
Li, T., et al. (2017). "Regulation of Seed Vigor by
To reduce seed
ZmRS
Manipulation of Raffinose Family Oligosaccharides in Maize
vigor
and Arabidopsis thaliana." Mol Plant 10(12): 1540-1555.
Liu, J., et al. (2017). "The Conserved and Unique Genetic
To increase grain
ZmINCW1
Architecture of Kernel Size and Weight in Maize and Rice."
size/weight
Plant Physiol 175(2): 774-785.
To enhance
Liu, Y., et al. (2017). "Functional characterization of KS-type
ZmDHN13 tolerance
to dehydrin ZmDHN13 and its related conserved domains under
oxidative stress oxidative stress." Sci Rep 7(1): 7361.
Shi, Q., et al. (2017). "Functional Characterization of the
To respond to
ZmPIF4 Maize Phytochrome-Interacting Factors PIF4 and
PIF5."
phytochrome singals
Front Plant Sci 8:2273.
Shi, Q., et al. (2017). "Functional Characterization of the
To respond to
ZmPIF5 Maize Phytochrome-Interacting Factors PIF4 and
PIF5."
phytochrome singals
Front Plant Sci 8:2273.
Wang, C., et al. (2017). "ABP9, a maize bZIP transcription
ABP9 Stress resistance factor, enhances tolerance to salt and
drought in transgenic
cotton." Planta 246(3): 453-469.
Wang, J., et al. (2017). "Overexpression of the protein
Low phosphate phosphatase 2A regulatory subunit a gene
ZmPP2AA1
ZmPP2AA1
response improves low phosphate tolerance by remodeling
the root
system architecture of maize." PLoS One 12(4): e0176538.
Xiao, Q., et al. (2017). "ZmMYB14 is an important
transcription factor involved in the regulation of the activity
ZmMYB14 Starch synthesis
of the ZmBT1 promoter in starch biosynthesis in maize."
FEBS J 284(18): 3079-3099.
Zandvakili, N., et al. (2017). "Cloning, Overexpression and
Resistance to plant
ZmPR10 in vitro
Antifungal Activity of Zea Mays PR10 Protein." Iran
pathogenic fungi
J Biotechnol 15(1): 42-49.
57
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Zhu, L., et al. (2020). Overexpression of SFA1 in engineered
S ccharomyces cerevisiae to increase xylose utilization and
SFA1 Cellulose hydrolysis
ethanol production from different lignocellulose
hydrolysates. Bioresour Technol 313, 123724.
Wang, H.,et al. (2021). The maize SUMO conjugating
ZmSCElb Paraquat resistance enzyme ZmSCElb protects plants from paraquat
toxicity.
Ecotoxicol Environ Saf 211, 111909.
Fu, J., et al. (2021). Maize transcription factor ZmEREB20
ZmEREB20 Salt stress resistance enhanced salt tolerance in transgenic
Arabidopsis. Plant
Physiol Biochem 159, 257-267.
Zhu, D., et al. (2020). MAPK-like protein 1 positively
ZmMPKL1 Drought tolerance regulates maize seedling drought sensitivity by
suppressing
ABA biosynthesis. Plant J 102, 747-760.
Zhong, Y., et al. (2020). ZmCCD10a Encodes a Distinct Type
ZmCCD10a Phosphate stress of Carotenoid Cleavage Dioxygenase and Enhances
Plant
Tolerance to Low Phosphate. Plant Physiol 184, 374-392.
Zhang, X., Guo, W., Du, D., Pu, L., and Zhang, C. (2020).
Overexpression of a maize BR transcription factor ZmBZR1
ZmBZR1 Organ development .
in Arabidopsis enlarges organ and seed size of the transgenic
plants. Plant Sci 292, 110378.
Zhang, L., et al. (2020). Overexpression of the maize
ZmTMT Quality gamma-tocopherol methyltransferase gene
(ZmTMT)
improvement increases alpha-tocopherol content in transgenic
Arabidopsis
and maize seeds. Transgenic Res 29, 95-104.
Zhang, H., et al. (2020). Enhanced Vitamin C Production
Mediated by an ABA-Induced PTP-like Nucleotidase
ZmPTPN Drought tolerance
Improves Plant Drought Tolerance in Arabidopsis and Maize.
Mol Plant 13, 760-776.
Zhai, K., et al. (2020). Overexpression of Maize ZmMYB59
Gene Plays a Negative Regulatory Role in Seed Germination
ZmMYB59 Seed germination . . .
in Nicotiana tabacum and Oryza sativa. Front Plant Sci 11,
564665.
Resistance to Zang, Z., et al. (2020). A Novel ERF
Transcription Factor,
ZmERF105 exserohilum ZmERF105, Positively Regulates Maize Resistance
to
turcicum Exserohilum turcicum. Front Plant Sci 11, 850.
58
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Yang, Z., et al. (2020). The transcription factor ZmNAC126
To accelerate accelerates leaf senescence downstream of the
ethylene
ZmNAC126
maturation signalling pathway in maize. Plant Cell Environ
43,
2287-2300.
Yang, Y.Z., et al. (2020). EMP32 is required for the
EMP32
Seed development cis-splicing of nad7 intron 2 and seed development in maize.
RNA Biol, 1-11.
Phosphate Xu, Y., et al. (2020). Overexpression of a
phosphate
transportation to
transporter gene ZmPt9 from maize influences growth of
ZmPt9
promote crop transgenic Arabidopsis thaliana. Biochem Biophys
Res
growth Commun.
Xiang, Y.,et al. (2020). ZmNAC49 reduces stomatal density
ZmNAC49 Drought tolerance
to improve drought tolerance in maize. J Exp Bot.
Wang, X., et al. (2020). The Transcription Factor NIGT1.2
To maintain
Modulates Both Phosphate Uptake and Nitrate Influx during
NIGT1.2
nitrogen and
Phosphate Starvation in Arabidopsis and Maize. Plant Cell
phosphorus balance 32, 3519-3534.
Wang, C., et al.(2020). Functional characterization of a
chloroplast-localized Mn(2+)(Ca(2+))/H(+) antiporter,
ZmmCCHAl Photosynthesis
ZmmCCHAl from Zea mays ssp. mexicana L. Plant Physiol
Biochem 155, 396-405.
ZmBES1/BZ Grain development, Sun, F., et al. (2020). Maize transcription
factor
R1-5 yield increase
ZmBES1/BZR1-5 positively regulates kernel size. J Exp Bot.
Simmons, C.R., et al. (2020). Maize BIG GRAIN' homolog
ZM-BG1H1 Yield increase
overexpression increases maize grain yield. Plant Biotechnol
J 18, 2304-2315.
Shi, Y., et al. (2020). ZmCCAla on Chromosome 10 of
Photoperiod
ZmCCAla
Maize Delays Flowering of Arabidopsis thaliana. Front Plant
regulation
Sci 11, 78.
Qin, X., et al. (2020). Q(Dtbn1), an F-box gene affecting
To control tassel
Dtbnl maize tassel branch number by a dominant model.
Plant
branch number
Biotechnol J.
Liu Y. et al. (2020). Involvement of a truncated MADS-box
To regulate lateral '
ZmTMM1
transcription factor ZmTMM1 in root nitrate foraging. J Exp
root development
Bot 71, 4547-4561.
59
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Liu, M* , et al. (2020). Analysis of the genetic architecture of
To increase branch
Zm-miR164e
maize kernel size traits by combined linkage and association
number
mapping. Plant Biotechnol J 18, 207-221.
Li, T., et al. (2020). Raffinose synthase enhances drought
tolerance through raffinose synthesis or galactinol hydrolysis
ZmRAFS Drought tolerance
in maize and Arabidopsis plants. J Biol Chem 295,
8064-8077.
Li, Q., et al. (2020). CRISPR/Cas9-mediated knockout and
To drawf plant
ZmPHYC1
height and spike overexpression studies reveal a role of maize phytochrome C
ZmPHYC2 in regulating flowering time and plant height.
Plant
height
Biotechnol J 18, 2520-2532.
Kong, J., et al. (2020). Overexpression of the Transcription
To increase
Factor GROWTH-REGULATING FACTORS Improves
GRF5 transformation
Transformation of Dicot and Monocot Species. Front Plant
efficiency
Sci 11, 572319.
Jia, H., et al. (2020). A serine/threonine protein kinase
KNR6 Yield increase encoding gene KERNEL NUMBER PER ROW6 regulates
maize grain yield. Nat Commun 11, 988.
He, C., et al. (2020). Overexpression of an Antisense RNA of
To regulate plant
Maize Receptor-Like Kinase Gene ZmRLK7 Enlarges the
ZmRLK7 structure and organ
Organ and Seed Size of Transgenic Arabidopsis Plants. Front
size
Plant Sci 11, 579120.
Han, Q., et al. (2020). ZmDREB1A Regulates RAFFINOSE
SYNTHASE Controlling Raffinose Accumulation and Plant
ZmDREB1A Cold tolerance
Chilling Stress Tolerance in Maize. Plant Cell Physiol 61,
331-341.
To regulate corn
Han, Q., et al. (2020). ZmDREB2A regulates ZmGH3.2 and
seed longevity and
ZmDREB2A ZmRAFS, shifting metabolism towards seed aging tolerance
increase aging
over seedling growth. Plant J 104, 268-282.
tolerance
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
To regulate JA
Fu J. et al. (2020). ZmMYC2 exhibits diverse functions and
mediated growth,ZmMYC2 enhances JA signaling in transgenic Arabidopsis.
Plant Cell
development and
defensive reaction Rep 39, 273-288.
Development Feng, C., et al. (2020). The deposition of CENH3
in maize is
CENH3
regulation stringently regulated. Plant J 102, 6-17.
To enhance
tolerance to
Du, H., et al. (2020). A Maize ZmAT6 Gene Confers
aluminum toxicity
ZmAT6 . Aluminum Tolerance via Reactive Oxygen Species
in corn to scavenge
Scavenging. Front Plant Sci 11, 1016.
active oxygen
species
Drought tolerance Ding, L., et al. (2020). Modification of the Expression of
the
PIP2;5 Aquaporin ZmPIP2;5 Affects Water Relations and
Plant
and yield increase
Growth. Plant Physiol 182, 2154-2165.
Chen, L., et al. (2020). The retromer protein ZmVPS29
ZmVPS29 To promote grain
regulates maize kernel morphology likely through an
development auxin-dependent process(es). Plant Biotechnol
J 18,
1004-1014.
Cao, L., et al. (2020). Systematic Analysis of the Maize
OSCA Genes Revealing ZmOSCA Family Members Involved
ZmOSCA Drought tolerance in Osmotic Stress and ZmOSCA2.4 Confers
Enhanced
Drought Tolerance in Transgenic Arabidopsis. Int .1- Mol Sci
21.
To participate in salt
stress tolerance Bo, C., et al. (2020). Maize WRKY114 gene
negatively
ZmWRKY11
through regulates salt-stress tolerance in transgenic
rice. Plant Cell
4
ABA-mediated Rep 39, 135-148.
pathways
Zhu, G., et al. (2019). ZmPGIP3 Gene Encodes a
Polygalacturonase-Inhibiting Protein that Enhances
ZmPGIP3 Disease resistance
Resistance to Sheath Blight in Rice. Phytopathology 109,
1732-1740.
Zhao, Y., et al. (2019). A cytosolic NAD( )-dependent
Tolerance to salt
ZmGPDH1 GPDH from maize (ZmGPDH1) is involved in
conferring salt
and osmotic stress
and osmotic stress tolerance. BMC Plant Biol 19, 16.
61
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Zhang, X., et al. (2019). A maize stress-responsive Di19
To respond to salt
ZmDi19-1 stress transcription factor, ZmDi19-1, confers enhanced
tolerance to
salt in transgenic Arabidopsis. Plant Cell Rep 38, 1563-1578.
Zhan, W., et al. (2019). An allele of ZmPORB2 encoding a
To increase
protochlorophyllide oxidoreductase promotes tocopherol
ZmPORB2 tocopherol
accumulation in both leaves and kernels of maize. Plant J
accumulation
100, 114-127.
To participate in
Yu, T., et al. (2019). Overexpression of the maize
circadian rhythm
ZmVQ52 and photosynthetic
transcription factor ZmVQ52 accelerates leaf senescence in
Arabidopsis. PLoS One 14, e0221949.
pathway
To increase APA Yu, T., et al. (2019). ZmAPRG, an
uncharacterized gene,
and Pi enhances acid phosphatase activity and Pi
concentration in
ZmAPRG
concentration in maize leaf during phosphate starvation. Theor
Appl Genet
corn leaves 132, 1035-1048.
Yu, F., et al. (2019). A group VII ethylene response factor
Waterlogging
ZmEREB180 tolerance gene, ZmEREB180, coordinates waterlogging
tolerance in
maize seedlings. Plant Biotechnol J 17, 2286-2298.
To improve growth
and photosynthetic Wu, J., et al. (2019). Overexpression of zmm28 increases
Zmm28 capacity of corn maize grain yield in the field. Proc Natl Acad
Sci U S A 116,
plants and nitrogen 23850-23858.
use efficiency
To regulate starch Wu, J., et al. (2019). The DOF-Domain Transcription Factor
ZmD0F36 synthesis in corn ZmD0F36 Positively Regulates Starch Synthesis
in
endosperm Transgenic Maize. Front Plant Sci 10, 465.
Wang, H., et al. (2019). The Maize Class-I SUMO
ZmSCEld Drought tolerance Conjugating Enzyme ZmSCEld Is Involved in
Drought
Stress Response. Int J Mol Sci 21.
Wang, H., et al. (2019). Overexpression of a maize SUMO
ZmSCEle Stress resistance conjugating enzyme gene (ZmSCEle) increases
Sumoylation
levels and enhances salt and drought tolerance in transgenic
tobacco. Plant Sci 281, 113-121.
To regulate leaf Wang, C., et al. (2019). ZmGLR, a cell membrane localized
ZmGLR morphogenesis in microtubule-associated protein, mediated leaf
morphogenesis
corn in maize. Plant Sci 289, 110248.
62
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Vi' = = =' = T X T et al (2019).
Overexpression of the ZmDEF1
Resistance to weevil . ZmDEF1 gene increases the resistance to weevil
larvae in transgenic
larvae
maize seeds. Mol Biol Rep 46, 2177-2185
Stephenson, E., et al. (2019). Over-expression of the
Corn vegetative and
photoperiod response regulator ZmCCT10 modifies plant
ZmCCT10 reproductive
architecture, flowering time and inflorescence morphology in
development
maize. PLoS One 14, e0203728.
Qin, Y.J., et al. (2019). ZmHAK5 and ZmHAK1 function in
ZmHAK1 Stress resistance K(+) uptake and distribution in maize under
low K(+)
conditions. J Integr Plant Biol 61, 691-705.
To enhance K(+) Qin, Y.J., et al. (2019). ZmHAK5 and ZmHAK1 function in
ZmHAK5 uptake activity and K(+) uptake and distribution in maize under low
K(+)
promote growth
conditions. J Integr Plant Biol 61, 691-705.
Peng, X., et al. (2019). A maize NAC transcription factor,
ZmNAC34 Starch synthesis ZmNAC34, negatively regulates starch
synthesis in rice.
Plant Cell Rep 38, 1473-1484.
To increase Meng, C., et al. (2019). Overexpression of maize
MYB-IF35
ZmMYB-IF3 .
resistance to cold increases chilling tolerance in Arabidopsis.
Plant Physiol
and oxidative stress Biochem 135, 167-173.
Liu, W., et al. (2019). Function analysis of ZmNAC33, a
ZmNAC33 Drought tolerance positive regulator in drought stress response in
Arabidopsis.
Plant Physiol Biochem 145, 174-183.
Liu, F., et al. (2019). DNA Repair Gene ZmRAD51A
ZmRAD51A Disease resistance Improves Rice and Arabidopsis Resistance to
Disease. Int J
Mol Sci 20.
Liang, Y., et al. (2019). ZmMADS69 functions as a flowering
activator through the ZmRap2.7-ZCN8 regulatory module
ZmMADS69 Early flowering
and contributes to maize flowering time adaptation. New
Phytol 221, 2335-2347.
Liang, Y., et al. (2019). ZmASR3 from the Maize ASR Gene
ZmASR3 Drought tolerance Family Positively Regulates Drought Tolerance
in
Transgenic Arabidopsis. Int J Mol Sci 20.
Li, Z., et al. (2019). The bHLH family member ZmPTF1
regulates drought tolerance in maize by promoting root
ZmPTF1 .. Drought tolerance
development and abscisic acid synthesis. J Exp Bot 70,
5471-5486.
63
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
To play a role in
absorption and
Li, S., et al. (2019). Improving Zinc and Iron Accumulation
ZmZIP5 rhizome in Maize Grains Using the Zinc and Iron
Transporter
transformation of ZmZIP5.
Plant Cell Physiol 60, 2077-2085.
zinc and iron
ZmUBP15 To respond to
Kong, J., et al. (2019). Maize factors ZmUBP15, ZmUBP16
ZmUBP16Z cadium stress and and ZmUBP19 play important roles for plants to
tolerance the
mUBP19 salt stress cadmium stress and salt stress. Plant Sci 280,
77-89.
ZmCtll To improve stalk
Jiao, S., et al. (2019). Chitinase-likel Plays a Role in Stalk
tensile strength Tensile Strength in Maize. Plant Physiol 181,
1127-1147.
He, Z.,et al. (2019). The Maize Clade A PP2C Phosphatases
ZmPP2C-A Drought tolerance Play Critical Roles in Multiple Abiotic Stress
Responses. Int
J Mol Sci 20.
To suppress
He, Y., et al. (2019). A maize polygalacturonase functions as
ZmPGH1
programmed cell a suppressor of programmed cell death in plants. BMC Plant
death Biol 19, 310.
He, L., et al. (2019). Novel Maize NAC Transcriptional
Repressor ZmNAC071 Confers Enhanced Sensitivity to ABA
ZmNAC071 Stress response and Osmotic Stress by Downregulating Stress-
Responsive
Genes in Transgenic Arabidopsis. J Agric Food Chem 67,
8905-8918.
Giuliani, R., et al. (2019). Transgenic maize
ZmPEPC To improve carbon phosphoenolpyruvate carboxylase alters leaf-
atmosphere
metabolism CO2 and (13)CO2 exchanges in Oryza sativa.
Photosynth Res
142, 153-167.
To promote callus Du, X., et al. (2019). Transcriptome Profiling Predicts New
ZmBBM2 induction and Genes to Promote Maize Callus Formation and
transformation Transformation. Front Plant Sci 10, 1633.
Dong, Q.,et al. (2019). Overexpression of ZmbZIP22 gene
To regulate starch
ZmbZIP22 alters endosperm starch content and composition
in maize
synthesis
and rice. Plant Sci 283, 407-415.
Dong, Q. et al. (2019). Functional analysis of ZmMADSla
Positively regulates
ZmMAD Sla reveals its role in regulating starch
biosynthesis in maize
starch synthesis
endosperm. Sci Rep 9, 3253.
Ding, S.,et al. (2019). Genome-Wide Analysis of TCP Family
ZmTCP42 Drought tolerance Genes in Zea mays L. Identified a Role for
ZmTCP42 in
Drought Tolerance. Int J Mol Sci 20.
64
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
To obviously Chen, Q., et al. (2019). Overexpression of ATG8 in
ATG8
improve nitrogen Arabidopsis Stimulates Autophagic Activity and Increases
remobilization Nitrogen Remobilization Efficiency and Grain Filling. Plant
efficiency Cell Physiol 60, 343-352
Chen, J.,et al. (2019). Overexpression of SUM01 located
To regulate floral predominately to euchromatin of dividing cells
affects
SUM01
development reproductive development in
maize. Plant Signal Behav 14,
e1588664.
Bhatia, R.,et al. (2019). Modified expression of ZmMYB167
ZmMYB167 To increase biomass in Brachypodium distachyon and Zea mays leads to
increased
cell wall lignin and phenolic content. Sci Rep 9, 8800.
Zhu, Y.,et al. (2018). A transgene design for enhancing oil
ZmLEC1 Fatty acid synthesis content in Arabidopsis and Camelina seeds.
Biotechnol
Biofuels 11, 46.
Zhou, L., et al. (2018). Overexpression of a maize plasma
Drought tolerance
ZmPIP1; 1
membrane intrinsic protein ZmPIP1;1 confers drought and
and salt stress
salt tolerance in Arabidopsis. PLoS One 13, e0198639.
Yang, L., et al. (2018). Overexpression of the maize E3
ZmAIRP4 Drought tolerance ubiquitin ligase gene ZmAIRP4 enhances
drought stress
tolerance in Arabidopsis. Plant Physiol Biochem 123, 34-42.
Xu, Y., et al. (2018). Expression of a maize NBS gene
ZmNBS42 Disease resistance ZmNBS42 enhances disease resistance in Arabidopsis.
Plant
Cell Rep 37, 1523-1532.
Xu, Y., et al. (2018). The Maize NBS-LRR Gene ZmNBS25
ZmNBS25 Disease resistance Enhances Disease Resistance in Rice and
Arabidopsis. Front
Plant Sci 9, 1033.
To increase
Xu, Y.,et al. (2018). The mycorrhiza-induced maize ZmPt9
axial root length and
ZmPt9 gene affects root development and phosphate availability in
promote lateral root
nonmycorrhizal plant. Plant Signal Behav 13, e1542240.
formation
To increase influx
of sugar to organ Xie, G.,et al. (2018). Over-expression of mutated ZmDA1 or
ZmDA1
pool from corn grain ZmDAR1 gene improves maize kernel yield by enhancing
ZmDAR1
and enhance starch starch synthesis. Plant Biotechnol J 16, 234-
244.
synthesis
To increase Xiang, X., et al. (2018). Overexpression of
serine
SAT prolamine
acetyltransferase in maize leaves increases seed-specific
accumulation methionine-rich zeins. Plant
Biotechnol J 16, 1057-1067.
Xia, Z.,et al. (2018). Overexpression of the Maize Sulfite
Oxidase Increases Sulfate and GSH Levels and Enhances
ZmS0 Drought tolerance
Drought Tolerance in Transgenic Tobacco. Front Plant Sci 9,
298.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Wang, C.T.,et al. (2018). The Maize WRKY Transcription
ZmWRKY40 Drought tolerance Factor ZmWRKY40 Confers Drought Resistance in
Transgenic Arabidopsis. Int J Mol Sci 19.
To participate in
ZmWRKY10 several stress
Wang, C.T., et al. (2018). Maize WRKY Transcription Factor
ZmWRKY106 Confers Drought and Heat Tolerance in
6 response pathways
of abiotic resistance Transgenic Plants. Int J Mol Sci 19.
Wang, B.,et al. (2018). ZmNF-YB16 Overexpression
To increase corn Improves Drought Resistance and Yield by Enhancing
ZmNF-YB16
yield
Photosynthesis and the Antioxidant Capacity of Maize Plants.
Front Plant Sci 9, 709.
To increase Sun, Q., et al. (2018). MicroRNA528 Affects
Lodging
ZmLAC3
lignin content in Resistance of Maize by Regulating Lignin Biosynthesis under
corn stalk Nitrogen-Luxury Conditions. Mol Plant 11, 806-
814.
To positively
regulate plant
Ma, H.,et al. (2018). ZmbZIP4 Contributes to Stress
abiotic stress
ZmbZIP4 Resistance in Maize by Regulating ABA Synthesis and Root
response and
Development. Plant Physiol 178, 753-770.
participate in corn
root development
Liu, W.,et al. (2018). Over-Expression of a Maize
ZmNAGK Drought tolerance N-Acetylglutamate Kinase Gene (ZmNAGK) Improves
Drought Tolerance in Tobacco. Front Plant Sci 9, 1902.
Form
well-developed root Li, Z., et al. (2018). Enhancing auxin accumulation in
maize
system to make
ZmPINla
root tips improves root growth and dwarfs plant height. Plant
seminal root longer
Biotechnol J 16, 86-99.
and lateral root
denser
Li, Y.J.,et al. (2018). The maize secondary metabolism
To increase abiotic
glycosyltransferase UFGT2 modifies flavonols and
UFGT2 stress tolerance of
contributes to plant acclimation to abiotic stresses. Ann Bot
plants
122, 1203-1217.
To enhance
resistance to salt Li, X.,et al. (2018). Maize similar to RCD1 gene induced by
ZmSRO lb stress, cadmium salt enhances Arabidopsis thaliana abiotic
stress resistance.
stress and oxidative Biochem Biophys Res Commun 503, 2625-2632.
stress
Li, S.,et al. (2018). A DREB-Like Transcription Factor From
Development
ZmDREB4.1 Maize (Zea mays), ZmDREB4.1, Plays a Negative Role
in
regulation
Plant Growth and Development. Front Plant Sci 9, 395.
To increase seed Li, N., et al. (2011). "Over-expression of AGPase genes
Bt2
weight and starch enhances seed weight and starch content in transgenic
Sh2
content maize." Planta 233(2): 241-250.
Le Gall, G., et al. (2003). "Characterization and content of
LC Synthesis of flavonoid glycosides in genetically modified
tomato
Cl flavonoid
(Lycopersicon esculentum) fruits." J Agric Food Chem 51(9):
2438-2446.
66
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Ying, S., etal. (2012). "Cloning and characterization of a
To increase stress maize bZIP transcription factor, ZmbZIP72, confers drought
ZmbZIP72
resistance and salt tolerance in transgenic Arabidopsis."
Planta 235(2):
253-266.
Wang, M., et al. (2007). "Overexpression of a putative maize
ZmCBL4 Salt tolerance calcineurin B-like protein in Arabidopsis
confers salt
tolerance." Plant Mol Biol 65(6): 733-746.
Zhao, J., etal. (2009). "Cloning and characterization of a
To enhance salt
ZmCIPK16 novel CBL-interacting protein kinase from maize."
Plant Mol
tolerance
Biol 69(6): 661-674.
Jiang, S., et al. (2013). "A maize calcium-dependent protein
To enhance drought kinase gene, ZmCPK4, positively regulated abscisic acid
ZmCPK4
tolerance signaling and enhanced drought stress tolerance in
transgenic
Arabidopsis." Plant Physiol Biochem 71: 112-120.
To enhance drought Qin, F., etal. (2004). "Cloning and functional analysis of
a
tolerance, salt novel DREB1/CBF transcription factor involved
in
ZmDREB1A
tolerance and cold cold-responsive gene expression in Zea mays L." Plant Cell
tolerance Physiol 45(8): 1042-1052.
Fu, J. and Z. Ristic (2010). "Analysis of transgenic wheat
To enhance thermo (Triticum aestivum L.) harboring a maize (Zea mays L.) gene
ZmEF-Tul
tolerance for plastid EF-Tu: segregation pattern, expression
and effects
of the transgene." Plant Mol Biol 73(3): 339-347.
ZmLEAFY
COTYLEDO
To increase seed oil Barthole, G., et al. (2012). "Controlling lipid
accumulation in
Ni
content cereal grains." Plant Sci 185-186: 33-39
ZmWRINKL
ED1
Zou, H. W., et al. (2013). "Isolation and Functional Analysis
ZmLTP3 Salt tolerance of ZmLTP3, a Homologue to Arabidopsis LTP3."
Int J Mol
Sci 14(3): 5025-5035.
Kong, X., et al. (2011). "ZmMKK4, a novel group C
Salt and cold mitogen-activated protein kinase kinase in maize
(Zea mays),
ZmMKK4
tolerance confers salt and cold tolerance in transgenic
Arabidopsis."
Plant Cell Environ 34(8): 1291-1303.
Wu, S., et al. (2007). "Cloning, characterization, and
To promote root
transformation of the phosphoethanolamine
ZmPEAMT1 growth and enhance
salt tolerance N-methyltransferase gene (ZmPEAMT1) in maize (Zea
mays
L.)." Mol Biotechnol 36(2): 102-112.
Zhai, S. M., et al. (2012). "Overexpression of the
hosnhati dvl in ositol synthase gene from Zea mays in tobacco
ZmPIS Drought tolerance -
plants alters the membrane lipids composition and improves
drought stress tolerance." Planta 235(1): 69-84
Hu, X., et al. (2010). "Enhanced tolerance to low temperature
in tobacco by over-expression of a new maize protein
ZmPP2C2 Cold tolerance
phosphatase 2C, ZmPP2C2." J Plant Physiol 167(15):
1307-1315.
Liu, J., etal. (2013). "Overexpression of a maize E3 ubiquitin
ligase gene enhances drought tolerance through regulating
ZmRFP1 Drought tolerance
stomatal aperture and antioxidant system in transgenic
tobacco." Plant Physiol Biochem 73: 114-120.
67
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Ying, S., etal. (2011). "Cloning and characterization of a
maize SnRK2 protein kinase gene confers enhanced salt
ZmSAPK8 Salt tolerance
tolerance in transgenic Arabidopsis." Plant Cell Rep 30(9):
1683-1699.
Gu, L., et al. (2010). "Overexpression of maize
ZmSIMK1 Salt tolerance mitogen-activated protein kinase gene, ZmSIMK1
in
Arabidopsis increases tolerance to salt stress." Mol Biol Rep
37(8): 4067-4073
Shen, B., et al. (2010). "Expression of ZmLEC1 and
ZmLEC1 To increase seed oil
ZmWRI1 increases seed oil production in maize." Plant
ZmWRI1 content
Physiol 153(3): 980-987.
P uvreau, B., etal. (2011). "Duplicate maize Wrinkledl
ZmWrinkled To increase seed oil
1 content transcription factors activate target genes
involved in seed oil
biosynthesis." Plant Physiol 156(2): 674-686.
Table G lists the representative functional genes in barley. Methods in the
present
invention can be used to edit such genes and create new genes by designing new
combinations of different gene elements or different protein domain, and can
be utilized in
barley breeding program.
Table G: Important functional genes in barley
Gene
Application Reference
name
HGGT Chen, J., et al. (2017). Overexpression of hvhggt enhances
Grain size and
(L00548 tocotrienol levels and antioxidant activity in
barley. J. Agric.
weight
177) Food Chem..
Liu,Y.B., et al. (2018). Transient overexpression of hvserk2
HvSERK Resistance to
improves barley resistance to powdery mildew. International
2 powdery mildew
Journal of Molecular Sciences, 19(4), 1226.
Drought Feng, X., et al. (2020). Overexpression of hvaktl
improves
HvAKT1 barley drought tolerance by regulating root ion
homeostasis
tolerance
and ros and no signaling. Journal of Experimental Botany.
HvADH-
Kasbauer Christoph L,et al. (2017). Barley ADH-1 modulates
1 Disease
susceptibility to Bgh and is involved in chitin-induced
(L00548 resistance
systemic resistance. Plant Physiology and Biochemistry.
236)
Greenup, A. G.,et al. (2010). 0ddsoc2 is a MADS box floral
To delay
HvOS2 repressor that is down-regulated by vernalization in
temperate
blooming
cereals. Plant physiology, 153(3), 1062-1073.
Mulki M A., Korff M V. (2015). Constans controls floral
HvC01/ Vernalization
repression by upregulating vernalization 2 (vrn-h2) in barley.
HvFT1 regulation
Plant Physiology, 170(1), 325.
Drought Feng, X., et al. (2020). Hvakt2 and hvhakl confer
drought
Hvhakl tolerance in barley through enhanced leaf
mesophyll h+
tolerance
homoeostasis. Wiley-Blackwell Online Open, 18(8), 1683.
Xu, Z. S.,et al. (2009). Isolation and functional
characterization of hvdrebl-a gene encoding a
DREB1 Stress resistance
dehydration-responsive element binding protein in hordeum
vulgare. Journal of Plant Research, 122(1), 121-130.
68
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Lim, W. L.,et al. (2019). Overexpression of hvcs1f6 in barley
grain alters carbohydrate partitioning plus transfer tissue and
Cs1F6 Yield increase
endosperm development. Journal of Experimental Botany,
71(1).
HvPIP2;3
Lim, W. L., et al. (2019). Overexpression of hvcs1f6 in barley
/HvPIP2;
grain alters carbohydrate partitioning plus transfer tissue and
Salt tolerance
4/HvPIP2 endosperm development. Journal of Experimental
Botany,
;1 71(1).
To increase zinc
Hiroshi, Masuda.,et al. (2009). Overexpression of the Barley
HvNAS1 and iron content Nicotianamine Synthase GeneHvNAS1Increases Iron and
Zinc
in grains Concentrations in Rice Grains., 2(4), 155-166.
Bayat F, et al. (2011). Overexpression of hvnhx2, a vacuolar
na+/h+ antiporter gene from barley, improves salt tolerance in
NHX2 Salt tolerance
'arabidopsis thaliana'. Australian Journal of Crop Science,
5(4), 428-432.
Daniel P Woods, et al. (2016). Evolution of vrn2/ghd7-like
Vernalization
VRN1
genes in vernalization-mediated repression of grass flowering.
regulation
Plant Physiology, 170 (4), 2124-2135.
Table H lists the representative functional genes in rice. Methods in the
present
invention can be used to edit such genes and create new genes by designing new
combinations of different gene elements or different protein domain, and can
be utilized in
rice breeding program.
Table H: Important functional genes in rice
Gene name Application Reference
Fan, T., et al. (2020). "A Rice Autophagy Gene
OsATG8b Grain quality
OsATG8b Is Involved in Nitrogen Remobilization and
Control of Grain Quality." Front Plant Sci 11: 588.
Dong, N. Q., et al. (2020). "UDP-glucosyltransferase
To increase grain size
OsGsal and enhance abiotic regulates grain size and abiotic stress
tolerance
associated with metabolic flux redirection in rice."
stress tolerance
Nat Commun 11(1): 2629.
Khew, C. Y., et al. (2015). "Brassinosteroid
Grain filling and leaf insensitive 1-associated kinase 1 (OsI-
BAK1) is
OsI-BAK1
development
associated with grain filling and leaf development in
rice." J Plant Physiol 182: 23-32.
Suppression of phospholipase D genes improves
OsCATA Grain development chalky grain production by
high temperature during the grain-filling stage in rice
Duan, P., et al. (2015). "Regulation of OsGRF4 by
OsGRF4 Grain size and yield
OsmiR396 controls grain size and yield in rice." Nat
Plants 2: 15203.
Fang, N., et al. (2016). "SMALL GRAIN 11 Controls
small grain
Grain yield
Grain Size, Grain Number and Grain Yield in Rice."
D2/SMG11
Rice (N Y) 9(1): 64.
Choi, J., et al. (2012). "Functional identification of
OsHk6 Grain yield
OsHk6 as a homotypic cytokinin receptor in rice with
preferential affinity for iP." Plant Cell Physiol 53(7):
69
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
1334-1343.
Han, Y., et al. (2005). "Biochemical character of the
Growth of axial root purified OsRAA1, a novel rice protein with
OsRAA1
and lateral root GTP-binding activity, and its expression
pattern in
Oryza sativa." J Plant Physiol 162(9): 1057-1063.
Jong, I. C., et al. (2003). "Structure and expression of
the rice class-I type histone deacetylase genes
OsHDAC1 Plant architecture OsHDAC1-3: OsHDAC1 overexpression in
transgenic
plants leads to increased growth rate and altered
architecture." Plant J 33(3): 531-541.
Lee, J., et al. (2020). "OsbHLH073 Negatively
Regulates Internode Elongation and Plant Height by
OsbHLH073 Plant architecture
Modulating GA Homeostasis in Rice." Plants (Basel)
9(4).
Li, D., et al. (2009). "Engineering OsBAK1 gene as a
OsBAK1 Plant architecture molecular tool to improve rice architecture
for high
yield." Plant Biotechnol J 7(8): 791-806.
Hakata, M., et al. (2012). "Overexpression of a rice
Plant height and grain TIFY gene increases grain size through
enhanced
TIFYllb
size accumulation of carbohydrates in the stem."
Biosci
Biotechnol Biochem 76(11): 2129-2134.
Plant height and Huang, J. Y., et al. (2010). "[Over-
expression of
OsPSK3 OsPSK3 increases chlorophyll content of
leaves in
chlorophyll content
rice]." Yi Chuan 32(12): 1281-1289.
Kurotani, K. I., et al. (2015). "Overexpression of a
CYP94 family gene CYP94C2b increases internode
CYP94 Plant height
length and plant height in rice." Plant Signal Behav
10(7): e1046667.
Fu, F. F., et al. (2010). "Coexpression analysis
identifies Rice Starch Regulatorl, a rice AP2/EREBP
OsRSR1 Seed quality and yield family transcription factor, as a novel
rice starch
biosynthesis regulator." Plant Physiol 154(2):
927-938.
Yamamoto, M. P.,et al. (2006)." Synergism between
RPBF Dof and RISBZ1bZIP Activators in the
RPBF Seed quality
Regulation of Rice SeedExpression Genes. "Plant
Physiol
Hiroshi, Yasuda.,et al. (2009). "Overexpression of BiP
has Inhibitory Effects on theAccumulation of Seed
PDI Seed storage proteins
Storage Proteins in EndospermCells of Rice."Plant &
Cell Physiology, 50(8), 1532.
Hiroshi, Yasuda., et al. (2009). "Overexpression of
BiP has Inhibitory Effects on the Accumulation of
BiP Seed storage proteins
Seed Storage Proteins in Endosperm Cells of Rice."
Plant & Cell Physiology, 50(8), 1532.
Ge, Z. L., et al. (2018)."Transcription factor
To positively regulate WRKY22 promotes aluminum tolerance viaactivation
OsWRKY22
tolerance to aluminum of OSFRDL4 expression and enhancement of citrate
secretion in rice (oryza sativa) ". New Phytologist,
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
219.
To affect flowering
Li, D., et al. (2009). "Functional characterization of
OsDof12 under long day length
rice OsDof12." Planta 229(6): 1159-1169.
conditions
Kanda, Y., et al. (2019). "Broad-Spectrum Disease
To enhance immune Resistance Conferred by the Overexpression of
Rice
BSR1
response RLCK BSR1 Results from an Enhanced Immune
Response to Multiple MAMPs." Int J Mol Sci 20(22).
Hu, F., et al. (2012). "Overexpression of OsTLP27 in
To increase
OsTLP27 rice improves chloroplast function and photochemical
photosynthesis
efficiency." Plant Sci 195: 125-134.
Huang, L., et al. (2007). "Down-regulation of a
To enhance tolerance SILENT INFORMATION REGULATOR2-related
OsSRT1 to oxidative histone deacetylase gene, OsSRT1, induces DNA
responsive stress fragmentation and cell death in rice." Plant
Physiol
144(3): 1508-1519.
Zhang, G. H., et al. "LSCHL4 from Japonica Cultivar,
LSCHL4 To increase yield Which Is Allelic to
NAL1,Increases Yield of Indica
Super Rice 93-11. 'Molecular Plant(8), 1350-1364.
Luo, B., et al. (2018). "Overexpression of a
High-Affinity Nitrate Transporter OsNRT2.1
To increase yield and
OsNRT2.1 Increases Yield and Manganese Accumulation in Rice
weight
UnderAlternating Wet and Dry Condition." Frontiers
in Plant ence, 9, 1192.
Zhu, C., et al. (2020). "y-Aminobutyric Acid
To maintain iron Suppresses Iron Transportation from Roots to
Shoots
GABA homeostasis in rice in Rice Seedlings by InducingAerenchyma
seedlings Formation." International Journal of Molecular
Sciences, 22(1), 220.
Zou, L. P., et al. (2011). "Leaf rolling controlled by
Roc5 Leaf shape the homeodomain leucine zipper class IV gene
Roc5
in rice." Plant Physiol 156(3): 1589-1602.
Yang, C., et al.(2013). "Overexpression of
Leaf morphogenesis microRNA319 impacts leaf morphogenesis and
leads
OsPCF8
and cold tolerance to enhanced cold tolerance in rice (Oryza
sativaL.)."
Plant Cell & Environment, 36(12).
Yang, C., et al. (2013). "Overexpression of
Leaf morphogenesis microRNA319 impacts leaf morphogenesis and
leads
OsPCF5
and cold tolerance to enhanced cold tolerance in rice (Oryza
sativaL.)".
Plant Cell & Environment, 36(12).
Yang, C., et al. (2013). "Overexpression of
Osa-MIR31 Leaf morphogenesis microRNA319 impacts leaf morphogenesis and
leads
9a and cold tolerance to enhanced cold tolerance in rice (Oryza
sativaL.)."
Plant Cell & Environment, 36(12).
Zhao, X., et al. (2021). "OsNBL1, a Multi-Organelle
Localized Protein, Plays Essential Roles in Rice
OsClpP6 Leaf senescence
Senescence, Disease Resistance, and Salt
Tolerance."Rice, 14(1).
Leaf angle and seed Zhang, XQ., et al. (2015). Epigenetic
mutation of
RAV6
size RAV6 affects leaf angle and seed size in rice.
PLANT
71
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
PHYSIOL, 2015,169(3), 2118-2128.
Zhao, J., et al. (2015). Functional inactivation of
Chloroplast putative photosynthetic electron acceptor
ferredoxin
OsHDY1
development c2 (fdc2) induces delayed heading date and
decreased
photosynthetic rate in rice. Plos One, 10.
Youmei, Wang., et al. (2017). The
2'-o-methyladenosine nucleoside modification gene
OsTRM13 Salt stress tolerance
ostrm13 positively regulates salt stress tolerance in
rice. Journal of Experimental Botany.
Chi, Zhang., et al. (2017). The rice high-affinity k+
OsHKT2;4 Salt balance transporter OsHKT2;4 mediates Mg2+
homeostasis
under high-Mg2+ conditions in transgenic
arabidopsis. Frontiers in Plant Science, 8.
Han, R., et al. (2020). "Enhancing xanthine
To delay leaf
dehydrogenase activity is an effective way to delay
OsXDH senescence and
leaf senescence and increase rice yield." Rice (NY)
increase rice yield
13(1): 16.
Kang, K., et al. (2009). "Senescence-induced
To delay leaf serotonin biosynthesis and its role in
delaying
TDC
senescence senescence in rice leaves." Plant Physiol
150(3):
1380-1393
Kong, Z., et al. (2006). "A novel nuclear-localized
To delay leaf CCCH-type zinc finger protein, OsDOS, is
involved
OsDOS
senescence in delaying leaf senescence in rice." Plant
Physiol
141(4): 1376-1388.
Ko, S. S., et al. (2017). "Tightly Controlled
bHLH142 Male sterility Expression of bHLH142 Is Essential for
Timely
Tapetal Programmed Cell Death and Pollen
Development in Rice." Front Plant Sci 8: 1258.
Lee, S., et al. (2010). "Zinc deficiency-inducible
Zinc uptake and
OsZIP8 OsZIP8 encodes a plasma membrane-localized
zinc
distribution
transporter in rice." Mol Cells 29(6): 551-558.
Lee, S., et al. (2010). "OsZIP5 is a plasma membrane
OsZIP5 Zinc distribution zinc transporter in rice." Plant Mol Biol
73(4-5):
507-517.
Ishimaru, Y., et al. (2007). "Overexpression of the
OsZIP4 zinc transporter confers disarrangement of
OsZIP4 Zinc distribution
zinc distribution in rice plants." J Exp Bot 58(11):
2909-2915.
Ikeda, K., et al. (2007). "Rice ABERRANT PANICLE
AP01 Spikelet number ORGANIZATION 1, encoding an F-box protein,
regulates meristem fate." Plant J 51(6): 1030-1040.
Feng, C., et al. (2016). "The
Resistance to bacterial polygalacturonase-inhibiting protein 4
(OsPGIP4), a
OsPGIP4 potential component of the qB1sr5a locus,
confers
leaf streak in rice
resistance to bacterial leaf streak in rice." Planta
243(5): 1297-1308.
Ch eung, M. Y., et al. (2008). "Constitutive expression
Resistance to bacterial
OsGAP1 of a rice GTPase-activating protein induces
defense
pathogen
responses." New Phytol 179(2): 530-545.
72
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Khanday, I., et al. (2019). "A male-expressed rice
Vegetative
BBM1
embryogenic trigger redirected for asexual
propagation
propagation through seeds." Nature 565(7737): 91-95.
Tiwari, M., et al. (2020). "Functional characterization
Resistance to sheath of
tau class glutathione-S-transferase in rice to
OsGSTU5
blight disease
provide tolerance against sheath blight disease." 3
Biotech 10(3): 84.
Chen, X. J., et al. (2016). "Overexpression of
Resistance to sheath
0 sPGIP1 OsPGIP1
Enhances Rice Resistance to Sheath Blight."
blight disease
Plant Dis 100(2): 388-395.
Swain, D. M., et al. (2019). "Concurrent
RGG1 and
overexpression of rice G-protein beta and gamma
Sheath blight disease subunits provide enhanced tolerance to sheath
blight
RGB1
disease and abiotic stress in rice." Planta 250(5):
1505-1520.
Pooja, S., et al. (2015). "Homotypic clustering of
OsMYB4 binding site motifs in promoters of the rice
OsMYB4 Sheath blight disease
genome and cellular-level implications on sheath
blight disease resistance." Gene 561(2): 209-218.
Yue, W., et al. (2017). Osnlal, a ring-type ubiquitin
To maintain phosphate
ligase, maintains phosphate homeostasis in oryza
OsNLA1
homeostasis
sativa via degradation of phosphate transporters. The
Plant Journal, 90(6), 1040.
Lee, S., et al. (2009). "Disruption of OsYSL15 leads
OsYSL15 Iron uptake to iron
inefficiency in rice plants." Plant Physiol
150(2): 786-800.
Chang.,et al. (2018). OsYSL13 is involved in iron
OsYSL13 Iron
distribution distribution in rice. International Journal of Molecular
Sciences.
Lee, S. and G. An (2009). "Over-expression of
OsIRT1 leads to increased iron and zinc
OsIRT1 Iron and zinc uptake
accumulations in rice." Plant Cell Environ 32(4)
408-416.
Zhang, Y., et al.(2012). Vacuolar membrane
Iron and zinc transporters osvitl and osvit2 modulate
iron
OsVIT2 translocation
between flag leaves and seeds in rice.
translocation
Plant Journal for Cell & Molecular Biology, 72(3),
400-410.
Zhang, Y., et al.(2012). Vacuolar membrane
Iron and zinc transporters osvitl and osvit2 modulate
iron
OsVIT1
translocation between flag leaves and seeds in rice.
translocation
Plant Journal for Cell & Molecular Biology, 72(3),
400-410.
Ishimaru, Y., et al. (2010). "Rice metal-nicotianamine
Iron and manganese
transporter, OsYSL2, is required for the long-distance
OsYSL2
uptake
transport of iron and manganese." Plant J 62(3):
379-390.
Zhao, N., et al.(2020). Over-expression of HDA710
To regulate leaf
delays leaf senescence in rice (oryza sativa 1.).
OsGSTU12
senescence
Frontiers in Bioengineering and Biotechnology, 8,
471.
73
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Zhao, N., et al.(2020). Over-expression of HDA10
To regulate leaf delays leaf senescence in rice (oryza
sativa 1.).
HDA710
senescence Frontiers in Bioengineering and
Biotechnology, 8,
471.
Qi, W., et al. (2017). Constitutive expression of
osdof4, encoding a c2-c2 zinc finger transcription
To regulate flowering
OsDof4 factor, confesses its distinct flowering
effects under
period
long- and short-day photoperiods in rice (oryza sativa
1.). BMC Plant Biology, 17.
Lichao Zhang., et al.(2016). The wheat MYB-related
To regulate flowering transcription factor TaMYB72 promotes flowering in
RFT1
time rice. Journal of Integrative Plant Biology,
08(v.58),
7-10.
Lichao Zhang., et al.(2016). The wheat MYB-related
To regulate flowering transcription factor TaMYB72 promotes flowering in
Hd3a
time rice. Journal of Integrative Plant Biology,
08(v.58),
7-10.
Yu, Y., et al. (2017). Laccase-13 regulates seed
To regulate seed setting rate by affecting hydrogen peroxide
dynamics
OsLAC13
setting rate and mitochondrial integrity in rice.
Frontiers in Plant
Science, 8.
Zheng, S., et al. (2019). Pnas plus: osago2 controls ros
production and the initiation of tapetal pcd by
To regulate
OsHXKl epigenetically regulating oshxkl expression
in rice
anther development
anthers. Proceedings of the National Academy of
Sciences of the United States of America, 116(15).
Zheng, S., et al. (2019). Pnas plus: osago2 controls ros
production and the initiation of tapetal pcd by
To regulate
OsAGO2 epigenetically regulating oshxkl expression
in rice
anther development
anthers. Proceedings of the National Academy of
Sciences of the United States of America, 116(15).
Yoshida, A.,et al (2013). TAWAWAl, a regulator
of rice inflorescence architecture, functions through
To regulate
TAWAWA1 the suppression of meristem phase
transition.
growth development
Proceedings of the National Academy of Sciences,
110(2), 767-772.
C, Yong., et al. (2010). Overexpression of an f-box
To regulate root protein gene reduces abiotic stress
tolerance and
MAIF1
growth promotes root growth in rice. Molecular
Plant, 4(1),
190-197.
Tong, A., et al. (2017). "Altered accumulation of
osa-miR171 osa-miR171b contributes to rice stripe virus
infection
Stripe virus
by regulating disease symptoms." J Exp Bot 68(15):
4357-4367.
To generate somatic Hu, H., et al. (2005). "Rice SERK1 gene
positively
embryogenesis and regulates somatic embryogenesis of cultured
cell and
OsSERK1
enhance rice blast host defense response against fungal
infection." Planta
resistance 222(1): 107-117.
To improve crop yield Wang, W., et al. (2018). "Expression of the
Nitrate
OsNRT1.1A and shorten crop Transporter Gene OsNRT1.1A/OsNPF6.3 Confers
maturation High Yield and Early Maturation in Rice."
Plant Cell
74
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
30(3): 638-651.
Jia, H., et al. (2011). "The phosphate transporter gene
To improve inorganic
OsPT8 OsPht1;8 is involved in phosphate homeostasis in
phosphate uptake
rice." Plant Physiol 156(3): 1164-1175.
Cao, Y., et al. (2008). "Overexpression of a rice
To enhance disease
defense-related F-box protein gene OsDRF1 in
resistance (mosaic
OsDRF1 tobacco improves disease resistance
through
virus and
potentiation of defense gene expression." Physiol
pseudomonas)
Plant 134(3): 440-452.
To increase Li, C., et al. (2011). "A rice plastidial
nucleotide sugar
photosynthetic epimerase is involved in galactolipid biosynthesis and
PHD1
efficiency and crop improves photosynthetic efficiency." PLoS
Genet
yield 7(7): e1002196.
Kim, S. G., et al. (2010). "Overexpression of rice
To improve tolerance isoflavone reductase-like gene (OsIRL)
confers
OsIRL
to peroxides
tolerance to reactive oxygen species." Physiol Plant
138(1): 1-9.
"Overexpression of the 16-kDa a-amylase/trypsin
To increase yield and
RAG2 inhibitor
RAG2 improves grain yield and quality of
quality
rice"
Li, G., et al. (2018). "Overexpression of a rice BAHD
To enhance acyltransferase gene in switchgrass
(Panicum
OsAT10
saccharification .. virgatum L.) enhances saccharification." BMC
Biotechnol 18(1): 54.
Sun, Y., et al. (2015). "The OsSec18 complex
To increase rice plant
interacts with PO(P1-P2)2 to regulate vacuolar
OsSec18 height and thousand
morphology in rice endosperm cell." BMC Plant Biol
kernel weight
15: 55.
Chen, X., et al. (2019). "Amino acid substitutions in a
To enhance sheath
polygalacturonase inhibiting protein (OsPGIP2)
OsPGIP2 blight resistance in
increases sheath blight resistance in rice." Rice (N Y)
rice
12(1): 56.
Wang, H., et al. (2015). "Rice WRKY4 acts as a
Sheath blight transcriptional activator
mediating defense responses
OsWRKY4
resistance in rice
toward Rhizoctonia solani, the causing agent of rice
sheath blight." Plant Mol Biol 89(1-2): 157-171.
Takahashi, A., et al. (2007). "Rice Ptila negatively
Ptila Rice resistance regulates
RAR1-dependent defense responses." Plant
Cell 19(9): 2940-2951.
Shi, L., et al. (2019). "OsCDC48/48E complex is
OsCDC48 Rice resistance
required for plant survival in rice (Oryza sativa L.)."
Plant Mol Biol 100(1-2): 163-179.
Wang, S., et al. (2015) "Rice OsFLS2-Mediated
Bacteria resistance in Perception of Bacterial Flagellins Is Evaded
by
OsFLS2
rice Xanthomonas oryzae pvs. oryzae and oryzicola."
Mol
Plant 8(7): 1024-1037.
Drought tolerant and Fang, Y., et al. (2015). "A stress-
responsive NAC
SNAC3 heat resistant gene in
transcription factor SNAC3 confers heat and drought
rice tolerance through modulation of reactive
oxygen
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
species in rice." J Exp Bot 66(21): 6803-6817.
Wang, S., et al. (2019). "Rice Homeobox Protein
Lodging resistance KNAT7
Integrates the Pathways Regulating Cell
KNAT7
and yield of rice Expansion and Wall Stiffness." Plant Physiol
181(2):
669-682.
Du, D., et al. (2020). "The CC-NB-LRR OsRLR1
OsRLRl&O Disease resistance in
mediates rice disease resistance through interaction
sWRKY19 rice
with OsWRKY19." Plant Biotechnol J.
Prasad, B. D., et al. (2009). "Overexpression of rice
Disease resistance and
(Oryza sativa L.) OsCDR1 leads to constitutive
OsCDR1 defensive mechanism
activation of defense responses in rice and
of rice
Arabidopsis." Mol Plant Microbe Interact 22(12):
1635-1644.
Wang, H., et al. (2016). "A Signaling Cascade from
Virus resistance in
OsRDR1 miR444 to RDR1 in Rice Antiviral RNA
Silencing
rice
Pathway." Plant Physiol 170(4): 2365-2377.
Qiu, D., et al. (2007). "OsWRKY13 mediates rice
Disease resistance in disease resistance by regulating defense-
related genes
OsWRKY13
rice in salicylate- and jasmonate-dependent
signaling."
Mol Plant Microbe Interact 20(5): 492-499.
Rice grain-filling and Wang, E., et al. (2008). "Control of rice
grain-filling
GIF1 yield and
yield by a gene with a potential signature of
domestication." Nat Genet 40(11): 1370-1374.
Wang, J., et al. (2019) "The Amino Acid Permease 5
Rice tiller number and
OsAAP5 (OsAAP5) Regulates Tiller Number and Grain
Yield
yield
in Rice." Plant Physiol 180(2): 1031-1045.
Wytynck, P., et al.(2021). Effect of rip overexpression
on abiotic stress tolerance and development of rice.
0 sRIP1 Rice development
International Journal of Molecular Sciences, 22(3),
1434.
Kabin Xie., et al. (2006). Genomic organization,
differential expression, and interaction of squamosa
OsmiR156b Rice
development promoter-binding-like transcription factors and
microrna156 in rice. Plant Physiology, 142(1),
280-93.
Yin, X., et al. (2019). OsMADS18, a
membrane-bound MADS -box transcription factor,
OsMADS57 Rice
development modulates plant architecture and the abscisic acid
response in rice. Journal of Experimental Botany(15),
3895-3909.
Yin, X., et al. (2019). OsMADS18, a
membrane-bound MADS -box transcription factor,
OsMADS18 Rice
development modulates plant architecture and the abscisic acid
response in rice. Journal of Experimental Botany(15),
3895-3909
Yin, X., et al (2019). OsMADS18, a
OsMADS15 Rice
development membrane-bound MADS -box transcription factor,
modulates plant architecture and the abscisic acid
76
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
response in rice. Journal of Experimental Botany(15),
3895-3909.
Yin, X., et al. (2019). OsMADS18, a
membrane-bound MADS -box transcription factor,
OsMADS14 Rice development modulates plant architecture and the
abscisic acid
response in rice. Journal of Experimental Botany(15),
3895-3909.
Xiong, Y., et al. (2019). NF-YC12 is a key
multi-functional regulator of accumulation of seed
NF-YC12 Rice development
storage substances in rice. Journal of Experimental
Botany(15), 15.
Yan, D., et al. (2015). Curved chimeric palea 1
encoding an EMF1-like protein maintains epigenetic
CCP1 Rice development
repression of OsMADS58 in rice palea development.
Plant Journal, 82(1), 12-24.
Sun, Q., et al. (2020). "Indeterminate Domain Proteins
Resistance to sheath
LPA1 Regulate Rice Defense to Sheath Blight
Disease."
blight disease in rice
Rice (N Y) 13(1): 15.
To improve
Achary, V. M. M., et al. (2020). "Overexpression of
glyphosate tolerance improved EPSPS gene results in field level glyphosate
EPSPS
and increase grain
tolerance and higher grain yield in rice." Plant
yield in rice Biotechnol J 18(12): 2504-2519.
Dehydroasc Do,
H., et al. (2016). "Structural understanding of the
orbate Rice yield and
recycling of oxidized ascorbate by dehydroascorbate
reductase biomass
reductase (0sDHAR) from Oryza sativa L. japonica."
OsDHAR Sci Rep 6: 19498.
Choe, Y. H., et al. (2013). "Homologous expression of
Rice yield and its
gamma-glutamylcysteine synthetase increases grain
OsECS(gam
tolerance to yield
and tolerance of transgenic rice plants to
ma-ecs)
environmental stresses
environmental stresses." J Plant Physiol 170(6):
610-618.
Ueno, Y., et al. (2017). "WRKY45 phosphorylation at
threonine 266 acts negatively on WRKY45-dependent
WRKY45 Rice blast resistance
blast resistance in rice." Plant Signal Behav 12(8):
e13 56968.
Azizi, P., et al. (2016). "Over-Expression of the Pikh
Gene with a CaMV 35S Promoter Leads to Improved
Pikh Gene Rice blast resistance
Blast Disease (Magnaporthe oryzae) Tolerance in
Rice." Front Plant Sci 7: 773.
To improve nitrogen
Tang, D., et al. (2018). "Ectopic expression of fungal
EcGDH assimilation and grain EcGDH improves nitrogen assimilation and
grain
yield in rice yield
in rice." J Integr Plant Biol 60(2): 85-88.
To improve nitrogen
Tomoyuki Yamaya1,2,4, Mitsuhiro Obaral, Hiroyuki
NADH-GO
utilization and grain Nakajimal, Shohei Sasakil,
GAT
filling in rice
Toshihiko Hayakawal and Tadashi 5ato3
Dhatt, B. K., et al. (2021). "Allelic variation in rice
Fertilization Independent Endosperm 1 contributes to
Fiel Rice yield (grain size)
grain width under high night temperature stress." New
Phytol 229(1): 335-350.
77
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Wang, J., et al. (2016). "Overexpression of
OsMYB1R1 OsMYB1R1-VP64 fusion protein increases grain yield
Rice yield
-VP64 in rice by delaying flowering time." FEBS
Lett
590(19): 3385-3396.
Sun, W., et al. (2020). "OsmiR530 acts downstream of
OsMIR530 Rice yield OsPIL15 to regulate grain yield in rice." New
Phytol
226(3): 823-837.
Wang, C., et al. (2020). "A cytokinin-activation
enzyme-like gene improves grain yield under various
OsLOGL5 Rice yield
field conditions in rice." Plant Mol Biol 102(4-5):
373-388.
Doku, H. A., et al. (2019). "The expression pattern of
OsDiml Rice yield OsDiml in rice and its proposed function."
Sci Rep
9(1): 18492.
Uji, Y., et al. (2016). "Overexpression of OsMYC2
Resistance to bacterial Results in the Up-Regulation of Early JA-Rresponsive
OsMYC2
leaf blight in rice Genes and Bacterial Blight Resistance in
Rice." Plant
Cell Physiol 57(9): 1814-1827.
Bart, R. S., et al. (2010). "Rice Sn16, a
cinnamoyl-CoA reductase-like gene family member,
Resistance to bacterial
Rice NH1 is
required for NH1-mediated immunity to
leaf blight in rice
Xanthomonas oryzae pv. oryzae." PLoS Genet 6(9):
e1001123.
Sugio, A., et al. (2007). "Two type III effector genes
of Xanthomonas oryzae pv. oryzae control the
Resistance to bacterial OsTFX1 induction of the host genes OsTFIIAgammal
and
leaf blight in rice
OsTFX1 during bacterial blight of rice." Proc Nat!
Acad Sci U S A 104(25): 10720-10725.
To improve auxin
Zhao, Z., et al. (2013). A role for a dioxygenase in
catabolism and
DA0 auxin metabolism and reproductive development in
maintain auxin
rice. Developmental Cell, 27(1), 113-122.
homeostasis
Zhou, Y., et al. (2014). Overexpression of
OsSWEET5 Growth development OsSWEET5 in rice causes growth retardation
and
precocious senescence. Plos One, 9(4), e94210.
Wu, P., et al.(2008). Role of OsPHR2 on phosphorus
OsPHR2 Growth development homeostasis and root hairs development in rice
(oryza
sativa.L.). Plant Signaling & Behavior, 3(9), 674-675.
Wu, P., et al.(2008). Role of OsPHR2 on phosphorus
OsPHR1 Growth development homeostasis and root hairs development in rice
(oryza
sativa.L.). Plant Signaling & Behavior, 3(9), 674-675.
Wu, Z., et al. (2011). Investigating the contribution of
the phosphate transport pathway to arsenic
OsPHF1 Growth development
accumulation in rice. Plant Physiology, 157(1),
498-508.
Vijayraghavan, U.. (2011). Auxin-responsive
OsMGH3, a common downstream target of
OsMGH3 Growth development
OsMADS1 and OsMADS6, controls rice floret
fertility. Plant & Cell Physiology, 52(12), 2123-2135.
Zhang, L. Y., et al. (2009). Antagonistic HLH/bHLH
BZR1 Growth development
transcription factors mediate brassinosteroid
78
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
regulation of cell elongation and plant development in
rice and arabidopsis. Plant Cell, 21(12), 3767-3780.
Fu, L., et al. (2013). "Overexpression of constitutively
Biotic and abiotic active OsCPK10 increases Arabidopsis resistance
OsCPK10 stress (resistance to against Pseudomonas
syringae pv. tomato and rice
Magnaporthe grisea) resistance against Magnaporthe grisea." Plant Physiol
Biochem 73: 202-210.
Kang, K., et al. (2011). "Methanol is an endogenous
elicitor molecule for the synthesis of tryptophan and
Synthesis of
PME1 tryptophan-derived secondary metabolites
upon
tryptophan
senescence of detached rice leaves." Plant J 66(2):
247-257.
Tolerance to Yang, W. T., et al. (2018). Rice OsMYB5P
improves
OsMYB5P phosphorous plant phosphate acquisition by regulation of
phosphate
deficiency
transporter. PloS one, 13(3), e0194628.
Zhang., et al. (2015)."TOND1 confers tolerance to
Tolerance to nitrogen
TOND1 nitrogen
deficiency in rice."The Plant
deficiency
Journa1,81(3) :367-376.
Hsu, K. H., et al. (2014). "Expression of a gene
To enhance stomata encoding a rice RING zinc-finger protein, OsRZFP34,
OsRZFP34
opening enhances stomata opening." Plant Mol Biol
86(1-2):
125-137.
Kaikavoosi, K., et al. (2015). "2-Acetyl-1-pyrroline
To increase synthesis augmentation in scented indica rice (Oryza
sativa L.)
PS CS of proline and varieties through Delta(1)-pyrroline-5-
carboxylate
augment rice scent synthetase (P5CS) gene transformation." Appl
Biochem Biotechnol 177(7): 1466-1479.
Kumar, S., et al. (2019). "Arsenic-responsive
Tolerance to heavy high-affinity rice sulphate transporter, OsSultr1;1,
OsSultr1;1
mental provides abiotic stress tolerance under
limiting
sulphur condition." J Hazard Mater 373: 753-762.
Campo, S., et al. (2014). "Overexpression of a
Salt and drought Calcium-Dependent Protein Kinase Confers Salt and
OsCPK4
tolerance Drought Tolerance in Rice by Preventing
Membrane
Lipid Peroxidation." Plant Physiol 165(2): 688-704.
Asano, T., et al. (2012). "A rice calcium-dependent
Salt tolerance and
oscpk12 blast disease protein kinase OsCPK12 oppositely modulates
salt-stress tolerance and blast disease resistance."
resistance
Plant J 69(1): 26-36.
serine-threo Diedhiou, C. J., et al. (2008). "The SNF1-
type
nine protein serine-threonine protein kinase SAPK4 regulates
Salt tolerance
kinase stress-responsive gene expression in rice."
BMC Plant
SAPK4 Biol 8: 49.
Ganguly, M., et al. (2012). "Overexpression of
Rab16A gene in indica rice variety for generating
Rab16A Salt tolerance
enhanced salt tolerance." Plant Signal Behav 7(4):
502-509.
79
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Zhou, Y., et al. (2018). The receptor-like cytoplasmic
kinase STRK1 phosphorylates and activates Catc,
STRK1 Salt stress tolerance
thereby regulating H202 homeostasis and improving
salt tolerance in rice. Plant Cell, tpc.01000.2017.
Zhang, X.X., et al. (2013). OsDREB2A, a rice
OsDREB2A Salt stress tolerance transcription factor, significantly
affects salt tolerance
in transgenic soybean. Plos One, 8(12), e83011.
Worawat., et al. (2018). Downstream components of
the calmodulin signaling pathway in the rice salt
OsCaml Salt stress tolerance
stress response revealed by transcriptome profiling
and target identification. BMC Plant Biology.
Kanneganti, V. and A. K. Gupta (2008).
Salt, drought and cold
"Overexpression of OsiSAP8, a member of stress
OsiSAP8
tolerance associated protein (SAP) gene family of rice
confers
tolerance to salt, drought and cold stress in transgenic
tobacco and rice." Plant Mol Biol 66(5): 445-462.
Jan, A., et al. (2013). "OsTZFl, a CCCH-tandem zinc
Salt and drought finger protein, confers delayed senescence
and stress
OsTZF1
tolerance tolerance in rice by regulating stress-
related genes."
Plant Physiol 161(3): 1202-1216.
Huang, L., et al. (2018). "An Atypical Late
Salt and drought Embryogenesis Abundant Protein OsLEA5 Plays a
OsLEA5
tolerance Positive Role in ABA-Induced Antioxidant
Defense in
Oryza sativa L." Plant Cell Physiol 59(5): 916-929.
Huang, J., et al (2007). A novel rice C2H2-type zinc
finger protein lacking DLN-box/EAR-motif plays a
ZFP182 Salt tolerance role in salt tolerance. Biochimica et
Biophysica Acta
(BBA)-Gene Structure and Expression, 1769(4),
220-227.
Kumar, M., et al. (2017). "Ectopic Expression of
OsSta2 Salt tolerance 0s5ta2 Enhances Salt Stress Tolerance in
Rice." Front
Plant Sci 8:316.
Guo, X., et al. (2009). "OsMSRA4.1 and OsMSRB1.1,
OsMSRA4.1 Salt tolerance two rice plastidial methionine sulfoxide
reductases,
are involved in abiotic stress responses." Planta
230(1): 227-238.
Kumar, R., et al. (2012). "Functional screening of
cDNA library from a salt tolerant rice genotype
Pokkali identifies mannose-l-phosphate guanyl
OsMPG1 Salt tolerance
transferase gene (0sMPG1) as a key member of
salinity stress response." Plant Mob Biol 79(6):
555-568.
Kumar, K. and A. K. Sinha (2013). "Overexpression
of constitutively active mitogen activated protein
OsMKK6 Salt tolerance
kinase kinase 6 enhances tolerance to salt stress in
rice." Rice (N Y) 6(1): 25.
Chen, G., et al. (2015). "Rice potassium transporter
OsHAK1 is essential for maintaining
OsHAK1 Salt tolerance
potassium-mediated growth and functions in salt
tolerance over low and high potassium concentration
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
ranges." Plant Cell Environ 38(12): 2747-2765.
Jadamba, C., et al. (2020). "Overexpression of Rice
OsEXPA7 Salt tolerance Expansin7 (0sexpa7) Confers Enhanced
Tolerance to
Salt Stress in Rice." Int J Mol Sci 21(2).
Kusuda, H., et al. (2015). "Ectopic expression of
MIPS Salt tolerance myo-inositol 3-phosphate synthase induces a
wide
range of metabolic changes and confers salt tolerance
in rice." Plant Sci 232: 49-56.
Kurotani, K., et al. (2015). "Stress Tolerance Profiling
of a Collection of Extant Salt-Tolerant Rice Varieties
CYP94C2b Salt tolerance and Transgenic Plants Overexpressing Abiotic
Stress
Tolerance Genes." Plant Cell Physiol 56(10):
1867-1876
Kurotani, K., et al. (2015). "Elevated levels of CYP94
family gene expression alleviate the jasmonate
CYP94C2b Salt tolerance
response and enhance salt tolerance in rice." Plant
Cell Physiol 56(4): 779-789.
Fukao, T., et al. (2011). "The submergence tolerance
SUB 1 A Flooding tolerance regulator SUB 1A mediates crosstalk
between
submergence and drought tolerance in rice." Plant Cell
23(1): 412-427.
Ye, N. H., et al. (2018). Natural variation in the
promoter of rice calcineurin b-like protein10
OsCBL10 Flooding tolerance (0sCBL10) affects flooding tolerance during
seed
germination among rice subspecies. Plant Journal for
Cell & Molecular Biology.
Hu, H., et al. (2008). "Characterization of
transcription factor gene SNAC2 conferring cold and
SNAC2 Stress tolerance
salt tolerance in rice." Plant Mol Biol 67(1-2):
169-181.
Huang, Y., et al. (2019). "OsNCED5, a
9-cis-epoxycarotenoid dioxygenase gene, regulates
OsNCED5 Stress tolerance
salt and water stress tolerance and leaf senescence in
rice." Plant Sci 287: 110188.
Hu, T., et al. (2019). "Overexpression of OsLea14-A
OsLea14-A Stress tolerance improves the tolerance of rice and
increases Hg
accumulation under diverse stresses." Environ Sci
Pollut Res Int 26(11): 10537-10551.
Kim, S. K., et al. (2012). "The rice thylakoid lumenal
cyclophilin OsCYP20-2 confers enhanced
OsCYP20-2 Stress tolerance
environmental stress tolerance in tobacco and
Arabidopsis." Plant Cell Rep 31(2): 417-426.
Ghosh, A., et al. (2014). "A glutathione responsive
rice glyoxalase II, OsGLYII-2, functions in salinity
OsGLYII-2 Salt tolerance adaptation by maintaining better
photosynthesis
efficiency and anti-oxidant pool." Plant J 80(1):
93-105.
81
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Gutha, L. R. and A. R. Reddy (2008). "Rice DREB1B
Biotic and abiotic promoter shows distinct stress-specific
responses, and
0 sDREB1B the overexpression of cDNA in tobacco
confers
stress tolerance
improved abiotic and biotic stress tolerance." Plant
Mol Biol 68(6): 533-555.
Kidwai, M., et al. (2019). "Oryza sativa class III
peroxidase (OsPRX38) overexpression in Arabidopsis
OsPRX38 Arsenic tolerance thaliana reduces arsenic accumulation due
to
apoplastic lignification." J Hazard Mater 362:
383-393.
Hwang, S. G., et al. (2017). "Molecular
characterization of rice arsenic-induced RING finger
OsAIR2 Arsenic tolerance E3 ligase 2 (OsAIR2) and its heterogeneous
overexpression in Arabidopsis thaliana." Physiol Plant
161(3): 372-384.
Hwang, S. G., et al. (2016). "Molecular
characterization of Oryza sativa arsenic-induced
OsAIR1 Arsenic tolerance RING E3 ligase 1 (OsAIR1): Expression
patterns,
localization, functional interaction, and heterogeneous
overexpression." J Plant Physiol 191: 140-148.
Biswas, S., et al. (2019). "Overexpression of
Thermo and salt heterotrimeric G protein beta subunit gene
(0sRGB1)
OsRGB1
tolerance confers both heat and salinity stress
tolerance in rice."
Plant Physiol Biochem 144: 334-344.
Keke Yi., et al .0sPTF1, a Novel Transcription Factor
Low Phosphate
OsPTF1 Involved inTolerance to Phosphate Starvation in Rice
tolerance
Fang, C., et al. (2020). "Serine
OsSHMT,
hydroxymethyltransferase localised in the
Lsil gene Chilling tolerance endoplasmic reticulum plays a role in
scavenging
(Lsil-OX) H202 to enhance rice chilling tolerance." BMC
Plant
Biol 20(1): 236.
Deng, C., et al. (2017). "The rice transcription factors
OsICE Chilling tolerance OsICE confer enhanced cold tolerance in
transgenic
Arabidopsis." Plant Signal Behav 12(5): e1316442.
Dong-Qing Xu., et al (2008). Overexpression of a
Drought and salt
ZFP252 tolerance TFIIIA-type zinc finger protein geneZFP252
enhances
drought and salt tolerance in rice (Oryza sativa L.)
Du, H., et al. (2014). "A homolog of ETHYLENE
Drought and flooding OVERPRODUCER, OsETOL1, differentially
OsETOL1
tolerance modulates drought and submergence tolerance
in
rice." Plant J 78(5): 834-849.
El-Esawi, M. A. and A. A. Alayafi (2019).
To improve drought
"Overexpression of Rice Rab7 Gene Improves
OsRab7 and heat tolerance and
Drought and Heat Tolerance and Increases Grain
increase rice yield
Yield in Rice (Oryza sativa L.)." Genes (Basel) 10(1).
Du, H., et al. (2012). "A GH3 family member,
Drought and cold OsGH3-2, modulates auxin and abscisic acid
levels
OsGH3-2
tolerance and differentially affects drought and cold
tolerance in
rice." J Exp Bot 63(18): 6467-6480.
82
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Dey, A., et al. (2016). "Enhanced Gene Expression
Rather than Natural Polymorphism in Coding
Drought tolerance and
OsbZIP23 Sequence of the OsbZIP23 Determines Drought
yield increase
Tolerance and Yield Improvement in Rice
Genotypes." PLoS One 11(3): e0150763.
Favero Peixoto-Junior, R., et al. (2018).
"Overexpression of ScMYBAS1 alternative splicing
ScMYBAS1 Drought tolerance
transcripts differentially impacts biomass
accumulation and drought tolerance in rice transgenic
plants." PLoS One 13(12): e0207534.
Bang, S. W., et al. (2019). "Overexpression of
OsTF1L, a rice HD-Zip transcription factor, promotes
OsTF1L Drought tolerance
lignin biosynthesis and stomatal closure that improves
drought tolerance." Plant Biotechnol J 17(1): 118-131.
Abreu, F. R. M., et al. (2018). "Overexpression of a
phospholipase (OsPLDalphal) for drought tolerance
OsPLDal Drought tolerance
in upland rice (Oryza sativa L.)." Protoplasma 255(6):
1751-1761.
Guo, C., et al. (2013). "The rice OsDIL gene plays a
OsDIL Drought tolerance role in
drought tolerance at vegetative and
reproductive stages." Plant Mol Biol 82(3): 239-253.
Cui, L. G., et al. (2015). "DCA1 Acts as a
DST Drought and salt
Transcriptional Co-activator of DST and Contributes
&DCA1 tolerance to
Drought and Salt Tolerance in Rice." PLoS Genet
11(10): e1005617.
Zhou, L., et al (2016). "A novel gene OsAHL1
OsAHL1 Drought tolerance improvesboth drought avoidance anddrought
tolerance
in rice."Scientific reports, 6(1), 1-15.
Jeong, J. S., et al. (2013). "OsNAC5 overexpression
Drought tolerance and enlarges root diameter in rice plants
leading to
OsNAC5
yield increase
enhanced drought tolerance and increased grain yield
in the field." Plant Biotechnol J 11(1): 101-114.
Xiong, L., et al.(2003). "Disease Resistance and
Drought, salt, and cold
Abiotic Stress Tolerance in Rice Are Inversely
OsMAPK5 tolerance; disease
Modulated by an Abscisic Acid¨Inducible
resistance
Mitogen-Activated Protein Kinase." Plant Cell.
Jeong, J. S., et al. (2010). "Root-specific expression of
OsNAC10
Drought, salt and cold OsNAC10 improves drought tolerance and grain yield
tolerance in
rice under field drought conditions." Plant Physiol
153(1): 185-197
Hong, Y., et al. (2016). "Overexpression of a
Drought and salt Stress-Responsive NAC Transcription Factor
Gene
ONACO22
tolerance
ONACO22 Improves Drought and Salt Tolerance in
Rice." Front Plant Sci 7:4.
Huang, J., et al. (2009). "Increased tolerance of rice to
Tolerance to drought,
cold, drought and oxidative stresses mediated by the
ZFP245 cold and oxidative
overexpression of a gene that encodes the zinc finger
stresses protein ZFP245." Biochem Biophys Res Commun
389(3): 556-561.
83
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Joo, J., et al. (2013). "Abiotic stress responsive rice
Drought and cold ASR1 and ASR3 exhibit different tissue-
dependent
OsASR1
tolerance sugar and hormone-sensitivities." Mol Cells
35(5):
421-435.
Kim, Y. S. and J. K. Kim (2009). "Rice transcription
Drought, high salt and
AP37 factor AP37 involved in grain yield increase
under
cold tolerance
drought stress." Plant Signal Behav 4(8): 735-736.
Jiang, S. Y., et al. (2012). "Over-expression of
Drought and heat OSRIP18 increases drought and salt tolerance
in
OSRIP18
tolerance transgenic rice plants." Transgenic Res
21(4):
785-795.
Xiao, J., et al.(2013)."Rice WRKY13 Regulates Cross
Talk between Abiotic and Biotic Stress Signaling
WRKY13 Drought tolerance
Pathways by Selective Binding to Different
cis-Elements. "Plant Physiology, 163(4), 1868-1882.
Hu, H., et al. (2006). "Overexpressing a NAM, ATAF,
and CUC (NAC) transcription factor enhances drought
SNAC1 Drought tolerance
resistance and salt tolerance in rice." Proc Natl Acad
Sci U S A 103(35): 12987-12992
Lenka, S. K., et al. (2019). "Heterologous expression
of rice RNA-binding glycine-rich (RBG) gene
OsRBGD3 Drought tolerance OsRBGD3 in transgenic Arabidopsis
thaliana confers
cold stress tolerance." Funct Plant Biol 46(5):
482-491.
Kumar, V. V. S., et al. (2020). "ABA receptor
OsPYL6 confers drought tolerance to indica rice
OsPYL6 Drought tolerance
through dehydration avoidance and tolerance
mechanisms." J Exp Bot.
Lenka, S. K., et al. (2018). "Ectopic Expression of
Rice PYL3 Enhances Cold and Drought Tolerance in
OsPYL3 Drought tolerance
Arabidopsis thaliana." Mol Biotechnol 60(5):
350-361.
Lee, D. K., et al. (2015). "The NF-YA transcription
factor OsNF-YA7 confers drought stress tolerance of
OsNF-YA7 Drought tolerance
rice in an abscisic acid independent manner." Plant
Sci 241: 199-210.
Wang, X., et al. (2020). "The NAD kinase OsNADK1
affects theintracellular redox balance and enhances
OsNADK1 Drought tolerance
the tolerance of rice to drought."BMC Plant Biology,
20.
Lee, D. K., et al. (2017). "The rice OsNAC6
transcription factor orchestrates multiple molecular
OsNAC6 Drought tolerance mechanisms involving root
structural adaptions and
nicotianamine biosynthesis for drought tolerance."
Plant Biotechnol J 15(6): 754-764.
Jung, H., et al. (2015). "OsIAA6, a member of the rice
Aux/IAA gene family, is involved in drought
OsIAA6 Drought tolerance
tolerance and tiller outgrowth." Plant Sci 236:
304-312.
84
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Lee, D. K., et al. (2017). "Rice OsERF71-mediated
OsERF71 Drought tolerance root
modification affects shoot drought tolerance."
Plant Signal Behav 12(1): e1268311.
Huang, L., et al. (2018). "Characterization of
OsDRAP1 Drought tolerance
Transcription Factor Gene OsDRAP1 Conferring
Drought Tolerance in Rice." Front Plant Sci 9: 94.
Lee, S. S., et al. (2015). "Rice cyclophilin OsCYP18-2
is translocated to the nucleus by an interaction with
OsCYP18-2 Drought tolerance
SKIP and enhances drought tolerance in rice and
Arabidopsis." Plant Cell Environ 38(10): 2071-2087.
Shuya, Wei., et al.(2014). "A rice calcium-dependent
protein kinase OsCPK9positively regulates drought
OsCPK9 Drought tolerance
stress tolerance andspikelet fertility."BMC Plant
Biology, 14(1), 133-133.
Huang, Y. C., et al. (2012). "Comprehensive analysis
of differentially expressed rice actin depolymerizing
OsADF Drought tolerance factor gene family and heterologous
overexpression of
OsADF3 confers Arabidopsis Thaliana drought
tolerance." Rice (NY) 5(1): 33.
Huang, Y., et al. (2007). "Characterization of a stress
OCPI1 Drought tolerance
responsive proteinase inhibitor gene with positive
effect in improving drought resistance in rice." Planta
226(1): 73-85.
Komatsu, S., et al. (2007). "Over-expression of
calcium-dependent protein kinase 13 and calreticulin
CDPK13 Drought tolerance
interacting protein 1 confers cold tolerance on rice
plants." Mol Genet Genomics 277(6): 713-723.
Zhang, Y., et al. (2009). 'Expression of a rice DREB1
OsDREB1D Cold and salt tolerance gene,
OsDREB1D, enhances cold and high-salt
tolerance in transgenic Arabidopsis."Bmb Reports,
42(8), 486-492.
Kumar, M., et al. (2017). "Genome-Wide
Identification and Analysis of Genes, Conserved
OsWRKY71 Cold tolerance
between japonica and indica Rice Cultivars, that
Respond to Low-Temperature Stress at the Vegetative
Growth Stage." Front Plant Sci 8: 1120.
Kim, S. H., et al. (2007). "Isolation of cold
OsLti6b Cold tolerance
stress-responsive genes in the reproductive organs,
and characterization of the OsLti6b gene from rice
(Oryza sativa L.)." Plant Cell Rep 26(7): 1097-1110.
Li, C. R., et al. (2013). "Overexpression of an
alternative oxidase gene, OsA0X1a, improves cold
OsA0X1a Cold tolerance
tolerance in Oryza sativa L." Genet Mol Res 12(4):
5424-5432.
Kunihiro, S., et al. (2014). "Overexpression of rice
OsREX1-S, encoding a putative component of the
core general transcription and DNA repair factor IIH,
OsREX1-S Cadmium tolerance
renders plant cells tolerant to cadmium- and
UV-induced damage by enhancing DNA excision
repair." Planta 239(5): 1101-1111.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Hu, S., et al. (2017). "OsMYB45 plays an important
OsMYB45 Cadmium tolerance
role in rice resistance to cadmium stress." Plant Sci
264: 1-8.
Hwang, S. G., et al. (2016). "Molecular dissection of
Tolerance to salinity Oryza sativa salt-induced RING Finger
Protein 1
OsSIRP1 and other stresses
(OsSIRP1): possible involvement in the sensitivity
response to salinity stress." Physiol Plant 158(2):
168-179
He, X., et al. (2017). "A rice jacalin-related
mannose-binding lectin gene, OsJRL, enhances
Tolerance to salinity
OsJRL
Escherichia coli viability under high salinity stress
and other stresses
and improves salinity tolerance of rice." Plant Biol
(Stuttg) 19(2): 257-267.
Xu, Y., et al.(2020). "Natural variations of SLG1
SLG1 Heat tolerance confer high-temperaturetolerance in
indica
rice. "Nature Communications, 11(1), 5441.
Feng, L., et al. (2007). "Overexpression of SBPase
SBPase Heat tolerance
enhances photosynthesis against high temperature
stress in transgenic rice plants." Plant Cell Rep 26(9):
1635-1646.
Ho, S. L., et al. (2013). "Sugar starvation- and
GA-inducible calcium-dependent protein kinase 1
OsCDPK1 Drought tolerance
feedback regulates GA biosynthesis and activates a
14-3-3 protein to confer drought tolerance in rice
seedlings." Plant Mol Biol 81(4-5): 347-361.
Li, J., et al (2017)."OsASR5 enhances drought
tolerance through a stomatal closure pathway
OsASR5 Drought tolerance
associated with ABA and H202 signalling in
ri ce. "Plant Biotechnology Journal..
Kang, Z., et al. (2019). "Overexpression of the zinc
Abiotic stress finger protein gene OsZFP350 improves root
OsZFP350
tolerance development by increasing resistance to
abiotic stress
in rice." Acta Biochim Pol 66(2): 183-190.
Jain, M., et al. (2008). "Constitutive expression of a
meiotic recombination protein gene homolog,
Abiotic stress
OsTOP6A1 OsTOP6A1, from rice confers abiotic stress
tolerance
tolerance
in transgenic Arabidopsis plants." Plant Cell Rep
27(4): 767-778.
Kumar, S., et al. (2013). "Expression of a rice Lambda
class of glutathione S-transferase, OsGSTL2, in
Abiotic stress
OsGSTL2
Arabidopsis provides tolerance to heavy metal and
tolerance
other abiotic stresses." J Hazard Mater 248-249:
228-237.
Kumari, S., et al. (2015). "Expression of a cyclophilin
OsCyp2-P isolated from a salt-tolerant landrace of
Abiotic stress
OsCyp2-P
rice in tobacco alleviates stress via ion homeostasis
tolerance
and limiting ROS accumulation." Funct Integr
Genomics 15(4): 395-412.
86
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
To enhance tolerance
Huang, J., et al. (2008). "Expression analysis of rice
to high and low
A20/AN1-type zinc finger genes and characterization
ZFP177 temperatures and
of ZFP177 that contributes to temperature stress
sensitivity to salt and
tolerance." Gene 420(2): 135-144.
drought
Fang, J. C., et al. (2021). "A CCR4-associated factor
Low-temperature 1, OsCAF1B, confers tolerance of low-
temperature
OsCAF1B
tolerance stress to rice seedlings." Plant Mol Biol
105(1-2):
177-192.
Ke, S., et al. (2019). "Rice OsPEX1, an extensin-like
OsPEX1 Lignin content protein, affects lignin biosynthesis and
plant growth."
Plant Mol Biol 100(1-2): 151-161.
Liang, Z., et al. (2010). "A novel simple extracellular
leucine-rich repeat (eLRR) domain protein from rice
OsLRR1 Immune response (0sLRR1) enters the endosomal pathway and
interacts
with the hypersensitive-induced reaction protein 1
(0sHIR1)." Plant Cell & Environment, 32.
Liang, Z., et al. (2010). "A novel simple extracellular
leucine-rich repeat (eLRR) domain protein from rice
OsHIR1 Immune response (0sLRR1) enters the endosomal pathway and
interacts
with the hypersensitive-induced reaction protein 1
(0sHIR1)." Plant Cell & Environment, 32.
D Wu., et al.(2015). "Overexpressing OsPIN2
enhances aluminium internalization by elevating
OsPIN2 Aluminium tolerance
vesicular trafficking in rice root apex. 'Journal of
Experimental Botany, 66(21), 6791-6801.
Heang, D. and H. Sassa (2012). "An atypical bHLH
protein encoded by POSITIVE REGULATOR OF
Grain length and GRAIN LENGTH 2 is involved in controlling
grain
PGL2
weight length and weight of rice through interaction
with a
typical bHLH protein APG." Breed Sci 62(2):
133-141.
Heang, D. and H. Sassa (2012). "Antagonistic actions
Grain length and
PGL1 of HLH/bHLH proteins are involved in grain
length
weight
and weight in rice." PLoS One 7(2): e31325.
Grain number and Yang, J., et al. (2018). "Chromatin
interacting factor
OsCKX2 OsVIL2 increases biomass and rice grain
yield."Plant
yield
Biotechnology Journal.
Islam, M. A., et al. (2009). "Characterization of
Wax accumulation and Glossy 1-homologous genes in rice involved in
leaf
OsGL1-2
drought resistance wax accumulation and drought resistance."
Plant Mol
Biol 70(4): 443-456
Wang, T., et al. (2019). "GRAIN LENGTH AND
GLA1 To regulate grain size AWN 1 negatively regulates grain size in
rice." J
Integr Plant Biol 61(10): 1036-1042.
Yang, B. J., et al. "Rice microtubule-associated
To regulate grain protein IQ67-DOMAIN14 regulates grain shape
by
OsIQD14
shape modulating microtubule cytoskeleton
dynamics. "Wiley-Blackwell Online Open, 18(5).
Guan, Q., et al. (2012). "Genetic transformation and
OsAPx2 Salt tolerance analysis of rice OsAPx2 gene in Medicago
sativa."
PLoS One 7(7): e41233.
87
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Sun, Y., et al. (2017). "TP546, a Rice Terpene
Synthase Conferring Natural Resistance to Bird
TPS46 Aphid resistance
Cherry-Oat Aphid, Rhopalosiphum padi (Linnaeus)."
Front Plant Sci 8: 110.
Huang, Y., et al. (2018). "9-cis-Epoxycarotenoid
Dioxygenase 3 Regulates Plant Growth and Enhances
OsNCED3 Stress resistance
Multi-Abiotic Stress Tolerance in Rice." Front Plant
Sci 9: 162.
Yuexing Yuan., et al.(2010). "Functional analysis of
rice NPR1-like genes reveals that OsNPR1/NH1 is the
Rice bacterial leaf
OsNPR1 rice orthologue conferring disease
resistance with
blight resistance
enhance herbivore susceptibility. "Plant Biotechnology
Journal, 5(2), 313-324.
Kutubuddin A Molla., et al.(2013). "Rice oxalate
oxidase gene driven by green tissue-specific promoter
Sheath blight
0s0X04 increases tolerance to sheath blight
pathogen
resistance
(Rhizoctonia solani) in transgenic rice. "Molecular
Plant Pathology, 14(9).
Rice stripe disease Hong, W., et al. (2015). "OsRDR6 plays role
in host
RDR6 resistance defense against double-stranded RNA virus,
Rice
Dwarf Phytoreovirus." Sci Rep 5: 11324.
Kuang, J., et al. (2017). "A Class II small heat shock
Biotic and abiotic protein OsHsp18.0 plays positive roles in both biotic
OsHsp18.0
stress tolerance and abiotic defense responses in rice." Sci Rep 7(1):
11333.
Ge, L. F., et al. (2008). "Overexpression of the
trehalose-6-phosphate phosphatase gene 0sTPP1
Salt stress, cold stress
OsTPP1 confers stress tolerance in rice and results
in the
tolerance
activation of stress responsive genes." Planta 228(1):
191-201.
Ye, Zhang., et al.(2016). "An A20/AN1-type zinc
finger protein modulates gibberellins and abscisic acid
ZFP185 Stress resistance
contents and increases sensitivity to abiotic stress in
rice (Oryza sativa). "Journal of Experimental Botany.
Choi, G. H. and K. Back (2019). "Suppression of
Melatonin 2-Hydroxylase Increases Melatonin
M2H Stress resistance Production Leading to the
Enhanced Abiotic Stress
Tolerance against Cadmium, Senescence, Salt, and
Tunicamycin in Rice Plants." Biomolecules 9(10).
Kothari, K. S., et al. (2016). "Rice Stress Associated
Protein 1 (OsSAP1) Interacts with Aminotransferase
OsSAP1 Stress resistance (0sAMTR1) and Pathogenesis-
Related la Protein
(OsSCP) and Regulates Abiotic Stress Responses."
Front Plant Sci 7: 1057.
Lee, S., et al. (2012). "Activation of Rice
nicotianamine synthase 2 (0sNAS2) enhances iron
OsNAS2 Stress tolerance
availability for biofortification." Mol Cells 33(3):
269-275.
88
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Redillas, M. C., et al. (2012). "The overexpression of
Drought tolerance and OsNAC9 alters the root architecture of rice
plants
OsNAC9
crop yield enhancing drought resistance and grain yield
under
field conditions." Plant Biotechnol J 10(7): 792-805.
Ahmad, I., et al. (2016). "Overexpression of the
OsTPKb Drought tolerance potassium channel TPKb in small vacuoles
confers
osmotic and drought tolerance to rice." New Phytol
209(3): 1040-1048.
Fang, M., et al. (2019). "Overexpression of OsFTL10
OsFTL10 Drought tolerance induces early flowering and improves
drought
tolerance in Oryza sativa L." Peed 7: e6422.
Chen, H., et al. (2012). "Basic leucine zipper
0 sbZIP16 Drought tolerance transcription factor OsbZIP16 positively
regulates
drought resistance in rice." Plant Sci 193-194: 8-17.
Ahmad, I., et al. (2016). "Overexpression of the rice
AKT1 potassium channel affects potassium nutrition
OsAKT1 Drought tolerance
and rice drought tolerance." J Exp Bot 67(9):
2689-2698.
Du, H., et al. (2011). "Characterization of an inositol
Drought and salt 1,3,4-trisphosphate 5/6-kinase gene that is
essential
OsITPK2
tolerance for drought and salt stress responses in
rice." Plant
Mol Biol 77(6): 547-563.
You, J., et al.(2013) "The SNAC1-targeted gene
Drought tolerance and OsSROlc modulates stomatal closure and
oxidative
OsSROlc
oxidation resistance stress tolerance by regulating hydrogen
peroxide in
rice. 'Journal of Experimental Botany(2), 569.
Chang, Y., et al. (2017). "Co-overexpression of the
Constitutively Active Form of OsbZIP46 and
OsbZIP46C Drought and
ABA-Activated Protein Kinase SAPK6 Improves
A1&SAPK6 temperature tolerance
Drought and Temperature Stress Resistance in Rice."
Front Plant Sci 8: 1102.
Du, H., et al. (2010). "Characterization of the
beta-carotene hydroxylase gene DSM2 conferring
DSM2 Drought tolerance and
drought and oxidative stress resistance by increasing
/0sBCH1 oxidation resistance
xanthophylls and abscisic acid synthesis in rice." Plant
Physiol 154(3): 1304-1318.
Zuluaga, A. P., et al. (2020). "The Rice DNA-Binding
Drought tolerance and Protein ZBED Controls Stress Regulators and
ZBED
disease resistance Maintains Disease Resistance After a Mild
Drought."
Front Plant Sci 11: 1265.
Wang, Z., et al. (2018)."The E3 Ligase DROUGHT
HYPERSENSITIVE Negatively Regulates Cuticular
ROC4 Drought tolerance Wax Biosynthesis by Promoting the
Degradation of
Transcription Factor ROC4 in Rice." Plant Cell,
tpc.00823.2017.
You, J., et al. (2014). "A STRESS-RESPONSIVE
NAC1-Regulated Protein Phosphatase Gene Rice
OsPP18 Drought tolerance Protein Phosphatase18 Modulates Drought and
Oxidative Stress Tolerance through Abscisic
Acid-Independent Reactive Oxygen Species
89
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Scavenging in Rice."Plant Physiology, 166(4),
2100-14.
Lee, D. K., et al. (2016). "Overexpression of the
OsERF71 Transcription Factor Alters Rice Root
OsERF71 Drought tolerance
Structure and Drought Resistance." Plant Physiol
172(1): 575-588.
Wan, L., et al. (2011). "Transcriptional activation of
OsDERF1 in OsERF3 and OsAP2-39 negatively
0 sDERF1 Drought tolerance
modulates ethylene synthesis and drought tolerance in
rice." PLoS One 6(9): e25216.
Kang, J., et al. (2017). "Overexpression of the
leucine-rich receptor-like kinase gene LRK2 increases
LRK2 Drought tolerance
drought tolerance and tiller number in rice." Plant
Biotechnol J 15(9): 1175-1185.
"The E3 Ligase DROUGHT HYPERSENSITIVE
Negatively Regulates Cuticular Wax Biosynthesis by
DHS Drought tolerance
Promoting the Degradation of Transcription Factor
ROC4 in Rice"
Jin, Y. M., et al. (2018). "Overexpression of a New
OsCTZFP8 Cold resistance Zinc Finger Protein Transcription Factor
OsCTZFP8
Improves Cold Tolerance in Rice." Int J Genomics
2018: 5480617.
Kim, H., et al. (2014). "Overexpression of PYL5 in
OsPYL/RC Abiotic stress rice enhances drought tolerance, inhibits
growth, and
AR5 tolerance modulates gene expression." J Exp Bot
65(2):
453-464.
Jan, R., et al. (2020). "Overexpression of OsF3H
modulates WBPH stress by alteration of
Plant hopper
OsF3H phenylpropanoid pathway at a transcriptomic
and
resistance
metabolomic level in Oryza sativa." Sci Rep 10(1):
14685.
Helliwell, E. E., et al. (2013). "Transgenic rice with
Magnaporthe oryzae inducible ethylene production exhibits broad-spectrum
OsACS2 and Rhizoctonia solani disease
resistance to the fungal pathogens
disease resistance Magnaporthe oryzae and Rhizoctonia solani."
Plant
Biotechnol J 11(1): 33-42.
Naoki, Y., et al. (2013)."WRKY76 is a rice
Magnaporthe oryzae transcriptional repressor playing opposite
roles in
OsWRKY76 resistance and drought blast disease resistance and cold stress
tolerance tolerance. "Journal of Experimental
Botany(16),
5085-5097.
Magnaporthe oryzae Jisha, V., et al. (2015). "Overexpression
of an
and xanthomonas AP2/ERF Type Transcription Factor OsEREBP1
0 sEREBP1
oryzae resistance; Confers Biotic and Abiotic Stress Tolerance
in Rice."
drought tolerance PLoS One 10(6): e0127831.
Juan., et al.(2008)"Constitutive expression of
Magnaporthe oryzae pathogen-inducible OsWRKY31 enhances disease
OsWRKY31
resistance resistance and affects root growth and auxin
response
in transgenic rice plants."Cell Research.
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Han, Y., et al. (2019). "A Magnaporthe Chitinase
Magnaporthe oryzae Interacts with a Rice Jacalin-Related
Lectin to
OsMBL1
resistance Promote Host Colonization." Plant Physiol
179(4):
1416-1430.
Shen, Q., et al. (2019). "CYP71Z18 overexpression
Magnaporthe oryzae
CYP71Z18 confers elevated blast resistance in transgenic rice."
resistance
Plant Mol Biol 100(6): 579-589.
Fan, C., et al. (2018). "Ectopic expression of a novel
OsExtensin-like gene consistently enhances plant
Plant lodging
OsEXTL lodging resistance by regulating cell
elongation and
resistance
cell wall thickening in rice." Plant Biotechnol J 16(1):
254-263.
Qiao, L., et al. (2020). "Expression of rice siR109944
in Arabidopsis affects plant immunity to multiple
siR109944 Disease resistance
fungal pathogens." Plant Signal Behav 15(4):
1744347.
Wally, 0. and Z. K. Punja (2010). "Enhanced disease
resistance in transgenic carrot (Daucus carota L.)
OsPrx114 Disease resistance
plants over-expressing a rice cationic peroxidase."
Planta 232(5): 1229-1239
Wang, H., et al. (2007). "Overexpression of rice
WRKY89 enhances ultraviolet B tolerance and
OsWRKY89 Disease resistance
disease resistance in rice plants." Plant Mol Biol
65(6): 799-815.
Shengze, et al. (2019). Transcriptional regulation of
miR528 Virus resistance mir528 by OsSPL9 orchestrates antiviral
response in
rice. -)-Y-fitt:AVIR.(8), 1114-1122.
He, S. L., et al. (2018). "Overexpression of a
constitutively active truncated form of OsCDPK1
OsCDPK1 Disease resistance
confers disease resistance by affecting OsPR10a
expression in rice." Sci Rep 8(1): 403.
Huang, L. F., et al. (2016). "Multiple Patterns of
Bacterial leaf blight Regulation and Overexpression of a
OsPR10a and streak disease Ribonuclease-Like Pathogenesis-Related
Protein
resistance Gene, OsPR10a, Conferring Disease Resistance
in
Rice and Arabidopsis." PLoS One 11(6): e0156414.
Bacterial leaf blight Lee, H., et al. (2018). "Rice WRKY11 Plays a
Role in
OsWRKY11 Pathogen Defense and Drought Tolerance." Rice (N
resistance
Y) 11(1): 5.
Kachewar, N. R., et al. (2019). "Overexpression of
Bacterial leaf blight OsPUB41, a Rice E3 ubiquitin ligase induced
by cell
OsPUB41
resistance wall degrading enzymes, enhances immune
responses
in Rice and Arabidopsis." BMC Plant Biol 19(1): 530.
Li, B., et al. (2019). "Overexpression a "fruit-weight
Bacterial leaf blight
OsFWL5 2.2-like" gene OsFWL5 improves rice
resistance."
resistance
Rice (NY) 12(1): 51.
91
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Jan, R., et al. (2020). "Overexpression of OsCM
Bacterial leaf blight alleviates BLB stress via phytohormonal
accumulation
OsCM
resistance and transcriptional modulation of defense-
related
genes in Oryza sativa." Sci Rep 10(1): 19520.
Elliott, C., et al. (2002). "Functional conservation of
Powdery mildew wheat and rice Mb o orthologs in defense
modulation to
OsM1o2
resistance the powdery mildew fungus." Mol Plant
Microbe
Interact 15(10): 1069-1077.
Izawa, T., et al. (2000). "Phytochromes confer the
SE5 Flowering photoperiodic control of flowering in rice (a
short-day
plant)." Plant J 22(5): 391-399.
Lee, S., et al. (2004). "Functional analyses of the
flowering time gene OsMADS50, the putative
OsMADS50 Flowering SUPPRESSOR OF OVEREXPRESSION OF CO
1/AGAMOUS-LIKE 20 (SOC1/AGL20) ortholog in
rice." Plant J 38(5): 754-764.
Jeon, J. S., et al. (2000). "leafy hull sterilel is a
OsMADS1 Flowering homeotic mutation in a rice MADS box gene affecting
rice flower development." Plant Cell 12(6): 871-884.
Hayama, R., et al. (2003). "Adaptation of
OsGI Flowering photoperiodic control pathways produces short-
day
flowering in rice." Nature 422(6933): 719-722.
Zhang, Z., et al.(2020). Two glyoxylate reductase
isoforms are functionally redundant but required
OsGR2 Detoxication
under high photorespiration conditions in rice. BMC
Plant Biology, 20(1).
Zhang, Z., et al.(2020). Two glyoxylate reductase
isoforms are functionally redundant but required
OsGR1 Detoxication
under high photorespiration conditions in rice. BMC
Plant Biology, 20(1).
Jain, M., et al. (2020). "A D-lactate dehydrogenase
To relieve biotic stress from rice is involved in conferring
tolerance to
OsD-LDH2
tolerance multiple abiotic stresses by maintaining
cellular
homeostasis." Sci Rep 10(1): 12835.
Yang A. et al. (2016). "A Small GTPase, OsRab6a,
i
Environment singal i OsRab6a s Involved n the Regulation of Iron
Homeostasis in
(iron) response
Rice." Front Plant Sci 11: 595439.
Broad, R. C., et al. (2020). "Effect of Rice
Overexpression on
GDP-L-Galactose Phosphorylase Constitutive
ascorbate
OsGGP Overexpression on Ascorbate Concentration, Stress
concentration; stress
Tolerance, and Iron Bioavailability in Rice." Front
tolerance
Plant Sci 11: 595439.
Ming, Zheng ., et al.(2015). "DEFORMED FLORAL
ORGAN1 (DF01) regulates floral organ identity by
Floral organ
OsMADS58 epigenetically repressing the expression
of
development
OsMADS58 in rice (Oryza sativa). "New Phytologist,
206(4).
Ming,Zheng., et al.(2015). "DEFORMED FLORAL
Floral organ ORGAN1 (DF01) regulates floral organ identity
by
DF01
development epigenetically repressing the expression
of
OsMADS58 in rice (Oryza sativa). "New Phytologist,
92
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
206(4).
Zhang, Y. C., et al.(2019). "OsmiR528 regulates
rice-pollen intine formationby targeting an uclacyanin
OsUCL23 Pollen development
to influence flavonoid metabolism. "Proceedings of the
National Academy of Sciences, 117(1), 201810968.
Chu, H., et al. (2013). "A CLE-WOX signalling
allene oxide Brown planthopper module regulates root meristem
maintenance and
cyclase resistance vascular tissue development in rice." J Exp
Bot
64(17): 5359-5369.
Chen, L., et al. (2020). "Overexpression of a Cytosolic
6-Phosphogluconate Dehydrogenase Gene Enhances
0s6PGDH1 Brown planthopper
the Resistance of Rice to Nilaparvata lugens." Plants
(Basel) 9(11).
Chen, L., et al. (2018). "Overexpression of OsGID1
OsGID1 Brown planthopper Enhances the Resistance of
Rice to the Brown
Planthopper Nilaparvata lugens." Int j Mol Sci 19(9).
Hydrogen peroxide
accumulation, rice Hoang, T. V., et al. (2019). "Heat stress transcription
blast resistance, factor OsSPL7 plays a critical role in
reactive oxygen
OsSPL7
bacterial blight species balance and stress responses in rice."
Plant Sci
resistance, cold 289: 110273.
tolerance
Moreno-Moyano, L. T., et al.(2016). "Association of
zinc and ironconten Increased Grain Iron and Zinc Concentrations with
OsNAS2
in rice gains Agro-
morphological Traits ofBiofortified
Rice."Frontiers in Plant Science, 7, 1463.
Liu, S., et al. (2019). "Overexpression of a
CPYC-Type Glutaredoxin, OsGrxC2.2, Causes
OsGrxC2.2 increasegrain weight
Abnormal Embryos and an Increased Grain Weight in
Rice"
Wei Li., et al (2011). "Rice RING protein OsBBIl
broad spectrum
with E3 ligase activity confers broad-spectrum
OsBBIl resistance to
resistance against Magnaporthe oryzae by modifying
Magnaporthe oryzae
the cell wall defence."Cell Research, 21(5), 835-848.
Liu, X., et al. (2015)."Regulation of Histone
Methylation and Reprogramming of Gene Expression
SDG711 large inflorescence
in the Rice Inflorescence Meristem."Plant Cell, 27(5),
1428-44.
Li, Y., et al.(2018). "Panicle Morphology Mutant 1
increaseyield and (PMM1) determines the inflorescence
architecture of
PMM1
grain weight rice by controlling brassinosteroid
biosynthesis."BMC
Plant Biology, 18(1).
Liu, K. P., et al.(2017). "SET DOMAIN GROUP701
encodes a H3K4-methytransferase and regulates
SDG701 early flowering multiple key processes of rice plant
development. "NEW PHYTOL, 2017,215(2)(-),
609-623.
Xixi, Liu., et al. (2019)."Protein Interactomic
Analysis of SAPKs and ABA-Inducible bZIPs
SAPK10 early flowering
Revealed Key Roles of SAPK10 in Rice
Flowering "International Journal of Molecular
93
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Sciences.
Lu, L., et al. (2016) "OsPAP10c, a novel secreted
acid phosphatase in rice, plays an important role in the
OsPAP10c phosphorus utilization
utilization of external organic phosphorus. "Plant, Cell
& Environment.
Liu, A. L., et al. (2013). "Over-expression of
salt and drought
OsHsfA7 OsHsfA7 enhanced salt and drought tolerance
in
tolerance
transgenic rice."BMB Reports, 46(1).
Qibin Ma., et al.(2009). "Enhanced T olerance to
Chilling Stress in OsMYB3R-2T ransgenic Rice Is
OsMYB3R-
cold tolerance Mediated by Alteration in Cell Cycle and
Ectopic
2
Expression of Stress Genes." Plant Physiology,
150(1), 244-256.
Moon, S. J., et al.(2019)."Ectopic Expression of
OsDREB1G, a Member of the OsDREB1 Subfamily,
0 sDREB1G cold tolerance
Confers Cold Stress Tolerance in Rice."Frontiers in
plant science, 10.
Lou, D., et al.(2018)."The sucrose
non-fermenting-1-related protein kinases SAPK1 and
SAPK1
salt tolerance SAPK2 function collaboratively as positive
regulators
SAPK2
of saltstress tolerance in rice."BMC Plant Biology,
18(1).
Min, L., et al.(2010). Rice gtpase osracb: potential
OsRacB salt tolerance
accessory factor in plant salt-stress signaling. Acta
Biochimica Et Biophysica Sinica, 38(6), 393-402.
Xin Liu., et al.(2018). Identification and
characterization of the rice pre-harvest sprouting
OsCNX6 salt tolerance
mutants involved in molybdenum cofactor
biosynthesis The New Phytologist.
Liu, Y., et al. (2020). "Overexpression of OsCIPK30
tolerance to rice
OsCIPK30 Enhances
Plant T olerance to Rice stripe
stripe virus
virus 'Frontiers in Microbiology, 8, 2322.
"Proteomic Analysis of Rice Subjected to Low Light
low light
OsGAPB Stress and Overexpression of OsGAPB Increases
the
stresstolerance
Stress Tolerance." Rice, 13(1).
Eng, L., et al. (2011)."An EAR-motif-containing ERF
OsERF3 stress resistance transcription factor affects herbivore-
induced
signaling, defense and resistance in rice." Plant
Journal, 68(4), 583-596.
Liang, S., et al. (2019). "Overexpression of OsARD1
Improves Submergence, Drought, and Salt Tolerances
0 sARD1 stress resistance
of Seedling Through the Enhancement of Ethylene
Synthesis in Rice "Frontiers in Plant Science, 10.
Liu, W. Y., et al.(2009). "The OsDHODH1 Gene is
drought and salt Involved
in Salt and Drought Tolerance in
OsDHODH1
tolerance
Rice. "Journal of Integrative Plant Biology, 51(009),
825-833.
94
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Lian, H. L., et al.(2004). "The Role of Aquaporin
RWC3 drought tolerance RWC3 in Drought A voidance in Rice."Plant &
Cell
Physiology.
Liu, C., et al. (2019). "The bZIP73 transcription factor
bZIP73 cold tolerance controls rice cold tolerance at the
reproductive
stage "Plant Biotechnology Journal, 17(9).
rice blast disease Hirochika, H., et al. (2010)."Pdkl Kinase
Regulates
resistance and Basal Disease Resistance Through the
OsPdkl
bacterial leaf blight OsOxil¨OsPtila Phosphorylation Cascade in
disease Rice."Plant & Cell Physiology, 51(12), 2082-
91.
Mou, S., et al.(2015). Over-expression of rice CBS
domain containing protein, OsCBSX3, confers rice
rice blast disease
OsCBSX3 resistance to magnaporthe oryzae
inoculation.
resistance
International Journal of Molecular Sciences, 16(7),
15903-15917.
Liu, X., et al. (2020). Rice OsAAA-ATPasel is
induced during blast infection in a salicylic
OsAAA-AT rice blast disease
acid-dependent manner, and promotes blast fungus
Pasel resistance
resistance International Journal of Molecular
Sciences, 21(4), 1443.
Liu, F., et al. (2020). The rice xa3 gene confers
bacterial leaf blight resistance to xanthomonas oryzae pv. oryzae
in the
XA3
disease resistance model rice kitaake genetic background.
Frontiers in
Plant Science, 11.
Seok-Jun., et al.(2018). OsTGA2 confers disease
bacterial leaf blight resistance to rice against leaf blight by
regulating
OsTGA2
disease resistance expression levels of disease related genes
via
interaction with NH1. PloS one, 13(11), e0206910.
Wenqi, L., et al.(2019). Overexpressing CYP71z2
bacterial leaf blight
OsCYP71Z2 enhances resistance to bacterial blight by
suppressing
disease resistance
auxin biosynthesis in rice. PloS one.
Mou, S., et al., (2013). Functional analysis and
bacterial leaf blight expressional characterization of rice
ankyrin
0 sPIANK1
diseaseresi stance repeat-containing protein, ospiankl, in basal
defense
against magnaporthe oryzae attack. Plos One, 8.
Runlong,M., et al.(2013).Nitric Oxide and Protein
NOE1/0sC
programmed cell death S-
Nitrosylation Are Integral to Hydrogen
ATC
Peroxide-Induced Leaf Cell Death in Rice
Ma, N., et al, (2013). Overexpression of OsEXPA8, a
facilitating cell root-specific gene, improves rice growth and
root
OsEXPA8
extension system architecture by facilitating cell
extension.
PLOS ONE, 8(10), e75997-.
Broad spectrum Filipe, 0., et al. (2018). "The energy
sensor
OsSnRKla disease resistance OsSnRKla confers broad-spectrum disease
resistance
(rice blast) in rice." Sci Rep 8(1): 3864.
Ning Xu., et al.(2018). Rice transcription factor
OsMADS25 modulates root growth and confers
OsMADS25 Root development
salinity tolerance via the ABA-mediated regulatory
pathway and ROS scavenging. PLoS genetics.
MHZ5 Root and coleoptile Yin, C. C., et al. (2015). Ethylene
responses in rice
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
growth
roots and coleoptiles are differentially regulated by a
carotenoid isomerase-mediated abscisic acid pathway.
Plant Cell, 27(4), 1061-1081.
Xu, M., et al.(2005)A pinl family gene, ospinl,
Root development and involved in auxin-dependent adventitious
root
OsPIN1
tillering emergence and tillering in rice. Plant &
Cell
Physiology(10), 1674.
Bae, H., et al. (2011). "Overexpression of OsRDCP1,
Drought stress a
rice RING domain-containing E3 ubiquitin ligase,
OsRDCP1
tolerance increased tolerance to drought stress in rice
(Oryza
sativa L.)." Plant Sci 180(6): 775-782.
Zou, Y., et al. (2014). "OsRPK1, a novel leucine-rich
Negatively regulate
OsRPK1 plant
height and tiller repeat receptor-like kinase, negatively regulates polar
auxin transport and root development in rice."
number
Biochim Biophys Acta 1840(6): 1676-1685.
Negatively regulates
Huang, L., et al. (2016). "Rice NAC transcription
drought tolerance and
ONAC095 factor ONAC095 plays opposite roles in drought and
positively regulates
cold stress tolerance." BMC Plant Biol 16(1): 203.
cold tolerance
Fang, Z., et al. (2021). "The Amino Acid Transporter
OsAAP4 Contributes to Rice Tillering and Grain
OsAAP4 Tillering and yield
Yield by Regulating Neutral Amino Acid Allocation
through Two Splicing Variants." Rice (N Y) 14(1): 2.
Zang, A., et al. (2010). Overexpression of OsRAN2 in
rice and Arabidopsis renders transgenic plants
OsRAN2 Abiotic stress
hypersensitive to salinity and osmotic stress. Journal
of experimental botany, 61(3), 777-789.
Zhou, J., et al (2020). CYP71D8L is a key regulator
OsCYP71D
involved in growth and stress responses by mediating
Abiotic stress
8L
gibberellin homeostasis in rice. Journal of
experimental botany, 71(3), 1160-1170.
Zhang, C. et al (2011). An apoplastic h-type
Development and
thioredoxin is involved in the stress response through
OsTRXhl
stress response
regulation of the apoplastic reactive oxygen species in
rice Plant Physiology, 157(4), 1884-1899.
To exert strong Petruccelli, S., et al. (2001).
"Transcription factor
negative effect on the
RF2a alters expression of the rice tungro bacilliform
RF2a
development of virus promoter in transgenic tobacco plants."
Proc
transgenic plants Natl
Acad Sci U S A 98(13): 7635-7640.
Yao, L., et al. (2018). The AWPM-19 family protein
OsPM1 Response to drought OsPM1 mediates abscisic acid
influx and drought
response in rice. The Plant Cell, 30(6), 1258-1276.
Kim, S. K., et al. (2008). "OsCO3, a
To delay flowering in
CONSTANS-LIKE gene, controls flowering by
OsCO3 the conditions of short
daylight
negatively regulating the expression of FT-like genes
under SD conditions in rice." Planta 228(2): 355-365
96
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Fang, C., et al. (2017). "Overexpression of Lsil in
Resistance to cold cold-sensitive rice mediates transcriptional
regulatory
OsLsil
stress networks and enhances resistance to chilling
stress."
Plant Sci 262: 115-126.
Zhu, Z., et al. (2020). "New insights into
Perox3 Rice blast resistance bsr-dl-mediated broad-
spectrum resistance to rice
blast." Mol Plant Pathol 21(7): 951-960.
Chujo, T., et al. (2014). "Overexpression of
phosphomimic mutated OsWRKY53 leads to
OsWRKY53 Rice blast resistance
enhanced blast resistance in rice." PLoS One 9(6):
e98737.
Wang, Q., et al. (2018). "Resistance protein Pit
interacts with the GEF OsSPK1 to activate OsRacl
OsSPK1 Rice blast resistance
and trigger rice immunity." Proc Natl Acad Sci U S A
115(49): E11551-E11560.
Xu, G., et al. (2020). "A fungal effector targets a heat
shock-dynamin protein complex to modulate
OsDjA9 Rice blast resistance
mitochondrial dynamics and reduce plant immunity."
Sci Adv 6(48).
Bundo, M. and M. Coca (2016). "Enhancing blast
disease resistance by overexpression of the
OsCPK4 Rice blast resistance
calcium-dependent protein kinase OsCPK4 in rice."
Plant Biotechnol J 14(6): 1357-1367.
Li, X. P., et al. (2020). "Osa-miR162a fine-tunes rice
Osa-miR162 Rice blast resistance resistance to Magnaporthe oryzae and
Yield." Rice (N
Y) 13(1): 38.
Zhang, C., et al. (2020). "A fungal effector and a rice
APIP4 Rice blast NLR protein have antagonistic effects on a
Bowman-Birk trypsin inhibitor." Plant Biotechnol J
18(11): 2354-2363.
Chen, X., et al. (2018). "The rice terpene synthase
gene OsTPS19 functions as an (S)-limonene synthase
OsTPS19 Rice blast in planta, and its overexpression leads to enhanced
resistance to the blast fungus Magnaporthe oryzae."
Plant Biotechnol J 16(10): 1778-1787.
Qu, L. J., et al. (2003). "Molecular cloning and
functional analysis of a novel type of Bowman-Birk
RBBI2-3 Rice blast
inhibitor gene family in rice." Plant Physiol 133(2):
560-570.
Rehmeyer, C., et al. (2006). "Organization of
chromosome ends in the rice blast fungus,
TLH Rice blast
Magnaporthe oryzae." Nucleic Acids Res 34(17):
4685-4701.
Schaffrath, U., et al. (2000). "Constitutive expression
of the defense-related Rirlb gene in transgenic rice
Rirlb Rice blast plants confers enhanced resistance to the
rice blast
fungus Magnaporthe grisea." Plant Mol Biol 43(1):
59-66.
Wang, C., et al. (2019). "Overexpression of
MoSDT1 Rice blast Magnaporthe Oryzae Systemic Defense Trigger 1
(MoSDT1) Confers Improved Rice Blast Resistance in
97
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Rice." Int J Mol Sci 20(19).
Saint-Macary, M. E., et al. (2015). "Methionine
biosynthesis is essential for infection in the rice blast
Met6 Rice blast
fungus Magnaporthe oryzae." PLoS One 10(4):
e0111108.
Selvaraj, P., et al. (2017). "Cpk2, a Catalytic Subunit
Cpk2 Rice blast of Cyclic AMP-PKA, Regulates Growth and
Pathogenesis in Rice Blast." Front Microbiol 8: 2289.
Tang, M., et al. (2017). "The Nup98 Homolog APIP12
Targeted by the Effector AvrPiz-t is Involved in Rice
APIP12 Rice blast
Basal Resistance Against Magnaporthe oryzae." Rice
(N Y) 10(1): 5.
Saunders, D. G., et al. (2010). "Spatial uncoupling of
mitosis and cytokinesis during appressorium-mediated
SEP1 Rice blast
plant infection by the rice blast fungus Magnaporthe
oryzae." Plant Cell 22(7): 2417-2428.
Yu, J., eta! (2019). Increased autophagy of rice can
Nitrogen use
OsATG8a efficiency increase yield and nitrogen use efficiency
(NUE).
Frontiers in plant science, 10, 584.
Iwamoto M. and A. Tagiri (2016).
To improve nutrient '
"MicroRNA-targeted transcription factor gene RDD 1
RDD1 uptake and increase
yield promotes nutrient ion uptake and
accumulation in
rice." Plant J 85(4): 466-477.
Zhang, L., et al (2015). Three CCT domain-containing
genes were identified to regulate heading date by
OsCCT19 Head sprouting
candidate gene-based association mapping and
transformation in rice. Scientific reports, 5(1), 1-11.
Zhang, L., et al (2015). Three CCT domain-containing
genes were identified to regulate heading date by
OsCCT11 Head sprouting
candidate gene-based association mapping and
transformation in rice. Scientific reports, 5(1), 1-11.
Zhang, L., et al (2015). Three CCT domain-containing
OsCCTO1 Head sprouting genes were identified to regulate heading
date by
candidate gene-based association mapping and
transformation in rice. Scientific reports, 5(1), 1-11.
Itoh, H., et al. (2005). "Overexpression of a GRAS
Gibberellin signaling
SLRL1 protein lacking the DELLA domain confers
altered
repressor
gibberellin responses in rice." Plant J 44(4): 669-679.
He, Z., et al. (2017). "OsGIF1 Positively Regulates
Yield and plant
OsGIF1 the Sizes of Stems, Leaves, and Grains in
Rice." Front
morphology
Plant Sci 8: 1730.
Kim, Y. S., et al. (2013). "Homologous expression of
cytosolic dehydroascorbate reductase increases grain
OsDHAR1 Yield and biomass yield and biomass under paddy field
conditions in
transgenic rice (Oryza sativa L. japonica)." Planta
237(6): 1613-1625.
Huang, Y., et al. (2020). "Wide Grain 7 increases
grain width by enhancing H3K4me3 enrichment in the
WG7 Yield
OsMADS1 promoter in rice (Oryza sativa L.)." Plant J
102(3): 517-528
98
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Sahoo, R. K., et al. (2012). "Pea DNA helicase 45
PDH45 Yield promotes salinity stress tolerance in IR64
rice with
improved yield." Plant Signal Behav 7(8): 1042-1046.
Fan, C., et al. (2019). "Sucrose Synthase Enhances
Hull Size and Grain Weight by Regulating Cell
OsSUS3 Yield
Division and Starch Accumulation in Transgenic
Rice." Int J Mol Sci 20(20).
Ye, Y., et al (2018). OsSND2, a NAC family
transcription factor, is involved in secondary cell wall
OsSND2 Yield
biosynthesis through regulating MYBs expression in
rice. Rice, 11(1), 1-14.
Wang, M., et al (2016). "OsSGL, a novel pleiotropic
OsSGL Yield stress-related gene enhances grain length and
yield in
rice." Sci Rep 6: 38157.
Zhang, Y., et al (2019). The Rho-family GTPase
OsRacl controls rice grain size and yield by
OsRacl Yield
regulating cell division. Proceedings of the National
Academy of Sciences, 116(32), 16121-16126
Fu, X., et al. (2019). "Enhanced Expression of QTL
OsqLL9 Yield qLL9/DEP1 Facilitates the Improvement of
Leaf
Morphology and Grain Yield in Rice." Int J Mol Sci
20(4).
Fan, X., et al. (2016). "Overexpression of a
pH-sensitive nitrate transporter in rice increases crop
OsNRT2.3b Yield
yields." Proc Natl Acad Sci USA 113(26):
7118-7123.
Wang, J., et al. (2018). "Rice nitrate transporter
OsNPF7.2 Yield OsNPF7.2 positively regulates tiller number
and grain
yield." Rice (N Y) 11(1): 12.
Wu, J.,et al (2021). Rice NIN-LIKE PROTEIN 4 plays
OsNLP4 Yield a pivotal role in nitrogen use efficiency.
Plant
biotechnology journal, 19(3), 448-461.
Yang, C., et al(2014). OsMYB103L, an R2R3-MYB
OsMYB103 Yield transcription factor, influences leaf
rolling and
mechanical strength in rice (Oryza sativa L.). BMC
plant biology, 14(1), 1-15.
Zhang, Y., et al(2017). OsMPH1 regulates plant
OsMPH1 Yield height and improves grain yield in rice. PLoS
one,
12(7), e0180825.
Zhao, M.,et al (2015). Regulation of OsmiR156h
OsmiR156 Yield through alternative polyadenylation improves
grain
yield in rice. PloS one, 10(5), e0126154.
Zou, X., et al. (2015). "Over-expression of an
S-domain receptor-like kinase extracellular domain
OsLSK1 Yield
improves panicle architecture and grain yield in rice."
J Exp Bot 66(22): 7197-7209.
Qi, W., et al. (2011). "Rice ethylene-response
AP2/ERF factor OsEATB restricts internode
OsEATB Yield
elongation by down-regulating a gibberellin
biosynthetic gene." Plant Physiol 157(1): 216-228.
99
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Guan, Q., et al. (2017). "Tolerance analysis of
OsCu/Zn-S chloroplast 0 sCu/Zn-SOD overexpressing rice under
Yield
OD NaCl and NaHCO3 stress." PLoS One 12(10):
e0186052.
Yang, X.,et al (2018). Overexpression of
OsbHLH107, a member of the basic helix-loop-helix
OsbHLH107 Yield
transcription factor family, enhances grain size in rice
(Oryza sativa L.). Rice, 11(1), 1-12.
Seo, H., et al. (2020). "The Rice Basic
OsbHLH079 Yield Helix-Loop-Helix 79 (OsbHLH079) Determines
Leaf
Angle and Grain Shape." Int J Mol Sci 21(6).
Zhen, X., et al(2019). OsATG8c-mediated increased
OsATG8c Yield autophagy regulates the yield and nitrogen use
efficiency in rice. International journal of molecular
sciences, 20(19), 4956.
Lee, S., et al. (2020). "OsASN1 Overexpression in
Rice Increases Grain Protein Content and Yield under
OsASN1 Yield
Nitrogen-Limiting Conditions." Plant Cell Physiol
61(7): 1309-1320.
Yaish, M. W., et al(2010). The APETALA-2-like
OsAP2-39 Yield transcription factor OsAP2-39 controls key
interactions between abscisic acid and gibberellin in
rice. PLoS Genet, 6(9), el001098.
He, Q., et al. (2018). "Overexpression of an auxin
receptor OsAFB6 significantly enhanced grain yield
OsAFB6 Yield
by increasing cytokinin and decreasing auxin
concentrations in rice panicle." Sci Rep 8(1): 14051.
Guo, Z. H., et al. (2019). "The overexpression of rice
ACYL-CoA-BINDING PROTEIN2 increases grain
OsACBP2 Yield
size and bran oil content in transgenic rice." Plant J
100(6): 1132-1147.
Zhao, J.,et al (2019). ABC transporter OsABCG18
controls the shootward transport of cytokinins and
OsABCG18 Yield
grain yield in rice. Journal of experimental botany,
70(21), 6277-6291.
Ji, Y., et al. (2020). "The amino acid transporter
AAP1 mediates growth and grain yield by regulating
OsAAP6 Yield
neutral amino acid uptake and reallocation in Oryza
sativa." J Exp Bot 71(16): 4763-4777.
Zhang, M.,et al (2021). Plasma membrane H+-ATPase
overexpression increases rice yield via simultaneous
OSA1 Yield
enhancement of nutrient uptake and photosynthesis.
Nature communications, 12(1), 1-12.
Huo, X., et al. (2017). "NOG1 increases grain
NOG1 Yield
production in rice." Nat Commun 8(1): 1497
Zhao, Y. F., et al(2019). "miR1432-0sACOT
(Acyl-CoA thioesterase) module determines grain
miR1432 Yield
yield via enhancing grain filling rate in rice." Plant
biotechnology journal, 17(4), 712-723.
LRK1 Yield Zha, X.,et.al (2009). "Overexpression of the
rice
100
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LRK1 gene improves quantitative yield components."
Plant biotechnology journal, 7(7), 611-620.
Wang, Y.,et al (2018). "Overexpressing lncRNA
LAIR Yield LAIR
increases grain yield and regulates
neighbouring gene cluster expression in rice." Nature
communications, 9(1), 1-9.
Piao, R., et al. (2014). "Isolation and characterization
HD1 Yield of a dominant dwarf gene, d-h, in rice." PLoS
One
9(2) e86210.
Shi, C. L., et al. (2020). "A quantitative trait locus
GW6 Yield GW6 controls rice grain size and yield
through the
gibberellin pathway." Plant J 103(3): 1174-1188.
Zhou, Y., et al (2017). "GNS4, a novel allele of
GNS4 Yield DWARF11, regulates grain number and grain size
in a
high-yield rice variety." Rice, 10(1), 1-11.
Swamy, B. P., et al. (2013). "Genetic, physiological,
DEGs Yield and gene expression analyses reveal that
multiple
QTL enhance yield of rice mega-variety IR64 under
drought." PLoS One 8(5): e62795.
Wu, Y., et al (2016). "CLUSTERED PRIMARY
BRANCH 1, a new allele of DWARF 11, controls
CPB1/D11 Yield
panicle architecture and seed size in rice." Plant
biotechnology journal, 14(1), 377-386.
Liu, L., et al. (2015). "Activation of big grainl
Bi Grain 1 Yield significantly improves grain size by regulating auxin
g
transport in rice." Proc Natl Acad Sci U S A.
112:11102-11107.
Selvaraj, M. G., et al. (2017). "Overexpression of an
Arabidopsis thaliana galactinol synthase gene
AtGolS2 Yield improves drought tolerance in transgenic rice
and
increased grain yield in the field." Plant Biotechnol J
15(11): 1465-1477.
0 sNLP1(NI Alfatih, A., et al. (2020). "Rice NIN-LIKE
PROTEIN
N-LIKE Yi eld 1 rapidly responds to nitrogen deficiency
and
PROTEIN improves yield and nitrogen use efficiency." J Exp
1) Bot 71(19): 6032-6042.
Qu, M., et al. (2020). "Alterations in stomatal
OsNHX1 Yield response to fluctuating light increase
biomass and
yield of rice under drought conditions." Plant J
104(5): 1334-1347.
Qian, W., et al. (2017). "Novel rice mutants
CYP734A4 Yield overexpressing the brassinosteroid catabolic gene
CYP734A4." Plant Mol Biol 93(1-2): 197-208.
Verma, R. K., et al. (2020). "Overexpression of
AtICE1 Yield Arabidopsis ICE1 enhances yield and multiple
abiotic
stress tolerance in indica rice." Plant Signal Behav
15(11): 1814547.
Domingo, C., et al. (2009). "Constitutive expression
O sGH3. 1 Resistance to a fungal of OsGH3.1 reduces auxin content and
enhances
pathogen defense response and resistance to a fungal
pathogen
in rice." Mol Plant Microbe Interact 22(2): 201-210.
101
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Alam, M. M., etal. (2015). "Overexpression of a rice
Tolerance to heme activator protein gene (0sHAP2E)
confers
OsHAP2E pathogens, salinity resistance to pathogens, salinity and
drought, and
and drought increases photosynthesis and tiller number."
Plant
Biotechnol J 13(1): 85-96.
Dai, M., etal. (2008). "Functional analysis of rice
Semi-dwarfing HOMEOBOX4 (0shox4) gene reveals a negative
Oshox4
phenotype function in gibberellin responses." Plant
Mol Biol
66(3): 289-301.
Yang, D. L., et al (2008). "Altered Disease
Resistance to bacterial Development in the eui Mutants
EUI leaf blight and leaf and Eui Overexpressors Indicates that
Gibberellins
blast in rice Negatively Regulate Rice Basal Disease
Resistance. "Molecular plant, 1(3), 528-537.
Caddell, D. F., et al. (2017). "Silencing of the Rice
Resistance to bacterial Gene LRR1 Compromises Rice Xa21 Transcript
LRR1
leaf blight in rice Accumulation and XA21-Mediated Immunity."
Rice
(NY) 10(1): 23.
Ding, X., et al. (2008). "Activation of the
indole-3-acetic acid-amido synthetase GH3-8
Resistance to bacterial
GH3-8, suppresses expansin expression and
promotes
leaf blight in rice
salicylate- and jasmonate-independent basal immunity
in rice." Plant Cell 20(1): 228-240.
Tran, T. T., et al. (2018). "Functional analysis of
OsSWEET1 Resistance to bacterial African Xanthomonas oryzae pv. oryzae
TALomes
4 leaf blight in rice reveals a new susceptibility gene in
bacterial leaf
blight of rice." PLoS Pathog 14(6): e1007092.
Sharma, A., et al. (2000). "Transgenic expression of
Resistance to bacterial cecropin B, an antibacterial peptide from Bombyx
cecropin B
leaf blight in rice mori, confers enhanced resistance to
bacterial leaf
blight in rice." FEBS Lett 484(1): 7-11.
Hogue, M. S., et al. (2006). "Over-expression of the
rice OsAMT1-1 gene increases ammonium uptake and
OsAMT1-1 Ammonium uptake content, but impairs growth and development of
plants
under high ammonium nutrition." Funct Plant Biol
33(2): 153-163.
Lan, J., etal. (2020). "Small grain and semi-dwarf 3, a
WRKY transcription factor, negatively regulates plant
OsWRKY36 Dwarfing
height and grain size by stabilizing SLR1 expression
in rice." Plant Mol Biol 104(4-5): 429-450
He, Q., et al. (2020). "OsbHLH6 interacts with
bHLH6 Pi uptake OsSPX4 and regulates the phosphate
starvation
response in rice.' Plant J.
Huang, W., et al. (2018) "Two Splicing Variants of
Nitrogen uptake and
OsNPF7.7 OsNPF7.7 Regulate Shoot Branching and
Nitrogen
utilization
Utilization Efficiency in Rice." Front Plant Sci 9: 300.
Kobayashi, T., et al. (2020). "Iron
deficiency-inducible peptide coding genes OsIMA1
OsIMA1 Fe uptake
and OsIMA2 positively regulate a major pathway of
iron uptake and translocation in rice." J Exp Bot.
102
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Dey, A., et al. (2016). "The sucrose non-fermenting
1-related kinase 2 gene SAPK9 improves drought
Drought tolerance and
tolerance and grain yield in rice by modulating
SAPK9
grain yield
cellular osmotic potential, stomatal closure and
stress-responsive gene expression." BMC Plant Biol
16(1): 158.
La, H., et al. (2011). "A 5-methylcytosine DNA
glycosylase/lyase demethylates the retrotransposon
DNG701 DNA methylation
Tos17 and promotes its transposition in rice." Proc
Natl Acad Sci USA 108(37): 15498-15503.
Feng, Z., et al. (2016). "SLG controls grain size and
OsSLG grain yield leaf angle by modulating brassinosteroid
homeostasis
in rice." J Exp Bot 67(14): 4241-4253.
Table I lists the representative functional genes in wheat. Methods in the
present
invention can be used to edit such genes and create new genes by designing new
combinations of different gene elements or different protein domain, and can
be utilized in
wheat breeding program.
Table I: Important functional genes in wheat
Gene name Application Reference
Ashikawa I, et al. (2010). Ectopic expression of wheat and barley
TaDOG1L Seed dogl-like genes promotes seed dormancy in arabidopsis.
Plant
1 dormancy Science An International Journal of Experimental Plant
Biology,
179(5), 536-542.
Cai-Li B I, et al. (2010). Cloning and characterization of a
Salt
CTR1 putative ctrl gene from wheat. Journal of Integrative
Agriculture,
resistance
9(009), 1241-1250.
Dong N, et al. (2010). Overexpression of tapiepl, a
Pathogenic
TaPIEP1 bacteria
pathogen-induced erf gene of wheat, confers host-enhanced
resistance to fungal pathogen bipolaris sorokiniana. Functional &
resistance
Integrative Genomics, 10(2), 215-226.
Valquiria R M Pierucci, et al. (2009). Effects of overexpression of
Flour
1Dy12 high molecular weight glutenin subunit 1 dy10 on wheat
tortilla
quality
properties. J Agric Food Chem, 57(14), 6318-6326.
Zhou W, et al. (2009). Overexpression of tastrg gene improves
Salt
STRP salt and drought tolerance in rice. Journal of Plant
Physiology,
resistance
166(15), 1660-1671.
Xu Z S, et al. (2008). Characterization of the taaidfa gene
Signal
encoding a crt/dre-binding factor responsive to drought, high-salt,
TaAIDFa transductio
and cold stress in wheat. Molecular Genetics & Genomics,
280(6), 497-508.
Sugie A, et al. (2006). Overexpression of wheat alternative
Cold oxidase gene waoxla alters respiration capacity and
response to
Waoxla
tolerance
reactive oxygen species under low temperature in transgenic
arabidopsis. Genes & Genetic Systems, 81(5), 349-354.
Li C, et al. (2006). Cloning and expression analysis of tskl, a
Promotion
wheat skpl homologue, and functional comparison with
skpl of cell
division arabidopsis askl in male meiosis and auxin signalling.
Functional
Plant Biology, 33(4), 381-390.
103
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Drought
Mao, H., et al. (2020). "Regulatory changes in TaSNAC8-6A are
TaSNAC8- tolerance in
associated with drought tolerance in wheat seedlings." Plant
6A seedling
Biotechnol J 18(4): 1078-1092.
stage
Sheath
Lu, L., et al. (2019). "TaCML36, a wheat calmodulin-like protein,
TaCML36 blight
positively participates in an immune response to Rhizoctonia
disease
cerealis." Crop Journal 7(5): 608-618.
resistance
Salt and Ayadi, M., et al (2019). "Overexpression of a Wheat
Aquaporin
TdPIP2;1 drought Gene, TdPIP2;1, Enhances Salt and Drought Tolerance
in
tolerance Transgenic Durum Wheat cv. Maali." Int J Mol Sci
20(10).
Liu, P., et al. (2019). "TaCIPK10 interacts with and
Stripe rust
TaCIPK10 phosphorylates
TaNH2 to activate wheat defense responses to
resistance
stripe rust." Plant Biotechnol J 17(5): 956-968.
Drought
Kalaipandian, S., et al. (2019). "Overexpression of TaCML20, a
tolerance
TaCML20 calmodulin-like gene, enhances water soluble carbohydrate
and growth
accumulation and yield in wheat." Physiol Plant 165(4): 790-799.
promoting
Powdery Jing,
Y., et al. (2019). "Overexpression of TaJAZ1 increases
TaJAZ1 mildew powdery mildew resistance through promoting reactive
oxygen
resistance species accumulation in bread wheat." Sci Rep 9(1):
5691.
Reduced
Dong, H., et al. (2019). "TaCOLD1 defines a new regulator of
TaCOLD1 height of
plant height in bread wheat." Plant Biotechnol J 17(3): 687-699.
plant
Salt and
TaMYB86 drought Song, Y., et al. (2020). "TaMYB86B encodes a R2R3-type
MYB
tolerance transcription factor and enhances salt tolerance in
wheat." Plant
Sci 300: 110624.
He, Y., et al. (2020). "TaUGT6, a Novel
FHB
TaUGT6 UDP-Glycosyltransferase Gene Enhances the Resistance to
FHB
resistance
and DON Accumulation in Wheat." Front Plant Sci 11: 574775.
Yang, J. J., et al. (2020) "Expansin gene TaEXPA2 positively
TaEXP A2 Drought regulates drought tolerance in transgenic wheat
(Triticum
tolerance
aestivum L.)." Plant Science 298: 14.
Hasnain, A., et al. (2020). "Transcription Factor TaDofl
N and C
TaDofl assimilatio Improves Nitrogen and Carbon Assimilation Under Low-
Nitrogen
Conditions in Wheat." Plant Molecular Biology Reporter 38(3):
441-451.
Su, P., et al. (2020). "A member of wheat class III peroxidase
Salt
TaPRX-2A gene
family,TaPRX-2A,enhanced the tolerance of salt stress."
tolerance
BMC Plant Biol 20(1).
Salt Wang,
W., et al. (2020). "The involvement of wheat U-box E3
TaPUB1 ubiquitin ligase TaPUB1 in salt stress tolerance." J
Integr Plant
tolerance
Biol 62(5): 631-651.
Cheuk, A., et al. (2020). "The barley stripe mosaic virus
Drought
expression system reveals the wheat C2H2 zinc finger protein
TaZFP1B
tolerance
TaZFP1B as a key regulator of drought tolerance." BMC Plant
Biol 20(1): 144.
104
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Dmochowska-Boguta, M., et al. (2020). "TaWAK6 encoding
Leaf rust
TaWAK6 wall-
associated kinase is involved in wheat resistance to leaf rust
resistance
similar to adult plant resistance." PLoS One 15(1): e0227713.
sheath
Liu, X., et al. (2020). "The wheat LLM-domain-containing
blight
TaGATA1 disease
transcription factor TaGATA1 positively modulates host immune
response to Rhizoctonia cerealis." J Exp Bot 71(1): 344-355.
resistance
Zhao, Y. J., et al. (2020). "Characterization on the water
TaMAPK1 Drought
deprivation-associated physiological traits as well as the related
6 tolerance
differential genes during seed filling stage in wheat (T. aestivum
L.)." Plant Cell Tissue and Organ Culture 140(3): 605-618.
Heat and
Zang, X., et al. (2018). "Overexpression of the Wheat (Triticum
TaPEPKR aestivum L.) TaPEPKR2 Gene Enhances Heat and Dehydration
drought
2 Tolerance in Both Wheat and Arabidopsis." Front Plant
Sci 9:
tolerance
1710.
Drought
Gao, H., et al. (2018). "Overexpression of a WRKY Transcription
TaWRKY2 Factor TaWRKY2 Enhances Drought Stress Tolerance in
tolerance
Transgenic Wheat." Front Plant Sci 9: 997.
Liu, Z., et al. (2018). "TaNBP1, a guanine nucleotide-binding
Low
subunit gene of wheat, is essential in the regulation of N
TaNBP1 nitrogen
starvation adaptation via modulating N acquisition and ROS
tolerance
homeostasis." BMC Plant Biol 18(1): 167.
Qiao, Q. H., et al. (2018). "Wheat miRNA member TaMIR2275
Low
TaMIR227 involves
plant nitrogen starvation adaptation via enhancement of
nitrogen
the N acquisition-associated process." Acta Physiologiae
tolerance
Plantarum 40(10): 13.
Bi, H., et al. (2018). "Overexpression of the TaSHN1
transcription factor in bread wheat leads to leaf surface
Drought
TaSHN1
modifications, improved drought tolerance, and no yield penalty
tolerance
under controlled growth conditions." Plant Cell Environ 41(11):
2549-2566.
Promoting
Hu, M., et al. (2018). "Transgenic expression of plastidic
TaGS2-2A nitrogen
use glutamine synthetase increases nitrogen uptake and
yield in
wheat." Plant Biotechnol J 16(11): 1858-1867.
efficiency
To enhance
Chen, D., et al. (2018). "Overexpression of a predominantly
drought
TaRNAC1 tolerance
root-expressed NAC transcription factor in wheat roots enhances
of root root length, biomass and drought tolerance." Plant
Cell Rep
37(2) 225-237.
system
Powdery Chen, G., et al. (2018). "TaEDS1 genes positively
regulate
TaED S1 mildew resistance to powdery mildew in wheat." Plant Mol Biol
96(6):
resistance 607-625.
Xing, L. P., et al. (2018). "Over-expressing a
Ta-UGT Head blight UDP-glucosyltransferase gene (Ta-UGT (3) ) enhances
Fusarium
(3)
resistance Head Blight resistance of wheat." Plant Growth Regulation 84(3):
561-571.
Sheath Wang, M., et al. (2018). "A wheat caffeic acid
aCOMT-3 blight 3-0-methyltransferase TaCOMT-3D positively
contributes to
disease both resistance to sharp eyespot disease and stem
mechanical
resistance strength." Sci Rep 8(1): 6543.
105
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Cui, X. Y., et al. (2018). "Wheat CBL-interacting protein kinase
TaCIPK23 Drought23 positively regulates drought stress and ABA responses."
BMC
tolerance
Plant Biol 18(1): 93.
Drought Zhang, N., et al. (2017). "The E3 Ligase TaSAP5 Alters
Drought
TaSAP5 Stress Responses by Promoting the Degradation of DRIP
tolerance
Proteins." Plant Physiol 175(4): 1878-1892.
TaTAR2.1- To increase Shao, A., et al. (2017). "The Auxin Biosynthetic
TRYPTOPHAN
yield and AMINOTRANSFERASE RELATED TaTAR2.1-3A Increases
3A
biomass Grain Yield of Wheat." Plant Physiol 174(4): 2274-
2288.
Sheath Zhu, X., et al. (2017). "The wheat NB-LRR gene TaRCR1
is
blight required for host defence response to the necrotrophic
fungal
TaRCR1
disease pathogen Rhizoctonia cerealis." Plant Biotechnol J
15(6):
resistance 674-687.
Wei, X., et al. (2017). "TaPIMP2, a pathogen-induced MYB
root rot
TaPIMP2 protein in wheat, contributes to host resistance to common root
resistance
rot caused by Bipolaris sorokiniana." Sci Rep 7(1): 1754.
Yang, M. Y., et al. (2017). "Wheat nuclear factor Y (NF-Y) B
TaNF-YB3 Drought subfamily gene TaNF-YB3;1 confers critical drought
tolerance
;1 tolerance through modulation of the ABA-associated signaling
pathway."
Plant Cell Tissue and Organ Culture 128(1): 97-111.
Zang, X., et al. (2017). "Overexpression of wheat ferritin gene
Heat and
TaFER-5B enhances tolerance to heat stress and other abiotic
TaFER-5B other
stresses associated with the ROS scavenging." BMC Plant Biol
tolerance
17(1): 14.
Sheath
Rong, W., et al. (2016). "A Wheat Cinnamyl Alcohol
TaCAD12 blightDehydrogenase TaCAD12 Contributes to Host Resistance to the
disease
Sharp Eyespot Disease." Front Plant Sci 7: 1723.
resistance
Sheath
Wei, X., et al. (2016). "The wheat calcium-dependent protein
blight
TaCPK7-D kinase TaCPK7-D positively regulates host resistance to sharp
disease
eyespot disease." Mol Plant Pathol 17(8): 1252-1264.
resistance
Nitrogen Yang, T., et al. (2016). "TabHLH1, a bHLH-type
transcription
and factor gene in wheat, improves plant tolerance to Pi
and N
TabHLH1 phosphorus
deprivation via regulation of nutrient transporter gene
stress transcription and ROS homeostasis." Plant Physiol
Biochem 104:
tolerance 99-113.
Sheath Shan, T., et al. (2016). "The wheat R2R3-MYB
transcription
blight factor TaRIM1 participates in resistance response
against the
TaRIM1
disease pathogen Rhizoctonia cerealis infection through
regulating
resistance defense genes." Sci Rep 6: 28777.
Zhao, Y., et al. (2016). "A putative pyruvate transporter
Salt
TaBASS2 TaBASS2 positively regulates salinity tolerance in wheat via
tolerance
modulation of ABI4 expression." BMC Plant Biol 16(1): 109.
Wang, M., et al. (2016). "A wheat superoxide dismutase gene
Salt stress
TaSOD2 enhances salt resistance through modulating redox
TaSOD2 and other
homeostasis by promoting NADPH oxidase activity." Plant Mol
stresses
Biol 91(1-2): 115-130.
Powdery Chen, T., et al. (2016). "Two members of TaRLK family
confer
TaRLK1/T
mildew powdery mildew resistance in common wheat." BMC Plant
Biol
aRLK2
resistance 16: 27.
106
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Ryoko Morimoto, et al. (2005)Intragenic diversity and functional
Formation
conservation of the three homoeologous loci of the KN1 -type
Wknoxl of leaf
homeobox gene Wknoxl in common wheat. Plant Molecular
blade
Biology, 57(6).
Stress
response Kurek I., et al. (2002) Overexpression of the wheat
fk506-binding
FKBP and protein 73 (fkbp73) and the heat-induced wheat fkbp77
in
photosynth transgenic wheat reveals different functions of the two isoforms.
esis Transgenic Res, 11(4): 373-9.
enhancing
TaMloA/B Powdery Elliott C., et al. (2002) Functional conservation of
wheat and rice
mildew mlo orthologs in defense modulation to the powdery
mildew
/D
resistance fungus. Mol Plant Microbe Interact, 15(10): 1069-
77.
Christensen A. B., et al.(2004), The germinlike protein g1p4
Disease exhibits superoxide dismutase activity and is an
important
GLP
resistance component of quantitative resistance in wheat and
barley[J]. Mob
Plant Microbe Interact, 17(1): 109-17.
wide
adaptabilit
Simons K. J., et al. (2006),Molecular characterization of the
Q gene y, plant
morpholog major wheat domestication gene q. Genetics, 172(1): 547-55.
Flowering Zhao X. Y., et al. (2005), The wheat tagil, involved in
TaGI1 time photoperiodic flowering, encodes an arabidopsis gi
ortholog[J].
regulation Plant Mob Biol, 58(1): 53-64..
Bahrini, I., et al. (2011). "Overexpression of the
TaWRKY4 Head blight pathogen-inducible wheat TaWRKY45 gene confers disease
resistance resistance to multiple fungi in transgenic wheat plants." Breed Sci
61(4): 319-326.
Regulation Pearce, S., et al. (2011). "Molecular characterization of Rht-1
Rht-Al of plant dwarfing genes in hexaploid wheat." Plant Physiol
157(4):
height 1820-1831.
Zhang, H., et al. (2011). "Characterization of a common wheat
TaSnRK2. Abio-stress
(Triticum aestivum L.) TaSnRK2.7 gene involved in abiotic stress
7 tolerance
responses." J Exp Bot 62(3): 975-988.
Head blight Han' J.' et al. (2012). "Transgenic expression of lactoferrin
BLF imparts enhanced resistance to head blight of wheat
caused by
resistance
Fusarium graminearum." BMC Plant Biol 12: 33.
Kikuchi, R., et al. (2012). "The differential expression of HvC09,
Flowering
a member of the CONSTANS-like gene family, contributes to the
HvC09 time
control of flowering under short-day conditions in barley." J Exp
regulation
Bot 63(2): 773-784.
Saville, R. J., et al. (2012). "The 'Green Revolution' dwarfing
Disease
DELLA genes play a role in disease resistance in Triticum aestivum
and
resistance
Hordeum vulgare." J Exp Bot 63(3): 1271-1283.
Stripe rust
Wang, X., et al. (2012). "Wheat BAX inhibitor-1 contributes to
TaBI-1 wheat resistance to Puccinia striiformis." J Exp Bot 63(12):
resistance
4571-4584.
107
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Anther
Wang, Y., et al. (2012). "TamiR159 directed wheat TaGAMYB
TaGAMY developme
nt and heat cleavage and its involvement in anther development and heat
response." PLoS One 7(11): e48445.
response
Salt Zhang, L., et al. (2012). "Molecular characterization
of 60
TaMYB32 isolated wheat MYB genes and analysis of their
expression during
tolerance
abiotic stress." J Exp Bot 63(1): 203-214.
Dong, W., et al. (2013). "Wheat oxophytodienoate reductase gene
Salt Ta0PR1 confers salinity tolerance via enhancement of
abscisic
Ta0PR1
tolerance acid signaling and reactive oxygen species
scavenging." Plant
Physiol 161(3): 1217-1228.
Fusarium
Kim, H. K., et al. (2013). "Functional roles of FgLaeA in
graminearu
FgLaeA controlling secondary metabolism, sexual development,
and
-m
virulence in Fusarium graminearum." PLoS One 8(7): e68441
resistance
Liu, X., et al. (2013). "Transgenic wheat expressing Thinopyrum
TiMYB2R full rot intermedium MYB transcription factor TiMYB2R-1 shows
-1 disease enhanced resistance to the take-all disease." J Exp
Bot 64(8):
2243-2253.
Pasquali, M., et al. (2013). "FcStuA from Fusarium culmorum
Fusarium
FgStuA culmorum controls wheat foot and root rot in a toxin
dispensable manner."
PLoS One 8(2): e57429.
Qin, Z., et al. (2013). "Ectopic expression of a wheat WRKY
TaWRKY7 Dormancy
1-1 regulation transcription factor gene TaWRKY71-1 results
in hyponastic
leaves in Arabidopsis thaliana." PLoS One 8(5): e63033.
Fusarium
Son, H., et al. (2013). "AbaA regulates conidiogenesis in the
graminearu
AbaA ascomycete fungus Fusarium graminearum." PLoS One
8(9):
-m
e72915.
resistance
Gulyas, Z., et al. (2014). "Central role of the flowering repressor
Flowering ZCCT2 in the redox control of freezing tolerance and the initial
ZCCT
regulation development of flower primordia in wheat." BMC Plant Biol 14:
91.
Liu, S., et al. (2014). "A wheat SIMILAR TO RCD-ONE gene
Abio-stress enhances seedling growth and abiotic stress resistance by
Ta-srol
tolerance modulating redox homeostasis and maintaining genomic
integrity." Plant Cell 26(1): 164-180.
Zheng, J., et al. (2014). "TEF-7A, a transcript elongation factor
TaTEF-7A Yield gene, influences yield-related traits in bread wheat
(Triticum
aestivum L.)." J Exp Bot 65(18): 5351-5365.
He, X., et al. (2015). "The Nitrate-Inducible NAC Transcription
TaNAC2-5
Yield Factor TaNAC2-5A Controls Nitrate Response and
Increases
A
Wheat Yield." Plant Physiol 169(3): 1991-2005.
Fusarium Perochon, A., et al. (2015). "TaFROG Encodes a
Pooideae
TaFROG graminearu Orphan Protein That Interacts with SnRK1 and Enhances
-m Resistance to the Mycotoxigenic Fungus Fusarium graminearum."
resistance Plant Physiol 169(4): 2895-2906.
Tang, C., et al. (2015). "PsANT, the adenine nucleotide
Disease
PsANT translocase of Puccinia striiformis, promotes cell
death and
resistance
fungal growth." Sci Rep 5: 11241.
108
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Salt Yu, G.
H., et al. (2015). "Changes in the Physiological
SbPIP1 Parameters of SbPIP1-Transformed Wheat Plants under
Salt
tolerance
Stress." Int J Genomics 2015: 384356.
Ab io-stress Zhang, L., et al. (2015). "The Novel Wheat Transcription Factor
TaNAC47 TaNAC47 Enhances Multiple Abiotic Stress Tolerances
in
tolerance
Transgenic Plants." Front Plant Sci 6: 1174.
A Zhou, S. M., et al. (2015). "The involvement of wheat
F-box
nti-oxid at
TaFBA1 protein gene TaFBA1 in the oxidative stress tolerance of
plants."
ion
PLoS One 10(4) e0122117.
Powdery Zhu, Y., et al. (2015). "E3 ubiquitin ligase gene CMPG1-V from
CMPG1-V mildew Haynaldia villosa L. contributes to powdery
mildew resistance in
resistance common wheat (Triticum aestivum L.)." Plant J 84(1): 154-168.
Rhizoctoni Zhu, X., et al. (2015). "The wheat AGC kinase TaAGC1
is a
TaAGC1 a cerealis positive contributor to host resistance to
the necrotrophic
resistance pathogen Rhizoctonia cerealis." J Exp Bot 66(21): 6591-6603.
Late
maturing Zhao, D., et al. (2015). "Overexpression of a NAC transcription
TaNAC-S ,improve factor delays leaf senescence and increases
grain nitrogen
grain seed concentration in wheat." Plant Biol (Stuttg) 17(4):
904-913.
quality
Abio-stress Zhang, L., et al. (2015). "A novel wheat bZIP transcription
factor,
TabZIP60 tolerance TabZIP60, confers multiple abiotic stress
tolerances in transgenic
Arabidopsis." Physiol Plant 153(4): 538-554.
Yadav, D., et al. (2015). "Constitutive overexpression of the
TaNF-YB4 Promoting TaNF-YB4 gene in transgenic wheat significantly improves
grain
Y ield
yield." J Exp Bot 66(21): 6635-6650.
Xue, G. P., et al. (2015). "TaHsfA6f is a transcriptional activator
TaHsfA6f Heat that regulates a suite of heat stress protection genes
in wheat
response (Triticum aestivum L.) including previously unknown Hsf
targets." J Exp Bot 66(3): 1025-1039.
Salt Xu, Z., et al. (2015) "Wheat NAC transcription factor
TaNAC29
TaNAC29 is involved in response to salt stress." Plant Physiol
Biochem 96:
tolerance
356-363.
Wagatsuma, T., et al. (2015). "Higher sterol content regulated by
CYP51 Aluminum CYP51
with concomitant lower phospholipid content in
tolerance membranes is a common strategy for aluminium tolerance in
several plant species." J Exp Bot 66(3): 907-918.
Blue light
TaGBF1 response Sun, Y., et al. (2015). "The wheat TaGBF1 gene
is involved in the
and salt blue-light response and salt tolerance." Plant J 84(6): 1219-1230.
tolerance
Schoonbeek, H. J., et al. (2015). "Arabidopsis EF-Tu receptor
Disease
EF-Tu enhances bacterial disease resistance in transgenic
wheat." New
resistance
Phytol 206(2): 606-613.
Cheng, W., et al. (2015). "Host-induced gene silencing of an
Chs3b Disease essential chitin synthase gene confers durable
resistance to
resistance Fusarium head blight and seedling blight in wheat." Plant
Biotechnol J 13(9): 1335-1345.
Fusarium Cheng, Y., et al. (2015). "Characterization of protein kinase
PsSRPKL head blight PsSRPKL, a novel pathogenicity factor in the wheat
stripe rust
resistance fungus." Environ Microbiol 17(8): 2601-2617.
109
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Djemal, R. and H. Khoudi (2015). "Isolation and molecular
Abio-stress
characterization of a novel WIN1/SHN1 ethylene-responsive
TdSHN1 tolerance
transcription factor TdSHN1 from durum wheat (Triticum
turgidum. L. subsp. durum)." Protoplasma 252(6): 1461-1473.
Abio-stress Kong, D., et al. (2015). "Identification of TaWD40D, a
wheat
WD40 tolerance WD40 repeat-containing protein that is
associated with plant
tolerance to abiotic stresses." Plant Cell Rep 34(3): 395-410.
Ma, M., et al. (2015). "Expression of TaCYP78A3, a gene
TaCYP78 Grain size
encoding cytochrome P450 CYP78A3 protein in wheat (Triticum
A3 regulation
aestivum L.), affects seed size." Plant J 83(2): 312-325.
Seed Ashikawa, I., et al. (2014). "A transgenic approach to
controlling
TaDOG1L
dormancy wheat seed dormancy level by using Triticeae DOG1-like genes."
4
regulation Transgenic Res 23(4): 621-629.
Han, Y. Y., et al. (2014). "The involvement of expansins in
Promoting
TaEXPB23 uptake of responses to phosphorus availability in wheat,
and its potentials
phosphorus in improving phosphorus efficiency of plants." Plant
Physiol
Biochem 78: 53-62.
Lu, W., et al. (2014). "Overexpression of TaNHX3, a vacuolar
Salt Na(+)/H(+) antiporter gene in wheat, enhances salt
stress
TaNHX3
tolerance tolerance in tobacco by improving related physiological
processes." Plant Physiol Biochem 76: 17-28.
Abio-stress Rong, W., et al. (2014). "The ERF transcription factor
TaERF3
TaERF3 promotes tolerance to salt and drought stresses in
wheat." Plant
tolerance
Biotechnol J 12(4): 468-479.
Xu, D. B., et al. (2014). "ABI-like transcription factor gene
Abio-stress
TaABL1 TaABL1 from wheat improves multiple abiotic stress
tolerances
tolerance
in transgenic plants." Funct Integr Genomics 14(4): 717-730.
Xue, G. P., et al. (2014). "The heat shock factor family from
Thermo Triticum aestivum in response to heat and other major abiotic
TaHsfC2a
tolerance stresses and their role in regulation of heat shock protein
genes."
J Exp Bot 65(2): 539-557.
Yu, G., et al. (2014). "Identification of wheat non-specific lipid
Chilling
TaLTP transfer proteins involved in chilling tolerance."
Plant Cell Rep
tolerance
33(10): 1757-1766.
Feng, H., et al. (2013). "Target of tae-miR408, a
Stripe rust chemocyanin-like protein gene (TaCLP1), plays positive roles in
TaCLP1
resistance wheat response to high-salinity, heavy cupric stress and stripe
rust." Plant Mol Biol 83(4-5): 433-443.
Guo, J., et al. (2013). "Wheat zinc finger protein TaLSD1, a
Stripe rust negative regulator of programmed cell death, is involved in wheat
TaLSD1
resistance resistance against stripe rust fungus." Plant Physiol Biochem
71:
164-172.
Starch Kang, G., et al. (2013). "Increasing the starch content and grain
TaLSU I weight of common wheat by overexpression of the
cytosolic
content
AGPase large subunit gene." Plant Physiol Biochem 73: 93-98.
Kovalchuk, N., et al. (2013). "Optimization of TaDREB3 gene
Chilling
TaDREB3 tolerance expression in transgenic barley using cold-
inducible promoters."
Plant Biotechnol J 11(6): 659-670.
Powdery Li, S., et al. (2013). "Wheat gene TaS3 contributes to powdery
TaS3
mildew mildew susceptibility." Plant Cell Rep 32(12): 1891-1901.
110
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Heavy-met Tan,
J., et al. (2013). "Functional analyses of TaHMA2, a
TaHMA2
al tolerance P(1B)-type ATPase in wheat." Plant Biotechnol J 11(4): 420-431.
Tian, S., et al. (2013). "Cloning and characterization of
TaSnRK2. Abio-stress
TaSnRK2.3, a novel SnRK2 gene in common wheat." J Exp Bot
3 tolerance
64(7): 2063-2080.
Cai' H et al. (2011). "Identification of a MYB3R gene involved
TaMYB3R Abio-stress
1 tolerance in drought, salt and cold stress in wheat (Triticum
aestivum L.)."
Gene 485(2): 146-152.
Fusarium Zhu, X., et al. (2012). "Overexpression of wheat lipid
transfer
graminearu
protein gene TaLTP5 increases resistances to Cochliobolus
TaLTP5
-m sativus and Fusarium graminearum in transgenic wheat."
Funct
resistance Integr Genomics 12(3): 481-488.
Salt Zhao,
X., et al. (2012). "The role of TaCHP in salt stress
TaCHP
resistance
responsive pathways." Plant Signal Behav 7(1): 71-74.
Wang, X., et al. (2011). "TaDAD2, a negative regulator of
Stripe rust programmed cell death, is important for the interaction
between
TaDAD2
resistance wheat and the stripe rust fungus." Mol Plant Microbe
Interact
24(1): 79-90.
Table J lists some representative functional genes in tomato.
Table J: Important functional genes in in tomato
Gene name Application Reference
S1WRKY3 as a positive
Chinnapandi, B., et al. (2019). "Tomato
regulator of induced
S1WRKY3 acts as a positive regulator for
resistance in response
S1WRKY3 to nematode invasion resistance against the root-knot nematode
and infection, mostly
Meloidogyne javanica by activating lipids and
hormone-mediated defense-signaling pathways."
during the early stages
of nematode infection. Plant Signal Behav 14(6): 1601951.
Gong, B., et al. (2014). "Overexpression of
tolerance to alkali S-adenosyl-L-methionine synthetase
increased
S1SAMS1 tomato
tolerance to alkali stress through
stress
polyamine metabolism." Plant Biotechnol J
12(6): 694-708.
Hu, S., et al. (2020). "Regulation of fruit
ripening by the brassinosteroid biosynthetic gene
51CYP90B3 BR biosynthesis
S1CYP90B3 via an ethylene-dependent pathway
in tomato." Hortic Res 7: 163.
Li, S., et al. (2020). "S1TLFP8 reduces water loss
decreased stomatal to improve water-use efficiency by
modulating
S1TLFP8 cell size and stomatal density via
density
endoreduplication." Plant Cell Environ 43(11):
2666-2679.
Li, X. J., et al. (2016). "DWARF overexpression
improved seed
induces alteration in phytohormone homeostasis,
germination, root
DWARF development,
architecture and carotenoid
development and early
accumulation in tomato." Plant Biotechnol J
growth vigour
14(3): 1021-1033.
111
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Lin, D., et al. (2016). "Ectopic expression of
S1AG07 alters leaf pattern and inflorescence
SIAGO7 increased fruit yield
architecture and increases fruit yield in tomato."
Physiol Plant 157(4): 490-506.
Maach, M., et al. (2020). "Overexpression of
LeNHX4 improved yield, fruit quality and salt
LeNHX4 increased fruit size tolerance in tomato plants
(Solanumlycopersicum L.)." MolBiol Rep 47(6):
4145-4153.
Nie, S., et al. (2017). "Enhancing
B assinosteroid Signaling via Overexpression of
improve multiple major
S1BRI1 Tomato
(Solanumlycopersicum) S1BRI1
agronomic traits
Improves Major Agronomic Traits." Front Plant
Sci 8: 1386.
Renau-Morata, B., et al. (2020). "The targeted
S1CDF4 increased yield
overexpression of S1CDF4 in the fruit enhances
tomato size and yield involving gibberellin
signalling." Sci Rep 10(1): 10645.
Thirumalaikumar, V. P., et al. (2018). "NAC
transcription factor JUNGBRUNNEN1 enhances
S1JUB1 drought tolerance
drought tolerance in tomato." Plant Biotechnol J
16(2): 354-366.
Wang, J., et al. (2020). "Transcriptomic and
genetic approaches reveal an essential role of the
S1NAP1 drought tolerance NAC
transcription factor S1NAP1 in the growth
and defense response of tomato." Hortic Res
7(1): 209.
Ahammed, G. J., et al. (2020). "Overexpression
of tomato RING E3 ubiquitin ligase gene
cadmium (Cd)
S1RING1 S1RING1
confers cadmium tolerance by
tolerance
attenuating cadmium accumulation and oxidative
stress." Physiol Plant.
Bastias, A., et al. (2014). "The transcription
regulates primary factor AREB1 regulates primary metabolic
SlAREB1
metabolic pathways pathways in tomato fruits." J Exp Bot
65(9):
2351-2363.
Cai, S. Y., et al. (2017). "HsfAla upregulates
cadmium (Cd)
HsfA 1 a
melatonin biosynthesis to confer cadmium
tolerance
tolerance in tomato plants." J Pineal Res 62(2)
Cui, B., et al. (2016). "Overexpression of
regulation of plant SlUPA-
like induces cell enlargement, aberrant
SlUPA-like development and stress development and low stress tolerance
through
tolerance
phytohormonal pathway in tomato." Sci Rep 6:
23818
Cui, J., et al. (2018). "Tomato MYB49 enhances
tolerance to drought
resistance to Phytophthorainfestans and
MYB49
and salt stresses
tolerance to water deficit and salt stress." Planta
248(6): 1487-1503.
Duan, M., et al. (2012). "Overexpression of
tolerance to chilling
thylakoidalascorbate peroxidase shows enhanced
LetAPX
stress
resistance to chilling stress in tomato." J Plant
Physiol 169(9): 867-877.
112
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Jia, C., et al. (2021). "Tomato BZR/BES
regulates BR signaling
S1BZR1D and transcription factor S1BZR1 positively
regulates
BR signaling and salt stress tolerance in tomato
salt tolerance
and Arabidopsis." Plant Sci 302: 110719.
Li, F., et al. (2020). "Overexpression of
S1MBP22 in Tomato Affects Plant Growth and
S1MBP22 drought tolerance
Enhances Tolerance to Drought Stress." Plant
Sci 301: 110672.
Liu, D. D., et al. (2019). "Overexpression of the
Melatonin Synthesis-Related Gene SlCOMT1
S1COMT1 salt tolerance
Improves the Resistance of Tomato to Salt
Stress." Molecules 24(8).
enhances tolerance to Liu, Y., et al. (2017). "Overexpression of
S1GRAS40
Abiotic Stresses and S1GRAS40 in Tomato Enhances Tolerance to
influences Auxin and Abiotic Stresses and Influences Auxin and
Gibberellin signaling Gibberellin Signaling." Front Plant Sci 8: 1659.
Zhang, C., et al. (2011). "Overexpression of
increased ascorbate
S1GMEs leads to ascorbate accumulation with
accumulation and
S1GMEs enhanced oxidative stress, cold, and salt
improved tolerance to
tolerance in tomato." Plant Cell Rep 30(3):
abiotic stresses
389-398.
Muhammad, T., et al. (2019). "Overexpression
regulates tolerance to of a Mitogen-Activated Protein Kinase
S1MAPK3 Cd(2+) and drought S1MAPK3 Positively Regulates Tomato
stress Tolerance to Cadmium and Drought Stress."
Molecules 24(3).
Table K lists some representative functional genes in potato and sweet potato.
Table K: Important functional genes in potato and sweetpotato
Crop Gene name Application Reference
Charfeddine M, et al.(2019) . "Investigation of
Salt the response to salinity of transgenic potato
potato StERF94
tolerance plants overexpressing the transcription
factor
StERF94". Journal of Biosciences, 44(6).
To reduce Brummell D A, et al.
(2015)."Overexpression
STARCH gelatinization of STARCH BRANCHING ENZYME II
BRANCHING temperature increases short-chain branching of
potato
ENZYME ,to change amylopectin and alters the physicochemical
II(SBEII) starch properties of starch from potato tuber". BMC
properties Biotechnology.
Dong T, et al. (2020). "Cysteine protease
Reduced inhibitors reduce enzymatic browning of
potato protease
potato inhibitors (StPIs)
enzymatic potato by lowering the accumulation of
free
browning amino acids". Journal of Agricultural and
Food
Chemistry.
Chang Y, et al. (2020). "NAC transcription
NAC family Wilt
factor involves in regulating bacterial wilt
potato transcription resistance in
resistance in potato". Functional Plant
factor (StNACb4) potato
Biology, 47.
Increased KLAAS SEN M T, et al. (2020).
nitrate transporter
potato gene(StNPF1.11) nitrogen use
"Overexpression of a putative nitrate
efficiency, transporter (StNPF1.11) increases plant
height,
113
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
plant height, leaf chlorophyll content and tuber
protein
leaf content of young potato plants". Funct Plant
chlorophyll Biol, 47(5): 464-472
content and
tuber protein
content
eukaryotic Sanchez P A G, et al.
(2020)."Overexpression
translation PVY of a modified eIF4E regulates potato
virus Y
potato initiation
factor 4E resistance resistance at the transcriptional level in
(eIF4E) potato".
BMC Genomics, 21.
Chen Q, et al. (2018). "StPOTHR1, a
NDR1/HIN1-like gene in Solanumtuberosum,
Late blight enhances resistance against
potato StPOTHR1
resistance Phytophthorainfestans". Biochemical &
Biophysical Research
Communications,1155-1161.
NATALIA, et al. (2008). "Overexpression of
Enhance
snakin-1 gene enhances resistance to
resistance to
potato Snakin-1 (SN1) Rhizoctoniasolani and Erwiniacarotovora
in
bacterial
disease
transgenic potato plants". Molecular Plant
Pathology, 9(3):329-338.
Cao M, et al. (2020). "Functional Analysis of
Phosphate
Growth StPHT1;7, a Solanumtuberosum L. Phosphate
potato Transporter
promoting
Transporter Gene, in Growth and Drought
PHT1; 7
Tolerance". Plants, 9(10):1384.
Tolerance to Varun Dwivedi, et al. (2020)."Functional
certain
characterization of a defense-responsive
potato StBUS/ELS
bacteria and bulnesol/elemol synthase from potato".
fungi PhysiologiaPlantarum.
Donia Bouaziz, et al. (2013). "Overexpression
Increase
of StDREB1 Transcription Factor Increases
potato StDREB1 tolerance to
Tolerance to Salt in Transgenic Potato Plants".
salt
Molecular Biotechnology, 54(3):803-817
To promote Zhu X, et al. (2021)."Mitogen-activated
growth under protein kinase 11 (MAPK11) maintains growth
potato StMAPK11
drought and
photosynthesis of potato plant under
condition drought condition". Plant Cell Reports,1-
16.
Rosin FM, et al. (2003)."Overexpression of a
Knotted-like Homeobox Gene of Potato Alters
Enlarged
potato POTH1 tube Vegetative Development by Decreasing
Gibberellin Accumulation". Plant Physiology,
132(1):106-117.
Yamamizo C, et al. (2006). "Rewiring
Late blight Mitogen-Activated Protein Kinase Cascade by
potato StMPK1
resistance
Positive Feedback Confers Potato Blight
Resistance". Plant Physiology, 140(2):681-692
S. Lee HE, et al. (2007). 'Ethylene
responsive
tuberosumethylene element binding protein 1 (StEREBP1) from
Cold and salt
responsive
Solanumtuberosum increases tolerance to
potato stress
element binding abiotic stress in transgenic potato plants".
tolerance
protein Biochemical & Biophysical Research
(StEREBP1) Communications, 353(4):863-868.
114
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Mithu Chatterjee, et al, (2007)."A
Enlarged BELL1-Like Gene of Potato Is Light
Activated
potato StBEL5
tube and Wound Inducible". Plant Physiology,
Volume 145, Issue 4, 1435-1443,
Ni X, et al. (2010)."Cloning and molecular
Broad characterization of the potato RING
finger
potato StRFP1 spectrum protein gene StRFP1 and its function in
potato
resistance to broad-spectrum resistance against
late blight Phytophthorainfestans". Journal of Plant
Physiology, 167(6):488-496.
Shin D, et al. (2011)."Expression of
Drought StMYB1R-1, a novel potato single MYB-like
potato StMYB1R-1
tolerance domain transcription factor, increases
drought
tolerance". Plant Physiology, 155(1):421-432.
Liu X, et al. (2013)."StInvInh2 as an inhibitor
Reduced
of StvacINV1 regulates the cold-induced
StInvInh2A cold-induced
potato sweetening of potato tubers by
specifically
StInvInh2B sweetening
of potato capping vacuolar invertase activity".
Plant
Biotechnology Journal, 11(5):640-647.
Li W, et al. (2013)."Cloning and
Increased characterization of a potato StAN11 gene
potato StAN11 anthocyanin involved in anthocyanin
biosynthesis
accumulation regulation". Journal of Integrative Plant
Biology, 56(4):364-372.
Michal, et al. (2015)."Potato Annexin
Drought STANN1 Promotes Drought Tolerance and
potato STANN1
tolerance Mitigates Light Stress in Transgenic
Solanumtuberosum L. Plants". Plos One.
Increased
Goo Y M, et al. (2015). "Overexpression of
accumulation
the sweet potato IbOr gene results in the
sweet of carotenoid
IbOr increased accumulation of carotenoid and
potato and confers
confers tolerance to environmental stresses in
tolerance to
salt stress transgenic potato". ComptesRendusBiologi
es.
Yu Y, et al. (2020)."Overexpression of
phosphatidylserine synthase IbPSS1 affords
Increased
sweet cellular Na+ homeostasis and salt
tolerance by
IbPSS1 salt tolerance
potato activating plasma membrane Na+/H+
antiport
in root
activity in sweet potato roots". Horticulture
Research, 7:131.
Kim S H, et al. (2013)."Downregulation of the
lycopene -cyclase gene increases carotenoid
sweet Increased synthesis via the 13-branch-specific
pathway
IbLCY-e
potato salt tolerance and enhances salt-stress
tolerance in sweet
potato transgenic calli". Physiologia
Plantarum, 147(4):432-442.
Liu, D.G.,et al (2014b)
sweet Increased AnIpomoeabatatasiron-sulfur cluster
scaffold
IbNFUl
potato salt tolerance protein gene,IbNFUl, is
involved in salt
tolerance.PLoS One,9, e93935
sweet Increased Liu, D.G.et al (2014a) Overexpression
IbP5CR
potato salt tolerance ofIbP5CRenhances salt
tolerance in
115
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
transgenicsweetpotato.Plant Cell, Tissue
Organ Cult.117(1),1-16
Liu, D.G., et al (2014c) A novela/b-hydrolase
sweet Increased
IbMas geneIbMasenhances salt tolerance in
potato salt tolerance
transgenic sweetpotatoPLoS One,9, el 15128.
Liu, D.G., et al (2015)IbSIMT1, a novel
salt-induced methyltransferase gene from
sweet Increased
Ib SIMT1 Ipomoea batatas, is involved in salt
potato salt tolerance
tolerance.Plant Cell, Tissue Organ Cult.
120, 701-715
Hong, et al. (2016)."A
Increased
sweet salt and myo-inositol-l-phosphate synthase gene,
IbMIPS1 potato drought
IbMIPS1, enhances salt and drought tolerance
and stem nematode resistance in transgenic
tolerance
sweet potato". Plant Biotechnology Journal.
Table L: List of herbicide resistance genes
Gene
Crop Gene name Reference
number
Perez-Jones, A., et al. (2006). "Introgression of an
AY21040
imidazolinone-resistance gene from winter wheat
wheat Imil
7.1 (Triticum aestivum L.) into jointed goatgrass
(Aegilops
cylindrica Host)." Theor Appl Genet114(1): 177-186.
Theodoulou, F. L., et al. (2003). "Co-induction of
AY06448 glutathione-S-transferases and multidrug resistance
wheat GST Cla47
0.1 associated protein by xenobiotics in wheat." Pest
Manag
Sci59(2): 202-214.
Theodoulou, F. L., et al. (2003). "Co-induction of
AY06448 glutathione-S-transferases and multidrug resistance
wheat GST 19E50
1.1 associated protein by xenobiotics in wheat." Pest
Manag
Sci59(2): 202-214.
Theodoulou, F. L., et al. (2003). "Co-induction of
AF479764 glutathione-S-transferases and multidrug resistance
wheat GST 28e45
.1 associated protein by xenobiotics in wheat." Pest
Manag
Sci59(2): 202-214.
Theodoulou, F. L., et al. (2003). "Co-induction of
AY06447 glutathione-S-transferases and multidrug resistance
wheat MRP1
9.1 associated protein by xenobiotics in wheat." Pest
Manag
Sci59(2): 202-214.
Busi, R., et al. (2020). "Cinmethylin controls multiple
cytochrome L005431
herbicide-resistant Lolium rigidum and its wheat
wheat
P450 23
selectivity is P450-based." Pest Manag Sci76(8):
2601-2608.
Wang, H., et al. (2021). "The maize SUMO conjugating
corn ZmSCElb enzyme
ZmSCElb protects plants from paraquat
toxicity." Ecotoxicol Environ Saf 211: 111909.
116
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Sun, L., etal. (2018). "The expression of detoxification
corn ZmGSTIV genes in two maize cultivars by interaction of
isoxadifen-ethyl and nicosulfuron." Plant Physiol
Biochem 129: 101-108.
Sun, L., etal. (2018). "The expression of detoxification
corn ZmGST6 genes in two maize cultivars by interaction of
isoxadifen-ethyl and nicosulfuron." Plant Physiol
Biochem 129: 101-109.
Sun, L., etal. (2018). "The expression of detoxification
corn ZmGST31 genes in two maize cultivars by interaction of
isoxadifen-ethyl and nicosulfuron." Plant Physiol
Biochem 129: 101-110.
Sun, L., etal. (2018). "The expression of detoxification
corn ZmMRP1 genes in two maize cultivars by interaction of
isoxadifen-ethyl and nicosulfuron " Plant Physiol
Biochem 129: 101-111.
Li, D., et al. (2017). "Characterization of glutathione
S-transferases in the detoxification of metolachlor in
corn GSTI
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271
Li, D., et al. (2017). "Characterization of glutathione
S-transferases in the detoxification of metolachlor in
corn GSTIII
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271.
Li, D., et al. (2017). "Characterization of glutathione
S-transferases in the detoxification of metolachlor in
corn GSTIV
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271.
Li, D., et al. (2017). "Characterization of glutathione
S-transferases in the detoxification of metolachlor in
corn GST5
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271.
Li, D., et al. (2017). "Characterization of glutathione
S-transferases in the detoxification of metolachlor in
corn GST6
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271.
Li, D., et al. (2017). "Characterization of glutathione
S-transferases in the detoxification of metolachlor in
corn GST7
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271
bifunctional Mahmoud, M., et al. (2020). "Identification of
3-dehydroqu Structural Variants in Two Novel Genomes of Maize
corn
mate Inbred Lines Possibly Related to Glyphosate
dehydratase Tolerance." Plants (Basel) 9(4).
117
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Mahmoud, M. et al. (2020). "Identification of
shikimate
Structural Variants in Two Novel Genomes of Maize
corn dehydrogena
Inbred Lines Possibly Related to Glyphosate
se
Tolerance." Plants (Basel) 9(5).
Mahmoud, M., et al. (2020). "Identification of
chori smate Structural Variants in Two Novel Genomes of Maize
corn
synthase Inbred Lines Possibly Related to Glyphosate
Tolerance." Plants (Basel) 9(6).
Yu, Q., et al. (2015). "Evolution of a double amino acid
(T102I+P10 substitution in the 5-enolpyruvylshikimate-3-
phosphate
corn 6S [TIPS]) synthase
in Eleusine indica conferring high-level
(EPSPS) glyphosate resistance." Plant Physiol 167(4):
1440-1447.
Liu, X., et al. (2019). "Rapid identification of a
Zm00001 candidate nicosulfuron sensitivity gene (Nss) in maize
corn CYP81A9
d013230 (Zea mays L.) via combining bulked segregant analysis
and RNA-seq." Theor Appl Genet 132(5): 1351-1361.
Mathesius, C. A., et al. (2009). "Safety assessment of a
modified acetolactate synthase protein (GM-HRA) used
soybean GmHRA
as a selectable marker in genetically modified
soybeans." Regul Toxicol Pharmacol 55(3): 309-320.
"The expression level of a new gene is upregulated" in the present invention
means that
the expression level of a new gene relative to the endogenous wild-type gene
of the
corresponding organism is increased, preferably the expression level is
increased by at least
0.5 times, at least 1 time, at least 2 times, at least 3 times, at least 4
times or at least 5 times.
The term "gene editing" refers to strategies and techniques for targeted
specific modification
of any genetic information or genome of living organisms. Therefore, the term
includes editing of
gene coding regions, but also includes editing of regions other than gene
coding regions of the
genome. It also includes editing or modifying other genetic information of
nuclei (if present) and
cells.
The term "CRISPR/Cas nuclease" may be a CRISPR-based nuclease or a nucleic
acid
sequence encoding the same, including but not limited to: 1) Cas9, including
SpCas9, ScCas9,
SaCas9, xCas9, VRER-Cas9, EQR-Cas9, SpG-Cas9, SpRY-Cas9, SpCas9-NG, NG-Cas9,
NGA-Cas9 (VQR), etc.; 2) Cas12, including LbCpfl, FnCpfl, AsCpfl, MAD7, etc.,
or any
variant or derivative of the aforementioned CRISPR-based nuclease; preferably,
wherein the at
least one CRISPR-based nuclease comprises a mutation compared to the
corresponding wild-type
sequence, so that the obtained CRISPR-based nuclease recognizes a different
PAM sequence. As
used herein, "CRISPR-based nuclease" is any nuclease that has been identified
in a naturally
occurring CRISPR system, which is subsequently isolated from its natural
background, and has
preferably been modified or combined into a recombinant construct of interest,
suitable as a tool
for targeted genome engineering. As long as the original wild-type CRISPR-
based nuclease
provides DNA recognition, i.e., binding properties, any CRISPR-based nuclease
can be used and
118
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
optionally reprogrammed or otherwise mutated so as to be suitable for various
embodiments of
the invention.
The term "CRISPR" refers to a sequence-specific genetic manipulation technique
that relies
on clustered regularly interspaced short palindromic repeats, which is
different from RNA
interference that regulates gene expression at the transcriptional level.
"Cas9 nuclease" and "Cas9" are used interchangeably herein, and refer to RNA-
guided
nuclease comprising Cas9 protein or fragment thereof (for example, a protein
containing the
active DNA cleavage domain of Cas9 and/or the gRNA binding domain of Cas9).
Cas9 is a
component of the CRISPR/Cas (clustered regularly interspaced short palindrome
repeats and
associated systems) genome editing system. It can target and cut DNA target
sequences under the
guidance of guide RNA to form DNA double-strand breaks (DSB).
"Cas protein" or "Cas polypeptide" refers to a polypeptide encoded by
Cas(CRISPR-associated) gene. Cas protein includes Cas endonuclease. Cas
protein can be a
bacterial or archaeal protein. For example, the types I to III CRISPR Cas
proteins herein
generally originate from prokaryotes; the type I and type III Cas proteins can
be derived from
bacteria or archaea species, and the type II Cas protein (i.e., Cas9) can be
derived from bacterial
species. "Cas proteins" include Cas9 protein, Cpfl protein, C2c1 protein, C2c2
protein, C2c3
protein, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10, Cas12a, Cas12b, or a
combination or complex
thereof.
"Cas9 variant" or "Cas9 endonuclease variant" refers to a variant of the
parent Cas9
endonuclease, wherein when associated with crRNA and tracRNA or with sgRNA,
the Cas9
endonuclease variant retains the abilities of recognizing, binding to all or
part of a DNA target
sequence and optionally unwinding all or part of a DNA target sequence,
nicking all or part of a
DNA target sequence, or cutting all or part of a DNA target sequence. The Cas9
endonuclease
variants include the Cas9 endonuclease variants described herein, wherein the
Cas9 endonuclease
variants are different from the parent Cas9 endonuclease in the following
manner: the Cas9
endonuclease variants (when complexed with gRNA to form a polynucleotide-
directed
endonuclease complex capable of modifying a target site) have at least one
improved property,
such as, but not limited to, increased transformation efficiency, increased
DNA editing efficiency,
decreased off-target cutting, or any combination thereof, as compared to the
parent Cas9
endonuclease (complexed with the same gRNA to form a polynucleotide-guided
endonuclease
complex capable of modifying the same target site).
The Cas9 endonuclease variants described herein include variants that can bind
to and nick
double-stranded DNA target sites when associated with crRNA and tracrRNA or
with sgRNA,
while the parent Cas endonuclease can bind to the target site and result in
double strand break
(cleavage) when associated with crRNA and tracrRNA or with sgRNA.
"Guide RNA" and "gRNA" are used interchangeably herein, and refer to a guide
RNA
sequence used to target a specific gene for correction using CRISPR
technology, which usually
consists of crRNA and tracrRNA molecules that are partially complementary to
form a complex,
wherein crRNA contains a sequence that has sufficient complementarity with the
target sequence
so to hybridize with the target sequence and direct the CRISPR complex
(Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it
is known in the
119
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
art that a single guide RNA (sgRNA) can be designed, which contains both the
properties of
crRNA and tracrRNA.
The terms "single guide RNA" and "sgRNA" are used interchangeably herein, and
refer to
the synthetic fusion of two RNA molecules, which comprises a fusion of a crRNA
(CRISPR
RNA) of a variable targeting domain (linked to a tracr pairing sequence
hybridized to tracrRNA)
and a tracrRNA (trans-activating CRISPR RNA). The sgRNA may comprise crRNA or
crRNA
fragments and tracrRNA or tracrRNA fragments of the type II CRISPR/Cas system
that can form
a complex with the type II Cas endonuclease, wherein the guide RNA/Cas
endonuclease complex
can guide the Cas endonuclease to a DNA target site so that the Cas
endonuclease can recognize,
optionally bind to the DNA target site, and optionally nick the DNA target
site or cut (introduce a
single-strand or double-strand break) the DNA target site.
In certain embodiments, the guide RNA(s) and Cas9 can be delivered to a cell
as a
ribonucleoprotein (RNP) complex. RNP is composed of purified Cas9 protein
complexed with
gRNA, and it is well known in the art that RNP can be effectively delivered to
many types of
cells, including but not limited to stem cells and immune cells (Addgene,
Cambridge, MA, Mirus
Bio LLC, Madison, WI).
The protospacer adjacent motif (PAM) herein refers to a short nucleotide
sequence adjacent
to a (targeted) target sequence (prespacer) recognized by the gRNA/Cas
endonuclease system. If
the target DNA sequence is not adjacent to an appropriate PAM sequence, the
Cas endonuclease
may not be able to successfully recognize the target DNA sequence. The
sequence and length of
PAM herein can be different depending on the Cas protein or Cas protein
complex in use. The
PAM sequence can be of any length, but is typically in length of 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19 or 20 nucleotides.
Cytochrome P450enzyme system (CYP) is discovered as a protein that can be
bound to
CO. In 1958, Klingenberg discovered this pigment protein in rat liver
microsomes.
Cytochrome P450was so named because of its maximum absorption value at 450nm
wavelength when combined with CO in its reduced state. As the largest
superfamily of
oxidoreductases, P450 is widely distributed in the vast majority of organisms,
including but
not limited to animals, plants, fungi, bacteria, archaea and viruses.
Cytochrome P450
enzymes include those reviewed in the following literature: Van Bogaert et al,
2011, FEBS J.
278(2): 206-221, or Urlacherand Girhard, 2011, Trends in Biotechnology 30(1):
26-36, or
the following web sites: http : //drnel s on .uthsc . edu/Cytochrom eP45 0.
html and
http://p450.riceblast.snusacskr/index.php?a=view. Its naming is based on the
English
abbreviation CYP (Cytochrome P450) with numbers + letters + numbers,
respectively
representing the family, subfamily and individual enzymes.
For some embodiments, the said cytochrome P450s include but not limited to the
following as per list:
120
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
GE:ne
CYPI CYP1 AI,cP1Ar.C8PE
aP2 CYP2AL, CfP2A7, CYP2A13: CY.P2B6,
CYP2.01 CYP2C9, CYP2C1e, CfP2C1S,
CYPZDE, CfP2Et CYPa-1, CYP:212,
CYP2R CIP2S1. CYP2U1, CYP2W1
0T3 CYPIlet CYP3A.S. CYPW, 0P3M3
aP4 CYNA 1 1. (VNA22, CW4i. CSP4F-2,
CIP4F3, CYP4F8.. CfP*11: CY.P4F12,
CiP4F22, CYP412,CW.4X-1, CfP4.1.1
CtfP5 CYP5A1
CYP7 reP7A1, CYPTE
CYP8 CW8A1 =;prostacytiin Ertn3358), CYPHI
g.)e add biCcynther.is?
CYP11 (WI Th't CYP'11
CYP1.7 CYPI7A1
CYP19 CiPI9A1
CYP20 C'eP2DA1
cxv21 CYP21A2
C'eF24 CY.P24A1
CYF26 a.P2:5A/. C172:6131.. c?-nrycl
CYP27 aP27A1 {be acid bissyritnizais. CYP27E1
(vitamin D3 1-aipria hydamytase, 3ctiqates
vitamin D3). Cii"-27C1 kincttcsr4
C.".(#339 CYP.39241
CYP46 CYP46M
cypz..1 14-ai0a demet',Oase)
For some embodiments, the rice cytochrome P450s include but not limited to the
following as per list:
MSU/TIGR locus ID CYP name
LOC OsOlg08800 CYP96D1
LOC OsOlg08810 CYP96E1
LOC OsOlg10040 CYP90D2v1
LOC OsOlg10040 CYP90D2V2
LOC OsOlg11270 CYP710A5
LOC OsOlg11280 CYP710A6
LOC OsOlg11300 CYP710A7
LOC OsOlg11340 CYP710A8
LOC OsOlg12740 CYP71T1
LOC OsOlg12750 CYP71T2
LOC OsOlg12760 CYP71T3
LOC OsOlg12770 CYP71T4
LOC OsOlg24780 CYP709D1
LOC OsOlg24810 CYP89D1
LOC OsOlg27890 CYP71K1
LOC OsOlg29150 CYP734A6
LOC OsOlg36294 CYP71C19P
LOC OsOlg38110 CYP76M14
LOC OsOlg41800 CYP72A31P
LOC OsOlg41810 CYP72A32
LOC OsOlg41820 CYP72A33
LOC OsOlg43700 CYP72A17v1
LOC OsOlg43700 CYP72A17v2
121
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC OsOlg43710 CYP72A18
LOC OsOlg43740 CYP72A20
LOC OsOlg43750 CYP72A21
LOC OsOlg43760 CYP72A22
LOC OsOlg43774 CYP72A23
LOC OsOlg43844 CYP72A24
LOC OsOlg43851 CYP72A25
LOC OsOlg50490 CYP706C2
LOC OsOlg50530 CYP711A2
LOC OsOlg50580 CYP711A3
LOC OsOlg50590 CYP711A4
LOC OsOlg52790 CYP72A35
LOC OsOlg58950 CYP94D13
LOC OsOlg58960 CYP94D12
LOC OsOlg58970 CYP94D11
LOC OsOlg58990 CYP94D10
LOC OsOlg59000 CYP94D9
LOC OsOlg59020 CYP94D7
LOC OsOlg59050 CYP94D6
LOC OsOlg60450 CYP73A35P
LOC OsOlg63540 CYP86A9
LOC OsOlg63930 CYP94C3v1
LOC OsOlg63930 CYP94C3v2
LOC OsOlg72260 CYP94E2
LOC OsOlg72270 CYP94E1
LOC OsOlg72740 CYP71AA3
LOC OsOlg72760 CYP71AA2
LOC 0s02g01890 CYP89E1
LOC 0s02g02000 CYP74F1
LOC 0s02g02230 CYP51H5
LOC 0s02g07680 CYP97B4v1
LOC 0s02g07680 CYP97B4v2
LOC 0s02g07680 CYP97B4v3
LOC 0s02g07680 CYP97B4v4
LOC 0s02g07680 CYP97B4v5
LOC 0s02g09190 CYP71X12
LOC 0s02g09200 CYP71X11
LOC 0s02g09220 CYP71X10
LOC 0s02g09240 CYP71X8
LOC 0s02g09250 CYP71X7
LOC 0s02g09290 CYP71X4
LOC 0s02g09310 CYP71X3
LOC 0s02g09320 CYP71X2
LOC 0s02g09330 CYP71X1P
LOC 0s02g09390 CYP71K3
LOC 0s02g09400 CYP71K4
LOC 0s02g09410 CYP71K5
LOC 0s02g11020 CYP734A2
LOC 0s02g12540 CYP71V5
LOC 0s02g12550 CYP71V4
LOC 0s02g12680 CYP74E1
122
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC 0s02g12690 CYP74E2
LOC 0s02g12890 CYP711A5v1
LOC 0s02g12890 CYP711A5v2
LOC 0s02g17760 CYP71U3
LOC 0s02g21810 CYP51H4
LOC 0s02g26770 CYP73A40
LOC 0s02g26810 CYP73A39
LOC 0 sO2g29720 CYP76N1P
LOC 0s02g29960 CYP92A15
LOC 0s02g30080 CYP81L5
LOC 0s02g30090 CYP81L4
LOC 0s02g30100 CYP81L3
LOC 0s02g30110 CYP81L2
LOC 0s02g32770 CYP71Z5
LOC 0s02g36030 CYP76M5
LOC 0s02g36070 CYP76M8
LOC 0s02g36110 CYP76M17
LOC 0s02g36150 CYP71Z6
LOC 0s02g36190 CYP71Z7
LOC 0s02g36280 CYP76M6
LOC 0s02g38290 CYP86E1v1
LOC 0s02g38290 CYP86E1v2
LOC 0s02g38930 CYP71X13P
LOC 0 sO2g38940 CYP71X14
LOC 0s02g44654 CYP86A10v1
LOC 0s02g44654 CYP86A10v2
LOC 0s02g45280 CYP87A5
LOC 0 sO2g47470 CYP707A5v1
LOC 0 sO2g47470 CYP707A5v2
LOC 0 sO2g47470 CYP707A5v3
LOC 0s02g57290 CYP97A4v1
LOC 0s02g57290 CYP97A4v2
LOC 0s02g57290 CYP97A4v3
LOC 0s02g57290 CYP97A4v4
LOC 0s02g57810 CYP715B1
LOC 0s03g02180 CYP84A6
LOC 0s03g04190 CYP78A17
LOC 0s03g04530 CYP96B6
LOC 0s03g04630 CYP96B2
LOC 0 sO3g04640 CYP96B9
LOC 0s03g04650 CYP96B3
LOC 0s03g04660 CYP96B5
LOC 0s03g04680 CYP96B4
LOC 0s03g07250 CYP704B2
LOC 0s03g12260 CYP94D15
LOC 0s03g12500 CYP74A5
LOC 0s03g12660 CYP90B2
LOC 0s03g14400 CYP76H4
LOC 0s03g14420 CYP76H5
LOC 0s03g14560 CYP76Q1
LOC 0s03g21400 CYP714B2
123
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC 0s03g25150 CYP75A11
LOC 0s03g25480 CYP709E1
LOC 0s03g25490 CYP709E2Pv1
LOC 0s03g25490 CYP709E2Pv2
LOC 0 sO3g30420 CYP78Al2
LOC 0s03g37080 CYP71E6P
LOC 0s03g37290 CYP79A7
LOC 0s03g39540 CYP71AC3P
LOC 0s03g39650 CYP71W1
LOC 0s03g39690 CYP71W3
LOC 0s03g39760 CYP71W4
LOC 0s03g40540 CYP85A1
LOC 0s03g40600 CYP78A14
LOC 0 sO3g44740 CYP92C21
LOC 0s03g45619 CYP87C2v1
LOC 0s03g45619 CYP87C2v2
LOC 0s03g55240 CYP81A6
LOC 0s03g55260 CYP81A8
LOC 0s03g55800 CYP74A4
LOC 0s03g61980 CYP733A1
LOC 0s03g63310 CYP71E4
LOC 0s04g01140 CYP93G1v1
LOC 0s04g01140 CYP93 Glv2
LOC 0s04g03870 CYP723A2
LOC 0s04g03890 CYP723A3
LOC 0s04g08824 CYP79A10
LOC 0s04g08828 CYP79A9
LOC 0s04g09430 CYP79A9P
LOC 0 sO4g09920 CYP99A3
LOC 0s04g10160 CYP99A2
LOC 0s04g18380 CYP81M1
LOC 0 sO4g27020 CYP71Z1
LOC 0s04g33370 CYP77A18
LOC 0s04g39430 CYP724B1
LOC 0 sO4g40460 CYP71 S2
LOC 0 sO4g40470 CYP71S1
LOC 0s04g47250 CYP86A11
LOC 0s04g48170 CYP87A6
LOC 0s04g48200 CYP87B4
LOC 0s04g48210 CYP87A4v1
LOC 0s04g48210 CYP87A4v2
LOC 0s04g48460 CYP704A3
LOC 0s05g01120 CYP722B1
LOC 0s05g08850 CYP96D2
LOC 0s05g11130 CYP90D3
LOC 0s05g12040 CYP51G3
LOC 0s05g25640 CYP73A38
LOC 0s05g30890 CYP72A34
LOC 0s05g31740 CYP94E3
LOC 0s05g33590 CYP721B2
LOC 0s05g33600 CYP721B1
124
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC 0s05g34325 CYP51H6
LOC 0s05g34330 CYP51H7P
LOC 0s05g34380 CYP51H8
LOC 0s05g35010 CYP71AD1
LOC 0s05g37250 CYP94C4
LOC 0s05g40384 CYP714D1
LOC 0s05g41440 CYP98A4v1
LOC 0s05g41440 CYP98A4v2
LOC 0s05g43910 CYP71R1
LOC 0s06g01250 CYP93 G2
LOC 0s06g02019 CYP88A5
LOC 0s06g03930 CYP704A4
LOC 0s06g09210 CYP709C10
LOC 0 sO6g09220 CYP709C11
LOC 0s06g15680 CYP71R2P
LOC 0s06g19070 CYP76Q2
LOC 0 sO6g22020 CYP71C20
LOC 0 sO6g22340 CYP89C1
LOC 0s06g24180 CYP84A7
LOC 0s06g30179 CYP71AB3
LOC 0s06g30500 CYP71AB2
LOC 0 sO6g30640 CYP76M9
LOC 0 sO6g36920 CYP711A6
LOC 0 sO6g37224 CYP701A9
LOC 0s06g37300 CYP701A8
LOC 0s06g37330 CYP701A19
LOC 0s06g37364 CYP701A6v1
LOC 0s06g37364 CYP701A6v2
LOC 0s06g37364 CYP701A6v3
LOC 0s06g39780 CYP76M7
LOC 0s06g39880 CYP734A4
LOC 0s06g41070 CYP93F1
LOC 0s06g42610 CYP89B12P
LOC 0s06g43304 CYP71Y7
LOC 0s06g43320 CYP71Y6
LOC 0s06g43350 CYP71Y5
LOC 0s06g43370 CYP71Y4
LOC 0s06g43384 CYP71Y3
LOC 0s06g43410 CYP71Y1P
LOC 0 sO6g43420 CYP71K10
LOC 0s06g43430 CYP71K9
LOC 0 sO6g43440 CYP71K8
LOC 0s06g43480 CYP71K7P
LOC 0s06g43490 CYP71K6
LOC 0s06g43520 CYP71AF1
LOC 0s06g45960 CYP71AC2
LOC 0s06g46680 CYP77B2
LOC 0s07g11739 CYP71Z2
LOC 0s07g11870 CYP71Z21
LOC 0s07g11970 CYP71Z22
LOC 0s07g19130 CYP71Q2
125
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC 0s07g19210 CYP71Q1
LOC 0s07g23570 CYP709C9
LOC 0s07g23710 CYP709C12P
LOC 0s07g26870 CYP89G1
LOC 0s07g28160 CYP51H1
LOC 0s07g29960 CYP87B5
LOC 0s07g33440 CYP728B3
LOC 0s07g33480 CYP728C9v1
LOC 0s07g33480 CYP728C9v2
LOC 0s07g33540 CYP728C7
LOC 0s07g33550 CYP728C5
LOC 0s07g33560 CYP728C4
LOC 0s07g33580 CYP728C3
LOC 0s07g33610 CYP728C1v1
LOC 0s07g33610 CYP728C1v2
LOC 0s07g33620 CYP728B1
LOC 0s07g37970 CYP51H9
LOC 0s07g37980 CYP51G4P
LOC 0s07g41240 CYP78A13
LOC 0s07g44110 CYP709C8
LOC 0s07g44130 CYP709C6
LOC 0s07g44140 CYP709C5
LOC 0s07g45000 CYP727A1
LOC 0s07g45290 CYP734A5
LOC 0s07g48330 CYP714B1
LOC 0s08g01450 CYP71C12
LOC 0s08g01470 CYP71C13P
LOC 0s08g01490 CYP71C17
LOC 0s08g01510 CYP71C15
LOC 0s08g01520 CYP71C16
LOC 0s08g03682 CYP703A3
LOC 0s08g05610 CYP89C8P
LOC 0s08g05620 CYP89C9
LOC 0s08g12990 CYP76H11
LOC 0s08g16260 CYP96B8
LOC 0s08g16430 CYP96B7
LOC 0s08g33300 CYP735A3
LOC 0s08g35510 CYP92Al2
LOC 0s08g36310 CYP76M1
LOC 0s08g36860 CYP707A6
LOC 0s08g39640 CYP76M11P
LOC 0s08g39660 CYP76M10
LOC 0s08g39694 CYP76M4Pv1
LOC 0s08g39694 CYP76M4Pv2
LOC 0s08g39694 CYP76M4Pv3
LOC 0s08g39730 CYP76M2
LOC 0s08g43390 CYP78A15
LOC 0s08g43440 CYP706C1
LOC 0s09g08920 CYP92A13
LOC 0s09g08990 CYP92A14
LOC 0s09g10340 CYP71V2
126
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
LOC 0s09g21260 CYP728A1
LOC 0s09g23820 CYP735A4
LOC 0s09g26940 CYP92A11
LOC 0s09g26960 CYP92A9
LOC 0s09g26970 CYP92A8
LOC 0s09g26980 CYP92A7
LOC 0s09g27500 CYP76L1
LOC 0s09g27510 CYP76K1
LOC 0s09g28390 CYP707A37
LOC 0s09g35940 CYP78A16
LOC 0s09g36070 CYP71T8
LOC 0s09g36080 CYP71AK2
LOC OslOg05020 CYP89B11
LOC OslOg05490 CYP76P1
LOC OslOg08319 CYP76H9
LOC OslOg08474 CYP76H8
LOC OslOg08540 CYP76H6
LOC OslOg09090 CYP76V1
LOC OslOg09160 CYP71AB1
LOC OslOg16974 CYP75B11
LOC OslOg17260 CYP75B3
LOC OslOg21050 CYP76P3
LOC OslOg23130 CYP729A2
LOC OslOg23180 CYP729A1v1
LOC OslOg23180 CYP729A1v2
LOC OslOg26340 CYP78A11
LOC OslOg30380 CYP71Z3
LOC OslOg30390 CYP71Z4
LOC OslOg30410 CYP71Z8
LOC OslOg34480 CYP86B3
LOC OslOg36740 CYP89F1
LOC OslOg36848 CYP84A5
LOC OslOg36960 CYP89B10
LOC OslOg36980 CYP89B9
LOC OslOg37020 CYP89B8P
LOC OslOg37034 CYP89B7P
LOC OslOg37050 CYP89B6
LOC OslOg37070 CYP89B5P
LOC OslOg37100 CYP89B4
LOC OslOg37110 CYP89B3
LOC OslOg37120 CYP89B2
LOC OslOg37160 CYP89B1
LOC OslOg38090 CYP704A7
LOC OslOg38110 CYP704A5v1
LOC OslOg38110 CYP704A5v2
LOC OslOg38120 CYP704A6
LOC OslOg39930 CYP97C2v1
LOC OslOg39930 CYP97C2v2
LOC 0s11g02710 CYP714C16P
LOC 0s11g04290 CYP94D5
LOC 0s11g04310 CYP94D4
127
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
LOC 0s11g04710 CYP90A3
LOC 0s11g05380 CYP94C2
LOC 0s11g18570 CYP87B1
LOC 0s11g27730 CYP71C32
LOC 0s11g28060 CYP71C33
LOC 0s11g29290 CYP94B4
LOC 0s11g29720 CYP78D1
LOC 0s11g32240 CYP51G1
LOC 0s11g41680 CYP71K11
LOC 0s11g41710 CYP71K12
LOC 0s12g02630 CYP714C1
LOC 0s12g02640 CYP714C2
LOC 0s12g04100 CYP94D63
LOC 0s12g04110 CYP94D64
LOC 0s12g04480 CYP90A19
LOC 0s12g05440 CYP94C79
LOC 0s12g09500 CYP76P2
LOC 0s12g09790 CYP76M13
LOC 0s12g16720 CYP71P1
LOC 0s12g18820 CYP87C5P
LOC 0s12g25660 CYP94B5
LOC 0s12g32850 CYP71E5
LOC 0s12g39240 CYP81N1
LOC 0s12g39300 CYP81N1P
LOC 0s12g39310 CYP81P1
LOC 0s12g44290 CYP71V3
As used herein,ATP-binding cassette (ABC) transporter family are a family of
membrane transporter proteins that regulate the transport of a wide variety of
pharmacological agents, potentially toxic drugs, and xenobiotics, as well as
anions. ABC
transporters are homologous membrane proteins that bind and use cellular
adenosine
triphosphate (ATP) for their specific activities. And the ATP-binding cassette
(ABC)
transporter proteins comprise a large family of prokaryotic and eukaryotic
membrane
proteins involved in the energy-dependent transport of a wide range of
substrates across
membranes (Higgins, C. F. et al., Ann. Rev. Cell Biol., 8:67-113 (1992)). In
eukaryotes,
ABC transport proteins typically consist of four domains that include two
conserved
ATP-binding domains and two transmembrane domains (Hyde et al., Nature,
346:362-5
(1990)).
As used herein, NAC transcription factors are unique transcription factors in
plants and
are numerous and widely distributed in terrestrial plants. They constitute one
of the largest
transcription factor families and play an important role in multiple growth
development and
stress response processes. Wherein, NAC is an acronym derived from the names
of the three
genes first described as containing a NAC domain, namely NAM (no apical
meristem),
ATAF1,2 and CUC2 (cup-shaped cotyledon).
As used herein, wherein, the Myb gene was found to encode a transcription
factor
128
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
(Biedenkapp H., et al., 1988, Nature, 335: 835-837), represent a family
comprising many
related genes, and exist in a wide variety of species, including yeast,
nematodes, insects and
plants, as well as vertebrates (Masaki Iwabuchi and Kazuo Shinozaki,
Shokubutsu genomu
kinou no dainamizumu: tensha inshi ni yoru hatsugen seigyo (Dynamism of Plant
Genome
functions: Expression control by transcriptional factor), Springer Japan,
2001). Plant
transcription factor MYB (v-myb avian myeloblastosis viral oncogene homolog)
is a type of
transcription factor discovered in recent years that is related to the
regulation of plant
growth and development, physiological metabolism, cell morphology and pattern
formation
and other physiological processes. It is ubiquitous in plants and is also one
of the largest
transcription families in plants, MYB transcription factors play an important
role in plant
metabolism and regulation. Most MYB proteins contain a Myb domain composed of
amino
acid residues at the N-terminus. According to the structural characteristics
of this highly
conserved domain, MYB transcription factors can be divided into four
categories:
1R-MYB/MYB-related; R2R3-MYB; 3R-MYB; 4R-MYB (4 repetitions of R1/R2). MYB
transcription factors have a variety of biological functions and are widely
involved in the
growth and development of plant roots, stems, leaves, and flowers. At the same
time, the
MYB gene family also responds to abiotic stress processes such as drought,
salinity, and
cold damage. In addition, MYB transcription factors are also closely related
to the quality of
certain cash crops.
As used herein, the family of MADS transcription factors that play critical
roles in
diverse developmental process in plants including flower and seed development
(Minster, et
al., 2002; Parenicova, et al., 2003). MADS protein is composed of domains such
as MADS
(M), Intervening (I), Keratin 2 like (K) and C2 terminal (C), which belong to
domain
proteins.
As used herein, the DREB (dehydration responsive element binding protein) type
transcription factor is a subfamily of the AP2/EREBP (APETALA2/an ethylene-
responsive
element binding protein) transcription factor family. It has a conserved AP2
domain and can
specifically combine with DRE cis-acting elements in the promoter region of
stress
resistance genes to regulate the expression of a series of downstream stress
response genes
under conditions of low temperature, drought, saline-alkali and so on. It is a
key regulatory
factor in stress adaptation.
As used herein, the bZIP (basic region/leucine zipper) family of transcription
factors
comprises the simplest motif that nature uses for targeting specific DNA
sites: a pair of
short a-helices that recognize the DNA major groove with sequence-specificity
and high
affinity (Struhl, K., Ann. Rev. Biochem., 1989, 58,1051; Landschulz, W. H., et
al., Science,
1988, 240, 1759-1764).
As used herein, plant bZIP transcription factors are a class of proteins that
are widely
129
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
distributed in eukaryotes and relatively conserved. Its basic region is highly
conserved and
contains about 20 amino acid residues. According to the difference in the
structure of bZIP,
it can be divided into 10 subfamilies The transcription factors of different
subgroups
perform different functions, mainly including the expression of plant seed
storage genes, the
regulation of plant growth and development, light signal transduction, disease
prevention,
stress response and ABA sensitivity and other signal responses.
As used herein, Glutathione-S-Transferases (GSTs) family are a large family of
enzymes ubiquitously expressed in animals, plants and microorganism. It is a
superfamily of
enzymes that are encoded by multiple genes and have multiple functions. They
are
combined with harmful heterologous substances or oxidation products through
glutathione
to promote the metabolism, regional isolation or elimination of such
substances, and
involved in cellular defense against a broad spectrum of cytotoxic agents (see
Gate and Tew,
Expert Op/n. Ther. Targets 5: 477, 2001). Over 400 different GST sequences
have been
identified and based on their genetic characteristics and substrate
specificity can be
classified in four different classes a, [t, it, and 0 (see Mannervik et al.,
Biochem. 1 282:305,
1992). Each allelic variant encoded at the same gene locus is distinguished by
a letter.
According to the homology and gene structure characteristics of plant
proteins, the GST
family is divided into 8 subfamilies: F (Phi), U (Tau), T (Theta), Z (Zeta), L
(Lambda),
DHAR, EF1By and TCHQD . The F and U families are unique to plants. Compared
with
other subfamilies, they have the most members and the most abundant content.
Soluble GST
is mainly distributed in the cytoplasm, a few in chloroplasts and microbodies,
and a small
amount in the nucleus and apoplasts. Plant GST was first discovered in corn
(Zea mays L.),
and subsequently found in plants such as Arabidopsis thaliana, soybean
(Glycinemax), rice
(Oryza sativa L.), and tobacco (Nicotiana tabacum L.) .
As used herein, the term "organism" includes animals, plants, fungi, bacteria,
and the like.
As used herein, the term "host cell" includes plant cells, animal cells,
fungal cells, bacterial
cells, and the like.
In the present invention, the term "animal" includes any member of the animal
kingdom, for
example, invertebrates and vertebrates. Invertebrates include but not limited
to protozoa (such as
amoeba), helminthes, molluscs (such as escargots, snails, freshwater mussels,
oysters and
devilfishes), arthropods (such as insects, spiders, and crabs), etc.;
vertebrates include but not
limited to fishes (such as zebrafish, salmon, crucian carp, carp or tilapia
and other edible
economic fish that can be raised artificially), amphibians (such as frogs,
toads and newts), reptiles
(such as snakes, lizards, iguanas, turtles and crocodiles), birds (such as
chickens, geese, ducks,
turkeys, ostriches, quails, pheasants, parrots, finches, hawks, eagles, kites,
vultures, harriers,
ospreys, owls, crows, guinea fowls, pigeons, emus and cassowaries), mammals
(such as humans,
non-human primates (such as lemurs, tarsier, monkeys, apes and orangutans),
pigs, cattle, sheep,
horses, camels, rabbits, kangaroos, deer, polar bears, canines (such as dogs,
wolves, foxes and
130
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
jackals), felines (such as lions, tigers, cheetahs, lynxes and cats) and
rodents (such as mice, rats,
hamsters and guinea pigs)] etc. The term "non-human" does not include humans.
The term "animal" also includes individual animals at every developmental
stage (including
newborn, embryo, and fetus stage).
The term "fungus" refers to any member of eukaryotic organisms generated by
saprophytic
and parasitic spores. Generally, they are filamentous organisms and previously
they are classified
as chlorophyll deficiency plants, including but not limited to
basidiomycotina, deuteromycotina,
ascomycotina, mastigomycotina, zygomycotina, etc. However, it should be
understood that the
fungal classification is constantly evolving, and as a result, the specific
definition of the fungal
kingdom might be adjusted in the future. The macro-fungi can be divided into
four categories:
edible fungi, medicinal fungi, poisonous fungi and fungi with unknown uses.
Most of the edible
fungi and medicinal fungi belong to basidiomycotina, for example, Tremella
fuciformis,
Phlogiotis helvelloides, Tremella aurantialba, Auricularia auricular,
Auricularia polytricha,
Auricularia delicate, Auricularia messenterica, Auricularia rugosissima,
Calocera cornea,
Fistulina hepatica, Poria cocos, Grifola frondosa, Grifola umbellate,
Ganoderma applanatum,
Coriolus versicolor, , Ganoderma capense, Ganoderma lucifum, Ganoderma
cochlear,
Ganoderma lobatum, Ganoderma tsugae, Ganderma sinense, Polyporus rhinoceros,
Omphalia
lapidescens, Phellinus baumii, Cryptoporus volvatus, Pycnoporus cinnabarinus,
Fuscoporus
obliqus, Sparassis crispa, Hericium erinaceus, Thelephora via/is, Ramaria
flava, Ramaria
botrytoides, Ramaria stricta, Ramaria botrytis, Clavicorona pyxidata,
Clavulina cinerea,
Cantharellus cibarius, Hydnum repandum, Lycoperdon perlatum, Lycoperdon
Polymorphum,
Lycoperdon pus//urn, Lycoperdon aurantium, Lycoperdon flavidum, Lycoperdon
poleroderma,
Lycoperdon verrucosum, Boletus albidus, Boletus aereus, Boletus rube//us,
Sullins grevillea,
Suillus granulatus, Sullins luteus, Fistulina hepatica, Russula integra,
Russula alutacea, Russula
zoeteus, Russula Viresceu, Pleurotus citrinopileatus, Pleurotus ostreatus,
Pleurotus sapidus,
Pleurotus ferulae, Pleurotus abalonus, Pleurotus cornucopiae, Pleurotus
cystidiosus, Pleurotus
djamor, Pleurotus salmoneostramineus, Pleurotus eryngii (DC. ex Fr.) Quel.
var. eryngii,
Pleurotus eryngii (DC. ex Fr.) Quel.varferu/ae Lanzi, Pleurotus nebrodensis,
Pleurotus ostreatus,
Pleurotus florida, Pleurotus pulmonarius, Pleurotus tuber-regium,
Hohenbuchelia serotine,
Agaricus bisporus, Agaricus arvensis, Agaricus blazei, Tricholoma matsutake,
Tricholoma
gambosum, Tricholoma conglobatum, Tricholoma album, Tricholoma mongolicum,
Armillaria
me/lea, Arm//lane/la ventricosa, Armillariella mucida, Armillariella
tabescens, Collybia radicata,
Collybia radicata (Relh.ex Fr.) Quel. var. furfuracea PK., Marasmius
androsaceus, Termitomyces
albuminosus, Tricholoma giganteum, Hypsizigus marmoreus, Lepista sordida,
Lyophyllum
ulmarium, Lyophyllum shimeji, Flammulina velutipes, Cortinarius armillatus,
Amanita caesarea,
Amanita caesarea ( Scop. ex Fr. ) Pers. ex Schw. var. alba Gill, Amanita
strobiliformis, Amanita
vaginata, Volvariella volvacea, Pholiota adiposa, Pholiot squarrosa, Pholiot
mutabilis, Pholiota
131
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
nameko, Strop haria rugoso-annulata, Coprinus sterquilinus, Coprinus
fuscesceus, Coprinus
atramentarius, Coprinus comatus, Coprinus ovatus, Dictyophora indusiata,
Dictyophora
duplicate, Dictyophora echino-volvata, Schizphylhls commne, Agrocybe
cylindracea, Lentinus
edodes; some are Ascomycotina, for example, Morchella esculenta, Cordyceps
sinensis,
Cordyceps militaris, Claviceps purpurea, Cordyceps sobolifera, Engleromyces
geotzii,
Podostroma yunnansis, Shiraia bambusiicola, Hypocrella bambusea, Xylaria
nigripes, Tuber
spp..
In the present invention, the "plant" should be understood to mean any
differentiated
multicellular organism capable of performing photosynthesis, in particular
monocotyledonous or
dicotyledonous plants, for example, (1) food crops: Oryza spp., like Oryza
sativa, Oryza latifolia,
Oryza sativa, Oryza glaberrima; Triticum spp., like Triticum aestivum, T.
Turgidumssp. durum;
Hordeum spp., like Hordeum vulgare, Hordeum arizonicum; Secale cereale; Avena
spp., like
Avena sativa, Avena fatua, Avena byzantine, Avena fatua var. sativa, Avena
hybrida; Echinochloa
spp., like Pennisetum glaucum, Sorghum, Sorghum bicolor, Sorghum vulgare,
Triticale, Zea
mays or Maize, Millet, Rice, Foxtail millet, Proso millet, Sorghum bicolor,
Panicum, Fagopyrum
spp., Panicum miliaceum, Setaria italica, Zizania palustris, Eragrostis tef,
Panicum miliaceum,
Eleusine coracana; (2) legume crops: Glycine spp. like Glycine max, Soja
hispida, Soja max,
Vicia spp., Vigna spp., Pisum spp., field bean, Lupinus spp., Vicia,
Tamarindus indica, Lens
culinaris, Lathyrus spp., Lablab, broad bean, mung bean, red bean, chickpea;
(3) oil crops:
Arachis hypogaea, Arachis spp, Sesamum spp., Helianthus spp. like Helianthus
annuus, Elaeis
like Eiaeis guineensis, Elaeis oleifera, soybean, Brassicanapus, Brassica
oleracea, Sesamum
orientale, Brassica juncea, Oilseed rape, Camellia oleifera, oil palm, olive,
castor-oil plant,
Brassica napus L., canola; (4) fiber crops: Agave sisalana, Gossypium spp.
like Gossypium,
Gossypium barbadense, Gossypium hirsutum, Hibiscus cannabinus, Agave sisalana,
Musa textilis
Nee, Linum usitatissimum, Corchorus capsularis L, Boehmeria nivea (L.),
Cannabis sativa,
Cannabis sativa; (5) fruit crops: Ziziphus spp., Cucumis spp., Passiflora
edulis, Vitis spp.,
Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Punica granatum,
Malus spp.,
Citrullus lanatus, Citrus spp., Ficus carica, Fortunella spp., Fragaria spp.,
Crataegus spp.,
Diospyros spp., Eugenia unifora, Eriobotrya japonica, Dimocarpus longan,
Carica papaya, Cocos
spp., Averrhoa carambola, Actinidia spp., Prunus amygdalus, Musa spp. (musa
acuminate),
Persea spp. (Persea Americana), Psidium guajava, Mammea Americana, Mangifera
indica,
Canarium album (Oleaeuropaea), Caricapapaya, Cocos nucifera, Malpighia
emarginata,
Manilkara zapota, Ananas comosus, Annona spp., Citrus reticulate (Citrus
spp.), Artocarpus spp.,
Litchi chinensis, Ribes spp., Rubus spp., pear, peach, apricot, plum, red
bayberry, lemon,
kumquat, durian, orange, strawberry, blueberry, hami melon, muskmelon, date
palm, walnut tree,
cherry tree; (6) rhizome crops: Manihot spp., Ipomoea batatas, Colocasia
esculenta, tuber mustard,
Allium cepa (onion), eleocharis tuberose (water chestnut), Cyperus rotundus,
Rhizoma
dioscoreae; (7) vegetable crops: Spinacia spp., Phaseolus spp., Lactuca
sativa, Momordica spp,
Petroselinum crispum, Capsicum spp., Solanum spp. (such as Solanum tuberosum,
Solanum
integrifolium, Solanum lycopersicum), Lycopersicon spp. (such as Lycopersicon
esculentum,
Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Kale,
Luffa acutangula,
132
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
lentil, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts,
cabbage, carrot,
cauliflower, celery, collard greens, squash, Benincasa hispida, Asparagus
officinalis, Apium
graveolens, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia,
Cucurbita spp.,
Coriandrum sativum, B.carinata, Rapbanus sativus, Brassica spp. (such as
Brassica napus,
Brassica rapa ssp., canola, oilseed rape, turnip rape, turnip rape, leaf
mustard, cabbage, black
mustard, canola (rapeseed), Brussels sprout, Solanaceae (eggplant), Capsicum
annuum (sweet
pepper), cucumber, luffa, Chinese cabbage, rape, cabbage, calabash, Chinese
chives, lotus, lotus
root, lettuce; (8) flower crops: Tropaeolum minus, Tropaeolum majus, Canna
indica, Opuntia
spp., Tagetes spp., Cymbidium (orchid), Crinum asiaticum L., Clivia,
Hippeastrum rutilum, Rosa
rugosa, Rosa Chinensis, Jasminum sambac, Tulipa gesneriana L., Cerasus sp.,
Pharbitis nil (L.)
Choisy, Calendula officinalis L., Nelumbo sp., Bellis perennis L., Dianthus
caryophyllus, Petunia
hybrida, Tulipa gesneriana L., Lilium brownie, Prunus mume, Narcissus tazetta
L., Jasminum
nudiflorum Lindl., Primula malacoides, Daphne odora, Camellia japonica,
Michelia alba,
Magnolia liliiflora, Viburnum macrocephalum, Clivia miniata, Malus
spectabilis, Paeonia
suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii,
Rhododendron
hybridum, Michelia figo (Lour.) Spreng., Cercis chinensis, Kerria japonica,
Weigela florida,
Fructus forsythiae, Jasminum mesnyi, Parochetus communis, Cyclamen persicum
Mill.,
Phalaenophsis hybrid, Dendrobium nobile, Hyacinthus orientalis, Iris tectorum
Maxim,
Zantedeschia aethiopica, Calendula officinalis, Hippeastrum rutilum, Begonia
semperflorenshybr,
Fuchsia hybrida, Begonia maculataRaddi, Geranium, Epipremnum aureum; (9)
medicinal crops:
Carthamus tinctorius, Mentha spp., Rheum rhabarbarum, Crocus sativus, Lycium
chinense,
Polygonatum odoratum, Polygonatum Kingianum, Anemarrhena asphodeloides Bunge,
Radix
ophiopogonis, Fritillaria cirrhosa, Curcuma aromatica, Amomum villosum Lour.,
Polygonum
multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, Astragalus
membranaceus, Panax
ginseng, Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis,
Ligusticum wallichii,
Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha
haplocalyx,
Leonurus sibiricus L., Agastache rugosus, Scutellaria baicalensis, Prunella
vulgaris L., Pyrethrum
carneum, Ginkgo biloba L., Cinchona ledgeriana, Hevea brasiliensis (wild),
Medicago sativa
Linn, Piper Nigrum L., Radix Isatidis, Atractylodes macrocephala Koidz; (10)
raw material crops:
Hevea brasiliensis, Ricinus communis, Vernicia fordii, Moms alba L., Hops
Humulus lupulus,
Betula, Alnus cremastogyne Burk., Rhus verniciflua stokes; (11) pasture crops:
Agropyron spp.,
Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris arundinacea,
Panicum virgatum,
prairiegrasses, Indiangrass, Big bluestem grass, Phleum pratense, turf,
cyperaceae (Kobresia
pygmaea, Carex pediformis, Carex humilis), Medicago sativa Linn, Phleum
pratense L.,
Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Crotalaria juncea,
Sesbania cannabina,
Azolla imbircata, Eichhornia crassipes, Amorpha fruticosa, Lupinus micranthus,
Trifolium,
Astragalus adsurgens pall, Pistia stratiotes linn, Alternanthera
philoxeroides, Lolium; (12) sugar
crops: Saccharum spp., Beta vulgaris; (13) beverage crops: Camellia sinensis,
Camellia Sinensis,
tea, Coffee (Coffea spp.), Theobroma cacao, Humulus lupulus Linn.; (14) lawn
plants:
Ammophila arenaria, Poa spp.(Poa pratensis (bluegrass)), Agrostis spp.
(Agrostis matsumurae,
Agrostis palustris), Lolium spp. (Lolium), Festuca spp. (Festuca ovina L.),
Zoysia spp.
(Zoysiajaponica), Cynodon spp. (Cynodon dactylon/bermudagrass), Stenotaphrum
secunda tum
133
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
(Stenotaphrum secundatum), Paspalum spp., Eremochloa ophiuroides
(centipedegrass),
Axonopus spp. (carpetweed), Bouteloua dactyloides (buffalograss), Bouteloua
var. spp.
(Bouteloua gracilis), Digitaria sanguinalis, Cyperusrotundus,
Kyllingabrevifolia,
Cyperusamuricus, Erigeron canadensis, Hydrocotylesibthorpioides,
Kummerowiastriata,
Euphorbia humifusa, Viola arvensis, Carex rigescens, Carex heterostachya,
turf; (15) tree crops:
Pinus spp., Salix spp., Acer spp., Hibiscus spp., Eucalyptus spp., Ginkgo
biloba, Bambusa sp.,
Populus spp., Prosopis spp., Quercus spp., Phoenix spp., Fagus spp., Ceiba
pentandra,
Cinnamomum spp., Corchorus spp., Phragmites australis, Physalis spp.,
Desmodium spp.,
Populus, Hedera helix, Populus tomentosa Can, Viburnum odoratissinum, Ginkgo
biloba L.,
Quercus, Ailanthus altissima, Schima superba, Ilex pur-purea, Platanus
acerifolia, ligustrum
lucidum, Buxus megistophylla Levl., Dahurian larch, Acacia mearnsii, Pinus
massoniana, Pinus
khasys, Pinus yunnanensis, Pinus fmlaysoniana, Pinus tabuliformis, Pinus
koraiensis, Juglans
nigra, Citrus limon, Platanus acerifolia, Syzygium jambos, Davidia
involucrate, Bombax
malabarica L., Ceiba pentandra (L.), Bauhinia blakeana, Albizia saman,
Albizzia julibrissin,
Erythrina corallodendron, Erythrina indica, Magnolia gradiflora, Cycas
revolute, Lagerstroemia
indica, coniferous, macrophanerophytes, Frutex; (16) nut crops: Bertholletia
excelsea, Castanea
spp., Corylus spp., Carya spp., Juglans spp., Pistacia vera, Anacardium
occidentale, Macadamia
(Macadamia integrifolia), Carya illinoensis Koch, Macadamia, Pistachio, Badam,
other plants
that produce nuts; (17) others: arabidopsis thaliana, Bra chiaria eruciformis,
Cenchrus echinatus,
Setaria faberi, eleusine indica, Cadaba farinose, algae, Carex elata,
ornamental plants, Carissa
macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus sp., Festuca
arundinacea,
Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, Melilotus
spp., Moms nigra,
Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, Sambucus spp.,
Sinapis sp.,
Syzygium spp., Tripsacum dactyloides, Triticosecale rimpaui, Viola odorata,
and the like.
In a specific embodiment, the plant is selected from rice, maize, wheat,
soybean, sunflower,
sorghum, rape, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco,
cassava, potato, sweet
potato, Chinese cabbage, cabbage, cucumber, Chinese rose, Scindapsus aureus,
watermelon,
melon, strawberry, blueberry, grape, apple, citrus, peach, pear, banana, etc.
As used herein, the term "plant" includes a whole plant and any progeny, cell,
tissue or part
of plant. The term "plant part" includes any part of a plant, including, for
example, but not limited
to: seed (including mature seed, immature embryo without seed coat, and
immature seed); plant
cutting; plant cell; plant cell culture; plant organ (e.g., pollen, embryo,
flower, fruit, bud, leaf,
root, stem, and related explant). Plant tissue or plant organ can be seed,
callus tissue, or any other
plant cell population organized into a structural or functional unit. Some
plant cells or tissue
cultures can regenerate a plant that has the physiological and morphological
characteristics of the
plant from which the cell or tissue is derived, and can regenerate a plant
that has substantially the
same genotype as the plant. In contrast, some plant cells cannot regenerate
plants. The
regenerable cells in plant cells or tissue cultures can be embryos,
protoplasts, meristematic cells,
callus, pollen, leaves, anthers, roots, root tips, silks, flowers, kernels,
ears, cobs, husks, or stems.
The plant parts comprise harvestable parts and parts that can be used to
propagate offspring
plants. The plant parts that can be used for propagation include, for example,
but not limited to:
seeds, fruits, cuttings, seedlings, tubers and rootstocks. The harvestable
parts of plants can be any
134
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
of useful parts of plants, including, for example, but not limited to:
flowers, pollen, seedlings,
tubers, leaves, stems, fruits, seeds and roots.
The plant cells are the structural and physiological units of plants. As used
herein, the plant
cells include protoplasts and protoplasts with partial cell walls. The plant
cells may be in a form
of isolated single cells or cell aggregates (e.g., loose callus and cultured
cells), and may be part of
higher order tissue units (e.g., plant tissues, plant organs, and intact
plants). Therefore, the plant
cells can be protoplasts, gamete-producing cells, or cells or collection of
cells capable of
regenerating a whole plant. Therefore, in the embodiments herein, a seed
containing a plurality of
plant cells and capable of regenerating into a whole plant is considered as a
"plant part".
As used herein, the term "protoplast" refers to a plant cell whose cell wall
is completely or
partially removed and whose lipid bilayer membrane is exposed. Typically, the
protoplast is an
isolated plant cell without cell wall, which has the potential to regenerate a
cell culture or a whole
plant.
The plant "offspring" includes any subsequent generations of the plant.
The terms "inhibitory herbicide tolerance" and "inhibitory herbicide
resistance" can be used
interchangeably, and both refer to tolerance andresistance to an inhibitory
herbicide .
"Improvement in tolerance to inhibitory herbicide " and "improvement in
resistance to inhibitory
herbicide" mean that the tolerance or resistance to the inhibitory herbicide
is improved as
compared to a plant containing the wild-type gene.
Generally, if the herbicidal compounds as described herein, which can be
employed in the
context of the present invention are capable of forming geometrical isomers,
for example E/Z
isomers, it is possible to use both, the pure isomers and mixtures thereof, in
the compositions
according to the invention. If the herbicidal compounds as described herein
have one or more
centers of chirality and, as a consequence, are present as enantiomers or
diastereomers, it is
possible to use both, the pure enantiomers and diastereomers and their
mixtures, in the
compositions according to the invention. If the herbicidal compounds as
described herein have
ionizable functional groups, they can also be employed in the form of their
agriculturally
acceptable salts. Suitable are, in general, the salts of those cations and the
acid addition salts of
those acids whose cations and anions, respectively, have no adverse effect on
the activity of the
active compounds. Preferred cations are the ions of the alkali metals,
preferably of lithium,
sodium and potassium, of the alkaline earth metals, preferably of calcium and
magnesium, and of
the transition metals, preferably of manganese, copper, zinc and iron, further
ammonium and
substituted ammonium in which one to four hydrogen atoms are replaced by Ci-C4-
alkyl,
hydroxy-C I-C4-alkyl, C t-C4-al koxy-C 1-C 4-al kyl, hydroxy-C i-C4-al koxy-C
i-C 4-al kyl, phenyl or
benzyl, preferably ammonium, methyl ammonium, isopropylammonium,
dimethylammonium,
diisopropylammonium, trimethylammonium, heptylammonium, dodecylammonium,
tetradecyl ammonium, tetramethylammonium, tetraethylammonium,
tetrabutylammonium,
2-hydroxyethylammonium (olamine salt), 2-(2-hydroxyeth-1 -oxy)eth-l-ylammonium
(diglycolamine salt), di(2-hydroxyeth-1-yl)ammonium (diolamine salt),
tri s(2-hydroxyethyl)ammonium (trol amine salt), tris(2-
hydroxypropyl)ammonium,
135
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
benzyltrimethylammonium, benzyltriethylammonium, N,N,N-
trimethylethanolammonium
(choline salt), furthermore phosphonium ions, sulfonium ions, preferably
tri(Ct-C4-alkyl)sulfonium, such as tri-methylsulfonium, and sulfoxonium ions,
preferably
tri(Ct-C4-alkyl)sulfoxonium, and finally the salts of polybasic amines such as
N,N-bis-(3-aminopropyl)methylamine and diethylenetri amine. Anions of useful
acid addition
salts are primarily chloride, bromide, fluoride, iodide, hydrogensulfate,
methylsulfate, sulfate,
dihydrogenphosphate, hydrogenphosphate, nitrate, bi-carbonate, carbonate,
hexafluorosilicate,
hexafluorophosphate, benzoate and also the anions of C1-C4-alkanoic acids,
preferably formate,
acetate, propionate and butyrate.
The herbicidal compounds as described herein having a carboxyl group can be
employed in the form of the acid, in the form of an agriculturally suitable
salt as mentioned
above or else in the form of an agriculturally acceptable derivative, for
example as amides,
such as mono- and di-Ci-C6-alkylamides or arylamides, as esters, for example
as allyl esters,
propargyl esters, Ci-C10-alkyl esters, alkoxyalkyl esters, tefuryl
((tetra-hydrofuran-2-yl)methyl) esters and also as thioesters, for example as
Ci-Cio-alkylthio esters. Preferred mono- and di-Ci-C6-alkylamides are the
methyl and the
dimethylamides. Preferred arylamides are, for example, the anilides and the 2-
chloroanilides.
Preferred alkyl esters are, for example, the methyl, ethyl, propyl, isopropyl,
butyl, isobutyl,
pentyl, mexyl (1-methyl hexyl), meptyl (1-methylheptyl), heptyl, octyl or
isooctyl
(2-ethylhexyl) esters. Preferred C1-C4-alkoxy- Ci-C4-alkyl esters are the
straight-chain or
branched Ci-C4-alkoxy ethyl esters, for example the 2-methoxyethyl, 2-
ethoxyethyl,
2-butoxyethyl (butotyl), 2-butoxypropyl or 3-butoxypropyl ester. An example of
a
straight-chain or branched Ci-C6-alkylthio ester is the ethylthio ester.
(1) Inhibition of HPPD (Hydroxyphenyl Pyruvate Dioxygenase). a substance that
has
herbicidal activity per se or a substance that is used in combination with
other herbicides
and/or additives which can change its effect, and the substance can act by
inhibiting HPPD.
Substances which are capable of producing herbicidal activity by inhibiting
HPPD are well
known in the art, including but not limited to the following types:
1) triketones, e.g., sulcotrione (CAS NO.: 99105-77-8), mesotrione (CAS NO.:
104206-82-8), bicyclopyrone (CAS NO.: 352010-68-5), tembotrione (CAS NO.:
335104-84-2), tefuryltrione (CAS NO.: 473278-76-1), benzobicyclon (CAS NO.:
156963-66-5);
2) diketonitriles, e.g., 2-cyano-3-cyclopropy1-1-(2-methylsulfony1-4-
trifluoromethylphenyl)propane-1,3-dione (CAS NO.: 143701-75-1), 2-cyano-3-
cyclopropy1-1-(2-methylsulfony1-3,4- dichlorophenyl)propane-1,3-dione (CAS
NO.:
212829-55-5), 2-cyano-1- [4-(methylsulfony1)-2-trifluoromethylpheny1]-3-(1-
methyl
cycloprop-yl)propane-1,3-dione (CAS NO.: 143659-52-3);
136
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
3) isoxazoles, e.g., isoxaflutole (CAS NO.: 141112-29-0), isoxachlortole (CAS
NO.:
141112-06-3), clomazone (CAS NO.: 81777-89-1);
4) pyrazoles, e.g., topramezone (CAS NO.: 210631-68-8); pyrasulfotole (CAS
NO.:
365400-11-9), pyrazoxyfen (CAS NO.: 71561-11-0); pyrazolate (CAS NO.: 58011-68-
0),
benzofenap (CAS NO.: 82692-44-2), bipyrazone (CAS NO.: 1622908-18-2),
tolpyralate
(CAS NO.: 1101132-67-5), fenpyrazone (CAS NO.: 1992017-55-6), cypyrafluone
(CAS
NO.: 1855929-45-1), tripyrasulfone (CAS NO.: 1911613-97-2);
5) benzophenons;
6) others: lancotrione (CAS NO.: 1486617-21-3), fenquinotrione (CAS NO.:
1342891-70-6), fufengcao'an(CAS NO:2421252-30-2);
and those mentioned in patent CN105264069A.
(2) Inhibition of EPSPS (Enolpyruvyl Shikimate Phosphate Synthase): e.g.,
sulphosate,
Glyphosate, glyphosate-isopropylammonium, and glyphosate-trimesium.
(3) Inhibition of PPO (Protoporphyrinogen Oxidase) can be divided into
pyrimidinediones,
diphenyl-ethers, phenylpyrazoles, N-phenylphthalimides, thiadiazoles,
oxadiazoles, triazolinones,
oxazolidinedionesand other herbicides with different chemical structures.
In an exemplary embodiment, pyrimidinediones herbicides include but not
limited to
butafenacil (CAS NO: 134605-64-4), saflufenacil (CAS NO: 372137-35-4),
benzfendizone (CAS
NO: 158755-95-4), tiafenacil (CAS NO: 1220411-29-9), ethyl
[3-[2-chloro-4-fluoro-5-(1-methy1-6-trifluoromethyl -2,4-dioxo-1,2,3,4-
tetrahydropyrimidin-3-yl)phenoxy]-2- pyridyloxy]acetate (Epyrifenacil, CAS NO:
353292-31-6),
1 -Methyl-6-thfluoromethy1-3-(2,2,7- thfluoro-3-oxo-4- prop-2-ynyl -3,4-
dihydro-2H-benzo[1,4]oxazin-6-y1)- 1H-pyrimidine-2,4-dione (CAS NO: 1304113-05-
0),
3-[7-Chloro-5- fluoro-2-(trifluoromethyl)-1 H-benzimidazol-4-y1]-1
-methy1-6-(trifluoromethyl)-1 H-pyrimidine-2,4- dione (CAS NO: 212754-02-4),
flupropacil
(CAS NO: 120890-70-2), uracil containing isoxazoline disclosed in CN105753853A
(for
o F CI
)L 0 0
F3C 0
example, the compound 0-/), uracil pyridines disclosed in
W02017/202768 and uracils disclosed in W02018/019842;
Diphenyl-ethers herbicides include but not limited to fomesafen (CAS NO: 72178-
02-0),
oxyfluorfen (CAS NO: 42874-03-3), aclonifen (CAS NO: 74070-46-5), ethoxyfen-
ethyl (CAS
NO: 131086-42-5), lactofen (CAS NO: 77501-63-4), chlomethoxyfen (CAS NO: 32861-
85-1),
chlornitrofen (CAS NO: 1836-77-7), fluoroglycofen-ethyl (CAS NO: 77501-90-7),
Acifluorfen
or Acifluorfen sodium (CAS NO: 50594-66-6 or 62476-59-9), Bifenox (CAS NO:
42576-02-3),
ethoxyfen (CAS NO: 188634-90-4), fluoronitrofen (CAS NO: 13738-63-1),
furyloxyfen (CAS
NO: 80020-41-3), nitrofluorfen (CAS NO: 42874-01-1), and halosafen (CAS NO:
77227-69-1);
137
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Phenylpyrazoles herbicides include but not limited to pyraflufen-ethyl (CAS
NO:
129630-19-9), and fluazolate (CAS NO: 174514-07-9);
N-phenylphthalimides herbicides include but not limited to flumioxazin (CAS
NO:
103361-09-7), cinidonethyl (CAS NO: 142891-20-1), Flumipropyn (CAS NO: 84478-
52-4), and
flumiclorac-pentyl (CAS NO: 87546-18-7);
Thiadiazoles herbicides include but not limited tofluthiacet-methyl (CAS NO:
117337-19-6),
fluthiacet (CAS NO: 149253-65-6), and thidiazimin (CAS NO: 123249-43-4);
Oxadiazoles herbicides include but not limited to Oxadiargyl (CAS NO: 39807-15-
3), and
Oxadiazon (CAS NO: 19666-30-9);
Triazolinones herbicidesinclude but not limited to carfentrazone (CAS NO:
128621-72-7),
carfentrazone-ethyl (CAS NO: 128639-02-1), sulfentrazone (CAS NO: 122836-35-
5), azafenidin
(CAS NO: 68049-83-2), and bencarbazone (CAS NO: 173980-17-1);
Oxazolidinediones herbicides include but not limited to pentoxazone (CAS NO:
110956-75-7);
Other herbicides include but not limited to pyraclonil (CAS NO: 158353-15-2),
flufenpyr-ethyl (CAS NO: 188489-07-8), profluazol (CAS NO: 190314-43-3),
trifludimoxazin
(CAS NO: 1258836-72-4), N-ethyl-3-2,6-dichloro-4-t fluoromethylphenoxy)-5-
methyl-1
H-pyrazole-l-carboxamide (CAS NO: 452098-92-9), N-tetrahydrofurfury1-3-(2,6-
dichloro-4-
trifluoromethylphenoxy)-5-methy1-1 H-pyrazole-l-carboxamide (CAS NO: 915396-43-
9),
N-ethyl-3-(2- chloro-6-fluoro-4-trifluoromethylphenoxy)-5-methyl -1H-pyrazole-
1-carboxamide
(CAS NO: 452099-05-7), N-tetrahydrofurfury1-3-
(2-chloro-6-fluoro-4-trifluoromethylphenoxy)-5-methy1-1 H-pyrazole-1-
carboxamide (CAS
NO: 452100-03-7), 3-[7-fluoro-3-oxo-4-(prop-2-ynyl) -3,4-dihydro-2H-
benzo[1,4]oxazin-6-y1]-1,5-dimethy1-6-thioxo -[1,3,5]triazinan-2,4-dione (CAS
NO:
451484-50-7), 2-(2,2,7-Trifluoro-3-oxo-4- prop-2-yny1-3,4-dihydro-
2H-benzo[1,4]oxazin-6-y1)-4,5,6,7-tetrahydro -isoindole-1,3-dione (CAS NO:
1300118-96-0),
methyl (E)-4-[2-chloro-5- [4-chloro-5-(difluoromethoxy)-1H-methyl-pyrazol-3-
y1]-4-fluoro-phenoxy] -3-methoxy-but-2-enoate (CAS NO: 948893-00-3),
phenylpyridines
disclosed in W02016/120116, benzoxazinone derivatives disclosed in
EP09163242.2, and
x4
compounds represented by general formula I I (See patent
CN202011462769.7);
138
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
0 0 0
NN'
Th\JA02: 'I\JAN"\
SNOSN SONO
In another exemplary embodiment, Q represents I , I ,
0 o
A) III 0
) 7:' 1 N `V Nk CNANk
F3C N 0 F3C0
F3C 0, F3C S, F3C S F3C 0 F3C 0
0
\ N,
0 0 0 0
(E3c,Tro
NANA õk-/L-0
3,,
F3C0
,o,k(NyNes,.
70 0, 0
0,F3c , or
\ 0
F3CA N11-
H2N __
0 ;
Y represents halogen, halo C1-C6 alkyl or cyano;
Z represents halogen
M represents CH or N;
X represents -CXIX2-(C1-C6 alkyl)õ-, -(C1-C6 alkyl)-CX1X2-(C1-C6 alkyl)õ- or
n represents 0 or 1; r represents an integer of 2 or more,
Xi, X2 each independently represent H, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-
C6
alkynyl, halo C1-C6 alkyl, halo C2-C6 alkenyl, halo C2-C6 alkynyl, C3-C6
cycloalkyl,
C3-C6 cycloalkyl C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, hydroxy C1-C6
alkyl,
C1-C6 alkoxy C1-C6 alkyl, phenyl or benzyl;
X3, X4 each independently represent 0 or S;
W represents hydroxy, C1-C6 alkoxy, C2-C6 alkenyloxy, C2-C6 alkynyloxy, halo
C1-C6 alkoxy, halo C2-C6 alkenyloxy, halo C2-C6 alkynyloxy, C3-C6
cycloalkyloxy,
phenyloxy, sulfhydryl, C1-C6 alkylthio, C2-C6 alkenylthio, C2-C6 alkynylthio,
halo C1-C6
alkylthio, halo C2-C6 alkenylthio, halo C2-C6 alkynylthio, C3-C6
cycloalkylthio,
phenylthio, amino or C1-C6 alkylamino.
In another exemplary embodiment, the compound represented by the general
formula I
F3CN 0
is selected from compound A: Q represents I ; Y represents chlorine; Z
represents
fluorine; M represents CH; X represents - C*XiX2-(C1-C6 alkyl)õ-(C* is the
chiral center, R
configuration), n represents 0; Xi represents hydrogen; X2 represents methyl;
X3 and X4
each independently represent 0; W represents methoxy.
4) Inhibition of ALS (Acetolactate Synthase) including but not limited to the
following
herbicides or their mixtures:
139
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
(1) sulfonylureas such as amidosulfuron, azimsulfuron, bensulfuron,
bensulfuron-methyl, chlorimuron, chlorimuron-ethyl, chlorsulfuron,
cinosulfuron,
cyclosulfamuron, ethametsulfuron, ethametsulfuron-methyl, ethoxysulfuron,
flazasulfuron,
flucetosulfuron, flupyrsulfuron, flupyrsulfuron-methyl-sodium, foramsulfuron,
halosulfuron,
halosulfuron- methyl, imazosulfuron, iodosulfuron, iodosulfuron-methyl-sodium,
iofensulfuron, iofensulfuron-sodium, mesosulfuron, metazosulfuron,
metsulfuron,
metsulfuron-methyl, nicosulfuron, orthosulfamuron, oxasulfuron, primisulfuron,
primisulfuron-methyl, propyrisulfuron, prosulfuron, pyrazosulfuron,
pyrazosulfuron-ethyl,
rim sulfuron, sulfometuron, sulfometuron-methyl, sulfosulfuron,
thifensulfuron,
thifensulfuron-methyl, triasulfuron, tribenuron, tribenuron-methyl,
trifloxysulfuron,
trifloxysulfuron-sodium, triflusulfuron, triflusulfuron-methyl and
tritosulfuron;
(2) imidazolinones such as imazamethabenz, imazamethabenz-methyl, imazamox,
imazapic, imazapyr, imazaquin and imazethapyr;
(3) triazolopyrimidine herbicides and sulfonanilides such as cloransulam,
cloransulam-methyl, diclosulam, flumetsulam, florasulam, metosulam,
penoxsulam,
pyroxsulam, pyrimisulfan and triafamone;
(4) pyrimidinylbenzoates such as bispyrib ac, bispyribac-sodium, pyribenzoxim,
pyriftalid, pyriminob ac, pyriminobac-methyl, pyrithiobac, pyrithiobac-sodium,
4-[[[24(4,6-dimethoxy-2- pyrimidinyl)oxy]phenyl]methyliaminoi-benzoic acid-1
-methylethyl ester (CAS NO.: 420138-41 -6), 4-[[[2-[(4,6-dimethoxy-2-
pyrimidinyl) oxy]
phenyl]methyl]amino]-benzoic acid propyl ester (CAS NO.: 420138-40-5),
N-(4-bromopheny1)-2-[(4,6-dimethoxy-2- pyrimidinyl)oxy]benzenemethanamine (CAS
NO.:
420138-01 -8);
(5) sulfonylaminocarbonyl-triazolinone herbicides such as flucarbazone,
flucarbazone-sodium, propoxycarbazone, propoxycarbazone-sodium, thiencarbazone
and
thiencarbazone-methyl;
5) Inhibition of ACCase (Acetyl CoA Carboxylas): Fenthiaprop, alloxydim,
alloxydim-sodium, butroxydim, clethodim, clodinafop, clodinafop-propargyl,
cycloxydim,
cyhalofop, cyhalofop-butyl, diclofop, diclofop-methyl, fenoxaprop, fenoxaprop-
ethyl,
fenoxaprop-P, fenoxaprop-P-ethyl, fluazifop, fluazifop-butyl, fluazifop-P,
fluazifop-P-butyl,
haloxyfop, haloxyfop-methyl, haloxyfop-P, haloxyfop-P-methyl, metamifop,
pinoxaden,
profoxydim, propaquizafop, quizalofop, quizalofop-ethyl, quizalofop-tefuryl,
quizalofop-P,
quizalofop-P-ethyl, quizalofop-P-tefuryl, sethoxydim, tepraloxydim,
tralkoxydim,
4-(4'-Chloro-4-
cycl opropy1-2'-fluoro[1, 1'-biphenyl 1-3 -y1)-5 -hydroxy-2,2,6,6-tetram ethy1-
2H-pyran-
3(6H)-one(CAS NO. 1312337-72-6); 4-(2',4'-Dichloro-4-cyclopropyl[1,1'-
biphenyl] -3-y1)
-5-hydroxy-2,2,6,6-tetramethy1-2H-pyran-3(6H)-one(CAS NO.: 1312337-45-3);
140
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
4-(4'-Chloro-4-ethyl-2'-fluoro[1,1'-bipheny1]-3-y1)-5-hydroxy-2,2,6,6-
tetramethyl
-2H-pyran-3(6H)-one(CAS NO.: 1033757-93-5); 4-(2',4'-Dichloro-4-ethyl[1, l'-
bipheny1]-3-y1)-2,2,6,6-tetramethy1-2H-pyran-3,5(4H,6H)-dione (CAS NO.:
1312340-84-3);
5-(Acetyloxy)-4-(4'-chloro-4-cyclopropy1-2'-fluoro[1,1'-biphenyl]
-3-y1)-3,6-dihydro-2,2,6,6-tetramethy1-2H-pyran-3-one (CAS NO.: 1312337- 48-
6);
5-(Acetyloxy)-4-(2',4'-dichloro-4-cyclopropy141,1'-bipheny1]-3-y1)-3,6-dihydro
-2,2,6,6-tetramethy1-2H-pyran-3-one; 5-(Acetyloxy)-4-(4'-chloro-4-ethy1-2'-
fluoro
[1,1'-bipheny1]-3-y1)-3,6-dihydro-2,2,6,6-tetramethy1-2H-pyran-3-one(CAS NO.:
1312340-82-1); 5-(Acetyloxy)-4-(2',4'-dichloro -4-ethyl[1,1'-bipheny1]-3-y1)-
3,6-
dihydro-2,2,6,6-tetramethyl-2H-pyran-3-one (CAS NO.: 1033760-55-2); 4-(4'-
Chloro
-4-cyclopropy1-2'-fluoro[1,11-biphenyl] -3 -y1)-5,6-dihydro-2,2,6,6-tetram
ethy1-5 -oxo-
2H-pyran-3-y1 carbonic acid methyl ester (CAS NO.: 1312337-51-1); 4-(2',4'-
Dichloro-4-cyclopropy141,11-biphenyl]-3-y1)-5,6-dihydro-2,2,6,6-tetramethyl-5-
oxo
-2H-pyran-3-y1 carbonic acid methyl ester; 4-(4'-Chloro-4-ethyl-2'-fluoro
[1,1'-bipheny1]-3-y1)-5,6-dihydro-2,2,6,6-tetramethy1-5-oxo-2H-pyran-3-y1
carbonic acid
methyl ester (CAS NO.: 1312340-83-2); 4-(2',4'-Dichloro-4-ethyl [1,1'-
biphenyl]
-3-y1)-5,6-dihydro-2,2,6,6-tetramethy1-5-oxo-2H-pyran-3-y1 carbonic acid
methyl ester
(CAS NO.: 1033760-58-5).
(6) Inhibition of GS (Glutamine Synthetase):e.g., Bialaphos/bilanafos,
Bilanaphos-natrium, Glufosinate-ammonium, Glufosinate, and glufosinate-P.
(7) Inhibition of PDS(Phytoene Desaturase): e.g., flurochlori done,
flurtamone,
beflubutamid, norflurazon, fluridone, Diflufenican,Picolinafen, and
4-(3-trifluoromethylphenoxy) -2-(4-trifluoromethylphenyl)pyrimidine (CAS NO:
180608-33-7).
(8) Inhibition of DHPS (Dihydropteroate Synthase): e.g., Asulam.
(9) Inhibition of DXPS (Deoxy-D-Xyulose Phosphate Synthase): e.g., Bixlozone,
and
Clomazone.
(10) Inhibition of HST (Homogentisate Solanesyltransferase):
e.g.,Cyclopyrimorate.
(11) Inhibition of SPS (Solanesyl Diphosphate Synthase): e.g., Aclonifen.
(12) Inhibition of Cellulose Synthesis: e.g., Indaziflam, Triaziflam,
Chlorthiamid,
Dichlobenil, Isoxaben, Flupoxam, 1-cyclohexy1-5-pentafluorphenyloxy-
1441,2,4,6]
thiatriazin-3-ylamine (CAS NO: 175899-01-1), and the azines disclosed in
CN109688807A.
(13) Inhibition of VLCFAS (Very Long-Chain Fatty Acid Synthesis) include but
not
limited to the following types:
1) a-Chloroacetamides: e.g., acetochlor, alachlor, butachlor, dimethachlor,
dimethenamid, dimethenamid-P, metazachl or, metolachlor, metolachlor-S,
pethoxamid,
pretilachlor, propachlor, propisochlor, and thenylchlor;
141
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
2) a-Oxyacetamides e.g., flufenacet, and mefenacet;
3) a-Thioacetamides: e g , anilofos, and piperophos;
4) Azolyl-carboxamides: e.g., cafenstrole, fentrazamide, and ipfencarbazone;
5) Benzofuranes e.g., Benfuresate, and Ethofumesate;
6) Isoxazolines: e.g., fenoxasulfone, and pyroxasulfone;
7) Oxiranes e.g., Indanofan, and Tridiphane;
8) Thiocarbamates: e.g.,
Cycloate,Dimepiperate,EPTC,Esprocarb,Molinate,Orbencarb,Prosulfocarb,Thiobencar
b/Be
nthiocarb,Tri-allate,Vernolate, and isoxazoline compounds of the formulae
11.1, 11.2, 11.3,
11 4, 11.5, 11.6, 11.7, 11.8 and II.9,and other isoxazoline compounds
mentioned in patent WO
2006/024820, WO 2006/037945, WO 2007/071900, WO 2007/096576, etc
F3C N F,C N
F I1/41.-OH P .-V-CH
P \s:' õ., 3
HHat>cf\-- cyN FtIr OCHF.z iiHt>ellsi F OCH F2
3 0
0,1
11,2
F,C ts,1 Fr N F,C ki
3 1 3 X 11 1
iisC o.N 14 C ,..t4 F
3 0 H3C 0-N
11,3 114 11,5
FAC F,C ki
rs A \--At
"'lir' N-CH
ii3C.,f-ir -A 4N
HH:CC)(11:),N F-.' 'F OCHF2
tie 11,7
F3C N, F C
1 NA
F 0,. p --- N-CH F a\ P 1 NH
Nst. 4, 3
H e' -NI
F F 0CHF2 3 a F F
11,9
11.6
(14) Inhibition of fatty acid thioesterase: e.g., Cinmethylin, and
Methiozolin;
(15) Inhibition of serine threonine protein phosphatase: e.g., Endothall.
(16) Inhibition of lycopene cyclase: e.g., Amitrole
The term "wild-type" refers to a nucleic acid molecule or protein that can be
found in nature.
In the present invention, the term "cultivation site" comprises a site where
the plant of the
present invention is cultivated, such as soil, and also comprises, for
example, plant seeds, plant
seedlings and grown plants. The term "weed-controlling effective amount"
refers to an amount of
herbicide that is sufficient to affect the growth or development of the target
weed, for example, to
prevent or inhibit the growth or development of the target weed, or to kill
the weed.
Advantageously, the weed-controlling effective amount does not significantly
affect the growth
142
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
and/or development of the plant seeds, plant seedlings or plants of the
present invention. Those
skilled in the art can determine such weed-controlling effective amount
through routine
experiments.
The term "gene" comprises a nucleic acid fragment expressing a functional
molecule (such
as, but not limited to, specific protein), including regulatory sequences
before (5' non-coding
sequences) and after (3' non-coding sequences) a coding sequence.
The DNA sequence that "encodes" a specific RNA is a DNA nucleic acid sequence
that can
be transcribed into RNA. The DNA polynucleotides can encode a RNA (mRNA) that
can be
translated into a protein, or the DNA polynucleotides can encode a RNA that
cannot be translated
into a protein (for example, tRNA, rRNA, or DNA-targeting RNA; which are also
known as
"non-coding" RNA or " ncRNA").
The terms "polypeptide", "peptide" and "protein" are used interchangeably in
the present
invention, and refer to a polymer of amino acid residues. The terms are
applied to amino acid
polymers in which one or more amino acid residues are artificially chemical
analogs of
corresponding and naturally occurring amino acids, as well as to naturally
occurring amino acid
polymers. The terms "polypeptide", "peptide", "amino acid sequence" and
"protein" may also
include their modification forms, including but not limited to glycosylation,
lipid linkage,
sulfation, 7-carboxylation of glutamic acid residue, hydroxylation and ADP-
ribosylation.
The term "biologically active fragment" refers to a fragment that has one or
more amino acid
residues deleted from the N and/or C-terminus of a protein while still
retaining its functional
activity.
The terms "polynucleotide" and "nucleic acid" are used interchangeably and
comprise DNA,
RNA or hybrids thereof, which may be double-stranded or single-stranded.
The terms "nucleotide sequence" and "nucleic acid sequence" both refer to the
sequence of
bases in DNA or RNA.
Those of ordinary skill in the art can easily use known methods, such as
directed evolution
and point mutation methods, to mutate the DNA fragments as shown in SEQ ID No.
9 to SEQ ID
No. 17 of the present invention. Those artificially modified
nucleotidesequences that have at least
75% identity to any one of the foregoing sequences of the present invention
and exhibit the same
function are considered as derivatives of the nucleotide sequence of the
present invention and
equivalent to the sequences of the present invention.
The term "identity" refers to the sequence similarity to a natural nucleic
acid sequence.
Sequence identity can be evaluated by observation or computer software. Using
a computer
sequence alignment software, the identity between two or more sequences can be
expressed as a
percentage (%), which can be used to evaluate the identity between related
sequences. "Partial
sequence" means at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or
95% of a
given sequence.
The stringent condition may be as follows: hybridizing at 50 C in a mixed
solution of 7%
sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1 mM EDTA, and washing at 50 C
in 2x SSC
and 0.1% SDS; or alternatively: hybridizing at 50 C in a mixed solution of 7%
SDS, 0.5M
NaPO4 and 1mM EDTA, and washing at 50 C in 1x SSC and 0.1% SDS; or
alternatively:
hybridizing at 50 C in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA,
and washing
143
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
at 50 C in 0.5x SSC and 0.1% SDS; or alternatively: hybridizing at 50 C in a
mixed solution of
7% SDS, 0.5M NaPat and 1mM EDTA, and washing at 50 C in 0.1x SSC and 0.1% SDS;
or
alternatively: hybridizing at 50 C in a mixed solution of 7% SDS, 0.5M NaPO4
and 1mM EDTA,
and washing at 65 C in 0.1x SSC and 0.1% SDS; or alternatively: hybridizing at
65 C in a
solution of 6x SSC, 0.5% SDS, and then membrane washing with 2x SSC, 0.1% SDS
and lx
SSC, 0.1% SDS each once; or alternatively: hybridizing and membrane washing
twice in a
solution of 2x SSC, 0.1% SDS at 68 C, 5 min each time, and then hybridizing
and
membranewashing twice in a solution of 0.5x SSC, 0.1% SDS at 68 C, 15min each
time; or
alternatively: hybridizing and membrane washing in a solution of 0.1x SSPE (or
0.1x SSC), 0.1%
SDS at 65 C.
As used in the present invention, "expression cassette", "expression vector"
and "expression
construct" refer to a vector such as a recombinant vector suitable for
expression of a nucleotide
sequence of interest in a plant. The term "expression" refers to the
production of a functional
product. For example, the expression of a nucleotide sequence may refer to the
transcription of
the nucleotide sequence (such as transcription to generate mRNA or functional
RNA) and/or the
translation of RNA into a precursor or mature protein.
The "expression construct" of the present invention can be a linear nucleic
acid fragment, a
circular plasmid, a viral vector, or, in some embodiments, can be an RNA (such
as mRNA) that
can be translated.
The "expression construct" of the present invention may comprise regulatory
sequences and
nucleotide sequences of interest from different sources, or regulatory
sequences and nucleotide
sequences of interest from the same source but arranged in a way different
from those normally
occurring in nature.
The "highly-expressing gene" in the present invention refers to a gene whose
expression
level is higher than that of a common gene in a specific tissue.
The terms "recombinant expression vector" or "DNA construct" are used
interchangeably
herein and refer to a DNA molecule comprising a vector and at least one
insert. Recombinant
expression vectors are usually produced for the purpose of expression and/or
propagation of the
insert or for the construction of other recombinant nucleotide sequences. The
insert may be
operably or may be inoperably linked to a promoter sequence and may be
operably or may be
inoperably linked to a DNA regulatory sequence.
The terms "regulatory sequence" and "regulatory element" can be used
interchangeably and
refer to a nucleotide sequence that is located at the upstream (5' non-coding
sequence), middle or
downstream (3' non-coding sequence) of a coding sequence, and affects the
transcription, RNA
processing, stability or translation of a related coding sequence. Plant
expression regulatory
elements refer to nucleotide sequences that can control the transcription, RNA
processing or
stability or translation of a nucleotide sequence of interest in plants.
The regulatory sequences may include, but are not limited to, promoters,
translation leader
sequences, introns, and polyA recognition sequences.
The term "promoter" refers to a nucleic acid fragment capable of controlling
the
transcription of another nucleic acid fragment. In some embodiments of the
present invention, the
promoter is a promoter capable of controlling gene transcription in plant
cells, regardless of
144
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
whether it is derived from plant cells. The promoter can be a constitutive
promoter or a
tissue-specific promoter or a developmentally regulated promoter or an
inducible promoter.
The term "strong promoter" is a well-known and widely used term in the
art.Many strong
promoters are known in the art or can be identified by routine experiments.
The activity of the
strong promoter is higher than the activity of the promoter operatively linked
to the nucleic acid
molecule to be overexpressed in a wild-type organism, for example, a promoter
with an activity
higher than the promoter of an endogenous gene. Preferably, the activity of
the strong promoter is
higher by about 2%, 5%, 8%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%,
150%,
200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000% or
more
than 1000% than the activity of the promoter operably linked to the nucleic
acid molecule to be
overexpressed in the wild-type organism. Those skilled in the art know how to
measure the
activity of apromoter and compare the activities of different promoters.
The term "constitutive promoter" refers to a promoter that will generally
cause gene
expression in most cell types in most cases. "Tissue-specific promoter" and
"tissue-preferred
promoter" are used interchangeably, and refer to a promoter that is mainly but
not necessarily
exclusively expressed in a tissue or organ, and also expressed in a specific
cell or cell type.
"Developmentally regulated promoter" refers to a promoter whose activity is
determined by a
developmental event. "Inducible promoter" responds to an endogenous or
exogenous stimulus
(environment, hormone, chemical signal, etc.) to selectively express an
operably linked DNA
sequence.
As used herein, the term "operably linked" refers to a connection of a
regulatory element
(for example, but not limited to, promoter sequence, transcription termination
sequence, etc.) to a
nucleic acid sequence (for example, a coding sequence or open reading frame)
such that the
transcription of the nucleotide sequence is controlled and regulated by the
transcription regulatory
element. The techniques for operably linking regulatory element region to
nucleic acid molecule
are known in the art.
The "introducing" a nucleic acid molecule (such as a plasmid, linear nucleic
acid fragment,
RNA, etc.) or protein into a plant refers to transforming a cell of the plant
with the nucleic acid or
protein so that the nucleic acid or protein can function in the plant cell.
The term "transformation"
used in the present invention comprises stable transformation and transient
transformation.
The term "stable transformation" refers to that the introduction of an
exogenous nucleotide
sequence into a plant genome results in a stable inheritance of the exogenous
gene. Once stably
transformed, the exogenous nucleic acid sequence is stably integrated into the
genome of the
plant and any successive generations thereof
The term "transient transformation" refers to that the introduction of a
nucleic acid molecule
or protein into a plant cell to perform function does not result in a stable
inheritance of the foreign
gene. In transient transformation, the exogenous nucleic acid sequence is not
integrated into the
genome of the plant.
Changing the expression of endogenous genes in organisms includes two aspects:
intensity
and spatial-temporal characteristics. The change of intensity includes the
increase (knock-up),
decrease (knock-down) and/or shut off the expression of the gene (knock-out);
the
spatial-temporal specificity includes temporal (growth and development stage)
specificity and
145
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
spatial (tissue) specificity, as well as inducibility. In addition, it
includes changing the targeting
of a protein, for example, changing the feature of cytoplasmic localization of
a protein into a
feature of chloroplast localization or nuclear localization.
Unless otherwise defined, all technical and scientific terms used herein have
the same
meanings as commonly understood by those of ordinary skill in the art to which
the present
invention pertains. Although any methods and materials similar or equivalent
to those described
herein can also be used in the practice or testing of the present invention,
the preferred methods
and materials are now described.
All publications and patents cited in this description are incorporated herein
by reference as
if each individual publication or patent is exactly and individually indicated
to be incorporated by
reference, and is incorporated herein by reference to disclose and describe
methods and/or
materials related to the publications cited. The citation of any publication
which it was published
before the filing date should not be interpreted as an admission that the
present invention is not
eligible to precede the publication of the existing invention. In addition,
the publication date
provided may be different from the actual publication date, which may require
independent
verification.
Unless specifically stated or implied, as used herein, the terms "a", "a/an"
and "the" mean "at
least one." All patents, patent applications, and publications mentioned or
cited herein are
incorporated herein by reference in their entirety, with the same degree of
citation as if they were
individually cited.
The present invention has the following advantageous technical effects:
The present invention comprehensively uses the information of the following
two different
professional fields to develop a method for directly creating new genes in
organisms, completely
changing the conventional use of the original gene editing tools (i.e.,
knocking out genes),
realizing a new use thereof for creating new genes, in particular, realizing
an editing method for
knocking up endogenous genes by using gene editing technology to increase the
expression of
target genes. The first is the information in the field of gene editing, that
is, when two or more
different target sites and Cas9 simultaneously target the genome or organism,
different situations
such as deletion, inversion, doubling or inversion-doubling may occur. The
second is the
information in the field of genomics, that is, the information about location
and distance of
different genes in the genome, and specific locations, directions and
functions of different
elements (promoter, 5'UTR, coding region (CDS), different domain regions,
terminator, etc.) in
genes, and expression specificity of different genes, etc By combining the
information in these
two different fields, breaks are induced at specific sites of two or more
different genes or at two
or more specific sites within a single gene (specific sites can be determined
in the field of
genomics), a new combination of different gene elements or functional domains
can be formed
through deletion, inversion, doubling, and inversion-doubling or chromosome
arm exchange, etc.
(the specific situations would be provided in the field of gene editing),
thereby specifically
creating a new gene in the organism.
The new genes created by the present invention are formed by the fusion or
recombination
of different elements of two or more genes under the action of the spontaneous
DNA repair
mechanism in the organism to change the expression intensity, spatial-temporal
specificity,
146
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
special functional domains and the like of the original gene without an
exogenous transgene or
synthetic gene elements. Because the new gene has the fusion of two or more
different gene
elements, this greatly expands the scope of gene mutation, and will produce
more abundant and
diverse functions, thus it has a wide range of application prospects. At the
same time, these new
genes are not linked to the gene editing vectors, so the vector elements can
be removed through
genetic segregation, and thereby resulting in non-transgenic biological
materials containing the
new genes for animal and plant breeding. Alternatively, non-integrated
transient editing can be
performed by delivery of mRNA or ribonucleic acid protein complex (RNP) to
create
non-genetically modified biological materials containing the new genes. This
process is
non-transgenic and the resultant edited materials would contain no transgene
as well. In theory
and in fact, these new genes can also be obtained through traditional breeding
techniques (such as
radiation or chemical mutagenesis). The difference is that the screening with
traditional
techniques requires the creation of libraries containing a huge number of
random mutants and
thus it is time-consuming and costly to screen new functional genes. While in
the present
invention, new functional genes can be created through bioinformatics analysis
combined with
gene editing technology, the breeding duration can be greatly shortened. The
method of the
present invention is not obliged to the current regulations on gene editing
organisms in many
countries.
In addition, the new gene creation technology of the present invention can be
used to change
many traits in organisms, including the growth, development, resistance,
yield, etc., and has great
application value. The new genes created may have new regulatory elements
(such as promoters),
which will change the expression intensity and and/or spatial-temporal
characteristics of the
original genes, or will have new amino acid sequences and thus have new
functions. Taking crops
as an example, changing the expression of specific genes can increase the
resistance of crops to
noxious organisms such as pests and weeds and abiotic stresses such as
drought, waterlogging,
and salinity, and can also increase yield and improve quality. Taking fish as
an example,
changing the expression characteristics of growth hormone in fish can
significantly change its
growth and development speed.
Brief Description of Drawings
Figure 1 shows a schematic diagram of creating a new HPPD gene in rice.
Figure 2 shows a schematic diagram of creating a new EPSPS gene in rice.
Figure 3 shows a schematic diagram of creating a new PPDX gene in Arabidopsis
thaliana.
Figure 4 shows a schematic diagram of creating a new PPDX gene in rice.
Figure 5 shows the sequencing results for the HPPD-duplication Scheme tested
with rice
protoplast.
Figure 6 shows the map of the Agrobacterium transformation vector pQY2091 for
rice.
Figure 7 shows the electrophoresis results of the PCR products for the
detection of new gene
fragments in pQY2091 transformed hygromycin resistant rice callus. The arrow
indicates the
PCR band of the new gene created by the fusion ofthe promoter of the UBI2 gene
with the coding
region of the HPPD. The numbers are the numbers of the different callus
samples. M represents
DNA Marker, and the band sizes are 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp,
2500bp,
5000bp, 7500bp in order.
147
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Figure 8 shows the electrophoresis results of the PCR products for the
detection of new gene
fragments in pQY2091 transformed rice TO seedlings. The arrow indicates the
PCR band of the
new gene created by the fusion of the promoter of the UBI2 gene with the
coding region of the
HPPD. The numbers are the serial numbers of the different TO seedlings. M
represents DNA
Marker, and the band sizes are sequentially 100bp, 250bp, 500bp, 750bp,
1000bp, 2000bp,
2500bp, 5000bp, 7500bp.
Figure 9 shows the test results for the resistance to Bipyrazone of the QY2091
TO generation
of the HPPD gene doubling strain. In the same flowerpot, the wild-type Jinjing
818 is on the left,
and the HPPD doubling strain is on the right.
Figure 10 shows the relative expression levels of the HPPD and UBI2 genes in
the QY2091
TO generation of the HPPD gene doubling strain. 818CK1 and 818CK3 represent
two control
plants of the wild-type Jinjing 818; 13M and 20M represent the primary tiller
leaf samples of the
QY2091-13 and the QY2091-20 TO plants; 13L and 20L represent the secondary
tiller leaf
samples of the QY2091-13 and the QY2091-20 TO plants used in the herbicide
resistance test.
Figure 11 shows a schematic diagram of the possible genotypes of QY2091 Ti
generation
and the binding sites of the molecular detection primers.
Figure 12 shows the comparison of the sequencing results detecting the HPPD
doubling and
the predicted doubled sequences for QY2091-13 and QY2091-20.
Figure 13 shows the results of the herbicide resistance test for the Ti
generation of the
QY2091 HPPD doubling strain at the seedling stage.
Figure 14 shows a schematic diagram of the types of the possible editing event
of rice PPO1
gene chromosome fragment inversion and the binding sites of molecular
detection primers.
Figure 15 shows the sequencing results of the EPSPS-inversion detection.
Figure 16 shows the map of the rice Agrobacterium transformation vector
pQY2234.
Figure 17 shows the electrophoresis results of the PCR products for the
detection of new
gene fragments of hygromycin resistant rice callus transformed with pQY2234.
The arrow
indicates the PCR band of the new gene created by the fusion ofthe promoter of
the CP12
genewith the coding region of the PPO1. The numbers are the serial numbers of
different callus
samples. M represents DNA Marker, and the band sizes are sequentially 100bp,
250bp, 500bp,
750bp, 1000bp, 2000bp, 2500bp, 5000bp, 7500bp.
Figure 18 shows the resistance test results of the PPO1 gene inversion strain
to Compound A
of the QY2234 TO generation. Under the same treatment dose, the left flowerpot
is the wild-type
Huaidao No.5 control, and the right is the PPO1 inversion strain.
Figure 19 shows the relative expression levels of PPO1 and CP12 genes in the
QY2234 TO
generation PPO1 inversion strain. H5CK1 and H5CK2 represent two wild-type
Huaidao No.5
control plants; 252M, 304M and 329M represent the primary tiller leaf samples
of QY2234-252,
QY2234-304 and QY2234-329 TO plants; 252L, 304L and 329L represent secondary
tiller leaf
samples.
Figure 20 shows the comparison of the sequencing result of the PPO1 inversion
with the
predicted inversion sequence in the Huaidao 5 background.
Figure 21 shows the comparison of the sequencing result of the PPO1 inversion
with the
predicted inversion sequence in the Jinjing 818 background.
148
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Figure 22 shows the herbicide resistance test results for the Ti generation of
the QY2234
PPO1 inversion strain at seedling stage.
Figure 23 Duplication created a new GH1 gene cassette in zebrafish embryos.
The GH1
gene is the growth hormone gene in zebrafish. CollAla is collagen type I alpha
la gene.
CollAla-GH1 fusion was the new gene cassette as a result of the duplication.
DNA
template used for PCR amplification in the Control group (CK) was extracted
from young
zebrafish without microinjection. DNA template used for PCR amplification in
theTreatment group (RNP treat) was DNA sample extracted from young zebrafish
after
microinjection.
Figure 24 PPO1 inversion event lines were tested for herbicide resistance in
the field at
Ti generation of QY2234 rice plants. WT is wild-type Jinjing 818. 5# and 42#
represent
samples from the PPO1 inversion event lines of QY2234/818-5 and QY2234/818-42,
respectively. The herbicide tested was PPO inhibitor compound A.
Figure 25 shows the Western Blot detection of PPO1 protein in the Ti rice
plants of the
QY2234 lines. 5#, 42#, 114#, and 257# represent the samples from the inversion
event lines
of QY2234/818-5, QY2234/818-42, QY2234/818-144, and QY2234/818-257,
respectively.
Figure 26 shows the field assay of HPPD inhibitor herbicide resistance under
field
conditions at Ti generation of QY2091 rice plants. 12# and 21# represent
QY2091-12 and
QY2091-21 duplication event lines, respectively. The herbicide tested was HHPD
inhibitor
Bipyrazone.
Figure 27 A schematic diagram of the duplicated DNA fragment harboring PPO1
gene
in rice, and 4 duplicated events were detected in rice protoplast cells using
sequencing peak
comparison. pQY2648, pQY2650, pQY2651, pQY2653 are the vector numbers tested.
R2,
F2 were used as sequencing primers.The diagram is not in proportion with DNA
segment
lengths.
Figure 28 A schematic diagram of fragment translocation between chromosomel
and
chromosome2 that up-regulates HPPD gene expression in rice. After targeted
fragment
translocation, CP12 gene promoter drives HPPD CDS expression; at the same
time, HPPD
gene promoter drives CP12 CDS expression. The diagram is not in proportion
with DNA
segment lengths.
Figure 29 Fusion of the promoter of CP12 and the coding region of HPPD was
detected
in rice protoplast cells transformed with pQY2257.The diagram is not in
proportion with
DNA segment lengths.
Figure 30 Fusion of the promoter of HPPD and the coding region of CP12 was
detected
in rice protoplast cells transformed with pQY2259. The diagram is not in
proportion with
DNA segment lengths.
Figure 31 A schematic diagram of knocking-up HPPD gene expression as a result
of
the duplication of the segment between the two targeted cuts in rice, which
was mediated by
149
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
CRISPR/LbCpfl. The diagram is not in proportion with DNA segment lengths.
Figure 32 A schematic diagram of fusing the OsCATC gene with a chloroplast
signal
peptide domain (LOC4331514CTP) through the deletion of the segment between the
two
targeted cuts in rice protoplast,which results in OsCATC protein have
achloroplast signal
peptide domain and thus could go to chloroplast after expressed; and the
positive events
were detected in rice protoplast cells, which was demonstrated by sequencing.
CTP stands
for chloroplast signal peptide domain. The diagram is not in proportion with
DNA segment
lengths.
Figure 33 A schematic diagram of the OsGLO3 gene linking the chloroplast
signal
peptide domain (L0C4337056CTP) through chromosome fragment inversion between
the
targeted cuts, which results in OsGLO3 protein have a chloroplast signal
peptide domain
and thus could go to chloroplast after expressed;while L0C4337056 gene drops
its CTP;and
the detection results of positive event rice protoplasts.CTP stands for
chloroplast signal
peptide domain. The diagram is not in proportion with DNA segment lengths.
Figure 34 A schematic diagram showing knock-up of PPO2 gene by duplication of
the
DNA fragments between the two targeted cuts in rice. A new gene is produced
wherethe
SAMDC strong promoter drives the expression of PPO2. The diagram is not in
proportion
with DNA segment lengths.
Figure 35 Positive duplication events were detected in pQY1386-transformed
rice calli
as indicated by alignment of sequencing data. 28#, 62# are two duplication-
positive calli.
The diagram is not in proportion with DNA segment lengths.
Figure 36 Positive duplication events were detected in pQY1387-transformed
rice calli
as indicated by alignment of sequencing data. 64#, 824, 110#, 145# are
duplication-positive
calli. The diagram is not in proportion with DNA segment lengths.
Figure 37 Positive duplication events were detected in TO rice plants
(QY1387/818-2)
emerged from pQY1387-transformed calli. The repair outcomes of two targets as
well as the
duplication joint were aligned with Sanger sequencing data. The diagram is not
in
proportion with DNA segment lengths.
Figure 38 The detection results of the relative expression level of PPO2 in
QY1387/818 TO rice plants.As expected, PPO2 expression significantly increased
meanwhile SAMDC expression significantly reduced.
Figure 39 Herbicide resistance assay of rice QY1387 TO plants. 2# represents
the
1387/818-2 line, 4# represents the 1387/818-4 line, and WT is the wild type of
Jinjing 818.
The herbicide tested is PPO inhibitor compound A
Figure 40 A schematic diagram of creation of new PPO2 genes by DNA fragment
inversion between the two targeted cuts in rice. The diagram is not in
proportion with DNA
segment lengths.
150
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Figure 41 Positive inversion events were detected in QY2611-transformed rice
calli as
indicated by alignment of sequencing data. 10# represents the QY2611/818-10
callus, 13#
represents the QY2611/818-13 callus. The diagram is not in proportion with DNA
segment
lengths.
Figure 42 Positive inversion events were detected in QY2612-transformed rice
calli as
indicated by alignment of sequencing data. 5# represents the QY2612/818-5
callus, 34#
represents the QY2612/818-34 callus. The diagram is not in proportion with DNA
segment
lengths.
Figure 43 A schematic diagram of successful generation of new PPO2 gene
cassette in
maize protoplast cells, through duplication of the segment between the two
targeted cutsand
demonstrated by alignment of Sanger sequencing data. pQY1340 and pQY1341 are
test
vectors. The diagram is not in proportion with DNA segment lengths.
Figure 44 A schematic diagram of successful generation of new PP02-2A gene
cassette
in wheat protoplast cells transfected with pQY2626 vector, through inversion
of the segment
between the two targeted cuts, anddemonstrated by alignment of Sanger
sequencing data.
The diagram is not in proportion with DNA segment lengths.
Figure 45 A schematic diagram of successful generation of new PP02-2B gene
cassette
in wheat protoplast cells transfected with pQY2631 vector, through duplication
of the
segment between the two targeted cuts, and demonstrated by alignment of Sanger
sequencing data. The diagram is not in proportion with DNA segment lengths.
Figure 46 A schematic diagram of successful generation of new PP02-2D gene
cassette
in wheat protoplast cells transfected with pQY2635 vector, through duplication
of the
segment between the two targeted cuts, and demonstrated by alignment of Sanger
sequencing data. The diagram is not in proportion with DNA segment lengths.
Figure 47 Sequencing results of chromosome fragment inverted rice Line
QY1085/818-23.
Figure 48 Sequencing results of chromosome fragment duplicatedrice Line
QY1089/818-321.
Figure 49 A schematic diagram of successful generation of new IGF2 (Insulin-
like
growth factor 2) gene cassette driven by TNNI2 gene promoter, through
inversion of the
segment between the two targeted cuts, and demonstrated the detection of the
positive
fusion event of Pig TNNI2 promoter and IGF2 genein pig primary fibroblast
cells. The
diagram is not in proportion with DNA segment lengths.
Figure 50 A schematic diagram of successful generation of new TNNI3 (muscle
troponin T) gene cassette driven by IGF2 gene promoter, through inversion of
the segment
between the two targeted cuts, and demonstrated thedetection of the fusion
event of Pig
IGF2 promoter and TNNT3 gene in pig primary fibroblast cells. The diagram is
not in
151
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
proportion with DNA segment lengths.
Figure 51 shows the sequencing result of forward and reverse primers. The
experiment
result shows that the fragments between ghl gene and collal a gene in zebra
fish embryo are
doubled.
Figure 52 is the sequencing result. The experiment result shows that the
coding area
and the coding area & promotor of ddx5 gene and the coding area & the promotor
of ghl
gene are exchanged due to the inversion of chromosome fragments;
Figure 53 is the comparison diagram of inversion and wild type zebra fish. The
result
shows that the growth of zebra fish with upregulated expression is obviously
accelerated.
Figure 54 is a schematic diagram of Ubi2 promoter translocation to knock-up
PPO2
gene in rice.
Figure 55 shows the herbicide resistance test results for the Ti generation of
the QY378-16
translocation rice at seedling stage.
Specific Models for Carrying Out the Invention
The present invention is further described in conjunction with the examples as
follows. The
following description is just illustrative, and the protection scope of the
present invention should
not be limited to this.
Example 1: An editing method for knocking up the expression of the endogenous
HPPD gene by inducing doubling of chromosome fragment in plant ¨ rice
protoplast test
HPPD was a key enzyme in the pathway of chlorophyll synthesis in plants, and
the
inhibition of the activity of the HPPD would eventually lead to albino
chlorosis and death of
plants. Many herbicides, such as mesotrione and topramezone, were inhibitors
with the HPPD as
the target protein, and thus increasingthe expression level of the endogenous
HPPD gene in plants
could improve the tolerance of the plants to these herbicides. The rice HPPD
gene (as shown in
SEQ ID NO: 6, in which 1-1067bp is the promoter, and the rest is the
expression region) locates
on rice chromosome 2. Through bioinformatic analysis, it was found that rice
Ubiquitin2
(hereinafter referred to as UBI2) gene (as shown in SEQ ID NO: 5, in which 1-
2107bp was the
promoter, and the rest was the expression region) locates about 338 kb
downstream of HPPD
gene, and the UBI2 gene and the HPPD gene were in the same direction on the
chromosome.
According to the rice gene expression profile data provided by the
International Rice Genome
Sequencing Project (http://rice.plantbiology.msu.edu/index.shtml), the
expression intensity of the
UBI2 gene in rice leaves was 3 to 10 times higher than that of the HPPD gene,
and the UBI2 gene
promoter was a strong constitutively expressed promoter.
As shown in Figure 1, Scheme 1 shows that double-strand breaks were
simultaneously
generated at the sites between the promoters and the CDS region of the HPPD
and UBI2 genes
respectively, the event of doubling the region between the two breaks were
obtained after
screening and identification, and a new gene could be formed by fusing the
promoter of UBI2
and the coding region of HPPD together. In addition, according to Scheme 2 as
shown in Figure 1,
a new gene in which the promoter of UBI2 and the coding region of HPPD were
fused could also
be formed by two consecutive inversions. First, the schemes as shown in Figure
1 were tested in
the rice protoplast system as follows:
152
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
1. Firstly, the genomic DNA sequencesof the rice HPPD and UBI2 geneswere input
into the
CRISPOR online tool (http://crispor.tefor.net/) to search for available
editing target sites. After
online scoring, the following target sites between the promoters and the CDS
regions of HPPD
and UBI2 genes were selected for testing:
0 sHPPD-gui d e RNA1 GTGCTGGTTGCCTTGGCTGC
0 sHPPD-gui d e RNA2 CACAAATTCACCAGCAGCCA
0 sHPPD-gui d e RNA3 TAAGAACTAGCACAAGATTA
0 sHPPD-gui d e RNA4 GAAATAATC AC CAAAC AGAT
The guide RNA1 and guide RNA2 located between the promoter and the CDS region
of the
HPPD gene, close to the start codon of the HPPD protein, and the guide RNA3
and guide RNA4
located between the promoter and CDS region of the UBI2 gene, close to the
UBI2 protein
initiation codon.
pHUE411 vector (https://www.addgene.org/62203/) is used as the backbone, and
the
following primers were designed for the above-mentioned target sites to
perform vector
construction as described in "Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu
B, Wang XC,
Chen QJ. A CRISPR/Cas9 Toolkit for multiplex genome editing in plants. BMC
Plant Biol. 2014
Nov 29; 14(1): 327".
Primer No. DNA sequence (5 to 3')
OsHPPD-sgRN ATATGGTC T CGGGCGGTGC T GGTTGC C TT GGC T GCGT TTTAGAGC
Al -F TAGAAATAGCAAG
OsHPPD-sgRN ATATGGTC T CGGGCGC AC AAATT C ACCAGC AGC C AGT T TTAGAG
A2-F CTAGAAATAGCAAG
OsHPPD-sgRN TATTGGTCTCTAAACTAATCTTGTGCTAGTTCTTAGCTTCTTGGT
A3 -R GCCGCGC
OsHPPD-sgRN TATTGGTCTCTAAACATCTGTTTGGTGATTATTTCGCTTCTTGGTG
A4-R CCGCGC
gene editing vectors for the following dual-target combination were
constructed following
the method provided in the above-mentioned literature. Specifically, with the
pCBC-MT1T2
plasmid (https://www.addgene.org/50593/) as the template, sgRNA1+3, sgRNA1+4,
sgRNA2+3
and sgRNA2+4 double target fragments were amplified respectively for
constructing the sgRNA
expression cassettes. The vectorbackbone of pHUE411 was digested with BsaI,
and recovered
from the gel, and the target fragment was digested and directly used for the
ligation reaction. T4
DNA ligase was used to ligate the vector backbone and the target fragment, and
the ligation
product was transformed into Trans5a competent cells. Different monoclones
were picked and
sequenced The Sparkjade High Purity Plasmid Mini Extraction Kit was used to
extract plasmids
from the clones with correct sequences, thereby obtaining recombinant
plasmids, respectively
named as pQY002065, pQY002066, pQY002067, and pQY002068, as follows:
pQY002065 pHUE411-HPPD-sgRNA1+3 combination of OsHPPD-guide RNA1, guide RNA3
pQY002066 pHUE411-HPPD-sgRNA1+4 combination of OsHiPPD-guide RNA1, guide RNA4
pQY002067 pHUE411-HPPD-sgRNA2+3 combination of OsHPPD-guide RNA2, guide RNA3
pQY002068 pHUE411-HPPD-sgRNA2+4 combination of OsHPPD-guide RNA2, guide RNA4
153
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
2. Plasmids of high-purity and high-concentration were prepared for the above-
mentioned
pQY002065-002068 vectors as follows:
Plasmids were extracted with the Promega Medium Plasmid Extraction Kit
(Midipreps DNA
Purification System, Promega, A7640) according to the instructions. The
specific steps were:
(1) Adding 5 ml of Escherichia coli to 300 ml of liquid LB medium containing
kanamycin,
and shaking at 200 rpm, 37 C for 12 to 16 hours;
(2) Placing the above bacteria solution in a 500 ml centrifuge tube, and
centrifuging at 5,000
g for 10 minutes, discarding the supernatant;
(3) Adding 3 ml of Cell Resuspension Solution (CRS) to resuspend the cell
pellet and
vortexing for thorough mixing;
(4) Adding 3 ml of Cell Lysis Solution (CLS) and mixing up and down slowly for
no more
than 5 minutes;
(5) Adding 3 ml of Neutralization Solution and mixed well by overturning until
the color
become clear and transparent;
(6) Centrifuging at 14,000g for 15 minutes, and further centrifuging for 15
minutes if
precipitate was not formed compact;
(7) Transferring the supernatant to a new 50 ml centrifuge tube, avoiding to
suck in white
precipitate into the centrifuge tube;
(8) Adding 10 ml of DNA purification resin (Purification Resin, shaken
vigorously before
use) and mixing well;
(9) Pouring the Resin/DNA mixture was poured into a filter column, and
treating by the
vacuum pump negative pressure method (0.05 MPa);
(10) Adding 15 ml of Column Wash Solution (CWS) to the filter column, and
vacuuming.
(11) Adding 15 ml of CWS, and repeating vacuuming once; vacuuming was extended
for 30
s after the whole solution passed through the filter column;
(12) Cutting off the filter column, transferring to a 1.5 ml centrifuge tube,
centrifuging at
12,000 g for 2 minutes, removing residual liquid, and transferring the filter
column to a new 1.5
ml centrifuge tube;
(13) Adding 200 pL of sterilized water preheated to 70 C, and keeping rest for
2 minutes;
(14) Centrifuging at 12,000 g for 2 minutes to elute the plasmid DNA; and the
concentration
was generally about 1 pg/pL.
3. Preparing rice protoplasts and performing PEG-mediated transformation:
First, rice seedlings for protoplasts were prepared, which is of the variety
Nipponbare. The
seeds were provided by the Weeds Department of the School of Plant Protection,
China
Agricultural University, and expanded in house. The rice seeds were hulled
first, and the hulled
seeds were rinsed with 75% ethanol for 1 minute, treated with 5% (v/v) sodium
hypochlorite for
20 minutes, then washed with sterile water for more than 5 times. After blow-
drying in an
ultra-clean table, they were placed in a tissue culture bottle containing 1/2
MS medium, 20 seeds
for each bottle. Protoplasts were prepared by incubating at 26 C for about 10
days with 12 hours
light.
The methods for rice protoplast preparation and PEG-mediated transformation
were
conducted according to "Lin et al., 2018 Application of protoplast technology
to CRISPR/Cas9
154
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
mutagenesis: from single-cell mutation detection to mutant plant regeneration.
Plant
Biotechnology Journal https://doi.org /10.1111/pbi.12870". The steps were as
follows:
(1) the leaf sheath of the seedlings was selected, cut into pieces of about 1
mm with a sharp
Geely razor blade, and placed in 0.6 M mannitol and MES culture medium
(formulation: 0.6 M
mannitol, 0.4 M MES, pH 5.7) for later use. All materials were cut and
transferred to 20 ml of
enzymatic hydrolysis solution (formulation: 1.5% Cellulase R10/RS (YaKult
Honsha), 0.5%
Mecerozyme R10 (YaKult Honsha), 0.5M mannitol, 20mM KC1, 20mM MES, pH 5.7,
10mM
CaCl2, 0.1% BSA, 5 mM 13-mercaptoethanol), wrapped in tin foil and placed in a
28 C shaker,
enzymatically hydrolyzed at 50 rpm in the dark for about 4 hours, and the
speed was increased to
100 rpm in the last 2 minutes;
(2) after the enzymatic lysis, an equal volume of W5 solution (formulation:
154mM NaCl,
125mM CaCl2, 5mM KC1, 15mM IVIES) was added, shaken horizontally for 10
seconds to release
the protoplasts. The cells after enzymatic lysis were filtered through a 300-
mesh sieve and
centrifuged at 150 g for 5 minutes to collect protoplasts;
(3) the cells were rinsed twice with the W5 solution, and the protoplasts were
collected by
centrifugation at 150 g for 5 minutes;
(4) the protoplasts were resuspended with an appropriate amount of MMG
solution
(formulation: 3.05g/L MgCl2, lg/L MES, 91.2g/L mannitol), and the
concentration of the
protoplasts was about 2x 106 cell s/mL.
The transformation of protoplasts was carried out as follows:
(1) to 200 RL of the aforementioned Mi1VIG resuspended protoplasts, endotoxin-
free plasmid
DNA of high quality (10-20m) was added and tapped to mix well;
(2) an equal volume of 40% (w/v) PEG solution (formulation: 40% (w/v) PEG,
0.5M
mannitol, 100mM CaCl2) was added, tapped to mix well, and kept rest at 28 C in
the dark for 15
minutes;
(3) after the induction of transformation, 1.5 ml of W5 solution was added
slowly, tapped to
mix the cells well. The cells were collected by centrifugation at 150 g for 3
minutes. This step
was repeated once;
(4) 1.5 ml of W5 solution was added to resuspend the cells, and placed in a 28
C incubator
and cultured in the dark for 12-16 hours. For extracting protoplast genomic
DNA, the cultivation
should be carried out for 48-60 hours.
4. Genome targeting and detecting new gene:
(1) First, protoplast DNAs were extracted by the CTAB method with some
modifications.
The specific method was as follows: the protoplasts were centrifuged, then the
supernatant was
discarded. 500 iaL of DNA extracting solution (formulation: CTAB 20g/L, NaCl
81.82g/L,
100mM Tris-HC1 (pH 8.0), 20 mM EDTA, 0.2% 13-mercaptoethanol) was added,
shaken to mix
well, and incubated in a 65 C water bath for 1 hour; when the incubated sample
was cooled, 500
of chloroform was added and mixed upside down and centrifuged at 10,000 rpm
for 10
minutes; 400 tL of the supernatant was transferred to a new 1.5 ml centrifuge
tube, 1 ml of 70%
(v/v) ethanol was added and the mixture was kept at -20 C for precipitating
for 20 minutes; the
mixture was centrifuged at 12,000 rpm for 15 minutes to precipitate the DNA;
after the
precipitate was air dried, 50 [IL of ultrapure water was added and stored at -
20 C for later use.
155
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
(2) The detection primers in the following table were used to amplify the
fragments
containing the target sites on both sides or the predicted fragmentsresulting
from the fusion of the
UBI2 promoter and the HPPD coding region. The lengths of the PCR products were
between
300-1000 bp, in which the primer8-F + primer6-R combination was used to detect
the fusion
fragment at the middle joint after the doubling of the chromosome fragment,
and the product
length was expected to be 630bp.
Primer Sequence (5' to 3')
OsHPPDduplicated-primerl-F CACTACCATCCATCCATTTGC
OsHPPDduplicated-primer6-R GAGTTCCCCGTGGAGAGGT
OsHPPDduplicated-primer3-F TCCATTACTACTCTCCCCGATT
OsHPPDduplicated-primer7-R GTGTGGGGGAGTGGATGAC
OsHPPDduplicated-primer5-F TGTAGCTTGTGCGTTTCGAT
OsHPPDduplicated-primer2-R
GGGATGCCCTCTTTGTCC
OsHPPDduplicated-primer8-F TCTGTGTGAAGATTATTGCCACT
OsHPPDduplicated-primer4-R GGGATGCCCTCCTTATCTTG
The PCR reaction system was as follows:
Components Volume
2 x IS buffer solution 5 1_,
Forward primer (10 M) 2 I.
Reverse primer (10 M) 2 1_,
Template DNA 2 I.
Ultrapure water Added to
50 litt
(3) A PCR reaction was conducted under the following general reaction
conditions:
Step Temperature Time
Denaturation 98 C 30 s
98 C 15s
Amplification for 30-35 cycles 58 C 15 s
72 C 30s
Final extension 72 C 3 min
Finished 16 C 5min
(4) The PCR reaction products were detected by 1% agarose gel electrophoresis.
The results
showed that the 630 bp positive band for the predicted fusion fragment of the
UBI2 promoter and
the HPPD coding region could be detected in the pQY002066 and pQY002068
transformed
samples.
5. The positive samples of the fusion fragment of the UBI2 promoter and the
HPPD coding
region were sequenced for verification, and the OsHPPDduplicated-primer8-F and
OsHPPDduplicated-primer6-R primers were used to sequence from both ends. As
shown in
Figure 5, the promoterof the UBI2 gene and the expression region of the HPPD
gene could be
directly ligated, and the editing event of the fusion of the promoter of rice
UBI2 gene and the
expression region of the HPPD gene could be detected in the protoplast genomic
DNA of the rice
transformed with pQY002066 and pQY002068 plasmids, indicating that the scheme
of doubling
the chromosome fragments to form a new HPPD gene was feasible, a new HPPD gene
which
156
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
expression was driven by a strong promoter could be created, and this was
defined as an HPPD
doubling event. The sequencing result of the pQY002066 vector transformed
protoplast for
testing HPPD doubling event was shown in SEQ ID NO: 9; and the sequencing
result of the
pQY002068 vector transformed protoplast for testing HPPD doubling event was
shown in SEQ
ID NO: 10.
Example 2: Creation of herbicide-resistant rice with knock-up expression of
endogenous HPPD gene by chromosome fragment doubling through
Agrobacterium-mediated transformation
1. Construction of knock-up editing vector: Based on the results of the
protoplast test in
Example 1, the dual-target combination OsHPPD-guide
RNAl:
5'GTGCTGGTTGCCTTGGCTGC3' and OsHPPD-guide
RNA4:
5'GAAATAATCACCAAACAGAT3' with a high editing efficiency was selected. The
Agrobacterium transformation vector pQY2091 was constructed according to
Example 1.
pHUE411 was used as the vector backbone and subjected to rice codon
optimization. The map of
the vector was shown in FIGURE 6.
2. Agrobacterium transformation of rice callus:
1) Agrobacterium transformation: lm of the rice knock-up editing vector
pQY2091 plasmid
was added to 100 of Agrobacterium EHA105 heat-shock competent cells (Angyu
Biotech,
Catalog No. G6040), placed on ice for 5 minutes, immersed in liquid nitrogen
for quick freezing
for 5 minutes, then removed and heated at 37 C for 5 minutes, and finally
placed on ice for 5
minutes. 500111 of YEB liquid medium (formulation: yeast extract lg/L, peptone
5g/L, beef
extract 5g/L, sucrose 5g/L, magnesium sulfate 0.5g/L) was added. The mixture
was placed in a
shaker and incubated at 28 C, 200 rpm for 2-3 hours; the bacteria were
collected by
centrifugation at 3500 rpm for 30 seconds, the collected bacteria were spread
on YEB
(kanamycin 50 mg/L + rifampicin 25 mg/L) plate, and incubated for 2 days in an
incubator at
28 C; the single colonies were picked and placed into liquid culture medium,
and the bacteria
were stored at -80 C.
2) Cultivation of Agrobacterium: The single colonies of the transformed
Agrobacterium on
the YEB plate was picked,added into 20 ml of YEB liquid medium (kanamycin 50
mg/L +
rifampicin 25 mg/L), and cultured while stirring at 28 C until the 0D600 was
0.5, then the
bacteria cells were collected by centrifugation at 5000 rpm for 10 minutes, 20-
40 ml of AAM
(Solarbio, lot number LA8580) liquid medium was added to resuspend the
bacterial cells to reach
0D600 of 0.2-0.3, and then acetosyringone (Solarbio, article number A8110) was
added to reach
the final concentration of 20011M for infecting the callus.
3) Induction of rice callus: The varieties of the transformation recipient
rice were Huaidao 5
and Jinjing 818, purchased from the seed market in Huai'an, Jiangsu, and
expanded in house.
800-2000 clean rice seeds were hulled, then washed with sterile water until
the water was clear
after washing. Then the seeds were disinfected with 70% alcohol for 30
seconds, then 30 ml of
5% sodium hypochlorite was added and the mixture was placed on a horizontal
shaker and
shaken at 50 rpm for 20 minutes, then washed with sterile water for 5 times.
The seeds were
placed on sterile absorbent paper, air-dried to remove the water on the
surface of the seeds,
inoculated on an induction medium and cultivated at 28 C to obtain callus.
157
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
The formulation of the induction medium: 4.1g/L N6 powder + 0.3 g/L hydrolyzed
casein +
2.878 g/L proline + 2 mg/L 2,4-D + 3% sucrose + 0.1g/L inositol + 0.5 g
glutamine + 0.45%
phytagel, pH 5.8.
4) Infection of rice callus with Agrobacterium: The callus of Huaidao No. 5 or
Jinjing 818
subcultured for 10 days with a diameter of 3 mm was selected and collected
into a 50 ml
centrifuge tube; the resuspension solution of the Agrobacterium AAM with the
0D600 adjusted
to 0.2-0.3 was poured into the centrifuge tube containing the callus, placed
in a shaker at 28 C at
a speed of 200 rpm to perform infection for 20 minutes; when the infection was
completed, the
bacteria solution was discarded, the callus was placed on sterile filter paper
and air-dried for
about 20 minutes, then placed on a plate containing co-cultivation medium to
perform
co-cultivation, on which the plate was covered with a sterile filter paper
soaked with AAM liquid
medium containing 100 jiM acetosyringone; after 3 days of co-cultivation, the
Agrobacterium
was removed by washing (firstly washing with sterile water for 5 times, then
washing with
500mg/L cephalosporin antibiotic for 20 minutes), and selective cultured on
50mg/L hygromycin
selection medium.
The formulation of the co-cultivation medium: 4.1g/L N6 powder + 0.3 g/L
hydrolyzed
casein + 0.5 g/L proline + 2 mg/L 2,4-D + 200 1.1M AS + 10 g/L glucose + 3%
Sucrose + 0.45%
phytagel, pH 5.5.
3. Molecular identification and differentiation into seedlings of hygromycin
resistant callus:
Different from the selection process of conventional rice transformation, with
specific
primers of the fusion fragments generated after the chromosome fragment
doubling,
hygromycin resistant callus could be molecularly identified during the callus
selection and culture
stage in the present invention, positive doubling events could be determined,
and callus
containing new genes resulting from fusion of different gene elements was
selected for
differentiation cultivation and induced to emerge seedlings. The specific
steps were as follows:
1) The co-cultured callus was transferred to the selection medium for the
first round of
selection (2 weeks). The formulation of the selection medium is: 4.1g/L N6
powder + 0.3 g/L
hydrolyzed casein + 2.878 g/L proline + 2 mg/L 2,4-D + 3% sucrose + 0.5g
glutamine + 30 mg/L
hygromycin (HYG) + 500 mg/L cephalosporin (cef) + 0.1 g/L inositol + 0.45%
phytagel, pH 5.8.
2) After the first round of selection was completed, the newly grown callus
was transferred
into a new selection medium for the second round of selection (2 weeks). At
this stage, the newly
grown callus with a diameter greater than 3 mm was clamped by tweezers to take
a small amount
of sample, the DNA thereof was extracted with the CTAB method described in
Example 1 for the
first round of molecular identification. In this example, the primer pair of
OsHPPDduplicated-primer8-F (8F) and OsHPPD duplicated-primer6-R (6R) was
selected to
perform PCR identification for the callus transformed with the pQY2091 vector,
in which the
reaction system and reaction conditions were similar to those of Example
1.Among the total of
350 calli tested, no positive sample was detected in the calliof Huaidao 5,
while 28 positive
samples were detected in the calli of Jinjing 818.The PCR detection results of
some calli were
shown in Figure 7.
3) The calli identified as positive by PCR were transferred to a new selection
medium for the
third round of selection and expanding cultivation; after the diameter of the
calli was greater than
158
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
mm, the callus in the expanding cultivation was subjected to the second round
of molecular
identification using 8F+6R primer pair, the yellow-white callus at good growth
status that was
identified as positive in the second round was transferred to a
differentiation medium to perform
differentiation, and the seedlings of about 1 cm could be obtained after 3 to
4 weeks; the
differentiated seedlings were transferred to a rooting medium for rooting
cultivation, after the
seedlings of the rooting cultivation were subjected to hardening off, they
were transferred to a
flowerpot with soil and placed in a greenhouse for cultivation. The
formulation of the
differentiation medium is: 4.42g/L MS powder + 0.5 g/L hydrolyzed casein + 0.2
mg/L NAA + 2
mg/L KT + 3% sucrose+ 3% sorbito1+30 mg/L hygromycin + 0.1 g/L inositol +
0.45% phytagel,
pH 5.8. The formulation of the rooting medium is: 2.3g/L MS powder + 3%
sucrose + 0.45%
phytagel.
4. Molecular detection of HPPD doubling seedlings (TO generation):
After the second round of molecular identification, 29 doubling event-positive
calli were
co-differentiated to obtain 403 seedlings of TO generation, and the 8F+6R
primer pair was used
for the third round of molecular identification of the 403 seedlings, among
which 56 had positive
bands.The positive seedlings were moved into a greenhouse for cultivation.The
PCR detection
results of some TO seedlings were shown in Figure 8.
5. HPPD inhibitory herbicide resistance test for HPPD doubled seedlings (TO
generation):
The transformation seedlings of TO generation identified as doubling event
positive were
transplanted into large plastic buckets in the greenhouse for expanding
propagation to obtain
seeds of Ti generation. After the seedlings began to tiller, the tillers were
taken from vigorously
growing strains, and planted in the same pots with the tillers of the wild-
type control varieties at
the same growth period. After the plant height reached about 20 cm, the
herbicide resistance test
was conducted. The herbicide used was Bipyrazone (CAS No. 1622908-18-2)
produced by our
company, and its field dosage was usually 4 grams of active ingredients per mu
(4g a.i./mu). In
this experiment, Bipyrazone was applied at adosage gradient of 2g a.i./mu, 4g
a.i./mu, 8g a.i./mu
and 32g a.i./muwith a walk-in spray tower.
The resistance test results were shown in Figure 9. After 5-7 days of the
application, the
wild-type control rice seedlings began to show albino, while the strains of
the HPPD doubling
events all remained normally green. After 4 weeks of the application, the wild-
type rice seedlings
were close to death, while the strains of the doubling events all continued to
remain green and
grew normally. The test results showed that the HPPD gene-doubled strains had
a significantly
improved tolerance to Bipyrazone.
6. Quantitative detection of the relative expression of the HPPD gene in the
HPPD doubled
seedlings (TO generation):
It was speculated that the improved resistance of the HPPD gene doubled strain
to
Bipyrazone was due to the fusion of the strong promoter of UBI2 and the HPPD
gene CDS that
increased the expression of HPPD, so the TO generation strains QY2091-13 and
QY2091-20 were
used to take samples from the primary tillers and the secondary tillers used
for herbicide
resistance test to detect the expression levels of the HPPD and UBI2 genes,
respectively, with the
wild-type Jinjing 818 as the control. The specific steps were as follows:
1) Extraction of total RNA (Trizol method):
159
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
0.1-0.3g of fresh leaves were taken and ground into powder in liquid nitrogen.
lml of Trizol
reagent was added for every 50-100mg of tissue for lysis; the Trizol lysate of
the above tissue
was transferred into a 1.5m1 centrifuge tube, stood at room temperature (15-
30 C) for 5 minutes;
chloroform was added in an amount of 0.2m1 per lml of Trizol; the centrifuge
tube was capped,
shaken vigorously in hand for 15 seconds, stood at room temperature (15-30 C)
for 2-3 minutes,
then centrifuged at 12000g (4 C) for 15 minutes; the upper aqueous phase was
removed and
placed in a new centrifuge tube, isopropanol was added in an amount of 0.5 ml
per 1 ml of Trizol,
the mixture was kept at room temperature (15-30 C) for 10 minutes, then
centrifuged at 12000g
(2-8 C) for 10 minutes; the supernatant was discarded, and 75% ethanol was
added to the pellet
in an amount of lml per lml of Trizol for washing. The mixture was vortexed,
and centrifuged at
7500g (2-8 C) for 5 minutes. The supernatant was discarded; the precipitated
RNA was dried
naturally at room temperature for 30 minutes; the RNA precipitate was
dissolved by 50 [El of
RNase-free water, and stored in the refrigerator at -80 C after
electrophoresis analysis and
concentration determination.
2) RNA electrophoresis analysis:
An agarose gel at a concentration of 1% was prepared, then 1 pi of the RNA was
taken and
mixed with 1 tl of 2X Loading Buffer. The mixture was loaded on the gel. The
voltage was set to
180V and the time for electrophoresis was 12 minutes. After the
electrophoresis was completed,
the agarose gel was taken out, and the locations and brightness of fragments
were observed with a
UV gel imaging system.
3) RNA purity detection:
The RNA concentration was measured with a microprotein nucleic acid analyzer.
RNA with
a good purity had an 0D260/0D280 value between 1.8-2.1. The value lower than
1.8 indicated
serious protein contamination, and higher than 2.1 indicated serious RNA
degradation.
4) Real-time fluorescence quantitative PCR
The extracted total RNA was reverse transcribed into cDNA with a special
reverse
transcription kit. The main procedure comprised: first determining the
concentration of the
extracted total RNA, and a portion of 1-4 vg of RNA was used for synthesizing
cDNA by reverse
transcriptase synthesis. The resulting cDNA was stored at -20 C.
CAsolution of the RNA template was prepared on ice as set forth in the
following table and
subjected to denaturation and annealing reaction in a PCR instrument. This
process was
conducive to the denaturation of the RNA template and the specific annealing
of primers and
templates, thereby improving the efficiency of reverse transcription.
Table 1: Reverse transcription, denaturation and annealing reaction system
Component Amounts (al)
Oligo dT primer (50.t.M) 1 IA
dNTP mixture (10mM each) 1
RNA Template 1-4 lag
RNase free water Added to 10 tL
Reaction conditions for denaturation and annealing:
65 C 5 min
160
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
4 C 5 min
The reverse transcription reaction system was prepared as set forth in Table
2for
synthesizing cDNA:
Table 2: Reverse transcription reaction system
Component Amount (il)
Reaction solution after the above denaturation and annealing 10 tl
5X RTase Plus Reaction Buffer 4 pi
RNase Inhibitor 0.5 pi
Evo M-MLV Plus RTase (200 U/Ial ) 1 jtl
RNase free water Added to 20 !.IL
Reaction conditions for cDNA synthesis:
42 C 60 min
95 C 5 min
The UBQ5 gene of rice was selected as the internal reference gene, and the
synthesized
cDNA was used as the template to perform fluorescence quantitative PCR. The
primers listed in
Table 3 were used to prepare the reaction solution according to Table 4.
Table 3: Sequence 5'-3' of the primer for Fluorescence quantitative PCR
UBQ5-F ACCACTTCGACCGCCACTACT
UBQ5-R ACGCCTAAGCCTGCTGGTT
RT-OsHPPD-F CAGATCTTCACCAAGCCAGTAG
RT-OsHPPD-R GAGAAGTTGCCCTTCCCAAA
RT-OsUbi2-F CCTCCGTGGTGGTCAGTAAT
RT-OsUbi2-R GAACAGAGGCTCGGGACG
Table 4: Reaction solution for real-time quantitative PCR (Real Time PCR)
Component of mixture Amount (11)
SYBR Premix ExTaq II 5
Forward primer (10[iM) 0.2 jtl
Reverse primer (101AM) 0.2
cDNA 1 il
Rox II 0.2p1
Ultrapure water 3.4 jtl
In total 10 pi
0 The reaction was performed following the real-time quantitative PCR reaction
steps in
Table 5. The reaction was conducted for 40 cycles.
Table 5: Real-time quantitative PCR reaction steps
Temperature ( C) Time
50 C 2 min
95 C 10 min
161
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
95 C 15 s
60 C 20 s
95 C 15 s
60 C 20 s
95 C 15 s
5) Data processing and experimental results
As shown in Table 6, UBQ5 was used as an internal reference, ACt was
calculated by
subtracting the Ct value of 1.JBQ5from the Ct value of the target gene, and
then 2-Act was
calculated, which represented the relative expression level of the target
gene. The 818CK1 and
818CK3 were two wild-type Jinjing 818 control plants; 13M and 20M represented
the primary
tiller leaf samples of QY2091-13 and QY2091-20 TO plants; 13L and 20L
represented the
secondary tiller leaf samples of QY2091-13 and QY2091-20 TO plants used for
herbicide
resistance testing.
Table 6: Ct values and relative expressionfolds of different genes
UBQ5 Mean UBI2 ACt 2-Act Mean HPPD ACt 2-Act Mean
23.27 17.56 -5.88 58.95 20.81 -2.63 6.20
23.55 17.71 -5.73 53.09 21.01 -2.43 5.40
818CK1 23.51 23.44 17.66 -5.78 55.06 55.70 20.98 -2.47 5.52 5.71
23.45 17.88 -5.50 45.20 20.93 -2.44 5.43
23.19 17.94 -5.44 43.41 21.13 -2.24 4.74
818CK3 23.49 23.37 17.72 -5.65 50.26 46.29 21.14 -2.24 4.72 4.96
24.61 19.56 -4.92 30.32 2023. -4.25 19.07
24.27 19.52 -4.96 31.05 20.29 -4.19 18.28
13M 24.56 24.48 19.16 -5.32 39.97 33.78 20.48 -4.00 15.99 17.78
23.98 18.76 -5.20 36.70 19.02 -4.94 30.64
23.89 18.52 -5.43 43.19 19.07 -4.89 29.56
13L 24.00 23.96 18.81 -5.14 35.34 38.41 19.07 -4.88 29.45 29.88
24.34 19.01 -5.40 42.30 19.37 -5.04 32.98
24.41 19.07 -5.34 40.64 1933. -5.09 34.05
20M 24.49 24.41 19.29 -5.13 35.00 39.32 19.26 -5.16 35.65 34.22
24.63 19.46 -5.11 34.52 19.88 -4.69 25.83
24.67 19.38 -5.19 36.48 19.91 -4.66 25.31
20L 24.41 24.57 19.42 -5.15 35.61 35.54 19.86 -4.71 26.16 25.77
The results were shown in Figure 10.The rice UBQ5 was used as an internal
reference gene
to calculate the relative expression levels of the OsHPPD and UBI2 genes. The
results showed
that the HPPD expression level of the HPPD doubled strain was significantly
higher than that of
the wild type, indicating that the fused UBI2 strong promoter did increase the
expression level of
HPPD, thereby creating a highly-expressing HPPD gene, with the HPPD gene
knocked up. The
slight decrease in the expression level of UBI2 could be due to the small-
scale mutations
resulting from the edition of the promoter region, and we had indeed detected
base insertions,
deletions or small fragment deletions at the UBI2 target site. Compared with
the wild type, the
162
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
expression levels of UBI2 and HPPD significantly tended to be consistent and
met the oretical
expectations; among them, the HPPD expression level of the 20M sample was
about 6 times
higher than that of the wild type CK3 group.
The above results proved that, following the effective chromosome fragment
doubling
program as tested in protoplasts, calli and transformed seedlings with
doubling events could be
selected by multiple rounds of molecular identification during
theAgrobacterium transformation
and tissue culturing, and the UBI2 strong promoter in the new HPPD gene fusion
generated in the
transformed seedlings did increase the expression level of HPPD gene,
rendering the plants to get
resistance to HPPD inhibitory herbicideBipyrazone, up to 8 times the field
dose, and thus a
herbicide-resistant rice with knock-up endogenous HPPD gene was created.
Taking this as an
example, using the chromosome fragment doubling technical solution of Example
1 and Example
2, a desired promoter could also be introduced into an endogenous gene which
gene expression
pattern should be changed to create a new gene, and a new variety of plants
with desired gene
expression pattern could be created through Agrobacterium-mediated
transformation.
Example 3: Molecular detection and herbicide resistance test of Ti generation
of
herbicide-resistant rice strain with knock-up expression of the endogenous
HPPD gene
caused by chromosome fragment doubling
The physical distance between the HPPD gene and the UBI2 gene in the wild-type
rice
genome was 338 kb, as shown in Scheme 1 in Figure 1.The length of the
chromosome was
increased by 338 kb after the chromosome fragment between them was doubled by
duplication,
and a highly-expressing new HPPD gene was generated with a UBI2 promoter at
the joint of the
duplicated fragment to drive the expression of the HPPD CDS region. In order
to determine
whether the new gene could be inherited stably and the effect of the doubling
chromosome
fragment on the genetic stability, molecular detection and herbicide
resistance test was conducted
for the Ti generation of the HPPD doubled strains.
First of all, it was observed that the doubling event had no significant
effect on the fertility
of TO generation plants, as all positive TO strains were able to produce
normal seeds. Planting test
of Ti generation seedlings were further conducted for the QY2091-13 and QY2091-
20 strains.
1. Sample preparation:
For QY2091-13, a total of 36 Ti seedlings were planted, among which 27 grew
normally
and 9 were albino. 32 were selected for DNA extraction and detection, where
No.1-24 were
normal seedlings, and No.25-32 were albino seedlings.
For QY2091-20, a total of 44 Ti seedlings were planted, among which 33 grew
normally
and 11 were albino. 40 were selected for DNA extraction and detection, where
No.1-32 were
normal seedlings, and No.33-40 were albino seedlings.
Albino seedlings were observed in the Ti generation plants. It was speculated
that, since
HPPD was a key enzyme in the chlorophyll synthesis pathway of plants, and the
TO generation
plants resulting from the dual-target edition possibly could be chimeras of
many genotypes such
as doubling, deletion, inversion of chromosome fragments, or small fragment
mutation at the
edited target site.The albino phenotype could be generated in the plants where
the HPPD gene
was destroyed, for example, the HPPD CDS region was deleted. Different primer
pairs were
designed for PCR to determine possible genotypes.
163
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
2. PCR molecular identification:
1) Sequences ofdetection primers: sequence 5'-3'
Primer 8F: TCTGTGTGAAGATTATTGCCACTAGTTC
Primer 6R: GAGTTCCCCGTGGAGAGGT
Test 141-F: CCCCTTCCCTCTAAAAATCAGAACAG
Primer 4R: GGGATGCCCTCCTTATCTTGGATC
Primer 3F: CCTCCATTACTACTCTCCCCGATTC
Primer 7R: GTGTGGGGGAGTGGATGACAG
pg-Hyg-Rl : TCGTCCATCACAGTTTGCCA
pg-35S-F: TGACGTAAGGGATGACGCAC
2) The binding sites of the above primers were shown in Figure 11. Among them,
the Primer
8F + Primer 6R were used to detect the fusion fragment of the UBI2 promoter
and the HPPD
CDS after the chromosome fragment doubling, and the length of the product was
630 bp; the Test
141-F + Primer 4R were used to detect chromosome fragment deletion event, and
the length of
the product was 222bp; and the pg-Hyg-R1+ pg-355-F were used to detect the T-
DNA fragment
of the editing vector, and the lengthof the product was 660bp.
3) PCR reaction system, reaction procedure and gel electrophoresis detection
were
performed according to Example 1.
3. Molecular detection results:
The detection results of doubling and deletion events were shown in Table 7.
It could be
noted that the chromosome fragment doubling events and deletion events were
observed in the Ti
generation plants, with different rations among different lines. The doubling
events in the
QY2091-13 (29/32)were higher than that in the QY2091-20 (21/40), possibly due
to the different
chimeric ratios in the TO generation plants. The test results indicated that
the fusion gene
generated by the doubling was heritable.
Table 7: Detection results of doubling and deletion events
QY2091-20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Doubling + - - - + + + - - - + -----+ + + -
Deletion -----+ - - + - - + - - ----- -
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Doubling - + - - + - + + + - + + + - + + + + + -
Deletion - - + + - + - - - + + - + - + - - - - +
QY2091-13 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Doubling + - + + + + + - + + + + + + + + + + + +
Deletion - + - + + + - + - - + --------+
21 22 23 24 25 26 27 28 29 30 31 32
Doubling - + + + + + + + + + + +
Deletion - - + - - + - - + + - +
The pg-Hyg-R1+ pg-35S-F primers were used to detectthe T -DNA fragmentof the
editing
vector for the above Ti seedlings. The electrophoresis results of the PCR
products of
QY2091-20-17 and QY2091-13-7 were negative for the T-DNA fragment, indicating
that it was a
164
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
homozygous doubling. It could be seen that doubling-homozygous non-transgenic
strains could
be segregated from the Ti generationof the doubling events.
4. Detection of editing events by sequencing:
The doubling fusion fragments were sequenced for the doubling-homozygous
positive Ti
generation samples 1, 5, 7, 11, 18 and 19 for QY2091-20 and for the doubling-
homozygous
positive Ti samples 1, 3, 7, 9, 10 and 12 for QY2091-13.The left target site
of the HPPD gene
and the right target site of the UBI2 were amplified at the same time for
sequencing to detect the
editing events at the target sites. Among them, the Primer 3F + Primer 7R were
used to detect the
editing event of the left HPPD target site, where the wild-type control
product was 48 lbp in
length; the Primer 8F+Primer 4R were used to detect the editing event of the
right UBI2 target
site, where the wild-type control product was 329bp in length.
1) Genotype of the doubling events:
The sequencing result of the HPPD doubling in QY2091-13 was shown in SEQ ID
NO: 18,
and the sequencing result of the HPPD doubling in QY2091-20 was shown in SEQ
ID NO: 19,
see Figure 12. Compared with the predicted linker sequences of the doubling,
one T base was
inserted at the linker in QY2091-13, 19 bases were deleted from the linker in
QY2091-20, and
both of the insertion and deletion occurred in the promoter region of UBI2 and
had no effect on
the coding region of the I-113PD protein. From the detection results on the
expression levels of the
HPPD gene in Example 2, it can be seen that the expression levels of these new
HPPD genes
where the UBI2 promoters were fused to the HPPD CDS region was significantly
increased.
2) Editing events at the original HPPD and UBI2 target sites on both sides:
There were more types of editing events at the target sites on both sides. In
two lines, three
editing types occurred in the HPPD promoter region, namely insertion of single
base, deletion of
17 bases, and deletion of 16 bases; and two editing types occurred in the UBI2
promoter region,
namely insertion of 7 bases and deletion of 3 bases. The Ti plants used for
testing and sampling
were all green seedlings and grew normally, indicating that small-scale
mutations in these
promoter regions had no significant effect on gene function, and herbicide-
resistant rice varieties
could be selected from their offspring.
5. Herbicide resistance test on seedlings of Ti generation:
The herbicide resistance of the Ti generation of the QY2091 HPPD doubled
strain was
tested at the seedling stage. After the Ti generation seeds were subjected to
surface disinfection,
they germinated on 1/2 MS medium containing 1.211M Bipyrazone, and cultivated
at 28 C, 16
hours light/8 hours dark, in which wild-type Jinjing 818 was used as a
control.
The test results of resistance were shown in Figure 13. After 10 days of
cultivation in light,
the wild-type control rice seedlings showed phenotypes of albinism and were
almost all albino,
while the lines of the HPPD doubling events QY2091-7, 13, 20, 22 showed
phenotype
segregation of chlorosis and green seedlings. According to the aforementioned
molecular
detection results, there was genotype segregation in the Ti generation.Albino
seedlings appeared
in the absence of herbicide treatment, while green seedlings continued to
remain green and grew
normally after the addition of 1.2 [iM Bipyrazone. The test results indicated
that the high
resistance to Bipyrazone of the HPPD gene-doubled lines could be stably
inherited to the Ti
generation.
165
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Example 4: An editing method for knocking up the expression of the endogenous
PPO
gene by inducing chromosome fragment inversion ¨ rice protoplast test
The rice PPO1 (also known as PPDX1) gene (as shown in SEQ ID NO: 7, in which
1-1065bp was the promoter, the rest was the coding region) was located on
chromosome 1, and
the calvin cycle protein CP12 gene (as shown in SEQ ID NO: ID NO: 8, in which
1-2088bp was
the promoter, and the rest was the coding region) was located 911kb downstream
of the PPO1
gene with opposite directions. According to the rice gene expression profile
data provided by the
International Rice Genome Sequencing Project
(http://rice.plantbiology.msu.edu/index.shtml),
the expression intensity of the CP12 gene in rice leaves was 50 times that of
the PPO1 gene, and
the CP12 gene promoter was a strong promoter highly expressing in leaves.
As shown in Scheme 1 of Figure 4, by simultaneously inducing double-strand
breaks
between the respective promoters and the CDS region of the two genes and
screening, the region
between the two breaks could be reversed, with the promoter of PPO1 gene
replaced with the
promoter of CP12 gene, increasing the expression level of the PPO1 gene and
achieving the
resistance to PPO inhibitory herbicides, thereby herbicide-resistant lines
could be selected. In
addition, as shown in Scheme 2 of Figure 4, a new gene of PPO1 driven by the
promoter of CP12
gene could also be created by first inversion and then doubling.
1. First, the rice PPO1 and CP12 genomic DNA sequences were input into the
CRISPOR
online tool (http://crispor.tefor.net/) to search for available editing target
sites. After online
scoring, the following target sites were selected between the promoters and
the CDS regions of
the PPO1 and CP12 genes for testing:
Name of target sgRNA Sequence (5' to 3)
OsPPO-guide RNA1 CCATGTCCGTCGCTGACGAG
OsPPO-guide RNA2 CC GC TC GTC AGC GAC GGACA
OsPPO-guide RNA3 GCCATGGCTGGCTGTTGATG
OsPPO-guide RNA4 C GGAT T TC T GC GT GT GATGT
The guide RNA1 and guide RNA2 located between the promoter and the CDS region
of the
PPO1 gene, close to the PPO1 start codon, and the guide RNA3 and guide RNA4
located
between the promoter and the CDS region of the CP12 gene, close to the CP12
start codon.
As described in Example 1, primers were designed for the above target sites to
construct
dual-target vectors, with pHUE411 as the backbone:
Primer No. DNA sequence (5' to 3')
0 sPP 0 1 -sgRN ATATGGTC TCGGGC GCC ATGTCCGTC GC T GACGAGGTT TTAGAGC
Al -F TAGAAATAGCAAG
0 sPP 0 1 -sgRN ATATGGTC TCGGGC GCC GC TC GTC AGC GAC GGACAGT TTTAGAG
A2-F CTAGAAATAGCAAG
OsPP01-sgRN TATTGGTCTCTAAACCATCAACAGCCAGCCATGGCGCTTCTTGGT
A3 -R GCCGCGCCTC
OsPP01-sgRN TATTGGTCTCTAAACACATCACACGCAGAAATCCGGCTTCTTGGT
A4-R GCCGCGCCTC
Specifically, the pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) was used
as the
template to amplify the sgRNA1+3, sgRNA1+4, sgRNA2+3, sgRNA2+4 dual-target
fragments
166
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
and construct sgRNA expression cassettes, respectively. The pHUE411 vector
backbone was
digested with BsaI and recovered from gel, and the target fragment was
directly used for the
ligation reaction after digestion. T4 DNA ligase was used to ligate the vector
backbone and the
target fragment, the ligation product was transformed into Trans5a competent
cells, different
monoclones were selected and sequenced. The Sparkjade High Purity Plasmid Mini
Extraction
Kit was used to extract plasmids with correct sequencing results, thereby
obtaining recombinant
plasmids, respectively named as pQY002095, pQY002096, pQY002097, pQY002098, as
shown
below:
pQY002095 pHUE411-PPO-sgRNA1+3 containing OsPPO-guide RNA1, guide RNA3
combination
pQY002096 pHUE411-PPO-sgRNA2+3 containing OsPPO-guide RNA2, guide RNA3
combination
pQY002097 pHUE411-PPO-sgRNA1+4 containing OsPPO-guide RNA1, guide RNA4
combination
pQY002098 pHUE411-PPO-sgRNA2+4 containing OsPPO-guide RNA2, guide RNA4
combination
2. Plasmids of high-purity and high-concentration were prepared for the above-
mentioned
pQY002095-002098 vectors as described in the step 2 of Example 1.
3. Rice protoplasts were prepared and subjected to PEG-mediated transformation
with the
above-mentioned vectors as described in step 3 of Example 1.
4. Genomic targeting and detection of new genewith the detection primers shown
in the
table below for the PCR detection as described in the step 4 of Example 1.
Primer Sequence (5' to 3')
0 sPPOi nversi on-checkF 1 (PPO-F 1)
GCTATGCCGTCGCTCTTTCTC
0 sPP Oi nversi on- ch eckF 2 (PPO-F2)
CGGACTTATTCCCACCAGAA
0 sPPOinversion-checkR1(PPO-R1)
GAGAAGGGGAGCAAGAAGACGT
0 sPP Oinversion-checkR2(PPO-R2)
AAGGCTGGAAGCTGTTGGG
0 sCPinversi on-checkF 1(CP-F 1)
CATTCCACCAAACTCCCCTCTG
0 sCP inversi on- ch eckF 2(CP -F2 )
AGGTCTCCTTGAGCTTGTCG
0 sCPinversi on-checkR1(CP-R1) GTCATCTGCTCATGTTTTCACGGTC
0 sCPinversi on-che ckR2(CP -R2) C
TGAGGAGGCGATAAGAAACGA
Among them, the combination of PPO-R2 and CP-R2 was used to amplify the CP12
promoter-driven PPO1 CDS new gene fragment that was generated on the right
side after
chromosome fragment inversion, and the combination of PPO-F2 and CP-F2 was
used to amplify
the PPO1 promoter-driven CPU CDS new gene fragment that was generated on the
left side after
inversion. The possible genotypes resulting from the dual-target editing and
the binding sites of
the molecular detection primers were shown in Figure 14.
5. The PCR and sequencing results showed that the expected new gene in which
the CP12
promoter drove the expression of PPO1 was created from the transformation of
rice protoplasts.
The editing event where the rice CP12 gene promoter was fused to the PPO1 gene
expression
region could be detected in the genomic DNA of the transformed rice
protoplasts. This indicated
that the scheme to form a new PPO gene through chromosome fragment inversion
was feasible,
167
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
and a new PPO gene driven by a strong promoter could be created, which was
defined as a PPO1
inversion event. The sequencing results for the chromosome fragment inversion
in protoplasts
transformed with the pQY002095 vector were shown in SEQ ID NO: 15; the
sequencing results
for the chromosome fragment deletion in protoplasts transformed with the
pQY002095 vector
were shown in SEQ ID NO: 16; and the sequencing results for the chromosome
fragment
inversion in protoplasts transformed with the pQY002098 vector were shown in
SEQ ID NO: 17.
Example 5: Creation of herbicide-resistant rice with knock-up expression of
the
endogenous PPO gene caused by chromosome fragment inversion through
Agrobacterium-mediated transformation
1. Construction of knock-up editing vector: Based on the results of the
protoplast testing, the
dual-target combination of OsPPO-guide RNAl: 5'CCATGTCCGTCGCTGACGAG3' and
OsPPO-guide RNA4: 5'CGGATTTCTGCGT-GTGATGT3' with high editing efficiency was
selected to construct the Agrobacterium transformation vector pQY2234. pHUE411
was used as
the vector backbone and the rice codon optimization was performed. The vector
map was shown
in Figure 16.
2. Agrobacterium transformed rice callus and two rounds of molecular
identification:
The pQY2234 plasmid was used to transform rice callus according to the method
described
in step 2 of Example 2. The recipient varieties were Huaidao No.5 and Jinjing
818. In the callus
selection stage, two rounds of molecular identification were performed on
hygromycin-resistant
callus, and the calli positive in inversion event were differentiated. During
the molecular
detection of callus, the amplification of the CP12 promoter-driven PPO1 CDS
new gene fragment
generated on the right side after chromosome fragment inversion by the
combination of PPO-R2
and CP-R2 was deemed as the positive standard for the inversion event, while
the CP12 new gene
generated on the left side after inversion was considered after
differentiation and seedling
emergence of the callus. A total of 734 calli from Huaidao No.5 were tested,
in which 24 calli
were positive for the inversion event, and 259 calli from Jinjing 818 were
tested, in which 29 calli
were positive for the inversion event. Figure 17 showed the PCR detection
results of Jinjing 818
calli No.192-259.
3. A total of 53 inversion event-positive calli were subjected to two rounds
of molecular
identification and then co-differentiated, and 9 doubling event-positive calli
were identified,
which were subjected to two rounds of molecular identification and then co-
differentiated to
produce 1,875 TO seedlings, in which 768 strains were from Huaidao No.5
background, and 1107
strains were from Jinjing 818 background. These 1875 seedlings were further
subjected to the
third round of molecular identification with the PPO-R2 and CP-R2 primer pair,
in which 184
lines from Huaidao No.5 background showedinversion-positive bands, 350 strains
from Jinjing
818 background showed inversion-positive bands. The positive seedlings were
moved to the
greenhouse for cultivation.
4. PPO inhibitory herbicide resistance test of PPO1 inversion seedlings (TO
generation):
Transformation seedlings of QY2234 TO generation identified as inversion event-
positive
were transplanted into large plastic buckets in the greenhouse to grow seeds
of Ti generation.
There were a large number of positive seedlings, so some TO seedlings and wild-
type control
lines with similar growth period and status were selected. When the plant
height reached about 20
168
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
cm, the herbicide resistance test was directly carried out. The herbicide used
was a
high-efficiency PPO inhibitory herbicideproduced by the company ("Compound
A"). In this
experiment, the herbicide was applied at the gradients of three levels, namely
0.18, 0.4, and 0.6 g
ai/mu, by a walk-in type spray tower.
The resistance test results were shown in Figure 18. 3-5 days after the
application, the
wild-type control rice seedlings began to wither from tip of leaf, necrotic
spots appeared on the
leaves, and the plants gradually withered, while most of the lines of the PPO1
inversion event
maintained normal growth, the leaves had no obvious phytotoxicity. In
addition, some lines
showed phytotoxicity, probably due to the polygenotypic mosaicism of editing
events and the
low expression level of PPO1 in the TO generation lines. Two weeks after the
application, the
wild-type rice seedlings died, and most of the inversion event strains
continued to remain green
and grew normally. The test results showed that the PPO1 inversion lines could
significantly
improve the tolerance of plants to Compound A.
5. Quantitative detection of relative expression level of PPO1 gene in PPO1
inversion
seedlings (TO generation):
It was speculated that the increased resistance of the PPO1 gene inversion
lines to
Compound A was due to the fusion of the strong CP12 promoter and the CDS of
the PPO1 gene
which would increase the expression level of PPO1. Therefore, the lines of TO
generation
QY2234-252, QY2234-304 and QY2234-329 from Huaidao No.5 background were
selected,
their primary tillers and secondary tillers were sampled and subjected to the
detection of
expression levels of PPO1 and CP12 genes.The wild-type Huaidao No.5 was used
as the control.
The specific protocols followed step 6 of Example 2, with the rice UBQ5 gene
as the internal
reference gene. the fluorescence quantitative primers were as follows: 5'-3'
UBQ5-F ACCACTTCGACCGCCACTACT
UBQ5-R ACGCCTAAGCCTGCTGGTT
RT-0 sPP 01-F GC AGCAGAT GCTC TGTCAATA
RT-OsPP01-R CTGGAGCTCTCCGTCAATTAAG
RT -0 sCP 12-Fl CC GGAC ATC TC GGACAA
RT-OsCP12-R1 CTCAGCTCCTCCACCTC
The UBQ5 was used as an internal reference. ACt was calculated by subtracting
the Ct value
of UBQ5 from the Ct value of the target gene.Then 2-Act was calculated, which
represented the
relative expression level of the target gene. The H5CK1 and H5CK2 were two
wild-type control
plants of Huaidao No.5, the 252M, 304M and 329M represented the primary tiller
leaf samples of
QY2234-252, QY2234-304 and QY2234-329 TO plants, and the 252L, 304L, and 329L
represented their secondary tiller leaf samples. The results were shown in
Table 8 below:
Table 8: Ct values and relative expression folds of different genes
UBQ5 Mean PPO1 ACt 2-Act Mean CP12 ACt 2-Act Mean
28.18 25.83 -2.43 5.39 22.28 -3.98 15.77
28.37 25.98 -2.28 4.85 22.06 -4.20 18.44
H5CK1 28.23 28.26 25.93 -2.33 5.03 5.09 22.11 -4.15 17.76 17.32
28.23 25.73 -2.36 5.15 21.63 -6.47 88.58
27.98 26.02 -2.07 4.20 21.53 -6.57 94.87
169
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
H5CK2 28.07 28.09 25.92 -2.18 4.52 4.62 21.54 -6.55 93.83 92.43
25.51 25.17 -0.54 1.45 22.26 -3.45 10.95
25.82 25.22 -0.49 1.41 22.36 -3.36 10.23
252M 25.80 25.71 25.22 -0.49 1.41 1.42 22.43 -3.29 9.76 10.31
26.41 23.36 -3.14 8.84 22.30 -4.21 18.49
26.64 23.41 -3.10 8.56 21.95 -4.56 23.55
252L 26.47 26.51 23.46 -3.05 8.28 8.56 21.78 -4.73 26.47 22.84
25.74 24.55 -1.29 2.44 22.51 -3.32 10.02
25.99 24.53 -1.31 2.48 22.45 -3.39 10.47
304M 25.78 25.84 24.48 -1.36 2.57 2.50 22.56 -3.28 9.71 10.07
25.97 23.63 -2.36 5.14 21.60 -4.39 20.97
26.00 23.75 -2.25 4.74 21.43 -4.56 23.55
304L 26.00 25.99 23.56 -2.43 5.39 5.09 22.32 -3.68 12.78 19.10
26.94 23.11 -3.89 14.84 22.23 -4.76 27.16
26.99 23.25 -3.75 13.42 21.85 -5.15 35.39
329M 27.07 27.00 23.22 -3.78 13.71 13.99 21.82 -5.18 36.29 32.95
26.50 23.64 -2.63 6.19 22.00 -4.27 19.30
26.52 23.74 -2.53 5.79 21.97 -4.30 19.71
329L 25.79 26.27 23.77 -2.50 5.65 5.87 22.15 -4.12 17.42 18.81
The relative expression levels of PPO1 and CP12 in different strains were
shown in Figure
19. As the results showed, unlike the doubling event in Example 2, the gene
expression levels of
these inversion event strains were significantly different. The expression
levels of CP12 are very
different between the two Huaidao No.5 CK groups, possibly because of the
different growth
rates of the seedlings. Compared with the H5CK2 control group, the expression
levels of CP12 in
the experimental groups all showed a tendency of decrease, while the
expression levels of PPO1
for 252L and 329M increased significantly, and the expression levels of PPO1
for 304L and 329L
modestly increased, and the expression levels of PPO1 for 252M and 304M
decreased. Different
from the doubling of chromosome fragments which mainly increased the gene
expression level,
the inversion of chromosome fragments generated new genes on both sides, so
various editing
events might occur at the targets on both sides, and the changes in the
transcription direction
might also affect gene expression level at the same time. That is to say, the
TO generation plants
were complex chimeras. There might also be significant differences in gene
expression levels
between primary and secondary tillers of the same plant. It could be seen from
the results of
quantitative PCR that the PPO1 inversion events showed a higher likelihood of
increasing the
PPO1 gene expression level, and thus herbicide-resistant strains with high
expression level of
PPO1 could be selected out by herbicide resistance selection for the inversion
events.
The above results proved that,following the scheme of detecting effective
chromosome
fragment inversion in protoplasts, calli and transformed seedlings with
inversion events could be
selected through the multiple rounds of molecular identification during
theAgrobacterium
transformation and tissue culturing, and the CP12 strong promoter fused with
the new PPO1 gene
generated in the transformant seedlings could indeed increase the expression
level of the PPO1
gene, which could confer the plants with resistance to the PPO inhibitory
herbicideCompound A,
170
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
thereby herbicide-resistant rice with knock-up endogenous PPO gene was
created. Taking this as
an example, the chromosome fragment inversion protocol of Example 4 and
Example 5 also
applied to other endogenous genes which gene expression pattern needed to be
changed by
introducing and fusing with a required promoter, thereby a new gene can be
created, and new
varieties with a desired gene expression pattern could be created through
Agrobacterium-mediated transformation in plants.
Example 6: Molecular detection and herbicide resistance test of the Ti
generation
plants of the herbicide-resistant rice lines with knock-up expression of the
endogenous
PPO1 gene through chromosome fragment inversion
The physical distance between the wild-type rice genome PPO1 gene and CP12
gene was
911 kb. As shown in Figure 14, a highly-expressing PPO1 gene with a CP12
promoter-driven
PPO1 CDS region was generated on the right side after the inversion of the
chromosome
fragment between the two genes. A deletion of chromosome fragment could also
occur. In order
to test whether the new gene could be inherited stably and the influence of
the chromosome
fragment inversion on genetic stability, molecular detection and herbicide
resistance test was
carried out on the Ti generation of the PPO1 inversion strain.
First of all, it was observed that the inversion event had no significant
effect on the fertility
of the TO generation plants, as all positive TO strains were able to produce
seeds normally. The
Ti generations of QY2234/H5-851 strains with the Huaidao No.5 background were
selected for
detection.
1. Sample preparation:
For QY2234/H5-851, a total of 48 Ti seedlings were planted. All the plants
grew normally.
2. PCR molecular identification:
1) Detection primer sequence: 5'-3'
PPO-R2: AAGGCTGGAAGCTGTTGGG
CP-R2: CTGAGGAGGCGATAAGAAACGA
PPO-F2: CGGACTTATTTCCCACCAGAA
CP-F2: AGGTCTCCTTGAGCTTGTCG
pg-Hyg-R1: TCGTCCATCACAGTTTGCCA
pg-35 S -F : TGACGTAAGGGATGACGCAC
2) The binding sites of the above primers were shown in Figure 14, wherein the
PPO-R2 +
CP-R2 was used to detect the fusion fragment of the right CP12 promoter and
the PPO1 coding
region after the inversion of the chromosome fragment, and the length of the
product was 507bp;
the PPO-F2 + CP-F2 was used to detect the fusion fragment of the left PPO1
promoter and the
CP12 coding region after the inversion of the chromosome fragment, and the
length of the
product was 560bp; the PPO-F2 + PPO-R2 was used to detect the left PPO target
site before the
inversion, and the length of the product in the wild-type control was 586bp;
the CP-F2 + CP-R2
was used to detect the right CP12 target site before the inversion, and the
length of the product in
the wild-type control was 481bp. The pg-Hyg-R1 + pg-35S-F was used to detect
theT-DNA
fragment of the editing vector, and the length of the product was 660bp.
3) PCR reaction system and reaction conditions:
Reaction system (10[tL system):
171
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
2*KOD buffer 5pL
2mM dNTPs 2pL
KOD enzyme 0.2pL
Primer F
Primer R 0.2pt
Water
Sample
Reaction conditions:
94 C 2 minutes
98 C 20 seconds
60 C 20 seconds 40 cycles
68 C 20 seconds
68 C 2 minutes
12 C 5 minutes
The PCR products were subjected to electrophoresis on a 1% agarose gel with a
voltage of
180V for 10 minutes.
3. Molecular detection results:
The detection results were shown in Table 9. A total of 48 plants were
detected, of which 12
plants (2/7/11/16/26/36/37/40/41/44/46/47) were homozygous in inversion, 21
plants
(1/3/4/5/6/8/9/15/17/20/22/23/24/27/30/31/33/34/39/42/43) were heterozygous in
inversion, and
15 plants (10/12/13/14/18/19/21/25/28/29/32/35/38/45/48) were homozygous in
non-inversion.
The ratio of homozygous inversion: heterozygous inversion: homozygous non-
inversion was
1:1.75:1.25, approximately 1:2:1. So the detection results met the Mendel's
law of inheritance,
indicating that the new PPO1 gene generated by inversion was heritable.
Table 9: Results of molecular detection
QY2234-851 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Right side of
+ + + + + + + + + - + - - - + + + - - +
inversion
Left side of
+ + + + + + + + + - + - - - + + + - - +
inversion
PPO WT + - + + + + - + + + - + + + + - + + + +
CP12 WT + - + + + + - + + + - + + + + - + + + +
QY2234-851 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Right side of
- + + + - + + - - + + - + + - + + - + +
inversion
Left side of
- + + + - + + - - + + - + + - + + - + +
inversion
PPO WT + + + + + - + + + + + + + + + - - + + -
CP12 WT + + + + + - + + + + + + + + + - - + + -
QY2234-851 41 42 43 44 45 46 47 48
Right side of
+ + + + - + + -
inversion
172
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
Left side of
+ + + + - + + -
inversion
PPO WT - + + - + - - +
CP12 WT - + + - + - - +
For the above Ti seedlings, the Pg-Hyg-R1 + pg-35S-F primers were used to
detect the
T-DNA fragmentof the editing vector.The electrophoresis results of 16 and 41
were negative for
T-DNA fragment, indicating homozygous inversionit could be seen that non-
transgenic strains
of homozygous inversion could be segregated from the Ti generationof the
inversion event.
4. Sequencing detection of the editing events:
The genotype detection of the inversion events focused on the editing events
of the new PPO
gene on the right side. The mutation events with the complete protein coding
frame of the PPO1
gene were retained.The CP12 site editing events on the left side that did not
affect the normal
growth of plants through the phenotype observation in the greenhouse and field
were retained.
The genotypes of the editing events detected in the inversion event-positive
lines were listed
below, in which seamless indicated identical to the predicted fusion fragment
sequence after
inversion. The genotypes of the successful QY2234 inversion events in Huaidao
No.5
background were as follows:
No. Genotype No. Genotype
Right side -lbp; left side Right side seamless; left side
+lbp
2234/H5-295 2234/H5-650
-32bp (G)
Right side seamless; left side
2234/H5-381 Right side +18bp 2234/H5-263
seamless
Right side -lbp; left side
2234/H5-410 2234/H5-555 Right side -23bp
+1bp
2234/H5-159 Right side -16bp 2234/H5-645 Right side -
5bp, +20bp,
2234/H5-232 Right side -4bp
Some of the sequencing peak maps and sequence comparison results were shown in
Figure
20.
The genotypes of the successful QY2234 inversion in the Jinjing818 background
were as
follows:
No. Right side PPO genotype No. Right side PPO genotype
2234/818-5 Right side seamless 2234/818-144 Right side +lbp
Sight side +2bp, -26bp, pure
2234/818-42 Right side -16bp 2234/818-151
peak
2234/818-108 Right side -15bp 2234/818-257 Sight
side +lbp
2234/818-134 Right side +5bp, -15bp
Some of the sequencing peak maps and sequence comparison results were shown in
Figure
21.
The sequencing results of the above different new PPO1 geneswith the CP12
promoter fused
to the PPO1 coding regionwere shown in SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22,
SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO : 25, and SEQ ID NO: 26.
173
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
5. Herbicide resistance test of Ti generation seedlings:
The herbicide resistance test was performed on the Ti generation of the
QY2234/H5-851
PPO1 inversion lines at seedling stage.The wild-type Huaidao No.5 was used as
a control, and
planted simultaneously with the Ti generation seeds of the inversion lines.
When the seedlings
reached a plant height of 15 cm, Compound A was applied by spraying at four
levels of 0.3, 0.6,
0.9 and 1.2 g a.i./mu. The culture conditions were 28 C, with 16 hours of
light and 8 hours of
darkness.
The resistance test results were shown in Figure 22. After 5 days of the
application, the
wild-type control rice seedlings showed obvious phytotoxicity at a dose of 0.3
g a.i./mu.They
began to wither from the tip of leaf, and necrotic spots appeared on the
leaves; at a dose of 0.6 g
a.i./mu, the plants died quickly. However, QY2234/H5-851 Ti seedlings could
maintain normal
growth at a dose of 0.3 g a.i./mu, and no obvious phytotoxicity could be
observed on the leaves;
at doses of 0.6 and 0.9 g ai/mu, some Ti seedlings showed dry leaf tips, but
most Ti seedlings
could keep green and continue to grow, while the control substantially died
off. At a dose of 1.2 g
a.i./mu, the control plants were all dead, while some of the Ti seedlings
could keep green and
continue to grow. The test results indicated that the resistance of the PPO1
gene inversionlines to
Compound A could be stably inherited to their Ti generation.
Example 7: An editing method for knocking up the expression of theendogenous
EPSPS gene in plant
EPSPS was a key enzyme in the pathway of aromatic amino acid synthesis in
plants and the
target site of the biocidal herbicide glyphosate. The high expression level of
EPSPS gene could
endow plants with resistance to glyphosate. The EPSPS gene (as shown in SEQ ID
NO: 4, in
which 1-1897bp was the promoter, and the rest was the expression region) was
located on
chromosome 6 in rice. The gene upstream was transketolase (TKT, as shown in
SEQ ID NO: 3,
in which 1-2091bp was the promoter, and the rest was the expression region)
with an opposite
direction. The expression intensity of TKT gene in leaves was 20-50 times that
of the EPSPS
gene. As shown in Figure 2, by simultaneously inducing double-strand breaks
between the
promoter and the CDS region of the two genes respectively, the inversion
(Scheme 1) or
inversion doubling (Scheme 2) of the region between the two breaks could be
obtained after
screening. In both cases, the promoter of the EPSPS gene would be replaced
with the promoter of
the TKT gene, thereby increasing the expression level of the EPSPS gene and
obtaining the
resistance to glyphosate. In addition, the Schemes 3, 4 and 5 as shown in
Figure 2 could also
create new EPSPS genes driven by the TKT gene promoter. The gene structure of
EPSPS
adjacent to and opposite in direction relative to TKTwas conserved in
monocotyledonous plants
(Table 10). While in dicotyledonous plants,both genes were also adjacent yet
in the same
direction; therefore, this method was universal in plants.
Table 10: Distance between the EPSPS gene and the adjacent TKT gene in
different plants
Location Distance from CDS
Species Direction
(chromosome) region start site (kb)
Rice 6 4 Reverse <TKT-EPSPS>
7A 35 Reverse <TKT-EPSPS>
Wheat
7D 15 Reverse <TKT-EPSPS>
174
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
4A? 50 Reverse <TKT-EPSPS>
Maize 9 22 Reverse <TKT-EPSPS>
Brachypodium
1 5 Reverse <TKT-EPSPS>
distachyon
Sorghum 10 15 Reverse <TKT-EPSPS>
Millet 4 5 Reverse <TKT-EPSPS>
Soybean 3 6 Forward TKT>EPSPS>
Tomato 5 6 Forward TKT>EPSPS>
2 6 Forward TKT>EPSPS>
Peanut
12 5 Forward TKT>EPSPS>
Cotton 9 22 Forward TKT>EPSPS>
Alfalfa 4 8 Forward TKT>EPSPS>
Arabidopsis 2 5 Forward TKT>EPSPS>
Grape 15 17 Forward TKT>EPSPS>
To this end, pHUE411 was used as the backbone, and the following as targets:
Name of target sgRNA Sequence (5' to 3)
OsEPSPS-guide RNA1 CCACACCACTCCTCTCGCCA
OsEPSPS-guide RNA2 CCATGGCGAGAGGAGTGGTG
OsEPSPS-guide RNA3 ATGGTCGCCGCCATTGCCGG
OsEPSPS-guide RNA4 GACCTCCACGCCGCCGGCAA
OsEPSPS-guide RNA5 TAGTCATGTGACCATCCCTG
OsEPSPS-guide RNA6 TTGACTCTTTGGTTCATGCT
Several different dual-target vectors had been constructed:
pQY002061 pHUE411-EPSPS-sgRNA1+3
pQY002062 pHUE411-EPSPS-sgRNA2+3
pQY002063 pHUE411-EPSPS-sgRNA1+4
pQY002064 pHUE411-EPSPS-sgRNA2+4
pQY002093 pHUE411-EPSPS-sgRNA2+5
pQY002094 pHUE411-EPSPS-sgRNA2+6
(2) With the relevant detection primers shown in the following table, the
fragments
containing the target sites on both sides or the predicated fragments
generated by the fusion of the
TKT promoter and the EPSPS coding region were amplified, and the length of the
productsis
between 300-1000 bp.
Primer Sequence (5' to 3')
EPSPSinversion checkFl ATCCAAGTTACCCCCTCTGC
EPSPSinversion checkR1 CACAAACACAGCCACCTCAC
EPSPSinversion check-nestF2 ATGTCCACGTCCACACCATA
EPSPSinversion check-nestR2 AATGGAATTCACGCAAGAGG
EPSPSinversion checkF3 GTAGGGGTTCTTGGGGTTGT
EPSPSinversion checkR3 CGCATGCTAACTTGAGACGA
EPSPSinversion check-nestF4 GGATCGTGTTCACCGACTTC
175
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
EPSP Sinversion check-nestR4 C C GGTAC AAC GC ACGAGTAT
EP SP Sinversion checkF5 GGCGTCATTCCATGGTTGATTGT
EP SP Sinversion checknestF6 GATAGACCCAGATGGGCATAGAATC
EP SP Sinversion checkR5 TGCATGCATTGATGGTTGGTGC
EP SP Sinversion checknestR6 CC GGCCC TTAGAATAAAGGTAGTAG
After protoplast transformation, the detection results showed that the
expected inversion
events were obtained. As shown in Figure 15, the sequencing result of the
inversion detection of
pQY002062 vector transformed protoplast was shown in SEQ ID NO: 11; the
sequencing result
of the deletion detection of pQY002062 vector transformed protoplast was shown
in SEQ ID No:
12; the sequencing result of the inversion detection of the pQY002093 vector
transformed
protoplast was shown in SEQ ID NO: 13; and the sequencing result of the
deletion detection of
pQY002093 vector transformed protoplast was shown in SEQ ID NO: 14.
These vectors were transferred into Agrobacterium for transforming calli of
rice. Plants
containing the new EPSPS gene were obtained.The herbicide bioassay results
showed that the
plants had obvious resistance to glyphosate herbicide.
Example 8: An editing method for knocking up the expression of the endogenous
PPO
gene in Arabidopsis
Protoporphyrinogen oxidase (PPO) was one of the main targets of herbicides. By
highly
expressing plant endogenous PPO, the resistance to PPO inhibitory herbicides
could be
significantly increased. The Arabidopsis PPO gene (as shown in SEQ ID NO: 1,
in which
1-2058bp was the promoter, and the rest was the expression region) located on
chromosome 4,
and the ubiquitin10 gene (as shown in SEQ ID NO: 2, in which 1-2078bp was the
promoter, and
the rest was the expression region) located 1.9M downstream with the same
direction as the PPO
gene.
As shown in the Scheme as shown in Figure 3, simultaneously generating double-
strand
breaks at the sites between the promoter and the CDS region of the PPO and the
ubiquitin10
genes respectively. Doubling events of the region between the two breaks could
be obtained by
screening, namely a new gene generated by fusing the ubiquitin10 promoter and
the PPO coding
region. In addition, following Scheme 2 as shown in Figure 1, a new gene in
which the
ubiquitin10 promoter and the PPO coding region were fused together could also
be created.
To this end, pHEE401E was used as the backbone
(https://www.addgene.org/71287/), and
the following locations were used as target sites:
Name of target sgRNA Sequence (5' to 3)
AtPPO-guide RNA1 CAAACCAAAGAAAAAGTATA
AtPPO-guide RNA2 GGTAATCTTCTTCAGAAGAA
AtPPO-guide RNA3
ATCATCTTAATTCTCGATTA
AtPPO-guide RNA4
TTGTGATTTCTATCTAGATC
The dual-target vectors were constructed following the method described by
"Wang ZP,
Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ. Egg cell-specific
promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for
multiple target
genes in Arabidopsis in a single generation. Genome Biol . 2015 Jul
21;16:144.":
pQY002076 pHEE401E-AtPPO-sgRNA1+3
176
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
pQY002077 pHEE401E-AtPPO- sgRNA1+4
pQY002078 pHEE401E-AtPPO- sgRNA2+3
pQY002079 pHEE401E-AtPPO- sgRNA2+4
Arabidopsis was transformed according to the method as follows:
(1) Agrobacterium transformation
Agrobacterium GV3101 competent cells were transformed with the recombinant
plasmidsto
obtain recombinant Agrobacterium.
(2) Preparation of Agrobacterium infection solution
1) Activated Agrobacterium was inoculated in 30m1 of YEP liquid medium
(containing
25mg/L Rif and 50mg/L Kan), cultured at 28 C under shaking at 200 rpm
overnight until the
0D600 value was about 1.0-1.5.
2) The bacteria were collected by centrifugation at 6000 rpm for 10 minutes,
and the
supernatant was discarded.
3) The bacteria were resuspended in the infection solution (no need to adjust
the pH) to
reach 0D600=0.8 for later use.
(3) Transformation of Arabidopsis
1) Before the plant transformation, the plants shouldgrow well with luxuriant
inflorescence
and no stress response. The first transformation could be carried out as long
as the plant height
reached 20cm. When the soil was dry, watering was carried out as appropriate.
On the day before
the transformation, the grown siliques were cut with scissors.
2) The inflorescence of the plant to be transformed was immersed in the above
solution for
30 seconds to 1 minute with gentle stirring.The infiltrated plant should have
a layer of liquid film
thereon.
3) After transformation, the plant was cultured in the dark for 24 hours, and
then removed to
a normal light environment for growth.
4) After one week, the second transformation was carried out in the same way.
(4) Seed harvest
Seeds were harvested when they were mature. The harvested seeds were dried in
an oven at
37 C for about one week.
(5) Selection of transgenic plants
The seeds were treated with disinfectant for 5 minutes, washed with ddH20 for
5 times, and
then evenly spread on MS selection medium (containing 30pg/m1 Hyg, 100 g/m1
Cef). Then the
medium was placed in a light incubator (at a temperature of 22 C, 16 hours of
light and 8 hours
of darkness, light intensity 100-150 umol/m2/s, and a humidity of 75%) for
cultivation. The
positive seedlings were selected and transplanted to the soil after one week.
(6) Detection of Ti mutant plants
(6.1) Genomic DNA extraction
1) About 200 mg of Arabidopsis leaves was cut and placed into a 2 ml
centrifuge tube.
Steel balls were added, and the leaves were ground with a high-throughput
tissue disruptor.
2) After thorough grinding, 400pL of SDS extraction buffer was addedand mixed
upside
down. The mixture was incubated in 65 C water bath for 15 minutes, and mixed
upside down
every 5 minutes during the period.
177
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
3) The mixture was centrifuged at 13000rpm for 5 minutes.
4) 3004, of supernatant was removed and transferred to a new 1.5m1 centrifuge
tube, an
equal volume of isopropanol pre-cooled at -20 C was added into the centrifuge
tube, and then the
centrifuge tube was kept at -20 C for 1 hour or overnight.
5) The mixture was centrifuged at 13000rpm for 10 minutes, and the supernatant
was
discarded.
6) 500[EL of 70% ethanol was added to the centrifuge tube to wash the
precipitate, the
washing solution was discarded after centrifugation (carefully not discarding
the precipitate).
After the precipitate was dried at room temperature, 300_, of ddH20 was added
to dissolve the
DNA, and then stored at -20 C.
(6.2) PCR amplification
With the extracted genome of the Ti plant as template, the target fragment was
amplified
with the detection primers. 5 pL of the amplification product was taken and
detected by 1%
agarose gel electrophoresis, and then imaged by a gel imager. The remaining
product was directly
sequenced by a sequencing company.
The sequencing results showed that the AtPPO1 gene doubling was successfully
achieved in
Arabidopsis, and the herbicide resistance test showed that the doubling plant
had resistance to
PPO herbicides.
Example 9: Creation of GH1 gene with new expression characteristics in
zebrafish
The growth hormone (GH) genes in fishes controlled their growth and
development speed.
At present, highly expressingthe GH gene in Atlantic salmons through the
transgenic technology
could significantly increase their growth rates. The technique was of great
economical value, but
only approved for marketing after decades. The GH1 gene was the growth hormone
gene in
zebrafish. In the present invention, suitable promoters in zebrafish (suitable
in terms of
continuous expression, strength, and tissue specificity) were fused together
with the CDS region
of GH1 gene in vivo through deletion, inversion, doubling, inversion doubling,
chromosome
transfer, etc. ,to create a fast-growing fish variety.
The experiment procedure was as follows:
1. Breeding of Zebra fish:
1) Preparation of paramecia: The mother liquor of paramecia was purchased
online
(http s: //item .taob ao. com/item .htm? spm=a23 Or. 1 .14 .49. 79f774c6C6
elpL8thd=573612042855
&ns=18zabbucket=18#detail). A 2L beaker was washed, sterilized and filled with
200 mL of
paramecia mother liquor; two yeast pieces and two sterilized grains of wheat
were added
thereto; sterile water was added until the volume reaches 2L; then the opening
was covered
and sealed with sterilized kraft paper; stationary culture was performed at 25-
28 C for 3-5 d;
the mixture was used to feed the juvenile zebra fish when the usable
concentration was
reached. Each time the paramecia solution was taken, a dense filter screen was
used to
remove impurities.
2) Incubation of brine shrimp: Brine shrimp, also known as fairy shrimp and
artemia,
was a marine plankton. Brine shrimp eggs were purchased and stored at 4 C. For
the
incubation, the mixture was prepared at a ratio of 1L deionized water: 32 g
NaC1:3.5 g brine
178
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
shrimp eggs; oxygenation was performed at 28.5 C for 25-30h; the incubated
brine shrimps
were collected. The incubated brine shrimps were kept in a small amount of
3.2% NaCl
solution, where they could be kept for 2-3 d at 4 C.
3) The standardized large-scale breeding of zebra fish was realized with
anindependent
zebrafish farming system manufactured by Shanghai Haisheng. The tap water
treated with a
water purifier was kept in a dosing barrel, where an appropriate amount of
NaCl and
NaHCO3 was added to maintain a specific conductivity of 500 us/cm and a pH of
7Ø The
water circulation system ensured all breeding tanks maintain a constant water
level and flow
state. A waste treatment system automatically filters the fish feces and
remaining fish food;
the fish culture water was reused after being sterilized by UV exposure and
heated (28.5 C);
the fresh water was automatically replenished after the wastewater was
discharged. The
lighting was controlled with an automatic timer in fish house to maintain the
"14h-light +
10h-dark cycles"; an air conditioning system kept the indoor temperature at 28
C; an
exhaust fan removed indoor moisture at regular intervals to avoid excessively
high humidity.
Zebra fish embryos were subjected to stationary culture in a biochemical
incubator at
28.5 C, and could be fed with paramecia 5 days after fertilization. Feeding
was performed
3-4 times a day. Fresh brine shrimp started to be supplemented gradually after
about 13 days.
When the bodies of all juveniles became red, it means the zebra fish can
completely eat
brine shrimp. The juvenile zebra fish was then transferred to the breeding
tank. A moderate
amount of fresh brine shrimp was fed 3 times a day.
AB varieties of zebra fish were transferred into an incubation box on a 2-
female :
2-male basis on the afternoon of the day before reproduction of zebra fish;
they were
separated by a baffle. The baffle was removed the next morning; the zebra fish
generally
began to lay eggs in about 10 minutes; embryos were collected within 30
minutes after egg
laying and rinsed with E3 culture medium (mass ratio29.3 % NaCl, 3.7 % CaCl2,
4% MgSO4,
1.3% KCl, pH7.2) to remove dead eggs.
4) Preparation of injection dish: 1.5% agarose was prepared; 30-40 ml of
agarose melt
was poured into each plastic culture dish. The surface of agarose was gently
covered with
the mold to avoid bubbles. The mold was removed after the gel got completely
solidified to
attain a "V-shaped" groove; a small amount of E3 culture medium was added into
the
prepared culture dish; it was sealed and kept at 4 C.
2. Preparation of RNP sample:
For zebrafish GH1 gene initiation codon upstream 100bp DNA sequence designed
sgRNA-GH1 target: 5'aagaacgagtttgtctatct3', for zebrafish collala gene
termination codon
designed sgRNA-collala target: 5'atgtagactctttgaggcga3', and for zebrafish
ddx5 gene
initiation codon upstream designed sgRNA-ddx5 target:
5'gcaccatcactgcgcgtaca3'.
Genscript was entrusted to synthesize the EasyEdit sgRNA. The synthetic sgRNA
and the
179
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
purified Cas9 were mixed at a ratio of 1:3; 10xCas9 buffer solution (200 mM
HEPES, 100
mM MgCl2, 5 mM DTT, 1.5 M KC1) was added and RNase-free ultra-pure water was
used
to dilute it to 1X so that the Cas9 protein concentration was 600 ng/uL, and
the sgRNA
concentration was 200 ng/uL; after 10 minutes of incubation at 25 C, a small
amount of
phenol red was added to dye the injection sample for convenient observation
during
injection; the volume of phenol red was normally less than 10% of the total
volume. In the
experiment, sgRNA-GH1 combined with sgRNA-collala and sgRNA-ddx5, respectively
and the RNP complex was prepared at equal ratio, and the mixture was injected
into fish
eggs.
3. Microinjection:
Under a stereomicroscope, the tip of injection needle was fractured slightly
in a
beveled manner using medical pointed toothless forceps for convenient
injection. 4 pL of
sample containing phenol red was taken by a micro loading tip; the pipette tip
inserts into
the needle from the end of needle to the tip reaching the point of injection
needle; the tip
was gently pushed to inject the sample into the needle while the tip was
gently pulled out so
that the front end of injection needle was filled with the red RNP sample; the
injection
needle with sample was then inserted into the holder for fixation. The
quantitative capillary
was 33 mm in length and 1 pL in total volume. The injection pressure was
adjusted to
increase the length of the liquid column in the capillary by 1 mm after 15
injections; then,
each sample injection volume was 1 nL. The injection dish was taken out of the
refrigerator
in advance, and set aside until the room temperature was reached. The
collected one-cell
stage fertilized eggs were arranged in the groove of dish; a small amount of
E3 culture
medium was added so that the liquid level was just over the fertilized eggs.
Under a
stereomicroscope, the tip of the injection needle was gently penetrated into
the membrane of
the fertilized egg and reaches the yolk close to the animal pole; RNP sample
was injected by
stepping on the pedal. Due to the small amount of phenol red in the RNP
sample, the light
red sample liquid can be clearly observed during the injection. The injected
embryos were
placed in a disposable plate containing E3 culture medium and cultured in a
constant
temperature incubator at 28.5 C. The culture medium needs to be replaced every
24 hours to
ensure the ion concentration and oxygen content.
4. DNA extraction:
After each set of injections, the tail fin of survived zebrafish at about 2-3
months old
were treated with cell lysate buffer(10 mmol/L Tris, 10 mmol/L EDTA, 200
mmol/L NaCl,
0.5% SDS, 200 pgimL Proteinase K, pH 8.2). Each tube was filled with 200 pL of
lysate
and held overnight at 50 C; they were violently shaken 2-3 times during this
period. The
tube was centrifuged at 1200 r/min for 5 min at room temperature, and then 200
pL of
supernatant was taken. Equal volume of phenol: chloroform: isoamyl alcohol
(25:24:1) was
180
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
added and violently shaken. The tube was centrifuged at 12000 r/min at room
temperature
for 10 min; the supernatant taken was mixed with equal volume of chloroform,
and then the
tube was violently shaken. The tube was centrifuged at 12000 r/min at room
temperature for
min; the supernatant was mixed with 1/20-volume 3 mol/L NaCl and 2.5-time
volume
pre-cooled anhydrous ethanol; the mixture was blended well and should not be
made upside
down; it's kept on ice for 30 min. The tube was centrifuged at 12000 r/min at
4 C for 10 min,
and the supernatant was abandoned swiftly. 1 mL 70% alcohol was added for
rinsing. The
tube was centrifuged at 12000 r/min at 4 C for 10 min. The supernatant was
abandoned
swiftly, and vacuum drying was performed. Finally, 30 pL of deionized water
was added in
the end to dissolve the DNA. The solution was kept at -20 C for future use.
After the 0.8%
agarose electrophoresis detection, the PCR test was performed with the
corresponding
primer, and the positive strip was subjected to sequencing verification.
Wherein, ghl-R:
tgctacaaataaagtgcactacaca and collala-F:gggtctggattggagtcaca were double
treated between
the amplified col lal a gene and ghl; ghl-R:tgctacaaataaagtgcactacaca and
ddx5-F:acgcgttacgtacgtcagaa, as well as GH1-F:aaatgaccggaatcacaaca and
ddx5-R:acgaccatccttaccctctg were inversely treated between the amplified ddx5
gene and
ghl.
The experimental results were shown as follows:as shown in Figure 23, the
characteristic fragments of chromosome duplication were detected in the
zebrafish embryo
samples of the RNP injection group; as shown in Figure 51, sequencing results
showed that
the expected duplication event occurred in the chromosome fragments between
GH1 and
COL1A1 A gene targets in zebrafish embryos; as shown in Figure 52, sequencing
results
showed that the coding area & promotor of ddx5 gene and the coding area & the
promotor
of ghl gene were exchanged due to the inversion of chromosome fragments; as
shown in
Figure 53, the growth of zebrafish with upregulated expression was obviously
accelerated.
Example 10: Field herbicide resistance test on Ti generation of herbicide-
resistant
rice 1inesQY2234
Ti generation of inversion lines QY2234/818-5 and QY2234/818-42 PPO1 were
subjected to field herbicide resistance test with the wild-type Jinjing 818
rice variety as an
herbicide-susceptible control. They were planted in sync with the inversion
line Ti
generation seeds in a paddy field of Red Flag Team, Nanbin Farm, Sanya, Hainan
Province;
the test was performed between November 30, 2020 and April 15, 2021. Seedlings
were
cultivated after 2 days of soaking rice seeds, and transplantation was
performed after 3
weeks of seedling; 3 sets of replications were arranged; an herbicide called
as compound A
was applied in 3 weeks after transplantation, and the concentration was set to
0.3, 0.6 and
0.9 ga.i./mu (1 mu = 1/15 ha); the status of rice seedlings was investigated
10 days post
application (DPA).
181
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
The result of the field herbicide resistance test was shown in Figure 24. In
10 DPA at a
dose of 0.3 ga.i./mu, all wild-type Jinjing 818 rice plants died; QY2234/818-5
and
QY2234/818-42 were growing normally; at the dose of 0.6 ga.i./mu,QY2234/818-42
was
growing normally, while most individual plants of QY2234/818-5 died, but there
were
resistant individual plants of QY2234/818-5; at the dose of 0.9 ga.i./mu, most
individual
plants of QY2234/818-42 and QY2234/818-5 died, but a few resistant plants were
green and
continued to grow. The test result indicated that the PPO1 gene inverted line
exhibited
herbicide resistance under field conditions under high light intensity in
Hainan; stable
resistant lines can be selected from the populations, whichprovides basic
materials for
herbicide-resistant rice breeding.
Example 11: Western Blot test on Ti-generation PPO1 protein expression level
of
the QY2234 line rice
The Ti-generation seedling leaves of the four PPO1 inversion rice lines, i.e.,
QY2234/818-5, QY2234/818-42, QY2234/818-144 and QY2234/818-257, were selected
to
determine the PPO1 protein expression level. With the wild-type Jinjing 818
rice variety as
a control, they were planted in the greenhouse in sync with the inversion line
Ti generation
seeds; when the seedlings grew to a height of 15 cm, leaf samples were taken
with reference
to Example 6 for molecular identification; the inversion-positive seedlings
were selected for
the Western Blot Test on protein expression.
A Western Blot test was performed as per the Molecular Cloning: A Laboratory
Manual (Sambrook, J., Fritsch, E.F. and Maniatis, T, Molecular Cloning: A
Laboratory
Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989). The
PPO1
protein antibody was rice PPO1 polyclonal antibody prepared by Qingdao
Jinmotang
Biotechnology Co., Ltd. (Qingdao, China); a plant endogenous reference Actin
protein
antibody was purchased from Sangon Biotech (Shanghai, China) Co., Ltd. (Art.
No.
D195301); the secondary antibody was HRP-labeled goat anti-rabbit IgG (Sangon,
Art. No.
D110058); the test was performed according to the operating instructions using
the Western
Blot Kit (Boster, Art. No. AR0040).
To be more specific, 2 g of single-plant rice sample was taken and ground with
liquid
nitrogen into powder; an appropriate amount of protein extraction buffer
(material: Protein
extraction buffer = 1:1.5); incubated on ice for 30 min; centrifuged at 4 C
with 27100 g for
15 min; the supernatant was mixed with 5Xloading buffer (delivered with the
kits); the
mixture was boiled for 15 min and subjected to electrophoresis at 110 V for 30
min.
The protein extraction buffer was formulated as follows:
component concentration
Tris-HCI (PH8.0) 100mM
glycerin 10%
EDTA 1mM
182
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
AsA (ascorbic acid) 2mM
PVPP 0.5%
PVP-40 0.5%
DTT (Add at operation time) 20mM
PMSF (Add at operation time) 1mM
After the electrophoresis was finished, the gel was removed, and the gel block
in an
appropriate size was taken depending on the size of target protein, and then
the filter paper
and PVDF film of approximately the same volume was taken; the gel block was
cleaned
with clear water and then soaked with transfer solution; the filter paper and
PVDF film were
also soaked and wetted with the transfer solution; the wet filter paper, PVDF
film,
SDS-PAGE gel block and filter paper were stacked from bottom to top to expel
as many
bubbles as possible; they could be flattened with a test tube, while the
displacement between
layers should be prevented during the flattening; the film was transferred
under at 25 V and
1.3A for 10-30 min; after the transfer, the PVDF film was cleaned with PBST
buffer. Upon
completion of the cleaning, they were transferred to the blocking buffer
solution and
blocked at room temperature for lh. After the confining, the PVDF film was
cleaned with
PBST buffer solution for 3 times to remove the blocking liquid, then the
primary antibody
was incubated at a dilution ratio of approx. 1:1000 - 1:3000; the incubation
time of the
primary antibody was 2h at room temperature, or 12h at 4 C. Upon completion of
the
primary antibody incubation, the PVDF film was cleaned with the PBST buffer
solution for
3 times with each cycle lasting for 10 min. The secondary antibody was
incubated at a
dilution ratio of approx. 1:10000 - 1:20000 for lh at room temperature. Upon
completion of
the secondary antibody incubation, the PVDF film was cleaned with the PBST
buffer
solution for 3 times with each cycle lasting for 10 min. ECL luminescence: ECL
solutions A
and B were mixed well in equal volume (prepared when needed), and the liquid
mixture was
dropped onto the PVDF film evenly; the film was placed in the fluorescence
imager for
imaging.
The Western Blot test result was shown in Figure 25. According to the result,
the
internal-control Actin protein expression levels of the PPO1 inversion-
positive lines
werethe same as the wild-type Jinjing 818, while the expression levels of PPO1
protein
weresignificantly up-regulated. The 4 selected QY2234 lines had different
genotypes at the
inverted junction region between the CP12 promoter and the PPO1 protein coding
region;
QY2234/818-5 was identical to the predicted post-inverted fusion fragment
sequence;
compared with the predicted sequence, QY2234/818-42 lacks 16 bases in the CP12
promoter region; 1 base was inserted in the CP12 promoter region of QY2234/818-
144 and
QY2234/818-257. The test result showed that all the new genotypes could
express PPO1
protein at high levels, and manifested that the method for creating new genes
provided by
the present invention could produce a variety of functional genotypes in the
genome to
183
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
enrich the gene pool.
Example 12: Field herbicide resistance test on Ti generation of HPPD-
duplicated
rice lines QY2091
Through germination test, the Ti-generation of HPPD-gene duplicated lines
QY2091-12 and QY2091-21 without albino seedling separation were selected for
the field
herbicide resistance test with the wild-type Jinjing 818 rice variety as a
control. They were
planted in sync with the Ti generation seeds of QY2091 lines in a paddy field
of Red Flag
Team, Nanbin Farm, Sanya, Hainan Province; the test was performed between
November 1,
2020 and April 10, 2021. Seedlings were cultivated after 2 days of soaking
rice seeds, and
QY2091 seeds were soaked with 1/30000 herbicide compound Bipyrazone aqueous
solution;
albino seedlings were removed after emergence; transplantation was performed
after 3
weeks of seedling, and 3 sets of repetitions were arranged; herbicide compound
Bipyrazone
was applied in 3 weeks after the transplantation at a concentration of 4, 8,
16, and 32
ga.i./mu; the seedling status was investigated 21 days after application.
The result of field herbicide resistance test was shown in Figure 26. In 21
days after
application, all wild-type Jinjing 818 rice plants died of albinism at 4
ga.i./mu and 8
ga.i./mu ofherbicide compound Bipyrazone, while the QY2091-12 and QY2091-21
were
normally growing; at 16 g a.i./mu, the QY2091-12 line was growing normally,
while the
QY2091-21 line began to exhibit resistance separation: Most individual plants
showed
resistance, and a few individual plants developed yellowing of new leaves; at
32 g a.i./mu,
QY2091-12 and QY2091-21 began to exhibit resistance separation, and a few
individual
plants died of albinism, while significant yellowing of new leaves was
observed in some
individual plants; approx. 1/2 of the individual plants were growing normally
and exhibit
extremely high resistance. The recommended dosage for field application of
herbicide
compound Bipyrazone was 4 g a.i./mu. The test result indicated that the edited
lines with
highly expressive HPPD new genes created through chromosome segment
duplication
exhibited herbicide resistance under field conditions under high light
intensity in Hainan,
and could withstand an herbicide dose that was 8 times the recommended field
dose. The
screening of stable resistant lines will provide basic materials for herbicide-
resistant rice
breeding.
Example 13: New gene creation activity of NLS-free Cas9 and separately
expressed crRNA and tracrRNA in rice protoplast
Targets were chosen from upstream and downstream of the PPO 1 gene to test
whether
chromosome fragment duplication events could be produced; furthermore, tests
were
performed on whether the nuclear localization signal with Cas9 removed could
produce
duplication event, and on whether replacing sgRNA (single guide RNA) with
separated
expression of crRNA and tracrRNA could induce cell targeted site editing to
produce
184
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
chromosome fragment duplication events.
Dual-target editing vector pQY2648 was constructed by the method described in
Example 1 for the selected target sequence design primers, i.e., OsPP01-
esgRNA3:5'
taggtctccaaacATG GCGTTTTCTGTCCGCGTgcttcttggtgccgcg3' and OsPP01-esgRNA2:5'
TaggtctccggcgCAGTT
GGATTAGGGAATATGGTTTAAGAGCTATGCTGGAAACAGC3'. The NLS signal
peptides at both ends of SpCas9 wereremoved on the basis of pQY2648 to
construct the
NLS-free rice PPO1 dual-target editing vector pQY2650; the sgRNA expression
cassette
was modified based on pQY2650 and pQY2648; the fused Scaffold sequence was
removed,
and the crRNA and tracrRNA sequences were separately expressed. To be more
specific, the
OsU3 promoter drove the expression of
OsPP01-sgRNA2:5'CAGTTGGATTAGGGAATATGGTTTAAGGCTATGCT3' crRNA
sequence; the TaU3 promoter drove the expression of the OsPP01-sgRNA3:5'
ACGCGGACAGAAAACGCCATGTTTAAGGCTATGC3' sequence; the OsU3 promoter
drove the expression of the expression cassette of tracrRNA sequence
5'AGCATAGCAAGTTTAAATAAGGCTAGTC
CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT3'; the NLS-free crRNA
rice PPO1 dual-target editing vector pQY2651 and the crRNA rice PPO1 dual-
target editing
vector pQY2653 containing NLS were constructed; the primers used during the
process
were as follows:
2650E-BstBI: 5'gtacaaaaaagcaggcttcgaaATGgacaagaagtactcgatcggc3'
2650R-SacI: 5'tgaacgatcggggaaattcgagctcCTAgtcgcccccgagctgag3'
OsU3-HindIII-For2651F: 5'GCAGGTCTCaagcttaaggaatctttaaacatacgaacag3'
CrRNAl-B sal-RI:
5'GCAGGTCTCCAGGTAAAAAAAAAAAGCATAGCCTTAAACCATATT
CCCTAATCCAACTG3'
TaU3-BsaI-F2: 5'GCAGGTCTCCACCcatgaatccaaaccacacggag3'
CrRNA2-BsaI-R2:
5'GCAGGTCTCGCTAGAAAAAAAAAAGCATAGCCTTAAACATGGCGT
TTTCTGTCCGCGT3'
TraCrRNA-OsU3-BsaIF3: 5'GCAGGTCTCGCTAGaaggaatctttaaacatacgaac3'
TraCrRNA-KpnI-R3:
5'GgtaccAAAAAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGG
ACTAGCCTTATTTAAACTTGCTATGCTCGCCacggatcatctgcacaac3',
For the above-mentioned 4 vectors, Example 1 was consulted to prepare the high-
purity
and high-concentration plasmids for PEG-mediated transformation of rice
protoplast; the
protoplast DNA was extracted for detection of edit duplication event; PCR
primersto
185
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
amplifythe designed duplicated DNA at the junction regions weredesigned
basedthe targeted
cut sites on both sides, and then the PCR amplified fragments were sequenced;
the primer
sequences wereas follows:
OsPPOlDup-testF1: CCACTGCTGCCACTTCCAC
OsPPOlDup-testF2: GGCGACTTAGCATAGCCAG
OsPPOlDup-testR1: GC TATTGC GGTGCGTATCC
OsPPOlDup-testR2: TCCAAGCTAGGGGTGAGAGA
The test result was shown in Figure 27; chromosome fragment duplication events
were
detected through the sequencing of PCR products using primers OsPPO1Dup-testF2
or
OsPPO1Dup-testR2 and DNA extracted from pQY2648, pQY2650, pQY2651 and pQY2653
transformed rice protoplast samples; small fragments of DNA were missing
between two
DNA break sites at the expected fragment junction regions. The protoplast test
result of
pQY2650 demonstrated that the Cas9 without NLS could cut the target
effectively to
produce and detected the doubling event of chromosome fragments between
targeted cuts
when chromosomes were edited with the dual-target editing vector. The result
of pQY2653
protoplast test demonstrates that the assembled gRNA could effectively guide
the target
editing in the event of separately expressed crRNA and tracrRNA to produce and
detect
doubling event of chromosome fragments between targeted cutting sites. The
pQY2651
protoplast test result demonstrated that NLS-free Cas9 could work with
separately expressed
crRNA and tracrRNA and the spontaneously assembled gRNA to effectively guide
target
editing to produce and detect doubling event of chromosome fragments between
cuts, which
indicated that the creation of new genes through doubling/duplication,
inversion, or
translocation of chromosome fragments using the method of the present
invention was
independent of the nuclear localization signal of Cas9 protein or the fused
single guide RNA
(sgRNA) system.
Example 14: Different chromosome fragment translocation and restructureto
createa new HPPD gene in rice
As mentioned in example 1 and example 4,rice HPPD gene is located on
chromosome 2,
CP12 gene is located on chromosome 1 but in opposite
direction.ThroughCRISPR/Cas9-mediated chromosome cutting andnaturally occurred
inversion of CP12 and PPO1 gene protein coding regions-containing fragmentand
followed
by the chromosomalfragments fusion, a new gene was generated in which CP12
promoter
drives PPO1 expression, andas expected PPO1 expression was significantly
enhanced,and
conferred rice plant herbicide resistance. Taking advantage of thehigh
expression
characteristics of the CP12 promoter, a dual-target editing vector was
designed and
constructed, which cut thetwo regions upstream two start codons ATGs.After
Agrobacterium-mediatedtransformation and followed by selection and plant-
regeneration, a
186
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
new HPPD gene in which CP12 promoter drives HPPD protein expression was
identified
through PCRand amplicon sequencing.
According to the analysis of rice gene expression profile data
(http://rice.plantbiology.msu.edu/index.shtml) provided by the international
rice genome
sequencing project (International Rice Genome Sequencing Project),CP12 gene
expression
intensity isdozens to hundred times that of HPPD gene in rice leaf blade, CP12
gene
promoter isstrong in leaf blades and seedlings.
With reference to example 1 and example 2, the related genomic DNA sequences
of
rice HPPD and CP12 genes were input into CRISPOR online tool
(http://crispor.tefor.net/)
to find and assess available edit targets. After online scoring, the following
targets (5'-3')
were selected between the promoters and protein coding regions of HPPD and
CP12 genes
for testing:
HPPD-guide RNA1 gtgctggttgccttggctgc
HPPD-guide RNA2 cacaaattcaccagcagcca
CP12-guide RNA1 gccatggctggctgttgatg
CP12-guide RNA2 cggatttctgcgtgtgatgt
HPPD-guide RNA1 and HPPD-guide RNA2 are located between HPPD gene promoter
and protein coding region and close to HPPD protein start codon ATG, while
CP12-guide
RNA1 and CP12-guide RNA2 are located between CP12 gene promoter and protein
coding
region and close to CP12 protein start codon ATG.
For the above-mentioned targets the following primersweredesigned and
synthezed, the
double-target editors pQY2257, pQY2258, pQY2259, pQY2260 were constructed with
expectation ofthe editing eventsin whichCP12 promoter driving HPPD protein
coding
region could be identifiedafter transformation and selection with hyg,as shown
in Figure 28.
Primer ID DNAsequence(5 to 3')target sequences are underlined
HPPD-sgRNAl-F
taggtctccggcmtgctggttgccttggctgottttagagctagaaatagcaagttaaaataaggc
HPPD-sgRNA2-F
taggtctccggcgcacaaattcaccagcagccagttttagagctagaaatagcaagttaaaataaggc
CP12-sgRNA1 -R taggtctccaaaccatcaacagccagccatggcgcttettggtgccgcg
CP12-sgRNA2-R taggtctccaaacacatcacacgcagaaatccggcttcttggtgccgcg
Wherein, guide RNA combinations in each editing vector:
pQY2257 contains the combination of HPPD-guide RNAland CP12-guide RNA1,
pQY2258 contains the combination of HPPD-guide RNA1 and CP12-guide RNA2
combination,
pQY2259 contains the combination of HPPD-guide RNA2 and CP12-guide RNA1
combination,
pQY2260 contains the combination of HPPD-guide RNA2 and CP12-guide RNA2
combination.
With reference to the example 1 for rice protoplast transformation method,the
above
187
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
pQY2257-2260 vectors with high purity and concentration of the plasmid DNA
were
prepared, and then the high-quality rice protoplast was prepared as well, PEG
mediated
transformation of the rice protoplast was carried out, and finally thegenome
editing and the
designed new gene wasexpected to be detected where CP12 promoter drives HPPD
gene
expression.
The following detecting primers, OsCP12pro-detection-F and OsHPPDutr-detection-
R,
were used to amplify the predicted fragment generated by the fusion of CP12
promoter and
HPPD coding region, and the length of PCR amplicon was expected to be 305 bp.
Similarly,
OsHPPDpro-detection-F and OsCP12cds-detection-R were used to detect the
fragment
produced by the fusion of HPPD promoter and CP12 coding region, and the length
of PCR
products was expected to be 445bp.
Primer ID Sequence(5' to 3')
OsCP12pro-detection-F ctgaggaggcgataagaaacga
OsIAPPDutr-detection-R
gtgtgggggagtggatgac
OsHPPDpro-detection-F caagagctttactccaagttacc
OsCP12cds-detection-R
acccgccctcggagttgg
The identification results showed that in pQY2257-transformed
protoplastsamples were
detected to have the CP12 promoter fused with the HPPD coding region, as shown
in figure
29. Whilein the pQY2259-transformed protoplast samples were detected to have
the HPPD
promoter fused with the CP12 coding region, as shown in figure 30.
The above results show that, using the method described in this invention, can
generaterecombination between two chromosome fragments derived from two
different
chromosomes, whichis expected to create the new genes as designed.
In this particular example,HPPD gene expression increasesdrivenby the strong
promoter of CP12 gene, meanwhileCP12 gene expression decreases driven by the
weak
promoter of HPPD gene.Therefore, the expressionlevel of the new genes
generated through
this invention can be regulated as needed by choice of a strong or weak
promoter.
Example 15: Creation of a newhigh-expression HPPD gene caused by chromosome
fragment duplication mediated by LbCpfl dual-target editing-rice protoplast
test
LbCpfl belongs to the Cas12a type of nucleases, recognizes a TTTV PAM site,
and
thus is suitable to edit a high AT-content DNA sequence; while Cas9 recognizes
a
NGGPAMsite and is suitable to edit a high GC-content DNA sequence. Therefore,
the DNA
scope of their editing ability is complementary to each other. In the rice
protoplast system,
the ability of LbCpfl to cut and then induce the chromosome fragment to
duplicate, i.e. to
create a new HPPD gene was tested, as shown in the Figure 31.
With reference to Example 1, the pHUE411 vector
(https://www.addgene.org/62203/)
was used as the backbone, and the sgRNA expression cassette was removed by
restriction
enzyme digestion.The SV40 NLS-LbCpfl-nucleoplasmin NLS gene fragment
synthesized in
188
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
GenScript Biotechnology Company (Nanjing, China) replaced the Cas9 CDS of
pHUE411.At 338kb downstream of HPPD gene is a high-expression Ubi2 gene with a
same
expression orientation. Thus, a duplication strategy was used to increase the
expression of
HPPD, which confers resistance to HPPD inhibitor herbicides. To this end,
acrRNA was
designed in the upstream of the start codon of rice HPPD gene:
5'accccccaccaccaactcctccc3',
and thesecond crRNA was designed in the upstream of the start codon of rice
UBI2 gene:
5'ctatctgtgtgaagattattgcc3'. A tandem crRNA sequence was synthesized with HH
ribozyme
and HDV ribozyme recognition sites at both ends, as shown below:
S'AAATTACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCTAATTTCTACT
AAGTGTAGATaccccccaccaccaactcctcccTAATTTCTACTAAGTGTAGATctatctgtgtgaagatt
attgccTAATTTCTACTAAGTGTAGATGGCCGGCATGGTCCCAGCCTCCTCGCTGGCG
CCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGAC3'.It was connected to the end
of LbCpfl protein expression cassettein the vector according to the operating
instructions of
the Seamless Cloning Kit from HB-infusion Hanbio Biotechnology Co.Ltd.
(Shanghai,
China). The maize UBIl promoter was used to drive both Lbcpfl protein and
crRNA in the
same expression cassette.This vector was named pQY2658.
With reference to Example 1,
plasmidswithhigh-purityandhigh-concentrationwereprepared for PEG-mediated
transformation of rice protoplasts.After 48-72 hr of transformation protoplast
DNA was
extractedfordetectingduplication-editing events. The primers fromboth sides of
the
targetswere designedto cover the duplicated area, and the target fragment was
expected to
be 494bp.The primer sequencesare:
Ubi2pro-Primer 5: gtagcttgtgcgtttcgatttg
HPPDcds-Primer 10: tcgacgtggtggaacgcgag
The PCR amplification of the DNA extracted from the pQY2658 transformed rice
protoplasts forthe duplicated adapter fragments did produce bands with the
expected size,
and the sequencing result of the amplicon is consistent with the expected
chromosome
fragment duplicated adapter sequence. The sequencing result is shown in
SEQ.No.27.
The test results onprotoplasttransformed with pQY2658 proved that LbCpfl
nuclease
can effectively cleave the target, generatethe detectableduplication of
chromosome
fragments between the targeted cut sites. It shows that the present invention
can be used to
create new genes through the duplication, inversion, or translocation of
chromosome
fragments, which can also be realized on the nuclease system of Cas12a.
Example 16: OsCATC gene connected to the chloroplast signal peptide domain
through deletion of a chromosome segment
Three genes of rice, namely glycolate oxidase OsGL03, oxalate oxidase 0s0X03
and
catalase OsCATC, form a photorespiratory branch, which was referred to as GOC
branch.
189
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
The glycolic acid produced by photorespiration could be directly catalyzed
into oxalic acid
in chloroplast and finally completely decomposed into CO2 by introducing the
GOC branch
into rice by transgene and locating it in the chloroplast, thereby creating a
photosynthetic
CO2 concentration mechanism similar to C4 plants, which helped improve the
photosynthetic efficiency and yield of rice (Shen et al. Engineering a New
Chloroplastic
Photorespiratory Bypass to Increase Photosynthetic Efficiency and Productivity
in Rice.
Molecular Plant, 2019, 12(2): 199-214).
By using the method presented by the invention, the protein domains of
different genes
could be recombined by non-transgenic method to add chloroplast signal domains
to genes
that required chloroplast localization. Primer OsCATC-sgRNAl:
5'gtcctggaacaccgccgcgg3'
was designed at the end of the chloroplast signal peptide domain of LOC4331514
gene of
upstream 28Kb of OsCATC gene; OsCATC-sgRNA2:51atcagccatggatccctaca31 was
designed
in the first five amino acid coding regions of OsCATC gene. The chloroplast
signal peptide
domain of L0C4331514 gene was expected to fuse with the coding region of
OsCATC gene
to produce a new CATC gene located in chloroplast after the removal of inter-
target
fragment. Dual-target editing vector pQY2654 was constructed by the method
stated in
Example 1, and the primers used were
OsCATC-sgRNAl-For2654F:taggtctccggcggtcctggaacaccgccgcggGTTTAAGAGCTATGC
TGGAAACAGC, and
OsCATC-sgRNA2-For2654R:taggtctccaaactgtagggatccatggctgatgcttcttggtgccgcg.
High-purity and high-concentration plasmids were prepared for PEG-mediated
transformation of rice protoplast; the protoplast DNA was extracted for
detection of deletion
edit event; detection primers were designed to extend the linker segment after
the middle
28Kb chromosome segment deletion for the targets on both sides; sequencing was
performed, and the primer sequences were shown below:
OsCATC-TestF: ccacaaaacgagtggctcag
OsCATC-TestR: gtgagcgagttgttgttgttcc
OsCATC-seqF: ctcttccctccactccactg
The test result was shown in Figure 32. The extraction of DNA from pQY2654
transformed rice protoplast could detect chromosome fragment deletion event
through PCR
amplification of the expected junction region after the targeted deletion, and
then
sequencing; the chloroplast signal peptide domain of L0C4331514 gene was fused
with the
coding region of OsCATC gene to create a new gene; the sequencing result was
shown in
SEQ ID No: 28. The protoplast test result of pQY2654 indicates that new genes
combined
from new protein domains could be created through the deletion of chromosome
segments
between different protein domains by using the method of the present
invention.
Example 17: OsGLO3 gene connected to the chloroplast signal peptide domain
190
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
through inversion of a chromosome segment
As stated in Example 16, the OsG103 gene also needed to be heterotopically
expressed
in chloroplasts to improve the photosynthetic efficiency of rice. Hence, for
the OsGLO3
gene, OsGL03-gRNA1:5'gtcctggaacaccgccgcgg3' was designed at the end of
chloroplast
signal peptide domain of the L0C4337056 gene of the upstream 69Kb, and
OsGLO3-sgRNA2:5'tgatgacttgagcagagaaa3' was designed in the initiation codon
region of
the OsCATC gene; the chloroplast signal peptide domain of the L0C4337056 gene
was
expected to fuse with the coding region of OsGLO3 gene to produce the new GLO
gene
located in chloroplast after the inversion of inter-target fragments. Dual-
target editing
vector pQY2655 was constructed as described in Example 1 using primers
OsGL03-sgRNA1-For2655F:taggtctccggcgcgatgcttggtggcaagtgcGTTTAAGAGCTATGCT
GGAAACAGC and
OsGL03-sgRNA2-For2655R:taggtctccaaactttctctgctcaagtcatcagcttcttggtgccgcg. High-
purity
and high-concentration plasmids were prepared for PEG-mediated transformation
of rice
protoplast; the protoplast DNA was extracted for detection of inversion edit
event; detection
primers were designed to extend the linker segment after the middle 69Kb
chromosome
segment inversion for the targets on both sides; sequencing was performed, and
the primer
sequenceswere shown below:
OsGL03-TestF1: cctccttgttcgtgttctccg
OsGL03-TestF2: cggtcggttggttcatttcagg
OsGL03-TestRl: catccagcagtgtgctaccag
OsGL03-TestR2: cttgagaaggcctccctgttc
The test result was shown in Figure 33. The extraction of DNA from pQY2655
transformed rice protoplast could detect chromosome fragment inversion event
through PCR
amplification of the expected junction region after the targeted inversion,
and then
sequencing; the chloroplast signal peptide domain of L0C4337056 gene was fused
with the
coding region of OsCATC gene to create a new gene; the sequencing result was
shown in
SEQ ID NO: 29 The protoplast test result of pQY2655 indicated that new genes
combined
from new protein domains could be created through the inversion of chromosome
segments
between different protein domains by using the method of the present
invention.
Example 18: Creation of Herbicide-resistant Rice through Knock-up of
Endogenous PPO2 Gene Expression
The rice PPO2 gene was located on rice chromosome 4; bioinformatics analysis
indicated that the S-adenosylmethionine decarboxylase (hereinafter referred as
"SAMDC")
gene was approx. 436kb downstream the PPO2 gene; the PPO2 gene and SAMDC gene
had
the same transcription direction on the chromosome. According to the analysis
performed
with the rice gene expression profile data
(http://rice.plantbiology.msu.edu/index.shtml)
191
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
from the International Rice Genome Sequencing Project, the expression
intensity of
SAMDC gene in rice leaves was tens to hundreds of times that of PPO2 gene; the
promoter
of SAMDC gene was a strong and constitutive express promoter.
For the rice PPO2 gene, the genomic DNA sequence of rice PPO2 and SAMDC was
entered into the CRISPOR online tool (http://crispor.tefor.net/) respectively,
to seek
available edit targets following the procedures stated in Examples 1 and 2.
Based on the
online scoring, the following targets were selected for test between the
promoter and CDS
region of PPO2 and SAMDC genes:
PPO2 -guide RNA1 gatttacttgttgtcttgtg
PPO2 -guide RNA2 ttggggctcttggatagcta
SAMDC-guide RNA1 ggttggtcagaacactgtgc
SAMDC-guide RNA2 actgtgccggagatggagga
PPO2-guide RNA1 and PPO2-guide RNA2 were close to the initiation codon ATG of
PPO2 between the promoter and CDS region of PPO2 gene, (i.e. 5'UTR); SAMDC-
guide
RNA1 and SAMDC-guide RNA2 were also close to the SAMDC protein initiation
codon
between SAMDC gene promoter and CDS region (i.e. 5'UTR).
The following primers were designed for above-noted targets; dual-target edit
vectors
pQY1386 and pQY1387 were constructed, and the edit event of chromosome
fragment
duplication between two targeted cuts was expected to be achieved; the novel
gene
expressed by PPO2 CDS driven by SAMDC promoter was produced at the duplication
fragment linker, as shown in Figure34.
Primer ID DNA sequence (5' to 3')
taggtctccggeggatttacttgttgtettgtgGTTTAAGAGCTATGCT
PP02-esgRNA1-F
GGAAACAGC
taggtctccggcgttggggctcttggatagctaGTTTAAGAGCTATGC
PPO2-esgRNA2-F
TGGAAACAGC
SAMDC-esgRNAl-R taggtctccaaacgcacagtgttctgaccaaccgcttcttggtgccgcg
SAMDC-esgRNA2-R taggtctccaaactcctccatctccggcacagtgcttcttggtgccgcg
Wherein,
pQY1386 contains the combination of PPO2-guide RNA1 and SAMDC-guide RNA1
pQY1387 contains the combination of PPO2-guide RNA2 and SAMDC-guide RNA2.
Vector plasmids were extracted, and agrobacterium strain EHA105 was
electrotransformed. Agrobacterium tumefaciens-mediated transformation was
performed
with rice variety Jinjing 818 as the receptor by the method stated in Example
2. Several
rounds of callus identification were conducted during the transformation and
selection, and
positive calli of duplication events were selected for differentiation.
The detection primers in the table below were used to amplify the fragments
containing
target sites on both sides or the fragments produced from the fusion of
predicted SAMDC
192
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
promoter and PPO2 coding region; the length of PCR product was expected to be
300-1000
bp; the primer5-F+primer4-R combination was used to detect the fusion segment
at the
intermediate linker after chromosome fragment duplication; the predicted
product length
was 912 bp.
Primer ID Sequence (5' to 3')
OsPPO2duplicated-primer1-F tctcggacaaacagtgcaccc
OsPPO2duplicated-primer2-F caaattgtgggccgtatgcacg
OsPPO2duplicated-primer3-R gcttcctcagcctgtacgcc
OsPPO2duplicated-primer4-R acccgccctcggagttgg
OsPPO2duplicated-primer5-F gtgcagtaagtggatgtactaatggagtc
OsPPO2duplicated-primer6-F gccggaggcgtgaagaagttcca
OsPPO2duplicated-primer7-R .. gacacaatggtgcaccgtgc
OsPPO2duplicated-primer8-R ggactcagagaggacataggagtc
According to the final identification result, duplication edit events were
detected in
QY1386/818-28# and QY1386/818-62# calli; the sequencing result at the
duplication
fragment linker was shown in SEQ ID NO: 30andSEQ ID NO: 31;The sequence
alignment
result was shown in Figure35; the result at #62 callus linker was exactly in
line with
expectations; seamless connection was observed, but duplication edit event was
not detected
in later differentiated seedlings.
Five duplication edit events were detected in the calli of QY1837; the
sequencing
results at the duplication fragment linker were shown inSEQ ID NO: 32, SEQ ID
NO: 33,
SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36; some sequence alignment
results
were shown in Figure36.
Duplication events were detected in QY1837 differentiated seedlings; the
results of the
PCR amplified products and the sequencing at chromosome duplication linkers,
PPO2
targets and SAMDC targets of some TO seedlings were given below:
TO seedling No. Genotype at duplication point PPO2 target
SAMDC target
1387/818-2 Heterozygosis: Seamless, -2bp +T, -11bp -6bp
1387/818-4/6/7 Heterozygosis: Seamless, -2bp +T, -11bp -2bp
Heterozygosis, Heterozygosis,
1387/818-36 No duplication detected
doublet doublet
Heterozygosis, Heterozygosis,
1387/818-38 Heterozygosis: Seamless, -2bp
doublet doublet
The result of comparison of 1387/818-2 with the sequencing peak diagram was
shown
in Figure37; it was obvious that novel PPO2 gene expressed by PPO2 driven by
SAMDC
promoter developed in the genome; small fragments were deleted on both sides
of the target,
but this did not affect the integrity of CDS region reading frame.
Quantitative PCR detection of the relative expression of PPO2 gene was
performed for
TO-generation differentiated seedlings 1387/818-2, 1387/818-4 and 1387/818-6;
the
experiment operation was in line with Example 2; the quantitative PCR primer
sequence
was 5'-3 as follows:
193
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
UBQ5-F ACCACTTCGACCGCCACTACT
UBQ5-R ACGCCTAAGCCTGCTGGTT
RT-OsPP02-F GTATGGCTCTGTCATTGCTGGTG
RT-OsPP02-R GTTTATTCCTTCCTTTCCCTGGC
RT-OsSAMDC-F ACCTATGGTTACCCTTGAAATGTG
RT-OsSAMDC-R CTGGGATAATGTCAGAGATGCC
With UBQ5 as the internal control, the result was shown in Figure 35; compared
with
the wild-type rice Jinjing 818 control, the PP02 gene expression of double-
edited seedlings
increases significantly, while SAMDC expression decreases relatively.
The herbicide resistance of TO seedlings of 1387/818-2 and 1387/818-4 was
preliminarily determined as stated in Example 6; wild-type Jinjing 818
seedlings with
similar plant heights were taken as the control, and compound A was applied to
them and TO
seedlings at the same time at a chemical concentration of 0.6 g a.i./mu; the
culture
temperature was kept at 28 C on a 16 (light) + 8 (dark) basis; pictures were
taken to record
the results 7 days after application, as shown in Figure 36. The TO seedlings
of 1387/818-2
and 1387/818-4 were a little dried-up at the top, while a few drug spots
appear on the leaf
surface; the wild-type Jinjing 818 withered and died; the result indicated
that the SAMDC
promoter-driven high expression of PPO2 protein enables rice to resist PPO
inhibitor
herbicides.
Example 19: Creation of herbicide-resistant rice through knock-up expression
of
the endogenous OsPPO2 gene caused by CRISPR/Cas9targetedchromosome cutting
and inversion afterAgrobacterium-mediated transformation
With reference to Example 4 to operate0sPP02 gene, OsZFF (LOC OSO4G41560), a
highly expressed gene at 170kb downstream from OsPPO2 in the opposite
direction, was
selected to design two sgRNAs targeting in the regions close to the protein
start codons
ATGs, and a dual-target editing vector pQY2611 was constructed. Similarly, to
increase the
inversion probability, the downstream 40kb from 0sPP02 and highly expressed
gene
OsNPP (LOC 0504G41340) in the opposite direction of 0sPP02 was also selected
to
design another two sgRNAs targeting in the regions close to the protein start
codons ATGs,
and another dual-target editing vector pQY2612 was constructed. The three
selected targets
were shown as the following table. It was expected that the editing could
produce
double-strand DNA cut and then the inversion of chromosome fragments between
the
targets to form a new gene with high expression of PP02, respectively, as
shown in Figure
40:
0sPP02-guide RNA2 ttggggctcttggatagcta
560-guide RNA3 agttagtttagtcgtctcga
340-guide RNA4 tccggtggcgtctgtttggt
The following primers were used to construct the vectors:
Primer ID Sequence (5' to 3')
0sPP02-sgRNA2-F taggtctccggcgttggggctcttggatagctaGTTTAAGAGCTATGCTGGAA
194
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
ACAGC
560-sgRNA3-R
taggtctccaaactcgagacgactaaactaactgcttcttggtgccgcg
340-sgRNA4-R taggtctccaaacaccaaacagacgcaagacaagcttcttggtgccgcg
Wherein,
pQY2611 contains the combination of OsPPO2-guide RNA2 and 560-guide RNA3
pQY2612 contains the combination of OsPPO2-guide RNA2 and 340-guide RNA4
pQY2611 contains the combination of OsP02-guide RNA2and560-guide RNA3
pQY2612 contains the combination of OsP02-guide RNA2and340-guide RNA4
The vector plasmid was extracted and transformed into Agrobacterium tumefacien
strain EHA105.The rice variety Jinjing 818 was used as the receptor for
Agrobacterium-mediated transformation, and the transformation method was
referred to
Example 2.Several rounds of callus identification were carried out during the
transformation-postselection process, and the callus with positive inversion
events was
selected for differentiation.
The detecting primers in the table below were used to amplify the fragments
containing
both target sites and the fused fragment betweenthe predicted 560 promoter and
the PPO2
coding region. The length of the PCR amplicon was expected 300-1000 bp.Primer2-
F +
Primer12-R and Primer3-F + Primer10-R were used to detect fused fragments at
the junction
of OsZFF after chromosome fragmentation and then inversion, and the expected
amplicon
lengths were 512bp and 561bp, respectively. Similarly, Primer2-F + Primer6-R
and
Primer3-F + Primer7-R were used to detect the fused fragments at the junction
of OSNPP
after chromosome fragmentation and then inversion, and the expected amplicon
lengths
were 383bp and 666bp, respectively.
Primer ID Sequence (5' to 3')
OsPPO2 inverted-primer2-F
caaattgtgggccgtatgcacg
OsPPO2 inverted-primer12-R
cacgtctccactctcccagcc
OsPPO2 inverted-primer3-F gcttcctcagcctgtacgcc
OsPPO2 inverted-primer1O-R
Gcccgtgcagcctagccatc
OsPPO2inverted-primer6-R ccacctccccggcggtactg
OsPPO2inverted-primer7-R
gatatgccggaccggacatgt
The pQY2611-transformed calli were identified through PCR and amplicon
sequencing.
292 samples were identified, 19 of which were positivefor the inversion.The
identified
inversion event genotypes were shown as following table:
Junction sequence between Junction sequence between
Positive callus ID inverted PPO2coding region inverted ZFFcoding region
and ZFF promoter region and PPO2 promoter region
2611/818-3 -4bp, homozygous +T, homozygous
2611/818-10 seamless, homozygous no identification
2611/818-13 -2bp, homozygous -lbp,
homozygous
195
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
2611/818-21 seamless, homozygous +T, homozygous
2611/818-24 seamless, homozygous not detect
-26bp,
2611/818-53 not detect
messychromatogrampeaks
-30bp,
2611/818-54 not detect
messychromatogrampeaks
-26bp,
2611/818-55 not detect
messychromatogrampeaks
2611/818-67 -30bp, homozygous not detect
2611/818-83 seamless, homozygous +T,
messychromatogrampeaks
2611/818-85 seamless, homozygous not detect
2611/818-90 +418bp, homozygous not detect
2611/818-92 -2bp, homozygous +T,
messychromatogrampeaks
2611/818-102 seamless, homozygous +T,
messychromatogrampeaks
2611/818-106 seamless, homozygous +T,
messychromatogrampeaks
2611/818-107 -2bp, homozygous +T,
messychromatogrampeaks
2611/818-108 -2bp, heterozygous not detect
2611/818-109 heterozygous not detect
2611/818-121 -22bp, homozygous not detect
The sequencing results of the OsZFF promoter fused with OsPPO2 CDS region were
shown in Seq No.37, Seq No.38, Seq No.39, Seq No.40, Seq No.41, Seq No.42, Seq
No.43.The alignment comparison results of 2611/818-10 and 2611/818-13
chromatogram
peaks are shown in Figure 41.The events 2611/818-3, 2611/818-10, 2611/818-54
were
differentiated further and obtained inversion positive TO plants.
Similarly, pQY2612-transformed calli were identified for inversion events. A
total of
577 callus samples were identified, and 45 callus samples were detected to be
positive for
the inversion.The genotypes of inversion events detected were shown as
following table:
Positive
genotype of inverted PPO2 genotype of inverted NFF
callusID
2612/818-5 seamless, homozygous -1 A,
homozygous
2612/818-29 seamless, homozygous not detect
2612/818-34 -3bp, homozygous not detect
2612/818-62 seamless, homozygous not detect
2612/818-64 seamless, homozygous not detect
2612/818-66 +1 T, homozygous not detect
2612/818-129 seamless, homozygous Seamless,
homozygous
2612/818-156 seamless, homozygous Seamless,
homozygous
2612/818-157 seamless, homozygous Seamless,
homozygous
2612/818-366 seamless, homozygous -5bp
2612/818-377 -3 lbp, the start codon is broken,homozygous not detect
196
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
2612/818-419 seamless, homozygous +lbp T
2612/818-444 Seamless, homozygous
Seamless,homozygous
2612/818-457 Seamless, homozygous
Seamless, homozygous
2612/818-497 +1 T, homozygous -3bp,
homozygous
The sequencing results of the OsNPP promoter fused OSPPO2 CDS region were
shown
in Seq No.44, Seq No.45, Seq No.46, and Seq No.47. The sequencing results of
events
2612/818-5 and 2611/818-34 and the chromatogrampeaks are shown in Figure
42.Eventually only event 2612/818-29 was differentiated successfully and
obtained a
positive TO plant with desired inversion.
Example 20: Test on creation of novel PPO2 gene with maize protoplasts
As shown in Example 7, the gene distribution on chromosomes was collinear
among
different plants; the method for successful creation of novel genes like
EPSPS, PP01, PPO2
and HPPD in new mode of expression was versatile among other plant species.
According to
Example 18, novel PPO2 gene was created through the PPO2 gene selection in
maize and
the duplication of chromosome fragments between maize SAMDC genes, and then
dual-target edit vectors were constructed for maize protoplast test.
The following targets were selected for test between the promoter and CDS
region of
PPO2 and SAMDC genes: ZmPP02-sgRNA1:5'ggatttgcttgttgtcgtgg3' was close to the
initiation codon ATG of PPO2 protein between the promoter and CDS region of
PPO2 gene
(i.e. 5'UTR). ZmSAMDC-sgRNA2:5'gtcgattatcaggaagcagc3 and
ZmSAMDC-sgRNA3:5'acaatgctggagatggaggg3' were close to the SAMDC protein
initiation
codon ATG between the promoter and CDS region of SAMDC gene(i.e. 5'UTR).
Dual-target edit vectors pQY1340 and pQY1341 were constructed using the
following
primers designed for above-noted targets.
Primer ID DNA sequence (5' to 3')
TaggtctccggcgggatttgcttgttgtcgtggGTTTAAGAGCTATGCT
ZmPP 02-sgRNAl-F
GGAAACAGC
ZmSAMDC-sgRNA2-R Taggtctccaaacgtcgattatcaggaagcagctgcaccagccgggaatcgaac
ZmSAMDC-sgRNA3-R Taggtctccaaacacaatgctggagatggagggtgcaccagccgggaategaac
Wherein, pQY1340 contained ZmPP02-sgRNA1 and SAMDC-sgRNA2 targets
combination, while pQY1341 contained ZmPP02-sgRNA1 and SAMDC-sgRNA3 targets
combination.
High-concentration plasmids were prepared for above-noted vectors and used for
the
protoplast transformation in maize following the procedures stated in Example
1 for
preparation and transformation of rice protoplasts; it was slightly different
from rice in that
a vacuum degree of 15 pa should be maintained for 30 minutes before
enzymolysis so that
the enzymatic hydrolysate contacts the cells more adequately; the maize
variety used was
B73.
The detection primers in the table below were used to amplify the fragments
containing
target sites on both sides or the fragments produced from the fusion of
predicted SAMDC
promoter and PPO2 coding region; the length of PCR product was expected to be
300-1100
197
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
bp; the ZmSAMDC test-F1+ ZmPPO2 test-R2 combination was used to detect the
fusion
segment at intermediate linker after chromosome fragment duplication; the
expected
product length was approx. 597 bp; inner primer ZmSAMDC test-F2 was used for
sequencing.
Primer ID DNA sequence (5' to 3')
ZmSAMDC test-Fl gggtggcaaaaagtctagcag
ZmSAMDC test-R1 ggtgagcaggagcttggtag
ZmSAMDC test-F2 cggaggcgtgaagaagttccag
ZmSAMDC test-R2 ccgtgcaagatccagaacagag
ZmPPO2 test-Fl gccatcctgagacctgtagc
ZmPPO2 test-R1 gcacaagggcataaagcaccac
ZmPPO2 test-F2 gcagtccgaccatacccatacc
ZmPPO2 test-R2 cctcgaaggcacaaacacgtac
1% agarose gel electrophoresis test was performed for the PCR reaction
product, and
the result indicated that the predicted positive band (approx. 597 bp) into
which the
ZmSAMDC promoter and ZmPPO2 coding region were fused was detected in all
pQY1340
and pQY1341 transformed maize protoplast samples. Positive fragments were
sequenced,
and the PPO2 duplication event sequencing result of pQY1340 vector transformed
protoplast test was shown in SEQ ID NO: 48; the PPO2 duplication event
sequencing result
of pQY1341 vector transformed protoplast test was shown in SEQ ID NO: 49. The
result of
comparison with the sequence at predicted chromosome segment duplication
linker was
shown in Figure43, indicating that the SAMDC gene promoter and the PPO2 gene
expression region can be linked up directly to create novel PPO2 gene with
strong
promoter-driven expression; thus, it's obvious that the method provided by the
present
invention for creating novel genes was also applicable to maize.
Example 21: Creation of novel PPO2 gene in wheat protoplast test
According to Example 18, in wheat the chromosome fragment region between PPO2
gene and SAMDC gene was selected for dual-target editing to create the novel
gene
expressed by PPO2 coding region driven by the SAMDC promoter. Wheat was
hexaploid,
so there were 3 sets of PPO2 genes and SAMDC genes in genomes A, B, and D. The
TaPP02-2A (TraesCS2A02G347900) gene was located at the wheat 2A chromosome,
and
the TaSAMDC-2A (TraesCS2A02G355400) gene was approx. 11.71Mb downstream; since
the TaSAMDC-2A and TaPP02-2A gene transcriptions are in opposite directions on
the
same chromosome, it's necessary to choose inversion editing strategy, as shown
in Figure44;
TaPP02-2B (TraesCS2B02G366300) was located at the wheat 2B chromosome, and
TaSAMDC-2B (TraesCS2B02G372900) was 9.5 Mb downstream; since TaSAMDC-2B and
TaPP02-2B gene expressions are in the same direction on the chromosome, the
duplication
editing strategy should be used, as shown in Figure45; TaPP02-2D
(TraesCS2D02G346200)
was located at the wheat 2D chromosome, and TaSAMDC-2D (TraesCS2D02G352900)
was
8.3 Mb downstream; since the TaSAMDC-2D and TaPP02-2D gene transcriptions are
in the
same direction on the chromosome, the duplication edit event should be
selected, as shown
in Figure46.
198
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
The DNA sequence of wheat ABD gene group PPO2 and SAMDC gene was entered
into the CRISPOR online tool (http://crispor.tefor.net/) respectively, to seek
available edit
targets. Based on the online scoring, the following targets were selected for
test between the
promoter and CDS region of PPO2 and SAMDC genes:
Primer ID DNA sequence (5' to 3')
2A guide RNAI GCGGAGTACTAGTAGGTACG
2A guide RNA2 TGTGAATTTGTTTCCTGCAG
2A guide RNA3 ATGACGCAGAGCACTCGTCG
2A guide RNA4 CTTCTCGTAGTTTAGGATTT
2B guide RNAI CCCTCCTACCTACTACTCCG
2Bguide RNA2 TGTGACATTTTTTTCATCTT
2Bguide RNA3 CGAAGGCGACGACGGAGAGC
2Bguide RNA4 TCACTTCTGTTCAGACATTT
2Dguide RNAI CCGCGGAGTAGTAGGTAGCA
2Dguide RNA2 GCTTCACGATAATCGACCAG
2Dguide RNA3 CGATGACGCCGACGCAGAGC
2Dguide RNA4 CCAATCTCTCTGGCCTGCTT
2A guide RNAI and 2A guide RNA2 were close to the initiation codon of PPO2
protein
between the promoter and CDS region of PPO2 gene (i.e.5'UTR); 2A guide RNA3
and 2A
guide RNA4 were close to the SAMDC protein initiation codon between SAMDC gene
promoter and CDS region (i.e.5'UTR). 2B and 2D followed the same principle as
above.
The following primers were designed for above-noted targets to construct the
vector
with pHUE411 vector (https://www.addgene.org/62203/) as the framework using
the
method presented in "Xing fit, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang
XC,
Chen QJ. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC
Plant Biol.
2014 Nov 29;14(1):327".
Primer ID DNA sequence (5' to 3')
TaPPO2A-T2 for taggtctccggcgGCGGAGTACTAGTAGGTACG
2626/2627BsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCA-for taggtctccaaacTGTGAATTTGTTTCCTGCAG
2627/2629BsaIR gcttcttggtgccgcg
TaPPO2A-T2 for taggtctccggcgATGACGCAGAGCACTCGTCG
2628/2629BsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCA-for taggtctccaaacCTTCTCGTAGTTTAGGATTT
2626/2628BsaIR gcttcttggtgccgcg
TaPPO2B-T2 for taggtctccggcgCCCTCCTACCTACTACTCCG
2630/263 lBsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCB for taggtctccaaacTGTGACATTTTTTTCATCTT
2630/2632BsaIR gcttcttggtgccgcg
TaPPO2B for taggtctccggcgCGAAGGCGACGACGGAGAGC
2632/2633Bsaff GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCB for taggtctccaaacTCACTTCTGTTCAGACATTT
199
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
263 1/263 3BsaIR gcttcttggtgccgcg
TaPPO2D for taggtctccggcgCCGCGGAGTAGTAGGTAGCA
2635/2636BsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCD for taggtctccaaacGCTTCACGATAATCGACCAG
2634/2636BsafR gcttcttggtgccgcg
TaPPO2D for taggtctccggcgCGATGACGCCGACGCAGAGC
2636/2637BsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCD for taggtctccaaacCCAATCTCTCTGGCCTGCTT
2635/2637BsaIR gcttcttggtgccgcg
The following dual-target combined gene edit vectors were constructed using
the
method described in the literature above. To be more specific, pCBC-MT1T2
plasmid
(https://www.addgene.org/50593/) was used as template to amplify dual-target
fragments
sgRNA1+3, sgRNA1+4, sgRNA2+3 and sgRNA2+4 to construct the sgRNA expression
cassettes. BsaI digests the pHUE411 vector framework, and the gel was
recovered; the
target fragment was used for ligation reaction directly after digestion. T4
DNA ligase was
used to link up the vector framework and target fragment, and the ligation
product was
transformed to the Trans5a competent cell; different monoclonal sequences were
selected;
after the sequences were confirmed by sequencing to be correct, the Sigitech
small-amount
high-purity plasmid extraction kit was used to extract plasmids and attain
recombinant
plasmids, which were respectively named as pQY2626, pQY2627, pQY2628, pQY2629,
pQY2630, pQY2631, pQY2632, pQY2633, pQY2634, pQY2635, pQY2636, and pQY2637
as follows:
pQY2626 contains the combination of 2A-guide RNA1 and 2A-guide RNA3
pQY2627 contains the combination of 2A-guide RNA1 and 2A-guide RNA4
pQY2628 contains the combination of 2A-guide RNA2 and 2A-guide RNA3
pQY2629 contains the combination of 2A-guide RNA2 and 2A-guide RNA4
pQY2630 contains the combination of 2B-guide RNA1 and 2B-guide RNA3
pQY263 1 contains the combination of 2B-guide RNA1 and 2B-guide RNA4
pQY2632 contains the combination of 2B-guide RNA2 and 2B-guide RNA3
pQY2633 contains the combination of 2B-guide RNA2 and 2B-guide RNA4
pQY2634 contains the combination of 2D-guide RNA1 and 2D-guide RNA3
pQY2635 contains the combination of 2D-guide RNA1 and 2D-guide RNA4
pQY2636 contains the combination of 2D-guide RNA2 and 2D-guide RNA3
pQY2637 contains the combination of 2D-guide RNA2 and 2D-guide RNA4
High-concentration plasmids were prepared for above-noted vectors and used for
the
protoplast transformation in wheat following the procedures stated in Example
1 for
preparation and transformation of rice protoplasts; it's slightly different
from rice that a
vacuum degree of 15 pa should be maintained for 30 minutes before enzymolysis
so that the
enzymatic hydrolysate contacts the cells more adequately. The variety of wheat
used was
KN199; the seeds were from the Teaching and Research Office on Weeds, School
of Plant
Protection, China Agricultural University, and were propagated at our lab; the
wheat seeds
were sown in small pots for dark culture at 26 C for approx. 10 d - 15 d;
stems and leaves of
200
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
the etiolated seedlings were used to prepare protoplasts.
The detection primers in the table below were used to PCR amplify the
fragments
containing target sites on both sides or the fragments produced from the
fusion of predicted
SAMDC promoter and PPO2 coding region; the length of PCR product was expected
to be
300-1100 bp; the ZmSAMDC test-F1+ ZmPPO2 test-R2 combination was used to
detect the
fusion segment at intermediate linker after chromosome fragment duplication;
the PCR
product length was expected to be 300-1100 bp; primer pair combinations
TaSAMDCA-g600F&TaPPO2A+g480R, TaSAMDCB-g610F &TaPPO2B+g470R, and
TaSAMDCD-g510F &TaPPO2D+g49OR were respectively used to test the fusion
segments
at intermediate linker after the chromosome fragment duplication or inversion
in the ABD
genome; the product length was expected to be approx. 1 kb.
Primer ID DNA sequence (5' to 3')
TaPPO2A-g330F TCACCAAAAATGTGTGCGCTCGTG
TaPPO2A+g48OR ACACAGGTCGCACCATTCGCTCCAACAC
TaPPO2B-g360F CACATTCACCAAAAATGTGTGTGCTCGACTG
TaPPO2B+g47OR AGGTCGCACCATTCGCCACAATCC
TaPPO2D-g340F TGGGTCCGTTTTTTATTGGGCGCTCAAG
TaPPO2D+g49OR CTCAATTCGCTCCAGCATTCGCCG
TaSAMDCA+g67OR CAGACCTCCATCTCGGGAATGATGTCG
TaSAMDCA-g600F TCCGTATGGCGCTTGTTCGTTGTTCG
TaSAMDCB+g62OR AGCACAGGAGACATGGCCATCAGCAG
TaSAMDCB-g610F GAATTTGCCGTGGCTTATGGCATCATG
TaSAMDCD+g67OR CCTCCATCTCAGGGATAATGTCAGAGATT
TaSAMDCD-g510F TACAGCATTCCGTCCCTGCTGTGAC
1% agarose gel electrophoresis test was performed for the PCR reaction
product, and
the result indicated that the predicted SAMDC promoter and the positive
strip/band of
approx. 1 kb in the PPO2 coding region fusion segment can be detected in the
pQY2626 and
PQY2627 transformed samples of the 2A genome, the pQY2630 and pQY2631
transformed
samples of 2B genome, and the QY2634, pQY2635 and pQY2636 transformed samples
of
2B genome.
PCR amplified positive fragments were sequenced, and the PPO2 inversion event
sequencing result of pQY2626 vector transformed protoplast test was shown in
SEQ ID NO:
50; the PPO2 inversion event sequencing result of PQY2627 vector transformed
protoplast
test was shown in SEQ ID NO: 51. The result of sequence comparison at
inversion linker of
predicted chromosome segment indicated that the TaSAMDC-2A gene promoter and
the
TaPP02-2A gene expression region can be linked up directly to create novel
PPO2 gene
with strong promoter-driven expression.
The PPO2 duplication event sequencing result of pQY2630 vector transformed
protoplast test was shown in SEQ ID NO: 52; the PPO2 duplication event
sequencing result
of pQY2631 vector transformed protoplast test was shown in SEQ ID NO: 53. The
result of
sequence comparison at duplication linker of predicted chromosome segment
indicated that
the TaSAMDC-2B gene promoter and the TaPP02-2B gene expression region can be
linked
201
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
up directly to create novel PPO2 gene with strong promoter-driven expression;
the result of
pQY2631 sequencing peak diagram comparison was shown in Figure45.
The PPO2 duplication event sequencing result of pQY2634 vector transformed
protoplast test was shown in SEQ ID NO: 54; the PPO2 duplication event
sequencing result
of pQY2635 vector transformed protoplast test was shown in SEQ ID NO: 55. The
PPO2
duplication event sequencing result of QY2636 vector transformed protoplast
test was
shown in SEQ ID NO: 56. The comparison with the predicted sequence at
chromosome
segment duplication linker indicated that TaSAMDC-2D gene promoter and TaPP02-
2D
gene expression region can be linked up directly to create novel PPO2 gene
with strong
promoter-driven expression; the result of pQY2635 sequencing peak diagram
comparison
was shown in Figure46.
According to the results of these protoplast tests, novel PPO2 genes expressed
by
TaPPO2 driven by TaSAMDC promoter can also be created through chromosome
segment
inversion or duplication in wheat; therefore, it's obvious that the method
presented in the
present invention for creating new genes was also applicable to wheat.
Example 22: Creation of herbicide-resistant rape with knock-up endogenous PP02
gene expression through agrobacterium tumefaciens-mediated transformation
Brassica napus was tetraploid, where the chromosome set was AACC; the
redundancy
between the A and C genomes enables the creation of new genes with different
combinations of gene elements through the deletion or rearrangement of
chromosome
segments. To create a rape germplasm resistant to PPO inhibitor herbicides,
the
up-regulation of endogenous PPO gene expression was a feasible technical
route. The
analysis of the genomic data of rape C9 chromosome shows that the 30S
ribosomal protein
S13 gene (hereinafter referred as 30SR) was located at approx. 23 kb upstream
the
BnC9.PPO2; both were in the same direction for transcription on the same
chromosome; the
expression levels of rape 30SR and BnC9.PPO2 in various tissues in rapeseed
were
analyzed with BrassicaEDB database (https://brassica.biodb.org/); 30 SR and
BnC9.PPO2
were principally expressed in leaves, and the expression level of 30SR was
significantly
higher than that of BnC9.PPO2; the PPO2 protein expression level was expected
to rise
when the novel gene expressed by BnC9.PPO2 CDS driven by 305R promoter was
created
by deleting the chromosome segment between 30SR promoter and BnC9.PPO2 CDS; in
that
way, rape gained herbicide tolerance.
Targets available were identified by finding the information on C9 chromosome
of
transformed receptor rape variety Westar at the rape database web site
(http://cbi.hzau.edu.cn/bnapus/); a total of 6 targets were selected:
BnC9.PPO2-guide RNA1 TTCCTGTATCCTTCTTCAG
BnC9.PPO2 -guide RNA2 AAGATGAGAGCTACGGATA
BnC9.PPO2 -guide RNA3 AACCCAACAGAAACGCGTC
BnC9.PPO2 -guide RNA4 CGAAAGAGAAGTAGACCAG
BnC9.PPO2 -guide RNA5 CTCCTGAAACGACAACAAA
BnC9.PPO2 -guide RNA6 CTTAAGTTATGTTTCTAAC
Wherein, guide RNA1, guide RNA2 and guide RNA3 were close to the initiation
codon
202
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
ATG of 30SR protein between the promoter and CDS region of 30SR gene
(i.e.5'UTR
region); guide RNA4, guide RNA5 and guide RNA6 were close to the BnC9.PPO2
protein
initiation codon ATG between BnC9.PPO2 gene promoter and CDS region (i.e.5'UTR
region).
With reference to Example 1, the edit vectors of different target
combinations, namely
pQY2533, pQY2534, pQY2535 and pQY2536 were constructed with pHSE401 vector as
the
framework; where:
pQY2533 contains the combination of guide RNA1 and guide RNA4
pQY2534 contains the combination of guide RNA2 and guide RNA5
pQY2535 contains the combination of guide RNA3 and guide RNA6
pQY2536 contains the combination of guide RNA1 and guide RNA5
Vector plasmids were extracted, and agrobacterium strain GV3101 was
electrotransformed. Agrobacterium tumefaciens-mediated transformation was
performed
with rape variety Westar as receptor using the method below:
Sowing: Seeds were soaked in 75% alcohol for 1 min, disinfected with 10%
sodium
hypochlorite solution for 9 min, washed 5 times with sterile water, sown into
MO medium,
and cultured in darkness at 24 C for 5-6 days.
Preparation of agrobacterium: 3 mL of liquid LB medium was transferred into
the
sterile tube; the solution with agrobacterium was subjected to shake culture
in a 200-rpm
shaker at 28 C for 20-24h. The solution with bacteria was incubated for 6-7h
in the LB
culture medium. The cultured bacteria solution was poured into a 50 mL sterile
centrifuge
tube; the tube was centrifuged for 5 min at 6000 rpm; the supernatant was
discarded, and a
moderate amount of DM suspension was added; the solution was shaken well and
the
0D600 value of infecting bacteria solution was set to approx. 0.6-0.8.
Infection and co-cultivation of explants: The prepared infecting bacteria
solution
was activated on ice, while the hypocotyls of seedlings cultured in darkness
were cut off
vertically with sterile forceps and scalpel; the cut-off explant was infected
for 12 minutes in
a dish, which was shaken every 6 min during infection; the explants were
transferred to
sterile filter paper after infection, and the excess infection solution was
sucked out; then, the
explants were placed in M1 culture medium and co-cultured at 24 C for 48h.
i0 Callus induction: After the co-culture, the explants were transferred to M2
culture
medium, where callus was induced for 18-20 days; the culture conditions: Light
culture at
22-24 C; light for 16 hrs / dark for 8 hrs. The conditions for differentiation
culture and
rooting culture were the same as the present stage.
Induced germination: The callus was transferred to M3 culture medium for
differentiation culture, and succession was performed every 14 days until
germination.
Rooting culture and transplantation: After the buds were differentiated to see
obvious growth points, the buds were carefully cut off from the callus with
sterile forceps
and scalpel; the excess callus was removed as much as possible, and then the
buds were
transferred to M4 medium for rootage. Rooted plants were transplanted into the
culture soil;
Ti-generation seeds were achieved through bagged selfing of the TO-generation
regenerated
plants.
203
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
The formula of culture medium used during the process was as follows:
Sowing culture medium MO
Culture Chemical name Dosage
Method of preparation
medium
MS 2.22g Dissolved
in 1000 mL
MO Agar 8g of double distilled
water; pH adjusted to
5.8-5.9; autoclaved
DM transform buffer solution
Culture Chemical name Dosage Method
of preparation
medium
MS 4.43g _______________________
Dissolved in 1000 mL
Sucrose 30g of double
distilled
DM 2,4-D lmL water;
pH adjusted to
Kinetin (KT) lmL 5.8-5.9;
AS added
Acetosyringone (AS) lmL after autoclaving
Co-culture medium M1
Culture Chemical name Dosage
Method of preparation
medium
MS 4.43g
Sucrose 30g Dissolved
in 1000 mL
Manitol 18g of double
distilled
M1 2,4-D lmL water; pH
adjusted to
Kinetin (KT) lmL 5.8-5.9;
AS added
Phytagel 4-5g after autoclaving
Acetosyringone (AS) lmL
Screening medium M2
Culture Chemical name Dosage
Method of preparation
medium
MS 4.43g
Sucrose 30g
___________________________________________________________________ Dissolved
in 1000 mL
Manitol 18g
2 4-D lmL _______________________ of
double distilled
,
___________________________________________________________________ water; pH
adjusted to
Kinetin (KT) lmL
M2 5.8-5.9; silver nitrate,
Phytagel 4-5g
timentin and
AgNO3 (silver nitrate) 0.2mL
___________________________________________________________________
hygromycin added
Timentin lmL
after autoclaving
Hygromycin (Hyg) 0.2mL
Acetosyringone (AS) lmL
Differential medium M3
204
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
Culture Chemical name Dosage Method of
preparation
medium
MS 4.43g
Glucose lOg
___________________________________________________________________ Dissolved
in 1000 mL of
Xylose 0.25g
___________________________________________________________________ double
distilled water; pH
MES 0.6g
__________________________________________________________________ adjusted
to 5.8-5.9; ZT,
M3 Phytagel 4-5g
IAA, timentin and
Zeatin (ZT) lmL
___________________________________________________________________
hygromycin added after
Indoleacetic acid (IAA) 0.2mL
autoclaving
Timentin lmL
Hygromycin (Hyg) 0.2mL
Rooting medium M4
Culture Chemical name Dosage Method of
preparation
medium
MS 2.2g
Sucrose lOg Dissolved in 1000 mL of
lmL ______________________ double distilled water; pH
M4 Indolebutyric acid (IBA) ________________________________ adjusted
to 5.8-5.9; timentin
Agar lOg added
after autoclaving
Timentin 0.5mL
After the emergence of seedlings, leaves were taken from TO seedlings for
molecular
identification. The detection primers in the table below were used to amplify
the fragments
containing target sites on both sides or the fragments produced from the
fusion of predicted
30SR promoter and BnC9.PPO2 coding region; where klenow fragment was removed,
the
PCR product length should be approx. 700 bp.
Primer ID Sequence (5' to 3')
30SR PRO-F: TGACTTTGCATCTCGCCACT
PPO2 PRO-R3:
GCAGATGATGATGATGATAAGCTC
363 TO seedlings from the transformation of the four vectors were tested;
Klenow
fragment deletion event was observed in 18 plants; the probability of Klenow
fragment
deletion varied depending on target combination; even the same target
combination may
bring about different probabilities of Klenow fragment deletion; pQY2534
vector offered
the highest probability (10.96%), while pQY2535vector offered the lowest
probability (2%);
the average probability was on the order of 5.56%.
Analysis of the sequencing result of 18 individual plants with positive
knocked out: The
sequencing results of 10 individual plants showed seamless Klenow fragment
deletion
between two targets; homozygous seamless knockout occurred in QY2533/w-7, and
heterozygous knockout occurred in the other 9 plants; compared with the
expected sequence
after deletion, the insertion or deletion of small fragments of base was
observed in 8
individual plants; up to 32 bases were deleted in the 30SR promoter region,
and this was not
205
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
expected to affect the promoter activity; homozygous knockout was observed in
QY2533/w-36, QY2533/w-42, QY2535/w-32 and QY2536/w-124; the details of result
were
as follows:
Plant No. PCR test result Sequencing result analysis
Deletion; seamless;
QY2533/w-7 With strip/band
homozygous
QY2533/w-36 With strip/band Deletion; -2bp; homozygous
QY2533/w-39 With strip/band Deletion; -13bp; heterozygous
With strip/band Deletion; +1bp; T;
QY2533/w-42
homozygous
With strip/band Deletion; seamless;
QY2534/w-32
miscellaneous peaks
With strip/band Deletion; seamless;
QY2534/w-36
miscellaneous peaks
With strip/band Deletion; seamless;
QY2534/w-40
miscellaneous peaks
With strip/band Deletion; -32bp; miscellaneous
QY2534/w-44
peaks
With strip/band Deletion; seamless;
QY2534/w-53
miscellaneous peaks
With strip/band Deletion; seamless;
QY2534/w-55
miscellaneous peaks
With strip/band Deletion; seamless;
QY2534/w-56
miscellaneous peaks
With strip/band Deletion; seamless;
QY2534/w-59
miscellaneous peaks
QY2535/w-32 With strip/band Deletion; +10bp; homozygous
QY2535/w-46 With strip/band Deletion; -lbp; heterozygous
With strip/band Deletion; seamless;
QY2536/w-73
miscellaneous peaks
With strip/band Deletion; seamless;
QY2536/w-77
miscellaneous peaks
QY2536/w-78 With strip/band Deletion; +lbp; heterozygous
QY2536/w-124 With strip/band Deletion; +A; homozygous
The sequencing result showed that the 30SR promoter can be directly connected
with
the BnC9.PPO2 CDS region to create novel PPO2 gene with strong promoter-driven
expression after the deletion of inter-target sequence.The sequencing results
of the 30SR
promoter fused BnC9.PPO2 CDS region were shown in Seq No.57, Seq No.58, Seq
No.59,
Seq No.60, and Seq No.61.
TO seedling test result indicated that the method presented in the present
invention
enabled the creation of novel genes expressed by the BnC9.PPO2 CDS region
driven by the
30SR promoter; so, it's obvious that the way presented in the present
invention to create new
206
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
genes was also applicable to rape. The results of test on rice, corn, wheat,
arabidopsis
thaliana, and rape demonstrate that the method provided by the present
invention was
designed for purposeful precise creation of novel genes with combinations of
different gene
elements or different protein domains in both monocotyledons and dicotyledons.
Example 23: Creation of Rice Blast Resistance through knock-up Expression of
an
Endogenous Gene OsWAK1
OsWAK1 is a novel functional protein kinase. It was reported that
overexpression of
the OsWAK1 gene can confer resistance to rice blast(Li et al. A novel wall-
associated
receptor-like protein kinase gene, OsWAK1, plays important roles in rice blast
disease
resistance. Plant Mol Biol, 2009, 69: 337-346). The OsWAK1 gene locates on
rice
chromosome 1. Through bioinformatics analysis, it was found that LOC
OsOlg044350
(hereinafter referred to as 44350) gene, which is highlyexpressed in rice,
locates about 26
kb upstream of OsWAK1 gene, and the 44350 gene and the OsWAK1 gene are in the
opposite direction on the chromosome. The 44350 gene promoter can be used for
inversion
to increase the expression of OsWAK1 gene. Similarly, BBTI12 (MSU ID:
LOC OsOlg04050), which is highlyexpressed in rice, locates about 206 kb
upstream of
OsWAK1 gene, and the BBTI12 gene and the OsWAK1 gene are in the same direction
on
the chromosome. The BBTI12 gene promoter can be used for duplication to
increase the
expression of OsWAK1 gene.
Similarly, the dual-target combination 0sWAK1ts2:5'TTCAGCTAGCTGCTACACAA
3' and 44350ts2: 5' TAGAAGCTTTGATGCTTGGA 3', was used to construct the
duplication editing vector pQY1085. The construction primers used were bsaI-
OsWAK1
5'UTR ts2-F:
S'AATGGTCTCAggcATTCagctagctgctacacaaGTTTAAGAGCTATGCTGGAAACAG
CAT3' and bsaI-44350 5'UTR ts2-R:
S'AATGGTCTCAAAACTCCAAGCATCAAAGCTTCTAgcttcttggtgccgcgc 3'.
Similarly, the dual-target combination OsWAK1ts2: 5'
TTCAGCTAGCTGCTACACAA 3' and BBTI12ts2: 5' CAAGTAGAGGAAATAGCTCA 3'
was used to construct the duplication editing vector pQY1089. The construction
primers
used were bsaI-0sWAK1 5'UTR ts2-F:
5'AATGGTCTCAGGCATTCAGCTAGCTGCTACACAAGTTTAAGAGCTATGCTG
GAAACAGCAT3' and bsaI-BBTI12 5'UTR ts2-R:
5'AATGGTCTCAAAACTGAGCTATTTCCTCTACTTGGCTTCTTGGTGCCGCGC
3' .
The above two plasmids were extracted to transform Agrobacterium sp. EHA105.,
The
recipient rice variety Jinjing 818 was transformed through Agrobacterium-
mediated
transformation and the transformation method was referenced to Example2.
During the
transformation process, genotype identification at the junction regions was
performed on the
207
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
rice calli, and the inversion or duplication event-positive calli were
selected to enter the
differentiation stage for regeneration of seedlings.
For pQY1085 transformed rice calli, the primer44350tsdet-F+primer0sWAKltsdet-F
combination was used to detect the fusion fragment at the middle joint after
the inversion of
the chromosome fragment, and the PCR product length was expected to be 713 bp.
Primer ID Sequences(5' to 3')
44350tsdet-F CGATCGATTCATCGAGAGGGCT
44350tsdet-R ATCACCAGCACGTTCCCCTC
0 sWAK1 T SDET-F TTTTGTGTGCCGCGACGAATGAG
0 sWAK1T SDET-R
CATAACGCTGTCGACAATTGACCTG
For pQY1089 transformed rice calli, the primer0sWAKltsdet-F+
primerBBTI12tsdet-R combination was used to detect the fusion fragment at the
middle
joint after the duplication of the chromosome fragment, and the PCR product
length was
expected to be 837 bp.
Primer ID Sequences(5' to 3')
BBTI12tsdet-F TTTTCTTTTGCAACAGCAGCAAAGATT
BBTI12tsdet-R AGGGTACATCCTAGACGAGTCCAAG
A
OsWAKltsdet-F TTTTGTGTGCCGCGACGAATGAG
OsWAKltsdet-R CATAACGCTGTCGACAATTGACCTG
The above two vectors were referred to in Example 2 for Agrobacterium-mediated
transformation of rice callus. After the callus was identified, the inversion
or duplication
event-positive calli were differentiated, and eventually positive edited
seedlings were
obtained. The results of molecular identification are shown in the Figure47.
As shown, the
pQY1085-transformed seedlings were detected to identifythe inversion editing
events in
which the 0s01g044350 promoter drives the OsWAK1 gene expression and thus a
new
OsWAK1 gene was formed. The representative sequences of the sequenced
inversion events,
QY1085/818-57, QY1085/818-107, QY1085/818-167, QY1085/818-23are shown in SEQ
ID
NO: 62, SEQ ID NO: 64, SEQ ID NO: 65andSEQ ID NO: 66.
As shown in the Figure 48, the pQY1089-transformed seedlings were detected to
identify theduplication editing events in which the BBTI12 promoter drives the
OsWAK1
gene expression and another new OsWAK1 gene was also formed. The
representative
sequences of the sequenced duplication events, QY1089/818-595, QY1089/818-321,
QY1089/818-312 are shown in SEQ ID NO: 63, SEQ ID NO: 67and SEQ ID NO: 68.
Example 24: Creation of blast-resistant rice through knock-up expression of
endogenous OsCNGC9 gene in rice
The cyclic nucleotide-gated channels (CNGCs) gene family encodes a set of
non-specific, Ca2+ permeable cation channels. It was reported that
overexpression of the
OsCNGC9 gene can confer resistance to rice blast(Wang et al. A cyclic
nucleotide-gated
208
CA 03218515 2023-10-30
WO 2022/233271
PCT/CN2022/090268
channel mediates cytoplasmic calcium elevation and disease resistance in
rice.Cell Research,
2019, epub). The OsCNGC9 gene locates on rice chromosome 9. Through
bioinformatics
analysis, it was found that LOC 0s09g39180 (hereinafter referred to as 39180)
gene, which
is highly expressed in rice, locates about 314 kb downstream of OsCNGC9 gene,
and the
39180 gene and the OsCNGC9 gene were in the opposite direction on the same
chromosome.
The 39180 gene promoter can be used for inversion to increase the expression
of OsCNGC9
gene. In addition, LOC 0s09g39390 (hereinafter referred to as 39390), which is
highly
expressed in rice, locates about 456 kb downstream of OsCNGC9 gene, and the
39390 gene
and the OsCNGC9 gene were in the same direction on the same chromosome. The
39390
gene promoter can be used for duplication to increase the expression of
OsCNGC9 gene.
The dual-target combination OsCNGC9ts1: 5' ACAGCAAGATTTGGTCCGGG 3' and
39180ts1: 5' ATGGAATGGAAGAGAATCGA 3' was used to construct the inversion
editing vector pQY1090. The construction primers used were bsaI-OsCNGC9 5'UTR
tsl-F:
5' AATGGTCTCAGGCAACAGCA
AGATTTGGTCCGGGGTTTAAGAGCTATGCTGGAAACAGCAT3' and bsaI-39180
5'UTR tsl-R: 5' AATGGTCTCAAAACTCGATTCTCTTCCATTCCATGCTTCTTG
GTGCCGCGC 3'.
The dual-target combination OsCNGC9ts1: 5' ACAGCAAGATTTGGTCCGGG 3' and
39390ts1: 5' CTACTGGCCTCGATTCGTCG 3' was used to construct the duplication
editing vector pQY1094. The construction primers used were bsaI-OsCNGC9 5'UTR
tsl-F:
5' AATGGTCTCAGGCAACAGCA
AGATTTGGTCCGGGGTTTAAGAGCTATGCTGGAAACAGCAT3' and bsaI-39390
5'UTR tsl-R: 5' AATGGTCTCAAAACCGACGAATCGAGGCCAGTAGGCTTCT
TGGTGCCGCGC 3'.
The above two plasmids were extracted to transform Agrobacterium sp. EHA105.,
The
recipient rice variety Jinjing 818 was transformed through Agrobacterium-
mediated
transformation and the transformation method was referenced to Example2.
During the
transformation process, molecular identification was performed on the rice
calli, and the
inversion or duplication event-positive calli were selected to enter the
differentiation stage
and regeneration of seedlings.
For pQY1090 transformed calli, the primer39180tsdet-R+ primerOsCNGC9tsdet-R
combination was used to detect the fusion fragment at the middle joint after
the inversion of
the chromosome fragment, and the PCR product length was expected to be 778 bp.
Primer ID Sequences(5' to 3')
OsCNGC9tsdet-F
ACATCTCATGTGCAAGATCCTAGCA
¨
OsCNGC9tsdet-R
AAACTGGTCCTGTCTCTCATCAGGA
39180tsdet-F TGGCTCAGCGAAGTCGAGC
39180tsdet-R CATGGTTGAACTGTCATGCTAATCAGT
209
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
For pQY1094 transformed calli, the primer3390tsdet-F3+ primerOsCNGC9tsdet-R
combination was used to detect the fusion fragment at the middle joint after
the duplication
of the chromosome fragment, and the PCR product length was expected to be 895
bp.
Primer ID Sequences(5 to 3')
OsCNGC9tsdet-F ACATCTCATGTGCAAGATCCTAGCA
OsCNGC9tsdet-R AAACTGGTCCTGTCTCTCATCAGGA
39390tsdet-F3 TACTACAGCCTTTGCCTTTCACGGTTC
39390tsdet-R GTCTGCCACATGCCGTTGAG
The above two vectors were referred to in Example 2 for Agrobacterium-mediated
transformation of rice callus. After the callus was identified, the inversion
or duplication
event-positive calli were differentiated, and finally positive edited
seedlings were obtained.
Sequencing results prove thatthe pQY1090 transformed seedlings were detected
to identify
the inversion edited events in which the LOC 0s09839180 promoter drives the
OsCNGC9
gene expression and thus a new OsCNGC9 gene was formed. The representative
sequences
of the sequenced inversion events QY1090/818-192, QY1090/818-554 and
QY1090/818-541, are shown in SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71.
Sequencing results prove that the pQY1094 transformed seedlings were detected
to
identify duplication edited events in which the LOC 0s09g39390 promoter drives
the
OsCNGC9 gene expression and thus another new OsCNGC9 gene was also formed. The
representative sequence of the sequenced duplicated event QY1094/818-202 are
shown in
SEQ ID NO: 72.
Example 25: Pig IGF2 gene expression knock-up
IGF-2 (Insulin-like growth factor 2) is one of three protein hormones that
have similar
structure with insulin. IGF2 is secreted by the liver and circulates in the
blood. It has the
activity of promoting mitosis and regulating growth.
TNNI2 and TNNT3 encode muscle troponin I and troponin T, respectively, and
they
are the core components of muscle fibers. These two protein coding genes are
constitutively
and highly expressed in muscle tissue. Therefore, using the promoters of these
two genes to
drive the expression of IGF2 gene is expected to significantly increase its
expression in
muscle cells and promote growth. Since the directions of these two genes are
opposite to
IGF2 on the same chromosome, knock-up of IGF2 could be achieved by promoters
exchange through chromosome segmentsinversion.
The experiment procedure was as follows:
1. CRISPR/Cas9 target site selection and vector construction:
Using the CRISPR target online design tool (http://crispr.mit.edu/), we
selected 20 bp
sgRNA oligonucleotide sequences in the 5'UTR regions of pig IGF2, TNNI2, and
TNNT3
genes, respectively.The sgRNA oligos were synthesized by BGI, Qingdao.
IGF2-sgRNA: 5'ccgggtggaaccttcagcaa3'
210
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
TNNI2-sgRNA: 5'agtgctgctgcccagacggg3'
TNNT3-sgRNA: 5'acagtgggcacatccctgac3'
Diluting the synthesized sgRNA oligo with deionized water to 100 limol/L in a
reaction
system (10 p.L): positive strand oligo lIAL, reverse strand oligo 1 p1,
deionized water 8
1AL.The annealing program of thermal cycler was set as follows: incubate at 37
C for 30
min; incubate at 95 C for 5 min, and then gradually reduce the temperature to
25 C at a
rate of 5 C/min.After annealing, the oligo was diluted by 250 volume using
deionized
water.pX459 plasmid was linearized with BbsIrestriction endonuclease, the
annealed
product was ligated, and transformed into competent DH5a, a single colony was
picked into
a shaker tube, incubated at 37 C for 12-16 h, 1 mL aliquot of bacterial
solution was sent for
sequencing. After sequencing verification, the bacterial solution was freezed
and extracted
for preparing the plasmid pX459-IGF2, pX459-TNNI2 and pX459- TNNT3. These
plasmids
were used for transfection in the following experiment.
2. Cell transfection:
Thawing and culturing the pig primary fibroblast cell, removal of the culture
medium
and added preheated PBS for washingbefore transfection, then removed PBS and
added 2m1
of 37 C prewarmed trypsin solution.Digesting for 3 minutes in room temperature
before
terminating digestion. Suspending the cells in nucleofection solution, and
diluting the
volume to 106/100W, adding plasmid to 51Ag/100111 final concentration,
performing
electro-transformation with optimized program on the electroporator, adding
5001A1 of
preheated culture medium, and culturing the cell in a concentration of 20% FBS
DMEM
medium, at 37 C, with 5% carbon dioxide, and saturated humidity.
3. cell screening and test:
When the cells reached 100% cell density, cells were lysed with NP40 buffer.
Genomic
DNA was extracted, and the target regions were amplified by PCR.
The result is shown in Figure 49, using the primer pair (T2-F2:
tgggggaggccatttatatc/IGF2-R2:acagctcgccactcatcc), the fusion events of the
TNNI2
promoter and the IGF2 gene was successfully detected.
As showed in the Figure 50, using the primer pair
(TNNT3-R:CCCCAAGATGCTGTGCTTAG/IGF2-F:CTTGGGCACACAAAATAGCC),
the fusion events of the IGF2 promoter and the TNNT3 gene were successfully
detected. As
affected by repeated sequences, efforts are still taken to detect the fusion
events of the
TNNT3 promoter and the IGF2 gene.
The invention fused the pig TNNI2 promoter with the IGF2protein coding region
in
vivo through the inversion editing events of the chromosome segment, which
forms a new
IGF2 gene with continuously high expression. These editing events created new
fast-growing pig cell lines. This example shows that the method of the present
invention can
211
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
be used to create new genes in mammalianorganisms.
Examp1e26: Chicken IGF1 expression Knock-up
IGF1 (insulin like growth factor 1) is closely related to the growth and
development of
chickens. MYBPC1 (myosin binding protein C) is a highly expressed gene
downstream of
IGF1. A new gene with the MYBPC1 promoter driving IGF1coding sequence was
created
through genome editing using a dual-target editing vector.
The experiment procedure was as follows:
1. CRISPR/Cas9 target site selection and targeted cutting vector construction:
Using the CRISPR target online design tool (http://crispr.mit.edu/), 20 bp
sgRNA
oligonucleotide sequences were designed in the 5'UTR regions of chicken IGF1
gene and
MYBPC1 gene respectively. sgRNA oligoes were synthesized by BGI. Diluting the
synthesized sgRNA oligoes with deionized water to 100 pmol/L in a reaction
system (10
[LL): positive strand oligo 1 vL, reverse strand oligo 1 iL, deionized water 8
A; the
annealing program of thermal cycler was set as follows : incubate at 37 C for
30 min;
Incubate at 95 C for 5 min, and then gradually reduce the temperature to 25
C at a rate of 5
C/min; after annealing, the oligo was diluted by 250 volumes of deionized
water. pX459
plasmid was linearized with BbsI restriction endonuclease, the annealed
product was ligated,
and transformed into competent DH5a, a single colony was picked into a shaker
tube,
incubated at 37 C for 12-16 h, aliquot 1 mL of bacterial solution was sent
for sequencing .
After sequencing verification, the bacterial solution was freezed and
extracted for preparing
the plasmid pX459-IGF1 and pX459-MYBPC1, Those dual-target editing plasmids
were
used for transfection of chicken DF-1 cells.
2. Cell culture and Passage of DF-1 cells:
DF-1 (Douglas Foster-1) cell is chicken embryo fibroblast cell with vigorously
proliferation ability, so DF-1 is the most popular cell line for in vitro
study. DF-1 cells were
thawed in a 37 C water bath, and then inoculated in a petri dish and placed in
a 37 C, 5%
CO2 constant temperature incubator for cell culture. The culture medium is 90%
DMEM/F12+10% FBS. When the cell density reached more than 90%, passaging cell
at a
ratio of 1:2 or 1:3.
3. DF-1 cell transfection:
O Preparing two 1.5m1 EP tubes and marked them as A tube and B tube
respectively.
O Placing 250 1 of Opti-MEM medium, 2.5ps plasmid and 5111 of P3000TM
reagent in
tube A.
O Placing 250 1 of Opti-MEM medium and 3.750 of Lipofectaminee 3000 reagent
in tube B.
O Transferring the liquid from tube A to tube B with a pipette, and quickly
mixing the
liquid of tube A and tube B and vortexing for 10 seconds.
212
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
OVortexing AB tube mixture (liposome-DNA complex) and incubating at room
temperature for 15 minutes.
O Finally, slowly adding liposome-DNA complex to the DF-1 cell dish after
the
culture medium had been removed with pipette.
4. DF-1 cell screening and test:
CCulturing DF-1/PGCs cells, and the transfection efficiency is best when the
confluence reaches 60-70%;
CD After 2 days of transfection, add 1ps/ml puromycin for screening;
CD After 4 days of transfection, replace with the fresh cell culture medium to
remove
tpuromycin, and continue to culture until the 7th day after transfection to
increase the
number of cells.
O Collecting the cells and extracting cell DNA with Tiangen's Genomic DNA
Kit
according to the operating instructions.
O Designing primers to amplify new gene fragments that are expected to be
doubled
or inverted.
The invention fused the chicken MYBPC1 promoter with the IGF1CDS region in
vivo
through the double editing events of the chromosome segment, which forms a new
IGF1
gene with continuously high expression. These editing events created new fast-
growing
avian cell lines. This example shows that the method of the present invention
can be used to
create new genes in avian organisms.
Example 27: Induced gene expression through chromosomal segment inversion in
yeast
FPP is a key precursor of many compounds in yeast. However, it can be degraded
by
many metabolic pathways in yeast, which affects the final yield of exogenous
products such
as terpenoids. The synthesis of squalene using FPP as substrate, is the first
step of the
ergosterol metabolic pathway, which is catalyzed by the squalene synthase
encoded by the
ERG9 gene. However, direct knockout of ERG9 gene would lead to the inability
of yeast
cells to grow, so the expression level of squalene synthase could only be
regulated
specifically, so that it could accumulate intracellular FPP concentration as
well
asmaintaining its own growth. HXTpromoter is a weakly glucose-responsive
promoter,
whose expression strength decreases with the decrease of glucose concentration
in the
external environment, which is consistent with the sugar metabolism process in
the
fermentation process, so it is an ideal induciblepromoter.
As found in the saccharornyces cerevisiae genome database web site
(https://www.yeastgenome.org/), both the HXT1 and ERG9 genes are located at
the long
arm end of chromosome VIII and are transcribed in the opposite direction, so
the
endogenous ERG9 gene promoter in yeast can be replaced by the HXT1 promoter,
whose
213
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
expression strength is responsive to glucose concentration, through the
inversionediting
events of the chromosome segmentit is expected that the specific induction of
ERG9 gene
expression will achieve the purpose of accumulation of FPP in yeast.
1. Vector design and construction
Vector design includes Cas9 vector and gRNA vector, which are constructed into
two
different backbones. For the Cas9 vector, we used pUC19 backbone, driven by
yeast TEF1
promoter, Cas9 sequence is yeast codon-optimized; gRNA vector used
pUC57backbone,
SNR52 promoter and SUP4 terminator. The sgRNA is designed using an online tool
(http://crispor.tefor.net/) and selected the following targets between the
promoter and
coding regions of the HXT1 and ERG9 genes for testing: ERG9 sgRNA:
GAAAAGAGAGAGGAAG; HXT1 sgRNA: CCCATAATCAATTCCATCTG. Once vectors
are completed, they will be mixed together for transformation.
2. Transformation of yeastby electroporation
1) Pickedup better-grown mono-clones from a fresh plate and inoculated it with
5 mL
YPD medium, grew with vigorously shaking 220rpm at 30 Cfor overnight. 2)
Transferred to
50 mL YPD medium so that the initial OD660wouldbe about0.2, incubated with
vigorously
shaking 220rpm at 30 C to make OD660about 1.2. 3) After placing the yeast on
ice for 30
min, centrifuged at 5000g for 5min at 4 C to collect the cells. 4) Discarded
the supernatant,
washedthe cells with pre-cooled sterile water twice, and then centrifuged. 5)
Discarded the
supernatant, washed the cells three times with pre-cooled 1 mol/L sorbitol
solution.6)
Centrifuged to collect the cells, washed the cells three times with pre-cooled
200 pH_ mol/L
sorbitol solution. 7) Added 20pL (about 5pg) plasmids or DNA fragments to the
cell
suspension, gently mixedand incubated at ice for 10 min. 8) Transferred the
mix into a
pre-cooled cup,shocked 5ms with 1500V. 9) Re-suspended the cells in the cup
with 1 mL
YPD medium and incubated at 30 Cwithvortexfor 1-2 hours. 10) Washed the
recoveredcells
with sterile water, and finally re-suspended with lmL sterile water, took
100pLon the
corresponding plate. 11) Incubated at 30 C thermostatic incubator for 3-5 days
to select the
transformers.
3. Extraction of yeast genome DNA
1) Took 5 ml overnight cultured medium, centrifuged to collect cells, after
washedwith
lmL PBS twice, centrifugedto collect cells at maximum speed for lmin; 2) Added
500pL
sorbitol buffer to re-suspend the cells and then added 50U Lyticase, incubated
at 37 C for
4h; 3) Centrifuged at 12000rpm for lmin to collect cells; 4) Added 5004 yeast
genomic
DNA extraction buffer and re-suspended, added 50pL 10%SDS, and placed
immediately at
65 C water bath for 30min; 5) Added 2004 5M KAc (pH8.9), and incubated at ice
for lh; 6)
Centrifuged at 12000rpm for 5minat 4 C, and transferred supernatant to a new
EP tube; 7)
Added isopropyl alcohol of equal volume, centrifuged at 12000rpm for 10s; 8)
discarded the
214
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
supernatant and added 500[LL 75% ethanol to wash DNA, centrifuged at 12000rpm
for lmin;
9) After precipitation, added 501AL TE buffer to dissolve; 10) Took 31..LL DNA
for
electrophoresis test, the remaining was reserved in -20 C refrigerator.
4. Detection of inverted events
PCR detection of transformed yeast cells using the following primers: HXT1pro-
detF:
TGCTGCGACATGATGATGGCTTT and
ERG9cds-detR:TCGTGGAGAGTGACGACAAGT, respectively. The length of PCR
product was expected to be 616bp.
The invention replaces the yeast ERG9 gene promoter with the HXT1 promoter in
vivo
through the inversion editing event of the chromosome fragment between the
target sites,
which forms a new ERG9 gene regulated by glucose concentration. This example
shows that
the method of the present invention can be used to create new genes in fungal
organisms.
Example 28: Knock-up expression of EPO gene in 293T cell line
EPO (erythropoietin), is an important cytokine in human, PSMC2 (proteasome 26S
subunit ATPase 2) is a regulated subunit of 26S protease complex, ubiquitously
expressed
in cells. By designing a dual-target editing vector to identify and screen new
EPO gene
which would driven by PSMC2 promoter in 293T cell lines.
1. Target design and editing vector construction of CRISPR/Cas9
Using target design online tools of CRISPR (http://crispr.mit.edu/), sequence
of 20 bp
sgRNA oligos was designed in the 5'UTR region of the human EPO gene and PSMC2
gene,
respectively. Oligos were synthesized by BGI Company(Qingdao, China. Diluted
the synthetic
sgRNA oligo to 100 [tmol/L with deionized water. Reaction system (10 !IL):
forword oligo 1[11,
reverse oligo 1jtl, deionized water 8pL; annealing program used for PCR:
incubated 30 min at
37 C, incubated 5 min at 95 C, then gradually cool down to 25 C at 5 C/min;
diluted the oligo
250 times after annealing. The pX459 plasmid wasfirstly linearized with BbsI
restriction enzyme,
and then the annealing product wasadded, ligated product was transformed into
DH5a competent
cells. Single clones wereselected into the centrifugal tube, incubated with
shaking at 37 C 12 to
16 hours, and then dividedinto 1 mL for sequencing. After sequence
confirmation, plasmidswere
extracted. Preparation of the plasmid pX459-EPO and pX459-PSMC2 for
transfection.
2. Resuscitation of 293T cell: removed the frozen tube from liquid nitrogen or
-80 C
refrigerator container, immersed directly into warm water bath at 37 C, and
shook it at interval to
melt it as soon as possible; removed the frozen tube from the water bath at 37
C, opened the lid
in the ultra-clean table, and sucked out the cell suspension with the tips (3
ml of cell complete
media has been pre-added in the centrifugal tube), flicked and mixed;
centrifugedat 1000 rpm for
min; discarded the supernatant, re-suspendedcells gently, added10% FBS cell
media,
re-suspended cells gently, adjusted cell density, inoculated atpetri dishes,
and incubated at 37 C.
Replaced the cell media once the next day.
3. Transferrd steps: removed cell petri dish (60mm) from the carbon dioxide
incubator,
sucked out the medium in the bottle at the ultra-clean workbench, added2m1 1
>< PBS solution,
215
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
gently rotated the petri dish to clean the cells, discardedthe lx PBS
solution; added trypsin 0.5 ml
and incubated for 3-5 minutes; during the incubation, observed the digested
cells under an
inverted microscope, and if the cells become round and no longer connected to
each other,
immediately added 2vo1ume complete medium (containing serum) in the ultra-
clean workbench,
added 1 mL of complete medium, blew and kept the cell suspended; the cell
suspension was
sucked out and placed in a 15 ml centrifugal tube, centrifuged at 1000 rpm for
5 min; discarded
the digestive fluid and tapped the bottom of the centrifugal tube to make the
cells re-suspended;
added 2.5 ml complete medium into two new 60mm petri dishes, the original
digestive dish also
added 2.5 ml of complete medium, and marked it; dropped the cell suspension in
the centrifugal
tube into three petri dishes at 0.5 ml/dish, blew cells with tips several
times, and incubated in a
carbon dioxide incubator.
4. Trypsin digested the cells and counted in a 100mm petri dish, making them
60%-70%
denser on the day of transfection. Added plasmid DNA with a maximum capacity
of 24.01..ig into
cell petri dish with a bottom area of 100 mm, diluted with 1.5 mL serum-free
medium, mixed and
incubated at 5 min at room temperature.
5. Cell transfection: (1) Diluted 80111 LIPOFECTAMINE 2000 reagent with a
1.5m1
serum-free medium, and mixed diluted DNA within 5 minutes. (2) Mixed diluted
plasmid DNA
with diluted LIPOFECTAMINE 2000, incubatedat room temperature for 20 minutes.
(3) The
above mixture was then added evenly to the cells. (4) Kept warm for 6 hours at
37 C, 5%
CO2,100% saturated humidity, and added 12 ml of fresh DMEM culture with 10%
FBS to each
petri dish. After 24 hours, replaced the old medium with a fresh DMEM medium
containing 10%
FBS and keep incubating.
6. After 48 hours of transfection, centrifuged to collect cells. DNA from 293T
cells was
extracted using Tiangen's TIAN amp Genomic DNA Kit The primers were also
designed
for PCR amplification of the target region.
Example 29: Creation of new genes with different expression patterns by
translocation of gene promoter or coding region fragment
A dual-target combination was designed for cutting off the promoter region of
0sUbi2
gene at chromosome 2, wherein target 1 was just before the 0sUbi2 initiation
codon and
target 2 was at the upstream of the 0sUbi2 promoter. Third target (Target 3)
was designed
to cut between the promoter and the initiation codon of 0sPP02 gene at
chromosome 4.The
sgRNA sequences designed for the three targets were as following:
Target 1:0sUbi2pro-7NGGsgRNA: 5' gaaataatcaccaaacagat3 '
Target 2:0sUbi2pro-1960NGGsgRNA:5'atggatatggtactatacta3'
Target 3:0sPP02cds-6NGGsgRNA:5'ttggggctcttggatagcta3',
As shown in Figure 54, new gene cassette, which is 0sUbi2 promoter driving
0sPP02
gene, is created as a result of designed translocation.The translocation of
0sUbi2 promoter
216
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
resulted in the combination of the OsUbi2 promoter and the OsPPO2 coding
region, which
is a new gene or new gene expression cassette, ie. OsUbi2 promoterdrives
OsPPO2
expression. The calli or plantlets derived from the calli harboring such
expected new gene
may be obtained through PCR screening and genotyping.
The designed sgRNA sequences were ordered from GenScript Biotechnology Company
(Nanjing, China). These sgRNAs were respectively assembled with SpCas9 forming
RNP
complexes, and three RNP complexes were mixed together in equal ratio. The
mixture was
subjected to biolistic transformation of rice calli (see W02021088601A1 for
specific
experimental procedures).
The transformed calli were cultivated for 2 weeks and then sampled by using
the
following primer pair to test:
OsUBi2pro-1648F: 5'ggaatatgtttgctgtttgatccg3'
OsPPO2-gDNA-236R: 5' cagaactgaacccacggagag3 '
PCR detection was preformed to detect whether new genes, which are OsUbi2
promoter driving OsPPO2, were generated. The translocation positive calli
continued to be
cultivated for 2 weeks, then followed by another round of PCR detection. After
3 rounds of
detection, the positive calli were differentiated into seedlings, which were
also sampled for
PCR detection. The positive TO seedlings were sequenced to identify the
specific genotypes.
A total of four different genotypes with OsUbi2 promoter driving OsPPO2 were
obtained:
QY378-16: Ubi2pro+PP02-CDS
5'CCCCCCTTTGGAATATGTTTGCTGTTTGATCCGTTGTTGTGTCCTTAATCTTG
TGCTAGTTCTTACCCTATCTCCAAGAGCCCCAAATCAGATGCTCTCTCCTGCCACC
ACCTTCTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCACGCTCGCGCTCC
CACCCGCTTCGCGGTCGCAGCATCCGCGCGCGCCGCACGGTTCCGCCCCGCGCGC
GCCATGGCCGCCTCCGACGACCCCCGCGGCGGGAGGTCCGTCGCCGTCGTCGGCG
CCGGCGTCAGT3'
QY378-18:Ubi2pro+PP02-CDS
5'AATTGGAATATGTTTGCTGTTTGATCCGTTGTTGTGTCCTTAATCTTGTGTTG
TGTCCTTAATCCAAGAGCCCCAAATCAGATGCTCTCTCCTGCCACCACCTTCTCCT
CCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCACGCTCGCGCTCCCACCCGCTTC
GCGGTCGCAGCATCCGCGCGCGCCGCACGGTTCCGCCCCGCGCGCGCCATGGCCG
CCTCCGACGACCCCCGCGGCGGGAGGTCCGTCGCCGTCGTCGGCGCCGGCGTCAG
TGG3'
QY378-41:Ubi2pro+PP02-CDS
5'ATCTGTGCTAGTTCTTaCCCTATCTCCAGAGCCCCAAATCAGATGCTCTCTCC
TGCCACCACCTTcTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCACGCTCG
CGCTCCCACCCGCTTCGCGGTCGCAGCATCCGCGCGCGCCGCACGGTTCCGCCCC
217
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
GCGCGCGCCATGGCCGCCTCCGACGACCCCCGCGGCGGGAGGTCCGTCGCCGTCG
TCGGCGCCGGCGTCAGGTGG3'
QY378-374: Ubi2pro+PP02-CDS
5'GGTGGTCTATCTTGTGTTGTGTCCTTATCCAGAGCCCCAAATCAGATGCTCT
CTCCTGCCACCACCTTCTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCAC
GCTCGCGCTCCCACCCGCTTCGCGGTCGCAGCATCCGCGCGCGCCGCACGGTTCC
GCCCCGCGCGCGCCATGGCCGCCTCCGACGACCCCCGCGGCGGGAGGTCCGTCGC
CGTCGTCGGCGCCGGCGTCAGGTG3'
The Ti generation seedlings were harvested from TO plants, then tested using
PCR.
The results confirmed that the above genotypes could be inherited stably. The
Ti generation
of QY378-16 were selected and treated with compound A by foliar spray. As
shown in
Figure 55, it showed significantly improved resistance to PPO-inhibiting
herbicide
Compound A. The wild-type rice was killed at the rate of 2 g a.i./mu, while
the Ti
generation of QY378-16 bearing Ubi2pro+PP02-CDS genotype could survive a rate
of 4 g
a.i./mu, showing that the new PPO2 gene improved plant tolerance to Compound
A.
By referring to this technical route, different target combinations were
designed for
OsUBi2, OsPPO2 and OsPPO1 using SpCas9 protein as the editing agent:
1. 0 sUbi2pro-196ONGGsgRNA: 5' atggatatggtactatacta3'
2. 0sUbi2pro-7NGGsgRNA:5'atattgtgaagacattgac3'
3. 0sPPO2cds-6NGGsgRNA:5'ttggggctcttggatagcta3'
4. 0sPP02cds-14NGGsgRNA:5'gcaggagagagcatctgatt3'
5. 0 sPP Olcds-4NGGsgRNA: 5' ccatgtccgtcgctgacgag3'
The combination of sgRNA 1+2+3 and sgRNA 1+2+4 with Cas9 protein was subjected
to RNP transformation, new heritable genes with Ubi2pro+PP02-CDS were
identified after
PCR screen selection. Similarly, the combination of sgRNA 1+2+5 with Cas9
protein was
also subjected to RNP transformation, new heritable genes with Ubi2 promoter
driving
PP01-CDS were also obtained.
Using MAD7 protein as the editing agent:
1. 0 sUbi2pro-1896MAD7crRNA:5 ' gttggaggtcaaaataacagg3'
2. 0 sUbi2pro-14MAD7crRNA:5 ' tgaagacattgaccggcaaga3 '
3. 0 sUbi2pro-17MAD7crRNA:5 ' gtgattatttcttgcagatgc3'
4. 0sPP02cds-9MAD7crRNA:5'gggctcttggatagctatgga3'
5. 0sPP01cds-125MAD7crRNA:5'ccattccggtgggccattccg3'
The combination of crRNA 1+2+4 and crRNA 1+3+4 with MAD7 protein was subjected
to RNP transformation, new heritable genes with Ubi2pro+PP02-CDS were
identified after
PCR screen selection. Similarly, the combination of crRNA 1+2+5 and crRNA
1+3+5 added
with MAD7 protein was subjected to RNP transformation, new heritable genes
with Ubi2
218
CA 03218515 2023-10-30
WO 2022/233271 PCT/CN2022/090268
promoter driving PP01-CDS were also obtained.
In these examples, a new gene with different expression pattern was generated
by
inserting a translocated promoter upstream of the coding region of another
gene. Likewisely,
following the same technique idea, a new gene with different expression
pattern could also
be generated by inserting a translocated gene coding region into the
downstream region of
another promoter, which is covered by the technical solution scope of the
present
application.
All publications and patent applications mentioned in the description are
incorporated herein
by reference, as if each publication or patent application is individually and
specifically
incorporated herein by reference.
Although the foregoing invention has been described in more detail by way of
examples and
embodiments for clear understanding, it is obvious that certain changes and
modifications can be
implemented within the scope of the appended claims, such changes and
modifications are all
within the scope of the present invention.
219
